These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?  

PubMed Central

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Kües, Ursula; Rühl, Martin

2011-01-01

2

SKS6 , a multicopper oxidase-like gene, participates in cotyledon vascular patterning during Arabidopsis thaliana development  

Microsoft Academic Search

SKU5-Similar 6 (SKS6) is a one of a large gene family of 19 members in Arabidopsis thaliana (L.) Heynh that encode multicopper oxidase-like proteins that are related to ferroxidases, ascorbate oxidases and laccases.\\u000a Only one member of the family has been previously studied; Skewed5 (SKU5) is involved in the control of root growth. The encoded SKS6 protein, like SKU5 appears

Jolanta Jacobs; Judith L. Roe

2005-01-01

3

[Ceruloplasmin, hephaestin and zyklopen: the three multicopper oxidases important for human iron metabolism].  

PubMed

Multi-copper oxidases are a group of proteins which demonstrate enzymatic activity and are capable of oxidizing their substrates with the concomitant reduction of dioxygen to two water molecules. For some multi-copper oxidases there has been demonstrated ferroxidase activity which is related to their specific structure characterized by the presence of copper centres and iron-binding sites. Three multi-copper oxidases have been included in this group: ceruloplasmin, hephaestin and zyklopen. Multi-copper oxidases which are expressed in different tissues are capable of oxidizing a wide spectrum of substrates. Multi-copper oxidases are capable of oxidizing a wide spectrum of substrates. Ceruloplasmin exhibits antioxidant activity as well as being involved in many other biological processes. The observations of phenotypic effects of absence or low expression of multi-copper ferroxidase-coding genes suggest that the main role of these proteins is taking part in iron metabolism. The main role of ceruloplasmin in iron turnover is oxidizing Fe2+ into Fe3+, a process which is essential for iron binding to transferrin (the main iron-transporting protein), as well as to ferritin (the main iron-storage protein). The function of hephaestin as ferroxidase is essential for iron binding to apotransferrin in the lamina propria of the intestinal mucosa, a process that is important for further transport of iron to the liver by the portal vein. Available data indicate that zyklopen is responsible for the placental iron transport. The presence of three multi-copper oxidases with ferroxidase activity emphasizes the significance of oxidation for iron metabolism. The distribution of multi-copper ferroxidases in many tissues ensures the proper iron turnover in the body as well as preventing toxic effects related to the presence of Fe2+ ions. These ions contribute to generation of free radicals, including the highly reactive hydroxyl radical, through the Fenton and Haber-Weiss reactions. PMID:24988611

Wierzbicka, Diana; Gromadzka, Grazyna

2014-01-01

4

Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes  

PubMed Central

Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

McCarthy, James K.; Tebo, Bradley M.

2013-01-01

5

Multi-Copper Oxidases and Human Iron Metabolism  

PubMed Central

Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

Vashchenko, Ganna; MacGillivray, Ross T. A.

2013-01-01

6

Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study  

Microsoft Academic Search

BACKGROUND: The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism

Anthony Levasseur; Markku Saloheimo; David Navarro; Martina Andberg; Pierre Pontarotti; Kristiina Kruus; Eric Record

2010-01-01

7

A Multicopper Oxidase Is Required for Copper Resistance in Mycobacterium tuberculosis  

PubMed Central

Mycobacterium tuberculosis, the causative agent of tuberculosis, is one of the most important bacterial pathogens. Recent work has revealed that the natural bactericidal properties of copper are utilized by the host immune system to combat infections with bacteria, including M. tuberculosis. However, M. tuberculosis employs multiple mechanisms to reduce the internal copper amount by efflux and sequestration, which are required for virulence of M. tuberculosis. Here, we describe an alternative mechanism of copper resistance by M. tuberculosis. Deletion of the rv0846c gene increased the susceptibility of M. tuberculosis to copper at least 10-fold, establishing Rv0846c as a major component of copper resistance in M. tuberculosis. In vitro assays showed that Rv0846c oxidized organic substrates and Fe(II). Importantly, mutation of the predicted copper-coordinating cysteine 486 resulted in inactive Rv0846c protein which did not protect M. tuberculosis against copper stress. Hence, Rv0846c is a multicopper oxidase of M. tuberculosis and was renamed mycobacterial multicopper oxidase (MmcO). MmcO is membrane associated, probably by lipidation after export across the inner membrane by the twin-arginine translocation system. However, mutation of the lipidation site did not affect the oxidase activity or the copper protective function of MmcO. Our study revealed MmcO as an important copper resistance mechanism of M. tuberculosis, which possibly acts by oxidation of toxic Cu(I) in the periplasm. PMID:23772064

Rowland, Jennifer L.

2013-01-01

8

A Multicopper Oxidase-Related Protein Is Essential for Insect Viability, Longevity and Ovary Development  

PubMed Central

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests. PMID:25330116

Peng, Zeyu; Green, Peter G.; Arakane, Yasuyuki; Kanost, Michael R.; Gorman, Maureen J.

2014-01-01

9

CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity  

PubMed Central

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10?6±0.21 M·min?1 and 0.32±0.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

10

Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression  

Microsoft Academic Search

Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening\\u000a of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously\\u000a as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg

Mao Ye; Gang Li; Wei Qu Liang; Yu Huan Liu

2010-01-01

11

Multicopper Oxidase-3 Is a Laccase Associated with the Peritrophic Matrix of Anopheles gambiae  

PubMed Central

The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

Lang, Minglin; Kanost, Michael R.; Gorman, Maureen J.

2012-01-01

12

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger  

PubMed Central

Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

2012-01-01

13

Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub  

PubMed Central

Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L

2012-01-01

14

Determining the Role of Multicopper Oxidases in Manganese(II) Oxidation by Marine Bacillus Spores  

NASA Astrophysics Data System (ADS)

Bacteria play an important role in the environmental cycling of Mn by oxidizing soluble Mn(II) and forming insoluble Mn(III/IV) oxides. These biogenic Mn oxides are renowned for their strong sorptive and oxidative properties, which control the speciation and availability of many metals and organic compounds. A wide variety of bacteria are known to catalyze the oxidation of Mn(II); one of the most frequently isolated types are Bacillus species that oxidize Mn(II) only as metabolically dormant spores. We are using genetic and biochemical methods to study the molecular mechanisms of this process in these organisms. mnxG, a gene related to the multicopper oxidase (MCO) family of enzymes, is required for Mn(II) oxidation in the model organism, Bacillus sp. strain SG-1. Mn(II)-oxidizing activity can be detected in crude protein extracts of the exosporium and as a discrete band in SDS-PAGE gels, however previous attempts to purify or identify this Mn(II)-oxidizing enzyme have failed. A direct link between the Mn(II)-oxidizing enzyme and the MCO gene suspected to encode it has never been made. We used genetic and biochemical methods to investigate the role of the MCO in the mechanism of Mn(II) oxidation. Comparative analysis of the mnx operon from several diverse Mn(II)-oxidizing Bacillus spores revealed that mnxG is the most highly conserved gene in the operon, and that copper binding sites are highly conserved. As with Mn(II) oxidases from other organisms, heterologous expression of the Bacillus mnxG in E. coli did not yield an active Mn(II) oxidase. Purifying sufficient quantities of the native Mn(II) oxidase from Bacillus species for biochemical characterization has proven difficult because the enzyme does not appear to be abundant, and it is highly insoluble. We were able to partially purify the Mn(II) oxidase, and to analyze the active band by in-gel trypsin digestion followed by tandem mass spectrometry (MS/MS). MS/MS spectra provided a conclusive match to mnxG, suggesting that this MCO directly catalyzes the oxidation of Mn(II) and the precipitation of Mn(IV) oxide, which represents a novel reaction for a MCO. MS/MS analysis of bands identified by in-gel activity assays is a powerful method of identifying novel enzymes responsible for geochemical processes.

Dick, G. J.; Tebo, B. M.

2005-12-01

15

Iodide Oxidation by a Novel Multicopper Oxidase from the Alphaproteobacterium Strain Q-1  

PubMed Central

Alphaproteobacterium strain Q-1 is able to oxidize iodide (I?) to molecular iodine (I2) by an oxidase-like enzyme. One of the two isoforms of the iodide-oxidizing enzyme (IOE-II) produced by this strain was excised from a native polyacrylamide gel, eluted, and purified. IOE-II appeared as a single band (51 kDa) and showed significant in-gel iodide-oxidizing activity in sodium dodecyl sulfate-polyacrylamide gel electrophoresis without heat treatment. However, at least two bands with much higher molecular masses (150 and 230 kDa) were observed with heat treatment (95°C, 3 min). IOE-II was inhibited by NaN3, KCN, EDTA, and a copper chelator, o-phenanthroline. In addition to iodide, IOE-II showed significant activities toward phenolic compounds such as syringaldazine, 2,6-dimethoxy phenol, and p-phenylenediamine. IOE-II contained copper atoms as prosthetic groups and had UV/VIS absorption peaks at 320 and 590 nm. Comparison of several internal amino acid sequences obtained from trypsin-digested IOE-II with a draft genome sequence of strain Q-1 revealed that the products of two open reading frames (IoxA and IoxC), with predicted molecular masses of 62 and 71 kDa, are involved in iodide oxidation. Furthermore, subsequent tandem mass spectrometric analysis repeatedly detected peptides from IoxA and IoxC with high sequence coverage (32 to 40%). IoxA showed homology with the family of multicopper oxidases and included four copper-binding regions that are highly conserved among various multicopper oxidases. These results suggest that IOE-II is a multicopper oxidase and that it may occur as a multimeric complex in which at least two proteins (IoxA and IoxC) are associated. PMID:22447601

Suzuki, Mio; Eda, Yoshifumi; Ohsawa, Shiaki; Kanesaki, Yu; Yoshikawa, Hirofumi; Tanaka, Kan; Muramatsu, Yasuyuki; Yoshikawa, Jun; Sato, Ikuo; Fujii, Takaaki

2012-01-01

16

O2 Reduction to H2O by the Multicopper Oxidases  

PubMed Central

In nature the four electron reduction of O2 to H2O is carried out by Cytochrome c Oxidase (CcO) and the multicopper oxidases (MCOs). In the former, Cytochrome c provides electrons for pumping protons to produce a gradient for ATP synthesis, while in the MCOs the function is the oxidation of substrates, either organic or metal ions. In the MCOs the reduction of O2 is carried out at a trinuclear Cu cluster (TNC). Oxygen intermediates have been trapped which exhibit unique spectroscopic features that reflect novel geometric and electronic structures. These intermediates have both intact and cleaved O-O bonds, allowing the reductive cleavage of the O-O bond to be studied in detail both experimentally and computationally. These studies show that the topology of the TNC provides a unique geometric and electronic structure particularly suited to carry out this key reaction in Nature. PMID:18648693

Solomon, Edward I.; Augustine, Anthony J.; Yoon, Jungjoo

2010-01-01

17

Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra  

PubMed Central

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

18

Impact of Copper Limitation on Expression and Function of Multicopper Oxidases (Ferroxidases)12  

PubMed Central

Copper is an essential trace element whose recommended intake is met by most North American diets. However, incidence of new cases of secondary copper deficiency is rising due to complications of gastric bypass surgery and high zinc exposure. Patients frequently are ataxic and anemic. Anemia of copper deficiency was first described in the 19th century, but the underlying biochemistry remains unknown. Approximately one dozen cuproenzymes have been characterized in mammals. Four of these are referred to as multicopper oxidases (MCO) due to their copper binding geometries. They have iron oxidase activity (ferroxidase). These include the hepatic secreted protein ceruloplasmin representing ?90% of plasma copper, a splice-variant of ceruloplasmin originally characterized in brain linked by glycosylphosphatidylinositol (GPI) to membranes, an intestinal enriched MCO named hephaestin, and newly described MCO in placenta called zyklopen. Limitation in available copper appears to limit function of the MCO group exhibited as impaired iron flux due to the copper requirement of MCO for their ferroxidase activity. Dietary copper deficiency is associated with lower levels of ceruloplasmin, GPI-ceruloplasmin, and hephaestin. Limitation of copper does not appear to limit synthesis of MCO but rather their stability and turnover. However, there appears to be a disconnect between limitation in MCO function and anemia, because humans and mice missing ceruloplasmin are not anemic despite hepatic iron overload and hypoferremia. Furthermore, anemic copper-deficient mammals are not improved by iron replacement. This suggests that the anemia of copper deficiency is not caused by iron limitation but rather impairment in iron utilization. PMID:22332037

Prohaska, Joseph R.

2011-01-01

19

Engineering Klebsiella sp. 601 multicopper oxidase enhances the catalytic efficiency towards phenolic substrates  

PubMed Central

Background Structural comparison between bacterial CueO and fungal laccases has suggested that a charged residue Glu (E106) in CueO replaces the corresponding residue Phe in fungal laccases at the gate of the tunnel connecting type II copper to the protein surface and an extra ?-helix (L351-G378) near the type I copper site covers the substrate binding pocket and might compromise the electron transfer from substrate to type I copper. To test this hypothesis, several mutants were made in Klebsiella sp. 601 multicopper oxidase, which is highly homologous to E. coli CueO with a similarity of 90% and an identity of 78%. Results The E106F mutant gave smaller Km (2.4-7fold) and kcat (1-4.4 fold) values for all three substrates DMP, ABTS and SGZ as compared with those for the wild-type enzyme. Its slightly larger kcat/Km values for three substrates mainly come from the decreased Km. Deleting ?-helix (L351-G378) resulted in the formation of inactive inclusion body when the mutant ??351-378 was expressed in E. coli. Another mutant ?351-380M was then made via substitution of seven amino acid residues in the ?-helix (L351-G378) region. The ?351-380M mutant was active, and displayed a far-UV CD spectrum markedly different from that for wild-type enzyme. Kinetic studies showed the ?351-380M mutant gave very low Km values for DMP, ABTS and SGZ, 4.5-, 1.9- and 7-fold less than those for the wild type. In addition, kcat/Km values were increased, 9.4-fold for DMP, similar for ABTS and 3-fold for SGZ. Conclusion The Glu residue at position 106 appears not to be the only factor affecting the copper binding, and it may also play a role in maintaining enzyme conformation. The ?-helix (L351-G378) may not only block access to the type I copper site but also play a role in substrate specificities of bacterial MCOs. The ?351-380M mutant catalyzing oxidation of the phenolic substrate DMP effectively would be very useful in green chemistry. PMID:21624144

2011-01-01

20

Recombinant expression and functional characterization of human hephaestin: a multicopper oxidase with ferroxidase activity.  

PubMed

Human hephaestin (Hp) is a transmembrane protein that has been implicated in duodenal iron export. Mutations in the murine hephaestin gene (sla) produce microcytic, hypochromic anemia that is refractory to oral iron therapy. Hp shares approximately 50% sequence identity with the plasma multicopper ferroxidase ceruloplasmin including conservation of residues involved in disulfide bond formation and metal coordination. On the basis of this similarity to ceruloplasmin, human hephaestin may also bind copper and possess ferroxidase activity. To test this hypothesis, human hephaestin cDNA has been cloned by reverse transcription of human duodenal mRNA. Following in vitro mutagenesis to make the encoded polypeptide suitable for expression and purification, the hephaestin cDNA was cloned into the expression vector pNUT and introduced into baby hamster kidney cells. After selection with methotrexate, the baby hamster kidney cells secreted the recombinant human hephaestin into the medium at a level of approximately 2 mg/L. Purification was achieved by a single immunoaffinity chromatography step. As judged by SDS-PAGE, N-terminal sequence analysis, and matrix-assisted laser desorption ionization-time-of-flight mass spectrometry, the purified hephaestin was homogeneous with a mass of 129600 Da, suggesting a carbohydrate content of 7.7%. Inductively coupled plasma mass spectrometry revealed that recombinant hephaestin contained an average of 3.13 atoms of copper per protein molecule. A visible absorption maximum was observed at 607 nm, consistent with the presence of a Type 1 copper site. By using ferrous ammonium sulfate as a substrate, recombinant hephaestin was shown to have ferroxidase activity with a K(m) of 2.1 microM for Fe(II). Lastly, urea PAGE showed that hephaestin was able to catalyze formation of diferric transferrin from Fe(II) and apotransferrin. PMID:16274220

Griffiths, Tanya A M; Mauk, A Grant; MacGillivray, Ross T A

2005-11-15

21

Biochemical studies of the multicopper oxidase (small laccase) from Streptomyces coelicolor using bioactive phytochemicals and site-directed mutagenesis  

PubMed Central

Summary Multicopper oxidases can act on a broad spectrum of phenolic and non-phenolic compounds. These enzymes include laccases, which are widely distributed in plants and fungi, and were more recently identified in bacteria. Here, we present the results of biochemical and mutational studies of small laccase (SLAC), a multicopper oxidase from Streptomyces coelicolor (SCO6712). In addition to typical laccase substrates, SLAC was tested using phenolic compounds that exhibit antioxidant activity. SLAC showed oxidase activity against 12 of 23 substrates tested, including caffeic acid, ferulic acid, resveratrol, quercetin, morin, kaempferol and myricetin. The kinetic parameters of SLAC were determined for 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid), 2,6-dimethoxyphenol, quercetin, morin and myricetin, and maximum reaction rates were observed with myricetin, where kcat and Km values at 60°C were 8.1 (±?0.8) s?1 and 0.9 (±?0.3) mM respectively. SLAC had a broad pH optimum for activity (between pH?4 and 8) and temperature optimum at 60–70°C. It demonstrated remarkable thermostability with a half-life of over 10?h at 80°C and over 7?h at 90°C. Site-directed mutagenesis revealed 17 amino acid residues important for SLAC activity including the 10 His residues involved in copper coordination. Most notably, the Y229A and Y230A mutant proteins showed over 10-fold increase in activity compared with the wild-type SLAC, which was correlated to higher copper incorporation, while kinetic analyses with S929A predicts localization of this residue near the meta-position of aromatic substrates. Funding Information Funding for this research was provided by the Government of Ontario for the project ‘FFABnet: Functionalized Fibre and Biochemicals’ (ORF-RE-05-005), and the Natural Sciences and Engineering Research Council of Canada. PMID:23815400

Sherif, Mohammed; Waung, Debbie; Korbeci, Bihter; Mavisakalyan, Valentina; Flick, Robert; Brown, Greg; Abou-Zaid, Mamdouh; Yakunin, Alexander F; Master, Emma R

2013-01-01

22

Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.  

PubMed

The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions. PMID:24875125

Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen

2014-07-14

23

Agaricus bisporus and related Agaricus species on lignocellulose: production of manganese peroxidase and multicopper oxidases.  

PubMed

Biotechnological, microbiological, and genetic studies of Agaricus species other than A. bisporus, the white button mushroom, have been limited so far. To expand the knowledge in the genus Agaricus, six novel wild-type isolates of Agaricus spp. were studied on their nutritional demands for enzyme production and mycelial growth. All the selected Agaricus species produced extracellular manganese peroxidase (MnP) and laccase activities in semi-solid rye bran cultures. Moderate MnP activities were measured for A. bisporus, A. bernardii and A. campestris. The highest laccase activities were obtained for A. bisporus and A. campestris. On soy medium, the highest mycelial tyrosinase activity was determined for A. bernardii. For A. bisporus, addition of copper caused no increase in laccase or tyrosinase activities on soy or malt extract media. Hyphal growth rate of the isolates was studied on lignocellulose amended agar plates. Fastest growth was obtained for A. bisporus on wheat bran and birch leaf litter agar. Except for A. bernardii, hyphal growth rates correlated well with MnP and laccase production levels between Agaricus species. Molecular taxonomy of the novel Agaricus spp. positioned them to distinct phylogenetic clusters with species-level identity. In conclusion, our data point to the importance of both MnP and multicopper enzymes in Agaricus spp. while growing on lignocelluloses. PMID:23454218

Hildén, Kristiina; Mäkelä, Miia R; Lankinen, Pauliina; Lundell, Taina

2013-06-01

24

A new multicopper oxidase from Gram-positive bacterium Rhodococcus erythropolis with activity modulating methionine rich tail.  

PubMed

Multicopper oxidases are involved in a wide variety of physiological tasks in nature. They are part of the lignin formation/decomposition system in plants and fungi. In bacteria they are part of developmental processes and the heavy metal resistance apparatus. A well characterised example is the copper tolerance protein CueO of Escherichia coli (CueO(EC)). Here, we report the heterologous expression of the apo- and holo-form of CueO(RE), a homologue to CueO(EC) from Rhodococcus erythropolis. Upon incubation with copper(II) ions, low active apo-CueO(RE) was converted into the active holo-CueO(RE) in vivo. The holo-form was physico-chemically characterised using a copper(I) BCA complex and the model substrate 2,6-dimethoxyphenol. The spectroscopic and catalytic properties are different from CueO(EC), revealing a high catalytic efficiency (k(cat)/K(m)) of 115 min(-1)mM(-1) with physiological K(m) of 80 ?M for the cuprous oxidase activity. At the C-terminus of CueO(RE) a methionine rich tail region was identified which can be found in a variety of actinobacteria. Chimeras of the E. coli and R. erythropolis enzymes were constructed to investigate the influence of this tail regarding kinetic parameters. It was shown that the tail did not have the same function as the corresponding methionine rich loop in CueO(EC). However, it modulated the kinetic properties of the enzyme. PMID:23485678

Classen, Thomas; Pietruszka, Jörg; Schuback, Saskia Marina

2013-05-01

25

Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase  

PubMed Central

X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-­ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

2012-01-01

26

The two oxidized forms of the trinuclear Cu cluster in the multicopper oxidases and mechanism for the decay of the native intermediate  

PubMed Central

Multicopper oxidases (MCOs) catalyze the 4e? reduction of O2 to H2O. The reaction of the fully reduced enzyme with O2 generates the native intermediate (NI), which undergoes a slow decay to the resting enzyme in the absence of substrate. NI is a fully oxidized form, but its spectral features are very different from those of the resting form (also fully oxidized), because the type 2 and the coupled-binuclear type 3 Cu centers in the O2-reducing trinuclear Cu cluster site are isolated in the resting enzyme, whereas these are all bridged by a ?3-oxo ligand in NI. Notably, the one azide-bound NI (NIAz) exhibits spectral features very similar to those of NI, in which the ?3-oxo ligand in NI has been replaced by a ?3-bridged azide. Comparison of the spectral features of NI and NIAz, combined with density functional theory (DFT) calculations, allows refinement of the NI structure. The decay of NI to the resting enzyme proceeds via successive proton-assisted steps, whereas the rate-limiting step involves structural rearrangement of the ?3-oxo-bridge from inside to outside the cluster. This phenomenon is consistent with the slow rate of NI decay that uncouples the resting enzyme from the catalytic cycle, leaving NI as the catalytically relevant fully oxidized form of the MCO active site. The all-bridged structure of NI would facilitate electron transfer to all three Cu centers of the trinuclear cluster for rapid proton-coupled reduction of NI to the fully reduced form for catalytic turnover. PMID:17702865

Yoon, Jungjoo; Liboiron, Barry D.; Sarangi, Ritimukta; Hodgson, Keith O.; Hedman, Britt; Solomon, Edward I.

2007-01-01

27

Electronic Structure of the Peroxy Intermediate and Its Correlation to the Native Intermediate in the Multicopper Oxidases: Insights into the Reductive Cleavage of the O-O Bond  

PubMed Central

The multicopper oxidases (MCOs) utilize a blue type 1 (T1) copper site and a trinuclear Cu cluster comprised of a type 2 (T2) and a binuclear type 3 (T3) site that together catalyze the four-electron reduction of O2 to H2O. Reaction of the fully reduced enzyme with O2 proceeds via two sequential two-electron steps generating the peroxy intermediate (PI) and the native intermediate (NI). While a detailed description of the geometric and electronic structure of NI has been developed, this has been more elusive for PI largely due to the diamagnetic nature of its ground state. Density functional theory (DFT) calculations have been used to correlate to spectroscopic data to generate a description of the geometric and electronic structure of PI. A highly conserved carboxylate residue near the T2 site is found to play a critical role in stabilizing the PI structure, which induces oxidation of the T2 and one T3 Cu center and strong superexchange stabilization via the peroxide bridge, allowing irreversible binding of O2 at the trinuclear Cu site. Correlation of PI to NI is achieved using a two-dimensional potential energy surface generated to describe the catalytic two-electron reduction of the peroxide O-O bond by the MCOs. It is found that the reaction is thermodynamically driven by the relative stability of NI and the involvement of the simultaneous two-electron transfer process. A low activation barrier (calculated ~5–6 kcal/mol and experimental ~3–5 kcal/mol) is produced by the triangular topology of the trinuclear Cu cluster site, as this symmetry provides good donor-acceptor frontier molecular orbital (FMO) overlap. Finally, the O-O bond cleavage in the trinuclear Cu cluster can be achieved via either a proton-assisted or a proton-unassisted process, allowing the MCOs to function over a wide range of pH. It is found that while the proton helps to stabilize the acceptor O22? ?* orbital in the proton-assisted process for better donor-acceptor FMO overlap, the third oxidized Cu center in the trinuclear site assumes the role as a Lewis acid in the proton-unassisted process for similarly efficient O-O bond cleavage. PMID:17918839

Yoon, Jungjoo; Solomon, Edward I.

2008-01-01

28

The Escherichia coli Cell Division Protein and Model Tat Substrate SufI (FtsP) Localizes to the Septal Ring and Has a Multicopper Oxidase-Like Structure  

PubMed Central

The Escherichia coli protein SufI (FtsP) has recently been proposed to be a component of the cell division apparatus. The SufI protein is also in widespread experimental use as a model substrate in studies of the Tat (twin arginine translocation) protein transport system. We have used SufI-GFP (green fluorescent protein) fusions to show that SufI localizes to the septal ring in the dividing cell. We have also determined the structure of SufI by X-ray crystallography to a resolution of 1.9 Å. SufI is structurally related to the multicopper oxidase superfamily but lacks metal cofactors. The structure of SufI suggests it serves a scaffolding rather than an enzymatic role in the septal ring and reveals regions of the protein likely to be involved in the protein–protein interactions required to assemble SufI at the septal ring. PMID:19135451

Tarry, Michael; Arends, S.J. Ryan; Roversi, Pietro; Piette, Evan; Sargent, Frank; Berks, Ben C.; Weiss, David S.; Lea, Susan M.

2009-01-01

29

The mammalian aldehyde oxidase gene family  

PubMed Central

Aldehyde oxidases (EC 1.2.3.1) are a small group of structurally conserved cytosolic proteins represented in both the animal and plant kingdoms. In vertebrates, aldehyde oxidases constitute the small sub-family of molybdo-flavoenzymes, along with the evolutionarily and structurally related protein, xanthine oxidoreductase. These enzymes require a molybdo-pterin cofactor (molybdenum cofactor, MoCo) and flavin adenine dinucleotide for their catalytic activity. Aldehyde oxidases have broad substrate specificity and catalyse the hydroxylation of N-heterocycles and the oxidation of aldehydes to the corresponding acid. In humans, a single aldehyde oxidase gene (AOX1) and two pseudogenes clustering on a short stretch of chromosome 2q are known. In other mammals, a variable number of structurally conserved aldehyde oxidase genes has been described. Four genes (Aox1, Aox3, Aox4 and Aox3l1), coding for an equivalent number of catalytically active enzymes, are present in the mouse and rat genomes. Although human AOX1 and its homologous proteins are best known as drug metabolising enzymes, the physiological substrate(s) and function(s) are as yet unknown. The present paper provides an update of the available information on the evolutionary history, tissue- and cell-specific distribution and function of mammalian aldehyde oxidases. PMID:20038499

2009-01-01

30

A putative multicopper protein secreted by an atypical type II secretion system involved in the  

E-print Network

for a multicopper oxidase-like protein in an anaerobic organism. These results further emphasize the importance evidence suggests that Fe(III) reduction was an important form of respiration on early Earth (Lovley et al

Lovley, Derek

31

Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites  

SciTech Connect

The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

2009-04-30

32

[Cloning and sequencing of ACC oxidase gene from sugarcane].  

PubMed

The plant hormone ethylene is not only responsible for the initiation of fruit ripening, senescence and dormancy but also for regulating many other plant developmental processes, such as seed germination, root initiation, growth, floral differentiation, sex differentiation and responding to environment stresses. One of the rate-limiting steps for ethylene biosynthesizing in plant is catalyzed by 1-aminocyclopropane-1-carboxylate (ACC) oxidase. Understanding of ethylene expressive pattern in plant is an entrance to understand the roles of ethylene on plant. In this paper, two degenerate oligonucleotide primers were designed, coding for two conservative amino acid regions in ACC oxidase protein family, the sequences of the two primers were TAGAGCTCGATGC[TA]TG [CT]GA[GA]AA[AC]TGGGG and CGTCTAGAGCTTC[GA]AATCTTGGCTCCTT respectively. A PCR amplification was performed on sugarcane (Saccharum L. Hybrid cv. ROC16) DNA template, and produced a fragment of 940 bp. By using the program of BLAST on NCBI GenBank database, the sequence presented a very high match with the ACC oxidase genes from other plants, 63 searched out sequences were all ACC oxidase genes. After alignment on PCgene program, the identities of the cloned fragment with ACC oxidase genes from rice and bamboo were both reaching about 88%. So we can concluded that the cloned sequence was a member of ACC oxidase genes fragment from sugarcane. The sequence has been submitted to the GenBank database, the accession number is AF442821. According to the ACC oxidase protein family, a 'intron' of 103 bp was excluded and the sequence coded 279 amino acids, which spanned 88% of the putative whole sequence in length. Alignment and phylogenetic analysis of the amino acid sequence deduced from this fragment and the ACC oxidase sequences of other plants retrieved from GenBank were carried out by using PCgene program. The putative amino acid sequence shared a homology of 86% with the ACC oxidases of bamboo and rice, 74.6% with banana, 70% with tomato and potato and 68% with melon and carnation, which showed that the homology of sugarcane ACC oxidase with monocot was higher than with dicot. The results of phylogenetic analysis showed that ACC oxidase from sugarcane and ACC oxidases from rice clustered together firstly, and then came those from banana, ACC oxidases of dicot from potato, tomato, petunia, melon, Arabidopsis thaliana and carnation came subsequently. It indicated that sugarcane ACC oxidase had a closer phylogenetic affinities to the monocot ACC oxidase sequences than to the dicot ACC oxidases sequences. The clustering results of ACC oxidase molecules accorded with morphological classification system. PMID:12812078

Wang, Zi-Zhang; Li, Yang-Rui; Zhang, Shu-Zhen; Lin, Jun-Fang; Guo, Li-Qiong

2003-01-01

33

Organisation of the tomato polyphenol oxidase gene family  

Microsoft Academic Search

We report the isolation and characterization of seven nuclear genes encoding polyphenol oxidase (PPO) in tomato (Lycopersicon esculentum cv. VFNT Cherry). The seven genes (PPOs A, A', B, C, D, E and F) fall into three structural classes (I, II, and III) based on Eco RI and Hind III restriction fragment length polymorphisms (RFLP). RFLP mapping and PFGE analysis demonstrated

Sally M. Newman; Nancy T. Eannetta; Haifeng Yu; James P. Prince; M. Carmen de Vicente; Steven D. Tanksley; John C. Steffens

1993-01-01

34

Four novel mutations of the coproporphyrinogen III oxidase gene.  

PubMed

Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

2009-01-01

35

A functional polymorphism in the monoamine oxidase A gene promoter.  

PubMed

We describe a new polymorphism upstream of the gene for monoamine oxidase A (MAOA), an important enzyme in human physiology and behavior. The polymorphism, which is located 1.2 kb upstream of the MAOA coding sequences, consists of a 30-bp repeated sequence present in 3, 3.5, 4, or 5 copies. The polymorphism is in linkage disequilibrium with other MAOA and MAOB gene markers and displays significant variations in allele frequencies across ethnic groups. The polymorphism has been shown to affect the transcriptional activity of the MAOA gene promoter by gene fusion and transfection experiments involving three different cell types. Alleles with 3.5 or 4 copies of the repeat sequence are transcribed 2-10 times more efficiently than those with 3 or 5 copies of the repeat, suggesting an optimal length for the regulatory region. This promoter region polymorphism may be useful as both a functional and an anonymous genetic marker for MAOA. PMID:9799080

Sabol, S Z; Hu, S; Hamer, D

1998-09-01

36

Molecular evolution of the polyamine oxidase gene family in Metazoa  

PubMed Central

Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS) mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO) and orthologous genes related by speciation events (PAOs, SMOs/APAOs). Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies. PMID:22716069

2012-01-01

37

A putative multicopper protein secreted by an atypical type II secretion system involved in the reduction of insoluble electron acceptors in Geobacter sulfurreducens.  

PubMed

Extracellular electron transfer onto Fe(III) oxides in Geobacter sulfurreducens is considered to require proteins that must be exported to the outer surface of the cell. In order to investigate this, the putative gene for OxpG, the pseudopilin involved in a type II general secretion pathway of Gram-negative bacteria, was deleted. The mutant was unable to grow with insoluble Fe(III) oxide as the electron acceptor. Growth on soluble Fe(III) was not affected. An analysis of proteins that accumulated in the periplasm of the oxpG mutant, but not in the wild-type, led to the identification of a secreted protein, OmpB. OmpB is predicted to be a multicopper protein, with highest homology to the manganese oxidase, MofA, from Leptothrix discophora. OmpB contains a potential Fe(III)-binding site and a fibronectin type III domain, suggesting a possible role for this protein in accessing Fe(III) oxides. OmpB was localized to the membrane fraction of G. sulfurreducens and in the supernatant of growing cultures, consistent with the type II secretion system exporting OmpB. A mutant in which ompB was deleted had the same phenotype as the oxpG mutant, suggesting that the failure to export OmpB was responsible for the inability of the oxpG-deficient mutant to reduce Fe(III) oxide. This is the first report that proposes a role for a multicopper oxidase-like protein in an anaerobic organism. These results further emphasize the importance of outer-membrane proteins in Fe(III) oxide reduction and suggest that outer-membrane proteins other than c-type cytochromes are required for Fe(III) oxide reduction in Geobacter species. PMID:16849792

Mehta, Teena; Childers, Susan E; Glaven, Richard; Lovley, Derek R; Mester, Tünde

2006-08-01

38

Cloning of an insecticidal cholesterol oxidase gene and its expression in bacteria and in plant protoplasts.  

PubMed Central

We cloned and sequenced structural gene choM, which encodes an insecticidally active cholesterol oxidase in Streptomyces sp. strain A19249. The primary translation product was predicted to be a 547-amino-acid protein whose first 43 amino acids constitute a secretory signal peptide. Expression of the gene with the signal sequence in Escherichia coli resulted in production of a protein that had enzymatic and insecticidal properties which were indistinguishable from those of the cholesterol oxidase secreted by Streptomyces sp. strain A19249. Expression of the gene with or without the signal sequence in tobacco protoplasts resulted in production of an enzymatically active cholesterol oxidase. Images PMID:7811062

Corbin, D R; Greenplate, J T; Wong, E Y; Purcell, J P

1994-01-01

39

Localization of the human coproporphyrinogen oxidase gene to chromosome band 3q12  

Microsoft Academic Search

The human gene encoding coproporphyrinogen oxidase is the defective gene in hereditary coproporphyria. This gene was mapped to chromosome band 3q12 using fluorescent in situ hybridization. The chromosomal localization was confirmed by cosegregation of the human gene with chromosome 3 in a panel of human\\/rodent somatic hybrids.

Valère Cacheux; Pavel Martasek; Françoise Fougerousse; Marie Hélène Delfau; Luc Druart; Gerard Tachdjian; Bernard Grandchamp

1994-01-01

40

Two peanut germin-like genes and the potential superoxidase dismutase and oxalate oxidase activities  

Technology Transfer Automated Retrieval System (TEKTRAN)

Germins and germin-like proteins (GLPs) genes are members of large multigene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity leadin...

41

Phylogenetic Analysis of Six-Domain Multi-Copper Blue Proteins  

PubMed Central

Multicopper blue proteins, composed of several repetitive copper-binding domains similar to one-domain cupredoxin-like proteins, were found in almost all organisms. They are classified into the three different groups, based on their two-, three- or six-domain organization. We found orthologs of chordate six-domain copper-binding proteins in animals, plants, bacteria and archea. The phylogenetic analysis of 183 multicopper blue proteins and their copper-binding sites comparison make us think that all the modern six-domain blue proteins have originated from the common ancestral six-domain protein in the process of gene duplication and copper-binding sites loss as a result of amino acid substitutions. PMID:23516668

Vasin, Andrey; Klotchenko, Sergey; Puchkova, Ludmila

2013-01-01

42

Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development  

Microsoft Academic Search

Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene- specific probes capable of differentiating between PPO A\\/C, PPO B, PPO D, and PPO E\\/F, we examined the spatial and temporal ex- pression of this gene family during vegetative and reproductive development. RNA blots

Piyada Thipyapong; Daniel M. Joel; John C. Steffens

43

Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.  

PubMed

The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

2011-11-01

44

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa  

PubMed Central

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

45

Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression  

Technology Transfer Automated Retrieval System (TEKTRAN)

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

46

Regulation of 1-aminocyclopropane-1-carboxylate oxidase gene expression during leaf ontogeny in white clover  

Microsoft Academic Search

The expression of two 1-aminocyclopropane-1-carboxylate (ACC) oxidase (E.C. 1.4.3)(ACO) genes, TR-ACO2 and TR-ACO3 from white clover has been examined in leaf tissue in response to physiological stimuli. In detached mature-green leaves,\\u000a the expression of TR-ACO3 (a leaf-senescence-associated ACC oxidase) is induced over a 6 h time-course, while expression of TR-ACO2 (expressed constitutively in mature-green leaf tissue) decreased over the same time-course.

Richard W. Scott; Sang Dong Yoo; Donald A. Hunter; Deming Gong; Susanna Leung; Michael T. McManus

2010-01-01

47

A novel mutation of coproporphyrinogen oxidase (CPO) gene in a Japanese family  

Microsoft Academic Search

Hereditary coproporphyria (HCP) is an autosomal dominant disease characterized by a deficiency of coproporphyrinogen oxidase\\u000a (CPO). Only 11 mutations of the gene have been reported to date as the mutations responsible for HCP. We report here a novel\\u000a mutation of the gene responsible for the disease in a Japanese family. Analysis of the polymerase chain reaction (PCR) amplified\\u000a DNA fragments

Shinji Susa; Makoto Daimon; Ikuo Yamamori; Masao Kondo; Keiichi Yamatani; Hideo Sasaki; Takeo Kato

1998-01-01

48

Mitochondrial electron transport regulation of nuclear gene expression. Studies with the alternative oxidase gene of tobacco.  

PubMed Central

We have isolated a cDNA representing the tobacco (Nicotiana tabacum L. cv Bright Yellow) nuclear gene Aox1, which encodes the alternative oxidase of plant mitochondria. The clone contains the complete coding region (1059 base pairs) of a precursor protein of 353 amino acids with a calculated molecular mass of 39.8 kD. A putative transit peptide contains common signals believed to be important for import and processing of mitochondrially localized proteins. We have studied changes in Aox1 gene expression in tobacco in response to changes in cytochrome pathway activity. Inhibition of the cytochrome pathway by antimycin A resulted in a rapid and dramatic accumulation of Aox1 mRNA, whereas the level of mRNAs encoding two proteins of the cytochrome pathway did not change appreciably. This was accompanied by a dramatic increase in alternative pathway capacity and engagement in whole cells. Respiration under these conditions was unaffected by the uncoupler p-trifluoromethoxycarbonylcyanide (FCCP). When inhibition of the cytochrome pathway was relieved, levels of Aox1 mRNA returned to control levels, alternative pathway capacity and engagement declined, and respiration could once again be stimulated by FCCP. The results show that a mechanism involving changes in Aox1 gene expression exists whereby the capacity of the alternative pathway can be adjusted in response to changes in the activity of the cytochrome pathway. PMID:8058837

Vanlerberghe, G C; McIntosh, L

1994-01-01

49

Four novel mutations in the gene encoding gp91-phox of human NADPH oxidase: consequences for oxidase assembly.  

PubMed

The superoxide-forming nicotinamide adenine dinucleotide phosphate reduced (NADPH) oxidase of human phagocytes comprises membrane-bound and cytosolic proteins, which, upon cell activation, assemble on the plasma membrane to form the active enzyme. Patients with chronic granulomatous disease (CGD) are defective in one of the phagocyte oxidase (phox) components, p47-phox or p67-phox, which reside in the cytosol of resting phagocytes, or gp91-phox or p22-phox, which constitute the membrane-bound cytochrome b(558). In four X-linked CGD patients we have identified novel missense mutations in CYBB, the gene encoding gp91-phox. These mutations were associated with normal amounts of nonfunctional cytochrome b(558) in the patients' neutrophils. In phorbol-myristate-stimulated neutrophils and in a cell-free translocation assay with neutrophil membranes and cytosol, the association of p47-phox and p67-phox with the membrane fraction of the cells with Cys369-->Arg, Gly408-->Glu, and Glu568--> Lys substitutions was strongly disturbed. Only a Thr341-->Lys substitution, residing in a region of gp91-phox involved in flavin adenine dinucleotide (FAD) binding, supported a normal translocation. Thus, the introduction or reversal of charge at residues 369, 408, and 568 in gp91-phox destroys the correct binding of p47-phox and p67-phox to cytochrome b(558). Based on mutagenesis studies of structurally related flavin-dependent oxidoreductases, we propose that the Thr341-->Lys substitution results in impaired hydride transfer from NADPH to FAD. Because we found no electron transfer in solubilized neutrophil plasma membranes from any of the four patients, we conclude that all four amino acid replacements are critical for electron transfer. Apparently, an intimate relation exists between domains of gp91-phox involved in electron transfer and in p47/p67-phox binding. (Blood. 2000;95:666-673) PMID:10627478

Leusen, J H; Meischl, C; Eppink, M H; Hilarius, P M; de Boer, M; Weening, R S; Ahlin, A; Sanders, L; Goldblatt, D; Skopczynska, H; Bernatowska, E; Palmblad, J; Verhoeven, A J; van Berkel, W J; Roos, D

2000-01-15

50

In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes  

PubMed Central

NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.

2014-01-01

51

Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species  

Microsoft Academic Search

Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance\\u000a the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including\\u000a T. urartu, T. boeoticum, T. monococcum, T. dicoccoides, T. durum and Ae. tauschii, were sampled to isolate new alleles at Ppo-A1 and Ppo-D1 loci

X. Y. He; Z. H. He; C. F. Morris; X. C. Xia

2009-01-01

52

Paracoccus denitrificans mutants deleted in the gene for subunit II of cytochrome c oxidase also lack subunit I.  

PubMed

As a prerequisite to site-directed mutagenesis on cytochrome c oxidase, two different mutants are constructed by inactivating the cta gene locus encoding subunits II and III (ctaC and ctaE) of the Paracoccus denitrificans oxidase. Either a short fragment encoding part of the putative copper binding site near the C terminus of subunit II, or a substantial fragment, comprising parts of the coding region for both subunits and all of the intervening three open reading frames, are removed and replaced by the kanamycin resistance gene. Each construct, ligated into a suicide vector, is mated into Paracoccus, and mutants originating from double homologous recombination events are selected. We observe complete loss of alpha-type heme and of oxidase subunits, as well as a substantial decrease in the cytochrome c oxidase activity. Upon complementation with the ctaC gene (plus various lengths of downstream sequence extending into the operon), subunit II gets expressed in all cases. Wild-type phenotype, however, is only restored with the whole operon. Using smaller fragments for complementation gives interesting clues on roles of the open reading frames for the assembly process of the oxidase complex; two of the open reading frame genes most likely code for two independent assembly factors. Since homologous genes have been described not only for other bacterial oxidases, but their gene products shown to participate also in the assembly of the yeast enzyme, they seem to constitute a group of evolutionary conserved proteins. PMID:1850416

Steinrücke, P; Gerhus, E; Ludwig, B

1991-04-25

53

Identification and analysis of the Shewanella oneidensis major oxygen-independent coproporphyrinogen III oxidase gene.  

PubMed

Shewanella oneidenesis MR-1 is a facultative anaerobe that can use a large number of electron acceptors including metal oxides. During anaerobic respiration, S. oneidensis MR-1 synthesizes a large number of c cytochromes that give the organism its characteristic orange color. Using a modified mariner transposon, a number of S. oneidensis mutants deficient in anaerobic respiration were generated. One mutant, BG163, exhibited reduced pigmentation and was deficient in c cytochromes normally synthesized under anaerobic condition. The deficiencies in BG163 were due to insertional inactivation of hemN1, which exhibits a high degree of similarity to genes encoding anaerobic coproporphyrinogen III oxidases that are involved in heme biosynthesis. The ability of BG163 to synthesize c cytochromes under anaerobic conditions, and to grow anaerobically with different electron acceptors was restored by the introduction of hemN1 on a plasmid. Complementation of the mutant was also achieved by the addition of hemin to the growth medium. The genome sequence of S. oneidensis contains three putative anaerobic coproporphyrinogen III oxidase genes. The protein encoded by hemN1 appears to be the major enzyme that is involved in anaerobic heme synthesis of S. oneidensis. The other two putative anaerobic coproporphyrinogen III oxidase genes may play a minor role in this process. PMID:21726654

Al-Sheboul, Suhaila; Saffarini, Daad

2011-12-01

54

Cytochrome Oxidase Subunit II Gene from Carrot Contains an Intron 1  

PubMed Central

Introns in the cytochrome oxidase subunit II (COXII) gene of plant mitochondrial DNA (mtDNA) have been observed only in monocots. The COXII genes in dicots investigated to date do not contain introns. This is the first report of an intron in the COXII gene of a dicot. The presence of an intron in the carrot COXII intron was verified by restriction mapping and hybridization using specific maize and wheat COXII probes. Regions of the carrot COXII intron are homologous to the maize COXII intron and homologous to the wheat COXII intron-insert as demonstrated by hybridization. Homology of these regions was confirmed by sequencing portions of the gene. A comparison of the restriction map of the carrot COXII gene with the restriction maps of the COXII genes from pea, Oenothera, maize, wheat, and rice revealed that the carrot map coincides with the rice restriction map. Images Fig. 3 PMID:16665564

Turano, Frank J.; Debonte, Lorin R.; Wilson, Kenneth G.; Matthews, Benjamin F.

1987-01-01

55

Regulation of NADPH oxidase gene expression with PKA and cytokine IL-4 in neurons and microglia.  

PubMed

Neuronal excitation is mediated by the activation of NMDA receptor and associated with the formation of reactive oxygen species due to the activation of NADPH oxidase complex proteins. The activation of Gs protein coupled receptors (GPCRs) induces neuronal activation in the cAMP-dependent protein kinase A (PKA)-mediated signal cascade and regulates NADPH oxidase activity. However, it is unknown whether PKA regulates NADPH oxidase gene expression in neurons and microglia. In the present research, the NADPH oxidase gene expression was studied in rat cortical neurons and microglia in vitro. Purified microglial cells were identified with OX-42 antibody and they also expressed apolipoprotein E (ApoE). The time-dependent effect of cytokine interleukin-4 (IL-4) (20 ng/ml) in NADPH oxidase gene expression was studied in microglial cells. The levels of mRNA were determined by quantitative RT-PCR. The expression of NOX1, NOX2, and NCF2 was upregulated after IL-4 treatment for 4 h, but it was downregulated after 8-24 h. The expression of NCF1 was suppressed during any time of cytokine effect. IL-4 upregulated arginase1 (Arg1) and serine racemase1 (SRR1) gene expressions in microglia. Amyloid beta (Ab) suppressed NOX2, NCF1, and NCF2 gene expressions and upregulated glutamate cystine transporter (xCT), although IL-4 attenuated the effect of Ab (500 ?M) in the upregulation of xCT gene expression. The activation of PKA with agonist dibutyryl cAMP (dbcAMP) (100 ?M) induced the upregulation of Arg1 gene expression in microglia involving in the process of microglial activation. The transcription of NOX1, NOX2, and NCF1 was suppressed in microglial cells after dbcAMP treatment within 24 h. Neurons were identified with the microtubule-associated protein tau. The uniform distribution of tau along axons was established in normal neurons. Tau protein was redistributed after PKA agonist dbcAMP treatment for 24 h. L-glutamate (50 ?M) caused the apoptotic processes and the accumulation of tau in the soma of neurons and along axons. The activation of PKA for 24 h induced the transcriptional upregulation of NOX1 and NCF1 in cortical neurons. However, L-glutamate suppressed NOX1 gene expression in neurons. These data demonstrate that the effects of IL-4 and dbcAMP are similar in the regulation of SRR1, Arg1, and NADPH oxidase complex gene expressions in neurons and microglia. IL-4 prevents glutamate release from microglia suppressing xCT expression induced by Ab. These findings suggest that the activation of GPCR in PKA-mediated pathway leads to transcriptional regulation of NADPH oxidase complex. The modulation of GPCR activation may inhibit the oxidative stress in neurons. PMID:22565378

Savchenko, Valentina L

2013-04-01

56

Semidwarf (sd-1), “green revolution” rice, contains a defective gibberellin 20-oxidase gene  

PubMed Central

The introduction of semidwarf rice (Oryza sativa L.) led to record yield increases throughout Asia in the 1960s. The major semidwarfing allele, sd-1, is still extensively used in modern rice cultivars. The phenotype of sd-1 is consistent with dwarfism that results from a deficiency in gibberellin (GA) plant growth hormones. We propose that the semidwarf (sd-1) phenotype is the result of a deficiency of active GAs in the elongating stem arising from a defective 20-oxidase GA biosynthetic enzyme. Sequence data from the rice genome was combined with previous mapping studies to locate a putative GA 20-oxidase gene (Os20ox2) at the predicted map location of sd-1 on chromosome 1. Two independent sd-1 alleles contained alterations within Os20ox2: a deletion of 280 bp within the coding region of Os20ox2 was predicted to encode a nonfunctional protein in an indica type semidwarf (Doongara), whereas a substitution in an amino acid residue (Leu-266) that is highly conserved among dioxygenases could explain loss of function of Os20ox2 in a japonica semidwarf (Calrose76). The quantification of GAs in elongating stems by GC-MS showed that the initial substrate of GA 20-oxidase activity (GA53) accumulated, whereas the content of the major product (GA20) and of bioactive GA1 was lower in semidwarf compared with tall lines. We propose that the Os20ox2 gene corresponds to the sd-1 locus. PMID:12077303

Spielmeyer, Wolfgang; Ellis, Marc H.; Chandler, Peter M.

2002-01-01

57

Molecular cloning of the isoamyl alcohol oxidase-encoding gene (mreA) from Aspergillus oryzae.  

PubMed

Isoamyl alcohol oxidase (IAAOD) is a novel enzyme that catalyzes the formation of isovaleraldehyde, which is the main component of mureka that gives sake an off-flavor (Yamashita et al. Biosci. Biotechnol. Biochem., 63, 1216-1222, 1999). We cloned the genomic DNA sequence encoding IAAOD from a koji mold, Aspergillus oryzae, using a PCR-amplified DNA fragment corresponding to the partial amino acid sequences of the purified protein as a probe. The cloned gene comprises 1903 bp of an open reading frame with three putative introns and encodes 567 amino acids with a presumed signal peptide consisting of 24 amino acids at the N-terminus. Moreover, nine potential N-glycosylation sites were present. Homology search on amino acid sequence showed that IAAOD has a region significantly similar to those conserved in FAD-dependent oxidoreductases. Southern hybridization analysis revealed that the cloned gene exists as a single copy in the A. oryzae RIB 40 chromosome. The cloned gene was overexpressed under the control of the amyB promoter in A. oryzae. The isovaleraldehyde-producing activity in the culture supernatant of one transformant was over 800 times as high as that of transformant with the control vector. This result demonstrates that the cloned gene encodes IAAOD. We named this novel alcohol oxidase gene "mreA". PMID:16232791

Yamashita, N; Motoyoshi, T; Nishimura, A

2000-01-01

58

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)  

PubMed Central

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

59

A novel mutation of coproporphyrinogen oxidase (CPO) gene in a Japanese family.  

PubMed

Hereditary coproporphyria (HCP) is an autosomal dominant disease characterized by a deficiency of coproporphyrinogen oxidase (CPO). Only 11 mutations of the gene have been reported to date as the mutations responsible for HCP. We report here a novel mutation of the gene responsible for the disease in a Japanese family. Analysis of the polymerase chain reaction (PCR) amplified DNA fragments of the gene by direct-sequencing and/or cloning-based sequencing methods revealed the gene abnormality responsible for the disease. The mutation found was a single base deletion of T at nt position 526, which results in frame shift and truncation of coded protein at amino acid position 204. Screening of pre-symptomatic cases seemed to be possible by PCR restriction analysis using restriction enzyme Xcm I. PMID:9747031

Susa, S; Daimon, M; Yamamori, I; Kondo, M; Yamatani, K; Sasaki, H; Kato, T

1998-01-01

60

Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.  

PubMed

Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S

2003-01-21

61

Structural organization and evolution of the liver isoform gene for bovine cytochrome c oxidase subunit VIIa.  

PubMed

Subunit VIIa of mammalian cytochrome c oxidase is one of three nuclear-encoded subunits that exhibit isoforms, existing predominantly as an H-form in cardiac and skeletal muscle tissues and as an L-form in others. We have isolated and characterized the L-isoform gene (COX7aL). It is 5.4 kb long, consists of four exons, and is located at a CpG island. Sp1 sites and an NRF1 site are located in an approximately 100-bp region immediately upstream of the gene. Comparison of the sequence and organization with the previously described H-isoform gene shows identical intron-exon organizations, with the first intron of both isoform genes splitting the presequence coding region almost identically. These results suggest that the isoform genes arose by duplication from a common ancestor prior to the mammalian radiation and that the ancestor already contained the presequences. In addition, four processed pseudogenes of the L-type have been isolated and characterized, one of which (COX7aLP1) contains no deletions, insertions, or frame-shifts and can encode a precursor protein of 83 amino acids. Construction of a phylogenetic tree employing extant COX7aL cDNA and bovine pseudogene sequences suggests that the expressed bovine gene and COX7aLP1 arose from a gene duplication event 4.6-6.8 Mya. PMID:8307562

Seelan, R S; Grossman, L I

1993-12-01

62

Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks  

PubMed Central

Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

2009-01-01

63

Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.  

PubMed Central

Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M

1998-01-01

64

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings  

PubMed Central

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-?1, -?2, -?1, and -?, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-?1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-? 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

Jakubowicz, Ma?gorzata; Ga?ga?ska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

65

Identification of a p53-response element in the promoter of the proline oxidase gene  

SciTech Connect

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

Maxwell, Steve A. [Department of Molecular and Cellular Medicine, Room 252, College of Medicine, Texas A and M Health Science Center, College Station, TX 77843-1114 (United States)], E-mail: smaxwell@medicine.tamhsc.edu; Kochevar, Gerald J. [Department of Pathology and Laboratory Medicine, College of Medicine, Texas A and M Health Science Center, College Station, TX 77843-1114 (United States)

2008-05-02

66

Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.  

PubMed

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression. PMID:24594397

Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

2014-03-15

67

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion  

PubMed Central

Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on primary sequence data. The dynamic nature of this gene family differentiates PPO from other oxidative enzymes, and is consistent with a protein important for a diversity of functions relating to environmental adaptation. PMID:22897796

2012-01-01

68

Association Study of a Monoamine Oxidase A Gene Promoter Polymorphism with Major Depressive Disorder and Antidepressant Response  

Microsoft Academic Search

Monoamine oxidase A (MAOA), a mitochondrial enzyme involved in the degradation of biogenic amines, may be implicated in the pathogenesis of major depressive disorder (MDD) and be related to the therapeutic effects of antidepressants. To elucidate a genetic predisposition of MDD, we studied a variable-number-tandem-repeat (VNTR) polymorphism in the promoter region of the MAOA gene in a Chinese population of

Younger W-Y Yu; Shih-Jen Tsai; Chen-Jee Hong; Tai-Jui Chen; Ming-Chao Chen; Chih-Wei Yang; T-J Chen

2005-01-01

69

Description of the Cytochrome c Oxidase Subunit II Gene in Some Genera of New World Monkeys (Primates, Platyrrhini)  

Microsoft Academic Search

Nucleotide sequence variation at the mitochondrial cytochrome c oxidase subunit II gene (COII) was analyzed in 27 New World monkey specimens, nine newly reported herein. The study involved comparisons among platyrrhines and also between platyrrhines and catarrhines. The analysis of the frequencies of transitions and transversions at each codon position showed transitional saturation at third codon position. Neighbor-Joining trees obtained

Marina S. Ascunce; Esteban Hasson; Marta D. Mudry

2002-01-01

70

Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A  

SciTech Connect

Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

Brunner, H.G. (Univ. Hospital, Nijmegan (Netherlands)); Nelen, M.; Ropers, H.H.; van Oost, B.A. (Univ. Hospital Nijmegen (Netherlands))

1993-10-22

71

A novel missense mutation in exon 4 of the human coproporphyrinogen oxidase gene in two patients with hereditary coproporphyria  

Microsoft Academic Search

Hereditary coproporphyria (HCP) is an autosomal dominant disease characterized by a deficiency of coproporphyrinogen oxidase.\\u000a To date, four mutations of the gene have been reported. We report here another mutation in two Japanese families with HCP,\\u000a which was revealed by analysis of polymerase chain reaction (PCR)-amplified DNA fragments of the gene by a direct-sequencing\\u000a method. A point mutation, G to

Makoto Daimon; Eishirou Gojyou; Makoto Sugawara; Keiichi Yamatani; Makoto Tominaga; Hideo Sasaki

1997-01-01

72

Genetic mapping of tyramine oxidase and arylsulfatase genes and their regulation in intergeneric hybrids of enteric bacteria.  

PubMed Central

The genes for arylsulfatase (atsA) and tyramine oxidase (tynA) have been mapped in Klebsiella aerogenes by P1 transduction. They are linked to gdhD and trp in the order atsA-tynA-gdhD-trp-pyrF. Complementation analysis using F' episomes from Escherichia coli suggested an analogous location of these genes in E. coli, although arylsulfatase activity was not detected in E. coli. P1 phage and F' episomes were used to create intergeneric hybrid strains of enteric bacteria by transfer of the ats and tyn genes between K. aerogenes, E. coli, and Salmonella typhimurium. Intergeneric transduction of the tynK gene from K. aerogenes to an E. coli restrictionless strain was one to two orders less frequent than that of the leuK gene. The tyramine oxidase of E. coli and S. typhimurium in regulatory activity resemble very closely the enzyme of K. aerogenes. The atsE gene from E. coli was expressed, and latent arylsulfatase protein was formed in K. aerogenes and S typhimurium. The results of tyramine oxidase and arylsulfatase synthesis in intergeneric hybrids of enteric bacteria suggest that the system for regulation of enzyme synthesis is conserved more than the structure or function of enzyme protein during evolution. Images PMID:361719

Murooka, Y; Higashiura, T; Harada, T

1978-01-01

73

Genetic mapping of tyramine oxidase and arylsulfatase genes and their regulation in intergeneric hybrids of enteric bacteria.  

PubMed

The genes for arylsulfatase (atsA) and tyramine oxidase (tynA) have been mapped in Klebsiella aerogenes by P1 transduction. They are linked to gdhD and trp in the order atsA-tynA-gdhD-trp-pyrF. Complementation analysis using F' episomes from Escherichia coli suggested an analogous location of these genes in E. coli, although arylsulfatase activity was not detected in E. coli. P1 phage and F' episomes were used to create intergeneric hybrid strains of enteric bacteria by transfer of the ats and tyn genes between K. aerogenes, E. coli, and Salmonella typhimurium. Intergeneric transduction of the tynK gene from K. aerogenes to an E. coli restrictionless strain was one to two orders less frequent than that of the leuK gene. The tyramine oxidase of E. coli and S. typhimurium in regulatory activity resemble very closely the enzyme of K. aerogenes. The atsE gene from E. coli was expressed, and latent arylsulfatase protein was formed in K. aerogenes and S typhimurium. The results of tyramine oxidase and arylsulfatase synthesis in intergeneric hybrids of enteric bacteria suggest that the system for regulation of enzyme synthesis is conserved more than the structure or function of enzyme protein during evolution. PMID:361719

Murooka, Y; Higashiura, T; Harada, T

1978-11-01

74

Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover ( Trifolium pratense L.).  

PubMed

Polyphenol oxidase (PPO) genes and their corresponding enzyme activities occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activities in Arabidopsis and five legumes were compared with those of high-PPO red clover ( Trifolium pratense L.). Red clover PPO enzyme activity decreased leaves > stem > nodules > peduncle = petiole > embryo; PPO1 and PPO4 genes were expressed early in leaf emergence, whereas PPO4 and PPO5 predominated in mature leaves. PPO1 was expressed in embryos and nodules. PPO substrates, phaselic acid and clovamide, were detected in leaves, and clovamide was detected in nodules. Phaselic acid and clovamide, along with caffeic and chlorogenic acids, were suitable substrates for PPO1, PPO4, and PPO5 genes expressed in alfalfa ( Medicago sativa L.) leaves. PPO enzyme presence and activity were colocalized in leaves and nodules by cytochemistry. Substrates and PPO activity were localized in developing squashed cell layer of nodules, suggesting PPO may have a developmental role in nodules. PMID:23790148

Webb, K Judith; Cookson, Alan; Allison, Gordon; Sullivan, Michael L; Winters, Ana L

2013-08-01

75

Molecular cloning, expression profiles, and characterization of a novel polyphenol oxidase (PPO) gene in Hevea brasiliensis.  

PubMed

The polyphenol oxidase (PPO) is involved in undesirable browning in many plant foods. Although the PPOs have been studied by several researchers, the isolation and expression profiles of PPO gene were not reported in rubber tree. In this study, a new PPO gene, HbPPO, was isolated from Hevea brasiliensis. The sequence alignment showed that HbPPO indicated high identities to plant PPOs and belonged to dicot branch. The cis-acting regulatory elements related to stress/hormone responses were predicted in the promoter region of HbPPO. Real-time RT-PCR analyses showed that HbPPO expression varied widely depending on different tissues and developmental stages of leaves. Besides being associated with tapping panel dryness, the HbPPO transcripts were regulated by ethrel, wounding, H2O2, and methyl jasmonate treatments. Moreover, the correlation between latex coagulation rate and PPO activity was further confirmed in this study. Our results lay the foundation for further analyzing the function of HbPPO in rubber tree. PMID:25051980

Li, Dejun; Deng, Zhi; Liu, Changren; Zhao, Manman; Guo, Huina; Xia, Zhihui; Liu, Hui

2014-10-01

76

The Pea Gene NA Encodes ent-Kaurenoic Acid Oxidase1  

PubMed Central

The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA12 when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7?-hydroxykaurenoic acid and GA12-aldehyde, some additional products of the pea KAO activity were detected, including ent-6?,7?-dihydroxykaurenoic acid and 7?-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants. PMID:12529541

Davidson, Sandra E.; Elliott, Robert C.; Helliwell, Chris A.; Poole, Andrew T.; Reid, James B.

2003-01-01

77

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.  

PubMed

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS. PMID:24173666

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

78

Systematic analysis of coproporphyrinogen oxidase gene defects in hereditary coproporphyria and mutation update.  

PubMed

Hereditary coproporphyria (HC) is an acute hepatic porphyria with autosomal dominant inheritance caused by deficient activity of coproporphyrinogen III oxidase (CPO). Clinical manifestations of the disease are characterized by acute attacks of neurological dysfunction often precipitated by drugs, fasting, cyclical hormonal changes, or infectious diseases. Skin photosensitivity may also be present. The seven exons, the exon/intron boundaries and part of 3' noncoding sequence of the CPO gene were systematically analyzed by an exon-by-exon denaturing gradient gel electrophoresis (DGGE) strategy followed by direct sequencing in seven unrelated heterozygous HC patients from France, Holland, and Czech Republic. Seven novel mutations and two new polymorphisms were detected. Among these mutations: two are missense (G197W, W427R), two are nonsense (Q306X, Q385X), two are small deletions (662de14bp; 1168del3bp removing a glycine at position 390), and one is a splicing mutation (IVS1-15c-->g) which creates a new acceptor splice site. The pathological significance of the point mutations G197W, W427R, and the in-frame deletion 390delGly were assessed by their respective expression in a prokaryotic system using site-directed mutagenesis. These mutations resulted in the absence or a dramatic decrease of CPO activity. The two polymorphisms were localized in noncoding part of the gene: 1) a C/G polymorphism in the promotor region, 142 bp upstream from the transcriptional initiation site (-142C/G), and 2) a 6 bp deletion polymorphism in the 3' noncoding part of the CPO gene, 574 bp downstream of the last base of the normal termination codon (+574 delATTCTT). Five intragenic dimorphisms are now well characterized and the high degree of allelic heterogeneity in HC is demonstrated with seven new different mutations making a total of nineteen CPO gene defects reported so far. PMID:9888388

Rosipal, R; Lamoril, J; Puy, H; Da Silva, V; Gouya, L; De Rooij, F W; Te Velde, K; Nordmann, Y; Martàsek, P; Deybach, J C

1999-01-01

79

The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene.  

PubMed

The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

Clem, Stian A; Wu, Wenbi; Passarelli, A Lorena

2014-07-01

80

A monoamine-regulated Klebsiella aerogenes operon containing the monoamine oxidase structural gene (maoA) and the maoC gene.  

PubMed Central

The Klebsiella aerogenes gene maoA, which is involved in the synthesis of monoamine oxidase, was induced by tyramine and the related compounds, subjected to catabolite and ammonium ion repression, and cloned. The nucleotide sequence of the region involved in monoamine oxidase synthesis was determined. Two open reading frames, the maoA gene and a hitherto unknown gene (maoC), were found. These are located between a potential promoter sequence and a transcriptional terminator sequence. A region of the Escherichia coli chromosome that was highly homologous to the Klebsiella maoA gene was found. The potential maoA gene is located at 30.9 min on the E. coli chromosome. Analysis of the amino acid sequences of the first 11 amino acids from the N terminus of the purified monoamine oxidase agrees with those deduced from the nucleotide sequence of the maoA gene. The leader peptide extends over 30 amino acids and has the characteristics of a signal sequence. Primer extension and S1 nuclease mapping of transcripts generated in vivo suggests that the tyramine-induced mRNA starts at a site 62 bases upstream from the ATG initiation codon of the maoC gene. In the putative promoter region, a high degree of similarity to the consensus sequence for the binding site of cyclic AMP receptor protein was found. Thus, the mao region is composed of two cistrons, and the mao operon is regulated by monoamine compounds, glucose, and ammonium ions. Images PMID:1556068

Sugino, H; Sasaki, M; Azakami, H; Yamashita, M; Murooka, Y

1992-01-01

81

Association of a functional polymorphism of the monoamine oxidase A gene promoter with personality and psychiatric symptoms.  

PubMed

A functional polymorphism in the promoter of the monoamine oxidase gene has recently been described by Sabol et al. This polymorphism is a strong candidate for associations with personality traits and psychiatric symptoms. We report relevant data from a general population sample of 850 Caucasian Australians. We found no associations with anxiety and depression symptoms, with personality traits that predispose to anxiety (neuroticism, behavioral inhibition, negative affect) or to a personality trait related to antisocial behavior (psychoticism). PMID:10994647

Jorm, A F; Henderson, A S; Jacomb, P A; Christensen, H; Korten, A E; Rodgers, B; Tan, X; Easteal, S

2000-06-01

82

Cytochrome o (cyoABCDE) and d (cydAB) oxidase gene expression in Escherichia coli is regulated by oxygen, pH, and the fnr gene product  

SciTech Connect

The aerobic respiratory chain of Escherichia coli contains two terminal oxidases that catalyze the oxidation of ubiquinol-8 and the reduction of oxygen to water. They are the cytochrome o oxidase complex encoded by cyoABCDE and the cytochrome d oxidase complex encoded by cydAB. To determine how these genes are regulated in response to a variety of environmental stimuli, including oxygen, we examined their expression by using lacZ protein fusions in wild-type and fnr mutant strains of E. coli. Based on the pattern of anaerobic cydAB expression observed, we propose the existence of a second, as yet unidentified, regulatory element that must function either to activate cydAB expression as oxygen becomes limiting or to repress cydAB expression aerobically. Whereas cytochrome o oxidase encoded by cyoABCDE appears to be produced only under oxygen-rich growth conditions, in keeping with its biochemical properties, cytochrome d oxidase is expressed moderately aerobically and is elevated yet further when oxygen becomes limiting so that the organism can cope better under oxygen starvation conditions. We also examined cyoABCDE and cydAB expression in response to growth on alternative carbon compounds and to changes in the culture medium pH and osmolarity.

Cotter, P.A.; Gunsalus, R.P. (Univ. of California, Los Angeles (USA)); Chepuri, V.; Gennis, R.B. (Univ. of Illinois, Urbana (USA))

1990-11-01

83

Structural variation of the monoamine oxidase A gene promoter repeat polymorphism in nonhuman primates.  

PubMed

By conferring allele-specific transcriptional activity on the monoamine oxidase A (MAOA) gene in humans, length variation of a repetitive sequence [(variable number of tandem repeat (VNTR)] in the MAOA promoter influences a constellation of personality traits related to aggressive and antisocial behavior and increases the risk of neurodevelopmental and psychiatric disorders. Here, we have analyzed the presence and variability of this MAOA promoter repeat in several species of nonhuman primates. Sequence analysis of MAOA's transcriptional control region revealed the presence of the VNTR in chimpanzee (Pan troglodytes), bonobo (Pan paniscus), gorilla (Gorilla gorilla), orangutan (Pongo pygmaeus), rhesus macaque (Macaca mulatta) and Gelada baboon (Theropithecus gelada). The majority of P. troglodytes and P. paniscus showed a single repeat with a sequence identical to the VNTR sequence in humans. In contrast, analyses of the remaining species revealed shorter sequences similar to the first 18 bp of human VNTR. Compared with other nonhuman primates, the VNTR sequence of M. mulatta showed the highest length variability with allele frequencies of 35, 25 and 40% for the five, six and seven repeat variants, respectively. The extent of variability of the MAOA promoter repeat in both rhesus monkeys and humans supports the notion that there may be a relationship between functional MAOA expression and aggression-related traits in humans and rhesus macaque populations. PMID:16436187

Wendland, J R; Hampe, M; Newman, T K; Syagailo, Y; Meyer, J; Schempp, W; Timme, A; Suomi, S J; Lesch, K P

2006-02-01

84

The Multicopper Ferroxidase Hephaestin Enhances Intestinal Iron Absorption in Mice  

PubMed Central

Hephaestin is a vertebrate multicopper ferroxidase important for the transfer of dietary iron from intestinal cells to the blood. Hephaestin is mutated in the sex-linked anemia mouse, resulting in iron deficiency. However, sex-linked anemia mice still retain some hephaestin ferroxidase activity. They survive, breed, and their anemia improves with age. To gain a better understanding of the role of hephaestin in iron homeostasis, we used the Cre-lox system to generate knockout mouse models with whole body or intestine-specific (Villin promoter) ablation of hephaestin. Both types of mice were viable, indicating that hephaestin is not essential and that other mechanisms, multicopper ferroxidase-dependent or not, must compensate for hephaestin deficiency. The knockout strains, however, both developed a microcytic, hypochromic anemia, suggesting severe iron deficiency and confirming that hephaestin plays an important role in body iron acquisition. Consistent with this, the knockout mice accumulated iron in duodenal enterocytes and had reduced intestinal iron absorption. In addition, the similarities of the phenotypes of the whole body and intestine-specific hephaestin knockout mice clarify the important role of hephaestin specifically in intestinal enterocytes in maintaining whole body iron homeostasis. These mouse models will serve as valuable tools to study the role of hephaestin and associated proteins in iron transport in the small intestine and other tissues. PMID:24896847

Fuqua, Brie K.; Lu, Yan; Darshan, Deepak; Frazer, David M.; Wilkins, Sarah J.; Wolkow, Natalie; Bell, Austin G.; Hsu, JoAnn; Yu, Catherine C.; Chen, Huijun; Dunaief, Joshua L.; Anderson, Gregory J.; Vulpe, Chris D.

2014-01-01

85

Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy.  

PubMed

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

Bongers, Kale S; Fox, Daniel K; Kunkel, Steven D; Stebounova, Larissa V; Murry, Daryl J; Pufall, Miles A; Ebert, Scott M; Dyle, Michael C; Bullard, Steven A; Dierdorff, Jason M; Adams, Christopher M

2015-01-15

86

Coordination of cytochrome c oxidase gene expression in the remodelling of skeletal muscle.  

PubMed

Many fish species respond to low temperature by inducing mitochondrial biogenesis, reflected in an increase in activity of the mitochondrial enzyme cytochrome c oxidase (COX). COX is composed of 13 subunits, three encoded by mitochondrial (mt)DNA and 10 encoded by nuclear genes. We used real-time PCR to measure mRNA levels for the 10 nuclear-encoded genes that are highly expressed in muscle. We measured mRNA levels in white muscle of three minnow species, each at two temperatures: zebrafish (Danio rerio) acclimated to 11 and 30°C, goldfish (Carassius auratus) acclimated to 4 and 35°C, and northern redbelly dace (Chrosomus eos) collected in winter and summer. We hypothesized that temperature-induced changes in COX activity would be paralleled by COX nuclear-encoded subunit transcript abundance. However, we found mRNA for COX subunits showed pronounced differences in thermal responses. Though zebrafish COX activity did not change in the cold, the transcript levels of four subunits decreased significantly (COX5A1, 60% decrease; COX6A2, 70% decrease; COX6C, 50% decrease; COX7B, 55% decrease). Treatments induced changes in COX activity in both dace (2.9 times in winter fish) and goldfish (2.5 times in cold fish), but the response in transcript levels was highly variable. Some subunits failed to increase in one (goldfish COX7A2, dace COX6A2) or both (COX7B, COX6B2) species. Other transcripts increased 1.7-100 times. The most cold-responsive subunits were COX4-1 (7 and 21.3 times higher in dace and goldfish, respectively), COX5A1 (13.9 and 5 times higher), COX6B1 (6 and 10 times higher), COX6C (11 and 4 times higher) and COX7C (13.3 and 100 times higher). The subunits that most closely paralleled COX increases in the cold were COX5B2 (dace 2.5 times, goldfish 1.7 times) and COX6A2 (dace 4.1 times, goldfish 1.7 times). Collectively, these studies suggest that COX gene expression is not tightly coordinated during cold-induced mitochondrial remodelling in fish muscle. Further, they caution against arguments about the importance of transcriptional regulation based on measurement of mRNA levels of select subunits of multimeric proteins. PMID:21562175

Duggan, Ana T; Kocha, Katrinka M; Monk, Christopher T; Bremer, Katharina; Moyes, Christopher D

2011-06-01

87

Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population  

SciTech Connect

The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko [Ehime Univ. School of Medicine, Tokyo (Japan)] [and others

1995-12-18

88

DGGE analysis of the coproporphyrinogen oxidase gene: two new mutations in DNA from Danish patients with hereditary coproporphyria.  

PubMed

The knowledge of at least 21 different mutations and several polymorphisms in the coproporphyrinogen oxidase (CPO) gene demonstrates that the molecular basis of hereditary coproporphyria is heterogeneous. We developed a DGGE-based assay for the analysis of exons 2 to 7, including 14-96 nucleotides of the flanking intronic sequences of the CPO gene. To render it suitable for the clinical diagnostic laboratory, we designed the assay to allow use of identical PCR conditions and the same DGGE gel for analyses of all the regions. Using this assay, and subsequent sequencing of gene regions containing interallelic variations, two novel mutations in the CPO gene were identified: a missense mutation (607G-->A), leading to the substitution of an alanine with a threonine, and a nonsense mutation (1281G-->A), giving rise to a stop codon 28 codons upstream to the wild-type stop codon. PMID:11202054

Petersen, N E; Käehne, M; Christiansen, L; Brock, A; Hother-Nielsen, O; Rasmussen, K

2000-11-01

89

Alternative splicing and differential expression of two transcripts of nicotine adenine dinucleotide phosphate oxidase B gene from Zea mays.  

PubMed

With the exception of rice, little is known about the existence of respiratory burst oxidase homolog (rboh) gene in cereals. The present study reports the cloning and analysis of a novel rboh gene, termed ZmrbohB, from maize (Zea mays L.). The full-length cDNA of ZmrbohB encodes a 942 amino acid protein containing all of the respiratory burst oxidase homolog catalytically critical motifs. Alternative splicing of ZmrbohB has generated two transcript isoforms, ZmrbohB-alpha and -beta. Spliced transcript ZmrbohB-beta retains an unspliced intron 11 that carries a premature termination codon and probably leads to nonsense-mediated mRNA decay. Expression analysis showed that two splice isoforms were differentially expressed in various tissues and at different developmental stages, and the major product was ZmrbohB-alpha. The transcripts of ZmrbohB-alpha accumulated markedly when the maize seedlings were subjected to various abiotic stimuli, such as wounding, cold (4 degrees C), heat (40 degrees C), UV and salinity stress. In addition, several abiotic stimuli also affected the alternative splicing pattern of ZmrbohB except wounding. These results provide new insight into roles in the expression regulation of plant rboh genes and suggest that ZmrbohB gene may play a role in response to environmental stresses. PMID:19261072

Lin, Fan; Zhang, Yun; Jiang, Ming-Yi

2009-03-01

90

Changes in GA 20-oxidase gene expression strongly affect stem length, tuber induction and tuber yield of potato plants.  

PubMed

Gene StGA20ox1 encoding potato GA 20-oxidase is expressed to relatively high levels in leaves and regulated by daylength. To investigate whether this gene is involved in photoperiodic regulation of tuber formation, we have obtained transgenic potato plants expressing sense and antisense copies of the StGA20ox1 cDNA. Over-expression of this cDNA resulted in taller plants that required a longer duration of a short day photoperiod (SD) to tuberize. Tubers from these plants had a decreased time of dormancy and developed sprouts with elongated internodes. Plants expressing antisense copies of the StGA20ox1 cDNA had shorter stems, a decreased length of the internodes and tuberized earlier than control plants, showing increased tuber yields. Antisense inhibition of this gene had no visible effect on the time of dormancy of the tubers, although at the end of dormancy these formed sprouts with shortened internodes. Decreased levels of endogenous GA20 and GA1 were detected in the apex and first leaves of the antisense lines. These results demonstrate the involvement of the GA 20-oxidase activity encoded by StGA20ox1 in the control of stem elongation and in tuber induction but not in tuber dormancy, indicating that the latter may be regulated by another member of the gene family. PMID:10849342

Carrera, E; Bou, J; García-Martínez, J L; Prat, S

2000-05-01

91

Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1  

PubMed Central

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the ?-glucuronidase (GUS) gene. In a transient expression system, ?-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

1999-01-01

92

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review  

PubMed Central

Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

Buades-Rotger, Macià; Gallardo-Pujol, David

2014-01-01

93

Hereditary Coproporphyria Associated with the Q306X Mutation in the Coproporphyrin Oxidase Gene Presenting with Acute Ataxia  

PubMed Central

Background Hereditary coproporphyria (HCPO) is a low-penetrance, autosomal dominant, acute hepatic porphyria characterized by the overproduction and excretion of coproporphyrin. The most common neurological manifestations of this entity include peripheral, predominantly motor dysfunction, and central nervous system dysfunction. Ataxia associated with HCPO has not been reported previously. The aim of this article is to report a patient with HCPO presenting with acute ataxia. Case Report We describe a 44-year-old patient presenting clinically with acute ataxia who was diagnosed with HCPO; mutations were analyzed in the coproporphyrin-oxidase III (CPOX) gene in the patient and in six asymptomatic first-degree relatives. Discussion The patient was heterozygous for a mutation causing the amino acid exchange Q306X in the CPOX gene. No relatives carried the same or another mutation in the CPOX gene. HCPO should be considered in the differential diagnosis for patients presenting with ataxia. PMID:24156084

Jiménez-Jiménez, Félix Javier; Agúndez, José A. G.; Martínez, Carmen; Navacerrada, Francisco; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Alonso-Navarro, Hortensia; García-Martín, Elena

2013-01-01

94

maoB, a gene that encodes a positive regulator of the monoamine oxidase gene (maoA) in Escherichia coli.  

PubMed Central

The structural gene for copper- and topa quinone-containing monoamine oxidase (maoA) and an unknown amine oxidase gene have been located at 30.9 min on the Escherichia coli chromosome. Deletion analysis showed that the unknown gene was located within a 1.1-kb cloned fragment adjacent to the maoA gene. The nucleotide sequence of this fragment was determined, and a single open reading frame (maoB) consisting of 903 bp was found. The gene encoded a polypeptide with a predicted molecular mass of 34,619 Da which was correlated with the migration on a sodium dodecyl sulfate-polyacrylamide gel. The predicted amino acid sequence of the MaoB protein was identical to the NH2-terminal amino acid sequence derived by Edman degradation of the protein synthesized under the self-promoter. No homology of the nucleotide sequence of maoB to the sequences of any reported genes was found. However, the amino acid sequence of MaoB showed a high level of homology with respect to the helix-turn-helix motif of the AraC family in its C terminus. The homology search and disruption of maoA on the chromosome led to the conclusion that MaoB is a transcriptional activator of maoA but not an amine oxidase. The consensus sequence of the cyclic AMP-cyclic AMP receptor protein complex binding domain was adjacent to the putative promoter for the maoB gene. By use of lac gene fusions with the maoA and maoB genes, we showed that the maoA gene is regulated by tyramine and MaoB and that the expression of the maoB gene is subject to catabolite repression. Thus, it seems likely that tyramine and the MaoB protein activate the transcription of maoA by binding to the regulatory region of the maoA gene. PMID:8631685

Yamashita, M; Azakami, H; Yokoro, N; Roh, J H; Suzuki, H; Kumagai, H; Murooka, Y

1996-01-01

95

Species differences in the temporal pattern of Drosophila urate oxidase gene expression are attributed to trans-acting regulatory changes.  

PubMed Central

The Drosophila melanogaster urate oxidase (UO)-encoding gene is expressed in the third-instar larva and adult. In contrast, the Drosophila pseudoobscura UO gene is only expressed in the adult, whereas the Drosophila virilis UO gene is expressed only in the third-instar larva. UO activity in these three Drosophila species is detected exclusively within the Malpighian tubules. By using P-element mediated germ-line transformation, UO genes from D. pseudoobscura and D. virilis were integrated into the D. melanogaster genome. The D. virilis and D. pseudoobscura UO transgenes were expressed in the third-instar larva and adult Malpighian tubules, which is the D. melanogaster temporal pattern of UO gene expression. These observations indicate that differences in the temporal patterns of regulation of UO genes among these three Drosophila species are not likely to be due to evolutionary changes in the sequence or complement of UO cis-acting regulatory elements. The species differences in UO regulation are probably the result of changes in one or more trans-acting factors required for UO gene expression in the third-instar larval and adult stages. Images PMID:2062830

Wallrath, L L; Friedman, T B

1991-01-01

96

Location of chlorogenic acid biosynthesis pathway and polyphenol oxidase genes in a new interspecific anchored linkage map of eggplant.  

PubMed

BackgroundEggplant is a powerful source of polyphenols which seems to play a key role in the prevention of several human diseases, such as cancer and diabetes. Chlorogenic acid is the polyphenol most present in eggplant, comprising between the 70% and 90% of the total polyphenol content. Introduction of the high chlorogenic acid content of wild relatives, such as S. incanum, into eggplant varieties will be of great interest. A potential side effect of the increased level polyphenols could be a decrease on apparent quality due to browning caused by the polyphenol oxidase enzymes mediated oxidation of polyphenols. We report the development of a new interspecific S. melongena¿×¿S. incanum linkage map based on a first backcross generation (BC1) towards the cultivated S. melongena as a tool for introgressing S. incanum alleles involved in the biosynthesis of chlorogenic acid in the genetic background of S. melongena. ResultsThe interspecific genetic linkage map of eggplant developed in this work anchor the most informative previously published genetic maps of eggplant using common markers. The 91 BC1 plants of the mapping population were genotyped with 42 COSII, 99 SSRs, 88 AFLPs, 9 CAPS, 4 SNPs and one morphological polymorphic markers. Segregation marker data resulted in a map encompassing 1085 cM distributed in 12 linkage groups. Based on the syntheny with tomato, the candidate genes involved in the core chlorogenic acid synthesis pathway in eggplant (PAL, C4H, 4CL, HCT, C3¿H, HQT) as well as five polyphenol oxidase (PPO1, PPO2, PPO3, PPO4, PPO5) were mapped. Except for 4CL and HCT chlorogenic acid genes were not linked. On the contrary, all PPO genes clustered together. Candidate genes important in domestication such as fruit shape (OVATE, SISUN1) and prickliness were also located.ConclusionsThe achievements in location of candidate genes will allow the search of favorable alleles employing marker-assisted selection in order to develop new varieties with higher chlorogenic content alongside a lower polyphenol oxidase activity. This will result into an enhanced product showing a lower fruit flesh browning with improved human health properties. PMID:25491265

Gramazio, Pietro; Prohens, Jaime; Plazas, Mariola; Andújar, Isabel; Herraiz, Francisco; Castillo, Elena; Knapp, Sandra; Meyer, Rachel S; Vilanova, Santiago

2014-12-10

97

Introduction and expression of the Streptomyces cholesterol oxidase gene ( ChoA ), a potent insecticidal protein active against boll weevil larvae, into tobacco cells  

Microsoft Academic Search

We succeeded expressing the streptomyces cholesterol oxidase gene (choA), a potent insecticidal protein active against boll weevil larvae, in tobacco cells. A plasmid, pBC4, containing the choA gene under the control of the 35S promoter of cauliflower mosaic virus, was introduced into tobacco cells (BY-2) using a pneumatic particle gun. Stable integration of the choA gene in the genome of

H.-J. Cho; K.-P. Choi; M. Yamashita; H. Morikawa; Y. Murooka

1995-01-01

98

Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder  

SciTech Connect

We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

Lim, L.C.C.; Sham, P.; Castle, D. [Institute of Psychiatry, London (United Kingdom)] [and others

1995-08-14

99

Intragenic deletion in the gene encoding L-gulonolactone oxidase causes vitamin C deficiency in pigs  

Microsoft Academic Search

The absence of L-ascorbic acid (L-AA, or AA) synthesis in scurvy-prone organisms, including humans, other primates, guinea pigs, and flying mammals, was traced to the lack of L-gulonolactone oxidase (GULO) activity. GULO is a microsomal enzyme that catalyzes the terminal step in the biosynthesis of L-AA. Clinical cases of scurvy were described in a family of Danish pigs. This trait

Lara Hasan; Peter Vögeli; Peter Stoll; Špela Špilar Gerald KramerStranzinger; Stefan Neuenschwander

2004-01-01

100

Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission  

PubMed Central

Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei

2014-01-01

101

Evolutionary dynamics of the human NADPH oxidase genes CYBB, CYBA, NCF2, and NCF4: functional implications.  

PubMed

The phagocyte NADPH oxidase catalyzes the reduction of O2 to reactive oxygen species with microbicidal activity. It is composed of two membrane-spanning subunits, gp91-phox and p22-phox (encoded by CYBB and CYBA, respectively), and three cytoplasmic subunits, p40-phox, p47-phox, and p67-phox (encoded by NCF4, NCF1, and NCF2, respectively). Mutations in any of these genes can result in chronic granulomatous disease, a primary immunodeficiency characterized by recurrent infections. Using evolutionary mapping, we determined that episodes of adaptive natural selection have shaped the extracellular portion of gp91-phox during the evolution of mammals, which suggests that this region may have a function in host-pathogen interactions. On the basis of a resequencing analysis of approximately 35 kb of CYBB, CYBA, NCF2, and NCF4 in 102 ethnically diverse individuals (24 of African ancestry, 31 of European ancestry, 24 of Asian/Oceanians, and 23 US Hispanics), we show that the pattern of CYBA diversity is compatible with balancing natural selection, perhaps mediated by catalase-positive pathogens. NCF2 in Asian populations shows a pattern of diversity characterized by a differentiated haplotype structure. Our study provides insight into the role of pathogen-driven natural selection in an innate immune pathway and sheds light on the role of CYBA in endothelial, nonphagocytic NADPH oxidases, which are relevant in the pathogenesis of cardiovascular and other complex diseases. PMID:23821607

Tarazona-Santos, Eduardo; Machado, Moara; Magalhães, Wagner C S; Chen, Renee; Lyon, Fernanda; Burdett, Laurie; Crenshaw, Andrew; Fabbri, Cristina; Pereira, Latife; Pinto, Laelia; Redondo, Rodrigo A F; Sestanovich, Ben; Yeager, Meredith; Chanock, Stephen J

2013-09-01

102

THE ISOAMYL OXIDASE GENE IN PENICILLIUM GRISEOFULVUM IS PART OF THE PATULIN BIOSYNTHETIC PATHWAY  

Technology Transfer Automated Retrieval System (TEKTRAN)

Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

103

Diphenyleneiodonium chloride, an inhibitor of reduced nicotinamide adenine dinucleotide phosphate oxidase, suppresses light-dependent induction of clock and DNA repair genes in zebrafish.  

PubMed

In most species, solar light is both a DNA-damaging agent and the key entraining stimulus for the endogenous circadian clock. The zebrafish is an attractive vertebrate system in which to study the influence of light on gene expression because the DNA repair proteins and circadian oscillators in this species are light-responsive. At the molecular level, light treatment of zebrafish cells induces the production of reactive oxygen species (ROS). ROS both alters the reduction-oxidation (redox) state of these cells and stimulates intracellular extracellular signal-regulated kinase (ERK)/mitogen activated protein kinase (MAPK) cascades that transduce photic signals activating the transcription of particular light-responsive genes, including some clock genes and some DNA repair genes involved in photoreactivation. To date, however, the phototransducing molecules responsible for light-dependent ROS production have not been identified. Flavin-containing oxidases, such as reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, are versatile flavoenzymes that catalyze molecular oxidation in numerous metabolic pathways. Importantly, light induces the photoreduction of the flavin adenine dinucleotide (FAD) moiety in these oxidases, leading to ROS production. Here, we show in cultured zebrafish cells that diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase, both suppresses ERK/MAPK activation and efficiently reduces light-dependent expression of clock and photoreactivation genes. Our results suggest that flavin-containing oxidases may be responsible for light-dependent ROS production and thus light-dependent gene expression in zebrafish. Our findings also support the existence of a regulatory link between photoreactivation and the circadian clock in this species. PMID:21804230

Osaki, Tomomi; Uchida, Yoshimi; Hirayama, Jun; Nishina, Hiroshi

2011-01-01

104

Isolation and characterization of the human aldehyde oxidase gene: conservation of intron/exon boundaries with the xanthine oxidoreductase gene indicates a common origin.  

PubMed Central

Aldehyde oxidase (AO) is a molybdo-flavo enzyme involved in the metabolism of various endogenous and exogenous N-heterocyclic compounds of pharmacological and toxicological importance. The enzyme is the product of a gene which is implicated in the aetio-pathogenesis of familial recessive amyotrophic lateral sclerosis. Here, we report the cloning and structural characterization of the human AO gene. AO is a single copy gene approximately 85 kb long with 35 transcribed exons. The transcription-initiation site and the sequence of the 5'-flanking region, containing several putative regulatory elements, were determined. The 5'-flanking region contains a functional promoter, as assessed by appropriate reporter constructs in transient transfection experiments. Comparison of the AO gene structure shows conservation of the position and type of exon/intron junctions relative to those observed in the gene coding for another molybdo-flavoprotein, i.e. xanthine oxidoreductase (XOR). As the two genes code for proteins with a high level of amino acid identity, our results strongly suggest that the AO and XOR genetic loci arose as the consequence of a duplication event. Southern blot analysis conducted on genomic DNA from various animal species with specific cDNA probes indicates that the AO gene is less conserved than the XOR gene during evolution. PMID:9601067

Terao, M; Kurosaki, M; Demontis, S; Zanotta, S; Garattini, E

1998-01-01

105

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs  

PubMed Central

Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes contributed to browning reactions in tuber tissues but their effect was not equal. Different PPO genes may be regulated independently reflecting their diversified functions. Our results show that amiRNAs can be used to suppress closely related members of highly conserved multi-gene family. This approach also suggests a new strategy for breeding low-browning crops using small DNA inserts. PMID:24618103

2014-01-01

106

Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).  

PubMed

Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

Wang, Wei; Liu, Ji-Hong

2015-01-25

107

The role of the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of COX (cytochrome c oxidase) I and COX III mRNA.  

PubMed

Leigh syndrome French Canadian (LSFC) is a variant of cytochrome oxidase deficiency found in Québec and caused by mutations in the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene. Northern blots showed that the LRPPRC mRNA levels seen in skeletal muscle>heart>placenta>kidney>liver>lung=brain were proportionally almost opposite in strength to the severity of the enzymic cytochrome oxidase defect. The levels of COX (cytochrome c oxidase) I and COX III mRNA visible on Northern blots were reduced in LSFC patients due to the common (A354V, Ala354-->Val) founder mutation. The amount of LRPPRC protein found in both fibroblast and liver mitochondria from LSFC patients was consistently reduced to <30% of control levels. Import of [(35)S]methionine LRPPRC into rat liver mitochondria was slower for the mutant (A354V) protein. A titre of LRPPRC protein was also found in nuclear fractions that could not be easily accounted for by mitochondrial contamination. [35S]Methionine labelling of mitochondrial translation products showed that the translation of COX I, and perhaps COX III, was specifically reduced in the presence of the mutation. These results suggest that the gene product of LRPPRC, like PET 309p, has a role in the translation or stability of the mRNA for mitochondrially encoded COX subunits. A more diffuse distribution of LRPPRC in LSFC cells compared with controls was evident when viewed by immunofluorescence microscopy, with less LRPPRC present in peripheral mitochondria. PMID:15139850

Xu, Fenghao; Morin, Charles; Mitchell, Grant; Ackerley, Cameron; Robinson, Brian H

2004-08-15

108

Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome c oxidase subunit I gene.  

PubMed

Coccidian parasites in the genus Sarcocystis have a two-host life cycle, and have traditionally been identified on the basis of morphological features of the sarcocyst stage in their intermediate hosts. Additional molecular species identification, delimitation and phylogeny of Sarcocystis spp. have been based mainly on the nuclear ssrRNA gene. This gene is well suited for discrimination between more distant species but less so for closely related species. The objective of this study was therefore to establish the mitochondrial cytochrome c oxidase subunit I gene (cox1) as a novel genetic marker for Sarcocystis spp. and assess its utility for species identification and delimitation. New primers were developed and 1,020-1,095 bp long cox1 sequences were obtained from 155 isolates of 22 Sarcocystis spp. from cattle, sheep, red deer, reindeer, roe deer and moose, and used for phylogenetic reconstructions. For 18 species, the intraspecific and interspecific sequence identities were 98.5-100% and 58-92%, respectively. The four other species had previously been regarded as two species (Sarcocystis rangiferi, Sarcocystis tarandi), each infecting both reindeer and red deer. From cox1 data, each of those appeared to be two separate species, with S. rangiferi and S. tarandi being restricted to reindeer. Thus, cox1 sequences seem to perform better than ssrRNA gene sequences for delimitation of closely related species. The 22 species were distributed in three major clades according to their definitive hosts as in phylogenetic trees obtained from the ssrRNA gene. There were only minor differences in the branching order of different taxa between the trees obtained from either gene. This study has successfully established cox1 as a novel genetic marker for future research on Sarcocystis spp. It has also provided the first published molecular identification of Sarcocystis gigantea and Sarcocystis tenella in Norwegian sheep, and of Sarcocystis hirsuta and Sarcocystis sinensis in Argentinean cattle. PMID:23542092

Gjerde, Bjørn

2013-06-01

109

A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor  

PubMed Central

Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

2013-01-01

110

[Polymorphisms of catechol-O-methyltransferase and monoamine oxidase B genes among Chinese patients with Parkinson's disease].  

PubMed

OBJECTIVE To study polymorphisms of catechol-O-methyltransferase (COMT) and monoamine oxidase B (MAO-B) genes among Chinese patients with Parkinson's disease. METHODS Genotypes of the COMT and MAO-B genes of 1408 patients with Parkinson's disease was sequenced using Sanger method. And these patients were recruited by Chinese Parkinson Study Group from 29 research centers throughout the country. RESULTS The genotypic frequencies of COMT rs4680 AA, AG, GG were 8.9%, 42.0% and 49.1%. Those of rs4818 CC, CG, GG were 42.5%, 45.6% and 11.9%, respectively. The genotype frequencies of MAO-B rs1799836 A/AA, AG, G/GG were 74.4%, 14.1% and 11.5%, respectively. The haplotype formed by COMT rs4680 (GG) and MAO-B rs1799836 (A/AA) genotype has a frequency of 36.86%. CONCLUSION Polymorphisms of COMT and MAO-B genes has a unique characteristics among Chinese patients with Parkinson's disease. They may be related with differences in drug response in such patients. PMID:25636089

Hao, Hongying; Shao, Ming; An, Jing; Chen, Chushuang; Feng, Xiuli; Xie, Shu; Gu, Zhuqin; Chen, Biao

2015-02-10

111

SURFEIT-1 gene analysis and two-dimensional blue native gel electrophoresis in cytochrome c oxidase deficiency.  

PubMed

Leigh syndrome, a progressive, often fatal, neurodegenerative disorder, is frequently associated with a deficiency in the activity of cytochrome c oxidase (COX), the last enzyme of the mitochondrial respiratory chain. In contrast to NADH:ubiquinone oxidoreductase and succinate dehydrogenase deficiencies, no mutations in nuclear genes encoding COX subunits have been identified thus far. Very recently, however, a Leigh syndrome complementation group has been identified which showed mutations in the SURFEIT-1 (SURF-1) gene. The results of a mutational detection study in 16 new randomly selected COX-deficient patients revealed a new mutation (C688T) in 2 patients and the earlier reported 845delCT mutation in 2 additional patients. In addition, we evaluated the diagnostic value of two-dimensional blue native gel electrophoresis. We show that this technique reveals distinct patterns of both fully and partially assembled COX complexes and is thereby capable of discrimination between COX-deficient SURF-1 and non-SURF-1-mutated patients. PMID:10558868

Coenen, M J; van den Heuvel, L P; Nijtmans, L G; Morava, E; Marquardt, I; Girschick, H J; Trijbels, F J; Grivell, L A; Smeitink, J A

1999-11-19

112

Population genetic structure of the melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae) based on mitochondrial cytochrome oxidase (COI) gene sequences.  

PubMed

Population genetic structure of melon fly analysed with mitochondrial cytochrome oxidase I gene suggested that melon fly populations across the globe is homogeneous with non-significant variation of 0.000-0.003 base substitutions per site. Test isolates representing various geographic situations across the world were placed in 26 mitochondrial haplotypes based on variations associated with a maximum of three mutational steps and the predominant haplotype i.e. H1 was present in all melon fly populations except Hawaiian population. Evolution of mtCOI gene suggested that the fly could have originated some 0.4 million years ago. The present study also indicated that the B. cucurbitae population expansion is an event of post Pleistocene warm climatic conditions with small number of founder population. The invasion of B. cucurbitae in Hawaii was associated with the large population size and the global presence of the fly is associated with human mediated dispersal. The very low genetic variation suggested that the fly management might be possible by large scale sterile insect techniques programme. PMID:22660946

Prabhakar, Chandra S; Mehta, Pawan K; Sood, Pankaj; Singh, Sunil K; Sharma, Prachi; Sharma, Prem N

2012-03-01

113

Directional substitution and evolution of nucleotide content in the cytochrome oxidase II gene in earwigs (dermapteran insects).  

PubMed

The cytochrome oxidase subunit II (COII) gene was sequenced for six dermapteran species. The nucleotide composition of this gene is biased in most animals. While the CG content of other insect orders is low (mean, 27.6%; range, 19.5%-33.1%), species from the Forficula genus showed unusually high values (mean, 42.4%; range, 37.3%-44.1%), mostly due to high CG frequencies at third codon positions: the mean CG content at these positions was around 45% (range, 43.9%-46.9%) for Forficula, compared with only 13.3% for other insects. This effect was so strong that in one species, Forficula lesnei, there was no significant difference between the frequencies of the four bases. During evolution, this loss of bias has involved a significant increase in the synonymous substitution rate and an increase of transitions over transversions compared with other insects. A strong directionality of substitutions has favored T-->C and A-->G changes. This phenomenon was also observed between two conspecific populations of Forficula auricularia. A species from a closely related genus, Anechura bipunctata, was intermediate between Forficula and other insects for these parameters, while two remotely related dermapteran species, Labidura riparia and Euborellia moesta, were similar to other insects. These results suggest that the evolution of Forficula DNA content has been both rapid and recent. PMID:10605107

Wirth, T; Le Guellec, R; Veuille, M

1999-12-01

114

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.  

PubMed

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 ?g/L) in neutral or alkaline springs than in acidic springs (on average 30.88 ?g/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

115

Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity  

PubMed Central

Purpose Keratoconus (KC) is characterized by progressive vision loss due to corneal thinning and structural abnormalities. It is hypothesized that KC is caused by deregulated collagen levels and collagen fibril-maturating enzyme lysyl oxidase (LOX). Further, it is currently not understood whether the gene expression deregulated by the corneal epithelium influences KC pathogenesis. We studied (i) the expressions of the LOX, collagen I (COL IA1), collagen IV (COL IVA1), MMP9, and IL6 genes in KC corneal epithelia, (ii) validated their expression levels in patient tissues, and (iii) correlated expression levels with KC disease severity. The primary goal of this study was to evaluate the importance of these genes in the progression of KC. Methods We analyzed the gene expression levels of the key proteins LOX, collagens (COL IA1 and COL IVA1), MMP9, and IL6 in debrided corneal epithelia from a large cohort of KC patients (90 eyes) and compared them to control patients (52 eyes) without KC. We measured the total LOX activity in the tears of KC patients compared to controls. We also correlated the protein expression levels of LOX and collagens by immunohistochemistry (IHC) in primary tissues from KC patients (27 eyes) undergoing keratoplasty compared to healthy donor corneas (15 eyes). Results We observed a significant reduction in LOX transcript levels in KC corneal epithelia, and LOX activity in KC tears correlated with disease severity. Collagen transcripts were also reduced in KC while MMP9 transcript levels were upregulated and correlated with disease severity. IL6 was moderately increased in KC patients. IHC demonstrated a reduction in the protein expression levels of LOX in the epithelium and collagen IV in the basement membrane of KC patients compared to healthy donor corneas. Conclusions The data demonstrates that the structural deformity of the KC cornea may be dependent on reduced expressions of collagens and LOX, as well as on MMP9 elevated by the corneal epithelium.

Shetty, Rohit; Sathyanarayanamoorthy, Arunapriya; Ramachandra, Reshma Airody; Arora, Vishal; Ghosh, Anuprita; Srivatsa, Purnima Raman; Pahuja, Natasha; Nuijts, Rudy M. M. A.; Sinha-Roy, Abhijit; Ghosh, Arkasubhra

2015-01-01

116

Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity  

PubMed Central

The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan

2013-01-01

117

Hodgkin-Reed-Sternberg cells in classical Hodgkin lymphoma show alterations of genes encoding the NADPH oxidase complex and impaired reactive oxygen species synthesis capacity.  

PubMed

The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

Giefing, Maciej; Winoto-Morbach, Supandi; Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan

2013-01-01

118

Dual gene defects involving delta-aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient.  

PubMed

Summary A Caucasian male had symptoms of acute porphyria, with increases in urinary delta-aminolaevulinic acid (ALA), porphobilinogen (PBG) and coproporphyrin that were consistent with hereditary coproporphyria (HCP). However, a greater than expected increase in ALA, compared with PBG, and a substantial increase in erythrocyte zinc protoporphyrin, suggested additional ALA dehydratase (ALAD) deficiency. Nucleotide sequence analysis of coproporphyrinogen oxidase (CPO) cDNA of the patient, but not of the parents, revealed a novel nucleotide transition G835-->C, resulting in an amino acid change, G279R. The mutant CPO protein expressed in Escherichia coli was unstable, and produced about 5% of activity compared with the wild-type CPO. Erythrocyte ALAD activity was 32% of normal in the proband. Nucleotide sequence analysis of cloned ALAD cDNAs from the patient revealed a C36-->G base transition (F12L amino acid change). The F12L ALAD mutation, which was found in the mother and a brother, was previously described, and is known to lack any enzyme activity. This patient thus represents the first case of porphyria where both CPO and ALAD deficiencies were demonstrated at the molecular level. PMID:16398658

Akagi, Reiko; Inoue, Rikako; Muranaka, Shikibu; Tahara, Tsuyoshi; Taketani, Shigeru; Anderson, Karl E; Phillips, John D; Sassa, Shigeru

2006-01-01

119

Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea  

PubMed Central

The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

2010-01-01

120

ACC oxidase (ACO) genes in Trifolium occidentale (L.) and their relationship to ACO genes in white clover (T. repens L.) and T. pallescens (L.).  

PubMed

The identification and expression of two ACC oxidase (ACO) genes during leaf development in Trifolium occidentale (L.), one of the putative ancestral genomes of the allotetraploid, T. repens (L.; white clover), is described. In common with observations made in T. repens, the ACO genes displayed differential expression, with a TR-ACO2-like gene (designated TO-ACO2) confined to developing and early mature-green leaf tissue while expression of a TR-ACO3-like gene (designated TO-ACO3) is highest in leaves at the onset and during senescence. Biochemical analysis of TO-ACO2 revealed that both accumulation of the protein (determined by western analysis with a TR-ACO2 antibody) and enzyme activity matched the transcriptional activity of TO-ACO2. Western analysis also revealed that the Tr-ACO2 antibody recognised a protein of 37 kDa as a putative TP-ACO2 in T. pallescens. The 3'-UTRs of TO-ACO2 and TO-ACO3 were then compared with the 3'-UTRs of a TR-ACO2-like and TR-ACO3-like gene from T. pallescens, the other proposed ancestral genome (or closely related to the ancestor) of T. repens, with identity values of 87.8% for the ACO2-like genes and 94.8% for the ACO3-like genes. Comparison of the 3'-UTRs of TO-ACO2 with a TO-ACO2-like gene in T. repens (designated TR(O)-ACO2) and TP-ACO2 with a TP-ACO2-like gene in T. repens (designated TR(P)-ACO2) revealed identities of 100% and 96.6%, respectively, lending good support to T. occidentale as one of the ancestral genomes of T. repens. A similar comparison of the 3'-UTRs of TO-ACO3 with a TO-ACO3-like gene in T. repens (designated TR(O)-ACO3) and TP-ACO3 with a TP-ACO3-like gene in T. repens (designated TR(P)-ACO3) revealed identities of 99.5% and 97.9%, respectively, again supporting T. occidentale as one of the ancestral genomes. Further, these data confirm that both TO-ACO-like and TP-ACO-like genes are expressed in the allotetraploid T. repens. PMID:21320784

Du, Zhenning; Leung, Susanna; Dorling, Sarah J; McManus, Michael T

2011-04-01

121

CYP99A3: functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice.  

PubMed

Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochrome P450 (CYP) mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNA interference double knock-down of this pair of closely related CYPs reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which was ultimately achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al, and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-?-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al, and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene-derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

Wang, Qiang; Hillwig, Matthew L; Peters, Reuben J

2011-01-01

122

Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.  

PubMed

Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G.?pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G.?pecorum. High haplotype diversity was observed among G.?pecorum populations from all host species, indicating that the G.?pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G.?pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G.?pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures. PMID:25171609

Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K

2014-08-01

123

Overexpression of the gibberellin 2-oxidase gene from Torenia fournieri induces dwarf phenotypes in the liliaceous monocotyledon Tricyrtis sp.  

PubMed

Gibberellins (GAs) are the plant hormones that control many aspects of plant growth and development, including stem elongation. Genes encoding enzymes related to the GA biosynthetic and metabolic pathway have been isolated and characterized in many plant species. Gibberellin 2-oxidase (GA2ox) catalyzes bioactive GAs or their immediate precursors to inactive forms; therefore, playing a direct role in determining the levels of bioactive GAs. In the present study, we produced transgenic plants of the liliaceous monocotyledon Tricyrtis sp. overexpressing the GA2ox gene from the linderniaceous dicotyledon Torenia fournieri (TfGA2ox2). All six transgenic plants exhibited dwarf phenotypes, and they could be classified into two classes according to the degree of dwarfism: three plants were moderately dwarf and three were severely dwarf. All of the transgenic plants had small or no flowers, and smaller, rounder and darker green leaves. Quantitative real-time reverse transcription-polymerase chain reaction (PCR) analysis showed that the TfGA2ox2 expression level generally correlated with the degree of dwarfism. The endogenous levels of bioactive GAs, GA1 and GA4, largely decreased in transgenic plants as shown by liquid chromatography-mass spectrometry (LC-MS) analysis, and the level also correlated with the degree of dwarfism. Exogenous treatment of transgenic plants with gibberellic acid (GA3) resulted in an increased shoot length, indicating that the GA signaling pathway might normally function in transgenic plants. Thus, morphological changes in transgenic plants may result from a decrease in the endogenous levels of bioactive GAs. Finally, a possibility of molecular breeding for plant form alteration in liliaceous ornamental plants by genetically engineering the GA metabolic pathway is discussed. PMID:23747060

Otani, Masahiro; Meguro, Shuhei; Gondaira, Haruka; Hayashi, Megumi; Saito, Misaki; Han, Dong-Sheng; Inthima, Phithak; Supaibulwatana, Kanyaratt; Mori, Shiro; Jikumaru, Yusuke; Kamiya, Yuji; Li, Tuoping; Niki, Tomoya; Nishijima, Takaaki; Koshioka, Masaji; Nakano, Masaru

2013-11-01

124

Current issues in species identification for forensic science and the validity of using the cytochrome oxidase I (COI) gene.  

PubMed

Species identification techniques commonly utilized in Australian Forensic Science laboratories are gel immunodifussion antigen antibody reactions and hair comparison analysis. Both of these techniques have significant limitations and should be considered indicative opinion based tests. The Barcode of Life Initiative aims to sequence a section of DNA (~648 base pairs) for the Cytochrome Oxidase I mitochondrial gene (COI) in all living species on Earth, with the data generated being uploaded to the Barcode of Life Database (BOLD) which can then be used for species identification. The COI gene therefore offers forensics scientists an opportunity to use the marker to analyze unknown samples and compare sequences generated in BOLD. Once sequences from enough species are on the database, it is anticipated that routine identification of an unknown species may be possible. However, most forensic laboratories are not yet suited to this type of analysis and do not have the expertise to fully interpret the implications of matches and non matches involving a poorly sampled taxa (for example where there are cryptic species) and in providing the required opinion evidence. Currently, the use of BOLD is limited by the number of relevant species held in the database and the quality assurance and regulation of sequences that are there. In this paper, the COI methodology and BOLD are tested on a selection of introduced and Australian mammals in a forensic environment as the first step necessary in the implementation of this approach in the Australian context. Our data indicates that the COI methodology performs well on distinct species but needs further exploration when identifying more closely related species. It is evident from our study that changes will be required to implement DNA based wildlife forensics using the BOLD approach for forensic applications and recommendations are made for the future adoption of this technology into forensic laboratories. PMID:20563888

Wilson-Wilde, Linzi; Norman, Janette; Robertson, James; Sarre, Stephen; Georges, Arthur

2010-09-01

125

Expression of alternative oxidase in tomato  

SciTech Connect

Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

Kakefuda, M.; McIntosh, L. (Michigan State Univ., East Lansing (USA))

1990-05-01

126

No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms  

SciTech Connect

We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

Craddock, N.; Daniels, J.; Roberts, E. [Univ. of Wales, College of Medicine, Cardiff (United Kingdom)] [and others

1995-08-14

127

Severity of ulcerative colitis is associated with a polymorphism at diamine oxidase gene but not at histamine N-methyltransferase gene  

PubMed Central

AIM: To analyse the role of two common polymorphisms in genes coding for histamine metabolising enzymes as it relates to the risk to develop ulcerative colitis (UC) and the clinical course of these patients. METHODS: A cohort of 229 unrelated patients with UC recruited from a single centre and 261 healthy volunteers were analysed for the presence of Thr105Ile and His645Asp amino acid substitutions at histamine N-methyltransferase (HNMT) and diamine oxidase (ABP1) enzymes, respectively, by amplification-restriction procedures. All patients were phenotyped and followed up for at least 2 years (mean time 11 years). RESULTS: There were no significant differences in the distribution of ABP1 alleles between ulcerative colitis patients and healthy individuals [OR (95% CI) for variant alleles?=?1.22 (0.91-1.61)]. However, mutated ABP1 alleles were present with higher frequency among the 58 patients that required immunosuppresive drugs [OR (95 % CI) for carriers of mutated alleles 2.41 (1.21-4.83; P?=?0.006)], with a significant gene-dose effect (P?=?0.0038). In agreement with the predominant role of ABP1 versus HNMT on local histamine metabolism in human bowel, the frequencies for carriers of HNMT genotypes or mutated alleles were similar among patients, regardless clinical evolution, and control individuals. CONCLUSION: The His645Asp polymorphism of the histamine metabolising enzyme ABP1 is related to severity of ulcerative colitis. PMID:16489678

García-Martín, Elena; Mendoza, Juan L; Martínez, Carmen; Taxonera, Carlos; Urcelay, Elena; Ladero, José M; de la Concha, Emilio G; Díaz-Rubio, Manuel; Agúndez, José AG

2006-01-01

128

Functional expression of the Acanthamoeba castellanii alternative oxidase in Escherichia coli; regulation of the activity and evidence for Acaox gene function.  

PubMed

To evidence Acanthamoeba castellanii alternative oxidase (AcAOX) gene product function, we studied alterations in the levels of mRNA and protein and AcAOX activity during growth in amoeba batch culture. Moreover, heterologous expression of AcAOX in AOX-deficient Escherichia coli confirmed by the protein immunodetection and functional studies was performed. Despite the presence of native bo and bd quinol oxidases in E. coli membrane, from which the latter is known to be cyanide-resistant, functional expression of AcAOX in E. coli conferred cyanide-resistant benzohydroxamate-sensitive respiration on the bacteria. Moreover, AcAOX activity in transformed bacteria was stimulated by GMP and inhibited by ATP, indicating that AcAOX is regulated by mutual exclusion of purine nucleotides, which was previously demonstrated in the mitochondria of A. castellanii. PMID:24860925

Antos-Krzeminska, Nina; Jarmuszkiewicz, Wieslawa

2014-06-01

129

Monoamine Oxidase A and B Gene Polymorphisms and Negative and Positive Symptoms in Schizophrenia  

PubMed Central

Given that schizophrenia is a heterogeneous disorder, the analysis of clinical characteristics could help to identify homogeneous phenotypes that may be of relevance in genetic studies. Linkage and association studies have suggested that a locus predisposing to schizophrenia may reside within Xp11. We analyzed uVNTR and rs1137070, polymorphisms from MAOA and rs1799836 of MAOB genes to perform single SNP case-control association study in a sample of 344 schizophrenia patients and 124 control subjects. Single polymorphism analysis of uVNTR, rs1137070 and rs1799836 SNPs did not show statistical differences between cases and controls. Multivariate ANOVA analysis of clinical characteristics showed statistical differences between MAOB/rs1799836 and affective flattening scores (F = 4.852, P = 0.009), and significant association between MAOA/uVNTR and affective flattening in female schizophrenia patients (F = 4.236, P = 0.016) after Bonferroni's correction. Our preliminary findings could suggest that severity of affective flattening may be associated by modifier variants of MAOA and MAOB genes in female Mexican patients with schizophrenia. However, further large-scale studies using quantitative symptom-based phenotypes and several candidate variants should be analyzed to obtain a final conclusion. PMID:23738213

Camarena, Beatriz; Fresán, Ana; Aguilar, Alejandro; Escamilla, Raúl; Saracco, Ricardo; Palacios, Jorge; Tovilla, Alfonso; Nicolini, Humberto

2012-01-01

130

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).  

PubMed

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

131

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.  

PubMed

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants. PMID:24950439

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-01-01

132

Systematic position and relationships of Paracreptotrematina limi, based on partial sequences of 28S rRNA and cytochrome c oxidase subunit 1 genes.  

PubMed

Paracreptotrematina limi Amin and Myer, 1982 (Trematoda), an intestinal fluke specific to the mudminnow, Umbra limi, is conventionally classified within the papillose Allocreadiidae. Its unusual morphology (lack of identifiable vitellaria, large fully embryonated terminal eggs), assumptions of homology of its 2 atypical muscular oral 'papillae' (lobes) with those of the Bunoderinae, and its unknown life cycle make this classification tenuous. Previous phylogenetic analyses of the papillose allocreadiids, based on morphology, placed P. limi as a basal papillose allocreadiid. We tested this hypothesis with a phylogenetic analysis by using partial sequences of the 28S ribosomal RNA gene and the cytochrome c oxidase subunit I gene from several plagiorchiiform taxa, including reportedly related allocreadiids as well as selected species of Plagiorchiidae, Haematoloechidae, and Macroderoididae. Results of phylogenetic analyses of the 28S rRNA gene fragments by using parsimony criteria support the classification of P. limi as an allocreadiid and place it as a sister taxon to a clade with Allocreadium lobatum Wallin, 1909, Bunodera luciopercae (Müller, 1876) and Crepidostomum cooperi Hopkins, 1931, with Polylekithum ictaluri (Pearse, 1924) basal to all of them. Analysis of the cytochrome c oxidase subunit I gene sequence data from fewer taxa supports the placement of P. limi relative to 3 (A. lobatum, C. cooperi, and P. ictaluri) of the 4 allocreadiid taxa. These results also suggest that the previous conception of the papillose allocreadiids as a monophyletic assemblage that includes P. limi may require a reappraisal. PMID:16729708

Platta, Christopher S; Choudhury, Anindo

2006-04-01

133

Oxidase Test Protocol  

NSDL National Science Digital Library

The oxidase test is used to detect the presence of the enzyme cytochrome oxidase in microorganisms.  While used as a taxonomic tool for many microorganisms, the test was established initially to differentiate Neisseria spp. (oxidase positive) from Acinetobacter (oxidase negative) and Pseudomonas spp. (oxidase positive) from the Enterobacteriaceae (oxidase negative).

American Society For Microbiology;

2010-11-11

134

Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice.  

PubMed

Rice sheath blight, caused by the necrotrophic fungus Rhizoctonia solani, is one of the most devastating and intractable diseases of rice, leading to a significant reduction in rice productivity worldwide. In this article, in order to examine sheath blight resistance, we report the generation of transgenic rice lines overexpressing the rice oxalate oxidase 4 (Osoxo4) gene in a green tissue-specific manner which breaks down oxalic acid (OA), the pathogenesis factor secreted by R.?solani. Transgenic plants showed higher enzyme activity of oxalate oxidase (OxO) than nontransgenic control plants, which was visualized by histochemical assays and sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Transgenic rice leaves were more tolerant than control rice leaves to exogenous OA. Transgenic plants showed a higher level of expression of other defence-related genes in response to pathogen infection. More importantly, transgenic plants exhibited significantly enhanced durable resistance to R.?solani. The overexpression of Osoxo4 in rice did not show any detrimental phenotypic or agronomic effect. Our findings indicate that rice OxO can be utilized effectively in plant genetic manipulation for sheath blight resistance, and possibly for resistance to other diseases caused by necrotrophic fungi, especially those that secrete OA. This is the first report of the expression of defence genes in rice in a green tissue-specific manner for sheath blight resistance. PMID:23809026

Molla, Kutubuddin A; Karmakar, Subhasis; Chanda, Palas K; Ghosh, Satabdi; Sarkar, Sailendra N; Datta, Swapan K; Datta, Karabi

2013-12-01

135

Isolated sulfite oxidase deficiency.  

PubMed

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified. PMID:9050047

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

136

Association of lysyl oxidase-like 1 gene common sequence variants in Greek patients with pseudoexfoliation syndrome and pseudoexfoliation glaucoma  

PubMed Central

Purpose Three common sequence variants in the lysyl oxidase-like 1 (LOXL1) gene were recently associated with pseudoexfoliation (PEX) and pseudoexfoliation glaucoma (PEXG) in populations from various parts of the world. In this study, the genetic association of these variants was investigated in Greek patients with PEX and PEXG. Methods The three LOXL1 single nucleotide polymorphisms (SNPs), one intronic (rs2165241) and two nonsynonymous coding SNPs (rs1048661: R141L and rs3825942: G153D), were genotyped in a total of 48 unrelated patients with PEX, 35 patients with PEXG, and 52 healthy subjects who had normal findings in repeated ophthalmic examinations. A genetic association study was performed. Results Between the two coding SNPs, R141L did not show an association with PEX (p=0.297 for allele G, p=0.339 for genotype GG), whereas allele G of G153D showed a significant association (odds ratio [OR]=3.52, 95% confidence interval [CI]=1.735–7.166, p=3.24×10?4 for allele G, p=0.004 for genotype GG). Likewise, for the intronic SNP of rs2165241, genotype TT (p=0.005) and its corresponding allele T (OR=2.99, 95% CI=1.625–5.527, p=3.53×10?4) showed a significant association with PEX. The allele G of G153D showed a significant association with PEXG (OR=3.74, 95% CI=1.670–8.387, p=0.001). The combined haplotype GGT, consisting of all three risk alleles, was associated with PEX (p=0.037), conferring a 1.8-fold of increased risk to the disease (OR=1.799, 95% CI=1.04–3.13). Furthermore, the haplotype GGT presented in 39.8% of the patients with PEX and 26.9% of the controls. Conclusions Certain genetic variants in LOXL1 confer risk for PEX in Greek populations, confirming in part findings in patients from Northern Europe. PMID:23869164

Metaxaki, Ioanna; Constantoulakis, Pantelis; Papadimitropoulos, Miltiadis; Filiou, Eftihia; Georgopoulos, Gerasimos; Chamchougia, Aggeliki; Papakonstantinou, Dimitrios; Markomichelakis, Nikos; Koutsandrea, Chrysanthi

2013-01-01

137

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase.  

PubMed

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox protein. Most (>97%) CGD patients without p47phox (A47 degrees CGD) are homozygotes for one particular mutation in NCF1, a GT deletion in exon 2. This is due to recombination events between NCF1 and its two pseudogenes (psiNCF1) that contain this GT deletion. We have previously set up a gene-scan method to establish the ratio of NCF1 genes and pseudogenes. With this method we now found, in three CGD families patients with the normal number of two intact NCF1 genes (and four psiNCF1 genes) and in six CGD families, patients with one intact NCF1 gene (and five psiNCF1 genes). All patients lacked p47phox protein expression. These results indicate that other mutations were present in their NCF1 gene than the GT deletion. To identify these mutations, we designed PCR primers to specifically amplify the cDNA or parts of the genomic DNA from NCF1 but not from the psiNCF1 genes. We found point mutations in NCF1 in eight families. In another family, we found a 2,860-bp deletion starting in intron 2 and ending in intron 5. In six families the patients were compound heterozygotes for the GT deletion and one of these other mutations; in two families the patients had a homozygous missense mutation; and in one family the patient was a compound heterozygote for a splice defect and a nonsense mutation. Family members with either the GT deletion or one of these other mutations were identified as carriers. This knowledge was used in one of the families for prenatal diagnosis. PMID:16972229

Roos, Dirk; de Boer, Martin; Köker, M Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-12-01

138

D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate  

Microsoft Academic Search

Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2).

S M El Sayed; R M Abou El-Magd; Y Shishido; S P Chung; T Sakai; H Watanabe; S Kagami; K Fukui

2012-01-01

139

The polyphenol oxidase gene family in poplar: phylogeny, differential expression and identification of a novel, vacuolar isoform  

Microsoft Academic Search

Polyphenol oxidases (PPOs) are oxidative enzymes that convert monophenols and o-diphenols to o-quinones using molecular oxygen. The quinone products are highly reactive following tissue damage and can interact with cellular\\u000a constituents and cause oxidative browning and cross-linking. The induction of PPO in some plants as a result of wounding,\\u000a herbivore attack, or pathogen infection has implicated them in defense. However,

Lan T. Tran; C. Peter Constabel

140

Identification of a gene for pyruvate-insensitive mitochondrial alternative oxidase expressed in the thermogenic appendices in Arum maculatum.  

PubMed

Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S; Moore, Anthony L

2011-12-01

141

Isolation and characterization of a mutant protoporphyrinogen oxidase gene from Chlamydomonas reinhardtii conferring resistance to porphyric herbicides  

Microsoft Academic Search

In plant and algal cells, inhibition of the enzyme protoporphyrinogen oxidase (Protox) by the N-phenyl heterocyclic herbicide S-23142 causes massive protoporphyrin IX accumulation, resulting in membrane deterioration and cell lethality in the light. We have identified a 40.4 kb genomic fragment encoding S-23142 resistance by using transformation to screen an indexed cosmid library made from nuclear DNA of the dominant

Barbara L. Randolph-Anderson; Ryo Sato; Anita M. Johnson; Elizabeth H. Harris; Charles R. Hauser; Kenji Oeda; Fumiharu Ishige; Shoichi Nishio; Nicholas W. Gillham; John E. Boynton

1998-01-01

142

Induction of glucose oxidase, catalase, and lactonase in Aspergillus niger  

Microsoft Academic Search

The induction of glucose oxidase, catalase, and lactonase activities was studied both in wild-type and in glucose oxidase regulatory and structural mutants of Aspergillus niger. The structural gene for glucose oxidase was isolated and used for Northern analysis and in transformation experiments using various gox mutations. Wild-type phenotype could be restored in the glucose oxidase-negative mutant (goxC) by transformation with

Cor F. B. Witteveen; Hetty C. van den Broeck; Frank A. C. van Engelenburg; Leo H. de Graaff; Marcel H. B. C. Hillebrand; Peter J. Schaap; Jaap Visser

1993-01-01

143

A homolog of the Rhizobium meliloti nitrogen fixation gene fixN is involved in the production of a microaerobically induced oxidase activity in the phytopathogenic bacterium Agrobacterium tumefaciens.  

PubMed

Hybridization analysis using the Rhizobium meliloti nitrogen fixation gene fixN as a probe revealed the presence of a homologous DNA region in the phytopathogenic bacterium Agrobacterium tumefaciens. Hybridization signals were also detected with total DNAs of Rhizobium leguminosarum bv. phaseoli, Rhodobacter capsulatus and Escherichia coli, but not those of Xanthomonas campestris pv. campestris and Pseudomonas putida. The hybridizing fragment from A. tumefaciens was cloned and sequenced. The predicted gene product of one of the two open reading frames identified on the sequenced fragment shows homology to FixN of different Rhizobiaceae as well as a low but significant similarity to subunit I of heme copper oxidases from various bacteria. The presence of five strictly conserved histidine residues previously implicated in forming ligands to heme and CuB in oxidases and the predicted membrane topology provide evidence that the A. tumefaciens fixN-like gene product is a component of the heme copper oxidase superfamily. The incomplete open reading frame starting only 8 nucleotides downstream of the fixN-like gene exhibits homology to Rhizobium fixO. Using an uidA (GUS) gene fusion it could be shown that the A. tumefaciens fixN-like gene is preferentially expressed under microaerobic conditions. Expression of the uidA fusion is abolished in R. meliloti fixJ and fixK mutants, indicating that an Fnr-like protein is involved in transcriptional regulation of the fixN-like gene in A. tumefaciens. The presence of an upstream DNA sequence motif identical to the Fnr-consensus binding site (anaerobox) further supports this hypothesis. A. tumefaciens mutated in the fixN-like gene shows decreased TMPD-specific oxidase activity under microaerobic conditions, indicating that the fixN-like gene or operon codes for proteins involved in respiration under reduced oxygen availability. PMID:7753030

Schlüter, A; Rüberg, S; Krämer, M; Weidner, S; Priefer, U B

1995-04-20

144

Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genes in Vigna unguiculata.  

PubMed

Cowpea (Vigna unguiculata) alternative oxidase is encoded by a small multigene family (Aox1, 2a and 2b) that is orthologous to the soybean Aox family. Like most of the identified Aox genes in plants, VuAox1 and VuAox2 consist of 4 exons interrupted by 3 introns. Alignment of the orthologous Aox genes revealed high identity of exons and intron variability, which is more prevalent in Aox1. In order to determine Aox gene expression in V. unguiculata, a steady-state analysis of transcripts involved in seed development (flowers, pods and dry seeds) and germination (soaked seeds) was performed and systemic co-expression of VuAox1 and VuAox2b was observed during germination. The analysis of Aox transcripts in leaves from seedlings under different stress conditions (cold, PEG, salicylate and H2O2 revealed stress-induced co-expression of both VuAox genes. Transcripts of VuAox2a and 2b were detected in all control seedlings, which was not the case for VuAox1 mRNA. Estimation of the primary transcript lengths of V. unguiculata and soybean Aox genes showed an intron length reduction for VuAox1 and 2b, suggesting that the two genes have converged in transcribed sequence length. Indeed, a bioinformatics analysis of VuAox1 and 2b promoters revealed a conserved region related to a cis-element that is responsive to oxidative stress. Taken together, the data provide evidence for co-expression of Aox1 and Aox2b in response to stress and also during the early phase of seed germination. The dual nature of VuAox2b expression (constitutive and induced) suggests that the constitutive Aox2b gene of V. unguiculata has acquired inducible regulatory elements. PMID:20005596

Costa, José Hélio; Mota, Erika Freitas; Cambursano, Mariana Virginia; Lauxmann, Martin Alexander; de Oliveira, Luciana Maia Nogueira; Silva Lima, Maria da Guia; Orellano, Elena Graciela; Fernandes de Melo, Dirce

2010-05-01

145

Isolation and molecular characterization of KlCOX14, a gene of Kluyveromyces lactis encoding a protein necessary for the assembly of the cytochrome oxidase complex.  

PubMed

The yeast Kluyveromyces lactis was mutagenized with ethyl methane sulphonate and mutants unable to grow on respiratory carbon sources were isolated. Functional complementation of one of these mutants led to the isolation of KlCOX14, a gene encoding a 64 amino acid protein which is the functional homologue of Saccharomyces cerevisiae Cox14p, a protein necessary for the assembly of the cytochrome oxidase holoenzyme (Glerum et al., 1995). The disruption of KlCOX14 resulted in the absence of the absorption bands relative to cytochromes a and a(3) and in the complete loss of respiratory activity. Klcox14 mutants display the typical phenotype of pet mutants and have a reduced growth rate. In addition, unlike the wild-type, Klcox14 mutants are able to grow by fermentation also in the presence of low glucose. The nucleotide sequence of KlCOX14 has been deposited in the EMBL databank with Accession No. AJ238801. PMID:10669868

Fiori, A; Saliola, M; Goffrini, P; Falcone, C

2000-03-15

146

Population structure of the Monocelis lineata (Proseriata, Monocelididae) species complex assessed by phylogenetic analysis of the mitochondrial Cytochrome c Oxidase subunit I (COI) gene  

PubMed Central

Monocelis lineata consists of a complex of sibling species, widespread in the Mediterranean and Atlantic Ocean. Previous genetic analysis placed in evidence at least four sibling species. Nevertheless, this research was not conclusive enough to fully resolve the complex or to infer the phylogeny/phylogeography of the group. We designed specific primers aiming at obtaining partial sequences of the mtDNA gene Cytochrome c Oxidase subunit I (COI) of M. lineata, and have identified 25 different haplotypes in 32 analyzed individuals. The dendrogram generated by Neighbor-Joining analysis confirmed the differentiation between Atlantic and Mediterranean siblings, as well as the occurrence of at least two Mediterranean sibling species. Thus validated, the method here presented appears as a valuable tool in population genetics and biodiversity surveys on the Monocelis lineata complex. PMID:21637466

2009-01-01

147

Characterization of promoter elements required for expression and induction by sucrose of the Arabidopsis COX5b-1 nuclear gene, encoding the zinc-binding subunit of cytochrome c oxidase  

Microsoft Academic Search

Arabidopsis COX5b-1 encodes an isoform of the zinc binding subunit 5b of mitochondrial cytochrome c oxidase. A promoter region required for expression and induction by sucrose of this gene was analyzed using plants stably\\u000a transformed with mutagenized promoter fragments fused to the gus reporter gene. Promoter dependent expression is absolutely dependent on a G-box present at ?228 from the translation

Raúl N. Comelli; Ivana L. Viola; Daniel H. Gonzalez

2009-01-01

148

Two novel mutations and coexistence of the 991C.T and the 1339C.T mutation on a single allele in the coproporphyrinogen oxidase gene in Swedish patients with hereditary coproporphyria  

Microsoft Academic Search

Hereditary coproporphyria (HCP) is an autosomal dominant disorder, resulting from a partial deficiency of the enzyme coproporphyrinogen\\u000a oxidase (CPO). This enzyme catalyzes the sixth step of the heme biosynthetic pathway, and mutations in the CPO gene have been coupled to HCP. The present study was undertaken to identify disease-producing mutations in the CPO gene in nine Swedish families with HCP.

Åsa Wiman; Ylva Floderus; Pauline Harper

2002-01-01

149

The leader intron of Arabidopsis thaliana genes encoding cytochrome c oxidase subunit 5c promotes high-level expression by increasing transcript abundance and translation efficiency.  

PubMed

The involvement of regions located upstream of the translation start site in the expression of two Arabidopsis thaliana nuclear COX5c genes encoding subunit 5c of mitochondrial cytochrome c oxidase has been analysed. It was observed that these regions, which include a leader intron, direct the tissue-specific expression of the gus reporter gene, mainly in root and shoot meristems, actively growing tissues and vascular strands. Expression was also observed in flowers, specifically localized in anthers, stigma, and the receptacle, and in developing seeds. GUS activity measurements in protein extracts from transformed plants indicated that expression levels are higher than those observed with the constitutive CaMV 35S promoter. Removal of the leader intron produced a significant decrease in expression to values only slightly higher than those observed with a promoterless gus gene. Histochemical staining of plants transformed with the intronless construct revealed expression only in pollen, suggesting that regulatory elements capable of directing pollen-specific expression are present upstream of the intron. The COX5c-2 intron also increased GUS expression levels when fused in the correct orientation with the promoter of the unrelated COX5b-1 gene. Comparison of GUS activity values with the transcript levels suggests that the intron also increases translation efficiency of the corresponding mRNA. The results obtained point to an essential role of the intron present in the 5'-non-coding region of all known COX5c genes in directing the expression of these genes in plants. PMID:16061502

Curi, Graciela C; Chan, Raquel L; Gonzalez, Daniel H

2005-09-01

150

The origin of the Tibetan Mastiff and species identification of Canis based on mitochondrial cytochrome c oxidase subunit I (COI) gene and COI barcoding.  

PubMed

DNA barcoding is an effective technique to identify species and analyze phylogenesis and evolution. However, research on and application of DNA barcoding in Canis have not been carried out. In this study, we analyzed two species of Canis, Canis lupus (n = 115) and Canis latrans (n = 4), using the cytochrome c oxidase subunit I (COI) gene (1545 bp) and COI barcoding (648 bp DNA sequence of the COI gene). The results showed that the COI gene, as the moderate variant sequence, applied to the analysis of the phylogenesis of Canis members, and COI barcoding applied to species identification of Canis members. Phylogenetic trees and networks showed that domestic dogs had four maternal origins (A to D) and that the Tibetan Mastiff originated from Clade A; this result supports the theory of an East Asian origin of domestic dogs. Clustering analysis and networking revealed the presence of a closer relative between the Tibetan Mastiff and the Old English sheepdog, Newfoundland, Rottweiler and Saint Bernard, which confirms that many well-known large breed dogs in the world, such as the Old English sheepdog, may have the same blood lineage as that of the Tibetan Mastiff. PMID:22440462

Li, Y; Zhao, X; Pan, Z; Xie, Z; Liu, H; Xu, Y; Li, Q

2011-12-01

151

Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria  

PubMed Central

Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

2013-01-01

152

Structural Insights into Sulfite Oxidase Deficiency  

SciTech Connect

Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

2005-01-01

153

Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.  

PubMed

Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded. PMID:24956508

Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy

2014-07-01

154

Potentially novel copper resistance genes in copper-enriched activated sludge revealed by metagenomic analysis.  

PubMed

In this study, we utilized the Illumina high-throughput metagenomic approach to investigate diversity and abundance of both microbial community and copper resistance genes (CuRGs) in activated sludge (AS) which was enriched under copper selective stress up to 800 mg/L. The raw datasets (~3.5 Gb for each sample, i.e., the copper-enriched AS and the control AS) were merged and normalized for the BLAST analyses against the SILVA SSU rRNA gene database and self-constructed copper resistance protein database (CuRD). Also, the raw metagenomic sequences were assembled into contigs and analyzed based on Open Reading Frames (ORFs) to identify potentially novel copper resistance genes. Among the different resistance systems for copper detoxification under the high copper stress condition, the Cus system was the most enriched system. The results also indicated that genes encoding multi-copper oxidase played a more important role than those encoding efflux proteins. More significantly, several potentially novel copper resistance ORFs were identified by Pfam search and phylogenic analysis. This study demonstrated a new understanding of microbial-mediated copper resistance under high copper stress using high-throughput shotgun sequencing technique. PMID:25081552

Li, Li-Guan; Cai, Lin; Zhang, Xu-Xiang; Zhang, Tong

2014-12-01

155

Subunit 1 of cytochrome oxidase from Neurospora crassa: nucleotide sequence of the coding gene and partial amino acid sequence of the protein.  

PubMed Central

A partial protein sequence (223 residues) of cytochrome oxidase subunit 1 from Neurospora crassa has been established. The nucleotide sequence of a cloned mitochondrial DNA segment, including the structural gene coding for the mature subunit 1 (CO I locus) was determined. In contrast to the situation in yeast, the CO I locus in N. crassa is not interrupted by long intervening sequences. A polypeptide of 555 residues with a mol. wt. of 61 000 has been deduced from the reading frame established by protein sequencing. With the exception of the C-terminal part of the polypeptide, the proposed sequences for subunit 1 of N. crassa, yeast, and man are largely homologous. Protein sequencing reveals that a region of low homology close to the C-terminal portion belongs to the structural gene in N. crassa. The DNA sequence coding for the prepiece , which characterizes the polypeptide precursor of the N. crassa subunit 1, has not yet been localized. A RNA species of approximately 6.8 kb has been identified as the CO I transcript. There is no indication of splicing of this large transcript. Images Fig. 6. PMID:6327266

Burger, G; Scriven, C; Machleidt, W; Werner, S

1982-01-01

156

Expression of peroxisome proliferator-activated receptor alpha, and PPARalpha regulated genes in spontaneously developed hepatocellular carcinomas in fatty acyl-CoA oxidase null mice.  

PubMed

Fatty acyl-CoA oxidase null mice (AOX-/-) develop hepatocellular carcinomas in 100% of animals between 10 and 15 months. We evaluated spontaneously developed HCC in AOX-/- mice for PPARalpha, PPARalpha regulated genes and peroxisome volume density and compared with adjacent non-neoplastic liver and liver in wild-type (AOX+/+) and heterozygous (AOX+/-) mice. The level of PPARalpha mRNA was 2.5-fold higher in HCC compared to the adjacent liver. mRNAs of PPARalpha regulated genes such as peroxisomal bifunctional enzyme, thiolase, cytochrome P450 CYP4A1 and CYP4A3 were similar in HCC and adjacent liver and increased by 7- to 22-fold compared with wild-type and heterozygous mice. Immunoblot analysis of HCC showed high amounts of PPARalpha, peroxisomal bifunctional enzyme and thiolase. Electron microscopic examination revealed 3.8 and 8.3-fold increase in the volume density of peroxisomes in HCC and adjacent liver, respectively, compared to the volume density in wild-type mice. These results demonstrate that spontaneously developed HCC in AOX-/- mice display a similar type of pleiotropic responses to high levels of PPARalpha ligands as the non-neoplastic liver. The changes observed in HCC and adjacent liver in AOX-/- mice were identical to those observed in rats and mice exposed to peroxisome proliferators. PMID:12429965

Meyer, Kirstin; Jia, Yuzhi; Cao, Wen-Qing; Kashireddy, Papreddy; Rao, M Sambasiva

2002-12-01

157

The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.  

PubMed

Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

2012-08-01

158

Noninvasive hypoxia monitor based on gene-free engineering of lactate oxidase for analysis of undiluted sweat.  

PubMed

We report on the Prussian Blue based lactate biosensor with the remarkably increased upper detection limit suitable for analysis of undiluted sweat. Engineering of the enzyme lactate oxidase has been carried out upon its immobilization from water-isopropanol mixtures with the high (90%) content of organic solvent. To decrease the enzyme binding constant, we propose to shield the substrate binding sites in its active center with negatively charged polyelectrolyte. The biosensor made from the optimal mixture (3% ?- aminopropyltriethoxysilane and 5% perfluorosulfonated ionomer) is characterized by the calibration graph, which even in batch mode is shifted for 2 orders of magnitude toward high analyte concentrations as compared to it of lactate sensitive electrode made without Nafion analogue. In flow-injection mode, the biosensor allows lactate detection up to 0.5 M. The biosensor displays stable response for 4 h of continuous operation. The achieved analytical performance characteristics allow the monitoring of lactate content in undiluted sweat. A successful validation of the elaborated flow-through monitor with the integrated biosensor opens new horizons for noninvasive diagnostics of hypoxia-related conditions. PMID:24837858

Pribil, Medeya M; Laptev, Gennady U; Karyakina, Elena E; Karyakin, Arkady A

2014-06-01

159

Structure and inhibition of human diamine oxidase.  

PubMed

Humans have three functioning genes that encode copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 A. The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9% sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 and 2.2 A, respectively. They bind noncovalently in the active-site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O; Brown, Doreen E; Dooley, David M; Guss, J Mitchell

2009-10-20

160

Regulation of the Alternative Oxidase Aox1 Gene in Chlamydomonas reinhardtii. Role of the Nitrogen Source on the Expression of a Reporter Gene under the Control of the Aox1 Promoter1  

PubMed Central

In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga Chlamydomonas reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless arylsulfatase (Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (?253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source. PMID:12644691

Baurain, Denis; Dinant, Monique; Coosemans, Nadine; Matagne, René F.

2003-01-01

161

Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.  

PubMed Central

Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

1995-01-01

162

Association study between monoamine oxidase A (MAOA) gene polymorphisms and schizophrenia: lack of association with schizophrenia and possible association with affective disturbances of schizophrenia.  

PubMed

Monoamine oxidase A (MAOA) catalyzes monoamine neurotransmitters including dopamine, 5-hydroxytryptamine (5-HT, serotonin), and norepinephrine. MAOA also plays a key role in emotional regulation. The aim of this study was to investigate the associations between the exonic single nucleotide polymorphisms (SNPs) of the MAOA gene located on the X chromosome and schizophrenia. We also analyzed the relationships between these SNPs and the common clinical symptoms of schizophrenia such as persecutory delusion, auditory hallucinations, affective disturbances, and poor concentration. Two hundred seventy five Korean schizophrenia patients and 289 control subjects were recruited. Three SNPs [rs6323 (Arg294Arg), rs1137070 (Asp470Asp), and rs3027407 (3'-untranslated region)] of the MAOA gene were selected and genotyped by direct sequencing. The common clinical symptoms of schizophrenia according to the Operation Criteria Checklist were analyzed. Three examined SNPs showed no associations with male and female schizophrenia, respectively (p>0.05). In the analysis of the common clinical symptoms of schizophrenia patients, three examined SNPs were associated with affective disturbances, especially restricted affect and blunted affect in male schizophrenia, respectively (restricted affect, p=0.002, OR=2.71, 95% CI 1.45-5.00; blunted affect, p=0.009, OR 2.25, 95% CI 1.22-4.12). The SNPs were not associated with other clinical symptoms of schizophrenia (persecutory delusion, auditory hallucinations, and poor concentration). These results suggest that exonic SNPs (rs6323, rs1137070, and rs3027407) of the MAOA gene may be contributed to affective disturbances of Korean males schizophrenia, especially restricted affect and blunted affect. PMID:24510409

Kim, Su Kang; Park, Hae Jeong; Seok, Hosik; Jeon, Hye Sook; Chung, Joo-Ho; Kang, Won Sub; Kim, Jong Woo; Yu, Gyeong Im; Shin, Dong Hoon

2014-05-01

163

Molecular and computational approaches to characterize thermostable laccase gene from two xerophytic plant species.  

PubMed

Laccases are blue multicopper oxidases that carry out single electron transfers in the oxidation of phenols to quinones. In plants, they confer structural stability to the cell wall. Thermostable laccases were identified in xerophytes Cereus pterogonus and Opuntia vulgaris that could be used in biotechnology and industrial processes. Polyclonal anti-laccase antibodies were generated against purified laccase enzyme isoforms capable of 98-99% inhibition of the catalytic activity. Antibodies raised against lower molecular weight isoforms inhibited 70% of the catalytic activity of higher molecular forms. Only 20% inhibition was noted when assayed in reverse. A partial gene sequence of thermostable xerophytic laccase comprising 712 and 880 bp was identified employing cDNA as template. The nucleotide sequence was submitted to GenBank. The gene sequence was in silico translated into protein sequence and a 3-D structure was predicted using I-Tasser and Genesilico online servers that justified the experimental observations. Anti-laccase antibodies and nucleotide gene sequence of this thermostable plant laccase can be utilized for predicting laccase antigenic sequences and for cloning and expression of the thermostable eukaryotic laccase. PMID:24218182

Kumar, Gali Nirmal; Srikumar, Kotteazeth

2014-02-01

164

Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum  

PubMed Central

Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

2012-01-01

165

Silencing of hypoxia-inducible tumor suppressor lysyl oxidase gene by promoter methylation activates carbonic anhydrase IX in nasopharyngeal carcinoma  

PubMed Central

Lysyl oxidase (LOX) is an oxidative enzyme known to initiate the cross-linking of collagens and elastin, and suggested recently as a tumor suppressor for several tumor types including lung, pancreatic and gastric cancers. Previously we showed that LOX is strongly induced upon hypoxia in nasopharyngeal carcinoma (NPC) cell lines CNE2 and HONE1 but only slightly in HK1 and not in C666-1. Here, we further studied the regulatory mechanism and functions of LOX in NPC. LOX is widely expressed in human normal tissues with variations in expression levels. LOX was expressed in most NPC cell lines except for C666-1, while HK1 and FaDu (laryngeal cancer) only expressed low level of LOX. Methylation analysis showed that the LOX promoter was methylated in C666-1 and partially methylated in HK1. After demethylation with 5-aza-2’-deoxycytidine, LOX expression was reactivated along with increased unmethylated alleles. LOX promoter methylation was detected in 42/49 (85.7%) of NPC primary tumors but only 3/16 (18.75%) of nose swab samples from NPC patients. LOX overexpression reduced the clonogenicity and cell growth of NPC cells, and also inhibited the migration and invasion of the NPC cells. Carbonic anhydrase IX (CA9) mRNA level was obviously decreased in HK1 cells after transfection with LOX. The elevation of CA9 protein upon hypoxia was inhibited in LOX-transfected HK1 cells. The protein levels of an apoptosis marker cPARP were increased in LOX-transfected HK1 cells upon hypoxia treatment. Our data showed that silencing or down-regulation of LOX in NPC was due to its promoter methylation and LOX acts as a tumor suppressor in NPC. LOX silencing would facilitate NPC cells to escape from hypoxia-induced apoptosis and maintains a malignant and metastatic phenotype. PMID:25520868

Sung, Fion L; Cui, Yan; Hui, Edwin P; Li, Lili; Loh, Thomas KS; Tao, Qian; Chan, Anthony TC

2014-01-01

166

Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser  

SciTech Connect

Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

2010-01-01

167

Genetic divergence of Vipera berus and Vipera nikolskii (Reptilia: Viperidae, Vipera ) populations in lower Volga and adjacent territories assessed according to the sequences of cytochrome oxidase III and 12S ribosome RNA genes  

Microsoft Academic Search

The nucleotide sequences of mitochondrial genome fragments containing the genes coding for cytochrome oxidase subunit III\\u000a (COIII) and 12S ribosomal RNA of common European viper and Nikolsky’s viper from various habitats (Saratov, Samara, and Penza\\u000a oblasts; Chuvash Republic; and the Republic of Mordovia) were determined. According to the sequencing data, all samples clustered\\u000a into two groups except for a number

R. V. Efimov; E. V. Zav’yalov; V. A. Velikov; V. G. Tabachishin

2008-01-01

168

Himantura tutul sp. nov. (Myliobatoidei: Dasyatidae), a new ocellated whipray from the tropical Indo-West Pacific, described from its cytochrome-oxidase I gene sequence.  

PubMed

It has been previously established that the Leopard Whipray, Himantura leoparda, consists of two genetically isolated, cryptic species, provisionally designated as 'Cluster 1' and 'Cluster 4' (Arlyza et al., Mol. Phylogenet. Evol. 65 (2013) [1]). Here, we show that the two cryptic species differ by the spotting patterns on the dorsal surface of adults: Cluster-4 individuals tend to have larger-ocellated spots, which also more often have a continuous contour than Cluster-1 individuals. We show that H. leoparda's holotype has the typical larger-ocellated spot pattern, designating Cluster 4 as the actual H. leoparda. The other species (Cluster 1) is described as Himantura tutul sp. nov. on the basis of the nucleotide sequence of a 655-base pair fragment of its cytochrome-oxidase I gene (GenBank accession No. JX263335). Nucleotide synapomorphies at this locus clearly distinguish H. tutul sp. nov. from all three other valid species in the H. uarnak species complex, namely H. leoparda, H. uarnak, and H. undulata. H. tutul sp. nov. has a wide distribution in the Indo-West Pacific, from the shores of eastern Africa to the Indo-Malay archipelago. H. leoparda under its new definition has a similarly wide Indo-West Pacific distribution. PMID:23608177

Borsa, Philippe; Durand, Jean-Dominique; Shen, Kang-Ning; Arlyza, Irma S; Solihin, Dedy D; Berrebi, Patrick

2013-02-01

169

New restriction fragment length polymorphisms in the cytochrome oxidase I gene facilitate host strain identification of fall armyworm (Lepidoptera: Noctuidae) populations in the southeastern United States.  

PubMed

Several restriction sites in the cytochrome oxidase I gene of fall armyworm, Spodoptera frugiperda (J.E. Smith), were identified by sequence analysis as potentially being specific to one of the two host strains. Strain specificity was demonstrated for populations in Florida, Texas, Mississippi, Georgia, and North Carolina, with an AciI and SacI site specific to the rice (Oryjza spp.)-strain and a BsmI and HinfI site joining an already characterized MspI site as diagnostic of the corn (Zea mays L.)-strain. All four of these sites can be detected by digestion of a single 568-bp polymerase chain reaction-amplified fragment, but the use of two enzymes in separate digests was found to provide accurate and rapid determination of strain identity. The effectiveness of this method was demonstrated by the analysis of almost 200 adult and larval specimens from the Mississippi delta region. The results indicated that the corn-strain is likely to be the primary strain infesting cotton (Gossypium spp.) and that an unexpected outbreak of fall armyworm on the ornamental tree Paulownia tomentosa (Thunb.) Sieb. & Zucc. ex Steud. was due almost entirely to the rice-strain. PMID:16813297

Nagoshi, Rod N; Meagher, Robert L; Adamczyk, John J; Braman, S Kristine; Brandenburg, Rick L; Nuessly, Gregg

2006-06-01

170

Oxygen-dependent expression of cytochrome c oxidase subunit 4-2 gene expression is mediated by transcription factors RBPJ, CXXC5 and CHCHD2  

PubMed Central

Cytochrome c oxidase (COX) is the terminal enzyme of the electron transport chain, made up of 13 subunits encoded by both mitochondrial and nuclear DNA. Subunit 4 (COX4), a key regulatory subunit, exists as two isoforms, the ubiquitous isoform 1 and the tissue-specific (predominantly lung) isoform 2 (COX4I2). COX4I2 renders lung COX about 2-fold more active compared with liver COX, which lacks COX4I2. We previously identified a highly conserved 13-bp sequence in the proximal promoter of COX4I2 that functions as an oxygen responsive element (ORE), maximally active at a 4% oxygen concentration. Here, we have identified three transcription factors that bind this conserved ORE, namely recombination signal sequence–binding protein J? (RBPJ), coiled-coil-helix-coiled-coil-helix domain 2 (CHCHD2) and CXXC finger protein 5 (CXXC5). We demonstrate that RBPJ and CHCHD2 function towards activating the ORE at 4% oxygen, whereas CXXC5 functions as an inhibitor. To validate results derived from cultured cells, we show using RNA interference a similar effect of these transcription factors in the gene regulation of COX4I2 in primary pulmonary arterial smooth muscle cells. Depending on the oxygen tension, a concerted action of the three transcription factors regulates the expression of COX4I2 that, as we discuss, could augment both COX activity and its ability to cope with altered cellular energy requirements. PMID:23303788

Aras, Siddhesh; Pak, Oleg; Sommer, Natascha; Finley, Russell; Hüttemann, Maik; Weissmann, Norbert; Grossman, Lawrence I.

2013-01-01

171

An assessment of genetic variability in the mitochondrial cytochrome c oxidase subunit 1 gene of Cercopithifilaria sp. (Spirurida, Onchocercidae) from dog and Rhipicephalus sanguineus populations.  

PubMed

This study investigates sequence variation in mitochondrial cytochrome c oxidase subunit 1 gene within Cercopithifilaria sp. recorded recently in Italy. Fourteen sequence types (haplotypes) were characterized for 163 (7.7%) amplicons from 2111 Genomic DNA samples prepared from skin samples from dogs and from Rhipicephalus sanguineus (ticks) from different geographical areas of the Mediterranean basin (i.e., Italy, Spain and Greece). The most prevalent sequence types represented haplotypes I (70.5%) and X (16.0%), followed by haplotype VIII (4.9%) and other 11 haplotypes (8.6%). Three haplotypes (II, V and VI) were found exclusively in ticks. The overall intraspecific nucleotide variation among pcox1 haplotypes ranged from 0.4 to 3.5% (mean = 1.6%), whereas a mean interspecific difference of 9.5% was detected as compared with other onchocercids. Phylogenetic analysis of the nucleotide sequence data showed a clustering of Cercopithifilaria sp. with the other Cercopithifilaria species (with strong statistical support) to the exclusion of other onchocercids. The number of haplotypes identified here might be explained by complex ecology and transmission patterns as well as the high mutation rate of mitochondrial DNA and/or inbreeding associated with hosts and their vectors. PMID:22227114

Otranto, Domenico; Latrofa, Maria Stefania; Brianti, Emanuele; Annoscia, Giada; Parisi, Antonio; Dantas-Torres, Filipe; Bain, Odile; Gasser, Robin B

2012-04-01

172

Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans  

PubMed Central

A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922

Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL

2012-01-01

173

Amine oxidase copper-containing 1 (AOC1) is a downstream target gene of the Wilms tumor protein, WT1, during kidney development.  

PubMed

Amine oxidase copper-containing 1 (AOC1; formerly known as amiloride-binding protein 1) is a secreted glycoprotein that catalyzes the degradation of putrescine and histamine. Polyamines and their diamine precursor putrescine are ubiquitous to all organisms and fulfill pivotal functions in cell growth and proliferation. Despite the importance of AOC1 in regulating polyamine breakdown, very little is known about the molecular mechanisms that control its expression. We report here that the Wilms tumor protein, WT1, which is necessary for normal kidney development, activates transcription of the AOC1 gene. Expression of a firefly luciferase reporter under control of the proximal AOC1 promoter was significantly enhanced by co-transfection of a WT1 expression construct. Binding of WT1 protein to a cis-regulatory element in the AOC1 promoter was confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. Antisense inhibition of WT1 protein translation strongly reduced Aoc1 transcripts in cultured murine embryonic kidneys and gonads. Aoc1 mRNA levels correlated with WT1 protein in several cell lines. Double immunofluorescent staining revealed a co-expression of WT1 and AOC1 proteins in the developing genitourinary system of mice and rats. Strikingly, induced changes in polyamine homeostasis affected branching morphogenesis of cultured murine embryonic kidneys in a developmental stage-specific manner. These findings suggest that WT1-dependent control of polyamine breakdown, which is mediated by changes in AOC1 expression, has a role in kidney organogenesis. PMID:25037221

Kirschner, Karin M; Braun, Julian F W; Jacobi, Charlotte L; Rudigier, Lucas J; Persson, Anja Bondke; Scholz, Holger

2014-08-29

174

Neuron-specific specificity protein 4 (Sp4) bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons  

PubMed Central

Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically-regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1, that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. PMID:24032355

Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T. T.

2013-01-01

175

Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors  

PubMed Central

Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

2011-01-01

176

Rcf1 and Rcf2, Members of the Hypoxia-Induced Gene 1 Protein Family, Are Critical Components of the Mitochondrial Cytochrome bc1-Cytochrome c Oxidase Supercomplex  

PubMed Central

We report that Rcf1 (formerly Aim31), a member of the conserved hypoxia-induced gene 1 (Hig1) protein family, represents a novel component of the yeast cytochrome bc1-cytochrome c oxidase (COX) supercomplex. Rcf1 (respiratory supercomplex factor 1) partitions with the COX complex, and evidence that it may act as a bridge to the cytochrome bc1 complex is presented. Rcf1 interacts with the Cox3 subunit and can do so prior to their assembly into the COX complex. A close proximity of Rcf1 and members of the ADP/ATP carrier (AAC) family was also established. Rcf1 displays overlapping function with another Hig1-related protein, Rcf2 (formerly Aim38), and their joint presence is required for optimal COX enzyme activity and the correct assembly of the cytochrome bc1-COX supercomplex. Rcf1 and Rcf2 can independently associate with the cytochrome bc1-COX supercomplex, indicating that at least two forms of this supercomplex exist within mitochondria. We provide evidence that the association with the cytochrome bc1-COX supercomplex and regulation of the COX complex are a conserved feature of Hig1 family members. Based on our findings, we propose a model where the Hig1 proteins regulate the COX enzyme activity through Cox3 and associated Cox12 protein, in a manner that may be influenced by the neighboring AAC proteins. PMID:22310663

Strogolova, Vera; Furness, Andrew; Robb-McGrath, Micaela; Garlich, Joshua

2012-01-01

177

Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls  

SciTech Connect

It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

Noethen, M.M.; Eggermann, K.; Propping, P. [Univ. of Bonn (Germany)] [and others

1995-10-01

178

Deletion of genes encoding cytochrome oxidases and quinol monooxygenase blocks the aerobic-anaerobic shift in Escherichia coli K-12 MG1655.  

PubMed

The constitutive activation of the anoxic redox control transcriptional regulator (ArcA) in Escherichia coli during aerobic growth, with the consequent production of a strain that exhibits anaerobic physiology even in the presence of air, is reported in this work. Removal of three terminal cytochrome oxidase genes (cydAB, cyoABCD, and cbdAB) and a quinol monooxygenase gene (ygiN) from the E. coli K-12 MG1655 genome resulted in the activation of ArcA aerobically. These mutations resulted in reduction of the oxygen uptake rate by nearly 98% and production of d-lactate as a sole by-product under oxic and anoxic conditions. The knockout strain exhibited nearly identical physiological behaviors under both conditions, suggesting that the mutations resulted in significant metabolic and regulatory perturbations. In order to fully understand the physiology of this mutant and to identify underlying metabolic and regulatory reasons that prevent the transition from an aerobic to an anaerobic phenotype, we utilized whole-genome transcriptome analysis, (13)C tracing experiments, and physiological characterization. Our analysis showed that the deletions resulted in the activation of anaerobic respiration under oxic conditions and a consequential shift in the content of the quinone pool from ubiquinones to menaquinones. An increase in menaquinone concentration resulted in the activation of ArcA. The activation of the ArcB/ArcA regulatory system led to a major shift in the metabolic flux distribution through the central metabolism of the mutant strain. Flux analysis indicated that the mutant strain had undetectable fluxes around the tricarboxylic acid (TCA) cycle and elevated flux through glycolysis and anaplerotic input to oxaloacetate. Flux and transcriptomics data were highly correlated and showed similar patterns. PMID:20709841

Portnoy, Vasiliy A; Scott, David A; Lewis, Nathan E; Tarasova, Yekaterina; Osterman, Andrei L; Palsson, Bernhard Ø

2010-10-01

179

RESEARCH Open Access Genome of the long-living sacred lotus (Nelumbo  

E-print Network

protuberances of its self-cleaning leaf surface, which have been adapted for the manufacture of a self-cleaning plants of 4,223 genes. Strikingly, the sacred lotus has 16 COG2132 multi-copper oxidase family proteins

Downie, Stephen R.

180

Transforming Growth Factor–? Induces Extracellular Matrix Protein Cross-Linking Lysyl Oxidase (LOX) Genes in Human Trabecular Meshwork Cells  

PubMed Central

Purpose. The profibrotic cytokine TGF? is associated with glaucoma and plays an important role in the regulation of extracellular matrix metabolism in the trabecular meshwork (TM). The purpose of this study was to determine whether expression of ECM cross-linking LOX genes is regulated by TGF? in TM cells. Methods. Expression of the five LOX genes (LOX, LOXL1, LOXL2, LOXL3, and LOXL4) was examined in cultured human TM cells by using RT-PCR, quantitative RT-PCR, and Western immunoblot analysis. TM cells were treated with recombinant TGF?1, -2, and -3, to determine the effects on LOX and LOXL1 to -4 expression. The TM cells were pretreated with TGFBR inhibitors (LY364947, SB431542), canonical Smad signaling pathway (SIS3 or Smad2, -3, and -4 siRNAs) inhibitors, or inhibitors of the non-Smad signaling pathways (SP600125, SR11302), to identify the signaling pathway(s) involved in TGF? induction of LOX and LOXL gene and protein expression. A novel LOX activity assay was used to determine the effects of the LOX inhibitor BAPN on tropoelastin cross-linking. Results. All five LOX genes (LOX, LOXL1 to -4) were expressed in cultured human TM cells and were induced by all three isoforms of TGF?. This TGF? induction of LOX and LOXL expression was blocked by TGF? inhibitors as well as by inhibitors of the canonical Smad2, -3, and -4 signaling and non-Smad JNK/AP-1 signaling pathways (P < 0.05). Conclusions. Both Smad and non-Smad signaling pathways are involved in TGF?-mediated LOX induction, suggesting complex regulation of these important extracellular matrix cross-linking enzymes. Increased LOX activity may be at least partially responsible for TGF?-mediated IOP elevation and increased aqueous humor outflow resistance. PMID:21546528

Sethi, Anirudh; Mao, Weiming; Wordinger, Robert J.

2011-01-01

181

The Diamine Oxidase Gene Is Associated with Hypersensitivity Response to Non-Steroidal Anti-Inflammatory Drugs  

PubMed Central

Non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191), which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR ?=?1.7 (95% CI ?=?1.3–2.1; Pc ?=?0.0003) with a gene-dose effect (P?=?0.0001). The association was replicated in two populations from different geographic areas (Pc ?=?0.008 and Pc ?=?0.004, respectively). Conclusions and implications The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response. PMID:23152756

Agúndez, José A. G.; Ayuso, Pedro; Cornejo-García, José A.; Blanca, Miguel; Torres, María J.; Doña, Inmaculada; Salas, María; Blanca-López, Natalia; Canto, Gabriela; Rondon, Carmen; Campo, Paloma; Laguna, José J.; Fernández, Javier; Martínez, Carmen; García-Martín, Elena

2012-01-01

182

Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.  

PubMed

Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups. PMID:23873617

Gjerde, Bjørn

2013-10-01

183

Gibberellin 3-oxidase Gene Expression Patterns Influence Gibberellin Biosynthesis, Growth, and Development in Pea1[W][OPEN  

PubMed Central

Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3?-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth. PMID:23979969

Reinecke, Dennis M.; Wickramarathna, Aruna D.; Ozga, Jocelyn A.; Kurepin, Leonid V.; Jin, Alena L.; Good, Allen G.; Pharis, Richard P.

2013-01-01

184

Genetics Home Reference: Peroxisomal acyl-CoA oxidase deficiency  

MedlinePLUS

... oxidase. This enzyme is found in sac-like cell structures (organelles) called peroxisomes, which contain a variety of enzymes that break down many different substances. The peroxisomal straight-chain acyl-CoA oxidase ... gene mutations prevent the peroxisomal straight-chain ...

185

Methods and approaches to study plant mitochondrial alternative oxidase  

Microsoft Academic Search

The alternative oxidase is a non-proton motive 'alternative' to electron transport through the cytochrome pathway. Despite its wasteful nature in terms of energy conservation, the path- way is likely present throughout the plant kingdom and ap- pears to be expressed in most plant tissues. A small alterna- tive oxidase gene family exists, the members of which are differentially expressed in

Allison E. McDonald; Stephen M. Sieger; Greg C. Vanlerberghe

2002-01-01

186

Promoter analyses and transcriptional profiling of eggplant polyphenol oxidase 1 gene (SmePPO1) reveal differential response to exogenous methyl jasmonate and salicylic acid.  

PubMed

The transcriptional regulation of multigenic eggplant (Solanum melongena) polyphenol oxidase genes (SmePPO) is orchestrated by their corresponding promoters which mediate developmentally regulated expression in response to myriad biotic and abiotic factors. However, information on structural features of SmePPO promoters and modulation of their expression by plant defense signals are lacking. In the present study, SmePPOPROMOTERs were cloned by genome walking, and their transcription start sites (TSS) were determined by RLM-RACE. Extensive sequence analyses revealed the presence of evolutionarily conserved and over-represented putative cis-acting elements involved in light-regulated transcription, biosynthetic pathways (phenylpropanoid/flavonoid), hormone signaling (abscisic acid, gibberellic acid, jasmonate and salicylate), elicitor and stress responses (cold/dehydration responses), sugar metabolism and plant defense signaling (W-BOX/WRKY) that are common to SmePPOPROMOTER1 and 2. The TSS for SmePPO genes are located 9-15bp upstream of ATG with variable lengths of 5' untranslated regions. Transcriptional profiling of SmePPOs in eggplant seedlings has indicated differential response to methyl jasmonate (MeJA) or salicylic acid (SA) treatment. In planta, while MeJA elicited expression of all the six SmePPOs, SA was only able to induce the expression of SmePPO4-6. Interestingly, in dual treatment, SA considerably repressed the MeJA-induced expression of SmePPOs. Functional dissection of SmePPOPROMOTER1 by deletion analyses using Agrobacterium-mediated transient expression in tobacco leaves has shown that MeJA enhances the SmePPOPROMOTER1-?-glucuronidase (GUS) expression in vivo, while SA does not. Histochemical and quantitative GUS assays have also indicated the negative effect of SA on MeJA-induced expression of SmePPOPROMOTER1. By combining in silico analyses, transcriptional profiling and expression of SmePPOPROMOTER1-GUS fusions, the role of SA on the modulation of MeJA-induced SmePPO1 expression has been elucidated. It is concluded that similar to the coding regions of multigenic SmePPOs, the regulatory elements are also evolutionarily conserved and fall into two distinct sub-classes based on their responses to MeJA and SA. PMID:22377322

Shetty, Santoshkumar M; Chandrashekar, Arun; Venkatesh, Yeldur P

2012-05-01

187

Expression of Pisum sativum PsAO3 gene, which encodes an aldehyde oxidase utilizing abscisic aldehyde, is induced under progressively but not rapidly imposed drought stress.  

PubMed

Aldehyde oxidase (AO; EC 1.2.3.1) catalyzes the final step of abscisic acid (ABA) biosynthesis, which is the oxidation of abscisic aldehyde (ABAld) to ABA. Gene expression analyses indicate that the stress-induced Pisum sativum PsAO? isoform, which effectively uses ABAld as a substrate, is encoded by the PsAO3 gene. PsAO3 was heterologously expressed in Pichia pastoris and the recombinant PsAO3 protein revealed substrate preferences highly similar to the native PsAO? protein present in the pea leaves and roots. Both proteins prefer indole-3-aldehyde and naphthaldehyde as substrates, although high activities against abscisic aldehyde and citral were also observed. The Km values of PsAO3 for naphthaldehyde and abscisic aldehyde (4.6 and 5.1 ?M, respectively) were the lowest among the substrates tested. PsAO3 activity was almost completely inhibited by potassium cyanide, diphenyleneiodonium, and methanol. Rapidly imposed drought stress did not increase the level of PsAO3 mRNA or activity of any AO isoform, although an enhanced ABA accumulation and induction of PsNCED2 and -3 (9-cis-epoxycarotenoid dioxygenase; EC 1.13.11.51) expression, both in the pea roots and leaves, was observed. During a progressively induced drought, the level of PsAO3 transcript and PsAO? activity increased significantly in the roots and leaves, whereas ABA accumulation occurred only in the leaves where it was accompanied by induction of the PsNCED3 expression. Therefore, we suppose that next to NCED, also AO (mainly PsAO?) might be involved in regulation of the drought-induced ABA synthesis. However, while the "constitutive activity" of PsAO? is sufficient for the fast generation of ABA under rapid drought stress, the enhanced PsAO? activity is required for the progressive and long-term ABA accumulation in the leaves under progressive drought stress. PMID:23876699

Zdunek-Zastocka, Edyta; Sobczak, Miros?aw

2013-10-01

188

Molecular relationships and classification of several tufted capuchin lineages (Cebus apella, Cebus xanthosternos and Cebus nigritus, Cebidae), by means of mitochondrial cytochrome oxidase II gene sequences.  

PubMed

The morphological systematics of the tufted capuchins is confusing. In an attempt to clarify the complex systematics and phylogeography of this taxon, we provide a first molecular analysis. We obtained mitochondrial cytochrome oxidase II (mtCOII) gene sequences from 49 tufted capuchins that had exact geographic origins from diverse lineages in Colombia, Peru, Bolivia, French Guyana, Brazil, Argentina and Paraguay and that belonged to clearly recognized morphological taxa. This project had 4 main findings: (1) we determined 2 established and related taxa in the northern Amazon River area, which we named C. a. apella and C. a. fatuellus. C. a. apella is distributed from French Guyana until, at least, the Negro River in the northern Brazilian Amazon, whereas C. a. fatuellus is distributed throughout the Colombian Eastern Llanos and the northern Colombian Amazon. We also determined 2 other southern C. apella taxa, which we named C. a. macrodon and C. a. cay. C. a. macrodon has a western and southern Amazon distribution, while C. a. cay has a more southern distribution outside the Amazon basin. (2) In the upper Amazon basin, there is a unique lineage (C. a. macrocephalus) with 1 widely distributed haplotype. The 4 morphological subspecies (C. a. maranonis, C. a. macrocephalus, C. a. peruanus, C. a. pallidus), and maybe a fifth unknown subspecies, described in this area were molecularly undifferentiated at least for the mitochondrial gene analyzed. (3) Our molecular analysis determined that 1 individual of C. robustus fell into the lineage of C. a. macrocephalus. Therefore, this form does not receive any specific name. (4) The animals classified a priori as C. nigritus and C. xanthosternos (because of their morphological phenotypes and by their geographical origins) were clearly differentiated from the other specimens analyzed with the molecular marker employed. Therefore, we consider that these 2 lineages could be assigned the status of full species following the biological species definition. (5) In 2001, Groves described 4 tufted capuchin species (C. apella, C. libidinosus, C. nigritus and C. xanthosternos), while Silva Jr. determined 7 species (C. apella, C. macrocephalus, C. libidinosus, C. cay, C. nigritus, C. robustus and C. xanthosternos). The tests of Swofford-Olsen-Waddell-Hillis, of Shimodaira and Hasegawa and of Templeton did not fit with either of these two classificatory schemes, although Groves' scheme was better with regard to our data than that of Silva Jr. (6) All the temporal splits among the tufted capuchin taxa studied were estimated to have occurred during the last phase of the Pleistocene by using the ? statistic applied to the median joining haplotype network. PMID:23128150

Ruiz-García, Manuel; Castillo, Maria Ignacia; Lichilín-Ortiz, Nicolás; Pinedo-Castro, Myreya

2012-01-01

189

Mitochondrial Cytochrome c Oxidase and F1Fo-ATPase Dysfunction in Peppers (Capsicum annuum L.) with Cytoplasmic Male Sterility and Its Association with orf507 and ?atp6-2 Genes  

PubMed Central

Cytoplasmic male sterility (CMS) in pepper (Capsicum annuum L.) has been associated with novel genes in the mitochondria, such as orf507 and ?atp6-2. Plant sterility has been proved to result from the rearrangement of the mitochondrial genome. Previous studies have demonstrated that orf507 is co-transcribed with the cox II gene, and ?atp6-2 is truncated at the 3? region of the atp6-2 that is found in the maintainer line. Until this time, little has been known about the relationship between the novel gene and the function of its corresponding enzyme in mitochondria from the CMS pepper line. Moreover, the aberrant function of the mitochondrial enzymes is seldom reported in pepper. In this study, we observed that anther abortion occurred after the tetrad stage in the CMS line (HW203A), which was accompanied by premature programmed cell death (PCD) in the tapetum. The spatiotemporal expression patterns of orf507 and ?atp6-2 were analyzed together with the corresponding enzyme activities to investigate the interactions of the genes and mitochondrial enzymes. The two genes were both highly expressed in the anther. The orf507 was down-regulated in HW203A (CMS line), with nearly no expression in HW203B (the maintainer line). In contrast, the cytochrome c oxidase activity in HW203A showed the opposite trend, reaching its highest peak at the tetrad stage when compared with HW203B at the same stage. The ?atp6-2 in the CMS line was also down-regulated, but it was up-regulated in the maintainer line. The corresponding F1Fo-ATPase activity in the CMS line was gradually decreased along with the development of the anther, which showed the same trend for ?atp6-2 gene expression. On the contrary, with up-regulated gene expression of atp6-2 in the maintainer line, the F1Fo-ATPase activity sharply decreased after the initial development stage, but gradually increased following the tetrad stage, which was contrary to what happened in the CMS line. Taken together, all these results may provide evidence for the involvement of aberrant mitochondrial cytochrome c oxidase and F1Fo-ATPase in CMS pepper anther abortion. Moreover, the novel orf507 and ?atp6-2 genes in the mitochondria may be involved in the dysfunction of the cytochrome c oxidase and F1Fo-ATPase, respectively, which are responsible for the abortion of anthers in the CMS line. PMID:23296278

Ji, Jiaojiao; Huang, Wei; Yin, Chuanchuan; Gong, Zhenhui

2013-01-01

190

Severity of ulcerative colitis is associated with a polymorphism at diamine oxidase gene but not at histamine N-methyltransferase gene  

Microsoft Academic Search

AIM: To analyse the role of two common polymorphisms in genes coding for histamine metabolising enzymes as it relates to the risk to develop ulcerative colitis (UC) and the clinical course of these patients. METHODS: A cohort of 229 unrelated patients with UC recruited from a single centre and 261 healthy volunteers were analysed for the presence of Thr105Ile and

Elena García-Martín; Juan L Mendoza; Carmen Martínez; Carlos Taxonera; Elena Urcelay; José M Ladero; Emilio G de la Concha; Manuel Díaz-Rubio; Mendoza JL

2006-01-01

191

Localizing NADPH Oxidase-Derived ROS  

NSDL National Science Digital Library

Reactive oxygen species (ROS) function as signaling molecules to mediate various biological responses, including cell migration, growth, and gene expression. ROS are diffusible and short-lived molecules. Thus, localizing the ROS signal at the specific subcellular compartment is essential for activating redox signaling events after receptor activation. NADPH (nicotinamide adenine dinucleotide phosphate) oxidase is one of the major sources of ROS in vasculature; it consists of a catalytic subunit (Nox1, Nox2, Nox3, Nox4, or Nox5), p22phox, p47phox, p67phox, and the small guanosine triphosphatase Rac1. Targeting of NADPH oxidase to focal complexes in lamellipodia and membrane ruffles through the interaction of p47phox with the scaffold proteins TRAF4 and WAVE1 provides a mechanism for achieving localized ROS production, which is required for directed cell migration. ROS are believed to inactivate protein tyrosine phosphatases, which concentrate in specific subcellular compartments, thereby establishing a positive feedback system that activates redox signaling pathways to promote cell movement. Additionally, ROS production may be localized through interactions of NADPH oxidase with signaling platforms associated with lipid rafts and caveolae, as well as with endosomes. There is also evidence that NADPH oxidase is found in the nucleus, indicating its involvement in redox-responsive gene expression. This review focuses on targeting of NADPH oxidase to discrete subcellular compartments as a mechanism of localizing ROS and activation of downstream redox signaling events that mediate various cell functions.

Masuko Ushio-Fukai (IL; University of Illinois College of Medicine, Chicago REV)

2006-08-22

192

Coniferyl alcohol oxidase — a catechol oxidase?  

Microsoft Academic Search

The physico-chemical properties of coniferyl alcohol oxidase (CAO), a copper containing glycoprotein spatiotemporally associated with lignification in conifers, is reported here. By electron paramagnetic resonance spectroscopy, only type 3 copper was indicated in CAO. CAO oxidizes several laccase substrates; however, it is not a blue-copper protein and monoclonal antibodies against both native and deglycosylated CAO did not recognize any of

Preethi V. Udagama-Randeniya; Rodney A. Savidge

1995-01-01

193

[Genetic divergence of Vipera berus and Vipera nikolskii (Reptilia: Viperidae, Vipera) populations in lower Volga and adjacent territories assessed according to the sequences of cytochrome oxidase III 12S ribosome RNA genes].  

PubMed

The nucleotide sequences of mitochondrial genome fragments containing the genes coding for cytochrome oxidase subunit III (COIII) and 12S ribosomal RNA of common European viper and Nikolsky's viper from various habitats (Saratov, Samara, and Penza oblasts; Chuvash Republic; and the Republic of Mordovia) were determined. According to the sequencing data, all samples clustered into two groups except for a number of individuals carrying single mutations in the genes in question. One group comprised V. nikolskii from Saratov oblast and the other, V. berus from the Chuvash Republic, Republic of Mordovia, and Samara and Penza oblasts. These results comply with the available data on the karyotypes of the studied vipers of this region. Further genetic studies of V. nikolskii and V. berus from various parts of this area are necessary. PMID:18619049

Efimov, R V; Zav'ialov, E V; Velikov, V A; Tabachishin, V G

2008-02-01

194

Tyrosinase and Catechol Oxidase  

Microsoft Academic Search

THE nature of tyrosinase has been under discussion for a very long time. Raper and his school1, Graubard and Nelson2, and Keilin and Mann3 believe it to be a distinct enzyme, different from catechol oxidase. Onslow and Robinson4, McCance5, and Richter6 believe it to be a catechol oxidase plus o-chinone plus dehydrogenase. Kubowitz7, whose work appeared in a recent issue

L. Califano; D. Kertesz

1938-01-01

195

Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA  

PubMed Central

Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.

2011-01-01

196

Depression of enzyme activities and gene expression of ACC synthase and ACC oxidase in cut carnation flowers under high-temperature conditions  

Microsoft Academic Search

High-temperature depression of ethylene production in cut carnation flowers cv. ‘Excerea’ can occur because of inhibition\\u000a of ACC synthase (ACS) and ACC oxidase (ACO) activities in flowers. Large differences were apparent between ACS activity in\\u000a petals at 24°C and 32°C. These ACC-accumulation-related activities were markedly decreased in petals at 32°C, indicating that\\u000a a low ACS activity and ACC accumulation in

Pranom Yangkhamman; Koji Tanase; Kazuo Ichimura; Seiichi Fukai

2007-01-01

197

Structural and functional impairment of mitochondria in adriamycin-induced cardiomyopathy in mice: suppression of cytochrome c oxidase II gene expression  

Microsoft Academic Search

The use of adriamycin (ADR) in cancer chemotherapy has been limited due to its cumulative cardiovascular toxicity. Earlier observations that ADR interacts with mitochondrial cytochrome c oxidase (COX) and suppresses its enzyme activity led us to investigate ADR’s action on the cardiovascular functions and heart mitochondrial morphology in Balb-c mice i.p. treated with ADR for several weeks. At various times

Lefkothea C Papadopoulou; George Theophilidis; George N Thomopoulos; Asterios S Tsiftsoglou

1999-01-01

198

Copper deficiency leads to anemia, duodenal hypoxia, upregulation of HIF-2? and altered expression of iron absorption genes in mice.  

PubMed

Iron and copper are essential trace metals, actively absorbed from the proximal gut in a regulated fashion. Depletion of either metal can lead to anemia. In the gut, copper deficiency can affect iron absorption through modulating the activity of hephaestin - a multi-copper oxidase required for optimal iron export from enterocytes. How systemic copper status regulates iron absorption is unknown. Mice were subjected to a nutritional copper deficiency-induced anemia regime from birth and injected with copper sulphate intraperitoneally to correct the anemia. Copper deficiency resulted in anemia, increased duodenal hypoxia and Hypoxia inducible factor 2? (HIF-2?) levels, a regulator of iron absorption. HIF-2? upregulation in copper deficiency appeared to be independent of duodenal iron or copper levels and correlated with the expression of iron transporters (Ferroportin - Fpn, Divalent Metal transporter - Dmt1) and ferric reductase - Dcytb. Alleviation of copper-dependent anemia with intraperitoneal copper injection resulted in down regulation of HIF-2?-regulated iron absorption genes in the gut. Our work identifies HIF-2? as an important regulator of iron transport machinery in copper deficiency. PMID:23555700

Matak, Pavle; Zumerle, Sara; Mastrogiannaki, Maria; El Balkhi, Souleiman; Delga, Stephanie; Mathieu, Jacques R R; Canonne-Hergaux, François; Poupon, Joel; Sharp, Paul A; Vaulont, Sophie; Peyssonnaux, Carole

2013-01-01

199

On the amine oxidases of Klebsiella aerogenes strain W70.  

PubMed

Klebsiella aerogenes W70 was reported previously to produce a membrane-associated tyramine oxidase (TynA) that did not act on 2-phenylethylamine. Subsequently, a gene cloned from K. aerogenes W70 produced a soluble amine oxidase (MaoA) that acted readily on 2-phenylethylamine and tyramine. This enzyme appeared to be equivalent to a 2-phenylethylamine oxidase of Escherichia coli K-12 (MaoA) but was assumed to be the originally described K. aerogenes W70 tyramine oxidase (TynA). However, as described here, whole cells and cell-free extracts of K. aerogenes W70 showed only the tyramine oxidase (TynA) that is inactive against 2-phenylethylamine and not the maoA gene product. It seems that the organism has two amine oxidase genes, tynA and maoA, but only tynA is expressed. Hence, data relating to the expression of the K. aerogenes W70 tynA gene cannot be assumed to apply to the maoA gene of E. coli K-12 because they encode different enzymes. PMID:8997710

Cooper, R A

1997-01-01

200

Cholesterol oxidase: biotechnological applications.  

PubMed

Cholesterol oxidase is a bacterial FAD-containing flavooxidase that catalyzes the first reaction in cholesterol catabolism. Indeed, this enzyme catalyzes two reactions: the oxidation of the C(3)-OH group of cholesterol (and other sterols) to give cholest-5-en-3-one; and its isomerization to cholest-4-en-3-one. In the past several years, the structural and functional characterization of cholesterol oxidase has been developed together with its application as a biological tool. Cholesterol oxidase has been used in biocatalysis for the production of a number of steroids, as an insecticidal protein against boll weevil larvae and, in particular, as a diagnostic enzyme for determining serum levels of cholesterol. These applications prompted various laboratories worldwide to isolate this flavooxidase from different sources and to improve its properties by protein engineering, further increasing our knowledge on its structure-function relationships. These studies also discovered new physiological roles for cholesterol oxidase (e.g. in virulence and as an antifungal sensor). We assume that the investigations of cholesterol oxidase and its applications will continue to grow quickly in the near future, in particular to uncover unexpected, new areas of application. PMID:19843167

Pollegioni, Loredano; Piubelli, Luciano; Molla, Gianluca

2009-12-01

201

The structure and inhibition of human diamine oxidase†,‡  

PubMed Central

Humans have three functioning genes that code for copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 Å. The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9 % sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 Å and 2.2 Å, respectively. They bind non-covalently in the active site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O.; Brown, Doreen E; Dooley, David M; Guss, J Mitchell

2009-01-01

202

Evolution of a unique mitotype-specific protein-coding extension of the cytochrome c oxidase II gene in freshwater mussels (Bivalvia: Unionoida).  

PubMed

A unique mode of mitochondrial DNA inheritance, designated doubly-uniparental inheritance (DUI), occurs in three bivalve subclasses (Pteriomorpha: Mytiloida, Palaeoheterodonta: Unionoida, Heterodonta: Veneroida), indicating that DUI may be a widespread phenomenon among bivalves. In mytiloids, breakdown of this pattern of inheritance (gender-switching) is observed in natural populations and in a phylogenetic context. In contrast, gender-switching has not occurred during the evolutionary history of unionoids. Here we present sequences for the male (M) and female (F) mitotypes from an additional 8 species of Unionoida. Consistent with previous observations, the M and F mitotypes of all species form reciprocally monophyletic clades supporting the hypothesis of taxon-specific rates of gender-switching. Coinciding with the absence of gender-switching is an approximately 185 codon extension of the cytochrome c oxidase II (MTCO2) locus in the male genome. The extension is present in all 12 unionoid species examined, including a representative of the family Margaritiferidae, indicating that this protein-coding polymorphism originated > or = 200 MYBP: . Although the extension is well conserved in length among 11 of the 12 species, one taxon has a significantly shortened extension. Lastly, examination of the rates and patterns of substitution indicate that the extension is evolving under relaxed purging selection, a pattern inconsistent with the conserved nature of MTCO2 or any cytochrome c oxidase locus. PMID:16082567

Curole, Jason P; Kocher, Thomas D

2005-09-01

203

Diamine oxidase in the hen  

Microsoft Academic Search

In adult hens diamine oxidase (histaminase) activity was found in gastrointestinal tract (with the highest value in ileum), liver and spleen. Intestinal diamine oxidase is predominantly a particle-bound enzyme. In the intestine oxidation of putrescine leads to ?-pyrroline formation, in liver both ?1-pyrroline and ?-aminobutyric acid are formed. The inhibitor properties of hen intestinal and rat intestinal diamine oxidases are

T. Biega?ski; Maria A. Ulatowska

1983-01-01

204

Inventory control: cytochrome c oxidase assembly regulates mitochondrial translation.  

PubMed

Mitochondria maintain genome and translation machinery to synthesize a small subset of subunits of the oxidative phosphorylation system. To build up functional enzymes, these organellar gene products must assemble with imported subunits that are encoded in the nucleus. New findings on the early steps of cytochrome c oxidase assembly reveal how the mitochondrial translation of its core component, cytochrome c oxidase subunit 1 (Cox1), is directly coupled to the assembly of this respiratory complex. PMID:21179059

Mick, David U; Fox, Thomas D; Rehling, Peter

2011-01-01

205

Cloning and functional expression of the mitochondrial alternative oxidase gene (aox1) of Aspergillus niger in Lactococcus lactis and its induction by oxidizing conditions.  

PubMed

Lactococcus lactis is a widely used food bacterium mainly known for its fermentation metabolism. An important, and for long time overlooked, trait of this species is its ability to perform respiratory metabolism in the presence of heme and under aerobic conditions. There is no evidence however for the presence of an alternative respiration pathway and AOX activity. In this study, a cDNA fragment encoding the mitochondrial alternative oxidase, the enzyme responsible for alternative respiration, from a citric acid producing Aspergillus niger strain was cloned and expressed in L. lactis as a host strain. Expression of aox1 conferred on this organism cyanide-resistant and salicylhydroxamate-sensitive growth. Bioreactor cultures under fully aerobic conditions of the transformed L. lactis showed that the alternative respiratory pathway operates and improves significantly the microorganism's response to oxidizing stress conditions as it enhances biomass production, suppresses lactate formation, and leads to accumulation of large amounts of nisin. PMID:22133435

Papagianni, Maria; Avramidis, Nicholaos

2012-01-01

206

NADPH Oxidase 4 Regulates Cardiomyocyte Differentiation via Redox Activation of c-Jun Protein and the cis-Regulation of GATA-4 Gene Transcription*  

PubMed Central

NADPH oxidase 4 (Nox4) generates reactive oxygen species (ROS) that can modulate cellular phenotype and function in part through the redox modulation of the activity of transcription factors. We demonstrate here the potential of Nox4 to drive cardiomyocyte differentiation in pluripotent embryonal carcinoma cells, and we show that this involves the redox activation of c-Jun. This in turn acts to up-regulate GATA-4 expression, one of the earliest markers of cardiotypic differentiation, through a defined and highly conserved cis-acting motif within the GATA-4 promoter. These data therefore suggest a mechanism whereby ROS act in pluripotential cells in vivo to regulate the initial transcription of critical tissue-restricted determinant(s) of the cardiomyocyte phenotype, including GATA-4. The ROS-dependent activation, mediated by Nox4, of widely expressed redox-regulated transcription factors, such as c-Jun, is fundamental to this process. PMID:23589292

Murray, Thomas V. A.; Smyrnias, Ioannis; Shah, Ajay M.; Brewer, Alison C.

2013-01-01

207

Polyamine Oxidase5 Regulates Arabidopsis Growth through Thermospermine Oxidase Activity.  

PubMed

The major plant polyamines (PAs) are the tetraamines spermine (Spm) and thermospermine (T-Spm), the triamine spermidine, and the diamine putrescine. PA homeostasis is governed by the balance between biosynthesis and catabolism; the latter is catalyzed by polyamine oxidase (PAO). Arabidopsis (Arabidopsis thaliana) has five PAO genes, AtPAO1 to AtPAO5, and all encoded proteins have been biochemically characterized. All AtPAO enzymes function in the back-conversion of tetraamine to triamine and/or triamine to diamine, albeit with different PA specificities. Here, we demonstrate that AtPAO5 loss-of-function mutants (pao5) contain 2-fold higher T-Spm levels and exhibit delayed transition from vegetative to reproductive growth compared with that of wild-type plants. Although the wild type and pao5 are indistinguishable at the early seedling stage, externally supplied low-dose T-Spm, but not other PAs, inhibits aerial growth of pao5 mutants in a dose-dependent manner. Introduction of wild-type AtPAO5 into pao5 mutants rescues growth and reduces the T-Spm content, demonstrating that AtPAO5 is a T-Spm oxidase. Recombinant AtPAO5 catalyzes the conversion of T-Spm and Spm to triamine spermidine in vitro. AtPAO5 specificity for T-Spm in planta may be explained by coexpression with T-Spm synthase but not with Spm synthase. The pao5 mutant lacking T-Spm oxidation and the acl5 mutant lacking T-Spm synthesis both exhibit growth defects. This study indicates a crucial role for T-Spm in plant growth and development. PMID:24906355

Kim, Dong Wook; Watanabe, Kanako; Murayama, Chihiro; Izawa, Sho; Niitsu, Masaru; Michael, Anthony J; Berberich, Thomas; Kusano, Tomonobu

2014-06-01

208

Two novel mutations and coexistence of the 991C>T and the 1339C>T mutation on a single allele in the coproporphyrinogen oxidase gene in Swedish patients with hereditary coproporphyria.  

PubMed

Hereditary coproporphyria (HCP) is an autosomal dominant disorder, resulting from a partial deficiency of the enzyme coproporphyrinogen oxidase (CPO). This enzyme catalyzes the sixth step of the heme biosynthetic pathway, and mutations in the CPO gene have been coupled to HCP. The present study was undertaken to identify disease-producing mutations in the CPOgene in nine Swedish families with HCP. Exon 1 of the CPO gene of the nine probands was analyzed directly by sequencing, and exons 2-7 were screened by denaturating gradient gel electrophoresis, followed by sequencing of exons showing abnormal band pattern. Mutations were detected in five of the nine families. In two of these families, the novel mutations 623C>T (S208F, exon 2) and 982C>T (R328C, exon 5) were identified, respectively. In the affected members of the other three families, the previously reported mutations 991C>T (R331W, exon 5) and 1339C>T (R447C, exon 7) were shown to coexist on one allele. The present study contributes 2 novel mutations to the 34 that have been previously reported to cause HCP. In addition, this is the first report on patients carrying two HCP-coupled mutations on one allele. PMID:12181641

Wiman, Asa; Floderus, Ylva; Harper, Pauline

2002-01-01

209

Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach  

NASA Astrophysics Data System (ADS)

Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43°C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4°C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn oxidases McoA and MopA. The greater diversity of Mn oxidase pathways in this metagenome suggests a more diverse Mn oxidizing microbial community in the cold pumice sample. Key enzymes for four of the six known carbon fixation pathways (the Calvin Cycle, the reductive TCA cycle, the Wood-Ljungdahl pathway, and the 3-hydroxypropionate/4-hydroxybutyrate Cycle) were also identified in both samples indicating primary production occurs via a diverse community of carbon fixing organisms. Together, these samples contain active, diverse populations of Mn oxidizing bacteria living in association with microbial communities supported by chemoautotrophic carbon fixation.

Davis, R.; Tebo, B. M.

2013-12-01

210

A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity.  

PubMed

Rheumatoid arthritis (RA) is a chronic inflammatory disease with a heritability of 60%. Genetic contributions to RA are made by multiple genes, but only a few gene associations have yet been confirmed. By studying animal models, reduced capacity of the NADPH-oxidase (NOX) complex, caused by a single nucleotide polymorphism (SNP) in one of its components (the NCF1 gene), has been found to increase severity of arthritis. To our knowledge, however, no studies investigating the potential role played by reduced reactive oxygen species production in human RA have yet been reported. In order to examine the role played by the NOX complex in RA, we investigated the association of 51 SNPs in five genes of the NOX complex (CYBB, CYBA, NCF4, NCF2, and RAC2) in a Swedish case-control cohort consisting of 1,842 RA cases and 1,038 control individuals. Several SNPs were found to be mildly associated in men in NCF4 (rs729749, P = 0.001), NCF2 (rs789181, P = 0.02) and RAC2 (rs1476002, P = 0.05). No associations were detected in CYBA or CYBB. By stratifying for autoantibody status, we identified a strong association for rs729749 (in NCF4) in autoantibody negative disease, with the strongest association detected in rheumatoid factor negative men (CT genotype versus CC genotype: odds ratio 0.34, 95% confidence interval 0.2 to 0.6; P = 0.0001). To our knowledge, this is the first genetic association identified between RA and the NOX complex, and it supports previous findings from animal models of the importance of reactive oxygen species production capacity to the development of arthritis. PMID:17897462

Olsson, Lina M; Lindqvist, Anna-Karin; Källberg, Henrik; Padyukov, Leonid; Burkhardt, Harald; Alfredsson, Lars; Klareskog, Lars; Holmdahl, Rikard

2007-01-01

211

Ascorbate Oxidase-Dependent Changes in the Redox State of the Apoplast Modulate Gene Transcript Accumulation Leading to Modified Hormone Signaling and Orchestration of Defense Processes in Tobacco1[W  

PubMed Central

The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca2+ channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli. PMID:16603663

Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J.; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H.

2006-01-01

212

Cytokinin Oxidase from Wheat  

PubMed Central

As part of the study of the possible role(s) of CBF-1, a cytokinin-binding protein abundant in wheat embryo, a cytokinin oxidase was found in wheat (Triticum aestivum L.) germ and partially purified by conventional purification techniques and high performance chromatofocusing. This preparation catalyzes conversion of N6-(?2-isopentenyl)adenosine to adenosine at a Vmax of 0.4 nanomol per milligram protein per minute at 30°C and pH 7.5, the Km being 0.3 micromolar. This high affinity and the apparent molecular weight of 40,000 estimated by high performance gel permeation on a Spherogel TSK-3000 SW column indicate that this enzyme is different from other cytokinin oxidases previously reported. Oxygen is required for the reaction, as for other cytokinin oxidases already described. N6-(?2-isopentenyl)adenine and zeatin riboside are also degraded, but N6-(?2-isopentenyl)adenosine-5?-monophosphate is apparently not a substrate. Benzyladenine is degraded, but to a small extent, and it inhibits slightly the degradation of N6-(?2-isopentenyl)adenosine. The degradation of N6-(?2-isopentenyl)adenosine is strongly inhibited by diphenylurea and its highly active derivative N-(2-chloro-4-pyridyl)-N?-phenylurea. PMID:16666895

Laloue, Michel; Fox, J. Eugene

1989-01-01

213

Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.  

PubMed

The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an ?-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other ?-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the ?/?-Proteobacteria (?-type UOX), distinct from the ?/?-Proteobacterial proteins (?-type UOX), but different from the other ?-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional ?-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by ?/?-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu

2014-10-01

214

Genetic characterization of the partial mitochondrial cytochrome oxidase c subunit I (cox 1) gene of the zoonotic parasitic nematode, Ancylostoma ceylanicum from humans, dogs and cats.  

PubMed

Ancylostoma ceylanicum is the only zoonotic hookworm species that is able to produce patent infections in humans with the majority of cases reported in South East Asia. Over the past few years, there have been an increasing number of studies investigating the prevalence of this parasitic zoonosis using molecular diagnostic tools and a single genetic locus as marker for species identification. As there can be limitations in using a single genetic locus for epidemiological studies and genetic discrimination, the complementary use of a more variable locus will provide additional evidence to support the zoonotic exchange of hookworm species between humans and animals. In the present study, the cytochrome c oxidase subunit 1 (cox 1) sequence of A. ceylanicum from positive human and animal fecal samples were determined and compared with published reference sequences. Phylogenetic analysis demonstrated that isolates of A. ceylanicum were divided into two clusters, one consisting 3 human isolates and the other comprising 19 isolates of human and animal origin from different geographical locations within Malaysia. The two groups of A. ceylanicum could be distinguished from one another through five fixed nucleotide differences at locations 891, 966, 1008, 1077 and 1083. The detection of genetically distinct groups and considerable level of genetic variation within the cox 1 sequence of A. ceylanicum might suggest potential haplotype-linked differences in zoonotic, epidemiological and pathobiological characteristics, a hypothesis that still needs further investigation. PMID:23774318

Ngui, Romano; Mahdy, Mohammed A K; Chua, Kek Heng; Traub, Rebecca; Lim, Yvonne A L

2013-10-01

215

Improved detection of malaria cases in island settings of Vanuatu and Kenya by PCR that targets the Plasmodium mitochondrial cytochrome c oxidase III (cox3) gene.  

PubMed

Detection of sub-microscopic parasitemia is crucial for all malaria elimination programs. PCR-based methods have proven to be sensitive, but two rounds of amplification (nested PCR) are often needed to detect the presence of Plasmodium DNA. To simplify the detection process, we designed a nested PCR method whereby only the primary PCR is required for the detection of the four major human Plasmodium species. Primers designed for the detection of the fifth species, Plasmodium knowlesi, were not included in this study due to the absence of appropriate field samples. Compared to the standard 18S rDNA PCR method, our cytochrome c oxidase III (cox3) method detected 10-50% more cases while maintaining high sensitivities (1.00) for all four Plasmodium species in our samples from Vanuatu (n=77) and Kenya (n=76). Improvement in detection efficiency was more substantial for samples with sub-microscopic parasitemia (54%) than those with observable parasitemia (10-16%). Our method will contribute to improved malaria surveillance in low endemicity settings. PMID:25256904

Isozumi, Rie; Fukui, Mayumi; Kaneko, Akira; Chan, Chim W; Kawamoto, Fumihiko; Kimura, Masatsugu

2014-09-22

216

TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4  

SciTech Connect

Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D. [Department of Biochemistry, Whitaker Cardiovascular Institute, Boston University School of Medicine, 715 Albany Street, Boston, MA 02118 (United States); Ravid, Katya [Department of Biochemistry, Whitaker Cardiovascular Institute, Boston University School of Medicine, 715 Albany Street, Boston, MA 02118 (United States)], E-mail: ravid@biochem.bumc.bu.edu

2008-10-24

217

Natural Compounds as Modulators of NADPH Oxidases  

PubMed Central

Reactive oxygen species (ROS) are cellular signals generated ubiquitously by all mammalian cells, but their relative unbalance triggers also diseases through intracellular damage to DNA, RNA, proteins, and lipids. NADPH oxidases (NOX) are the only known enzyme family with the sole function to produce ROS. The NOX physiological functions concern host defence, cellular signaling, regulation of gene expression, and cell differentiation. On the other hand, increased NOX activity contributes to a wide range of pathological processes, including cardiovascular diseases, neurodegeneration, organ failure, and cancer. Therefore targeting these enzymatic ROS sources by natural compounds, without affecting the physiological redox state, may be an important tool. This review summarizes the current state of knowledge of the role of NOX enzymes in physiology and pathology and provides an overview of the currently available NADPH oxidase inhibitors derived from natural extracts such as polyphenols. PMID:24381714

2013-01-01

218

DEVELOPMENTAL REGULATION OF PEACH ACC OXIDASE-GUS FUSIONS IN TRANSGENIC TOMATO FRUITS  

Technology Transfer Automated Retrieval System (TEKTRAN)

Fruit ripening involves changes in the expression of a large number of genes including the well-characterized 1-Aminocyclopropane-1-caboxylic acid oxidase which catalyzes the conversion of 1-aminocyclopropane-1-caboxylate to ethylene. We isolated a genomic DNA sequence encoding ACC oxidase from pea...

219

Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.  

PubMed

The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. PMID:22759530

Papagianni, Maria; Avramidis, Nicholaos

2012-08-10

220

Role of amine oxidase expression to maintain putrescine homeostasis in Rhodococcus opacus.  

PubMed

While applications of amine oxidases are increasing, few have been characterised and our understanding of their biological role and strategies for bacteria exploitation are limited. By altering the nitrogen source (NH4Cl, putrescine and cadaverine (diamines) and butylamine (monoamine)) and concentration, we have identified a constitutive flavin dependent oxidase (EC 1.4.3.10) within Rhodococcus opacus. The activity of this oxidase can be increased by over two orders of magnitude in the presence of aliphatic diamines. In addition, the expression of a copper dependent diamine oxidase (EC 1.4.3.22) was observed at diamine concentrations>1mM or when cells were grown with butylamine, which acts to inhibit the flavin oxidase. A Michaelis-Menten kinetic treatment of the flavin oxidase delivered a Michaelis constant (KM)=190?M and maximum rate (kcat)=21.8s(-1) for the oxidative deamination of putrescine with a lower KM (=60?M) and comparable kcat (=18.2s(-1)) for the copper oxidase. MALDI-TOF and genomic analyses have indicated a metabolic clustering of functionally related genes. From a consideration of amine oxidase specificity and sequence homology, we propose a putrescine degradation pathway within Rhodococcus that utilises oxidases in tandem with subsequent dehydrogenase and transaminase enzymes. The implications of PUT homeostasis through the action of the two oxidases are discussed with respect to stressors, evolution and application in microbe-assisted phytoremediation or bio-augmentation. PMID:23540932

Foster, Alexander; Barnes, Nicole; Speight, Robert; Morris, Peter C; Keane, Mark A

2013-04-10

221

Polyamine Oxidase and Diamine Oxidase Activities in Acute Ureteral Obstruction  

Microsoft Academic Search

The polyamines (spermine, spermidine and putrescine) are present in all mammalian cells. These are essential for the normal growth and differentiation of animal tissues [1]. Their levels may dramatically increase in body fluids as a consequence of tissue damage and regeneration [2]. The major catabolic pathway for polyamines is oxidative deamination by polyamine oxidase (PAO) [3]. Diamine oxidase (EC 1.4.3.6)

1998-01-01

222

Catechol oxidase — structure and activity  

Microsoft Academic Search

Recently determined structures of copper-containing plant catechol oxidase in three different catalytic states have provided new insights into the mechanism of this enzyme and its relationship to other copper type-3 proteins. Moreover, the active site of catechol oxidase has been found to be structurally conserved with the oxygen-binding site of a molluscan hemocyanin.

Christoph Eicken; Bernt Krebs; James C Sacchettini

1999-01-01

223

The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes  

PubMed Central

Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

2013-01-01

224

STIM1 for stimulation of phagocyte NADPH oxidase.  

PubMed

In this issue of Blood, Zhang et al show that mice lacking the stromal-interacting molecule 1 (STIM1) gene in bone marrow cells are more susceptible to bacterial infection but are resistant to ischemia/reperfusion injury because of defective activation of phagocyte nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. PMID:24700712

Ye, Richard D

2014-04-01

225

Molecular abnormalities of coproporphyrinogen oxidase in patients with hereditary coproporphyria  

Microsoft Academic Search

Genetic defects of coproporphyrinogen oxidase (CPO) lead to hereditary coproporphyria, an inherited autosomal dominant porphyria. The recent cloning of human cDNAs and of the gene encoding CPO permits deducing the primary structure of the CPO protein and elucidating the molecular basis of HC in some families.

Bernard Grandchamp; Jerome Lamoril; Hervé Puy

1995-01-01

226

Characterisation of full-length mitochondrial copies and partial nuclear copies (numts) of the cytochrome b and cytochrome c oxidase subunit I genes of Toxoplasma gondii, Neospora caninum, Hammondia heydorni and Hammondia triffittae (Apicomplexa: Sarcocystidae).  

PubMed

Genomic DNA was extracted from three oocyst isolates of Hammondia triffittae from foxes and two oocyst isolates of Hammondia heydorni from dogs, as well as from cell culture-derived tachyzoites of Toxoplasma gondii (RH strain) and Neospora caninum (NC-Liverpool strain), and examined by PCR with primers targeting the cytochrome b (cytb) and the cytochrome c oxidase subunit I (cox1) genes in order to characterise both genes and, if possible, the remainder of the mitochondrial genome of these species. Several primers were designed and used in various combinations to amplify regions within and between both genes and to determine gene order. When certain forward primers targeting cytb were used in combination with certain reverse primers targeting cox1, two overlapping sequences were obtained for each species and isolate studied, which showed that a full-length copy of cytb was followed 36-37 bp downstream by a full-length copy of cox1, and these sequences are believed to represent the true mitochondrial genes and the gene order in the mitochondrial genome of the four species examined. The cytb of T. gondii, N. caninum, H. heydorni and H. triffittae comprised a total of 1,080 bp (359 amino acids) and used ATG and TAA as start and stop codon, respectively. The cox1 of these species also used TAA as stop codon, whereas the most likely start codon was ATG, resulting in a gene comprising 1,491 bp (496 amino acids). Pair-wise sequence comparisons based on either cytb or cox1 clearly separated T. gondii from N. caninum and both of these species from the two Hammondia species, whereas the latter two species were 100 % identical at cytb and shared 99.3 % identity at cox1. Phylogenetic analyses using the maximum-likelihood method confirmed these findings and placed T. gondii in a clade separate from the three other species and all four Toxoplasmatinae in a sister clade to Eimeria spp. PCR with other primers and/or primer pairs than those used to obtain the full-length mitochondrial genes yielded several types of about 1-1.5 kb long sequences, which comprised stretches of the primer-targeted genes at both ends and an intervening non-coding sequence of various length and composition. Thus, portions of cytb could be found both upstream and downstream from portions of cox1 and portions of the same gene could be found adjacent to each other (cytb?cox1; cox1?cytb; cytb?cytb; cox1?cox1). Sequence comparisons revealed that some of these gene fragments were truncated genes, whereas others included the putative start or stop codon of the full-length mitochondrial genes. From the nature of the gene fragments and/or their flanking sequences, they are assumed to be located on the chromosomes of the nuclear genome and to represent nuclear mitochondrial DNA segments (numts) or pseudogenes. In the four species examined, there were no nucleotide differences between the full-length mitochondrial copies of cytb and cox1 and their various incomplete nuclear counterparts. With a few exceptions, identical numt types and closely similar flanking sequences were obtained for all four species, which would indicate that the original transfer of these mitochondrial genes to the nuclear genome and/or the majority of any subsequent rearrangements of these gene fragments within the nuclear genome happened before the four species diverged. Yet, there were species-specific differences in the nucleotide composition of the nuclear gene fragments, identical to the differences in the mitochondrial genes, which would indicate that the incomplete nuclear copies of cytb and cox1 have been continuously updated during evolution to conform to their mitochondrial parent genes. The PCR-based findings of numts were further supported by Basic Local Alignment Search Tool (BLAST) searches against genome sequences of T. gondii and N. caninum using the concatenated mitochondrial cytb/cox1 sequences as queries. These searches revealed the presence of numerous numts of eighth distinct types in both species, with each one having a fixed starting and end point with respect t

Gjerde, Bjørn

2013-04-01

227

Three polyphenol oxidases from hybrid poplar are differentially expressed during development and after wounding and elicitor  

E-print Network

.10.3.1) genes was investigated in hybrid poplar (Populus trichocarpa · P.deltoides). PtdPPO1 was previously, polyphenol oxidase; TD, P. trichocarpa � P. deltoides. 344 Physiol. Plant. 122, 2004 #12;PPOs are often

Constabel, Peter

228

Transgenic cell lines as a useful tool to study the biochemistry of down-regulation of an endogenous rice gene using a heterologous diamine-oxidase cDNA  

Microsoft Academic Search

Transgenic rice (Oryza sativa L.) cell lines engineered with the pea diamine oxidase cDNA in antisense orientation under the control of two different promoters were recovered using particle bombardment. Plasmids p35Sdaoa and pEdaoa contained the pea diamine oxidase cDNA driven by the CaMV35S and the pea ENOD12 nodulin promoter, respectively. Molecular analyses confirmed the stable integration of the transgene and

Ludovic Bassie; Matthiew Noury; Jean Pierre Wisniewski; Lola Topsom; Paul Christou; Teresa Capell

2000-01-01

229

The Escherichia coli CydX Protein Is a Member of the CydAB Cytochrome bd Oxidase Complex and Is Required for Cytochrome bd Oxidase Activity  

PubMed Central

Cytochrome bd oxidase operons from more than 50 species of bacteria contain a short gene encoding a small protein that ranges from ?30 to 50 amino acids and is predicted to localize to the cell membrane. Although cytochrome bd oxidases have been studied for more than 70 years, little is known about the role of this small protein, denoted CydX, in oxidase activity. Here we report that Escherichia coli mutants lacking CydX exhibit phenotypes associated with reduced oxidase activity. In addition, cell membrane extracts from ?cydX mutant strains have reduced oxidase activity in vitro. Consistent with data showing that CydX is required for cytochrome bd oxidase activity, copurification experiments indicate that CydX interacts with the CydAB cytochrome bd oxidase complex. Together, these data support the hypothesis that CydX is a subunit of the CydAB cytochrome bd oxidase complex that is required for complex activity. The results of mutation analysis of CydX suggest that few individual amino acids in the small protein are essential for function, at least in the context of protein overexpression. In addition, the results of analysis of the paralogous small transmembrane protein AppX show that the two proteins could have some overlapping functionality in the cell and that both have the potential to interact with the CydAB complex. PMID:23749980

VanOrsdel, Caitlin E.; Bhatt, Shantanu; Allen, Rondine J.; Brenner, Evan P.; Hobson, Jessica J.; Jamil, Aqsa; Haynes, Brittany M.; Genson, Allyson M.

2013-01-01

230

[Identification of Ixodes persulcatus and Ixodes pavlovskyi occidentalis (Ixodidae) by the analysis of the gene fragment COXI (cytochrome oxidase subunit I)].  

PubMed

Ticks of the genus Ixodes were collected in 2010 in the lowland part of Toguchinsk district of Novosibirsk Province (Russia) and in the forest-park area of Novosibirsk Scientific Centre and its outskirts (Sovetskiy district of Novosibirsk), and identified as Ixodes persulcatus (Schulze, 1930) (18 females and 13 males) and Ixodes pavlovskyi (13 females and 10 males). Ten specimens of each sex from each collecting site were examined. The following nine characters were used: the length and width of the scutum (conscutum) and of the gnathosoma in ventral view; the length of palpal segments II-III; the width of the hypostome; the length of idiosoma with scapula, of leg I, of the medial spur on fore coxa (Taiga..., 1985; Filippova, Musatov, 1996; Filippova, Panova, 1998). According to morphometric characters, specimens of Ixodes pavlovskyi collected in the forest-park area of the Novosibirsk Scientific Centre were identified as the subspecies I. p. occidentalis Filippova et Panova, 1998. Nucleotide sequences of the COI mitochondrial gene fragment were determined for 56 ticks. Phylogenetic analysis of the COI gene fragment in representatives of the persulcatus-ricinus species-group dwelling in Asia demonstrated high degree of conservatism. Molecular-genetic methods allow reliable identification of morphologically similar species I. pavlovskyi and I. persulcatus, pathogenic for humans. PMID:23458013

Livanova, N N; Tikunova, N V; Livanov, S G; Fomenko, N V

2012-01-01

231

Novel genetic diversity within Anopheles punctimacula s.l.: Phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2)  

PubMed Central

Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3´ COI), the Barcode region in the five prime end of the COI (5´ COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3´ COI depicted six highly supported molecular lineages (A–F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5´ COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3´ COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

Loaiza, Jose R.; Scott, Marilyn E.; Bermingham, Eldredge; Sanjur, Oris I.; Rovira, Jose R.; Dutari, Larissa C.; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E.

2013-01-01

232

Bitter gourd (Momordica charantia) extract activates peroxisome proliferator-activated receptors and upregulates the expression of the acyl CoA oxidase gene in H4IIEC3 hepatoma cells.  

PubMed

Peroxisome proliferator-activated receptor alpha (PPARalpha) is a ligand-dependent transcription factor that regulates the expression of genes involved in lipid metabolism and transport. Ligands/activators of PPARalpha, like fibrate-type drugs, may have hypolipidemic effects. To identify food that contains activators of PPARalpha, a transactivation assay employing a clone of CHO-K1 cells stably transfected with a (UAS)(4)-tk-alkaline phosphatase reporter and a chimeric receptor of Gal4-rPPARalpha LBD was used to screen ethyl acetate (EA) extracts of a large variety of food materials. It was found that the EA extract of bitter gourd (Momordica charantia), a common oriental vegetable, activated PPARalpha to an extent that was equivalent to or even higher than 10 microM Wy-14643, a known ligand of PPARalpha. This extract also activated PPARgamma to a significant extent which was comparable to 0.5 microM BRL-49653. The activity toward PPARalpha was mainly in the soluble fraction of the organic solvent. The EA extract prepared from the whole fruit showed significantly higher activity than that from seeds or flesh alone. The bitter gourd EA extract was then incorporated into the medium for treatment of a peroxisome proliferator-responsive murine hepatoma cell line, H4IIEC3, for 72 h. Treated cells showed significantly higher activity of acyl CoA oxidase and higher expressions of mRNA of this enzyme and fatty acid-binding protein, indicating that the bitter gourd EA extract was able to act on a natural PPARalpha signaling pathway in this cell line. It is thus worth further investigating the PPAR-associated health benefits of bitter gourd. PMID:14631118

Chao, Che-Yi; Huang, Ching-jang

2003-01-01

233

Cytochrome oxidase: an alternative model.  

PubMed Central

Oxidative titration of reduced cytochrome oxidase (cytochrome c oxidase; ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) in the presence of carbon monoxide and sulfide, at potentials greater than +500 mV (vs. the neutral hydrogen electrode), have failed to produce new copper signals in the electron paramagnetic resonance spectrum of this enzyme. This observation implies that once of the copper centers in cytochrome oxidase remains Cu(I) under strongly oxidizing conditions. The rationalization of this fact, and the possible explanation of a great accumulation of spectroscopic data, is that cytochrome a3 may be a two-electron redox center, with stable Fe(IV), Fe(III), and Fe(II) states during its redox cycle. This oxidase model does not require an antiferromagnetic coupling scheme, in contrast to currently prevalent models. PMID:6246505

Seiter, C H; Angelos, S G

1980-01-01

234

Plasma postheparin diamine oxidase activity  

Microsoft Academic Search

Plasma diamine oxidase (DAO) activity may reflect intestinal involvement in Crohn's disease. The purpose of this study was\\u000a to develop a simple heparin stimulation test for assessing postheparin plasma diamine oxidase activity in Crohn's disease.\\u000a Ten volunteers and five patients with Crohn's disease received 1000 units and 3000 units of heparin intravenously and plasma\\u000a samples were obtained at timed intervals.

Jon S. Thompson; David A. Burnett; Robert A. Cormier; William P. Vaughan

1988-01-01

235

Expression and chloroplast targeting of cholesterol oxidase in transgenic tobacco plants.  

PubMed

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Corbin, D R; Grebenok, R J; Ohnmeiss, T E; Greenplate, J T; Purcell, J P

2001-07-01

236

Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1  

PubMed Central

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

237

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants  

PubMed Central

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

238

Molecular cloning, sequencing, and functional expression of a cDNA encoding human coproporphyrinogen oxidase.  

PubMed Central

Coproporphyrinogen oxidase (EC 1.3.3.3) catalyzes the sixth step in the heme biosynthetic pathway, the oxidation of coproporphyrinogen III to protoporphyrinogen IX. The activity of this enzyme is deficient in the disease hereditary coproporphyria. The sequence of the cDNA and predicted amino acid sequence of the human coproporphyrinogen oxidase are presented. The human protein sequence contains a region completely homologous to that we obtained by sequencing an 11-amino acid peptide fragment from purified murine liver coproporphyrinogen oxidase. Results of Southern blotting were consistent with the presence of a single human coproporphyrinogen oxidase gene, and Northern blotting demonstrated one transcript of similar size in erythroid and nonerythroid cell lines. Expression of the cDNA coding for the putative mature human coproporphyrinogen oxidase in Escherichia coli resulted in a 17-fold increase in coproporphyrinogen activity over endogenous activity. Images PMID:8159699

Martasek, P; Camadro, J M; Delfau-Larue, M H; Dumas, J B; Montagne, J J; de Verneuil, H; Labbe, P; Grandchamp, B

1994-01-01

239

NADPH Oxidases in Vascular Pathology  

PubMed Central

Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

2014-01-01

240

Spinach Thylakoid Polyphenol Oxidase 1  

PubMed Central

Polyphenol oxidase activity (E.C. 1.14.18.1) has been found in two enzyme species isolated from thylakoid membranes of spinach chloroplasts. The proteins were released from the membrane by sonication and purified >900-fold by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatography. The enzymes appear to be the tetramer and monomer of a subunit with a molecular weight of 42,500 as determined by lithium dodecyl sulfate gel electrophoresis. The higher molecular weight enzyme is the predominant form in freshly isolated preparations but on aging or further purification, the amount of lower molecular weight enzyme increases at the expense of the higher. Sonication releases polyphenol oxidase from the membrane largely in the latent state. C18 fatty acids, especially linolenic acid, are potent activators of the enzymic activity. In the absence of added fatty acids, the isolated enzyme spontaneously, but slowly, activates with time. Purified polyphenol oxidase utilizes o-diphenols as substrates and shows no detectable levels of monophenol or p-diphenol oxidase activities. The Km values for 3,4-dihydroxyphenylalanine and O2 are 6.5 and 0.065 millimolar, respectively. Suitable substrates include chlorogenic acid, catechol, caffeic acid, pyrogallol, and dopamine; however, the enzyme is substrate-inhibited by the last four at concentrations near their Km A large seasonal variation in polyphenol oxidase activity may result from a decrease in enzyme content rather than inhibition of the enzyme present. Images PMID:16661805

Golbeck, John H.; Cammarata, Kirk V.

1981-01-01

241

Cytochrome c oxidase dysfunction in oxidative stress.  

PubMed

Cytochrome c oxidase (CcO) is the terminal oxidase of the mitochondrial electron transport chain. This bigenomic enzyme in mammals contains 13 subunits of which the 3 catalytic subunits are encoded by the mitochondrial genes. The remaining 10 subunits with suspected roles in the regulation, and/or assembly, are coded by the nuclear genome. The enzyme contains two heme groups (heme a and a3) and two Cu(2+) centers (Cu(2+) A and Cu(2+) B) as catalytic centers and handles more than 90% of molecular O(2) respired by the mammalian cells and tissues. CcO is a highly regulated enzyme which is believed to be the pacesetter for mitochondrial oxidative metabolism and ATP synthesis. The structure and function of the enzyme are affected in a wide variety of diseases including cancer, neurodegenerative diseases, myocardial ischemia/reperfusion, bone and skeletal diseases, and diabetes. Despite handling a high O(2) load the role of CcO in the production of reactive oxygen species still remains a subject of debate. However, a volume of evidence suggests that CcO dysfunction is invariably associated with increased mitochondrial reactive oxygen species production and cellular toxicity. In this paper we review the literature on mechanisms of multimodal regulation of CcO activity by a wide spectrum of physiological and pathological factors. We also review an array of literature on the direct or indirect roles of CcO in reactive oxygen species production. PMID:22841758

Srinivasan, Satish; Avadhani, Narayan G

2012-09-15

242

Monoacylcadaverines as substrates for both monoamine oxidase and diamine oxidase; low rates of activity  

Microsoft Academic Search

Summary Monoacetylcadaverine and monopropionylcadaverine were found to be substrates for both rat liver monoamine oxidase and hog kidney diamine oxidase, but all the Km-values for the oxidases were very high. The amines were common substrates for type A and type B monoamine oxidase.

O. Suzuki; T. Matsumoto; M. Oya; Y. Katsumata; M. Stepita-Klauco

1980-01-01

243

Optimization of glucose oxidase production by Aspergillus niger using genetic- and process-engineering techniques.  

PubMed

Wild-type Aspergillus niger NRRL-3 was transformed with multiple copies of the glucose oxidase structural gene (god). The gene was placed under the control of the gpdA promoter of A. nidulans. For more efficient secretion the alpha-amylase signal peptide from A. oryzae was inserted in front of god. Compared to the wild type, the recombinant strain NRRL-3 (GOD3-18) produced up to four times more extracellular glucose oxidase under identical culture conditions. Addition of yeast extract (2 gl-1) to a mineral salts medium containing only glucose as carbon source increased volumetric and specific extracellular glucose oxidase activities by 130% and 50% respectively. With the same medium composition and inoculum size, volumetric and specific extracellular glucose oxidase activities increased more than ten times in bioreactor cultivations compared to shake-flask cultures. PMID:8590664

Hellmuth, K; Pluschkell, S; Jung, J K; Ruttkowski, E; Rinas, U

1995-11-01

244

Catecholamines oxidation by xanthine oxidase.  

PubMed

Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5. Activation of the peroxidative reaction is also elicited by catechol compounds through a redox cycle mechanism. Implications about the possible biochemical relevance of xanthine oxidase activity on catecholamines oxidation are discussed. PMID:9101714

Foppoli, C; Coccia, R; Cini, C; Rosei, M A

1997-03-15

245

Original article Variation for polyphenol oxidase activity  

E-print Network

Original article Variation for polyphenol oxidase activity in stems of Medicago species Michele) Abstract - Polyphenol oxidase (PPO) activity was detected in stems of both glandular-haired and glabrous; Inra/Elsevier, Paris.) insect resistance / Medicago spp / Leguminosae / polyphenol oxidase Résumé - L

Paris-Sud XI, Université de

246

GLUCOSE OXIDASE REDUCES OXIDATION IN FROZEN SHRIMP  

E-print Network

role oxygen can have during storage of foods (Scott, 1958). Glucose oxidase-catalase preparations are used to carry out the net reaction: 2 glucose + oxygen glucose oxidase > 2 gluconic acid. catalase of glucose oxidase -catalase would probably be more obvious in shrimp, which were packed in transparent bags

247

Lysyl Oxidase-related Protein1 Promotes Tumor Fibrosis and Tumor Progression in Vivo1  

Microsoft Academic Search

The lysyl oxidase gene family members function as extracellular matrix modulating enzymes. We have found that another member of this family, lysyl oxidase related protein-1 (LOR-1), is highly expressed in metastatic breast cancer-derived cell lines but not in the nonmetastatic estrogen- dependent MCF-7 cells. Furthermore, LOR-1 expression in periductal tumor cells of breast carcinomas is significantly correlated with increased tumor

Gal Akiri; Edmond Sabo; Hagit Dafni; Zehava Vadasz; Yelena Kartvelishvily; Noga Gan; Ofra Kessler; Tzafra Cohen; Murray Resnick; Michal Neeman; Gera Neufeld

2003-01-01

248

Import, targeting, and processing of a plant polyphenol oxidase  

Microsoft Academic Search

A tomato (Lycopersicon esculentum 1.) gene encoding a precur- sor of polyphenol oxidase (PPO) was transcribed and translated in vitro. lhe import, targeting, and processing of the (35Slmethionine- labeled precursor protein (pPP0) were studied in isolated chloro- plasts. lhe protein was routed to the thylakoid lumen in two steps. lhe 67-kD precursor was first imported into the stroma in an

Amos Sommer; John C. Steffens; Alfred M. Mayer; Eitan Harel

1994-01-01

249

Catecholamines oxidation by xanthine oxidase  

Microsoft Academic Search

Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5.

Cesira Foppoli; Raffaella Coccia; Chiara Cini; Maria Anna Rosei

1997-01-01

250

Androgen receptor and monoamine oxidase polymorphism in wild bonobos  

PubMed Central

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

251

Substrate selectivity of monoamine oxidase A, monoamine oxidase B, diamine oxidase, and semicarbazide-sensitive amine oxidase in COS-1 expression systems.  

PubMed

The substrate selectivity of monoamine oxidase A (MAO-A), monoamine oxidase B (MAO-B), diamine oxidase (DAO), and semicarbazide-sensitive amine oxidase (SSAO) was investigated in the absence of chemical inhibitors using the COS-1 cells expressed with respective amine oxidase. Serotonin (5-hydroxytryptamine), 1-methylhistamine, and histamine were preferentially oxidized by MAO-A, SSAO, and DAO, respectively, at a low substrate concentration. In contrast, benzylamine, tyramine, and beta-phenylethylamine served as substrates for all of MAO-A, MAO-B, and SSAO. Each amine oxidase showed broad substrate selectivity at a high substrate concentration. The cross-inhibition was remarkable in MAO-A and MAO-B, especially in MAO-A, but not in SSAO and DAO. A study of the substrate selectivity of amine oxidases should include consideration of the effects of substrate concentration and specific chemical inhibitors. PMID:17142964

Ochiai, Yoshinori; Itoh, Kunio; Sakurai, Eiichi; Adachi, Mayuko; Tanaka, Yorihisa

2006-12-01

252

The gene CYP3 encoding P450pcn1 (nifedipine oxidase) is tightly linked to the gene COL1A2 encoding collagen type 1 alpha on 7q21-q22.1.  

PubMed Central

CYP3, the gene which encodes the hepatic cytochrome P450pcn1, the isozyme responsible for the metabolic oxidation of the calcium channel-blocking drug nifedipine, has recently been mapped to human chromosome 7 using somatic cell hybrids. Using multilocus linkage analysis in CEPH families, we examined the linkage of a cDNA probe (hPCN1) for CYP3 to the oncogene MET, the pro-alpha 2(1) collagen gene COL1A2, and the T-cell receptor beta-chain gene TCRB, together with three arbitrary loci D7S8, D7S13, and D7S16, defined by the anonymous DNA probes pJ3.11, pB79a, and p7C22, respectively. From 70 CEPH parents screened with a StyI RFLP for hPCN1, four informative families were found each with both parental and maternal grandparents and 6-11 children per family. Tight linkage emerged between CYP3 and COL1A2, with a maximum combined lod score of 5.72 at theta = 0, suggesting the most likely subchromosomal localization of CYP3 is 7q21.3-q22.1. Images Figure 1 PMID:2901225

Brooks, B A; McBride, O W; Dolphin, C T; Farrall, M; Scambler, P J; Gonzalez, F J; Idle, J R

1988-01-01

253

Regulation of derepressed synthesis of arylsulfatase by tyramine oxidase in Salmonella typhimurium.  

PubMed Central

The participation of tyramine oxidase in the regulation of arylsulfatase synthesis in Salmonella typhimurium was studied. Arylsulfatase synthesis was repressed by inorganic sulfate, cysteine, methionine, or taurine. This repression was relieved by tyramine, octopamine, or dopamine, which induced tyramine oxidase synthesis, although the level of arylsulfatase activity was very low. The induction of tyramine oxidase and derepression of arylsulfatase by tyramine were strongly inhibited by glucose and ammonium chloride, and the repression of both enzymes was relieved by use of xylose as a carbon source after consumption of glucose or by use of tyramine as the sole source of nitrogen, irrespective of the carbon source used. The initial rates of tyramine uptake by cells grown with glucose and xylose were similar. Results with tyramine oxidase-constitutive mutants showed that constitutive expression of the tyramine oxidase gene resulted in derepression of arylsulfatase synthesis in the absence of tyramine. Thus, catabolite and ammonium repressions of arylsulfatase synthesis and the induction of the enzyme by tyramine seem to reflect the levels of tyramine oxidase synthesis. These results in S. typhimurium support our previous finding that the specific regulation system of arylsulfatase synthesis by tyramine oxidase is conserved in enteric bacteria. PMID:7007350

Murooka, Y; Harada, T

1981-01-01

254

cDNA sequences of variant forms of human placenta diamine oxidase  

Microsoft Academic Search

Genes for two forms of human placenta diamine oxidase(dao) were cloned from a cDNA library and sequenced. One gene,pdao 1, is identical in length to human kidneydao but differs from it by two bases in the coding region and differs slightly in the 3?- and 5?-noncoding regions. The second\\u000a gene,pdao2, is nearly identical to these genes in the coding region,

Xiaoping Zhang; Jaeho Kim; William S. McIntire

1995-01-01

255

L-amino acid oxidases with specificity for basic L-amino acids in cyanobacteria.  

PubMed

The two closely related fresh water cyanobacteria Synechococcus elongatus PCC 6301 and Synechococcus elongatus PCC 7942 have previously been shown to constitutively express a FAD-containing L-amino acid oxidase with high specificity for basic L-amino acids (L-arginine being the best substrate). In this paper we show that such an enzyme is also present in the fresh water cyanobacterium Synechococcus cedrorum PCC 6908. In addition, an improved evaluation of the nucleotide/amino acid sequence of the L-amino acid oxidase of Synechococcus elongatus PCC 6301 (encoded by the aoxA gene) with respect to the FAD-binding site and a translocation pathway signal sequence will be given. Moreover, the genome sequences of 24 cyanobacteria will be evaluated for the occurrence of an aoxA-similar gene. In the evaluated cyanobacteria 15 genes encoding an L-amino acid oxidase-similar protein will be found. PMID:17542496

Gau, Achim E; Heindl, Achim; Nodop, Anke; Kahmann, Uwe; Pistorius, Elfriede K

2007-01-01

256

Molecular evolution of N-methylputrescine oxidase in tobacco.  

PubMed

Biosynthesis of nicotine in tobacco requires N-methylputrescine oxidase (MPO), which belongs to the copper-containing amine oxidase superfamily. Previous studies identified tobacco MPO1 and its close homolog NtDAO1 (formerly called MPO2), of which MPO1 has been shown preferentially to oxidize N-methylated amines. We show here that NtDAO1, as well as a homologous Arabidopsis diamine oxidase (DAO), accept non-N-methylated amines more efficiently than their corresponding N-methylated amines. MPO1 is coordinately regulated with other nicotine biosynthesis genes with regard to COI1-MYC2-dependent jasmonate induction and its dependence on nicotine-specific ERF transcription factors, whereas NtDAO1 is constitutively expressed at low basal levels in tobacco plants. Both MPO1 and NtDAO1 are targeted to peroxisomes by their C-terminal motifs, and the peroxisomal localization of MPO1 is required for it to function in nicotine biosynthesis in jasmonate-elicited cultured tobacco cells. Restricted occurrence of the MPO subfamily in Nicotiana and Solanum indicates that, during the formation of the Solanaceae, MPO has evolved from a DAO, which functions in polyamine catabolism within peroxisomes, by optimizing substrate preference and gene expression patterns to be suitable for alkaloid formation. PMID:24287136

Naconsie, Maliwan; Kato, Keita; Shoji, Tsubasa; Hashimoto, Takashi

2014-02-01

257

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.  

PubMed

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

258

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris  

PubMed Central

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

259

A new crystal form of human diamine oxidase.  

PubMed

Copper amine oxidases (CAOs) are ubiquitous in nature and catalyse the oxidative deamination of primary amines to the corresponding aldehydes. Humans have three viable CAO genes (AOC1-3). AOC1 encodes human diamine oxidase (hDAO), which is the frontline enzyme for histamine metabolism. hDAO is unique among CAOs in that it has a distinct substrate preference for diamines. The structure of hDAO in space group P2(1)2(1)2(1) with two molecules in the asymmetric unit has recently been reported. Here, the structure of hDAO refined to 2.1 A resolution in space group C222(1) with one molecule in the asymmetric unit is reported. PMID:20124708

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Dooley, David M; Guss, J Mitchell

2010-02-01

260

Activation of Polyphenol Oxidase of Chloroplasts  

Microsoft Academic Search

Polyphenol oxidase ofleaves islocated mainlyinchloro- plasts isolated bydifferential orsucrose density gradient cen- trifugation. Thisactivity ispartofthelamellar structure that isnotlost onrepeated washing oftheplastids. Theoxidase ac- tivity wasstable during prolonged storage oftheparticles at 4C or-18C.TheKm (dihydroxyphenylalanine) forspinach leafpolyphenol oxidase was7mM byaspectrophotometric as- sayand2 mM bythemanometric assay. Polyphenol oxidase activity intheleafperoxisomal fraction, afterisopycnic cen- trifugation onalinear sucrose gradient, didnotcoincide with theperoxisomal enzymesbutwasattributed toproplastids at

N. E. Tolbert

1973-01-01

261

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*  

PubMed Central

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ?8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

262

New clusters of arsenite oxidase and unusual bacterial groups in enrichments from arsenic-contaminated soil.  

PubMed

In the present study cultivation-dependent and molecular methods were applied in combination to investigate the arsenite-oxidizing communities in enrichment cultures from arsenic and lead smelter-impacted soils with respect to both 16S rRNA and arsenite oxidase gene diversity. Enrichments with arsenite as the only electron donor resulted in completely different communities than enrichments with yeast extract and the simultaneous presence of arsenite. The lithoautotrophic community appeared to be dominated by Ferrimicrobium-related Actinobacteria, unusual Acidobacteria, Myxobacteria, and ?-Proteobacteria but the heterotrophic community comprised many Dokdonella-related ?-Proteobacteria. Gene sequences of clones encoding arsenite oxidase from the enrichment for lithoautotrophs belonged to three major clusters with sequences from non-cultivated microorganisms. So, primers used to detect arsenite oxidase genes could amplify the genes from many ?-, ?- and ?-Proteobacteria, but not from various strains of the other phyla present in the enrichment for lithotrophs. This was also observed for the isolates where arsenite oxidase genes from new proteobacterial isolates of the genera Burkholderia, Bosea, Alcaligenes, Bradyrhizobium and Methylobacterium could be amplified but the genes of the new Rhodococcus isolate S43 could not. The results indicate that the ability to oxidize arsenite is widespread in various unusual taxa, and molecular methods for their detection require further improvement. PMID:22350109

Sultana, Munawar; Vogler, Susann; Zargar, Kamrun; Schmidt, Anne-Christine; Saltikov, Chad; Seifert, Jana; Schlömann, Michael

2012-07-01

263

Role of NF-kappaB in transcriptional regulation of the phagocyte NADPH oxidase by tumor necrosis factor-alpha.  

PubMed

Macrophages play an important role in the pathogenesis of chronic inflammatory disease. Activation of these phagocytes induces the production of proinflammatory cytokines, such as IL-1 and TNF-alpha and the generation of reactive oxygen species (ROS), such as superoxide anion (O2*-). Recently, we found that TNF-alpha treatment of human monocytic cells (MonoMac1) and isolated human monocytes resulted in up-regulation of the NADPH oxidase gene, neutrophil cytosolic factor 2 (NCF2). These results suggested that TNF-alpha, produced by activated macrophages, could serve as an autocrine/paracrine regulator of the oxidase, resulting in increased and/or prolonged production of O2*-. To gain a better understanding of the mechanisms involved in NADPH oxidase regulation by TNF-alpha, we evaluated transcriptional regulation of oxidase genes in MonoMac1 cells and human monocytes. We show that TNF-alpha-treated cells have increased levels of mRNA and up-regulated expression of NADPH oxidase subunits p47(phox), p67(phox), and gp91(phox), as well as increased oxidase activity. Pharmacological inhibitors of NF-kappaB activation blocked TNF-alpha-induced up-regulation of NCF1, NCF2, and CYBB message, which correlated with a reduction in expression of the corresponding oxidase proteins and decreased O2*- production. These data demonstrate that the increase in and/or maintenance of O2*- production in TNF-alpha-treated MonoMac1 cells and monocytes are a result, in part, of transcriptional up-regulation of three essential NADPH oxidase genes via the NF-kappaB pathway. This novel finding supports a model, whereby TNF-alpha-dependent activation of NF-kappaB up-regulates phagocyte NADPH oxidase activity, leading to enhanced ROS production and further NF-kappaB activation, potentially contributing to sustained oxidant production in chronic inflammation. PMID:17537988

Gauss, Katherine A; Nelson-Overton, Laura K; Siemsen, Daniel W; Gao, Ying; DeLeo, Frank R; Quinn, Mark T

2007-09-01

264

Cloning, expression and biochemical characterization of the cholesterol oxidase CgChoA from Chryseobacterium gleum  

PubMed Central

Background Cholesterol oxidases are important enzymes for applications such as the analysis of cholesterol in clinical samples, the synthesis of steroid derived drugs, and are considered as potential antibacterial drug targets. Results The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector and heterologously expressed in Escherichia coli JM109 co-transformed with pRARE2. The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion chromatography, showed a temperature optimum of 35°C, and a pH optimum at 6.75 using 0.011 M MOPS buffer under the tested conditions. The purified protein showed a maximum activity of 15.5 U/mg. CgChoA showed a Michaelis-Menten like kinetic behavior only when the substrate was dissolved in water and taurocholate (apparent Km?=?0.5 mM). In addition, the conversion of cholesterol by CgChoA was studied via biocatalytic batches at analytical scale, and cholest-4-en-3-one was confirmed as product by HPLC-MS. Conclusion CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other organisms. Thus, the enzyme broadens the available toolbox of cholesterol oxidases for e.g. synthetic and biosensing applications. PMID:24885249

2014-01-01

265

Inhibition of Diamine Oxidase Activity by Metronidazole  

Microsoft Academic Search

Metronidazole was found to be a non-competitive inhibitor of man, rabbit and rat intestinal diamine oxidases with an inhibition constant value of ? 10?4 M. The purified bovine serum amine oxidase was not inhibited, whereas the purified swine kidney enzyme gave similar results. These findings suggest that metronidazole and similar compounds, used as antibacterial and antiprotozoal drugs, should be given

O. Befani; T. S. Shiozaki; P. Turini; P. Gerosa; B. Mondovi

1995-01-01

266

The catalytic cycle of catechol oxidase  

Microsoft Academic Search

Hybrid density functional theory with the B3LYP functional has been used to investigate the catalytic mechanism of catechol oxidase. Catechol oxidase belongs to a class of enzymes that has a copper dimer with histidine ligands at the active site. Another member of this class is tyrosinase, which has been studied by similar methods previously. An important advantage for the present

Per E. M. Siegbahn

2004-01-01

267

Highly efficient purification of porcine diamine oxidase  

Microsoft Academic Search

Diamine oxidase (DAO) is a member of the class of copper-containing amine oxidases and catalyzes the oxidative deamination of histamine and other biogenic amines. The enzyme from porcine kidney was purified by consecutive chromatography on concanavalin A Sepharose, heparin Sepharose and Mono Q. Besides being simpler and faster than previous methods, this new purification scheme results in a homogenous product

Doris Wilflingseder; Hubert G Schwelberger

2000-01-01

268

Regulation of innate immunity by NADPH oxidase  

PubMed Central

NADPH oxidase is a critical regulator of both antimicrobial host defense and inflammation. Activated in nature by microbes and microbial-derived products, the phagocyte NADPH oxidase is rapidly assembled, and generates reactive oxidant intermediates (ROIs) in response to infectious threat. Chronic granulomatous disease (CGD) is an inherited disorder of the NADPH oxidase characterized by recurrent and severe bacterial and fungal infections, and pathology related to excessive inflammation. Studies in CGD patients and CGD mouse models indicate that NADPH oxidase plays a key role in modulating inflammation and injury that is distinct from its antimicrobial function. The mechanisms by which NADPH oxidase mediates killing of pathogens and regulation of inflammation has broad relevance to our understanding of normal physiological immune responses and pathological states, such as acute lung injury and bacterial or fungal infections. PMID:22583699

Segal, Brahm H.; Grimm, Melissa J.; Khan, A. Nazmul H.; Han, Wei; Blackwell, Timothy S.

2012-01-01

269

Immunological comparison of sulfite oxidase  

SciTech Connect

Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

Pollock, V.; Barber, M.J. (Univ. South Florida College, Tampa (United States))

1991-03-11

270

Human kidney diamine oxidase: heterologous expression, purification, and characterization.  

PubMed

Human kidney diamine oxidase has been overexpressed as a secreted enzyme under the control of a metallothionein promoter in Drosophila S2 cell culture. This represents the first heterologous overexpression and purification of a catalytically active, recombinant mammalian copper-containing amine oxidase. A rapid and highly efficient purification protocol using chromatography on heparin affinity, hydroxyapatite, and gel filtration media allows for the recovery of large quantities of the recombinant enzyme, which is judged to be greater than 98% homogenous by SDS/PAGE. The availability of large quantities of highly purified enzyme makes it now possible to investigate the spectroscopic, mechanistic, functional, and structural properties of this human enzyme at the molecular level. Visible absorption, circular dichroism, electron paramagnetic resonance, and resonance Raman spectroscopic results are presented. The recombinant enzyme contains the cofactors 2,4,5-trihydroxyphenylalaninequinone and copper at stoichiometries of up to 1.1 and 1.5 mol per mol homodimer, respectively. In addition, tightly bound and stoichiometric calcium ions were identified and proposed to occupy a second metal-binding site. The apparent molecular weight of the recombinant protein, determined by analytical ultracentrifugation, suggests 20-26% glycosylation by weight. Detailed kinetic studies indicate the preferred substrates (k(cat)/K(M)) of human diamine oxidase are, in order, histamine, 1-methylhistamine, and putrescine, with K(M) values of 2.8, 3.4, and 20 microM, respectively. These results, demonstrating the substrate preference for histamine and 1-methylhistamine, were unanticipated given the available literature. The pH dependence of k(cat) for putrescine oxidation gives two apparent p K(a) values at 6.0 and 8.2. Tissue-specific expression of the human diamine oxidase gene was investigated using an mRNA array. The relevance of this work to earlier work and the suggested physiological roles of the human enzyme are discussed. PMID:12072962

Elmore, Bradley O; Bollinger, John A; Dooley, David M

2002-06-01

271

1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence  

PubMed Central

Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.

1999-01-01

272

Modular assembly of yeast cytochrome oxidase  

PubMed Central

Previous studies of yeast cytochrome oxidase (COX) biogenesis identified Cox1p, one of the three mitochondrially encoded core subunits, in two high–molecular weight complexes combined with regulatory/assembly factors essential for expression of this subunit. In the present study we use pulse-chase labeling experiments in conjunction with isolated mitochondria to identify new Cox1p intermediates and place them in an ordered pathway. Our results indicate that before its assimilation into COX, Cox1p transitions through five intermediates that are differentiated by their compositions of accessory factors and of two of the eight imported subunits. We propose a model of COX biogenesis in which Cox1p and the two other mitochondrial gene products, Cox2p and Cox3p, constitute independent assembly modules, each with its own complement of subunits. Unlike their bacterial counterparts, which are composed only of the individual core subunits, the final sequence in which the mitochondrial modules associate to form the holoenzyme may have been conserved during evolution. PMID:23266989

McStay, Gavin P.; Su, Chen Hsien; Tzagoloff, Alexander

2013-01-01

273

Alternative oxidase in animals: unique characteristics and taxonomic distribution.  

PubMed

Alternative oxidase (AOX), a ubiquinol oxidase, introduces a branch point into the respiratory electron transport chain, bypassing complexes III and IV and resulting in cyanide-resistant respiration. Previously, AOX was thought to be limited to plants and some fungi and protists but recent work has demonstrated the presence of AOX in most kingdoms of life, including animals. In the present study we identified AOX in 28 animal species representing nine phyla. This expands the known taxonomic distribution of AOX in animals by 10 species and two phyla. Using bioinformatics we found AOX gene sequences in members of the animal phyla Porifera, Placozoa, Cnidaria, Mollusca, Annelida, Nematoda, Echinodermata, Hemichordata and Chordata. Using reverse-transcriptase polymerase chain reaction (RT-PCR) with degenerate primers designed to recognize conserved regions of animal AOX, we demonstrated that AOX genes are transcribed in several animals from different phyla. An analysis of full-length AOX sequences revealed an amino acid motif in the C-terminal region of the protein that is unique to animal AOXs. Animal AOX also lacks an N-terminal cysteine residue that is known to be important for AOX enzyme regulation in plants. We conclude that the presence of AOX is the ancestral state in animals and hypothesize that its absence in some lineages, including vertebrates, is due to gene loss events. PMID:19648408

McDonald, Allison E; Vanlerberghe, Greg C; Staples, James F

2009-08-01

274

Cold-adapted arsenite oxidase from a psychrotolerant Polaromonas species.  

PubMed

Polaromonas sp. str. GM1 is an aerobic, psychrotolerant, heterotrophic member of the Betaproteobacteria and is the only isolate capable of oxidising arsenite at temperatures below 10 °C. Sequencing of the aio gene cluster in GM1 revealed the presence of the aioB and aioA genes, which encode the arsenite oxidase but the regulatory genes typically found upstream of aioB in other members of the Proteobacteria were absent. The GM1 Aio was purified to homogeneity and was found to be a heterodimer. The enzyme contained Mo and Fe as cofactors and had, using the artificial electron acceptor 2,6-dichlorophenolindophenol, a Km for arsenite of 111.70 ± 0.88 ?M and a Vmax of 12.16 ± 0.30 U mg(-1), which is the highest reported specific activity for any known Aio. The temperature-activity profiles of the arsenite oxidases from GM1 and the mesophilic betaproteobacterium Alcaligenes faecalis were compared and showed that the GM1 Aio was more active at low temperatures than that of A. faecalis. A homology model of the GM1 Aio was made using the X-ray crystal structure of the Aio from A. faecalis as the template. Structural changes that account for cold adaptation were identified and it was found that these resulted in increased enzyme flexibility and a reduction in the hydrophobicity of the core. PMID:23150098

Osborne, Thomas H; Heath, Matthew D; Martin, Andrew C R; Pankowski, Jaroslaw A; Hudson-Edwards, Karen A; Santini, Joanne M

2013-04-01

275

EXPRESSION OF TURKEY TRANSCRIPTION FACTORS AND ACYL COA OXIDASE IN DIFFERENT TISSUES AND GENETIC POPULATIONS  

Technology Transfer Automated Retrieval System (TEKTRAN)

Several transcription factors are involved in regulating lipid metabolism in various animal tissues. Peroxisome proliferator activated receptor (PPAR) gamma and PPAR alpha regulate both lipogenesis and fatty acid oxidation. Gene fragments for PPAR gamma, PPAR alpha, and acyl CoA oxidase (ACO) have b...

276

Effect of continuous feeding of galactose on the production of recombinant glucose oxidase using Saccharomyces cerevisiae  

Microsoft Academic Search

A recombinant strain of Saccharomyces cerevisiae harboring GOD gene originated from Aspergillus niger was used for the production of extracellular glucose oxidase. The effect of continuous galactose feeding on the induction of GAL-10 promoter was examined in a 5 l bioreactor. The highest enzyme production level (164 U cmх) was achieved at 96 h of cultivation. The production performance was

A. Kapat; J. K. Jung; Y. H. Park

2000-01-01

277

THE GENETIC CONTROL AND BIOCHEMICAL MODIFICATION OF CATECHOL OXIDASE IN MAIZE  

Microsoft Academic Search

Three isozyme variants of catechol oxidase have been shown to be deter- mined by alleles of a gene, Cz, which has been located on chromosome 10 less than 0.1 recombination units from the endosperm marker &,.-The ex- tractable form of the enzyme is modified by an endogeneous \\

TONY PRYOR

278

Molecular phylogeny of naidid worms (Annelida: Clitellata) based on cytochrome oxidase I  

Microsoft Academic Search

Naidids are tiny, primarily freshwater oligochaete annelids which reproduce asexually by fission. We investigated the phylogenetic relationships within this group by sequencing 1224bp of the mitochondrial gene cytochrome oxidase I (COI) from 26 species of naidids (representing 13 of the 23 genera currently recognized), as well as from four tubificids, their closest allies. Although not completely concordant, maximum parsimony and

Alexandra E. Bely; Gregory A. Wray

2004-01-01

279

Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans  

PubMed Central

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

Liu, Lei

2012-01-01

280

Monoamine oxidase inhibitors and neuroprotection: a review.  

PubMed

Monoamine oxidase inhibitors have been available for more than 50 years, initially developed as antidepressants but currently used in a variety of psychiatric and neurological conditions. There has been a recent surge of interest in monoamine oxidase inhibitors because of their reported neuroprotective and/or neurorescue properties. Interestingly, it seems that often these properties are independent of their ability to inhibit monoamine oxidase. This review article presents an overview of the neuroprotective/neurorescue properties of these multifaceted drugs and focuses on phenelzine, (-)-deprenyl, rasagiline, ladostigil, tranylcypromine, moclobemide, and clorgyline and their possible neuroprotective mechanisms. PMID:22960850

Al-Nuaimi, Saleem K; Mackenzie, Erin M; Baker, Glen B

2012-11-01

281

Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants  

PubMed Central

Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438

Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.

1980-01-01

282

Inhibition of diamine oxidase activity by metronidazole.  

PubMed

Metronidazole was found to be a non-competitive inhibitor of man, rabbit and rat intestinal diamine oxidases with an inhibition constant value of approximately 10(-4) M. The purified bovine serum amine oxidase was not inhibited, whereas the purified swine kidney enzyme gave similar results. These findings suggest that metronidazole and similar compounds, used as antibacterial and antiprotozoal drugs, should be given under careful control, especially when administered for long times, because a decrease of intestinal diamine oxidase activity was proven to be a risk factor for several pathologies of this organ. PMID:7626074

Befani, O; Shiozaki, T S; Turini, P; Gerosa, P; Mondovi, B

1995-07-17

283

Factors Affecting Reaction Kinetics of Glucose Oxidase  

NASA Astrophysics Data System (ADS)

Basic principles of enzyme kinetics are demonstrated using the enzyme glucose oxidase. The glucose oxidase enzymatic reaction is coupled to horseradish peroxidase, which in turn catalyzes the oxidation of a dye to a bright blue-green color. The appearance of the blue-green dye is used to monitor the course of the reaction and is quite visible in a classroom setting. A series of reactions are arranged that vary the enzyme concentration, substrate concentration, temperature, and the substrate used in the reaction. By monitoring the rate of the color change in each beaker, the reaction kinetics of glucose oxidase in each series is observed.

Johnson, Kristin A.

2002-01-01

284

A description of an HPLC assay of coproporphyrinogen III oxidase activity in mononuclear cells.  

PubMed

Coproporphyrinogen III oxidase is deficient in hereditary coproporphyria. An activity assay for this enzyme in mononuclear cells, besides the preparation of the substrate, are presented. The separation conditions for the product of the test protoporphyrin IX by gradient, reversed-phase high-performance liquid chromatography are given. The normal value from mononuclear cells of healthy volunteers was 138 +/- 21 pkat/g total soluble protein (mean +/- SD). The enzyme activity of a family with hereditary coproporphyria was measured. The gene carriers exhibit a specific coproporphyrinogen III oxidase activity of 61-90 pkat/g total soluble protein. PMID:14605502

Gross, U; Gerlach, R; Kühnel, A; Seifert, V; Doss, M O

2003-01-01

285

Inhibition of diamine oxidases and polyamine oxidases by diamine-based compounds  

Microsoft Academic Search

Summary  This review reports on inhibitors of copper-containing amine oxidases and flavoprotein polyamine oxidases, which are structurally\\u000a based on diamines. In the introduction, basic characteristics and classification of amine oxidases are described together\\u000a with the significance of their synthetic inhibitors. The following text is divided into several chapters, which deal with\\u000a diaminoketones, aza-diamines, unsaturated diamine analogs and diamines with heterocyclic substituents.

M. Šebela; M. Tylichová; P. Pe?

2007-01-01

286

Tomato Polyphenol Oxidase (Differential Response of the Polyphenol Oxidase F Promoter to Injuries and Wound Signals).  

PubMed Central

Tomato (Lycopersicon esculentum Mill.) polyphenol oxidases (PPOs) are encoded by a seven-member gene family that exhibits complex patterns of differential expression during growth and differentiation. Antisense down-regulation of constitutive and induced PPO expression results in hypersusceptibility to pathogens, suggesting a critical role for PPO-mediated phenolic oxidation in plant defense. However, the nature and extent of PPO induction and its contribution to resistance are unclear. In this study we examined the inducibility of the tomato PPO gene family. In mature plants PPO transcript levels systemically increased in young leaves (nodes 1-3) when mature leaflets (node 5) were injured. Transcripts hybridizing to PPO E/F-specific probes were the predominant wound-induced PPO mRNAs in young leaves. Analysis of PPO promoter: GUS fusion constructs shows that mechanical wounding and infection by fungal and bacterial pathogens induced transcription of PPO F. Different injuries, salicylic acid, ethylene, and jasmonates elicited distinct, cell-specific and developmental stage-specific patterns of PPO F expression. Whereas jasmonates and mechanical wounding significantly induced PPO F only in young leaves (nodes 1-3), and ethylene induced PPO F only in older leaves (node 7), salicylic acid induced PPO F in stems and foliage at all developmental stages. These results demonstrate that cis-element(s) sufficient for PPO F inducibility reside in the 5[prime] flanking region, and these elements are responsive to a broad range of signals. PMID:12223816

Thipyapong, P.; Steffens, J. C.

1997-01-01

287

Optimization of glucose oxidase production by Aspergillus niger using genetic-and process-engineering techniques  

Microsoft Academic Search

Wild-type Aspergillus niger NRRL-3 was transformed with multiple copies of the glucose oxidase structural gene (god). The gene was placed under the control of the gpd A promoter of A. nidulans. For more efficient secretion the a-amylase signal peptide from A oryzae was inserted in front of god. Compared to the wild type, the recombinant strain NRRL-3 (GOD3-18) produced up

K. Hellmuth; S. Pluschkell; J.-K. Jung; E. Ruttkowski; U. Rinas

1995-01-01

288

Isolation, characterization, and molecular cloning of a thermostable xylitol oxidase from Streptomyces sp. IKD472.  

PubMed

A thermophilic bacterium, Streptomyces sp. IKD472, that can oxidize xylitol was isolated from a hot spring and was found to produce xylitol oxidase. The purified enzyme was a monomeric protein with an apparent molecular weight of 43 k as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis and gel filtration. This novel enzyme is capable of catalyzing the oxidation of one mole of xylitol to form one mole each of xylose and hydrogen peroxide. Since the V(max)K(m) value for xylitol was two and four times higher than those for galactitol and n-sorbitol, respectively, the enzyme was designated as xylitol oxidase. The enzyme was stable in the pH range from 5.5 to 10.5 and at temperatures up to 65 degrees C. The optimal temperature and pH were 55 degrees C and pH 7.5, respectively. Xylitol oxidase bound one mole of FAD as a coenzyme per mole of protein. The amino acid sequence of the NH2 terminus and the fragments obtained by lysylendpeptidase digestion of xylitol oxidase were determined for preparation of synthetic oligonucleotides as hybridization probes. A 2.8-kb chromosomal fragment hybridizing to the probes was cloned into pUC18 in Escherichia coli. The gene consists of an open reading frame of 1245 by that encodes a protein containing 415 amino acids with a molecular weight of 44,730 but without the conserved nucleotide-binding sequence, Gly-X-Gly-X-X-Gly. The amino acid sequence has 70% identity to putative oxidoreductase from Streptomyces coelicolar, 51% to sorbitol oxidase from Streptomyces sp., and 26% to L-gulonolactone oxidase from rat in terms of the overall amino acid sequence. DNA manipulation of the cloned gene in E. coli, by alteration of a strong promoter and a synthesized ribosome-binding sequence at an appropriate position, resulted in overproduction of xylitol oxidase 100 times more than that produced in the original Streptomyces sp. IKD472. The enzyme properties of recombinant xylitol oxidase were the same as those of the authentic enzyme. Stable xylitol oxidases, which allow easier quantitative analysis of xylitol, are useful for clinical applications. PMID:16232758

Yamashita, M; Omura, H; Okamoto, E; Furuya, Y; Yabuuchi, M; Fukahi, K; Murooka, Y

2000-01-01

289

Inhibition of microbial cholesterol oxidases by dimethylmorpholines.  

PubMed

Cholesterol oxidase is a potentially important enzyme in steroid transformations, catalysing the conversion of 3-hydroxy-5-ene steroids to 3-keto-4-ene derivatives via a 3-keto-5-ene intermediate. Morpholine derivatives, especially fenpropimorph and tridemorph, were found to block selectively the isomerisation activity of cholesterol oxidases isolated from Nocardia erythropolis, Streptomyces sp., Pseudomonas testosteroni and Schizophyllum commune. These enzymes differ strongly in physical characteristics and catalytic behaviour. The effectiveness of the inhibitors varied with the cholesterol oxidase tested. Fenpropimorph was most effective with each of the 4 enzymes, 50 mg/l inhibiting about 50% of the enzyme activity. Inhibition was instantaneous and followed a reversible competitive mechanism in Streptomyces sp. and a reversible non-competitive mechanism in Nocardia erythropolis and Schizophyllum commune. An irreversible type of inhibition was observed for P. testosteroni cholesterol oxidase. PMID:2308321

Hesselink, P G; Kerkenaar, A; Witholt, B

1990-01-01

290

Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases  

PubMed Central

Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

Giacomelli, Lisa

2013-01-01

291

Deletion of glucose oxidase changes the pattern of organic acid production in Aspergillus carbonarius  

PubMed Central

Aspergillus carbonarius has potential as a cell factory for the production of different organic acids. At pH 5.5, A.carbonarius accumulates high amounts of gluconic acid when it grows on glucose based medium whereas at low pH, it produces citric acid. The conversion of glucose to gluconic acid is carried out by secretion of the enzyme, glucose oxidase. In this work, the gene encoding glucose oxidase was identified and deleted from A. carbonarius with the aim of changing the carbon flux towards other organic acids. The effect of genetic engineering was examined by testing glucose oxidase deficient (?gox) mutants for the production of different organic acids in a defined production medium. The results obtained showed that the gluconic acid accumulation was completely inhibited and increased amounts of citric acid, oxalic acid and malic acid were observed in the ?gox mutants. PMID:25401063

2014-01-01

292

Plant and animal glycolate oxidases have a common eukaryotic ancestor and convergently duplicated to evolve long-chain 2-hydroxy acid oxidases.  

PubMed

Glycolate oxidase (GOX) is a crucial enzyme of plant photorespiration. The encoding gene is thought to have originated from endosymbiotic gene transfer between the eukaryotic host and the cyanobacterial endosymbiont at the base of plantae. However, animals also possess GOX activities. Plant and animal GOX belong to the gene family of (L)-2-hydroxyacid-oxidases ((L)-2-HAOX). We find that all (L)-2-HAOX proteins in animals and archaeplastida go back to one ancestral eukaryotic sequence; the sole exceptions are green algae of the chlorophyta lineage. Chlorophyta replaced the ancestral eukaryotic (L)-2-HAOX with a bacterial ortholog, a lactate oxidase that may have been obtained through the primary endosymbiosis at the base of plantae; independent losses of this gene may explain its absence in other algal lineages (glaucophyta, rhodophyta, and charophyta). We also show that in addition to GOX, plants possess (L)-2-HAOX proteins with different specificities for medium- and long-chain hydroxyacids (lHAOX), likely involved in fatty acid and protein catabolism. Vertebrates possess lHAOX proteins acting on similar substrates as plant lHAOX; however, the existence of GOX and lHAOX subfamilies in both plants and animals is not due to shared ancestry but is the result of convergent evolution in the two most complex eukaryotic lineages. On the basis of targeting sequences and predicted substrate specificities, we conclude that the biological role of plantae (L)-2-HAOX in photorespiration evolved by co-opting an existing peroxisomal protein. PMID:24408912

Esser, Christian; Kuhn, Anke; Groth, Georg; Lercher, Martin J; Maurino, Veronica G

2014-05-01

293

The polyamine oxidase inactivator MDL 72527.  

PubMed

Polyamine oxidase is a FAD-dependent amine oxidase, which is constitutively expressed in nearly all tissues of the vertebrate organism. In 1985, N1,N4-bis(2,3-butadienyl)-1,4-butanediamine (MDL 72527) was designed as a selective enzyme-activated irreversible inhibitor of polyamine oxidase (EC 1.5.3.11). It inactivates, at micromolar concentration and time-dependently, the enzyme in cells, as well as in all organs of experimental animals, without inhibiting other enzymes of polyamine metabolism. MDL 72527 served during nearly two decades as a unique tool in the elucidation of the physiological roles of polyamine oxidase. The compound has anticancer and contragestational effects, and it improves the anticancer effect of the ornithine decarboxylase inactivator (D,L)-2-(difluoromethyl)ornithine (DFMO). Profound depletion of the polyamine pools of tumour cells and effects on different components of the immune defence system are responsible for the anticancer effects of MDL 72527/DFMO combinations. Recently a direct cytotoxic effect of MDL 72527 at concentrations above those required for polyamine oxidase inactivation was observed. The induction of apoptosis by MDL 72527 was ascribed to its lysosomotropic properties. Therapeutic potentials of the apoptotic effect of MDL 72527 need to be explored. Polyamine oxidase is the last enzyme of the polyamine interconversion pathway that awaits the detailed elucidation of its structure and regulation. MDL 72527 should be useful as a lead in the development of inactivators which are selective for the isoforms of polyamine oxidase. Isozyme-selective inhibitors will give more profound insights into and reveal a diversity of specific functions of polyamine oxidase. PMID:12458962

Seiler, Nikolaus; Duranton, Benoit; Raul, Francis

2002-01-01

294

Initial characerization of human spermine oxidase  

E-print Network

INITIAL CHARACTERIZATION OF HUMAN SPERMINE OXIDASE A Thesis by PAUL RAMON JUAREZ Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE December 2008 Major Subject: Biochemistry INITIAL CHARACTERIZATION OF HUMAN SPERMINE OXIDASE A Thesis by PAUL RAMON JUAREZ Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

Juarez, Paul Ramon

2009-05-15

295

NADPH Oxidase Biology and the Regulation of Tyrosine Kinase Receptor Signaling and Cancer Drug Cytotoxicity  

PubMed Central

The outdated idea that reactive oxygen species (ROS) are only dangerous products of cellular metabolism, causing toxic and mutagenic effects on cellular components, is being replaced by the view that ROS have several important functions in cell signaling. In aerobic organisms, ROS can be generated from different sources, including the mitochondrial electron transport chain, xanthine oxidase, myeloperoxidase, and lipoxygenase, but the only enzyme family that produces ROS as its main product is the NADPH oxidase family (NOX enzymes). These transfer electrons from NADPH (converting it to NADP?) to oxygen to make O2•?. Due to their stability, the products of NADPH oxidase, hydrogen peroxide, and superoxide are considered the most favorable ROS to act as signaling molecules. Transcription factors that regulate gene expression involved in carcinogenesis are modulated by NADPH oxidase, and it has emerged as a promising target for cancer therapies. The present review discusses the mechanisms by which NADPH oxidase regulates signal transduction pathways in view of tyrosine kinase receptors, which are pivotal to regulating the hallmarks of cancer, and how ROS mediate the cytotoxicity of several cancer drugs employed in clinical practice. PMID:23434665

Paletta-Silva, Rafael; Rocco-Machado, Nathália; Meyer-Fernandes, José Roberto

2013-01-01

296

Inhibition of monoamine oxidase by substituted hydrazines  

PubMed Central

1. The initial rate of inhibition of monoamine oxidase by phenethylhydrazine was shown to be similar, in pH-dependence and kinetic properties, to the oxidation of that compound by monoamine oxidase. 2. The time-course of irreversible inhibition of monoamine oxidase by phenethylhydrazine lags behind that of reversible inhibition. 3. Hydralzine was shown to be a reversible competitive inhibitor of monoamine oxidase, but phenylhydrazine is an irreversible inhibitor. Inhibition by the latter compound is not affected by the absence of oxygen, and the presence of substrate exerts no protective action. 4. Hydrazine does not inhibit monoamine oxidase unless a substrate and oxygen are present. 5. Phenethylidenehydrazine was found to be a time-dependent inhibitor of monoamine oxidase and the rate of inhibition was hindered by increasing oxygen concentration. 6. A mechanism for the inhibition of the enzyme by phenethylhydrazine is proposed in which the product of oxidation of this compound is a potent reversible inhibitor and an irreversible inhibitor of the enzyme. A computer simulation of such a mechanism predicts time-courses of inhibition that are in reasonable agreement with those observed experimentally. PMID:4674124

Tipton, Keith F.

1972-01-01

297

Molecular, immunological, enzymatic and biochemical studies of coproporphyrinogen oxidase deficiency in a family with hereditary coproporphyria.  

PubMed

A 27-year-old woman who had recurrent pain in renal bed since 1998 with increasing character, was stationary admitted. The patient showed dark urine, complained of hair loss and took since 1994 a hormonal oral contraceptive. No photosensitivity was observed. Determinations of urinary porphyrin metabolites in 1998 revealed a porphyria cutanea tarda like excretion pattern with elevations of uro- (1767 nmol/24 hr, normal <29 nmol/24 hr) and heptacarboxyporphyrin (568 nmol/24 hr; normal <4 nmol/24 hr). Follow-up studies in feces showed the characteristics of a hereditary coproporphyria with dominance of coproporphyrin isomer III (total= 1470 nmol/g, isomer III= 93%), (normal: <37 nmol/g, isomer III = 25-35%). The excretion of porphyrin precursors (delta-aminolevulinic acid and porphobilinogen) was increased by taking an ethinylestradiol-cyproteronacetate-preparation, but acute and/or chronic manifestations were not observed. Coproporphyrinogen oxidase activity was decreased to 35% in the patient (normal=138+/-21 pkat/g protein; x+/-s), whereas the activity of red cell uroporphyrinogen decarboxylase was normal. Her mother and both sisters could be verified as heterozygous gene carriers of hereditary coproporphyria by their urinary and fecal excretion parameters and because of reduced coproporphyrinogen oxidase activity up to 50%. The father was normal with respect to his genotype. Molecular analysis revealed a hitherto unknown mutation with the transversion of a cytosine to thymine at nucleotide position 854 in exon 4 of the coproporphyrinogen oxidase gene. The gene defect was confirmed by DGGE in the mother and her three daughters. The investigation of the immunological nature of the defective coproporphyrinogen oxidase gene from the whole family revealed decreased concentrations of coproporphyrinogen oxidase protein in the patient, her mother and her two sisters. PMID:11929047

Gross, U; Puy, H; Kühnel, A; Meissauer, U; Deybach, J C; Jacob, K; Martasek, P; Nordmann, Y; Doss, M O

2002-02-01

298

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.  

PubMed

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace. PMID:18850326

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

299

Targeting NADPH oxidases in vascular pharmacology  

PubMed Central

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the selective inhibition of dysfunctional NADPH oxidase homologs. This appears to be the most reasonable approach, potentially much more efficient than non-selective scavenging of all ROS by the administration of antioxidants. PMID:22405985

Schramm, Agata; Matusik, Pawe?; Osmenda, Grzegorz; Guzik, Tomasz J

2012-01-01

300

Heme/copper terminal oxidases  

SciTech Connect

Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

Ferguson-Miller, S.; Babcock, G.T. [Michigan State Univ., East Lansing, MI (United States)] [Michigan State Univ., East Lansing, MI (United States)

1996-11-01

301

Cervical Intraepithelial Neoplasia Is Associated with Increased Polyamine Oxidase and Diamine Oxidase Concentrations in Cervical Mucus  

Microsoft Academic Search

Objective. The aim of this study was to establish whether reactive oxygen species, generated during oxidation of amines, catalyzed by polyamine oxidase (PAO) and diamine oxidase (DAO) in cervical secretions may play a role in the etiology of cervical cancer.Methods. Cervical mucus was obtained from women attending the gynecological outpatient department: 139 with and 154 without cytological evidence of cervical

M. S. Rogers; S. F. Yim; K. C. Li; C. C. Wang; M. Arumanayagam

2002-01-01

302

Relationship of cytochrome caa sub 3 from Thermus thermophilus to other heme- and copper-containing terminal oxidases  

SciTech Connect

Cytochrome oxidases are a key component of the energy metabolism of most aerobic organisms from mammals to bacteria. They are the final enzyme of the membrane associated respiratory chain responsible for converting the chemical energy of reduced substrates to a transmembrane electrochemical potential, which issused by the cell for a wide variety of energy-requiring processes. The most widely studied oxidase is the cytochrome c oxidase of the mammalian mitochondrion. This complex, integral membrane protein contains 13 subunits and four canonical metal centers: heme center a and a{sub 3}; copper centers CU{sub A} and CU{sub B}. It is responsible for electron transfer from reduced chytochrome c to dioxygen with the concomitant reduction of dioxygen to water and the coupled vectorial transfer of protons across the mitochondrial membrane. In this communication we will describe preliminary results of DNA sequencing experiments with the cytochrome caa{sub 3} oxidase, initially undertaken to determine the nature of the subunits of this oxidase and shed light on the distribution of the metal centers. We will speculate on oxidase gene and protein structures and evolutionary relationships in the light of these results and recent sequencing results from other groups. 47 refs., 4 figs., 1 tab.

Mather, M.W.; Springer, P.; Fee, J.A.

1990-01-01

303

Amitriptyline affects histamine-N-methyltransferase and diamine oxidase activity in rats and guinea pigs.  

PubMed

Histamine participates in numerous physiological and patophysiological processes. Drugs which interfere with the histamine actions are antagonists and agonists of histamine receptors. Histamine degrading enzymes as a possible target for modifying histamine action have so far not been extensively studied. Therefore we examined in vivo and in vitro effects of amitriptyline on two histamine degrading enzymes - diamine oxidase and histamine-N-methyltransferase. We were interested in the in vivo effects of amitriptyline on the diamine oxidase release into guinea pig plasma after heparin stimulation and in effects on the activity and gene expression of both histamine degrading enzymes in different guinea pig tissues. Amitriptyline's in vitro effects on the diamine oxidase and histamine-N-methyltransferase activities were measured in guinea pig and also in rat. Enzyme activities were determined with the radiometric micro-assay. The results showed that amitriptyline in vivo changed the profile of the heparin-induced diamine oxidase release, which could be due to changes in at least three processes: diamine oxidase release into plasma, protein synthesis and enzyme activity at the molecular level. Amitriptyline in some tissues (lung and spleen) amplified the mRNA expression of histamine degrading enzymes. Furthermore, the activities of these enzymes were increased in most examined tissues of amitriptyline treated guinea pigs. In vitro studies indicate that amitriptyline differently affects diamine oxidase and histamine-N-methyltransferase in two different rodent species, guinea pig and rat. Our study proved that amitriptyline enhances the histamine degrading processes in guinea pig, what might importantly contribute to lower histamine levels. PMID:17706192

Rajtar, Simona; Irman-Florjanc, Tatjana

2007-11-28

304

Molecular Insights of p47phox Phosphorylation Dynamics in the Regulation of NADPH Oxidase Activation and Superoxide Production*  

PubMed Central

Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox?/? coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2? production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888

Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei

2014-01-01

305

Genetic control of tyramine oxidase, which is involved in derepressed synthesis of arylsulfatase in Klebsiella aerogenes.  

PubMed Central

Mutants of Klebsiella aerogenes with three types of mutations affecting regulation of tyramine oxidase were isolated by a simple selection method. In the first type, the mutation (tynP) was closely linked to the structural gene for tyramine oxidase tynA). The order of mutation sites was atsA-tynP-tynA. In the second type, the mutation that relieves catabolite repression of the syntheses of several catabolite repression-sensitive enzymes are not linked to the tyn gene by P1 transduction. These strains contained high levels of cyclic adenosine 5'-monophosphate when grown on glucose. The third type of mutation, in which tyramine oxidase was synthesized constitutively, was shown by genetic analysis to involve mutations of tynP and tynR. The tynR gene was not linked to tynA. Results using the constitutive mutants showed that the constitutive expression of the tynA gene resulted in depression of arylsulfatase synthesis in the absence of tyramine. PMID:6249789

Oka, M; Murooka, Y; Harada, T

1980-01-01

306

Genetic control of tyramine oxidase, which is involved in derepressed synthesis of arylsulfatase in Klebsiella aerogenes.  

PubMed

Mutants of Klebsiella aerogenes with three types of mutations affecting regulation of tyramine oxidase were isolated by a simple selection method. In the first type, the mutation (tynP) was closely linked to the structural gene for tyramine oxidase tynA). The order of mutation sites was atsA-tynP-tynA. In the second type, the mutation that relieves catabolite repression of the syntheses of several catabolite repression-sensitive enzymes are not linked to the tyn gene by P1 transduction. These strains contained high levels of cyclic adenosine 5'-monophosphate when grown on glucose. The third type of mutation, in which tyramine oxidase was synthesized constitutively, was shown by genetic analysis to involve mutations of tynP and tynR. The tynR gene was not linked to tynA. Results using the constitutive mutants showed that the constitutive expression of the tynA gene resulted in depression of arylsulfatase synthesis in the absence of tyramine. PMID:6249789

Oka, M; Murooka, Y; Harada, T

1980-07-01

307

Novel role of NADPH oxidase in ischemic myocardium: a study with Nox2 knockout mice.  

PubMed

Several potential sources of reactive oxygen species (ROS) in cells exist. One source is NADPH oxidase, which is especially important for superoxide radical production. Nox2 is a primary regulatory subunit of NADPH oxidase. In the present study, we examined the role of ROS and NADPH oxidase in ischemic preconditioning (IP)-mediated cardioprotection by using Nox2(-/-) mice. Both wild-type (WT) and Nox2(-/-) mice were subjected to either 30 min of ischemia followed by 2 h of reperfusion (IR) or IP prior to 30 min ischemia and 2 h of reperfusion. Reduction in left ventricular developed pressure (60.1 versus 63 mmHg), dp/dt (max) (893 versus 1,027 mmHg/s), and aortic flow (0.9 versus 1.8 ml/min) was observed in Nox2(-/-)IPIR compared to WTIPIR along with increased infarct size (33% versus 22%) and apoptosis after 120 min of reperfusion. Differentially regulated genes were demonstrated by comparing gene expression in WTIPIR versus Nox2(-/-) IPIR hearts. Selected differentially regulated genes such as ?-catenin, SRPK3, ERDR1, ACIN1, Syntaxin-8, and STC1 were validated by real-time PCR. Taken together, this is the first report identifying important, differentially expressed genes during ischemic preconditioning in Nox2(-/-) mice by using microarray analysis. PMID:22038056

Thirunavukkarasu, Mahesh; Adluri, Ram Sudheer; Juhasz, Bela; Samuel, Samson Mathews; Zhan, Lijun; Kaur, Anupinder; Maulik, Gautam; Sanchez, Juan A; Hager, Janet; Maulik, Nilanjana

2012-08-01

308

Spatiotemporal Localization of d-Amino Acid Oxidase and d-Aspartate Oxidases during Development in Caenorhabditis elegans  

PubMed Central

Recent investigations have shown that a variety of d-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. d-Amino acid oxidase (DAO) and d-aspartate oxidase (DDO) are degradative enzymes stereospecific for d-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of d-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several d- and l-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and d-amino acids in multicellular organisms. PMID:22393259

Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito

2012-01-01

309

Diamine Oxidase Activity in Plasma and Urine in Uremia  

Microsoft Academic Search

Diamine oxidase activity was measured in plasma or urine in 12 normal men, 4 men with chronic liver or heart disease, 13 men with chronic renal failure, and 12 men undergoing maintenance hemodialysis. Also in five studies in 4 patients, plasma diamine oxidase activity and total amine levels were measured at hourly intervals during a hemodialysis treatment. Plasma diamine oxidase

Chick Fai Tarn; Joel D. Kopple; Marian Wang; Marian E. Swendseid

1979-01-01

310

Decreased plasma postheparin diamine oxidase levels in celiac disease  

Microsoft Academic Search

The highest diamine oxidase activity is contained in small-bowel mucosa and, after heparin administration, the enzyme is released by the intestine into the plasma. Previous experimental studies showed that measurement of plasma postheparin diamine oxidase activity is a sensitive test for quantitating the length and severity of small-bowel mucosal injury. On this basis, we measured plasma diamine oxidase activity in

Gino Roberto Corazza; Annaida Falasca; Alessandra Strocchi; Carlo Alfonso Rossi; Giovanni Gasbarrini

1988-01-01

311

Genes  

NSDL National Science Digital Library

Illustration of the placement of genes in a chromosome. A gene can be defined as a region of DNA that controls a hereditary characteristic. It usually corresponds to a sequence used in the production of a specific protein or RNA. A gene carries biological information in a form that must be copied and transmitted from each cell to all its progeny. This includes the entire functional unit: coding DNA sequences, non-coding regulatory DNA sequences, and introns. Genes can be as short as 1000 base pairs or as long as several hundred thousand base pairs. It can even be carried by more than one chromosome. The estimate for the number of genes in humans has decreased as our knowledge has increased. As of 2001, humans are thought to have between 30,000 and 40,000 genes.

Access Excellence

2005-03-12

312

NADPH OXIDASES IN LUNG BIOLOGY AND PATHOLOGY. HOST DEFENSE ENZYMES, AND MORE  

PubMed Central

The deliberate production of reactive oxygen species (ROS) by phagocyte NADPH oxidase is widely appreciated as a critical component of antimicrobial host defense. Recently, additional homologs of NADPH oxidase (NOX) have been discovered throughout the animal and plant kingdoms, which appear to possess diverse functions in addition to host defense, including cell proliferation, differentiation, and regulation of gene expression. Several of these NOX homologs are also expressed within the respiratory tract, where they participate in innate host defense as well as in epithelial and inflammatory cell signaling and gene expression, and fibroblast and smooth muscle cell proliferation, in response to bacterial or viral infection and environmental stress. Inappropriate expression or activation of NOX/DUOX during various lung pathologies suggests their specific involvement in respiratory disease. This review summarizes the current state of knowledge regarding the general functional properties of mammalian NOX enzymes, and their specific importance in respiratory tract physiology and pathology. PMID:18164271

van der Vliet, Albert

2008-01-01

313

The primary structure of bovine monoamine oxidase type A. Comparison with peptide sequences of bovine monoamine oxidase type B and other flavoenzymes.  

PubMed Central

We have isolated cDNA clones believed to encompass the full-length coding sequences for a subunit of bovine monoamine oxidase type A (MAO-A). The clones code for an apoprotein of 527 amino acid residues corresponding to a molecular mass of 59,806 Da. The inferred protein sequences show an overall similarity of 68% with partial amino acid sequences of bovine type B MAO (about 41% of the total sequence), as well as a greater similarity (greater than 90%) with some regions including that for the published sequence of the flavin-binding region. Sequence comparisons indicate that these two forms of MAO are encoded by distinct genes. Comparison of this sequence with other flavoenzymes showed similarity with regions associated with non-covalent flavin-binding sites. Analysis of mRNAs coding for MAO enzymes showed a heterogeneity of transcripts consistent with several different forms of monoamine oxidase. Images Fig. 3. PMID:2719656

Powell, J F; Hsu, Y P; Weyler, W; Chen, S A; Salach, J; Andrikopoulos, K; Mallet, J; Breakefield, X O

1989-01-01

314

Increased monocyte oxidase activity in cystic fibrosis heterozygotes and homozygotes.  

PubMed

Freshly isolated monocytes from cystic fibrosis (CF) heterozygotes and homozygotes had significantly increased oxygen uptake and superoxide formation after surface glycoprotein stimulation than did monocytes from age- and sex-matched controls. Lack of differences among the genotypes in inhibition by simple sugars of the concanavalin A-stimulated superoxide production and lack of differences in concanavalin A-binding surface proteins suggested that different regulation of the oxidase pathway produced the increased oxygen uptake and superoxide formation in CF patients and carriers. This regulatory role is consistent with the predicted structure of the CF gene product. The results support the hypothesis that the mononuclear phagocytes of CF heterozygotes have a significantly increased ability to kill intracellular microbes and may confer a selective advantage to the host. PMID:1652266

Regelmann, W E; Skubitz, K M; Herron, J M

1991-07-01

315

Copper Starvation-inducible Protein for Cytochrome Oxidase Biogenesis in Bradyrhizobium japonicum*  

PubMed Central

Microarray analysis of Bradyrhizobium japonicum grown under copper limitation uncovered five genes named pcuABCDE, which are co-transcribed and co-regulated as an operon. The predicted gene products are periplasmic proteins (PcuA, PcuC, and PcuD), a TonB-dependent outer membrane receptor (PcuB), and a cytoplasmic membrane-integral protein (PcuE). Homologs of PcuC and PcuE had been discovered in other bacteria, namely PCuAC and YcnJ, where they play a role in cytochrome oxidase biogenesis and copper transport, respectively. Deletion of the pcuABCDE operon led to a pleiotropic phenotype, including defects in the aa3-type cytochrome oxidase, symbiotic nitrogen fixation, and anoxic nitrate respiration. Complementation analyses revealed that, under our assay conditions, the tested functions depended only on the pcuC gene and not on pcuA, pcuB, pcuD, or pcuE. The B. japonicum genome harbors a second pcuC-like gene (blr7088), which, however, did not functionally replace the mutated pcuC. The PcuC protein was overexpressed in Escherichia coli, purified to homogeneity, and shown to bind Cu(I) with high affinity in a 1:1 stoichiometry. The replacement of His79, Met90, His113, and Met115 by alanine perturbed copper binding. This corroborates the previously purported role of this protein as a periplasmic copper chaperone for the formation of the CuA center on the aa3-type cytochrome oxidase. In addition, we provide evidence that PcuC and the copper chaperone ScoI are important for the symbiotically essential, CuA-free cbb3-type cytochrome oxidase specifically in endosymbiotic bacteroids of soybean root nodules, which could explain the symbiosis-defective phenotype of the pcuC and scoI mutants. PMID:23012364

Serventi, Fabio; Youard, Zeb Andrew; Murset, Valérie; Huwiler, Simona; Bühler, Doris; Richter, Miriam; Luchsinger, Ronny; Fischer, Hans-Martin; Brogioli, Robert; Niederer, Martina; Hennecke, Hauke

2012-01-01

316

Association between Monoamine Oxidase A Polymorphisms and Anger-Related Personality Traits in Korean Women  

Microsoft Academic Search

It has been suggested that polymorphisms in the monoamine oxidase A (MAO-A) gene are associated with aggressive and impulsive behaviors. In the present study, we investigated the association of the MAO-A variable number of tandem repeat polymorphism in the promoter region (MAO-A uVNTR) with anger-related personality traits. Specifically, MAO-A uVNTR polymorphisms were examined for associations with the State-Trait Anger Expression

Jae-Won Yang; So-Hee Lee; Seung-Ho Ryu; Boung-Chul Lee; Seung-Hyun Kim; Sook-Haeng Joe; In-Kwa Jung; Ihn-Geun Choi; Byung-Joo Ham

2007-01-01

317

Phylogeny of Ips DeGeer Species (Coleoptera: Scolytidae) Inferred from Mitochondrial Cytochrome Oxidase I DNA Sequence  

Microsoft Academic Search

We used 766 bp of DNA sequence data from the mitochondrial cytochrome oxidase I gene to reconstruct a phylogeny for 39 of 43 Ips species, many of which are economically important bark beetles. The phylogeny was reconstructed using equally weighted and weighted parsimony. In both analyses, peripheral clades were well supported while internal clades were poorly supported. Phylogenetic analysis of

Anthony I. Cognato; Felix A. H. Sperling

2000-01-01

318

MECHANISM OF POLYPHENOL OXIDASE ACTION IN REDUCING LIPOLYSIS AND PROTEOLYSIS IN RED CLOVER DURING BATCH CULTURE INCUBATION  

Technology Transfer Automated Retrieval System (TEKTRAN)

Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

319

ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens  

E-print Network

Pasteuria ramosa, which is highly amenable to laboratory experimentation. Through experimentation, much online 25 December 2008 Keywords: Invertebrate immunity ProPhenolOxidase Pasteuria ramosa Pathogen A B to the specialist endobacterial pathogen, Pasteuria ramosa. This study was focused on the proPO gene of Daphnia

Obbard, Darren

320

Diamine oxidase and putrescine oxidase immobilized reactors in flow injection analysis: a comparison in substrate specificity  

Microsoft Academic Search

Enzyme reactors for the determination of biogenic amines have been developed using diamine oxidase (DAO) from porcine kidney and from lentil and putrescine oxidase (PUO) from microorganism (Micrococcus roseus). Determination is based on the electrochemical oxidation of enzymatically produced H2O2 at platinum electrode poised at 600 mV versus Ag\\/AgCl. The enzymes are immobilized on controlled pore glass beads activated by

M.-A Carsol; M Mascini

1999-01-01

321

Cross talk between mitochondria and NADPH oxidases  

Microsoft Academic Search

Reactive oxygen species (ROS) play an important role in physiological and pathological processes. In recent years, a feed-forward regulation of the ROS sources has been reported. The interactions between the main cellular sources of ROS, such as mitochondria and NADPH oxidases, however, remain obscure. This work summarizes the latest findings on the role of cross talk between mitochondria and NADPH

Sergey Dikalov

2011-01-01

322

Studies on the mechanism of alcohol oxidase  

E-print Network

advanced than carbon hydrogen bond cleavage. With methanol, ethanol, and trifluoroethanol as substrates for alcohol oxidase, a single ionizable group with a pKa value of 8.3 must be deprotonated for binding and catalysis. This residue is proposed...

Menon, Vipin

2012-06-07

323

Inhibition of diamine oxidase by antimalarial drugs  

Microsoft Academic Search

The antimalarial drugs amodiaquine, quinacrine and chloroquine inhibit the catabolism of putrescine by the rat. Amodiaquine, the most potent of the three, does so in a dose-dependent fashion. This is attributed to the action in vivo of the drugs on diamine oxidase, an enzyme that is inhibited by them in vitro.

Kelvin Ma; Theodore L. Sourkes

1980-01-01

324

Postheparin-diamine oxidase (histaminase) in anaphylaxis  

Microsoft Academic Search

Summary The level of plasma postheparin-diamine oxidase was determined in two patients three days after an anaphylactic shock and was controlled four weeks, and also six months later. A decrease of the enzyme levels to about 10% of a control group was found and a slow enzyme increase to about 40% observed six months later. It seems probable that in

V. Gäng; W. Gaubitz; U. Gunzer

1975-01-01

325

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping  

SciTech Connect

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissues revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin [Keio Univ. School of Medicine, Tokyo (Japan)] [and others] [Keio Univ. School of Medicine, Tokyo (Japan); and others

1997-03-01

326

The black-headed jumping spider, Trite planiceps Simon, 1899 (Araneae: Salticidae): redescription including cytochrome c oxidase subunit 1 and paralogous 28S sequences  

Microsoft Academic Search

Trite planiceps Simon, 1899, the black-headed jumping spider, is redescribed and the distribution and biology of the species is discussed. DNA sequences from the mitochondrial gene cytochrome c oxidase subunit 1 (COI) and the nuclear gene 28S ribosomal RNA are presented. An intraspecific phylogeny based on COI from T. planiceps from throughout New Zealand is presented. Paralogous copies of 28S

CJ Vink; N Dupérré; BN McQuillan

2011-01-01

327

BEHAVIORAL OUTCOMES OF MONOAMINE OXIDASE DEFICIENCY: PRECLINICAL AND CLINICAL EVIDENCE  

PubMed Central

Monoamine oxidase (MAO) isoenzymes A and B are mitochondrial-bound proteins, catalyzing the oxidative deamination of monoamine neurotransmitters as well as xenobiotic amines. Although they derive from a common ancestral progenitor gene, are located at X-chromosome and display 70% structural identity, their substrate preference, regional distribution, and physiological role are divergent. In fact, while MAO-A has high affinity for serotonin and norepinephrine, MAO-B primarily serves the catabolism of 2-phenylethylamine (PEA) and contributes to the degradation of other trace amines and dopamine. Convergent lines of preclinical and clinical evidence indicate that variations in MAO enzymatic activity—due to either genetic or environmental factors—can exert a profound influence on behavioral regulation and play a role in the pathophysiology of a large spectrum of mental and neurodegenerative disorders, ranging from antisocial personality disorder to Parkinson’s disease. Over the past few years, numerous advances have been made in our understanding of the phenotypical variations associated with genetic polymorphisms and mutations of the genes encoding for both isoenzymes. In particular, novel findings on the phenotypes of MAO-deficient mice are highlighting novel potential implications of both isoenzymes in a broad spectrum of mental disorders, ranging from autism and anxiety to impulse-control disorders and ADHD. These studies will lay the foundation for future research on the neurobiological and neurochemical bases of these pathological conditions, as well as the role of gene × environment interactions in the vulnerability to several mental disorders. PMID:21971001

Bortolato, Marco; Shih, Jean C.

2012-01-01

328

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis  

PubMed Central

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the ?-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that cytochrome bd is an important terminal oxidase in M. smegmatis. PMID:11717265

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

329

Norepinephrine increases NADPH oxidase-derived superoxide in human peripheral blood mononuclear cells via ?-adrenergic receptors  

PubMed Central

Many diseases associated with sympathoexcitation also exhibit elevated reactive oxygen species (ROS). A recent animal study indicated that exogenous administration of the sympathetic neurotransmitter norepinephrine (NE) increased systemic ROS via circulating leukocytes. The mechanisms contributing to this effect of NE and whether these findings can be translated to humans is unknown. Thus we tested the hypothesis that NE increases superoxide production in human peripheral blood mononuclear cells (PBMCs) via NADPH oxidase. Primary human PBMCs were freshly isolated from healthy young men and placed in culture. After NE (50 pg/ml, 50 ng/ml, and 50 ?g/ml concentrations) or control treatments, NADPH oxidase mRNA expression (gp91phox, p22phox, and p67phox) was assessed using real-time RT-PCR, and intracellular superoxide production was measured using dihydroethidium fluorescence. PBMCs were also treated with selective adrenergic agonists-antagonists to determine the receptor population involved. In addition, CD14+ monocyte-endothelial cell adhesion was determined using a fluorescent-based assay. NE significantly increased NADPH oxidase gene expression and intracellular superoxide production in a time-dependent manner (superoxide: 0.9 ± 0.2 fold, 6 h vs. 3.0 ± 0.3 fold, 36 h; NE, 50 ?g/ml; P < 0.05). The sustained increase in NE-induced superoxide production was primarily mediated via ?-adrenergic receptors, preferentially ?2-receptors. The NADPH oxidase blocker diphenylene iodonium and protein kinase C inhibitor Staurosporine significantly attenuated NE-induced increases in superoxide production. Importantly, NE treatment increased CD14+ monocyte-endothelial cell adhesion. These findings indicate for the first time that NE increases superoxide production in freshly isolated primary human PBMCs via NADPH oxidase through ?-adrenergic receptors, an effect facilitating monocyte adhesion to the endothelium. PMID:24068047

Deo, Shekhar H.; Jenkins, Nathan T.; Padilla, Jaume; Parrish, Alan R.

2013-01-01

330

Tellurite-mediated damage to the Escherichia coli NDH-dehydrogenases and terminal oxidases in aerobic conditions.  

PubMed

Escherichia coli exposed to tellurite shows augmented membrane lipid peroxidation and ROS content. Also, reduced thiols, protein carbonylation, [Fe-S] center dismantling, and accumulation of key metabolites occur in these bacteria. In spite of this, not much is known about tellurite effects on the E. coli electron transport chain (ETC). In this work, tellurite-mediated damage to the E. coli ETC's NADH dehydrogenases and terminal oxidases was assessed. Mutant lacking ETC components showed delayed growth, decreased oxygen consumption and increased ROS in the presence of the toxicant. Membranes from tellurite-exposed E. coli exhibited decreased oxygen consumption and dNADH/NADH dehydrogenase activity, showing an impairment of NDH-I but not of NDH-II activity. Regarding terminal oxidases, only the bo oxidase complex was affected by tellurite. When assaying NDH-I and NDH-II activity in the presence of superoxide, the NDH-I complex was preferentially damaged. The activity was partly restored in the presence of reducing agents, sulfide and Fe(2+) under anaerobic conditions, suggesting that damage affects NDH-I [4Fe-4S] centers. Finally, augmented membrane protein oxidation along with reduced oxidase activity was observed in the presence of the toxicant. Also, the increased expression of genes encoding alternative terminal oxidases probably reflects a cell's change towards anaerobic respiration when facing tellurite. PMID:25447814

Díaz-Vásquez, Waldo A; Abarca-Lagunas, María J; Cornejo, Fabián A; Pinto, Camilo A; Arenas, Felipe A; Vásquez, Claudio C

2015-01-15

331

Activation of polyphenol oxidase by polyamines.  

PubMed

Latent polyphenol oxidase was extracted and partially purified from grape cell suspension cultures. The enzyme was shown to be activated by polyamines. Activation of the enzyme increased with increasing polyamine concentrations and half-maximal activation was in the order of 8mM. Kinetic parameters, Km and Vm, were also calculated for the latent and activated enzymes. The activating effect of polyamines was studied at different pH values. Optimum pH was 4.5 for latent and activated enzymes. However, the highest degree of activation was obtained at pH 5. Activation caused a higher sensitivity of polyphenol oxidase to pH and temperature. The ability of polyamines to activate the enzyme may suggest a limited conformational change. PMID:1804105

Jiménez-Atiénzar, M; Angeles Pedreño, M; García-Carmona, F

1991-12-01

332

Cation transport in cytochrome oxidase reconstituted vesicles.  

PubMed

Cation translocation across the membrane of cytochrome oxidase reconstituted vesicles may be followed with a simple spectrophotometric method. Cytochrome oxidase reconstituted vesicles, supplemented with ascorbate and cytochrome c. induce large spectral changes of the positive dye safranine, reversed by uncouplers and inhibitors of respiration. The dye is probably accumulated in the inner space of the vesicles, where it reaches high concentrations and aggregates. The spectral shifts and the absorbance changes, due to aggregation, are proportional to the amount of the dye taken up and depend on the respiratory control. In the presence of potassium, valinomycin causes an inhibition, whereas nigericin stimulates the dye uptake. The data are discussed in terms of electrical potential dependent fluxes. PMID:13827

Gutweniger, H; Massari, S; Beltrame, M; Colonna, R

1977-02-01

333

NADPH oxidase expression in active multiple sclerosis lesions in relation to oxidative tissue damage and mitochondrial injury  

PubMed Central

Multiple sclerosis is a chronic inflammatory disease of the central nervous system, associated with demyelination and neurodegeneration. The mechanisms of tissue injury are poorly understood, but recent data suggest that mitochondrial injury may play an important role in this process. Mitochondrial injury can be triggered by reactive oxygen and nitric oxide species, and we recently provided evidence for oxidative damage of oligodendrocytes and dystrophic axons in early stages of active multiple sclerosis lesions. In this study, we identified potential sources of reactive oxygen and nitrogen species through gene expression in carefully staged and dissected lesion areas and by immunohistochemical analysis of protein expression. Genome-wide microarrays confirmed mitochondrial injury in active multiple sclerosis lesions, which may serve as an important source of reactive oxygen species. In addition, we found differences in the gene expression levels of various nicotinamide adenine dinucleotide phosphate oxidase subunits between initial multiple sclerosis lesions and control white matter. These results were confirmed at the protein level by means of immunohistochemistry, showing upregulation of the subunits gp91phox, p22phox, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 in activated microglia in classical active as well as slowly expanding lesions. The subunits gp91phox and p22phox were constitutively expressed in microglia and were upregulated in the initial lesion. In contrast, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 expression were more restricted to the zone of initial damage or to lesions from patients with acute or early relapsing/remitting multiple sclerosis. Double labelling showed co-expression of the nicotinamide adenine dinucleotide phosphate oxidase subunits in activated microglia and infiltrated macrophages, suggesting the assembly of functional complexes. Our data suggest that the inflammation-associated oxidative burst in activated microglia and macrophages plays an important role in demyelination and free radical-mediated tissue injury in the pathogenesis of multiple sclerosis. PMID:22366799

Fischer, Marie T.; Sharma, Rakhi; Lim, Jamie L.; Haider, Lukas; Frischer, Josa M.; Drexhage, Joost; Mahad, Don; Bradl, Monika; van Horssen, Jack

2012-01-01

334

Defensive Roles of Polyphenol Oxidase in Plants  

Microsoft Academic Search

Plant polyphenol oxidases (PPOs) are widely distributed and well-studied oxidative enzymes, and their effects on discoloration in damaged and diseased plant tissues have been known for many years. The discovery in C.A. Ryan's laboratory in the mid-1990s that tomato PPO is induced by the herbivore defense signals systemin and jasmonate, together with seminal work on PPO's possible effects on herbiv-

C. Peter Constabel; Raymond Barbehenn

335

Sulfhydryl oxidases: sources, properties, production and applications  

Microsoft Academic Search

The formation of disulfide bonds in proteins and small molecules can greatly affect their functionality. Sulfhydryl oxidases\\u000a (SOXs) are enzymes capable of oxidising the free sulfhydryl groups in proteins and thiol-containing small molecules by using\\u000a molecular oxygen as an electron acceptor. SOXs have been isolated from the intracellular compartments of many organisms, but\\u000a also secreted SOXs are known. These latter

Greta Faccio; Outi Nivala; Kristiina Kruus; Johanna Buchert; Markku Saloheimo

2011-01-01

336

Silicon-Mediated Inactivation of Diamine Oxidase  

Microsoft Academic Search

The design, synthesis, and biologic evaluation of potential silicon-containing inhibitors of diamine oxidases (siladiaminopropane1, silaputrescine2, and sila analogs of cadaverine3, 4,and5) are described. All compounds have been prepared independently. The common feature in the reported syntheses is the way chosen to introduce the amine group relative to silicon: the Gabriel-type approach to obtaining aminomethyl- and aminopropylsilanes and the Mitsunobu-type approach

V. Van Dorsselaer; D. Schirlin; P. Marchal; F. Weber; C. Danzin

1996-01-01

337

Ligand interactions with galactose oxidase: mechanistic insights.  

PubMed Central

Interactions between galactose oxidase and small molecules have been explored using a combination of optical absorption, circular dichroism, and electron paramagnetic resonance (EPR) spectroscopies to detect complex formation and characterize the products. Anions bind directly to the cupric center in both active and inactive galactose oxidase, converting to complexes with optical and EPR spectra that are distinctly different from those of the starting aquo enzyme. Azide binding is coupled to stoichiometric proton uptake by the enzyme, reflecting the generation of a strong base (pKa > 9) in the active site anion adduct. At low temperature, the aquo enzyme converts to a form that exhibits the characteristic optical and EPR spectra of an anion complex, apparently reflecting deprotonation of the coordinated water. Anion binding results in a loss of the optical transition arising from coordinated tyrosine, implying displacement of the axial tyrosine ligand on forming the adduct. Nitric oxide binds to galactose oxidase, forming a specific complex exhibiting an unusual EPR spectrum with all g values below 2. The absence of Cu splitting in this spectrum and the observation that the cupric EPR signal from the active site metal ion is not significantly decreased in the complex suggest a nonmetal interaction site for NO in galactose oxidase. These results have been interpreted in terms of a mechanistic scheme where substrate binding displaces a tyrosinate ligand from the active site cupric ion, generating a base that may serve to deprotonate the coordinated hydroxyl group of the substrate, activating it for oxidation. The protein-NO interactions may probe a nonmetal O2 binding site in this enzyme. PMID:8386015

Whittaker, M M; Whittaker, J W

1993-01-01

338

Characterization of polyphenol oxidase in coffee  

Microsoft Academic Search

Polyphenol oxidase (PPO) was characterized in partially purified extracts of leaves (PPO-L) and fruit endosperm (PPO-E) of coffee (Coffea arabica L.). PPO activity was higher in early developmental stages of both leaves and endosperm of fruits. Wounding or exposure of coffee leaves to methyl jasmonate increased PPO activity 1.5–4-fold. PPO was not latent and was not activated by protease treatment.

Paulo Mazzafera; Simon P Robinson

2000-01-01

339

Imaging Monoamine Oxidase in the Human Brain  

SciTech Connect

Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

1999-11-10

340

The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.  

PubMed

The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus. PMID:18705873

Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

2008-05-01

341

Discovery and characterization of a 5-hydroxymethylfurfural oxidase from Methylovorus sp. strain MP688.  

PubMed

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

Dijkman, Willem P; Fraaije, Marco W

2014-02-01

342

Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688  

PubMed Central

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

Dijkman, Willem P.

2014-01-01

343

Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.  

PubMed

In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively. PMID:17291580

Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Ya?ci, Y

2007-06-01

344

Thermosensitive respiratory deficiency in yeast associated with specific effects on particulate cytochrome oxidase.  

PubMed

A mutant of Saccharomyces cerevisiae, unable to grow at the expense of non fermentable carbon sources at 37 degrees C, has been selected; at 25 degrees C the mutant strain behaves like the parental wild strain. Evaluations of respiration rates during aerobic growth at restrictive temperature on one hand, enzymatic and/or spectral evaluations of the individual components of the respiratory chain on the other hand show that the respiratory deficiency is specifically correlated with a reduced level of cytochrome oxidase. The decrease of enzyme activity is the direct consequence of a lowering of hemoprotein (a,a3) concentration. Temperature-activity relationship of cytochrome oxidase elaborated at the permissive temperature by the mutant strain is modified as far as the particulate enzyme is concerned, but no difference is observed after partial solubilization of the enzyme by non ionic surfactant. Genetic analysis shows that the mutant phenotype results from a nuclear gene mutation. PMID:192324

Bex, F; Sels, A A

1977-01-01

345

Reactive oxygen species production and activation mechanism of the rice NADPH oxidase OsRbohB.  

PubMed

Reactive oxygen species (ROS) produced by plant NADPH oxidases (NOXes) are important in plant innate immunity. The Oryza sativa respiratory burst oxidase homologue B (OsRbohB) gene encodes a NOX the regulatory mechanisms of which are largely unknown. Here, we used a heterologous expression system to demonstrate that OsRbohB shows ROS-producing activity. Treatment with ionomycin, a Ca(2+) ionophore, and calyculin A, a protein phosphatase inhibitor, activated ROS-producing activity; it was thus OsRbohB activated by both Ca(2+) and protein phosphorylation. Mutation analyses revealed that not only the first EF-hand motif but also the upstream amino-terminal region were necessary for Ca(2+)-dependent activation, while these regions are not required for phosphorylation-induced ROS production. PMID:22528669

Takahashi, Shinya; Kimura, Sachie; Kaya, Hidetaka; Iizuka, Ayako; Wong, Hann Ling; Shimamoto, Ko; Kuchitsu, Kazuyuki

2012-07-01

346

Trans-nuclear action of the nit-2 regulatory gene product and study of two additional nitrogen control genes in Neurospora crassa  

Microsoft Academic Search

The nit-2 gene of Neurospora crassa is a major regulatory gene for control of nitrogen metabolism. Synthesis of the enzyme L-amino acid oxidase requires a functional nit-2 gene product and is also controlled by amino acid induction and nitrogen catabolite repression. Electrophoretic variants of L-amino acid oxidase have been employed to demonstrate that in heterokaryons, a nit-2+ gene product can

John A. A. Chambers; Sherri M. Griffon; George A. Marzluf

1983-01-01

347

Differential responses of the promoters from nearly identical paralogs of loblolly pine ( Pinus taeda L.) ACC oxidase to biotic and abiotic stresses in transgenic Arabidopsis thaliana  

Microsoft Academic Search

Promoters from an ACC oxidase gene (PtACO1) and its nearly identical paralog (NIP) (PtACO2) of loblolly pine (Pinus taeda L.) were recovered from genomic DNA using PCR amplification. Transgenic Arabidopsis plants harboring genetic constructs from which ?-glucuronidase (GUS) expression was driven by the full-length (pACO1:GUS, pACO2:GUS) or truncated (pACO1-1.2:GUS, pACO2-1.2:GUS) loblolly pine ACC oxidase gene promoters displayed distinctive patterns of

Shenghua Yuan; Jeffrey F. D. Dean

2010-01-01

348

Disrupted and transgenic urate oxidase alter urate and dopaminergic neurodegeneration.  

PubMed

Urate is the end product of purine metabolism in humans, owing to the evolutionary disruption of the gene encoding urate oxidase (UOx). Elevated urate can cause gout and urolithiasis and is associated with cardiovascular and other diseases. However, urate also possesses antioxidant and neuroprotective properties. Recent convergence of epidemiological and clinical data has identified urate as a predictor of both reduced risk and favorable progression of Parkinson's disease (PD). In rodents, functional UOx catalyzes urate oxidation to allantoin. We found that UOx KO mice with a constitutive mutation of the gene have increased concentrations of brain urate. By contrast, UOx transgenic (Tg) mice overexpressing the enzyme have reduced brain urate concentrations. Effects of the complementary UOx manipulations were assessed in a mouse intrastriatal 6-hydroxydopamine (6-OHDA) model of hemiparkinsonism. UOx KO mice exhibit attenuated toxic effects of 6-OHDA on nigral dopaminergic cell counts, striatal dopamine content, and rotational behavior. Conversely, Tg overexpression of UOx exacerbates these morphological, neurochemical, and functional lesions of the dopaminergic nigrostriatal pathway. Together our data support a neuroprotective role of endogenous urate in dopaminergic neurons and strengthen the rationale for developing urate-elevating strategies as potential disease-modifying therapy for PD. PMID:23248282

Chen, Xiqun; Burdett, Thomas C; Desjardins, Cody A; Logan, Robert; Cipriani, Sara; Xu, Yuehang; Schwarzschild, Michael A

2013-01-01

349

Some properties of diamine oxidase from Pisum sativum.  

E-print Network

??Partial purification of diamine oxidase from pea seedlings, Pisum sativum, was accomplished by homogenization of 8-10 day etiolated epicotyl tissue, followed by ammonium sulfate fractionation… (more)

Yamasaki, Edith Fusayo

1967-01-01

350

21 CFR 866.2420 - Oxidase screening test for gonorrhea.  

Code of Federal Regulations, 2013 CFR

...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

2013-04-01

351

The monoamine regulon including syntheses of arylsulfatase and monoamine oxidase in bacteria.  

PubMed

Bacterial cells respond to monoamine compounds, such as tyramine, dopamine, octopamine, or norepinephrine, and induce the syntheses of tyramine oxidase encoded by tynA and monoamine oxidase encoded by maoA. These monoamine compounds also derepress the synthesis of atsA-specified arylsulfatase that is repressed by sulfur compounds. These complex mechanisms of regulons regulated by monoamine and sulfur compounds has been analyzed by cloning and characterization of genes that are involved in the repression and derepression of the synthesis of arylsulfatase. The atsA gene forms an operon with the atsB gene, which encodes an activator of the expression of atsA. The negative regulator gene for arylsulfatase was found to code for dihydrofolate reductase (folA). The maoA gene forms an operon with the maoC gene, which has similarity to a dehydrogenase involved in the tyramine metabolism. The moaF gene encoding a 30-kDa protein, which is induced by tyramine, also forms an operon with the moaE gene. Finally, the moaR gene, which is induced by monoamine, was found to play a central role in the positive regulation of the expression of the monoamine regulon (moa) including the atsBA, maoCA, moaEF, and tyn operons. The moaR expression is subject to autogenous regulation and to cAMP-CRP control. The MoaR protein has a helix-turn-helix motif in its C terminus. Thus, the MoaR protein probably regulates the operons by binding to the regulatory region of the moa regulon. PMID:8695909

Murooka, Y; Azakami, H; Yamashita, M

1996-06-01

352

Polyphenol oxidases and phenolics in relation to resistance against cucumber scab in Cucumis Sativus I. Fungal and host polyphenol oxidases  

Microsoft Academic Search

In culture filtrates ofCladosporium cucumerinum, the fungus causing cucumber scab, a constitutive, exocellular catechol oxidase was found; moreover, dihydroxy-phenylalanine and chlorogenic acid oxidases were produced. Catechol oxidase was detected in noticeable activity as soon as the pH of the culture medium had reached a value of 6.0, or if the medium was adjusted to this pH before sterilizing. The Michaelis

A. Fuchs

1965-01-01

353

Evidence for a Key Role of Cytochrome bo3 Oxidase in Respiratory Energy Metabolism of Gluconobacter oxydans  

PubMed Central

The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ?cyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ?cydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ?cyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen

2013-01-01

354

Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.  

PubMed

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 ?m for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J

2012-12-14

355

Evidence for a key role of cytochrome bo3 oxidase in respiratory energy metabolism of Gluconobacter oxydans.  

PubMed

The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H(+)/O ratio of the ?cyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ?cydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ?cyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873

Richhardt, Janine; Luchterhand, Bettina; Bringer, Stephanie; Büchs, Jochen; Bott, Michael

2013-09-01

356

Bienzyme biosensors for glucose, ethanol and putrescine built on oxidase and sweet potato peroxidase  

Microsoft Academic Search

Amperometric biosensors for glucose, ethanol, and biogenic amines (putrescine) were constructed using oxidase\\/peroxidase bienzyme systems. The H2O2 produced by the oxidase in reaction with its substrate is converted into a measurable signal via a novel peroxidase purified from sweet potato peels. All developed biosensors are based on redox hydrogels formed of oxidases (glucose oxidase, alcohol oxidase, or amine oxidase) and

Jaime Castillo; Szilveszter Gáspár; Ivan Sakharov; Elisabeth Csöregi

2003-01-01

357

Extracellular ATP Induces the Accumulation of Superoxide via NADPH Oxidases in Arabidopsis1  

PubMed Central

Extracellular ATP can serve as a signaling agent in animal cells, and, as suggested by recent reports, may also do so in plant cells. In animal cells it induces the production of reactive oxygen species through the mediation of NADPH oxidase. Similarly, here we report that in leaves of Arabidopsis (Arabidopsis thaliana), applied ATP, but not AMP or phosphate, induces the accumulation of superoxide (O2?) in a biphasic, dose-dependent manner, with a threshold at 500 nm ATP. This effect did not require ATP hydrolysis for it was mimicked by ATP?S. ATP also induced increased levels of Arabidopsis respiratory burst oxidase homolog D (AtrbohD) mRNA, but ATP-treated plants that had disrupted AtrbohD and AtrbohF genes did not accumulate O2?, indicating that NADPH oxidases are responsible for the induced O2? accumulation. Inhibitors of mammalian P2-type ATP receptors abolished ATP-induced O2? production, suggesting that the ATP effects may be mediated through P2-like receptors in plants. Cytosolic Ca2+ and calmodulin are likely to help transduce the ATP responses, as they do in animal cells, because a Ca2+ channel blocker, a Ca2+ chelator, and calmodulin antagonist all reduced ATP-induced O2? accumulation. Furthermore, ATP treatment enhanced the expression of genes that are induced by wounds and other stresses. The ATP measured at wound sites averaged 40 ?m, well above the level needed to induce O2? accumulation and gene expression changes. Transgenic plants overexpressing an apyrase gene had reduced O2? production in response to applied ATP and wounding. Together, these data suggest a possible role for extracellular ATP as a signal potentially in wound and stress responses. PMID:16428598

Song, Charlotte J.; Steinebrunner, Iris; Wang, Xuanzhi; Stout, Stephen C.; Roux, Stanley J.

2006-01-01

358

NADPH Oxidase Promotes Neutrophil Extracellular Trap Formation in Pulmonary Aspergillosis  

PubMed Central

NADPH oxidase is a crucial enzyme in antimicrobial host defense and in regulating inflammation. Chronic granulomatous disease (CGD) is an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates. Aspergillus species are ubiquitous, filamentous fungi, which can cause invasive aspergillosis, a major cause of morbidity and mortality in CGD, reflecting the critical role for NADPH oxidase in antifungal host defense. Activation of NADPH oxidase in neutrophils can be coupled to the release of proteins and chromatin that comingle in neutrophil extracellular traps (NETs), which can augment extracellular antimicrobial host defense. NETosis can be driven by NADPH oxidase-dependent and -independent pathways. We therefore undertook an analysis of whether NADPH oxidase was required for NETosis in Aspergillus fumigatus pneumonia. Oropharyngeal instillation of live Aspergillus hyphae induced neutrophilic pneumonitis in both wild-type and NADPH oxidase-deficient (p47phox?/?) mice which had resolved in wild-type mice by day 5 but progressed in p47phox?/? mice. NETs, identified by immunostaining, were observed in lungs of wild-type mice but were absent in p47phox?/? mice. Using bona fide NETs and nuclear chromatin decondensation as an early NETosis marker, we found that NETosis required a functional NADPH oxidase in vivo and ex vivo. In addition, NADPH oxidase increased the proportion of apoptotic neutrophils. Together, our results show that NADPH oxidase is required for pulmonary clearance of Aspergillus hyphae and generation of NETs in vivo. We speculate that dual modulation of NETosis and apoptosis by NADPH oxidase enhances antifungal host defense and promotes resolution of inflammation upon infection clearance. PMID:24549323

Röhm, Marc; Grimm, Melissa J.; D'Auria, Anthony C.; Almyroudis, Nikolaos G.

2014-01-01

359

RESEARCH ARTICLE Open Access Multiple controls affect arsenite oxidase gene  

E-print Network

chemical forms, inorganic species being considered as more toxic [2]. The contamination of drinking water. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment

Paris-Sud XI, Université de

360

1-Aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein  

PubMed Central

1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal ?-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in ?-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837

Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe

2013-01-01

361

Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter  

SciTech Connect

A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. (Biosource Genetics Corporation, Vacaville, CA (United States))

1993-05-01

362

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion  

Microsoft Academic Search

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay

M Legge; G B Duff

1981-01-01

363

Diamine oxidase content in urine of patients with renal failure  

Microsoft Academic Search

Diamine oxidase activity was determined in twentyseven samples collected from normal subjects and from patients with renal failure. The enzyme activity was absent or very low in the urine samples of normal subjects. The highest diamine oxidase activity was found in the patients affected with nephrosis, the Fanconi syndrome and renal transplantation, showing a relationship between urinary enzymatic activity and

D. Giarnieri; M. T. Costa; V. Giarnieri; B. Mondovi

1985-01-01

364

Factors regulating production of glucose oxidase by Aspergillus niger  

Microsoft Academic Search

Certain factors affecting production of extracellular and cell-bound glucose oxidase by Aspergillus niger were investigated. The intention was to maximize total glucose oxidase activity of academic and potential commercial application by the selection of the appropriate strain and consecutive optimization of growth media and conditions. It was possible to identify combinations resulting in the utilization of molasses as the best

D. G. Hatzinikolaou; B. J. Macris

1995-01-01

365

Diamine Oxidase: An Overview of Historical, Biochemical and Functional Aspects  

Microsoft Academic Search

This article is a review of the historical, biochemical, and functional aspects of the enzyme diamine oxidase (DAO). The amine oxidase DAO, formerly called histaminase, is found in various tissues, but is especially active in the intestinal mucosa. Its function is the oxidative deaminating of several polyamines, essential substances for cell proliferation. DAO is thus a regulating enzyme in rapidly

M. C. J. Wolvekamp; R. W. F. de Bruin

1994-01-01

366

Polyphenol oxidases in plants and fungi: Going places? A review  

Microsoft Academic Search

The more recent reports on polyphenol oxidase in plants and fungi are reviewed. The main aspects considered are the structure, distribution, location and properties of polyphenol oxidase (PPO) as well as newly discovered inhibitors of the enzyme. Particular stress is given to the possible function of the enzyme. The cloning and characterization of a large number of PPOs is surveyed.

Alfred M. Mayer

2006-01-01

367

Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase  

Microsoft Academic Search

A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions

Stuart C. Atlow; Lucia Bonadonna-Aparo; Alexander M. Klibanov

1984-01-01

368

Human kidney diamine oxidase: heterologous expression, purification, and characterization  

Microsoft Academic Search

Human kidney diamine oxidase has been overexpressed as a secreted enzyme under the control of a metallothionein promoter in Drosophila S2 cell culture. This represents the first heterologous overexpression and purification of a catalytically active, recombinant mammalian copper-containing amine oxidase. A rapid and highly efficient purification protocol using chromatography on heparin affinity, hydroxyapatite, and gel filtration media allows for the

Bradley O. Elmore; John A. Bollinger; David M. Dooley

2002-01-01

369

Diamine oxidase in relation to diamine and polyamine metabolism  

Microsoft Academic Search

Diamine oxidase catalyzes the oxidative deamination of short chain aliphatic diamines, like putrescine, and histamine. The enzyme is rate-limiting in the terminal catabolism of polyamines, which are endogenous polycations important for cell growth and differentiation. This review examines the behavior of diamine oxidase in mammalian tissues in relation to diamine and polyamine metabolism under physiological and pathological conditions. The role

Angela Sessa; Antonio Perin

1994-01-01

370

DETERMINATION OF DIAMINE OXIDASE ACTIVITY BY LIQUID SCINTILLATION COUNTING  

Microsoft Academic Search

A rapid method for diamine oxidase assay is described. The method is ; based on the formation of radioactive toluene-extractable end product(s) from the ; actlon of dlamlne oxidase on cadaverine-C¹⁴. The end products are ; extracted directly into toluene and assayed in a liquid scintillation ; spectrometer. The method is applicable using radioactive putrescine as ; substrate, but does

T. Okuyama; Y. Kobayashi

1961-01-01

371

Eosinophil diamine oxidase activity in acute inflammation in humans  

Microsoft Academic Search

Eosinophil diamine oxidase, histaminase, activity was assayed in acute inflammatory states and correlated to disease activity. Correlation to serum and urine histamine, metabolites of histamine and granulocyte histamine metabolizing enzymes was also studied. Using a radiochromatagraphic assay, diamine oxidase, histaminese, activity was determined in human peripheral blood eosinophils from patients with acute inflammatory states including active asthma, cold-induced urticaria and

James Jay Herman; H. RICHTER; R. HESTERBERG; J. SCHMIDT; D. LECAVALIER; P. RYAN

1982-01-01

372

Alternative oxidase in animals: unique characteristics and taxonomic distribution  

Microsoft Academic Search

SUMMARY Alternative oxidase (AOX), a ubiquinol oxidase, introduces a branch point into the respiratory electron transport chain, bypassing complexes III and IV and resulting in cyanide-resistant respiration. Previously, AOX was thought to be limited to plants and some fungi and protists but recent work has demonstrated the presence of AOX in most kingdoms of life, including animals. In the present

Allison E. McDonald; Greg C. Vanlerberghe; James F. Staples

2009-01-01

373

Primary structure of a novel subunit in ba3-cytochrome oxidase from Thermus thermophilus.  

PubMed Central

The bax-type cytochrome c oxidase from Thermus thermophilus is known as a two subunit enzyme. Deduced from the crystal structure of this enzyme, we discovered the presence of an additional transmembrane helix "subunit IIa" spanning the membrane. The hydrophobic N-terminally blocked protein was isolated in high yield using high-performance liquid chromatography. Its complete amino acid sequence was determined by a combination of automated Edman degradation of both the deformylated and the cyanogen bromide cleaved protein and automated C-terminal sequencing of the native protein. The molecular mass of 3,794 Da as determined by MALDI-MS and by ESI requires the N-terminal methionine to be formylated and is in good agreement with the value calculated from the formylmethionine containing sequence (3,766.5 Da + 28 Da = 3,794.5 Da). This subunit consits of 34 residues forming one helix across the membrane (Lys5-Ala34), which corresponds in space to the first transmembrane helix of subunit II of the cytochrome c oxidases from Paracoccus denitrificans and bovine heart, however, with opposite polarity. It is 35% identical to subunit IV of the ba3-cytochrome oxidase from Natronobacterium pharaonis. The open reading frame encoding this new subunit IIa (cbaD) is located upstream of cbaB in the same operon as the genes for subunit I (cbaA) and subunit II (cbaB). PMID:11152118

Soulimane, T.; Than, M. E.; Dewor, M.; Huber, R.; Buse, G.

2000-01-01

374

Heterologous expression of two FAD-dependent oxidases with (S)-tetrahydroprotoberberine oxidase activity from Arge mone mexicana and Berberis wilsoniae in insect cells.  

PubMed

Berberine, palmatine and dehydrocoreximine are end products of protoberberine biosynthesis. These quaternary protoberberines are elicitor inducible and, like other phytoalexins, are highly oxidized. The oxidative potential of these compounds is derived from a diverse array of biosynthetic steps involving hydroxylation, intra-molecular C-C coupling, methylenedioxy bridge formation and a dehydrogenation reaction as the final step in the biosynthesis. For the berberine biosynthetic pathway, the identification of the dehydrogenase gene is the last remaining uncharacterized step in the elucidation of the biosynthesis at the gene level. An enzyme able to catalyze these reactions, (S)-tetrahydroprotoberberine oxidase (STOX, EC 1.3.3.8), was originally purified in the 1980s from suspension cells of Berberis wilsoniae and identified as a flavoprotein (Amann et al. 1984). We report enzymatic activity from recombinant STOX expressed in Spodoptera frugiperda Sf9 insect cells. The coding sequence was derived successively from peptide sequences of purified STOX protein. Furthermore, a recombinant oxidase with protoberberine dehydrogenase activity was obtained from a cDNA library of Argemone mexicana, a traditional medicinal plant that contains protoberberine alkaloids. The relationship of the two enzymes is discussed regarding their enzymatic activity, phylogeny and the alkaloid occurrence in the plants. Potential substrate binding and STOX-specific amino acid residues were identified based on sequence analysis and homology modeling. PMID:21327819

Gesell, Andreas; Chávez, Maria Luisa Díaz; Kramell, Robert; Piotrowski, Markus; Macheroux, Peter; Kutchan, Toni M

2011-06-01

375

Ascorbic acid and L-gulonolactone oxidase in lagomorphs.  

PubMed

1. The activity of L-gulonolactone oxidase (EC 1.1.3.8) in the liver of eastern cottontail rabbits (Sylvilagus floridanus) is about 10-fold greater in winter than in summer. 2. L-gulonolactone oxidase activity is low and tissue ascorbate high during all seasons in snowshoe hares (Lepus americanus). 3. Liver contents of ascorbate fall to low levels in L. americanus fed on rabbit chow in the laboratory. 4. The activity of L-gulonolactone oxidase in liver of Sylvilagus and Oryctolagus is depressed by feeding high levels of L-ascorbic acid. 5. The New Zealand White breed of domestic rabbit (Oryctolagus cuniculus) has considerably higher levels of L-gulonolactone oxidase and liver ascorbate than does the Dutch breed. 6. In a wild population of Oryctolagus sampled in Australia L-gulonolactone oxidase levels were intermediate between those of the two domestic breeds and more variable than either. PMID:318384

Jenness, R; Birney, E C; Ayaz, K L

1978-01-01

376

Xanthine oxidase inhibitors from Garcinia esculenta twigs.  

PubMed

The EtOAc-soluble portion of the 80?% (v/v) EtOH extract from the twigs of Garcinia esculenta exhibited strong xanthine oxidase inhibition in vitro. Bioassay-guided purification led to the isolation of 1,3,6,7-tetrahydroxyxanthone (3) and griffipavixanthone (8) as the main xanthine oxidase inhibitors, along with six additional compounds (1, 2, 4-7), including two new compounds (1 and 2). This enzyme inhibition was dose dependent with an IC50 value of approximately 1.2?µM for 3 and 6.3?µM for 8. The inhibitory activity of 3 was stronger than the control allopurinol (IC50 value: 5.3?µM). To our knowledge, compound 8 is the first bixanthone that demonstrated potent XO inhibitory activity in vitro. The structures of the new compounds were established by spectroscopic analysis, and the optical properties and absolute stereochemistry of racemic (±) esculentin A (2) were further determined by the calculation of the DP4 probability and analysis of its MTPA ester derivatives. PMID:25340468

Zhu, Lun-Lun; Fu, Wen-Wei; Watanabe, Shimpei; Shao, Yi-Nuo; Tan, Hong-Sheng; Zhang, Hong; Tan, Chang-Heng; Xiu, Yan-Feng; Norimoto, Hisayoshi; Xu, Hong-Xi

2014-12-01

377

Aminoacetone oxidase from Streptococcus oligofermentans belongs to a new three-domain family of bacterial flavoproteins.  

PubMed

The aaoSo gene from Streptococcus oligofermentans encodes a 43 kDa flavoprotein, aminoacetone oxidase (SoAAO), which was reported to possess a low catalytic activity against several different L-amino acids; accordingly, it was classified as an L-amino acid oxidase. Subsequently, SoAAO was demonstrated to oxidize aminoacetone (a pro-oxidant metabolite), with an activity ~25-fold higher than the activity displayed on L-lysine, thus lending support to the assumption of aminoacetone as the preferred substrate. In the present study, we have characterized the SoAAO structure-function relationship. SoAAO is an FAD-containing enzyme that does not possess the classical properties of the oxidase/dehydrogenase class of flavoproteins (i.e. no flavin semiquinone formation is observed during anaerobic photoreduction as well as no reaction with sulfite) and does not show a true L-amino acid oxidase activity. From a structural point of view, SoAAO belongs to a novel protein family composed of three domains: an ?/? domain corresponding to the FAD-binding domain, a ?-domain partially modulating accessibility to the coenzyme, and an additional ?-domain. Analysis of the reaction products of SoAAO on aminoacetone showed 2,5-dimethylpyrazine as the main product; we propose that condensation of two aminoacetone molecules yields 3,6-dimethyl-2,5-dihydropyrazine that is subsequently oxidized to 2,5-dimethylpyrazine. The ability of SoAAO to bind two molecules of the substrate analogue O-methylglycine ligand is thought to facilitate the condensation reaction. A specialized role for SoAAO in the microbial defence mechanism related to aminoacetone catabolism through a pathway yielding dimethylpyrazine derivatives instead of methylglyoxal can be proposed. PMID:25269103

Molla, Gianluca; Nardini, Marco; Motta, Paolo; D'Arrigo, Paola; Panzeri, Walter; Pollegioni, Loredano

2014-12-15

378

Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution  

PubMed Central

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

379

Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.  

PubMed

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51) mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

380

Oxygen dependent pyruvate oxidase expression and production in Streptococcus sanguinis  

PubMed Central

The objective of this study was to characterize the oxygen dependent regulation of pyruvate oxidase (SpxB) gene expression and protein production in Streptococcus sanguinis (S. sanguinis). SpxB is responsible for the generation of growth-inhibiting amounts of hydrogen peroxide (H2O2) able to antagonize cariogenic Streptococcus mutans (S. mutans). Furthermore, the ecological consequence of H2O2 production was investigated in its self-inhibiting ability towards the producing strain. Expression of spxB was determined with quantitative Real-Time RT-PCR and a fluorescent expression reporter strain. Protein abundance was investigated with FLAG epitope engineered in frame on the C-terminal end of SpxB. Self inhibition was tested with an antagonism plate assay. The expression and protein abundance decreased in cells grown under anaerobic conditions. S. sanguinis was resistant against its own produced H2O2, while cariogenic S. mutans was inhibited in its growth. The results suggest that S. sanguinis produces H2O2 as antimicrobial substance to inhibit susceptible niche competing species like S. mutans during initial biofilm formation, when oxygen availability allows for spxB expression and Spx production. PMID:21485312

Zheng, Lan-yan; Itzek, Andreas; Chen, Zhi-yun; Kreth, Jens

2011-01-01

381

The Cox3p assembly module of yeast cytochrome oxidase.  

PubMed

Yeast cytochrome oxidase (COX) was previously inferred to assemble from three modules, each containing one of the three mitochondrially encoded subunits and a different subset of the eight nuclear gene products that make up this respiratory complex. Pull-down assays of pulse-labeled mitochondria enabled us to characterize Cox3p subassemblies that behave as COX precursors and contain Cox4p, Cox7p, and Cox13p. Surprisingly, Cox4p is a constituent of two other complexes, one of which was previously proposed to be an intermediate of Cox1p biogenesis. This suggests that Cox4p, which contacts Cox1p and Cox3p in the holoenzyme, can be incorporated into COX by two alternative pathways. In addition to subunits of COX, some Cox3p intermediates contain Rcf1p, a protein associated with the supercomplex that stabilizes the interaction of COX with the bc1 (ubiquinol-cytochrome c reductase) complex. Finally, our results indicate that although assembly of the Cox1p module is not contingent on the presence of Cox3p, the converse is not true, as none of the Cox3p subassemblies were detected in a mutant blocked in translation of Cox1p. These studies support our proposal that Cox3p and Cox1p are separate assembly modules with unique compositions of ancillary factors and subunits derived from the nuclear genome. PMID:24478450

Su, Chen-Hsien; McStay, Gavin P; Tzagoloff, Alexander

2014-04-01

382

The Cox3p assembly module of yeast cytochrome oxidase  

PubMed Central

Yeast cytochrome oxidase (COX) was previously inferred to assemble from three modules, each containing one of the three mitochondrially encoded subunits and a different subset of the eight nuclear gene products that make up this respiratory complex. Pull-down assays of pulse-labeled mitochondria enabled us to characterize Cox3p subassemblies that behave as COX precursors and contain Cox4p, Cox7p, and Cox13p. Surprisingly, Cox4p is a constituent of two other complexes, one of which was previously proposed to be an intermediate of Cox1p biogenesis. This suggests that Cox4p, which contacts Cox1p and Cox3p in the holoenzyme, can be incorporated into COX by two alternative pathways. In addition to subunits of COX, some Cox3p intermediates contain Rcf1p, a protein associated with the supercomplex that stabilizes the interaction of COX with the bc1 (ubiquinol-cytochrome c reductase) complex. Finally, our results indicate that although assembly of the Cox1p module is not contingent on the presence of Cox3p, the converse is not true, as none of the Cox3p subassemblies were detected in a mutant blocked in translation of Cox1p. These studies support our proposal that Cox3p and Cox1p are separate assembly modules with unique compositions of ancillary factors and subunits derived from the nuclear genome. PMID:24478450

Su, Chen-Hsien; McStay, Gavin P.; Tzagoloff, Alexander

2014-01-01

383

Requirement for Rac1-Dependent NADPH Oxidase in the Cardiovascular and Dipsogenic Actions of Angiotensin II in  

E-print Network

in vitro and in vivo studies using adenoviral (Ad)-mediated expression of dominant-negative Rac1 (AdN17Rac1 by pretreatment with AdN17Rac1 or the NADPH oxidase inhibitors apocynin or diphenylene iodonium. AdN17Rac1 also undergone gene transfer of AdN17Rac1 or AdwtRac1 to the brain. AdN17Rac1 abolished the increase in blood

Engelhardt, John F.

384

Leishmania major possesses a unique HemG-type protoporphyrinogen IX oxidase  

PubMed Central

Leishmania major was proposed to either utilize haem from its host or partially synthesize the tetrapyrrole from host provided precursors. However, only indirect evidence was available for this partial late haem biosynthetic pathway. Here, we demonstrate that the LMJF_06_1280 gene of L. major encodes a HemG-type PPO (protoporphyrinogen IX oxidase) catalysing the oxidation of protoporphyrinogen IX to protoporphyrin IX. Interestingly, trypanosomatids are currently the only known eukaryotes possessing HemG-type enzymes. The LMJF_06_1280 gene forms a potential transcriptional unit with LMJF_06_1270 encoding CPO (coproporphyrinogen III oxidase) and with LMJF_06_1290 for a cytochrome b5. In vivo function of the L. major hemG gene was shown by the functional complementation of the Escherichia coli ?hemG strain LG285. Restored haem formation in E. coli was observed using HPLC analyses. Purified recombinant L. major HemG revealed PPO activity in vitro using different ubiquinones and triphenyltetrazolium as electron acceptors. FMN was identified as the L. major HemG cofactor. Active site residues were found to be essential for HemG catalysis. These data in combination with the solved crystal structures of L. major CPO and the physiological proof of a ferrochelatase activity provide clear-cut evidence for a partial haem biosynthetic pathway in L. major. PMID:24962471

Zwerschke, Dagmar; Karrie, Simone; Jahn, Dieter; Jahn, Martina

2014-01-01

385

Phylogeny of Greya (Lepidoptera: Prodoxidae), Based on Nucleotide Sequence Variation in Mitochondrial Cytochrome Oxidase I and II: Congruence with Morphological Data  

Microsoft Academic Search

The phylogeny of Greya Busck (Lepidoptera: Prodoxidae) was inferred from nucleotide sequence variation across a 765bp region in the cytochrome oxidase I and II genes of the mitochondrial genome. Most parsimonious relationships of 25 haplotypes from 16 Greya species and two outgroup genera ( Tetragma and Prodoxus) showed substantial congruence with the species relationships indicated by morphological variation. Differences between

Olle Pellmyr; John N. Thompson; Richard G. Harrison

386

ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases  

USGS Publications Warehouse

Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

2012-01-01

387

The small protein CydX is required for function of cytochrome bd oxidase in Brucella abortus  

PubMed Central

A large number of hypothetical genes potentially encoding small proteins of unknown function are annotated in the Brucella abortus genome. Individual deletion of 30 of these genes identified four mutants, in BAB1_0355, BAB2_0726, BAB2_0470, and BAB2_0450 that were highly attenuated for infection. BAB2_0726, an YbgT-family protein located at the 3? end of the cydAB genes encoding cytochrome bd ubiquinal oxidase, was designated cydX. A B. abortus cydX mutant lacked cytochrome bd oxidase activity, as shown by increased sensitivity to H2O2, decreased acid tolerance and increased resistance to killing by respiratory inhibitors. The C terminus, but not the N terminus, of CydX was located in the periplasm, suggesting that CydX is an integral cytoplasmic membrane protein. Phenotypic analysis of the cydX mutant, therefore, suggested that CydX is required for full function of cytochrome bd oxidase, possibly via regulation of its assembly or activity. PMID:22919638

Sun, Yao-Hui; de Jong, Maarten F.; den Hartigh, Andreas B.; Roux, Christelle M.; Rolán, Hortensia G.; Tsolis, Renée M.

2012-01-01

388

The small protein CydX is required for function of cytochrome bd oxidase in Brucella abortus.  

PubMed

A large number of hypothetical genes potentially encoding small proteins of unknown function are annotated in the Brucella abortus genome. Individual deletion of 30 of these genes identified four mutants, in BAB1_0355, BAB2_0726, BAB2_0470, and BAB2_0450 that were highly attenuated for infection. BAB2_0726, an YbgT-family protein located at the 3' end of the cydAB genes encoding cytochrome bd ubiquinal oxidase, was designated cydX. A B. abortus cydX mutant lacked cytochrome bd oxidase activity, as shown by increased sensitivity to H(2)O(2), decreased acid tolerance and increased resistance to killing by respiratory inhibitors. The C terminus, but not the N terminus, of CydX was located in the periplasm, suggesting that CydX is an integral cytoplasmic membrane protein. Phenotypic analysis of the cydX mutant, therefore, suggested that CydX is required for full function of cytochrome bd oxidase, possibly via regulation of its assembly or activity. PMID:22919638

Sun, Yao-Hui; de Jong, Maarten F; den Hartigh, Andreas B; Roux, Christelle M; Rolán, Hortensia G; Tsolis, Renée M

2012-01-01

389

Identification of Topaquinone, As Illustrated for Pig Kidney Diamine Oxidase and Escherichia coli Amine Oxidase  

Microsoft Academic Search

Pig kidney diamine oxidase was purified to homogeneity. The reaction product of the cofactor with p-nitrophenylhydrazine (pNPH) was liberated with pronase treatment and purified. 1H NMR, uv\\/vis, and electrospray tandem mass spectroscopy revealed it to be a dipeptide with the sequence topaquinone-pNPH and aspartate. No heterogeneity was observed, indicating that no intramolecular cyclization of the quinone moiety occurs in the

V. Steinebach; B. W. Groen; S. S. Wijmenga; W. M. A. Niessen; J. A. Jongejan; J. A. Duine

1995-01-01

390

Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase  

SciTech Connect

A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

1984-01-01

391

Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.  

PubMed

Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching. PMID:19763895

Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

2010-05-01

392

hCOA3 Stabilizes Cytochrome c Oxidase 1 (COX1) and Promotes Cytochrome c Oxidase Assembly in Human Mitochondria*  

PubMed Central

Cytochrome c oxidase (COX) or complex IV of the mitochondrial respiratory chain plays a fundamental role in energy production of aerobic cells. In humans, COX deficiency is the most frequent cause of mitochondrial encephalomyopathies. Human COX is composed of 13 subunits of dual genetic origin, whose assembly requires an increasing number of nuclear-encoded accessory proteins known as assembly factors. Here, we have identified and characterized human CCDC56, an 11.7-kDa mitochondrial transmembrane protein, as a new factor essential for COX biogenesis. CCDC56 shares sequence similarity with the yeast COX assembly factor Coa3 and was termed hCOA3. hCOA3-silenced cells display a severe COX functional alteration owing to a decreased stability of newly synthesized COX1 and an impairment in the holoenzyme assembly process. We show that hCOA3 physically interacts with both the mitochondrial translation machinery and COX structural subunits. We conclude that hCOA3 stabilizes COX1 co-translationally and promotes its assembly with COX partner subunits. Finally, our results identify hCOA3 as a new candidate when screening for genes responsible for mitochondrial diseases associated with COX deficiency. PMID:23362268

Clemente, Paula; Peralta, Susana; Cruz-Bermudez, Alberto; Echevarría, Lucía; Fontanesi, Flavia; Barrientos, Antoni; Fernandez-Moreno, Miguel A.; Garesse, Rafael

2013-01-01

393

Early alterations of rat intestinal diamine oxidase activity by azoxymethane, an intestinal carcinogen  

Microsoft Academic Search

Some mutagenic hydrazino compounds are also diamine oxidase inhibitors. Therefore, this interrelationship was studied for the intestinal carcinogen azoxymethane.In vitro, azoxymethane was a very weak inhibitor of rat intestinal diamine oxidase activity.In vivo, after subcutaneous injection of a single dose of azoxymethane, diamine oxidase activity was increased in the duodenum but was mainly inhibited in the colon. Intestinal diamine oxidase

J. Kusche; R. Mennigen; L. Leisten

1989-01-01

394

Direct regulation of cytochrome c oxidase by calcium ions.  

PubMed

Cytochrome c oxidase from bovine heart binds Ca(2+) reversibly at a specific Cation Binding Site located near the outer face of the mitochondrial membrane. Ca(2+) shifts the absorption spectrum of heme a, which allowed previously to determine the kinetics and equilibrium characteristics of the binding. However, no effect of Ca(2+) on the functional characteristics of cytochrome oxidase was revealed earlier. Here we report that Ca(2+) inhibits cytochrome oxidase activity of isolated bovine heart enzyme by 50-60% with Ki of ?1 µM, close to Kd of calcium binding with the oxidase determined spectrophotometrically. The inhibition is observed only at low, but physiologically relevant, turnover rates of the enzyme (?10 s(-1) or less). No inhibitory effect of Ca(2+) is observed under conventional conditions of cytochrome c oxidase activity assays (turnover number >100 s(-1) at pH 8), which may explain why the effect was not noticed earlier. The inhibition is specific for Ca(2+) and is reversed by EGTA. Na(+) ions that compete with Ca(2+) for binding with the Cation Binding Site, do not affect significantly activity of the enzyme but counteract the inhibitory effect of Ca(2+). The Ca(2+)-induced inhibition of cytochrome c oxidase is observed also with the uncoupled mitochondria from several rat tissues. At the same time, calcium ions do not inhibit activity of the homologous bacterial cytochrome oxidases. Possible mechanisms of the inhibition are discussed as well as potential physiological role of Ca(2+) binding with cytochrome oxidase. Ca(2+)- binding at the Cation Binding Site is proposed to inhibit proton-transfer through the exit part of the proton conducting pathway H in the mammalian oxidases. PMID:24058566

Vygodina, Tatiana; Kirichenko, Anna; Konstantinov, Alexander A

2013-01-01

395

Why Orange Guaymas Basin Beggiatoa spp. Are Orange: Single-Filament-Genome-Enabled Identification of an Abundant Octaheme Cytochrome with Hydroxylamine Oxidase, Hydrazine Oxidase, and Nitrite Reductase Activities  

PubMed Central

Orange, white, and yellow vacuolated Beggiatoaceae filaments are visually dominant members of microbial mats found near sea floor hydrothermal vents and cold seeps, with orange filaments typically concentrated toward the mat centers. No marine vacuolate Beggiatoaceae are yet in pure culture, but evidence to date suggests they are nitrate-reducing, sulfide-oxidizing bacteria. The nearly complete genome sequence of a single orange Beggiatoa (“Candidatus Maribeggiatoa”) filament from a microbial mat sample collected in 2008 at a hydrothermal site in Guaymas Basin (Gulf of California, Mexico) was recently obtained. From this sequence, the gene encoding an abundant soluble orange-pigmented protein in Guaymas Basin mat samples (collected in 2009) was identified by microcapillary reverse-phase high-performance liquid chromatography (HPLC) nano-electrospray tandem mass spectrometry (?LC–MS-MS) of a pigmented band excised from a denaturing polyacrylamide gel. The predicted protein sequence is related to a large group of octaheme cytochromes whose few characterized representatives are hydroxylamine or hydrazine oxidases. The protein was partially purified and shown by in vitro assays to have hydroxylamine oxidase, hydrazine oxidase, and nitrite reductase activities. From what is known of Beggiatoaceae physiology, nitrite reduction is the most likely in vivo role of the octaheme protein, but future experiments are required to confirm this tentative conclusion. Thus, while present-day genomic and proteomic techniques have allowed precise identification of an abundant mat protein, and its potential activities could be assayed, proof of its physiological role remains elusive in the absence of a pure culture that can be genetically manipulated. PMID:23220958

Biddle, Jennifer F.; Siebert, Jason R.; Staunton, Eric; Hegg, Eric L.; Matthysse, Ann G.; Teske, Andreas

2013-01-01

396

Visualization of monoamine oxidase in human brain  

SciTech Connect

Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.

1996-12-31

397

[A method of determining glucose oxidase-immobilized glucose].  

PubMed

A method for manual measurement of glucose in biologic fluids has been developed, making use of glucose oxidase immobilized on a carbamide derivative of microcrystal cellulose; two variants are suggested: a rapid and a routine one. The method is characterized by a high analytical reliability, its results are in high correlation with the results of measurements by Beckman glucose analyzer (r = 0.92, p less than 0.001). The method is economic (glucose oxidase reagent may be used for more than 300 times), easily available, and is 3 to 6 times more rapid than the method with soluble glucose oxidase. It is particularly convenient for urgent laboratory diagnosis. PMID:1722525

Ivanov, I P; Danev, S I; Dimitrov, D G

1991-01-01

398

Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase  

PubMed Central

Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

2014-01-01

399

Properties of ubiquinol oxidase reconstituted from ubiquinol-cytochrome c reductase, cytochrome c and cytochrome c oxidase.  

PubMed Central

Ubiquinol-cytochrome c reductase (Complex III), cytochrome c and cytochrome c oxidase can be combined to reconstitute antimycin-sensitive ubiquinol oxidase activity. In 25 mM-acetate/Tris, pH 7.8, cytochrome c binds at high-affinity sites (KD = 0.1 microM) and low-affinity sites (KD approx. 10 microM). Quinol oxidase activity is 50% of maximal activity when cytochrome c is bound to only 25% of the high affinity sites. The other 50% of activity seems to be due to cytochrome c bound at low-affinity sites. Reconstitution in the presence of soya-bean phospholipids prevents aggregation of cytochrome c oxidase and gives rise to much higher rates of quinol oxidase. The cytochrome c dependence was unaltered. Antimycin curves have the same shape regardless of lipid/protein ratio, Complex III/cytochrome c oxidase ratio or cytochrome c concentration. Proposals on the nature of the interaction between Complex III, cytochrome c and cytochrome c oxidase are considered in the light of these results. PMID:6284131

Diggens, R J; Ragan, C I

1982-01-01

400

Identification and characterization of peanut oxalate genes and development of peanut cultivars resistant to stem rot  

Technology Transfer Automated Retrieval System (TEKTRAN)

In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...