Sample records for multicopper oxidase gene

  1. Characterization of the multicopper oxidase gene family in Anopheles gambiae.


    Gorman, Maureen J; Dittmer, Neal T; Marshall, Jeremy L; Kanost, Michael R


    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He, N., Botelho, J.M.C., McNall, R.J., Belozerov, V., Dunn, W.A., Mize, T., Orlando, R., Willis, J.H., 2007. Proteomic analysis of cast cuticles from Anopheles gambiae by tandem mass spectrometry. Insect Biochem. Mol. Biol. 37, 135-146). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  2. Multiple multi-copper oxidase gene families in basidiomycetes - what for?


    Kes, Ursula; Rhl, Martin


    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  3. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin


    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  4. Evolution of Multicopper Oxidase Genes in Coprophilous and Non-Coprophilous Members of the Order Sordariales

    PubMed Central

    Pggeler, Stefanie


    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events. PMID:21966247

  5. Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.


    Pggeler, Stefanie


    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events. PMID:21966247

  6. Multicopper oxidases and oxygenases

    SciTech Connect

    Solomon, E.I.; Sundaram, U.M.; Machonkin, T.E.


    Copper is an essential trace element in living systems, present in the parts per million concentration range. It is a key cofactor in a diverse array of biological oxidation-reduction reactions. These involve either outer-sphere electron transfer, as in the blue copper proteins and the Cu{sub A} site of cytochrome oxidase and nitrous oxide redutase, or inner-sphere electron transfer in the binding, activation, and reduction of dioxygen, superoxide, nitrite, and nitrous oxide. Copper sites have historically been divided into three classes based on their spectroscopic features, which reflect the geometric and electronic structure of the active site: type 1 (T1) or blue copper, type 2 (T2) or normal copper, and type 3 (T3) or coupled binuclear copper centers. 428 refs.

  7. Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study

    PubMed Central


    Background The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism although genome annotation revealed 6 laccase-like multicopper oxidase (LMCO) genes. The purpose of this work was i) to validate the function of a candidate LMCO gene from T. reesei, and ii) to reconstruct LMCO phylogeny and perform evolutionary analysis testing for positive selection. Results After homologous overproduction of a candidate LMCO gene, extracellular laccase activity was detected when ABTS or SRG were used as substrates, and the recombinant protein was purified to homogeneity followed by biochemical characterization. The recombinant protein, called TrLAC1, has a molecular mass of 104 kDa. Optimal temperature and pH were respectively 40-45C and 4, by using ABTS as substrate. TrLAC1 showed broad pH stability range of 3 to 7. Temperature stability revealed that TrLAC1 is not a thermostable enzyme, which was also confirmed by unfolding studies monitored by circular dichroism. Evolutionary studies were performed to shed light on the LMCO family, and the phylogenetic tree was reconstructed using maximum-likelihood method. LMCO and classical laccases were clearly divided into two distinct groups. Finally, Darwinian selection was tested, and the results showed that positive selection drove the evolution of sequences leading to well-known laccases involved in ligninolysis. Positively-selected sites were observed that could be used as targets for mutagenesis and functional studies between classical laccases and LMCO from T. reesei. Conclusions Homologous production and evolutionary studies of the first LMCO from the biomass-degrading fungus T. reesei gives new insights into the physicochemical parameters and biodiversity in this family. PMID:20735824

  8. [Ceruloplasmin, hephaestin and zyklopen: the three multicopper oxidases important for human iron metabolism].


    Wierzbicka, Diana; Gromadzka, Grazyna


    Multi-copper oxidases are a group of proteins which demonstrate enzymatic activity and are capable of oxidizing their substrates with the concomitant reduction of dioxygen to two water molecules. For some multi-copper oxidases there has been demonstrated ferroxidase activity which is related to their specific structure characterized by the presence of copper centres and iron-binding sites. Three multi-copper oxidases have been included in this group: ceruloplasmin, hephaestin and zyklopen. Multi-copper oxidases which are expressed in different tissues are capable of oxidizing a wide spectrum of substrates. Multi-copper oxidases are capable of oxidizing a wide spectrum of substrates. Ceruloplasmin exhibits antioxidant activity as well as being involved in many other biological processes. The observations of phenotypic effects of absence or low expression of multi-copper ferroxidase-coding genes suggest that the main role of these proteins is taking part in iron metabolism. The main role of ceruloplasmin in iron turnover is oxidizing Fe2+ into Fe3+, a process which is essential for iron binding to transferrin (the main iron-transporting protein), as well as to ferritin (the main iron-storage protein). The function of hephaestin as ferroxidase is essential for iron binding to apotransferrin in the lamina propria of the intestinal mucosa, a process that is important for further transport of iron to the liver by the portal vein. Available data indicate that zyklopen is responsible for the placental iron transport. The presence of three multi-copper oxidases with ferroxidase activity emphasizes the significance of oxidation for iron metabolism. The distribution of multi-copper ferroxidases in many tissues ensures the proper iron turnover in the body as well as preventing toxic effects related to the presence of Fe2+ ions. These ions contribute to generation of free radicals, including the highly reactive hydroxyl radical, through the Fenton and Haber-Weiss reactions. PMID:24988611

  9. Multi-Copper Oxidases and Human Iron Metabolism

    PubMed Central

    Vashchenko, Ganna; MacGillivray, Ross T. A.


    Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

  10. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.


    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio


    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  11. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed Central

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N


    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide product are proposed, indicating that the polypeptide of ORF1 might bind four copper ions: one type 1, one type 2, and two type 3. Images PMID:8282694

  12. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.


    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake


    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  13. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    PubMed Central

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin


    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  14. Multicopper manganese oxidase accessory proteins bind Cu and heme.


    Butterfield, Cristina N; Tao, Lizhi; Chacón, Kelly N; Spiro, Thomas G; Blackburn, Ninian J; Casey, William H; Britt, R David; Tebo, Bradley M


    Multicopper oxidases (MCOs) catalyze the oxidation of a diverse group of metal ions and organic substrates by successive single-electron transfers to O2 via four bound Cu ions. MnxG, which catalyzes MnO2 mineralization by oxidizing both Mn(II) and Mn(III), is unique among multicopper oxidases in that it carries out two energetically distinct electron transfers and is tightly bound to accessory proteins. There are two of these, MnxE and MnxF, both approximately 12kDa. Although their sequences are similar to those found in the genomes of several Mn-oxidizing Bacillus species, they are dissimilar to those of proteins with known function. Here, MnxE and MnxF are co-expressed independent of MnxG and are found to oligomerize into a higher order stoichiometry, likely a hexamer. They bind copper and heme, which have been characterized by electron paramagnetic resonance (EPR), X-ray absorption spectroscopy (XAS), and UV-visible (UV-vis) spectrophotometry. Cu is found in two distinct type 2 (T2) copper centers, one of which appears to be novel; heme is bound as a low-spin species, implying coordination by two axial ligands. MnxE and MnxF do not oxidize Mn in the absence of MnxG and are the first accessory proteins to be required by an MCO. This may indicate that Cu and heme play roles in electron transfer and/or Cu trafficking. PMID:26327317

  15. A Multicopper Oxidase-Related Protein Is Essential for Insect Viability, Longevity and Ovary Development

    PubMed Central

    Peng, Zeyu; Green, Peter G.; Arakane, Yasuyuki; Kanost, Michael R.; Gorman, Maureen J.


    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests. PMID:25330116

  16. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin


    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.851.17 mM, 3.0110?60.21 Mmin?1 and 0.320.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

  17. Structural insights into the O2 reduction mechanism of multicopper oxidase.


    Komori, Hirofumi; Higuchi, Yoshiki


    Multicopper oxidases are ubiquitous enzymes that catalyse the oxidation of various substrates via the reduction of O2 to H2O. The enzymes contain a common active centre consisting of four copper ions. The key component for O2 reduction is the trinuclear copper centre comprising one type II and a pair of type III copper ions. Although the crystal structures of many multicopper oxidases have been determined by X-ray crystallography, the geometric parameters in the trinuclear copper centre are different for each study. Recent studies have revealed that the redox state of copper ions is altered by X-ray irradiation. The reported crystal structures may represent mixtures of different stages of the catalytic reactions. In this review, we discuss recent findings related to the structure of the active site in multicopper oxidases. PMID:26272825

  18. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.


    Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J


    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  19. Multicopper oxidase-3 is a laccase associated with the peritrophic matrix of Anopheles gambiae.


    Lang, Minglin; Kanost, Michael R; Gorman, Maureen J


    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

  20. A multicopper oxidase contributes to the copper tolerance of Brucella melitensis 16M.


    Wu, Tonglei; Wang, Shaohua; Wang, Zhen; Peng, Xiaowei; Lu, Yanli; Wu, Qingmin


    Copper is a potent antimicrobial agent. Multiple mechanisms of copper tolerance are utilized by some pathogenic bacteria. BMEII0580, which is significantly similar to the multicopper oxidase from Escherichia coli, was predicted to be the probable blue copper protein YacK precursor in Brucella melitensis 16M, and was designated as Brucella multicopper oxidase (BmcO). A bioinformatics analysis indicated that the typical motifs of multicopper oxidases are present in BmcO. BmcO, the expression of which was up-regulated by copper, could catalyze the oxidation of 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), dimethoxyphenol (DMP) and para-phenylenediamine (pPD), which are widely used as substrates for multicopper oxidase. Additionally, BmcO exhibited ferroxidase activity, which indicated that it might play an important role in the Fe(2+) uptake of B. melitensis. Importantly, the mutant strain 16M?bmcO was more sensitive to copper than the wild-type strain B. melitensis 16M as well as its complementation strain 16M?bmcO(bmcO). The infection assays of cells showed that similar bacterial numbers of B. melitensis 16M, 16M?bmcO and 16M?bmcO(bmcO) strains were recovered from the infected macrophages. This result indicated that BmcO was not essential for B. melitensis intracellular growth. In conclusion, our results confirm that BmcO is a multicopper oxidase and contributes to the copper tolerance of B. melitensis 16M. PMID:25956175

  1. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    PubMed Central


    Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

  2. Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub

    PubMed Central

    Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L


    Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

  3. Determining the Role of Multicopper Oxidases in Manganese(II) Oxidation by Marine Bacillus Spores

    NASA Astrophysics Data System (ADS)

    Dick, G. J.; Tebo, B. M.


    Bacteria play an important role in the environmental cycling of Mn by oxidizing soluble Mn(II) and forming insoluble Mn(III/IV) oxides. These biogenic Mn oxides are renowned for their strong sorptive and oxidative properties, which control the speciation and availability of many metals and organic compounds. A wide variety of bacteria are known to catalyze the oxidation of Mn(II); one of the most frequently isolated types are Bacillus species that oxidize Mn(II) only as metabolically dormant spores. We are using genetic and biochemical methods to study the molecular mechanisms of this process in these organisms. mnxG, a gene related to the multicopper oxidase (MCO) family of enzymes, is required for Mn(II) oxidation in the model organism, Bacillus sp. strain SG-1. Mn(II)-oxidizing activity can be detected in crude protein extracts of the exosporium and as a discrete band in SDS-PAGE gels, however previous attempts to purify or identify this Mn(II)-oxidizing enzyme have failed. A direct link between the Mn(II)-oxidizing enzyme and the MCO gene suspected to encode it has never been made. We used genetic and biochemical methods to investigate the role of the MCO in the mechanism of Mn(II) oxidation. Comparative analysis of the mnx operon from several diverse Mn(II)-oxidizing Bacillus spores revealed that mnxG is the most highly conserved gene in the operon, and that copper binding sites are highly conserved. As with Mn(II) oxidases from other organisms, heterologous expression of the Bacillus mnxG in E. coli did not yield an active Mn(II) oxidase. Purifying sufficient quantities of the native Mn(II) oxidase from Bacillus species for biochemical characterization has proven difficult because the enzyme does not appear to be abundant, and it is highly insoluble. We were able to partially purify the Mn(II) oxidase, and to analyze the active band by in-gel trypsin digestion followed by tandem mass spectrometry (MS/MS). MS/MS spectra provided a conclusive match to mnxG, suggesting that this MCO directly catalyzes the oxidation of Mn(II) and the precipitation of Mn(IV) oxide, which represents a novel reaction for a MCO. MS/MS analysis of bands identified by in-gel activity assays is a powerful method of identifying novel enzymes responsible for geochemical processes.

  4. Atmospheric N Deposition Increases Bacterial Laccase-Like Multicopper Oxidases: Implications for Organic Matter Decay

    PubMed Central

    Zak, Donald R.


    Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize ?-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

  5. O2 Reduction to H2O by the Multicopper Oxidases

    PubMed Central

    Solomon, Edward I.; Augustine, Anthony J.; Yoon, Jungjoo


    In nature the four electron reduction of O2 to H2O is carried out by Cytochrome c Oxidase (CcO) and the multicopper oxidases (MCOs). In the former, Cytochrome c provides electrons for pumping protons to produce a gradient for ATP synthesis, while in the MCOs the function is the oxidation of substrates, either organic or metal ions. In the MCOs the reduction of O2 is carried out at a trinuclear Cu cluster (TNC). Oxygen intermediates have been trapped which exhibit unique spectroscopic features that reflect novel geometric and electronic structures. These intermediates have both intact and cleaved O-O bonds, allowing the reductive cleavage of the O-O bond to be studied in detail both experimentally and computationally. These studies show that the topology of the TNC provides a unique geometric and electronic structure particularly suited to carry out this key reaction in Nature. PMID:18648693

  6. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

    PubMed Central

    Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thny-Meyer, Linda


    Laccases (EC are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term laccase-like multi-copper oxidase (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

  7. Catalytic Cycle of Multicopper Oxidases Studied by Combined Quantum- and Molecular-Mechanical Free-Energy Perturbation Methods.


    Li, Jilai; Farrokhnia, Maryam; Rulíšek, Lubomír; Ryde, Ulf


    We have used combined quantum mechanical and molecular mechanical free-energy perturbation methods in combination with explicit solvent simulations to study the reaction mechanism of the multicopper oxidases, in particular, the regeneration of the reduced state from the native intermediate. For 52 putative states of the trinuclear copper cluster, differing in the oxidation states of the copper ions and the protonation states of water- and O2-derived ligands, we have studied redox potentials, acidity constants, isomerization reactions, as well as water- and O2 binding reactions. Thereby, we can propose a full reaction mechanism of the multicopper oxidases with atomic detail. We also show that the two copper sites in the protein communicate so that redox potentials and acidity constants of one site are affected by up to 0.2 V or 3 pKa units by a change in the oxidation state of the other site. PMID:26039490

  8. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael


    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  9. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli.


    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thny-Meyer, Linda; Richter, Michael


    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  10. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera

    PubMed Central

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng


    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  11. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera.


    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng


    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  12. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

    PubMed Central

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.


    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

  13. Biochemical studies of the multicopper oxidase (small laccase) from Streptomyces coelicolor using bioactive phytochemicals and site-directed mutagenesis

    PubMed Central

    Sherif, Mohammed; Waung, Debbie; Korbeci, Bihter; Mavisakalyan, Valentina; Flick, Robert; Brown, Greg; Abou-Zaid, Mamdouh; Yakunin, Alexander F; Master, Emma R


    Summary Multicopper oxidases can act on a broad spectrum of phenolic and non-phenolic compounds. These enzymes include laccases, which are widely distributed in plants and fungi, and were more recently identified in bacteria. Here, we present the results of biochemical and mutational studies of small laccase (SLAC), a multicopper oxidase from Streptomyces coelicolor (SCO6712). In addition to typical laccase substrates, SLAC was tested using phenolic compounds that exhibit antioxidant activity. SLAC showed oxidase activity against 12 of 23 substrates tested, including caffeic acid, ferulic acid, resveratrol, quercetin, morin, kaempferol and myricetin. The kinetic parameters of SLAC were determined for 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid), 2,6-dimethoxyphenol, quercetin, morin and myricetin, and maximum reaction rates were observed with myricetin, where kcat and Km values at 60C were 8.1 (?0.8) s?1 and 0.9 (?0.3) mM respectively. SLAC had a broad pH optimum for activity (between pH?4 and 8) and temperature optimum at 6070C. It demonstrated remarkable thermostability with a half-life of over 10?h at 80C and over 7?h at 90C. Site-directed mutagenesis revealed 17 amino acid residues important for SLAC activity including the 10 His residues involved in copper coordination. Most notably, the Y229A and Y230A mutant proteins showed over 10-fold increase in activity compared with the wild-type SLAC, which was correlated to higher copper incorporation, while kinetic analyses with S929A predicts localization of this residue near the meta-position of aromatic substrates. Funding Information Funding for this research was provided by the Government of Ontario for the project FFABnet: Functionalized Fibre and Biochemicals (ORF-RE-05-005), and the Natural Sciences and Engineering Research Council of Canada. PMID:23815400

  14. Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.


    Ausec, Luka; ?rnigoj, Miha; najder, Marko; Ulrih, Nataa Poklar; Mandic-Mulec, Ines


    Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6 His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH5.0 and pH9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general. PMID:26227413

  15. Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.


    Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen


    The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions. PMID:24875125

  16. Mn(II) Binding and Subsequent Oxidation by the Multicopper Oxidase MnxG Investigated by Electron Paramagnetic Resonance Spectroscopy.


    Tao, Lizhi; Stich, Troy A; Butterfield, Cristina N; Romano, Christine A; Spiro, Thomas G; Tebo, Bradley M; Casey, William H; Britt, R David


    The dynamics of manganese solid formation (as MnOx) by the multicopper oxidase (MCO)-containing Mnx protein complex were examined by electron paramagnetic resonance (EPR) spectroscopy. Continuous-wave (CW) EPR spectra of samples of Mnx, prepared in atmosphere and then reacted with Mn(II) for times ranging from 7 to 600 s, indicate rapid oxidation of the substrate manganese (with two-phase pseudo-first-order kinetics modeled using rate coefficients of: k(1obs) = 0.205 0.001 s(-1) and k(2obs) = 0.019 0.001 s(-1)). This process occurs on approximately the same time scale as in vitro solid MnOx formation when there is a large excess of Mn(II). We also found CW and pulse EPR spectroscopic evidence for at least three classes of Mn(II)-containing species in the reaction mixtures: (i) aqueous Mn(II), (ii) a specifically bound mononuclear Mn(II) ion coordinated to the Mnx complex by one nitrogenous ligand, and (iii) a weakly exchange-coupled dimeric Mn(II) species. These findings provide new insights into the molecular mechanism of manganese mineralization. PMID:26244911

  17. Mechanism of the reduction of the native intermediate in the multicopper oxidases: insights into rapid intramolecular electron transfer in turnover.


    Heppner, David E; Kjaergaard, Christian H; Solomon, Edward I


    The multicopper oxidases (MCOs) are the family of enzymes that catalyze the 4-electron reduction of O2 to H2O coupled to the four 1-electron oxidations of substrate. In the catalytic cycle electrons are transferred intramolecularly over ?13 from a Type 1 (T1) Cu site that accepts electrons from substrate to a trinuclear Cu cluster (TNC) where O2 is reduced to H2O at rapid rates consistent with turnover (560 s(-1)). The oxygen reduction mechanism for the MCOs is well-characterized, whereas the rereduction is less understood. Our initial study of Rhus vernicifera Laccase (Heppner et al. J. Am. Chem. Soc. 2013, 135, 12212) experimentally established that the native intermediate (NI), the species formed upon O-O bond cleavage, is reduced with an IET rate >700 s(-1) and is the catalytically relevant fully oxidized form of the enzyme, rather than the resting state. In this report, we present kinetic and spectroscopic results coupled to DFT calculations that evaluate the mechanism of the 3 e(-)/3 H(+) reduction of NI, where all three catalytically relevant intramolecular electron transfer (IET) steps are rapid and involve three different structural changes. These three rapid IET processes reflect the sophisticated mechanistic control of the TNC to enable rapid turnover. All three IET processes are fast due to the associated protonation of the bridging oxo and hydroxo ligands, generated by O-O cleavage, to form water products that are extruded from the TNC upon full reduction, thereby defining a unifying mechanism for oxygen reduction and rapid IET by the TNC in the catalytic cycle of the MCOs. PMID:25490729

  18. A novel enzyme-based antimicrobial system comprising iodide and a multicopper oxidase isolated from Alphaproteobacterium strain Q-1.


    Yuliana, Tri; Ebihara, Kyota; Suzuki, Mio; Shimonaka, Chie; Amachi, Seigo


    Alphaproteobacterium strain Q-1 produces an extracellular multicopper oxidase (IOX), which catalyzes iodide (I(-)) oxidation to form molecular iodine (I2). In this study, the antimicrobial activity of the IOX/iodide system was determined. Both Gram-positive and Gram-negative bacteria tested were killed completely within 5min by 50mUmL(-1) of IOX and 10mM iodide. The sporicidal activity of the system was also tested and compared with a common iodophor, povidone-iodine (PVP-I). IOX (300mUmL(-1)) killed Bacillus cereus, B. subtilis, and Geobacillus stearothermophilus spores with decimal reduction times of 2.58, 7.62, and 40.9min, respectively. However, 0.1% PVP-I killed these spores with much longer decimal reduction times of 5.46, 38.0, and 260min, respectively. To evaluate the more superior sporicidal activity of the IOX system over PVP-I, the amount of free iodine (non-complexed I2) was determined by an equilibrium dialysis technique. The IOX system included more than 40mgL(-1) of free iodine, while PVP-I included at most 25mgL(-1) free iodine. Our results suggest that the new enzyme-based antimicrobial system is effective against a wide variety of microorganisms and bacterial spores, and that its strong biocidal activity is due to its high free iodine content, which is probably maintained by re-oxidation of iodide released after oxidation of cell components by I2. PMID:26254787

  19. Molecular Dynamics of a Thermostable Multicopper Oxidase from Thermus thermophilus HB27: Structural Differences between the Apo and Holo Forms

    PubMed Central

    Bello, Martiniano; Valderrama, Brenda; Serrano-Posada, Hugo; Rudiño-Piñera, Enrique


    Molecular dynamic (MD) simulations have been performed on Tth-MCO, a hyperthermophilic multicopper oxidase from thermus thermophilus HB27, in the apo as well as the holo form, with the aim of exploring the structural dynamic properties common to the two conformational states. According to structural comparison between this enzyme and other MCOs, the substrate in process to electron transfer in an outer-sphere event seems to transiently occupy a shallow and overall hydrophobic cavity near the Cu type 1 (T1Cu). The linker connecting the β-strands 21 and 24 of the second domain (loop (β21–β24)D2) has the same conformation in both states, forming a flexible lid at the entrance of the electron-transfer cavity. Loop (β21–β24)D2 has been tentatively assigned a role occluding the access to the electron-transfer site. The dynamic of the loop (β21–β24)D2 has been investigated by MD simulation, and results show that the structures of both species have the same secondary and tertiary structure during almost all the MD simulations. In the simulation, loop (β21–β24)D2 of the holo form undergoes a higher mobility than in the apo form. In fact, loop (β21–β24)D2 of the holo form experiences a conformational change which enables exposure to the electron-transfer site (open conformation), while in the apo form the opposite effect takes place (closed conformation). To confirm the hypothesis that the open conformation might facilitate the transient electron-donor molecule occupation of the site, the simulation was extended another 40 ns with the electron-donor molecule docked into the protein cavity. Upon electron-donor molecule stabilization, loops near the cavity reduce their mobility. These findings show that coordination between the copper and the protein might play an important role in the general mobility of the enzyme, and that the open conformation seems to be required for the electron transfer process to T1Cu. PMID:22808237

  20. Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta

    PubMed Central

    Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.


    Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insects cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-?-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min?1, 80 min?1, and 290 min?1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min?1 and 180 min?1. These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

  1. Crystal structure of a blue laccase from Lentinus tigrinus: evidences for intermediates in the molecular oxygen reductive splitting by multicopper oxidases

    PubMed Central

    Ferraroni, Marta; Myasoedova, Nina M; Schmatchenko, Vadim; Leontievsky, Alexey A; Golovleva, Ludmila A; Scozzafava, Andrea; Briganti, Fabrizio


    Background Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in pathogenesis, immunogenesis and morphogenesis of organisms and in the metabolic turnover of complex organic substances. They catalyze the coupling between the four one-electron oxidations of a broad range of substrates with the four-electron reduction of dioxygen to water. These catalytic processes are made possible by the contemporaneous presence of at least four copper ion sites, classified according to their spectroscopic properties: one type 1 (T1) site where the electrons from the reducing substrates are accepted, one type 2 (T2), and a coupled binuclear type 3 pair (T3) which are assembled in a T2/T3 trinuclear cluster where the electrons are transferred to perform the O2 reduction to H2O. Results The structure of a laccase from the white-rot fungus Lentinus (Panus) tigrinus, a glycoenzyme involved in lignin biodegradation, was solved at 1.5 . It reveals a asymmetric unit containing two laccase molecules (A and B). The progressive reduction of the copper ions centers obtained by the long-term exposure of the crystals to the high-intensity X-ray synchrotron beam radiation under aerobic conditions and high pH allowed us to detect two sequential intermediates in the molecular oxygen reduction pathway: the "peroxide" and the "native" intermediates, previously hypothesized through spectroscopic, kinetic and molecular mechanics studies. Specifically the electron-density maps revealed the presence of an end-on bridging, ?-?1:?1 peroxide ion between the two T3 coppers in molecule B, result of a two-electrons reduction, whereas in molecule A an oxo ion bridging the three coppers of the T2/T3 cluster (?3-oxo bridge) together with an hydroxide ion externally bridging the two T3 copper ions, products of the four-electrons reduction of molecular oxygen, were best modelled. Conclusion This is the first structure of a multicopper oxidase which allowed the detection of two intermediates in the molecular oxygen reduction and splitting. The observed features allow to positively substantiate an accurate mechanism of dioxygen reduction catalyzed by multicopper oxidases providing general insights into the reductive cleavage of the O-O bonds, a leading problem in many areas of biology. PMID:17897461

  2. X-ray-induced catalytic active-site reduction of a multicopper oxidase: structural insights into the proton-relay mechanism and O2-reduction states.


    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia; Rodrguez-Almazn, Claudia; Stojanoff, Vivian; Rudio-Piera, Enrique


    During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O2 to 2H2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth-MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O2 reduction was found in a double conformation: Glu451a (?7? from the TNC) and Glu451b (?4.5? from the TNC). A positive peak of electron density above 3.5? in an Fo - Fc map for Glu451a?O(?2) indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth-MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth-MCO-C1-8) with different X-ray-absorbed doses allowed the observation of different O2-reduction states, and a total depletion of T2Cu at doses higher than 0.2?MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure. PMID:26627648

  3. Simulation of the cavity-binding site of three bacterial multicopper oxidases upon complex stabilization: interactional profile and electron transference pathways.


    Bello, Martiniano; Correa-Basurto, Jose; Rudio-Piera, Enrique


    Previous studies have shown that multicopper oxidases (MCOs) oxidize organic and inorganic compounds through oxidation-reduction reactions in which three structurally and functionally arranged copper centers coordinate the uptake of an electron from a reduced substrate. Structural comparisons among three bacterial MCOs, with high structural homology and available three-dimensional information, reveal that the primary structural differences between these MCOs are located near the mononuclear copper center (T1Cu), where substrate oxidation occurs, as opposed to where the reduction of oxygen to water occurs at the trinuclear center. Nevertheless, this substrate oxidation is achieved through an outer-sphere electron transfer mechanism that does not generate a stable substrate-enzyme complex. In this study, MCOs from Thermus thermophilus (Tth-MCO), Bacillus subtilis (CotA), and Escherichia coli (CueO), which have been previously determined through X-ray crystallography, were used as models to analyze the binding modes of these MCOs to three organic molecules, with specific interest in the substrate-binding site. The binding mode of the electron-donor molecule to the electron transfer binding site was primarily attributed to hydrophobic contacts, which likely play an important role in the determination of substrate specificity. Some complexes generated in this study showed an electron donor molecule conformation in which an electron could be directly transferred to the histidines coordinating T1Cu, while for others additional electron transference pathways were also possible through the participation of charged residues during electron transfer. PMID:23859715

  4. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals.


    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin


    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

  5. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals

    PubMed Central

    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin


    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

  6. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    PubMed Central

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique


    X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UVVis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations ofthe metal centres, were observed at both acidic pH and highabsorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

  7. Crystal Structures of Multicopper Oxidase CueO Bound to Copper(I) and Silver(I): Functional Role of a Methonine-Rich Sequence

    SciTech Connect

    Singh, Satish K.; Roberts, Sue A.; McDevitt, Sylvia F.; Weichsel, Andrzej; Wildner, Guenter F.; Grass, Gregor B.; Rensing, Christopher; Montfort, William R.


    The multicopper oxidase CueO oxidizes toxic Cu(I) and is required for copper homeostasis in Escherichia coli. Like many proteins involved in copper homeostasis, CueO has a methionine-rich segment that is thought to be critical for copper handling. How such segments function is poorly understood. Here, we report the crystal structure of CueO at 1.1 {angstrom} with the 45-residue methionine-rich segment fully resolved, revealing an N-terminal helical segment with methionine residues juxtaposed for Cu(I) ligation and a C-terminal highly mobile segment rich in methionine and histidine residues. We also report structures of CueO with a C500S mutation, which leads to loss of the T1 copper, and CueO with six methionines changed to serine. Soaking C500S CueO crystals with Cu(I), or wild-type CueO crystals with Ag(I), leads to occupancy of three sites, the previously identified substrate-binding site and two new sites along the methionine-rich helix, involving methionines 358, 362, 368, and 376. Mutation of these residues leads to a {approx}4-fold reduction in kcat for Cu(I) oxidation. Ag(I), which often appears with copper in nature, strongly inhibits CueO oxidase activities in vitro and compromises copper tolerance in vivo, particularly in the absence of the complementary copper efflux cus system. Together, these studies demonstrate a role for the methionine-rich insert of CueO in the binding and oxidation of Cu(I) and highlight the interplay among cue and cus systems in copper and silver homeostasis.

  8. Ground-state electronic and magnetic properties of a mu3-oxo-bridged trinuclear Cu(II) complex: correlation to the native intermediate of the multicopper oxidases.


    Yoon, Jungjoo; Solomon, Edward I


    The ground-state electronic and magnetic properties of one of the possible structures of the trinuclear Cu(II) site in the native intermediate (NI) of the multicopper oxidases, the mu(3)-oxo-bridged structure, are evaluated using the C(3)-symmetric Cu(3)(II) complex, mu(3)O. mu(3)O is unique in that no ligand, other than the oxo, contributes to the exchange coupling. However, mu(3)O has a ferromagnetic ground state, inconsistent with that of NI. Therefore, two perturbations have been considered: protonation of the mu(3)-oxo ligand and relaxation of the mu(3)-oxo ligand into the Cu(3) plane. Notably, when the oxo ligand is sufficiently close to the Cu(3) plane (<0.3 Angstroms), the ground state of mu(3)O becomes antiferromagnetic and can be correlated to that of NI. In addition, the ferromagnetic (4)A ground state of mu(3)O is found from variable-temperature EPR to undergo a zero-field splitting (ZFS) of 2D = -5.0 cm(-1), which derives from the second-order anisotropic exchange. This allows evaluation of the sigma-to-pi excited-state exchange pathways and provides experimental evidence that the orbitally degenerate (2)E ground state of the antiferromagnetic mu(3)O would also undergo a ZFS by the first-order antisymmetric exchange that has the same physical origin as the anisotropic exchange. The important contribution of the mu(3)-oxo bridge to the ground-to-ground and ground-to-excited-state superexchange pathways that are responsible for the isotropic, antisymmetric, and anisotropic exchanges are discussed. PMID:16241158

  9. Ground State Electronic and Magnetic Properties of a ?3-Oxo Bridged Trinuclear Cu(II) Complex: Correlation to the Native Intermediate of the Multicopper Oxidases

    PubMed Central

    Yoon, Jungjoo; Solomon, Edward I.


    The ground state electronic and magnetic properties of one of the possible structures of the trinuclear CuII site in the native intermediate (NI) of the multicopper oxidases, the ?3-oxo bridged structure, are evaluated using the C3-symmetric Cu3II complex, ?3O. ?3O is unique in that no ligand, other than the oxo, contributes to the exchange coupling. However, ?3O has a ferromagnetic ground state, inconsistent with that of NI. Therefore, two perturbations have been considered: protonation of the ?3-oxo ligand and relaxation of the ?3-oxo ligand into the Cu3 plane. Notably, when the oxo-ligand is sufficiently close to the Cu3 plane (< 0.3 ), the ground state of ?3O becomes antiferromagnetic and can be correlated to that of NI. In addition, the ferromagnetic 4A ground state of ?3O is found from variable-temperature EPR to undergo a zero-field splitting (ZFS) of 2D = -5.0 cm-1, which derives from the second-order anisotropic exchange. This allows evaluation of the ?-to-? excited state exchange pathways and provides experimental evidence that the orbitally-degenerate 2E ground state of the antiferromagnetic ?3O would also undergo a ZFS by the first-order antisymmetric exchange that has the same physical origin as the anisotropic exchange. The important contribution of the ?3-oxo bridge to the ground-to-ground and ground-to-excited state superexchange pathways that are responsible for the isotropic, antisymmetric and anisotropic exchange are discussed. PMID:16241158

  10. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    SciTech Connect

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique


    Radiation-induced reduction, radiolysis of copper sites and the effect of pH value together with the concomitant geometrical distortions of the active centres were analysed in several fungal (C. gallica) laccase structures collected at cryotemperature. This study emphasizes the importance of careful interpretation when the crystallographic structure of a metalloprotein is described. X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O{sub 2}. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UVVis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O{sub 2} reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account.

  11. Polymorphic variation in cytochrome oxidase subunit genes.


    Lu, Jianghua; Wang, Kaixuan; Rodova, Mariana; Esteves, Raquel; Berry, Diana; E, Lezi; Crafter, Adam; Barrett, Matthew; Cardoso, Sandra M; Onyango, Isaac; Parker, W Davis; Fontes, Joseph; Burns, Jeffrey M; Swerdlow, Russell H


    Cytochrome oxidase (COX) activity varies between individuals and low activities associate with Alzheimer's disease. Whether genetic heterogeneity influences function of this multimeric enzyme is unknown. To explore this we sequenced three mitochondrial DNA (mtDNA) and ten nuclear COX subunit genes from at least 50 individuals. 20% had non-synonymous mtDNA COX gene polymorphisms, 12% had a COX4I1 non-synonymous G to A transition, and other genes rarely contained non-synonymous polymorphisms. Frequent untranslated region (UTR) polymorphisms were seen in COX6A1, COX6B1, COX6C, and COX7A1; heterogeneity in a COX7A1 5' UTR Sp1 site was extensive. Synonymous polymorphisms were common and less frequent in the more conserved COX1 than the less conserved COX3, suggesting at least in mtDNA synonymous polymorphisms experience selection pressure and are not functionally silent. Compound gene variations occurred within individuals. To test whether variations could have functional consequences, we studied the COX4I1 G to A transition and an AGCCCC deletion in the COX7A1 5' UTR Sp1 site. Cells expressing the COX4I1 polymorphism had reduced COX Vmax activity. In reporter construct-transduced cells where green fluorescent protein expression depended on the COX7A1 Sp1 site, AGCCCC deletion reduced fluorescence. Our findings indicate COX subunit gene heterogeneity is pervasive and may mediate COX functional variation. PMID:20413852

  12. [Cloning and sequencing of ACC oxidase gene from sugarcane].


    Wang, Zi-Zhang; Li, Yang-Rui; Zhang, Shu-Zhen; Lin, Jun-Fang; Guo, Li-Qiong


    The plant hormone ethylene is not only responsible for the initiation of fruit ripening, senescence and dormancy but also for regulating many other plant developmental processes, such as seed germination, root initiation, growth, floral differentiation, sex differentiation and responding to environment stresses. One of the rate-limiting steps for ethylene biosynthesizing in plant is catalyzed by 1-aminocyclopropane-1-carboxylate (ACC) oxidase. Understanding of ethylene expressive pattern in plant is an entrance to understand the roles of ethylene on plant. In this paper, two degenerate oligonucleotide primers were designed, coding for two conservative amino acid regions in ACC oxidase protein family, the sequences of the two primers were TAGAGCTCGATGC[TA]TG [CT]GA[GA]AA[AC]TGGGG and CGTCTAGAGCTTC[GA]AATCTTGGCTCCTT respectively. A PCR amplification was performed on sugarcane (Saccharum L. Hybrid cv. ROC16) DNA template, and produced a fragment of 940 bp. By using the program of BLAST on NCBI GenBank database, the sequence presented a very high match with the ACC oxidase genes from other plants, 63 searched out sequences were all ACC oxidase genes. After alignment on PCgene program, the identities of the cloned fragment with ACC oxidase genes from rice and bamboo were both reaching about 88%. So we can concluded that the cloned sequence was a member of ACC oxidase genes fragment from sugarcane. The sequence has been submitted to the GenBank database, the accession number is AF442821. According to the ACC oxidase protein family, a 'intron' of 103 bp was excluded and the sequence coded 279 amino acids, which spanned 88% of the putative whole sequence in length. Alignment and phylogenetic analysis of the amino acid sequence deduced from this fragment and the ACC oxidase sequences of other plants retrieved from GenBank were carried out by using PCgene program. The putative amino acid sequence shared a homology of 86% with the ACC oxidases of bamboo and rice, 74.6% with banana, 70% with tomato and potato and 68% with melon and carnation, which showed that the homology of sugarcane ACC oxidase with monocot was higher than with dicot. The results of phylogenetic analysis showed that ACC oxidase from sugarcane and ACC oxidases from rice clustered together firstly, and then came those from banana, ACC oxidases of dicot from potato, tomato, petunia, melon, Arabidopsis thaliana and carnation came subsequently. It indicated that sugarcane ACC oxidase had a closer phylogenetic affinities to the monocot ACC oxidase sequences than to the dicot ACC oxidases sequences. The clustering results of ACC oxidase molecules accorded with morphological classification system. PMID:12812078

  13. Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.


    Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P


    "Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores. PMID:21239558

  14. Structural comparison of the Pichia pastoris alcohol oxidase genes.


    Koutz, P; Davis, G R; Stillman, C; Barringer, K; Cregg, J; Thill, G


    In methylotrophic yeasts, alcohol oxidase is the first enzyme in the methanol-utilization pathway. The genome of one such yeast, Pichia pastoris, contains two alcohol oxidase genes, AOX1 and AOX2. Sequence analysis indicated that each gene encodes a similar protein of 663 amino acids. The protein-coding regions of the genes were 92% and 97% homologous at the nucleotide and predicted amino acid sequence levels, respectively. In contrast to homology observed within the protein-coding portions of the AOX genes, no homology was found in either the 5' or 3' non-coding regions. Although alcohol oxidase is found in peroxisomes of P. pastoris, the AOX amino acid sequences did not contain a peptide sequence similar to the peroxisomal transport sequence found at the C-terminus of some peroxisomally located proteins in higher eukaryotes. PMID:2660463

  15. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.


    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N


    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a more widely distributed type including the B. stearothermophilus enzyme, suggesting that the latter type is evolutionarily older. PMID:10216161

  16. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )


    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  17. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central


    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (?54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 ?54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  18. Molecular evolution of the polyamine oxidase gene family in Metazoa

    PubMed Central


    Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS) mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO) and orthologous genes related by speciation events (PAOs, SMOs/APAOs). Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies. PMID:22716069

  19. Identification of new galactose oxidase genes in Fusarium spp.


    Aparecido Cordeiro, Fabio; Bertechini Faria, Carla; Parra Barbosa-Tessmann, Ione


    Galactose oxidase (GO) converts galactose to an aldehyde and has several biotechnological applications, including cancer diagnosis. It is mainly produced by Fusarium austroamericanum but is also produced by Fusarium acuminatum and by isolates of the Fusarium graminearum and Gibberella fujikuroi complexes. The F. austroamericanum GO gaoA gene has been cloned, but the GO genes from other secreting species have not been characterized. Problems associated with the F. austroamericanum GO such as high pI and low catalytic efficiency and thermostability, and the difficult purification process makes the search for homologous genes attractive. In this work, the GO genes from Fusarium verticillioides and Fusarium subglutinans, two species of the G. fujikuroi complex, were cloned, sequenced, and analyzed. New GO genes were found in databases and were used to construct a phylogenetic tree, which revealed the existence of three orthologous lineages of GO genes in Fusarium spp. In addition, RT-PCR analyses revealed that the new GO cloned gene may be endogenously expressed in F. subglutinans but not in F. verticillioides, in the used culture conditions. PMID:21077113

  20. Arsenite Oxidase aox Genes from a Metal-Resistant ?-Proteobacterium

    PubMed Central

    Muller, Daniel; Livremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire


    The ?-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  1. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation.


    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D P


    Monoamine oxidase A gene (MAOA) has earned the nickname "warrior gene" because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as "altruistic" punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  2. A putative multicopper protein secreted by an atypical type II secretion system involved in the reduction of insoluble electron acceptors in Geobacter sulfurreducens.


    Mehta, Teena; Childers, Susan E; Glaven, Richard; Lovley, Derek R; Mester, Tnde


    Extracellular electron transfer onto Fe(III) oxides in Geobacter sulfurreducens is considered to require proteins that must be exported to the outer surface of the cell. In order to investigate this, the putative gene for OxpG, the pseudopilin involved in a type II general secretion pathway of Gram-negative bacteria, was deleted. The mutant was unable to grow with insoluble Fe(III) oxide as the electron acceptor. Growth on soluble Fe(III) was not affected. An analysis of proteins that accumulated in the periplasm of the oxpG mutant, but not in the wild-type, led to the identification of a secreted protein, OmpB. OmpB is predicted to be a multicopper protein, with highest homology to the manganese oxidase, MofA, from Leptothrix discophora. OmpB contains a potential Fe(III)-binding site and a fibronectin type III domain, suggesting a possible role for this protein in accessing Fe(III) oxides. OmpB was localized to the membrane fraction of G. sulfurreducens and in the supernatant of growing cultures, consistent with the type II secretion system exporting OmpB. A mutant in which ompB was deleted had the same phenotype as the oxpG mutant, suggesting that the failure to export OmpB was responsible for the inability of the oxpG-deficient mutant to reduce Fe(III) oxide. This is the first report that proposes a role for a multicopper oxidase-like protein in an anaerobic organism. These results further emphasize the importance of outer-membrane proteins in Fe(III) oxide reduction and suggest that outer-membrane proteins other than c-type cytochromes are required for Fe(III) oxide reduction in Geobacter species. PMID:16849792

  3. Two peanut germin-like genes and the potential superoxidase dismutase and oxalate oxidase activities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Germins and germin-like proteins (GLPs) genes are members oflarge multi gene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity leadin...

  4. Lysyl oxidase gene expression in the stromal reaction to in situ and invasive ductal breast carcinoma.

    PubMed Central

    Peyrol, S.; Raccurt, M.; Gerard, F.; Gleyzal, C.; Grimaud, J. A.; Sommer, P.


    Lysyl oxidase is involved in the main pathway of collagen and elastin cross-linking: it has a role in the maturation of fibrillar matrix proteins in fibrosing processes and dictates their stability against metalloproteases. The stromal reaction patterns in ductal breast carcinoma are known to be morphologically varied. This has raised the hypothesis that there might be a differential expression of the lysyl oxidase gene as a function of stromal reaction pattern. The present study investigates this potential correlation and the role of matrix protein cross-linking in stromal differentiation. Lysyl oxidase was detected by immunohistochemistry and lysyl oxidase gene expression by in situ hybridization. Maximal expression was observed in myofibroblasts and myoepithelial cells around in situ tumors and in the reactive fibrosis facing the invasion front of infiltrating tumors. The lysyl oxidase substrates were observed in parallel, resulting in the stabilization of a scar-like peritumor barrier. In contrast, a lack of lysyl oxidase was associated with the loose or scirrhous stroma accompanying invading tumors; here, in situ hybridization revealed type I collagen synthesis, resulting in the deposition of non-cross-linked matrix proteins susceptible to degradation. The early development of a cross-linked matrix around ductal breast carcinoma suggests a possible bost defense mechanism, whereas the synchronous or late stromal reaction lacking lysyl oxidase favors tumor dispersion. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9033266

  5. Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha.


    Bruinenberg, P G; Evers, M; Waterham, H R; Kuipers, J; Arnberg, A C; AB, G


    We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence of a 3.6 kilobase stretch of DNA containing the amine oxidase (AMO) gene was determined. The AMO gene contains an open reading frame of 692 amino acids, with a relative molecular mass of 77,435. The 5' and 3' ends of the gene were mapped and show that the transcribed region measures 2134 nucleotides. The derived amino-acid sequence was confirmed by sequencing an internal proteolytic fragment of the purified protein. Amine oxidase contains the tripeptide sequence Ser-Arg-Leu, located 9 residues from the carboxy terminus, which may represent the topogenic signal for protein import into microbodies. PMID:2500147

  6. Two peanut germin-like genes and the potential superoxidase dismutase and oxalate oxidase activities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Germins and germin-like proteins (GLPs) genes are members of large multigene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity leadin...

  7. Cloning and expression of a Streptomyces cholesterol oxidase gene in Streptomyces lividans with plasmid pIJ702.


    Murooka, Y; Ishizaki, T; Nimi, O; Maekawa, N


    The cholesterol oxidase gene (cho) of Streptomyces sp. was cloned into Streptomyces lividans with the vector pIJ702. Deletion analysis of the recombinant plasmid showed that entire coding sequence of the cho gene was located within a 2.5-kilobase segment of the chromosomal DNA obtained from the cholesterol oxidase-producing strain. When cloned cells of S. lividans were grown in an appropriate medium, the cells produced severalfold more cholesterol oxidase extracellularly than did the producing strain. PMID:3466572

  8. Pistil-Specific and Ethylene-Regulated Expression of 1-Aminocyclopropane-1-Carboxylate Oxidase Genes in Petunia Flowers.

    PubMed Central

    Tang, X.; Gomes, AMTR.; Bhatia, A.; Woodson, W. R.


    The differential expression of the petunia 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene family during flower development and senescence was investigated. ACC oxidase catalyzes the conversion of ACC to ethylene. The increase in ethylene production by petunia corollas during senescence was preceded by increased ACC oxidase mRNA and enzyme activity. Treatment of flowers with ethylene led to an increase in ethylene production, ACC oxidase mRNA, and ACC oxidase activity in corollas. In contrast, leaves did not exhibit increased ethylene production or ACC oxidase expression in response to ethylene. Gene-specific probes revealed that the ACO1 gene was expressed specifically in senescing corollas and in other floral organs following exposure to ethylene. The ACO3 and ACO4 genes were specifically expressed in developing pistil tissue. In situ hybridization experiments revealed that ACC oxidase mRNAs were specifically localized to the secretory cells of the stigma and the connective tissue of the receptacle, including the nectaries. Treatment of flower buds with ethylene led to patterns of ACC oxidase gene expression spatially distinct from the patterns observed during development. The timing and tissue specificity of ACC oxidase expression during pistil development were paralleled by physiological processes associated with reproduction, including nectar secretion, accumulation of stigmatic exudate, and development of the self-incompatible response. PMID:12244270

  9. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel


    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  10. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  11. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  12. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.


    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a

  13. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  14. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  15. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities

    PubMed Central

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L.; Garattini, Enrico; Missirlis, Fanis; Leimkhler, Silke


    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX14) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Polpo) and aldehyde oxidase-1 (Aldox-1n1) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Polpo-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Polpo allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1n1 phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  16. Submergence enhances expression of a gene encoding 1-aminocyclopropane-1-carboxylate oxidase in deepwater rice.


    Mekhedov, S I; Kende, H


    Partial submergence greatly stimulates internodal growth in deep water rice (Oryza sativa L.). Previous work has shown that the effect of submergence is, at least in part, mediated by ethylene, which accumulates in the air spaces of submerged internodes. To investigate the expression of the genes encoding ethylene biosynthetic enzymes during accelerated growth of deep water rice, we cloned a 1-aminocyclopropane-1-carboxylate (ACC) oxidase cDNA (OS-ACO1) from internodes of submerged plants and measured the activity of the enzyme in tissue extracts with an improved assay. We found an increase in ACC oxidase mRNA levels and enzyme activity after 4 to 24 h of submergence. Thus, it is likely that ethylene biosynthesis in internodes of deep water rice is controlled, at least in part, at the level of ACC oxidase. PMID:8759917

  17. In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes

    PubMed Central

    Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.


    NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

  18. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  19. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James


    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  20. Cloning and In Situ Expression Studies of the Hydrogenobaculum Arsenite Oxidase Genes?

    PubMed Central

    Clingenpeel, Scott R.; D'Imperio, Seth; Oduro, Harry; Druschel, Greg K.; McDermott, Timothy R.


    Novel arsenite [As(III)] oxidase structural genes (aoxAB) were cloned from Hydrogenobaculum bacteria isolated from an acidic geothermal spring. Reverse transcriptase PCR demonstrated expression throughout the outflow channel, and the aoxB cDNA clones exhibited distribution patterns relative to the physicochemical gradients in the spring. Microelectrode analyses provided evidence of quantitative As(III) transformation within the microbial mat. PMID:19304831

  1. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadge; Mireau, Hakim


    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  2. Cytochrome c oxidase genes required for nitrogenase activity and diazotrophic growth in Anabaena sp. PCC 7120.


    Valladares, Ana; Herrero, Antonia; Pils, Dietmar; Schmetterer, Georg; Flores, Enrique


    N2 fixation is an O2-sensitive process and some filamentous diazotrophic cyanobacteria that grow performing oxygenic photosynthesis confine their N2 fixation machinery to heterocysts, specialized cells that maintain a reducing environment adequate for N2 fixation. Respiration is thought to contribute to the diazotrophic metabolism of heterocysts and the genome of the heterocyst-forming cyanobacterium Anabaena sp. PCC 7120 bears three gene clusters putatively encoding cytochrome c oxidases. Transcript analysis of these cox gene clusters through RNA/DNA hybridization identified two cox operons, cox2 and cox3, that are induced after nitrogen step-down in an NtcA- and HetR-dependent manner and appear to be expressed specifically in heterocysts. In contrast, cox1 was expressed only in vegetative cells. Expression of cox2 and cox3 occurred at an intermediate stage (about 9 h) during the process of heterocyst development following nitrogen step-down. Inactivation of genes in the two inducible cox operons, but not separately in either of them, strongly reduced nitrogenase activity and prevented diazotrophic growth in aerobic conditions. These results show that the nitrogen-regulated cytochrome c oxidase-type respiratory terminal oxidases Cox2 and Cox3 are essential for heterocyst function in Anabaena sp. PCC 7120. PMID:12603731

  3. The human protoporphyrinogen oxidase gene (PPOX): Organization and location to chromosome 1

    SciTech Connect

    Taketani, Shigeru; Furukawa, Takako; Kohno, Hirao; Tokunaga, Rikio


    We determined the structure of the human protoporphyrinogen oxidase (PPOX) gene after isolation and characterization of lambda phage clones mapping discrete regions of the cDNA. Southern blotting of human genomic DNA showed that there is a single copy of the PPOX gene, and fluorescence in situ hybridization to metaphase chromosomes mapped the gene to region 1q22. The gene has 13 exons and about 8 kb. The exon intron boundary sequences conform to consensus acceptor (GTn) and donor (nAG) sequences, and exons in the gene appear to encode functional protein domains. Primer extension analysis revealed two major transcriptional initiation sites in a region with sequence motifs characteristic of a promoter. The promoter region contains multiple Sp1 elements, CCAAT boxes, and potential GATA-1 binding sites. Mapping of the 5{prime} end PPOX mRNA by polymerase chain reaction indicated that there are the same transcripts in erythroid and nonerythroid cells. 23 refs., 5 figs., 1 tab.

  4. Nucleotide sequence of the gene for cholesterol oxidase from a Streptomyces sp.


    Ishizaki, T; Hirayama, N; Shinkawa, H; Nimi, O; Murooka, Y


    The nucleotide sequence of a 2.1-kilobase-pair fragment containing the Streptomyces choA gene, which codes a secreted cholesterol oxidase, was determined. A single open reading frame encodes a mature cholesterol oxidase of 504 amino acids, with a calculated Mr of 54,913. The leader peptides extend over 42 amino acids and have the characteristics of a signal sequence, including basic amino acids near the amino terminus and a hydrophobic core near the signal cleavage site. Analyses of the total amino acid composition and amino acid sequencing of the first 21 amino acids from the N terminus of the purified extracellular enzyme agree with the values deduced from nucleotide sequencing data. PMID:2914858

  5. Characterization of the murine gene for subunit VIIaL of cytochrome c oxidase.


    Chantrel-Groussard, K; Delpy, L; Ratinaud, M H; Cogn, M


    Mammalian cytochrome c oxidase consists of thirteen subunits, ten encoded by the nuclear genome and three by the mitochondrial DNA. In several species, two isoforms have been isolated for nuclear-encoded subunits VIa, VIIa and VIII: an ubiquitous L (liver) form and a heart- and skeletal-muscle specific H form. The gene for murine cytochrome c oxidase subunit VIIa-L (Cox7aL) and its promoter region were isolated, sequenced and analysed. The coding region is split in four exons spanning 4.1 kbp and the promoter carries potential binding sites for Sp1, NRF1 and NRF2 transcription factors. Transcriptional activity of the promoter in reporter assays suggested an ubiquitous expression in mouse tissues. PMID:11803812

  6. Identification, characterization, and localization of the human lysyl oxidase-related gene

    SciTech Connect

    Carlisle, K.S.; Mellott, J.K.; Yang, T.P. |


    Lysyl oxidase (lox) initiates the formation of inter- and intra-strand covalent crosslinks of mature collagen and elastin in connective tissue. The lox gene has been cloned and mapped to human chromosome 5q23.3-31.2. The lysyl oxidase gene is approximately 15 kb in size and consists of seven exons. Lox mRNA is expressed at high levels in rat aorta and lung, and is undetectable in brain, kidney, liver, and heart. We have cloned and sequenced a lysyl oxidase-related cDNA, lox2, which exhibits amino acid sequence homology to the carboxyl end of lox. However, the function of lox2 is unknown. The tissue- and cell-specific expression patterns of lox2 have been examined by Northern blot analysis. Levels of lox2 mRNA in mouse and rat tissue is elevated in heart, lung, kidney and spleen; low in brain, and muscle, and is not detected in liver. In cultured cells, lox2 mRNA levels are high in human skin and corneal fibroblasts, human and rat lung fibroblasts, and rat lung epithelial-like cells. Low levels of lox2 mRNA are found in human pulmonary artery endothelial cells and neuroblastoma cells and are undetectable in human hepatoma cells. We have isolated multiple, unique, overlapping lox2 genomic clones from a human leukocyte genomic phage library. Using a genomic phage clone as a probe, we have mapped lox2 to human chromosome 15q23-24 using fluorescence in situ hybridization to human metaphase chromosomes. Characterization of the genomic phage clones indicates significant conservation of gene structure in the 3{prime} conserved region of lox2 relative to lox. This preservation of gene structure suggests a partial gene duplication between human chromosomes 15 and 5.

  7. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng


    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  8. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T


    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  9. NADPH oxidase-mediated oxidative stress: genetic studies of the p22(phox) gene in hypertension.


    Zalba, Guillermo; San Jos, Gorka; Moreno, Mara U; Fortuo, Ana; Dez, Javier


    Increased vascular production of reactive oxygen species, especially superoxide anion, significantly contributes to the oxidative stress associated with hypertension. An enhanced superoxide production causes an increased inactivation of nitric oxide that diminishes nitric oxide bioavailability, thus contributing to endothelial dysfunction and hypertrophy of vascular cells. It has been shown that NADPH oxidases play a major role as the most important sources of superoxide anion in phagocytic and vascular cells. Several experimental observations have described an enhanced superoxide generation as a result of NADPH oxidase activation in hypertension. Although these enzymes respond to stimuli such as vasoactive factors, growth factors, and cytokines, recent data suggest a significant role of the genetic background in the modulation of the expression of its different components. Several polymorphisms have been identified in the promoter and in the coding region of CYBA, the gene that encodes the essential subunit of the NADPH oxidase p22phox, some of which seem to influence significantly the activity of these enzymes in the context of cardiovascular diseases. Among CYBA polymorphisms, genetic investigations have provided a novel marker, the -930(A/G) polymorphism, which determines the genetic susceptibility of hypertensive patients to oxidative stress. PMID:16115038

  10. Enhancing Resistance to Sclerotinia minor in Peanut by Expressing a Barley Oxalate Oxidase Gene1

    PubMed Central

    Livingstone, D. Malcolm; Hampton, Jaime L.; Phipps, Patrick M.; Grabau, Elizabeth A.


    Sclerotinia minor Jagger is the causal agent of Sclerotinia blight, a highly destructive disease of peanut (Arachis hypogaea). Based on evidence that oxalic acid is involved in the pathogenicity of many Sclerotinia species, our objectives were to recover transgenic peanut plants expressing an oxalic acid-degrading oxalate oxidase and to evaluate them for increased resistance to S. minor. Transformed plants were regenerated from embryogenic cultures of three Virginia peanut cultivars (Wilson, Perry, and NC-7). A colorimetric enzyme assay was used to screen for oxalate oxidase activity in leaf tissue. Candidate plants with a range of expression levels were chosen for further analysis. Integration of the transgene was confirmed by Southern-blot analysis, and gene expression was demonstrated in transformants by northern-blot analysis. A sensitive fluorescent enzyme assay was used to quantify expression levels for comparison to the colorimetric protocol. A detached leaflet assay tested whether transgene expression could limit lesion size resulting from direct application of oxalic acid. Lesion size was significantly reduced in transgenic plants compared to nontransformed controls (65%89% reduction at high oxalic acid concentrations). A second bioassay examined lesion size after inoculation of leaflets with S. minor mycelia. Lesion size was reduced by 75% to 97% in transformed plants, providing evidence that oxalate oxidase can confer enhanced resistance to Sclerotinia blight in peanut. PMID:15778458

  11. Polymorphisms in NADPH oxidase CYBA gene modify the risk of ESRD in patients with chronic glomerulonephritis.


    Zhou, Hui; Chen, Min; Zhu, Ying; Wang, Bing; Liu, Xiao-Ning; Zuo, Zhi; Tang, Feng-Ying


    End-stage renal disease (ESRD) was defined as start of renal replacement therapy or death due to kidney disease. However, death due to acute kidney injury was not included. It typically occurs when chronic renal failure progresses to a point where the kidneys are permanently functioning at less than 10% of their capacity. Oxidative stress (OS) plays a crucial role in ESRD. Nicotinamide adenine dinucleotide phosphate (NADPH) is one of the most important enzymes during oxidative stress. Cytochrome b light chain (CYBA), encoded by a polymorphic gene, which is a critical component of the nicotinamide adenine dinucleotide (NADH)/NADPH oxidase system and plays an important role in electron transport and superoxide anion production, is located on chromosome band 16q24 and has six exons spanning almost 7.76kb of genomic DNA. CYBA gene polymorphisms can influence the activity of NADPH oxidase. To evaluate the association between CYBA gene polymorphisms and ESRD, we genotyped five CYBA polymorphisms using TaqMan allelic discrimination assay on DNA samples from 306 healthy controls and 332 patients with ESRD. Our results suggested that rs1049255 polymorphism of CYBA modified the risk of ESRD (p ?=??0.019; OR ?=??0.625; 95%CI ?=??0.424-0.921). GG genotype and G allele might be a protective factor against the risk of ESRD, especially in patients with chronic glomerulonephritis. PMID:26627442

  12. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.


    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua


    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P<0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P<0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene. PMID:26546307

  13. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.


    Pu, Xiao-Jun; Lv, Xin; Lin, Hong-Hui


    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors-WRKY, NAC, bZIP and MYB-are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  14. Apple ACC-oxidase and polygalacturonase: ripening-specific gene expression and promoter analysis in transgenic tomato.


    Atkinson, R G; Bolitho, K M; Wright, M A; Iturriagagoitia-Bueno, T; Reid, S J; Ross, G S


    Levels of 1-aminocyclopropane-1-carboxylate (ACC) oxidase and polygalacturonase (PG) mRNAs were characterized during ripening of Royal Gala, Braeburn and Granny Smith apples. Both ACC-oxidase and PG mRNAs were up-regulated in ripening fruit of all three cultivars. Expression in Royal Gala was detected earlier than in Braeburn and Granny Smith, relative to internal ethylene concentration. Genomic clones corresponding to the ACC-oxidase and PG mRNAs expressed in ripe apple fruit were isolated and ca. 2 kb of each promoter was sequenced. The start point of transcription in each gene was mapped by primer extension, and sequences homologous to elements in other ethylene-responsive or PG promoters were identified. The fruit specificity of the apple ACC-oxidase and PG promoters was investigated in transgenic tomato plants using a nested set of promoter fragments fused to the beta-glucuronidase (gusA) reporter gene. For the ACC-oxidase gene, 450 bp of 5' promoter sequence was sufficient to drive GUS expression, although this expression was not specific to ripening fruit. Larger fragments of 1966 and 1159 bp showed both fruit and ripening specificity. For the PG gene, promoter fragments of 1460 and 532 bp conferred ripening-specific expression in transgenic tomato fruit. However GUS expression was down-regulated by 2356 bp of promoter, suggesting the presence of a negative regulatory element between positions -1460 and -2356. PMID:9747852

  15. Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).


    Beecher, Brian S; Carter, Arron H; See, Deven R


    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B. PMID:22311372

  16. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M


    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  17. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan


    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  18. Isolation and characterization of the pea cytochrome c oxidase Vb gene.


    Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi


    Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins. PMID:17426763

  19. Monoamine Oxidase A Gene Polymorphisms and Bipolar Disorder in Iranian Population

    PubMed Central

    Eslami Amirabadi, Mohammad Reza; Rajezi Esfahani, Sepideh; Davari-Ashtiani, Rozita; Khademi, Mojgan; Emamalizadeh, Babak; Movafagh, Abolfazl; Sadr, Said; Arabgol, Fariba; Darvish, Hossein; Razjoyan, Katayoon


    Background: Bipolar disorder (BPD) is a common and severe mood disorder. Although genetic factors have important rolesin the etiology of bipolar disorder, no specific gene has been identified in relation to this disorder. Monoamine oxidase gene is suggested to be associated with bipolar disorder in many studies. Objectives: This study aimed to investigatethe role of MAOA gene polymorphisms in the etiology of bipolar disorder in Iranian population. Patients and Methods: This study is a case-control study, with convenient sampling. Three common polymorphisms, a CA microsatellite, a VNTR, and a RFLP were typed in 156 bipolar patients and 173 healthy controls. Patients were chosen from Imam Hossein General Hospital, Psychiatry Ward (Tehran/Iran). Controlsamples for this study consisted of 173 healthy individuals recruitedby convenient sampling. Allelic distributions of these polymorphisms were analyzed in bipolar and control groups to investigate any association with MAOA gene. Results: Significant associations were observed regarding MAOA-CA (P = 0.016) and MAOA-VNTR (P = 0.004) polymorphisms in the bipolar females. There was no association between MAOA-RFLP and bipolar disorder. Conclusions: The obtained results confirm some previous studies regardinga gender specific association of MAOA gene with the bipolar disorder. PMID:25793118

  20. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  1. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.


    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu


    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  2. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.


    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L


    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  3. Behavioural alterations in male mice lacking the gene for D-aspartate oxidase.


    Weil, Zachary M; Huang, Alex S; Beigneux, Anne; Kim, Paul M; Molliver, Mark E; Blackshaw, Seth; Young, Stephen G; Nelson, Randy J; Snyder, Solomon H


    D-serine and D-aspartate are important regulators of mammalian physiology. D-aspartate is found in nervous and endocrine tissue, specifically in hypothalamic supraoptic and paraventricular nuclei, pituitary, and adrenal medullary cells. Endogenous D-aspartate is selectively degraded by D-aspartate oxidase. We previously reported that adult male mice lacking the gene for D-aspartate oxidase (Ddo(-/-) mice) display elevated concentrations of D-aspartate in several neuronal and neuroendocrine tissues as well as impaired sexual performance and altered autogrooming behaviour. In the present study, we analyzed behaviours relevant to affect, cognition, and motor control in Ddo(-/-) mice. Ddo(-/-) mice display deficits in sensorimotor gating and motor coordination as well as reduced immobility in the forced swim test. Basal corticosterone concentrations are elevated. The Ddo(-/-) mice have D-aspartate immunoreactive cells in the cerebellum and adrenal glands that are not observed in the wild-type mice. However, no differences in anxiety-like behaviour are detected in open field or light-dark preference tests. Also, Ddo(-/-) mice do not differ from wild-type mice in either passive avoidance or spontaneous alternation tasks. Although many of these behavioural deficits may be due to the lack of Ddo during development, our results are consistent with the widespread distribution of D-aspartate and the hypothesis that endogenous D-aspartate serves diverse behavioural functions. PMID:16725213

  4. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central


    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on primary sequence data. The dynamic nature of this gene family differentiates PPO from other oxidative enzymes, and is consistent with a protein important for a diversity of functions relating to environmental adaptation. PMID:22897796

  5. Expression of NADPH oxidase homologues and accessory genes in human cancer cell lines, tumours and adjacent normal tissues

    PubMed Central



    The family of NADPH oxidase (NOX) genes produces reactive oxygen species (ROS) pivotal for both cell signalling and host defense. To investigate whether NOX and NOX accessory gene expression might be a factor common to specific human tumour types, this study measured the expression levels of NOX genes 1–5, dual oxidase 1 and 2, as well as those of NOX accessory genes NoxO1, NoxA1, p47phox, p67phox and p22phox in human cancer cell lines and in tumour and adjacent normal tissue pairs by quantitative, real-time RT-PCR. The results demonstrate tumour-specific patterns of NOX gene expression that will inform further studies of the role of NOX activity in tumour cell invasion, growth factor response and proliferative potential. PMID:19431059

  6. The terminal quinol oxidase of the hyperthermophilic archaeon Acidianus ambivalens exhibits a novel subunit structure and gene organization.

    PubMed Central

    Purschke, W G; Schmidt, C L; Petersen, A; Schäfer, G


    A terminal quinol oxidase has been isolated from the plasma membrane of the crenarchaeon Acidianus ambivalens (DSM 3772) (formerly Desulfurolobus ambivalens), cloned, and sequenced. The detergent-solubilized complex oxidizes caldariella quinol at high rates and is completely inhibited by cyanide and by quinolone analogs, potent inhibitors of quinol oxidases. It is composed of at least five different subunits of 64.9, 38, 20.4, 18.8, and 7.2 kDa; their genes are located in two different operons. doxB, the gene for subunit I, is located together with doxC and two additional small open reading frames (doxE and doxF) in an operon with a complex transcription pattern. Two other genes of the oxidase complex (doxD and doxA) are located in a different operon and are cotranscribed into a common 1.2-kb mRNA. Both operons exist in duplicate on the genome of A. ambivalens. Only subunit I exhibits clear homology to other members of the superfamily of respiratory heme-copper oxidases; however, it reveals 14 transmembrane helices. In contrast, the composition of the accessory proteins is highly unusual; none is homologous to any known accessory protein of cytochrome oxidases, nor do homologs exist in the databases. DoxA is classified as a subunit II equivalent only by analogy of molecular size and hydrophobicity pattern to corresponding polypeptides of other oxidases. Multiple alignments and phylogenetic analysis of the heme-bearing subunit I (DoxB) locate this oxidase at the bottom of the phylogenetic tree, in the branch of heme-copper oxidases recently suggested to be incapable of superstoichiometric proton pumping. This finding is corroborated by lack of the essential amino acid residues delineating the putative H+-pumping channel. It is therefore concluded that A. ambivalens copes with its strongly acidic environment simply by an extreme turnover of its terminal oxidase, generating a proton gradient only by chemical charge separation. PMID:9023221

  7. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )


    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  8. Cloning and Characterization of Three Fatty Alcohol Oxidase Genes from Candida tropicalis Strain ATCC 20336

    PubMed Central

    Eirich, L. Dudley; Craft, David L.; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H.; Stols, Lucy; Donnelly, Mark I.; Wilson, C. Ron


    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of ?-hydroxy fatty acids to ?-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and Km values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes ?-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not ?-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the Km values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  9. Cloning and characterization of three fatty alcohol oxidase genes from Candida tropicalis strain ATCC 20336.


    Eirich, L Dudley; Craft, David L; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H; Stols, Lucy; Donnelly, Mark I; Wilson, C Ron


    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of omega-hydroxy fatty acids to omega-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and K(m) values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes omega-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not omega-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the K(m) values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  10. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome.


    Wu, Jason B; Chen, Kevin; Li, Yunmin; Lau, Yun-Fai Chris; Shih, Jean C


    Monoamine oxidase A (MAO A), encoded by the X chromosome, catalyzes the oxidative deamination of monoamine neurotransmitters, such as serotonin, and plays a critically important role in brain development and functions. Abnormal MAO A activity has been implicated in several neuropsychiatric disorders, such as depression, autism, and attention deficit hyperactivity disorder, which show sexual dimorphism. However, the molecular basis for these disease processes is unclear. Recently, we found that MAO A was a putative target gene directly regulated by a transcription factor encoded by the sex-determining region Y (SRY) gene located on the Y chromosome. We demonstrated that SRY activates both MAO A-promoter and catalytic activities in a human male neuroblastoma BE(2)C cell line. A functional SRY-binding site in the MAO A core promoter was identified and validated by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) analyses. Coimmunoprecipitation and ChIP assays showed that SRY and Sp1 form a transcriptional complex and synergistically activate MAO A transcription. This is the first study demonstrating that the Y-encoded transcription factor SRY is capable of regulating an X-located gene, suggesting a novel molecular mechanism for sexual dimorphism in neural development, brain functions, and initiation/progression of neural disorders associated with MAO A dysfunction. PMID:19661285

  11. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad


    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  12. Association between monoamine oxidase gene polymorphisms and smoking behaviour in Chinese males.


    Jin, Ying; Chen, Dafang; Hu, Yonghua; Guo, Song; Sun, Hongqiang; Lu, Aili; Zhang, Xiaoyan; Li, Lingsong


    Monoamine oxidase (MAO) is a critical metabolic enzyme of dopamine, which is a key neurotransmitter of the mesolimbic reward pathway in the human brain. Consequently, the gene encoding MAO is an important candidate gene in the genetics of smoking behaviour. We investigated the association between MAOA polymorphisms (a VNTR polymorphism and an EcoRV polymorphism) and smoking status. A community-based cross-sectional study was conducted with 203 current smoking subjects and 168 non-current smoking subjects in Beijing, China. Genotyping for these polymorphisms was performed using PCR and restriction fragment length polymorphism. Multiple logistic regression models were used to analyse the association of MAOA gene polymorphisms with smoking status. We found that individuals with the 1460T/O genotype had a significantly increased the risk of smoking compared to those with 1460C/O. The adjusted odds ratios (aORs) were 3.2 (95% CI 2.0-5.2) in current vs. non-current smokers group, 1.7 (95% CI 1.1-2.8) in ever vs. never smokers group, 2.5 (95% CI 1.4-4.3) in current vs. never smokers group, and 5.3 (95% CI 2.5-11.2) in current vs. former smokers group respectively. We also found that individuals with the 3-repeat genotype of the VNTR polymorphism had a significantly increased risk of smoking significantly compared to those with the 4-repeat genotype. The aORs were 2.0 (95% CI 1.0-4.1) in the current vs. former smokers group, and 1.9 (95% CI 1.0-3.6) in the nicotine dependent vs. non-nicotine dependent group respectively. Moreover, MAOA gene haplotypes were associated significantly with nicotine dependence in every group. In conclusion, there is an important association between MAOA polymorphisms and smoking status, suggesting a possible role of MAOA gene variants in nicotine dependence. PMID:16207390

  13. A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

    PubMed Central

    Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong


    Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s?1) and nicotine (Km = 2.03 mM, kcat = 0.396 s?1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

  14. A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.


    Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping


    Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

  15. Molecular characterization of the Drosophila melanogaster urate oxidase gene, an ecdysone-repressible gene expressed only in the malpighian tubules.

    PubMed Central

    Wallrath, L L; Burnett, J B; Friedman, T B


    The urate oxidase (UO) gene of Drosophila melanogaster is expressed during the third-instar larval and adult stages, exclusively within a subset of cells of the Malpighian tubules. The UO gene contains a 69-base-pair intron and encodes mature mRNAs of 1,224, 1,227, and 1,244 nucleotides, depending on the site of 3' endonucleolytic cleavage prior to polyadenylation. A direct repeat, 5'-AAGTGAGAGTGAT-3', is the proposed cis-regulatory element involved in 20-hydroxyecdysone repression of the UO gene. The deduced amino acid sequences of UO of D. melanogaster, rat, mouse, and pig and uricase II of soybean show 32 to 38% identity, with 22% of amino acid residues identical in all species. With use of P-element-mediated germ line transformation, 826 base pairs 5' and approximately 1,200 base pairs 3' of the D. melanogaster UO transcribed region contain all of the cis elements allowing for appropriate temporal regulation and Malpighian tubule-specific expression of the UO gene. Images PMID:2118989

  16. Dominant role of the cbb3 oxidase in regulation of photosynthesis gene expression through the PrrBA system in Rhodobacter sphaeroides 2.4.1.


    Kim, Yong-Jin; Ko, In-Jeong; Lee, Jin-Mok; Kang, Ho-Young; Kim, Young Min; Kaplan, Samuel; Oh, Jeong-Il


    In this study, the H303A mutant form of the cbb(3) oxidase (H303A oxidase), which has the H303A mutation in its catalytic subunit (CcoN), was purified from Rhodobacter sphaeroides. The H303A oxidase showed the same catalytic activity as did the wild-type form of the oxidase (WT oxidase). The heme contents of the mutant and WT forms of the cbb(3) oxidase were also comparable. However, the puf and puc operons, which are under the control of the PrrBA two-component system, were shown to be derepressed aerobically in the R. sphaeroides strain expressing the H303A oxidase. Since the strain harboring the H303A oxidase exhibited the same cytochrome c oxidase activity as the stain harboring the WT oxidase did, the aerobic derepression of photosynthesis gene expression observed in the H303A mutant appears to be the result of a defective signaling function of the H303A oxidase rather than reflecting any redox changes in the ubiquinone/ubiquinol pool. It was also demonstrated that ubiquinone inhibits not only the autokinase activity of full-length PrrB but also that of the truncated form of PrrB lacking its transmembrane domain, including the proposed quinone binding sequence. These results imply that the suggested ubiquinone binding site within the PrrB transmembrane domain is not necessary for the inhibition of PrrB kinase activity by ubiquinone. Instead, it is probable that signaling through H303 of the CcoN subunit of the cbb(3) oxidase is part of the pathway through which the cbb(3) oxidase affects the relative kinase/phosphatase activity of the membrane-bound PrrB. PMID:17557830

  17. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene

    SciTech Connect

    Virbasius, J.V.; Scarpulla, R.C. )


    A mutational analysis of the rat cytochrome c oxidase subunit IV (RCO4) promoter region revealed the presence of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase {beta}-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RCO4 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding a transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RCO4 promoter sequence. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression.

  18. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.


    Gro, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela


    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS. PMID:24173666

  19. ZFN-mediated gene targeting of the Arabidopsis protoporphyrinogen oxidase gene through Agrobacterium-mediated floral dip transformation.


    de Pater, Sylvia; Pinas, Johan E; Hooykaas, Paul J J; van der Zaal, Bert J


    Previously, we showed that ZFN-mediated induction of double-strand breaks (DSBs) at the intended recombination site enhanced the frequency of gene targeting (GT) at an artificial target locus using Agrobacterium-mediated floral dip transformation. Here, we designed zinc finger nucleases (ZFNs) for induction of DSBs in the natural protoporphyrinogen oxidase (PPO) gene, which can be conveniently utilized for GT experiments. Wild-type Arabidopsis plants and plants expressing the ZFNs were transformed via floral dip transformation with a repair T-DNA with an incomplete PPO gene, missing the 5' coding region but containing two mutations rendering the enzyme insensitive to the herbicide butafenacil as well as an extra KpnI site for molecular analysis of GT events. Selection on butafenacil yielded 2 GT events for the wild type with a frequency of 0.8 × 10⁻³ per transformation event and 8 GT events for the ZFNs expressing plant line with a frequency of 3.1 × 10⁻³ per transformation event. Molecular analysis using PCR and Southern blot analysis showed that 9 of the GT events were so-called true GT events, repaired via homologous recombination (HR) at the 5' and the 3' end of the gene. One plant line contained a PPO gene repaired only at the 5' end via HR. Most plant lines contained extra randomly integrated T-DNA copies. Two plant lines did not contain extra T-DNAs, and the repaired PPO genes in these lines were transmitted to the next generation in a Mendelian fashion. PMID:23279135

  20. ZFN-mediated gene targeting of the Arabidopsis protoporphyrinogen oxidase gene through Agrobacterium-mediated floral dip transformation

    PubMed Central

    Pater, Sylvia; Pinas, Johan E; Hooykaas, Paul J J; Zaal, Bert J


    Previously, we showed that ZFN-mediated induction of double-strand breaks (DSBs) at the intended recombination site enhanced the frequency of gene targeting (GT) at an artificial target locus using Agrobacterium-mediated floral dip transformation. Here, we designed zinc finger nucleases (ZFNs) for induction of DSBs in the natural protoporphyrinogen oxidase (PPO) gene, which can be conveniently utilized for GT experiments. Wild-type Arabidopsis plants and plants expressing the ZFNs were transformed via floral dip transformation with a repair T-DNA with an incomplete PPO gene, missing the 5′ coding region but containing two mutations rendering the enzyme insensitive to the herbicide butafenacil as well as an extra KpnI site for molecular analysis of GT events. Selection on butafenacil yielded 2 GT events for the wild type with a frequency of 0.8 × 10−3 per transformation event and 8 GT events for the ZFNs expressing plant line with a frequency of 3.1 × 10−3 per transformation event. Molecular analysis using PCR and Southern blot analysis showed that 9 of the GT events were so-called true GT events, repaired via homologous recombination (HR) at the 5′ and the 3′ end of the gene. One plant line contained a PPO gene repaired only at the 5′ end via HR. Most plant lines contained extra randomly integrated T-DNA copies. Two plant lines did not contain extra T-DNAs, and the repaired PPO genes in these lines were transmitted to the next generation in a Mendelian fashion. PMID:23279135

  1. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen


    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 ?M/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 ?M/min and Km (NADH) 51.3 ?M, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  2. Cytokinin Oxidase Gene Expression in Maize Is Localized to the Vasculature, and Is Induced by Cytokinins, Abscisic Acid, and Abiotic Stress

    PubMed Central

    Brugire, Norbert; Jiao, Shuping; Hantke, Sabine; Zinselmeier, Chris; Roessler, Jeffrey A.; Niu, Xiaomu; Jones, Robert J.; Habben, Jeffrey E.


    Cytokinins are hormones that play an essential role in plant growth and development. The irreversible degradation of cytokinins, catalyzed by cytokinin oxidase, is an important mechanism by which plants modulate their cytokinin levels. Cytokinin oxidase has been well characterized biochemically, but its regulation at the molecular level is not well understood. We isolated a cytokinin oxidase open reading frame from maize (Zea mays), called Ckx1, and we used it as a probe in northern and in situ hybridization experiments. We found that the gene is expressed in a developmental manner in the kernel, which correlates with cytokinin levels and cytokinin oxidase activity. In situ hybridization with Ckx1 and transgenic expression of a transcriptional fusion of the Ckx1 promoter to the Escherichia coli ?-glucuronidase reporter gene revealed that the gene is expressed in the vascular bundles of kernels, seedling roots, and coleoptiles. We show that Ckx1 gene expression is inducible in various organs by synthetic and natural cytokinins. Ckx1 is also induced by abscisic acid, which may control cytokinin oxidase expression in the kernel under abiotic stress. We hypothesize that under non-stress conditions, cytokinin oxidase in maize plays a role in controlling growth and development via regulation of cytokinin levels transiting in the xylem. In addition, we suggest that under environmental stress conditions, cytokinin oxidase gene induction by abscisic acid results in aberrant degradation of cytokinins therefore impairing normal development. PMID:12857805

  3. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  4. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.


    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  5. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.


    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  6. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.


    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  7. Purification of the aldehyde oxidase homolog 1 (AOH1) protein and cloning of the AOH1 and aldehyde oxidase homolog 2 (AOH2) genes. Identification of a novel molybdo-flavoprotein gene cluster on mouse chromosome 1.


    Terao, M; Kurosaki, M; Marini, M; Vanoni, M A; Saltini, G; Bonetto, V; Bastone, A; Federico, C; Saccone, S; Fanelli, R; Salmona, M; Garattini, E


    We report the cloning of the AOH1 and AOH2 genes, which encode two novel mammalian molybdo-flavoproteins. We have purified the AOH1 protein to homogeneity in its catalytically active form from mouse liver. Twenty tryptic peptides, identified or directly sequenced by mass spectrometry, confirm the primary structure of the polypeptide deduced from the AOH1 gene. The enzyme contains one molecule of FAD, one atom of molybdenum, and four atoms of iron per subunit and shows spectroscopic features similar to those of the prototypic molybdo-flavoprotein xanthine oxidoreductase. The AOH1 and AOH2 genes are 98 and 60 kilobases long, respectively, and consist of 35 coding exons. The AOH1 gene has the potential to transcribe an extra leader non-coding exon, which is located downstream of exon 26, and is transcribed in the opposite orientation relative to all the other exons. AOH1 and AOH2 map to chromosome 1 in close proximity to each other and to the aldehyde oxidase gene, forming a molybdo-flavoenzyme gene cluster. Conservation in the position of exon/intron junctions among the mouse AOH1, AOH2, aldehyde oxidase, and xanthine oxidoreductase loci indicates that these genes are derived from the duplication of an ancestral precursor. PMID:11562361

  8. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.


    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  9. Cortical Enlargement in Autism is Associated With a Functional VNTR in the Monoamine Oxidase A Gene

    PubMed Central

    Davis, Lea K.; Hazlett, Heather C.; Librant, Amy L.; Nopoulos, Peggy; Sheffield, Val C.; Piven, Joesph; Wassink, Thomas H.


    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that “low activity” alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the “low activity” allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2–3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the “low activity” allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the “low activity” allele in a separate sample of 114 affected sib pairfamilies. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the “low activity” genotype and the larger brain volumes in our sample. PMID:18361446

  10. [Cloning and bioinformatics analysis of ent-kaurene oxidase synthase gene in Salvia miltiorrhiza].


    Hu, Ya-ting; Gao, Wei; Liu, Yu-jia; Cheng, Qi-qing; Su, Ping; Liu, Yu-zhong; Chen, Min


    Based on the transcriptome database of Salvia miltiorrhiza, specific primers were designed to clone a full-length cDNA of ent-kaurene oxidase synthase (SmKOL) using the RACE strategy. ORF Finder was used to find the open reading frame of SmKOL cDNA, and ClustalW has been performed to analysis the multiple amino acid sequence alignment. Phylogenetic tree has been constructed using MEGA 5.1. The transcription level of SmKOL from the hairy roots induced by elicitor methyl jasmonate (MeJA) was qualifiedby real-time quantitative PCR. The full length of SmKOL cDNA was of 1 884 bp nucleotides encoding 519 amino acids. The molecular weight of the SmKOL protein was about 58.88 kDa with isoelectric point (pI) of 7.62. Results of real-time quantitative PCR analyses indicated that the level of SmKOL mRNA expression in hairy roots was increased by elicitor oMeJA, and reached maximum in 36 h. The full-length cDNA of SmKOL was cloned from S. miltiorrhiza hairy root, which provides a target gene for further studies of its function, gibberellin biosynthesis and regulation of secondary metabolites. PMID:25775789

  11. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central


    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of the hypothesis Studies of the gau ORF will shed light on the origin of novel genes and their functions in organelles and could also have medical implications for human diseases that are caused by mitochondrial dysfunction. Moreover, this strengthens evidence for mitochondrial genes coded according to an overlapping genetic code. PMID:22024028

  12. Cytochrome o (cyoABCDE) and d (cydAB) oxidase gene expression in Escherichia coli is regulated by oxygen, pH, and the fnr gene product

    SciTech Connect

    Cotter, P.A.; Gunsalus, R.P. ); Chepuri, V.; Gennis, R.B. )


    The aerobic respiratory chain of Escherichia coli contains two terminal oxidases that catalyze the oxidation of ubiquinol-8 and the reduction of oxygen to water. They are the cytochrome o oxidase complex encoded by cyoABCDE and the cytochrome d oxidase complex encoded by cydAB. To determine how these genes are regulated in response to a variety of environmental stimuli, including oxygen, we examined their expression by using lacZ protein fusions in wild-type and fnr mutant strains of E. coli. Based on the pattern of anaerobic cydAB expression observed, we propose the existence of a second, as yet unidentified, regulatory element that must function either to activate cydAB expression as oxygen becomes limiting or to repress cydAB expression aerobically. Whereas cytochrome o oxidase encoded by cyoABCDE appears to be produced only under oxygen-rich growth conditions, in keeping with its biochemical properties, cytochrome d oxidase is expressed moderately aerobically and is elevated yet further when oxygen becomes limiting so that the organism can cope better under oxygen starvation conditions. We also examined cyoABCDE and cydAB expression in response to growth on alternative carbon compounds and to changes in the culture medium pH and osmolarity.

  13. Divergent biochemical and enzymatic properties of oxalate oxidase isoforms encoded by four similar genes in rice.


    Li, Xiao Chun; Liao, Yuan Yang; Leung, David W M; Wang, Hai Yan; Chen, Bai Ling; Peng, Xin Xiang; Liu, E E


    The biochemical and enzymatic properties of four highly similar rice oxalate oxidase proteins (OsOxO1-4) were compared after their purification from the leaves of transgenic plants each overexpressing the respective OsOxO1-4 genes. Although alignment of their amino acid sequences has revealed divergence mainly in the signal peptides and they catalyze the same enzymic (oxalate oxidase) reaction, divergence in apparent molecular mass, Km, optimum pH, stability and responses to inhibitors and activators was uncovered by biochemical characterization of the purified OsOxO1-4 proteins. The apparent molecular mass of oligomer OsOxO1 was found to be similar to that of OsOxO3 but lower than the other two. The molecular mass of the subunit of OsOxO1 was lower than that of OsOxO3. The Km value of OsOxO3 was higher than the other three which had similar Km. OsOxO1 and OsOxO4 possessed peak activity at pH 8.5 which was close to that at the optimum pH 4.0. The activity of OsOxO2 at pH 8.5 was only 65% of that at its optimum pH 3.5, while the activity of OsOxO3 did not vary much at pH 6-9 and was also much lower than that at its optimum pH 3. OsOxO2 and OsOxO3 still maintained all their activities after being heated at 70C for 1h while OsOxO1 and OsOxO4 lost about 30% of their activities. Pyruvate and oxaloacetic acid inhibited the activity of OsOxO3 more strongly than the other three. Interestingly, glucose 6-phosphate, fructose 6-phosphate and fructose 1,6-biphosphate related to photosynthetic assimilation of triose phosphate greatly increased the activities of OsOxO3 and OsOxO4. In addition to the differences in the biochemical properties of the four OsOxO proteins, an intriguing finding is that the purified OsOxO1-4 exhibited substrate inhibition, which is a typical of the classical Michaelis-Menten enzyme kinetics exhibited by a majority of other enzymes. PMID:26347131

  14. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie


    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  15. Expression of the Aspergillus niger glucose oxidase gene in Saccharomyces cerevisiae and its potential applications in wine production.


    Malherbe, D F; du Toit, M; Cordero Otero, R R; van Rensburg, P; Pretorius, I S


    There is a growing consumer demand for wines containing lower levels of alcohol and chemical preservatives. The objectives of this study were to express the Aspergillus niger gene encoding a glucose oxidase (GOX; beta- d-glucose:oxygen oxidoreductase, EC in Saccharomyces cerevisiae and to evaluate the transformants for lower alcohol production and inhibition of wine spoilage organisms, such as acetic acid bacteria and lactic acid bacteria, during fermentation. The A. niger structural glucose oxidase (gox) gene was cloned into an integration vector (YIp5) containing the yeast mating pheromone alpha-factor secretion signal (MFalpha1(S)) and the phosphoglycerate-kinase-1 gene promoter (PGK1(P)) and terminator (PGK1(T)). The PGK1(P)- MFalpha1(S)- gox- PGK1(T) cassette (designated GOX1) was introduced into a laboratory strain (Sigma1278) of S. cerevisiae. Yeast transformants were analysed for the production of biologically active glucose oxidase on selective agar plates and in liquid assays. The results indicated that the recombinant glucose oxidase was active and was produced beginning early in the exponential growth phase, leading to a stable level in the stationary phase. The yeast transformants also displayed antimicrobial activity in a plate assay against lactic acid bacteria and acetic acid bacteria. This might be explained by the fact that a final product of the GOX enzymatic reaction is hydrogen peroxide, a known antimicrobial agent. Microvinification with the laboratory yeast transformants resulted in wines containing 1.8-2.0% less alcohol. This was probably due to the production of d-glucono-delta-lactone and gluconic acid from glucose by GOX. These results pave the way for the development of wine yeast starter culture strains for the production of wine with reduced levels of chemical preservatives and alcohol. PMID:12764565

  16. Isolation and partial nucleotide sequence of the laccase gene from Neurospora crassa: amino acid sequence homology of the protein to human ceruloplasmin.

    PubMed Central

    Germann, U A; Lerch, K


    The laccase (benzenediol:oxygen oxidoreductase, EC gene from Neurospora crassa was cloned and part of its nucleotide sequence corresponding to the carboxyl-terminal region of the protein has been determined. The gene was cloned by cDNA synthesis with a laccase-specific synthetic deoxyundecanucleotide as primer and poly(A) RNA isolated from cycloheximide-treated N. crassa cultures as template. Based on the nucleotide sequence of the cDNA obtained, a unique 21-mer was synthesized and used to screen a genomic DNA library from N. crassa. Five different positive clones were isolated and shown to share an overlapping DNA region with the same pattern of restriction sites. Sequence analysis of the common 1.36-kilobase Sal I fragment revealed an open reading frame of 726 nucleotides. The amino acid sequence deduced is in complete agreement with the primary structures of several tryptic peptides isolated previously from N. crassa laccase. The analyzed carboxyl-terminal region of laccase exhibits a striking sequence homology to the carboxyl-terminal part of the third homology unit of the multicopper oxidase ceruloplasmin and to a smaller extent, to the low molecular weight blue copper proteins plastocyanin and azurin. Based on amino acid sequence comparison between these proteins, putative copper ligands of N. crassa laccase are proposed. Moreover, these data further support the hypothesis that the small blue copper proteins and the multicopper oxidases have evolved from the same ancestral gene. Images PMID:2947240

  17. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho


    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  18. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.


    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P


    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  19. Coordination of cytochrome c oxidase gene expression in the remodelling of skeletal muscle.


    Duggan, Ana T; Kocha, Katrinka M; Monk, Christopher T; Bremer, Katharina; Moyes, Christopher D


    Many fish species respond to low temperature by inducing mitochondrial biogenesis, reflected in an increase in activity of the mitochondrial enzyme cytochrome c oxidase (COX). COX is composed of 13 subunits, three encoded by mitochondrial (mt)DNA and 10 encoded by nuclear genes. We used real-time PCR to measure mRNA levels for the 10 nuclear-encoded genes that are highly expressed in muscle. We measured mRNA levels in white muscle of three minnow species, each at two temperatures: zebrafish (Danio rerio) acclimated to 11 and 30C, goldfish (Carassius auratus) acclimated to 4 and 35C, and northern redbelly dace (Chrosomus eos) collected in winter and summer. We hypothesized that temperature-induced changes in COX activity would be paralleled by COX nuclear-encoded subunit transcript abundance. However, we found mRNA for COX subunits showed pronounced differences in thermal responses. Though zebrafish COX activity did not change in the cold, the transcript levels of four subunits decreased significantly (COX5A1, 60% decrease; COX6A2, 70% decrease; COX6C, 50% decrease; COX7B, 55% decrease). Treatments induced changes in COX activity in both dace (2.9 times in winter fish) and goldfish (2.5 times in cold fish), but the response in transcript levels was highly variable. Some subunits failed to increase in one (goldfish COX7A2, dace COX6A2) or both (COX7B, COX6B2) species. Other transcripts increased 1.7-100 times. The most cold-responsive subunits were COX4-1 (7 and 21.3 times higher in dace and goldfish, respectively), COX5A1 (13.9 and 5 times higher), COX6B1 (6 and 10 times higher), COX6C (11 and 4 times higher) and COX7C (13.3 and 100 times higher). The subunits that most closely paralleled COX increases in the cold were COX5B2 (dace 2.5 times, goldfish 1.7 times) and COX6A2 (dace 4.1 times, goldfish 1.7 times). Collectively, these studies suggest that COX gene expression is not tightly coordinated during cold-induced mitochondrial remodelling in fish muscle. Further, they caution against arguments about the importance of transcriptional regulation based on measurement of mRNA levels of select subunits of multimeric proteins. PMID:21562175

  20. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R


    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  1. Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

    PubMed Central

    Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.


    Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

  2. Overexpression of a Gene Encoding Hydrogen Peroxide-Generating Oxalate Oxidase Evokes Defense Responses in Sunflower1

    PubMed Central

    Hu, Xu; Bidney, Dennis L.; Yalpani, Nasser; Duvick, Jonathan P.; Crasta, Oswald; Folkerts, Otto; Lu, Guihua


    Oxalate oxidase (OXO) converts oxalic acid (OA) and O2 to CO2 and hydrogen peroxide (H2O2), and acts as a source of H2O2 in certain plant-pathogen interactions. To determine if the H2O2 produced by OXO can function as a messenger for activation of defense genes and if OXO can confer resistance against an OA-producing pathogen, we analyzed transgenic sunflower (Helianthus annuus cv SMF3) plants constitutively expressing a wheat (Triticum aestivum) OXO gene. The transgenic leaf tissues could degrade exogenous OA and generate H2O2. Hypersensitive response-like lesion mimicry was observed in the transgenic leaves expressing a high level of OXO, and lesion development was closely associated with elevated levels of H2O2, salicylic acid, and defense gene expression. Activation of defense genes was also observed in the transgenic leaves that had a low level of OXO expression and had no visible lesions, indicating that defense gene activation may not be dependent on hypersensitive response-like cell death. To further understand the pathways that were associated with defense activation, we used GeneCalling, an RNA-profiling technology, to analyze the alteration of gene expression in the transgenic plants. Among the differentially expressed genes, full-length cDNAs encoding homologs of a PR5, a sunflower carbohydrate oxidase, and a defensin were isolated. RNA-blot analysis confirmed that expression of these three genes was significantly induced in the OXO transgenic sunflower leaves. Furthermore, treatment of untransformed sunflower leaves with jasmonic acid, salicylic acid, or H2O2 increased the steady-state levels of these mRNAs. Notably, the transgenic sunflower plants exhibited enhanced resistance against the OA-generating fungus Sclerotinia sclerotiorum. PMID:12970484

  3. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ros, J; Morera, C; Taboada, H; Dvalos, A; Encarnacin, S; Mora, J; Sobern, M


    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship between expression of thiC and production of the cbb3 terminal oxidase. This is consistent with the proposition that a purine-related metabolite, 5-aminoimidazole-4-carboxamide ribonucleotide, is a negative effector of the production of the symbiotic terminal oxidase cbb3 in R. etli. PMID:9371431

  4. Traumatic brain injury-induced changes in gene expression and functional activity of mitochondrial cytochrome C oxidase.


    Harris, L K; Black, R T; Golden, K M; Reeves, T M; Povlishock, J T; Phillips, L L


    Traumatic brain injury (TBI) is documented to have detrimental effects on CNS metabolism, including alterations in glucose utilization and the depression of mitochondrial oxidative phosphorylation. Studies on mitochondrial metabolism have also provided evidence for reduced activity of the cytochrome oxidase complex of the electron transport chain (complex IV) after TBI and an immediate (lhr) reduction in mitochondrial state 3 respiratory rate, which can persist for up to 14 days postinjury. Using differential display methods to screen for differences in gene expression, we have found that cytochrome c oxidase II (COII), a mitochondrial encoded subunit of complex IV, is upregulated following TBI. Since COII carries a binding site for cytochrome c in the respiratory chain, and since it is required for the passage of chain electrons to molecular oxygen, driving the production of ATP, we hypothesized that metabolic dysfunction resulting from TBI alters COII gene expression directly, perhaps influencing the synaptic plasticity that occurs during postinjury recovery processes. To test this hypothesis, we documented COII mRNA expression and complex IV (cytochrome c oxidase) functional activity at 7 days postinjury, focusing on the long-term postinjury period most closely associated with synaptic reorganization. Both central fluid percussion TBI and combined TBI and bilateral entorhinal cortical lesion were examined. At 7 days survival, differential display, RT-PCR, and Northern blot analysis of hippocampal RNA from both TBI and combined insult models showed a significant induction of COII mRNA. This long-term elevation in COII gene expression was supported by increases in COII immunobinding. By contrast, cytochrome oxidase histochemical activity within tissue sections from injured brains suggested a reduction of complex IV activity within the TBI cases, but not within animals subjected to the combined insult. These differences in cytochrome c oxidase activity were supported by in vitro assay of complex IV using cerebral cortical and hippocampal tissues. Our present results support the hypothesis that COII is selectively vulnerable to TBI and that COII differences may indicate the degree of metabolic dysfunction induced by different pathologies. Taken together, such data will better define the role of metabolic function in long-term recovery after TBI. PMID:11686499

  5. Cloning of a Novel Nicotine Oxidase Gene from Pseudomonas sp. Strain HZN6 Whose Product Nonenantioselectively Degrades Nicotine to Pseudooxynicotine

    PubMed Central

    Qiu, Jiguo; Ma, Yun; Zhang, Jing; Wen, Yuezhong


    Pseudomonas sp. strain HZN6 utilizes nicotine as its sole source of carbon, nitrogen, and energy. However, its catabolic mechanism has not been elucidated. In this study, self-formed adaptor PCR was performed to amplify the upstream sequence of the pseudooxynicotine amine oxidase gene. A 1,437-bp open reading frame (designated nox) was found to encode a nicotine oxidase (NOX) that shows 30% amino acid sequence identity with 6-hydroxy-l-nicotine oxidase from Arthrobacter nicotinovorans. The nox gene was cloned into a broad-host-range cloning vector and transferred into the non-nicotine-degrading bacteria Escherichia coli DH5? (DH-nox) and Pseudomonas putida KT2440 (KT-nox). The transconjugant KT-nox obtained nicotine degradation ability and yielded an equimolar amount of pseudooxynicotine, while DH-nox did not. Reverse transcription-PCR showed that the nox gene is expressed in both DH5? and KT2440, suggesting that additional factors required for nicotine degradation are present in a Pseudomonas strain(s), but not in E. coli. The mutant of strain HZN6 with nox disrupted lost the ability to degrade nicotine, but not pseudooxynicotine. These results suggested that the nox gene is responsible for the first step of nicotine degradation. The (RS)-nicotine degradation results showed that the two enantiomers were degraded at approximately the same rate, indicating that NOX does not show chiral selectivity. Site-directed mutagenesis revealed that both the conserved flavin adenine dinucleotide (FAD)-binding GXGXXG motif and His456 are essential for nicotine degradation activity. PMID:23335761

  6. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko


    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  7. Water stress enhances expression of genes encoding plastid terminal oxidase and key components of chlororespiration and alternative respiration in soybean seedlings.


    Sun, Xin; Yang, Cui-Qin; Wen, Tao; Zeng, Fu-Chun; Wang, Qiang; Yang, Wen-Yu; Lin, Hong-Hui


    Plastid terminal oxidase (PTOX) is a plastid-localized plastoquinone (PQ) oxidase in plants. It functions as the terminal oxidase of chlororespiration, and has the potential ability to regulate the redox state of the PQ pool. Expression of the PTOX gene was up-regulated in soybean seedlings after exposure to water deficit stress for 6 h. Concomitantly expression of the NDH-H gene, encoding a component of the NADPH dehydrogenase (NDH) complex which is a key component of both chlororespiration and NDH-dependent cyclic electron transfer (CET), was also up-regulated. Transcript levels of the proton gradient regulation (PGR5) gene, which encodes an essential component of the PGR5-dependent CET, were not affected by water stress, while the expression of the alternative oxidase (AOX1) gene, which encodes a terminal oxidase of alternative respiration in mitochondria, was also up-regulated under water stress. Therefore, our results indicate that water stress induced the up-regulation of genes encoding key components of chlororespiration and alternative respiration. Transcript levels of the AOX1 gene began to increase in response to water stress before those of PTOX suggesting that alternative respiration may react faster to water stress than chlororespiration. PMID:25265850

  8. Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.


    Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence


    Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. PMID:24947769

  9. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David


    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  10. Five TGA "stop" codons occur within the translated sequence of the yeast mitochondrial gene for cytochrome c oxidase subunit II.


    Fox, T D


    A mitochondrial mutation that genetically maps in the middle of the gene coding cytochrome c oxidase subunit II has been found to be a single-base-pair deletion. Three independently isolated spontaneous revertants of this mutant have different single-base-pair insertions within 15 nucleotides of the mutation. These findings clearly identify the location of the gene and suggest that the mutation causes a frame-shift. The sequence of about 900 base pairs surrounding the mutation has been determined and found to have several chain termination codons in every possible reading frame. The sequence can, however, be translated in one frame by assuming that the codon TGA does not cause chain termination in yeast mitochondira, as was recently suggested for the human organelle [Barrell, B. G., Bankier, A. T. & Drouin, J. (1979) Nature (London), in press]. If TGA codes for tryptophan residues, as is apparently the case in human mitochondria, a polypeptide can be read from the yeast mtDNA that is identical to bovine cytochrome oxidase subunit II at 37.8% of its residues. Furthermore, the DNA sequences of the frame-shift revertants discussed above predict relative isolectric point differences between the wild-type and various revertant forms of the polypeptide. The detection of these isolectric point differences by two-dimensional electrophoresis of subunit II from the various strains independently confirms the presumed reading frame of the gene. It is concluded that TGA is translated in yeast mitochondria, most probably as tryptophan. PMID:230513

  11. Five TGA stop codons occur within the translated sequence of the yeast mitochondrial gene for cytochrome c oxidase subunit II

    PubMed Central

    Fox, Thomas D.


    A mitochondrial mutation that genetically maps in the middle of the gene coding cytochrome c oxidase subunit II has been found to be a single-base-pair deletion. Three independently isolated spontaneous revertants of this mutant have different single-base-pair insertions within 15 nucleotides of the mutation. These findings clearly identify the location of the gene and suggest that the mutation causes a frame-shift. The sequence of about 900 base pairs surrounding the mutation has been determined and found to have several chain termination codons in every possible reading frame. The sequence can, however, be translated in one frame by assuming that the codon TGA does not cause chain termination in yeast mitochondira, as was recently suggested for the human organelle [Barrell, B. G., Bankier, A. T. & Drouin, J. (1979) Nature (London), in press]. If TGA codes for tryptophan residues, as is apparently the case in human mitochondria, a polypeptide can be read from the yeast mtDNA that is identical to bovine cytochrome oxidase subunit II at 37.8% of its residues. Furthermore, the DNA sequences of the frame-shift revertants discussed above predict relative isolectric point differences between the wild-type and various revertant forms of the polypeptide. The detection of these isolectric point differences by two-dimensional electrophoresis of subunit II from the various strains independently confirms the presumed reading frame of the gene. It is concluded that TGA is translated in yeast mitochondria, most probably as tryptophan. Images PMID:230513

  12. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  13. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.


    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo


    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  14. Diversity of laccase-coding genes in Fusarium oxysporum genomes

    PubMed Central

    Kwiatos, Natalia; Ryngaj??o, Ma?gorzata; Bielecki, Stanis?aw


    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  15. A newly identified fatty alcohol oxidase gene is mainly responsible for the oxidation of long-chain ?-hydroxy fatty acids in Yarrowia lipolytica.


    Gatter, Michael; Frster, Andr; Br, Kati; Winter, Miriam; Otto, Christina; Petzsch, Patrick; Jekov, Michaela; Bahr, Katrin; Pfeiffer, Melanie; Matthus, Falk; Barth, Gerold


    Nine potential (fatty) alcohol dehydrogenase genes and one alcohol oxidase gene were identified in Yarrowia lipolytica by comparative sequence analysis. All relevant genes were deleted in Y.lipolytica H222?P which is lacking ?-oxidation. Resulting transformants were tested for their ability to accumulate ?-hydroxy fatty acids and dicarboxylic acids in the culture medium. The deletion of eight alcohol dehydrogenase genes (FADH, ADH1-7), which may be involved in ?-oxidation, led only to a slightly increased accumulation of ?-hydroxy fatty acids, whereas the deletion of the fatty alcohol oxidase gene (FAO1), which has not been described yet in Y.lipolytica, exhibited a considerably higher effect. The combined deletion of the eight (fatty) alcohol dehydrogenase genes and the alcohol oxidase gene further reduced the formation of dicarboxylic acids. These results indicate that both (fatty) alcohol dehydrogenases and an alcohol oxidase are involved in ?-oxidation of long-chain fatty acids whereby latter plays the major role. This insight marks the first step toward the biotechnological production of long-chain ?-hydroxy fatty acids with the help of the nonconventional yeast Y.lipolytica. The overexpression of FAO1 can be further used to improve existing strains for the production of dicarboxylic acids. PMID:24931727

  16. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan


    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  17. The copper-iron connection in biology: Structure of the metallo-oxidase Fet3p

    SciTech Connect

    Taylor, A. B.; Stoj, C. S.; Ziegler, L.; Kosman, D. J.; Hart, P. J.


    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O2 to H2O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase.

  18. The copper-iron connection in biology: Structure of the metallo-oxidase Fet3p

    PubMed Central

    Taylor, Alexander B.; Stoj, Christopher S.; Ziegler, Lynn; Kosman, Daniel J.; Hart, P. John


    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O2 to H2O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase. PMID:16230618

  19. The copper-iron connection in biology: structure of the metallo-oxidase Fet3p.


    Taylor, Alexander B; Stoj, Christopher S; Ziegler, Lynn; Kosman, Daniel J; Hart, P John


    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O(2) to H(2)O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase. PMID:16230618

  20. Environmental factors shaping the abundance and distribution of laccase-encoding bacterial community with potential phenolic oxidase capacity during composting.


    Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Guo, Jinsong; Zhang, Jiachao; Chen, Ming; Wu, Haipeng; Yuan, Yujie; He, Xiaoxiao; He, Yan


    Increasing molecular evidence points to a wide occurrence of laccase-like multicopper oxidase (LMCO)-encoding genes in bacteria. Most researches mainly focused on the bacterial LMCO diversity, whereas the processes and the environmental factors responsible for structuring bacterial LMCO communities remain relatively unknown in a composting system. Six gene libraries were constructed from samples in representative stages during composting. A total of 185 sequences obtained from sample DNA extracts were classified to 59 operational taxonomic units (OTUs) based on 10 % cutoff. The distribution profile of bacterial LMCO genes showed that proteobacterial- and actinobacterial-associated species were the dominant communities during composting. Pearson correlation analysis indicated that the pile temperature and water-soluble carbon (WSC) content were significantly positively correlated with bacterial LMCO gene OTU numbers, Chao1 and Shannon index, whereas the humic acid (HA)-like carbon content had the most significant effect on the distribution of the bacterial LMCO genes during composting by redundancy analysis. These findings will improve the understanding of the mutual relationship between environmental factors and bacterial LMCO community compositions in composting. PMID:26104868

  1. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.


    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  2. An operon containing the genes for cholesterol oxidase and a cytochrome P-450-like protein from a Streptomyces sp.

    PubMed Central

    Horii, M; Ishizaki, T; Paik, S Y; Manome, T; Murooka, Y


    The nucleotide sequence of the promoter region of the gene for cholesterol oxidase (choA) from Streptomyces sp. strain SA-COO was determined. We found an open reading frame (choP) that is located between a potential promoter sequence and the structural gene for the ChoA protein. Deletion analysis showed that the promoter region for choP is essential for expression of the choA gene. Mappings of S1 nuclease and primer extension of transcripts generated in vivo suggested that the synthesis of mRNA starts at a site 41 bases upstream from the ATG initiation codon of the choP gene. By Northern (RNA) blot analysis of the transcripts, we found a 2.9-kilobase transcript that is identical in size to the total sequence of the choP and choA genes. These results suggest that the two genes, choP and choA, are transcribed polycistronically under the control of the promoter that is upstream from the structural gene for choP. The choP gene encodes a protein of 381 amino acids with a calculated Mr of 41,668. The nucleotide sequence of the choP gene has a high degree of similarity to the sequence of the genes for cytochrome P-450s from humans and Pseudomonas species. A region of homology with the cytochrome P-450s from various organisms was identified in the choP protein and may represent a region associated with a binding site for heme iron. Analysis of the CO difference spectrum of an extract of Streptomyces lividans cells that carry a plasmid which includes the choP gene revealed a unique peak, characteristic of cytochrome P-450, which is identical to that obtained with the parent strain. Images PMID:2361941

  3. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID:25018760

  4. Genomic sequence and organization of the human gene for Cytochrome c oxidase subunit (COX7A1) VIIa-M

    SciTech Connect

    Wolz, W.; Kress, W.; Mueller, C.R.


    Cytochrome c oxidase (COX, EC, the last component of the mitochondrial electron transfer chain, is built up by 13 polypeptides; 3 of them are encoded by the mitochondrial genome while the 10 smaller subunits are encoded subunits occur in two different tissue-specific isoforms, a constitutive {open_quotes}L{close_quotes}-form and an {open_quotes}M{close_quotes}-form specific for skeletal and heart muscle. In this article, we describe the genomic sequence and organization of the human gene for COX subunit VIIa-M (COX7A1) located on chromosome 19q13.1 and compare it to its bovine homologue. The coding region of the gene extends over 1.45 kb of genomic sequence, organized in four exons. Intron-exon boundaries are well conserved between cattle and humans. Although it is a gene for a tissue-specific isoform, it has some features of a housekeeping gene: it is located in a CpG island, like it bovine homologue, and no TATA or CCAAT boxes were found in the 5{prime} flanking sequence. Southern hybridization of COX7A1 to human genomic DNA revealed no pseudogenes. Putative binding sites for ubiquitous transcription factors like Sp1 and specific expression in skeletal as well as in heart muscle have been found. In contrast to the bovine gene, the human gene contains putative binding sites for nuclear respiratory factor 2 (NRF-2), which is implicated in the activation of other respiratory enzymes. Therefore, the human and the bovine genes, although well conserved in their coding regions, could differ in the tissue-specific regulation of gene expression. Knowledge of the gene structure will facilitate the analysis of the involvement of subunit VIIa in mitochondrial myopathies and may provide clues to the function of this subunit in a multicomponent enzyme. 25 refs., 2 figs.

  5. Knockdown of the Rhipicephalus microplus cytochrome c oxidase subunit III gene is associated with a failure of Anaplasma marginale transmission.


    Bifano, Thais D; Ueti, Massaro W; Esteves, Eliane; Reif, Kathryn E; Braz, Glria R C; Scoles, Glen A; Bastos, Reginaldo G; White, Stephen N; Daffre, Sirlei


    Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to nave animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to nave calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

  6. Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission

    PubMed Central

    Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei


    Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

  7. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre


    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit PMID:24383965

  8. Evolutionary Dynamics of the Human NADPH Oxidase Genes CYBB, CYBA, NCF2, and NCF4: Functional Implications

    PubMed Central

    Tarazona-Santos, Eduardo; Magalhes, Wagner C.S.; Chen, Renee; Lyon, Fernanda; Burdett, Laurie; Crenshaw, Andrew; Fabbri, Cristina; Pereira, Latife; Pinto, Laelia; Redondo, Rodrigo A.F.; Sestanovich, Ben; Yeager, Meredith; Chanock, Stephen J.


    The phagocyte NADPH oxidase catalyzes the reduction of O2 to reactive oxygen species with microbicidal activity. It is composed of two membrane-spanning subunits, gp91-phox and p22-phox (encoded by CYBB and CYBA, respectively), and three cytoplasmic subunits, p40-phox, p47-phox, and p67-phox (encoded by NCF4, NCF1, and NCF2, respectively). Mutations in any of these genes can result in chronic granulomatous disease, a primary immunodeficiency characterized by recurrent infections. Using evolutionary mapping, we determined that episodes of adaptive natural selection have shaped the extracellular portion of gp91-phox during the evolution of mammals, which suggests that this region may have a function in host-pathogen interactions. On the basis of a resequencing analysis of approximately 35 kb of CYBB, CYBA, NCF2, and NCF4 in 102 ethnically diverse individuals (24 of African ancestry, 31 of European ancestry, 24 of Asian/Oceanians, and 23 US Hispanics), we show that the pattern of CYBA diversity is compatible with balancing natural selection, perhaps mediated by catalase-positive pathogens. NCF2 in Asian populations shows a pattern of diversity characterized by a differentiated haplotype structure. Our study provides insight into the role of pathogen-driven natural selection in an innate immune pathway and sheds light on the role of CYBA in endothelial, nonphagocytic NADPH oxidases, which are relevant in the pathogenesis of cardiovascular and other complex diseases. PMID:23821607

  9. Nitric oxide mediated amelioration of arsenic toxicity which alters the alternative oxidase (Aox1) gene expression in Hordeum vulgare L.


    Shukla, Pratiksha; Singh, Shalini; Dubey, Pragyan; Singh, Aradhana; Singh, A K


    The role of nitric oxide (NO) as a key molecule in the signal transduction pathway of a biotic stress response has already been described. Recent studies indicate that it also participate in the signaling of abiotic stresses. In the present study, we showed the altered expression of stress responsive gene alternative oxidase (Aox1) in seedlings of barley (Hordeum vulgare L.) in response to arsenic toxicity. Arsenic toxicity decreased the germination percentage, biomass, chlorophyll and carotenoid content whereas, arsenic toxicity enhanced the MDA content and proline content in a dose dependent manner. Other enzyme activities like catalase and superoxide dismutase increased with the increase in concentrations but it fell down at higher concentration of arsenic. Pretreatment of nitric oxide results in the enhanced expression of alternative oxidase which showed the adaptation of alternative pathway during the arsenic stress and it also enhances the growth ability and adaptability towards the arsenic stress. The results support the conclusion that nitric oxide ameliorates the arsenic toxicity not only at the level of antioxidant defense but also by affecting other mechanism of detoxification. PMID:26036416

  10. Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

    PubMed Central

    Gonzlez-Guzmn, Miguel; Abia, David; Salinas, Julio; Serrano, Ramn; Rodrguez, Pedro L.


    The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

  12. A restriction fragment length polymorphism results in a nonconservative amino acid substitution encoded within the first exon of the human lysyl oxidase gene

    SciTech Connect

    Csiszar, K.; Mariani, T.J.; Gosin, J.S.; Deak, S.B.; Boyd, C.D.


    A cDNA covering most of the coding sequence for human lysyl oxidase was used to screen, by Southern blot analysis, genomic DNA from circulating lymphocytes obtained from unrelated, apparently normal individuals. A heritable restriction fragment length polymorphism (RFLP) within a PstI restriction site was detected in 36% of individuals screened (a total of 72 chromosomes were analyzed). The major allele was represented as a 1.7-kb PstI restriction fragment. The minor allele was detected as 1.4 and 0.3kb restriction fragments. Lambda phage-DNA recombinants were isolated from a human lung fibroblast genomic DNA library using the human lysyl oxidase cDNA clone. DNA sequence analysis of several selected phage recombinants revealed that 83% of the coding sequence of lysyl oxidase was localized in four separate exons. Analysis of the coding sequence within exon 1, the most 5{prime} exon within the lysyl oxidase gene, revealed that the PstI RFLP was due to a G {r_arrow} A transition resulting in a nonconservative arginine to glutamine substitution proximal to a propeptide cleavage domain encoded by exon 1 of the lysyl oxidase gene. 33 refs., 5 figs., 1 tab.

  13. Identification of a gene essential for protoporphyrinogen IX oxidase activity in the cyanobacterium Synechocystis sp. PCC6803

    PubMed Central

    Kato, Kazushige; Tanaka, Ryouichi; Sano, Shinsuke; Tanaka, Ayumi; Hosaka, Hideo


    Protoporphyrinogen oxidase (Protox) catalyses the oxidation of protoporphyrinogen IX to protoporphyrin IX during the synthesis of tetrapyrrole molecules. Protox is encoded by the hemY gene in eukaryotes and by the hemG gene in many ?-proteobacteria, including Escherichia coli. It has been suggested that other bacteria possess a yet unidentified type of Protox. To identify a unique bacterial gene encoding Protox, we first introduced the Arabidopsis hemY gene into the genome of the cyanobacterium, Synechocystis sp. PCC6803. We subsequently mutagenized the cells by transposon tagging and screened the tagged lines for mutants that were sensitive to acifluorfen, which is a specific inhibitor of the hemY-type Protox. Several cell lines containing the tagged slr1790 locus exhibited acifluorfen sensitivity. The slr1790 gene encodes a putative membrane-spanning protein that is distantly related to the M subunit of NADH dehydrogenase complex I. We attempted to disrupt this gene in the wild-type background of Synechocystis, but we were only able to obtain heteroplasmic disruptants. These cells accumulated a substantial amount of protoporphyrin IX, suggesting that the slr1790 gene is essential for growth and Protox activity of cells. We found that most cyanobacteria and many other bacteria possess slr1790 homologs. We overexpressed an slr1790 homolog of Rhodobacter sphaeroides in Escherichia coli and found that this recombinant protein possesses Protox activity in vitro. These results collectively demonstrate that slr1790 encodes a unique Protox enzyme and we propose naming the slr1790 gene hemJ. PMID:20823222


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Effects of the synthetic auxin 2,4-dichlorophenoxy-propionic acid (2,4-DP) on 1-aminocyclopropane-1-carboxylate (ACC) synthase and oxidase gene expression by La France and aroma production by Bartlett pears (Pyrus communis L.) were investigated. In non-stored, non-treated LaFrance fruit, the ...

  15. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).


    Wang, Wei; Liu, Ji-Hong


    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  16. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.


    Rathinam, T; Gadde, U; Chapman, H D


    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70%) of the farms while 9 (30%) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7%) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  17. Molecular characterization of fire ants, Solenopsis spp., from Brazil based on analysis of mtDNA gene cytochrome oxidase I.


    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa


    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  18. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central


    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes contributed to browning reactions in tuber tissues but their effect was not equal. Different PPO genes may be regulated independently reflecting their diversified functions. Our results show that amiRNAs can be used to suppress closely related members of highly conserved multi-gene family. This approach also suggests a new strategy for breeding low-browning crops using small DNA inserts. PMID:24618103

  19. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.


    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muoz, Nama; Driss, Fathi; Sanchez, Manuel; Fumeron, Frdric; Roussel, Ronan; Hadjadj, Samy; Corra-Giannella, Maria Lcia; Marre, Michel; Velho, Gilberto


    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with a role for NADPH oxidase in the pathophysiology of kidney complications of diabetes. PMID:25862415

  20. Expression of a Streptomyces 3-hydroxysteroid oxidase gene in oilseeds for converting phytosterols to phytostanols.


    Venkatramesh, Mylavarapu; Karunanandaa, Balasulojini; Sun, Bin; Gunter, Catharine A; Boddupalli, Sekhar; Kishore, Ganesh M


    Plant sterols and their hydrogenated forms, stanols, have attracted much attention because of their benefits to human health in reducing serum and LDL cholesterol levels, with vegetable oil processing being their major source in several food products currently sold. The predominant forms of plant sterol end products are sitosterol, stigmasterol, campesterol and brassicasterol (in brassica). In this study, 3-hydroxysteroid oxidase from Streptomyces hygroscopicus was utilized to engineer oilseeds from rapeseed (Brassica napus) and soybean (Glycine max), respectively, to modify the relative amounts of specific sterols to stanols. Each of the major phytosterols had its C-5 double bond selectively reduced to the corresponding phytostanol without affecting other functionalities, such as the C-22 double bond of stigmasterol in soybean seed and of brassicasterol in rapeseed. Additionally, several novel phytostanols were obtained that are not produced by chemical hydrogenation of phytosterols normally present in plants. PMID:12475617

  1. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.


    Zhou, Yuchan; Underhill, Steven J R


    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  2. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.


    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne


    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. PMID:21838715

  3. High-resolution melting analysis of 15 genes in 60 patients with cytochrome-c oxidase deficiency.


    Vondrackova, Alzbeta; Vesela, Katerina; Hansikova, Hana; Docekalova, Dagmar Zajicova; Rozsypalova, Eva; Zeman, Jiri; Tesarova, Marketa


    Cytochrome-c oxidase (COX) deficiency is one of the common childhood mitochondrial disorders. Mutations in genes for the assembly factors SURF1 and SCO2 are prevalent in children with COX deficiency in the Slavonic population. Molecular diagnosis is difficult because of the number of genes involved in COX biogenesis and assembly. The aim of this study was to screen for mutations in 15 nuclear genes that encode the 10 structural subunits, their isoforms and two assembly factors of COX in 60 unrelated Czech children with COX deficiency. Nine novel variants were identified in exons and adjacent intronic regions of COX4I2, COX6A1, COX6A2, COX7A1, COX7A2 and COX10 using high-resolution melting (HRM) analysis. Online bioinformatics servers were used to predict the importance of the newly identified amino-acid substitutions. The newly characterized variants updated the contemporary spectrum of known genetic sequence variations that are present in the Czech population, which will be important for further targeted mutation screening in Czech COX-deficient children. HRM and predictive bioinformatics methodologies are advantageous because they are low-cost screening tools that complement large-scale genomic studies and reduce the required time and effort. PMID:22592081

  4. Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.


    Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi


    Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. PMID:22162429

  5. The genetic basis of "Scarsdale Gourmet Diet" variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.


    Frank, J; Poh-Fitzpatrick, M B; King, L E; Christiano, A M


    The porphyrias are disorders of porphyrin or porphyrin-precursor metabolism that result from inherited or acquired aberrations in the control of the porphyrin-heme biosynthetic pathway. Variegate porphyria (VP), one of the acute hepatic porphyrias, is characterized by a partial reduction in the activity of protoporphyrinogen oxidase (PPO), and recently, mutations in the PPO gene on chromosome 1q22-23 have been described. Our purpose was to identify the underlying genetic lesion in a severely affected patient with VP and to detect the silent mutation carriers in her family. The disease in this patient was precipitated by carbohydrate restriction as outlined in the "Scarsdale Gourmet Diet". Our mutation detection and confirmation strategy included PCR, automated sequencing, and restriction enzyme digestion. We identified a missense mutation in the patient and five family members. The mutation consisted of a previously unreported C-to-T transition in exon 5 of the PPO gene, resulting in the substitution of arginine by cysteine, designated R152C. This arginine residue is evolutionarily highly conserved in humans, mice, bacteria, yeast, and plants, indicating the importance of this residue in PPO. Our study established that a missense mutation in the PPO gene was the underlying mutation in this patient with VP and explained the occurrence of the phenotype in this family. PMID:9763307

  6. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo


    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  7. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells.


    Zong, Wen; Jiang, Yan; Zhao, Jing; Zhang, Jian; Gao, Jian-gang


    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor ?1 (TGF-?1). Ishikawa cells treated with TGF-?1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-? receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-? signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  8. Cloning, DNA sequence, and complementation analysis of the Salmonella typhimurium hemN gene encoding a putative oxygen-independent coproporphyrinogen III oxidase.

    PubMed Central

    Xu, K; Elliott, T


    Coproporphyrinogen oxidation is a last step in heme biosynthesis. The biochemically characterized eukaryotic coproporphyrinogen III oxidases have an obligate requirement for molecular oxygen, and a similar enzyme is encoded by the hemF gene in Salmonella typhimurium. Anaerobic heme synthesis requires an oxygen-independent coproporphyrinogen oxidase, which is probably encoded by the hemN gene in S. typhimurium. The hemN gene has been cloned from an insertion mutant. The nucleotide sequence was obtained and used for PCR amplification of the wild-type gene. A single open reading frame was identified as the hemN gene on the basis of its interruption by the insertion mutation and plasmid complementation studies of hemF hemN double mutants. The predicted HemN protein has 38% amino acid sequence identity to a putative anaerobic Rhodobacter sphaeroides coproporphyrinogen oxidase. The hemN RNA 5' end and the inferred transcription initiation site were mapped by primer extension. The 52.8-kDa HemN protein is expressed from the second ATG codon of the hemN open reading frame. An open reading frame with an unknown function directly upstream of hemN has a striking amino acid sequence, including 11 acidic residues in a row. Images PMID:8195073

  9. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.


    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  10. Directional substitution and evolution of nucleotide content in the cytochrome oxidase II gene in earwigs (dermapteran insects).


    Wirth, T; Le Guellec, R; Veuille, M


    The cytochrome oxidase subunit II (COII) gene was sequenced for six dermapteran species. The nucleotide composition of this gene is biased in most animals. While the CG content of other insect orders is low (mean, 27.6%; range, 19.5%-33.1%), species from the Forficula genus showed unusually high values (mean, 42.4%; range, 37.3%-44.1%), mostly due to high CG frequencies at third codon positions: the mean CG content at these positions was around 45% (range, 43.9%-46.9%) for Forficula, compared with only 13.3% for other insects. This effect was so strong that in one species, Forficula lesnei, there was no significant difference between the frequencies of the four bases. During evolution, this loss of bias has involved a significant increase in the synonymous substitution rate and an increase of transitions over transversions compared with other insects. A strong directionality of substitutions has favored T-->C and A-->G changes. This phenomenon was also observed between two conspecific populations of Forficula auricularia. A species from a closely related genus, Anechura bipunctata, was intermediate between Forficula and other insects for these parameters, while two remotely related dermapteran species, Labidura riparia and Euborellia moesta, were similar to other insects. These results suggest that the evolution of Forficula DNA content has been both rapid and recent. PMID:10605107

  11. Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity

    PubMed Central

    Shetty, Rohit; Sathyanarayanamoorthy, Arunapriya; Ramachandra, Reshma Airody; Arora, Vishal; Ghosh, Anuprita; Srivatsa, Purnima Raman; Pahuja, Natasha; Nuijts, Rudy M. M. A.; Sinha-Roy, Abhijit; Ghosh, Arkasubhra


    Purpose Keratoconus (KC) is characterized by progressive vision loss due to corneal thinning and structural abnormalities. It is hypothesized that KC is caused by deregulated collagen levels and collagen fibril-maturating enzyme lysyl oxidase (LOX). Further, it is currently not understood whether the gene expression deregulated by the corneal epithelium influences KC pathogenesis. We studied (i) the expressions of the LOX, collagen I (COL IA1), collagen IV (COL IVA1), MMP9, and IL6 genes in KC corneal epithelia, (ii) validated their expression levels in patient tissues, and (iii) correlated expression levels with KC disease severity. The primary goal of this study was to evaluate the importance of these genes in the progression of KC. Methods We analyzed the gene expression levels of the key proteins LOX, collagens (COL IA1 and COL IVA1), MMP9, and IL6 in debrided corneal epithelia from a large cohort of KC patients (90 eyes) and compared them to control patients (52 eyes) without KC. We measured the total LOX activity in the tears of KC patients compared to controls. We also correlated the protein expression levels of LOX and collagens by immunohistochemistry (IHC) in primary tissues from KC patients (27 eyes) undergoing keratoplasty compared to healthy donor corneas (15 eyes). Results We observed a significant reduction in LOX transcript levels in KC corneal epithelia, and LOX activity in KC tears correlated with disease severity. Collagen transcripts were also reduced in KC while MMP9 transcript levels were upregulated and correlated with disease severity. IL6 was moderately increased in KC patients. IHC demonstrated a reduction in the protein expression levels of LOX in the epithelium and collagen IV in the basement membrane of KC patients compared to healthy donor corneas. Conclusions The data demonstrates that the structural deformity of the KC cornea may be dependent on reduced expressions of collagens and LOX, as well as on MMP9 elevated by the corneal epithelium. PMID:25593510

  12. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min


    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  13. The P450-4 gene of Gibberella fujikuroi encodes ent-kaurene oxidase in the gibberellin biosynthesis pathway.


    Tudzynski, B; Hedden, P; Carrera, E; Gaskin, P


    At least five genes of the gibberellin (GA) biosynthesis pathway are clustered on chromosome 4 of Gibberella fujikuroi; these genes encode the bifunctional ent-copalyl diphosphate synthase/ent-kaurene synthase, a GA-specific geranylgeranyl diphosphate synthase, and three cytochrome P450 monooxygenases. We now describe a fourth cytochrome P450 monooxygenase gene (P450-4). Gas chromatography-mass spectrometry analysis of extracts of mycelia and culture fluid of a P450-4 knockout mutant identified ent-kaurene as the only intermediate of the GA pathway. Incubations with radiolabeled precursors showed that the metabolism of ent-kaurene, ent-kaurenol, and ent-kaurenal was blocked in the transformants, whereas ent-kaurenoic acid was metabolized efficiently to GA(4). The GA-deficient mutant strain SG139, which lacks the 30-kb GA biosynthesis gene cluster, converted ent-kaurene to ent-kaurenoic acid after transformation with P450-4. The B1-41a mutant, described as blocked between ent-kaurenal and ent-kaurenoic acid, was fully complemented by P450-4. There is a single nucleotide difference between the sequence of the B1-41a and wild-type P450-4 alleles at the 3' consensus sequence of intron 2 in the mutant, resulting in reduced levels of active protein due to a splicing defect in the mutant. These data suggest that P450-4 encodes a multifunctional ent-kaurene oxidase catalyzing all three oxidation steps between ent-kaurene and ent-kaurenoic acid. PMID:11472927

  14. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.


    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai


    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 ?g/L) in neutral or alkaline springs than in acidic springs (on average 30.88 ?g/L). aioA abundance ranged from 1.63 10(1) to 7.08 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

  15. Characterization of the Regulatory and Expression Context of an Alternative Oxidase Gene Provides Insights into Cyanide-Insensitive Respiration during Growth and Development1[C][W][OA

    PubMed Central

    Ho, Lois H.M.; Giraud, Estelle; Lister, Ryan; Thirkettle-Watts, David; Low, Jasmine; Clifton, Rachel; Howell, Katharine A.; Carrie, Chris; Donald, Tamzin; Whelan, James


    Alternative oxidase (AOX) is encoded in small multigene families in plants. Functional analysis of the Arabidopsis (Arabidopsis thaliana) alternative oxidase 1c (AtAOX1c) promoter, an AOX gene not induced by oxidative stress, indicated that regulation of expression was complex, with the upstream promoter region containing positive and negative response regions. Comparison to the promoter region of soybean (Glycine max) alternative oxidase 2b (GmAOX2b), another AOX gene not induced by oxidative stress, revealed that they contained seven sequence elements in common. All elements were active in the promoter region of AtAOX1c in suspension cells and in leaf tissue from Columbia and mutant plants, where a mitochondrial protein import receptor was inactivated. Analysis of coexpressed and putatively coregulated genes, the latter defined as containing five or more sequence elements functional in AtAOX1c, indicated that AtAOX1c was coregulated with components involved with cell division and growth. Consistent with this analysis, we demonstrated that site II elements, previously shown to regulate the proliferating cell nuclear antigen, are present in the upstream promoter region of AtAOX1c and were strong negative regulators of AtAOX1c expression. It was demonstrated that NDB4, a gene encoding an external NAD(P)H dehydrogenase, displayed strong coexpression with AtAOX1c. Overall, these results indicate that AtAOX1c is regulated by growth and developmental signals. PMID:17322330

  16. Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

    PubMed Central

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elo, Patricia


    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (, has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  17. Molecular identification and phylogenetic relationships of seven Indian Sciaenids (Pisces: Perciformes, Sciaenidae) based on 16S rRNA and cytochrome c oxidase subunit I mitochondrial genes.


    Lakra, Wazir S; Goswami, M; Gopalakrishnan, A


    The partial sequences of 16S rRNA and cytochrome c oxidase subunit I (COI) mitochondrial genes were analyzed for species identification and phylogenetic relationships among the commercially important Indian sciaenids (Otolithes cuvieri, Otolithes ruber, Johnius dussumieri, Johnius elongatus, Johnieops vogleri, Otolithoides biauritus and Protonibea diacanthus). Sequence analysis of both genes revealed that the seven species fell into three distinct groups, which were genetically distant from each other and exhibited identical phylogenetic resolution. Partial sequences of both the genes provided sufficient phylogenetic information to distinguish the seven sciaenids indicating the usefulness of mtDNA-based approach in species identification. PMID:18415704

  18. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression.


    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra


    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

  19. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

    PubMed Central

    Mackov, Hana; Hronkov, Marie; Dobr, Jana; Ture?kov, Veronika; Novk, Ond?ej; Lubovsk, Zuzana; Motyka, Vclav; Haisel, Daniel; Hjek, Tom; Pril, Ilja Tom; Gaudinov, Alena; torchov, Helena; Ge, Eva; Werner, Tom; Schmlling, Thomas; Vankov, Radomra


    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

  20. Disease resistance conferred by expression of a gene encoding H2O2-generating glucose oxidase in transgenic potato plants.

    PubMed Central

    Wu, G; Shortt, B J; Lawrence, E B; Levine, E B; Fitzsimmons, K C; Shah, D M


    Plant defense responses to pathogen infection involve the production of active oxygen species, including hydrogen peroxide (H2O2). We obtained transgenic potato plants expressing a fungal gene encoding glucose oxidase, which generates H2O2 when glucose is oxidized. H2O2 levels were elevated in both leaf and tuber tissues of these plants. Transgenic potato tubers exhibited strong resistance to a bacterial soft rot disease caused by Erwinia carotovora subsp carotovora, and disease resistance was sustained under both aerobic and anaerobic conditions of bacterial infection. This resistance to soft rot was apparently mediated by elevated levels of H2O2, because the resistance could be counteracted by exogenously added H2O2-degrading catalase. The transgenic plants with increased levels of H2O2 also exhibited enhanced resistance to potato late blight caused by Phytophthora infestans. The development of lesions resulting from infection by P. infestans was significantly delayed in leaves of these plants. Thus, the expression of an active oxygen species-generating enzyme in transgenic plants represents a novel approach for engineering broad-spectrum disease resistance in plants. PMID:8589621

  1. Synergistic interaction between semicarbazide-sensitive amine oxidase and angiotensin-converting enzyme in diabetes: functional analysis by gene ontology.


    Wiwanitkit, Viroj


    Plasma semicarbazide-sensitive amine oxidase (SSAO) and angiotensin-converting enzyme (ACE) were studied for their correlation with diabetes (DM) complication. The effect of interaction between SSAO and ACE in DM complication is of interest. Studying the functional change due to interaction between SSAO and ACE is difficult. In this work, the author used a new gene ontology technology to predict the functional change resulting from the interaction between SSAO and ACE. According to this study, there is a synergetic effect resulting from the interaction between SSAP and ACE. This can imply that co-expression of SSAP-ACE leads to more severe complication of DM. However, the author can also demonstrate that some molecular functions such as proteasome activator activity of SSAO and hydrolase activity, metallopeptidase activity, and zinc ion binding of ACE are suppressed after co-expression. These results provide good information for further study in diabetes medicine. However, further experimental works are required to support this in silico research. PMID:18413170

  2. The choline oxidase gene codA confers salt tolerance to transgenic Eucalyptus globulus in a semi-confined condition.


    Yu, Xiang; Kikuchi, Akira; Matsunaga, Etsuko; Morishita, Yoshihiko; Nanto, Kazuya; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa; Watanabe, Kazuo N


    The performance of tree species is influenced by environmental factors and growth stages. To evaluate the practical performance of transgenic tree species, it is insufficient to grow small, young trees under controlled conditions, such as in a growth chamber. Three transgenic Eucalyptus globulus lines, carrying the choline oxidase gene, were investigated for their salt tolerance and expression of the transgene at the young plantlet stage in a special netted-house. To clarify the characteristics at the young as well during the later stages, salt tolerance and the properties of the transgenic lines at large juvenile and adult stages were evaluated in the special netted-house. All transgenic lines showed high glycinebetaine content, particularly in young leaves. Trees of the transgenic line 107-1 showed low damage because of salinity stress based on the results from the chlorophyll analysis and malondialdehyde content, and they survived the high-salt-shock treatment at the large juvenile and adult stages. Only this line showed salt tolerance at all stages in the special netted-house. In this evaluation in the special netted-house, the tolerant line among young plantlets might perform better at all stages. Since evaluation in these special netted-house mimics field evaluation, line 107-1 is a potential tolerant line. PMID:22752644

  3. Diversity of arsenite oxidase gene and arsenotrophic bacteria in arsenic affected Bangladesh soils.


    Sanyal, Santonu Kumar; Mou, Taslin Jahan; Chakrabarty, Ram Prosad; Hoque, Sirajul; Hossain, M Anwar; Sultana, Munawar


    Arsenic (As) contaminated soils are enriched with arsenotrophic bacteria. The present study analyzes the microbiome and arsenotrophic genes-from As affected soil samples of Bhanga, Charvadrason and Sadarpur of Faridpur district in Bangladesh in summer (SFDSL1, 2, 3) and in winter (WFDSL1, 2, 3). Total As content of the soils was within the range of 3.24-17.8 mg/kg as per atomic absorption spectroscopy. The aioA gene, conferring arsenite [As (III)] oxidation, was retrieved from the soil sample, WFDSL-2, reported with As concentration of 4.9 mg/kg. Phylogenetic analysis revealed that the aioA genes of soil WFDSL-2 were distributed among four major phylogenetic lineages comprised of α, β, γ Proteobacteria and Archaea with a dominance of β Proteobacteria (56.67 %). An attempt to enrich As (III) metabolizing bacteria resulted 53 isolates. ARDRA (amplified ribosomal DNA restriction analysis) followed by 16S rRNA gene sequencing of the 53 soil isolates revealed that they belong to six genera; Pseudomonas spp., Bacillus spp., Brevibacillus spp., Delftia spp., Wohlfahrtiimonas spp. and Dietzia spp. From five different genera, isolates Delftia sp. A2i, Pseudomonas sp. A3i, W. chitiniclastica H3f, Dietzia sp. H2f, Bacillus sp. H2k contained arsB gene and showed arsenite tolerance up-to 27 mM. Phenotypic As (III) oxidation potential was also confirmed with the isolates of each genus and isolate Brevibacillus sp. A1a showed significant As (III) transforming potential of 0.2425 mM per hour. The genetic information of bacterial arsenotrophy and arsenite oxidation added scientific information about the possible bioremediation potential of the soil isolates in Bangladesh. PMID:26980601

  4. Current issues in species identification for forensic science and the validity of using the cytochrome oxidase I (COI) gene.


    Wilson-Wilde, Linzi; Norman, Janette; Robertson, James; Sarre, Stephen; Georges, Arthur


    Species identification techniques commonly utilized in Australian Forensic Science laboratories are gel immunodifussion antigen antibody reactions and hair comparison analysis. Both of these techniques have significant limitations and should be considered indicative opinion based tests. The Barcode of Life Initiative aims to sequence a section of DNA (~648 base pairs) for the Cytochrome Oxidase I mitochondrial gene (COI) in all living species on Earth, with the data generated being uploaded to the Barcode of Life Database (BOLD) which can then be used for species identification. The COI gene therefore offers forensics scientists an opportunity to use the marker to analyze unknown samples and compare sequences generated in BOLD. Once sequences from enough species are on the database, it is anticipated that routine identification of an unknown species may be possible. However, most forensic laboratories are not yet suited to this type of analysis and do not have the expertise to fully interpret the implications of matches and non matches involving a poorly sampled taxa (for example where there are cryptic species) and in providing the required opinion evidence. Currently, the use of BOLD is limited by the number of relevant species held in the database and the quality assurance and regulation of sequences that are there. In this paper, the COI methodology and BOLD are tested on a selection of introduced and Australian mammals in a forensic environment as the first step necessary in the implementation of this approach in the Australian context. Our data indicates that the COI methodology performs well on distinct species but needs further exploration when identifying more closely related species. It is evident from our study that changes will be required to implement DNA based wildlife forensics using the BOLD approach for forensic applications and recommendations are made for the future adoption of this technology into forensic laboratories. PMID:20563888

  5. Reconstructing Mammalian Phylogenies: A Detailed Comparison of the Cytochrome b and Cytochrome Oxidase Subunit I Mitochondrial Genes

    PubMed Central

    Tobe, Shanan S.; Kitchener, Andrew C.; Linacre, Adrian M. T.


    The phylogeny and taxonomy of mammalian species were originally based upon shared or derived morphological characteristics. However, genetic analyses have more recently played an increasingly important role in confirming existing or establishing often radically different mammalian groupings and phylogenies. The two most commonly used genetic loci in species identification are the cytochrome oxidase I gene (COI) and the cytochrome b gene (cyt b). For the first time this study provides a detailed comparison of the effectiveness of these two loci in reconstructing the phylogeny of mammals at different levels of the taxonomic hierarchy in order to provide a basis for standardizing methodologies in the future. Interspecific and intraspecific variation is assessed and for the first time, to our knowledge, statistical confidence is applied to sequence comparisons. Comparison of the DNA sequences of 217 mammalian species reveals that cyt b more accurately reconstructs their phylogeny and known relationships between species based on other molecular and morphological analyses at Super Order, Order, Family and generic levels. Cyt b correctly assigned 95.85% of mammal species to Super Order, 94.31% to Order and 98.16% to Family compared to 78.34%, 93.36% and 96.93% respectively for COI. Cyt b also gives better resolution when separating species based on sequence data. Using a Kimura 2-parameter p-distance (x100) threshold of 1.5–2.5, cyt b gives a better resolution for separating species with a lower false positive rate and higher positive predictive value than those of COI. PMID:21152400

  6. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.


    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M


    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  7. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.


    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  8. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )


    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  9. Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.


    Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P


    Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3?-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth. PMID:23979969

  10. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.


    He, X Y; He, Z H; Zhang, L P; Sun, D J; Morris, C F; Fuerst, E P; Xia, X C


    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the present study, complete genomic DNA sequences of two PPO genes, one each located on chromosomes 2A and 2D and their allelic variants were characterized by means of in silico cloning and experimental validation. Sequences were aligned at both DNA and protein levels. Two haplotypes on chromosome 2D showed 95.2% sequence identity at the DNA level, indicating much more sequence diversity than those on chromosome 2A with 99.6% sequence identity. Both of the PPO genes on chromosomes 2A and 2D contain an open reading frame (ORF) of 1,731 bp, encoding a PPO precursor peptide of 577 amino acids with a predicted molecular mass of approximately 64 kD. Two complementary dominant STS markers, PPO16 and PPO29, were developed based on the PPO gene haplotypes located on chromosome 2D; they amplify a 713-bp fragment in cultivars with low PPO activity and a 490-bp fragment in those with high PPO activity, respectively. The two markers were mapped on chromosome 2DL using a doubled haploid population derived from the cross Zhongyou 9507/CA9632, and a set of nullisomic-tetrasomic lines and ditelosomic line 2DS of Chinese Spring. QTL analysis indicated that the PPO gene co-segregated with the two STS markers and was closely linked to SSR marker Xwmc41 on chromosome 2DL, explaining from 9.6 to 24.4% of the phenotypic variance for PPO activity across three environments. In order to simultaneously detect PPO loci on chromosomes 2A and 2D, a multiplexed marker combination PPO33/PPO16 was developed and yielded distinguishable DNA patterns in a number of cultivars. The STS marker PPO33 for the PPO gene on chromosome 2A was developed from the same gene sequences as PPO18 that we reported previously, and can amplify a 481-bp and a 290-bp fragment from cultivars with low and high PPO activity, respectively. A total of 217 Chinese wheat cultivars and advanced lines were used to validate the association between the polymorphic fragments and grain PPO activity. The results showed that the marker combination PPO33/PPO16 is efficient and reliable for evaluating PPO activity and can be used in wheat breeding programs aimed for noodle and other end product quality improvement. PMID:17426955

  11. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.


    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  12. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T


    Urate oxidase, or uricase (EC, is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  13. Cloning and expression in Escherichia coli of the D-aspartate oxidase gene from the yeast Cryptococcus humicola and characterization of the recombinant enzyme.


    Takahashi, Shouji; Takahashi, Toshiyuki; Kera, Yoshio; Matsunaga, Ryuji; Shibuya, Hiroo; Yamada, Ryo-hei


    The D-aspartate oxidase (DDO) from the yeast Cryptococcus humicola UJ1 (ChDDO) is highly specific to D-aspartate. The gene encoding ChDDO was cloned and expressed in Escherichia coli. Sequence analysis of the ChDDO gene showed that an open reading frame of 1,110 bp interrupted by two introns encodes a protein of 370 amino acids. The deduced amino acid sequence showed an FAD-binding motif and a peroxisomal targeting signal 1 in the N-terminal region and at the C-terminus, respectively, and also the presence of certain catalytically important amino acid residues corresponding to those catalytically important in D-amino acid oxidase (DAO). The sequence exhibited only a moderate identity to human (27.4%) and bovine (28.0%) DDOs, and a rather higher identity to yeast and fungal DAOs (30.4-33.2%). Similarly, phylogenetic analysis showed that ChDDO is more closely related to yeast and fungal DAOs than to mammalian DDOs. The gene expression was regulated at the transcriptional level and specifically induced by the presence of D-aspartate as the sole nitrogen source. ChDDO was expressed in an active form in E. coli to an approximately 5-fold greater extent than in yeast. The purified recombinant enzyme was identical to the native enzyme in physicochemical and catalytic properties. PMID:15115779

  14. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.


    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua


    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-?m plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  15. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua


    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  16. Cytochrome c oxidase subunit III (COX3) gene, an informative marker for phylogenetic analysis and differentiation of Babesia species in China.


    Tian, Zhancheng; Liu, Guangyuan; Yin, Hong; Luo, Jianxun; Guan, Guiquan; Xie, Junren; Luo, Jin; Zheng, Jinfeng; Tian, Meiyuan; Yuan, Xiaosong; Wang, Fangfang; Chen, Ronggui; Wang, Haijun


    In this study a 552-bp region of the cytochrome c oxidase subunit III (COX3) was amplified by polymerase chain reaction (PCR) and sequenced from individual Babesia species. Sequence variation between Babesia species from China ranged between 0 and 32.4%. We analyzed the phylogenetic performance of the partial sequence of the COX3 gene to resolve Babesia relationships as compared to the nuclear 18S rRNA and the mitochondrial cytochrome b (COB) gene, These data indicate that the COX3 gene seems to be superior to the COB gene and the 18S rRNA in recognizing close lineages among some Babesia species. Our work indicates that the COX3 gene does complement and corroborate the phylogenetic inferences observed with the nuclear 18S rRNA and the COB gene previously reported. The combined phylogenetic analysis based on the nuclear 18S rRNA and the COX3 gene significantly improved (bootstrap) intraspecies support of the phylogenetic relationship. The presence of additional variable sites in the COX3 gene allowed an improved interspecies differentiation of Babesia species in this study. The data could be applicable for the survey of parasite dynamics, epidemiological studies as well as prevention and control of the disease. PMID:23619098

  17. Study on dioxygen reduction by mutational modifications of the hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase

    SciTech Connect

    Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige; Sakurai, Takeshi


    Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The single turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.

  18. Overexpression of a Maize Sulfite Oxidase Gene in Tobacco Enhances Tolerance to Sulfite Stress via Sulfite Oxidation and CAT-Mediated H2O2 Scavenging

    PubMed Central

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu


    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO2/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E.coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H2O2 accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  19. Oxygen Reactivity of Both Respiratory Oxidases in Campylobacter jejuni: the cydAB Genes Encode a Cyanide-Resistant, Low-Affinity Oxidase That Is Not of the Cytochrome bd Type?

    PubMed Central

    Jackson, Rachel J.; Elvers, Karen T.; Lee, Lucy J.; Gidley, Mark D.; Wainwright, Laura M.; Lightfoot, James; Park, Simon F.; Poole, Robert K.


    The microaerophilic bacterium Campylobacter jejuni is a significant food-borne pathogen and is predicted to possess two terminal respiratory oxidases with unknown properties. Inspection of the genome reveals an operon (cydAB) apparently encoding a cytochrome bd-like oxidase homologous to oxidases in Escherichia coli and Azotobacter vinelandii. However, C. jejuni cells lacked all spectral signals characteristic of the high-spin hemes b and d of these oxidases. Mutation of the cydAB operon of C. jejuni did not have a significant effect on growth, but the mutation reduced formate respiration and the viability of cells cultured in 5% oxygen. Since cyanide resistance of respiration was diminished in the mutant, we propose that C. jejuni CydAB be renamed CioAB (cyanide-insensitive oxidase), as in Pseudomonas aeruginosa. We measured the oxygen affinity of each oxidase, using a highly sensitive assay that exploits globin deoxygenation during respiration-catalyzed oxygen uptake. The CioAB-type oxidase exhibited a relatively low affinity for oxygen (Km = 0.8 ?M) and a Vmax of >20 nmol/mg/s. Expression of cioAB was elevated fivefold in cells grown at higher rates of oxygen provision. The alternative, ccoNOQP-encoded cyanide-sensitive oxidase, expected to encode a cytochrome cb?-type enzyme, plays a major role in the microaerobic respiration of C. jejuni, since it appeared to be essential for viability and exhibited a much higher oxygen affinity, with a Km value of 40 nM and a Vmax of 6 to 9 nmol/mg/s. Low-temperature photodissociation spectrophotometry revealed that neither oxidase has ligand-binding activity typical of the heme-copper oxidase family. These data are consistent with cytochrome oxidation during photolysis at low temperatures. PMID:17172349

  20. A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

  1. Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae

    PubMed Central



    • Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60 kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

  2. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.


    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing


    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  3. Population structure of the Monocelis lineata (Proseriata, Monocelididae) species complex assessed by phylogenetic analysis of the mitochondrial Cytochrome c Oxidase subunit I (COI) gene

    PubMed Central


    Monocelis lineata consists of a complex of sibling species, widespread in the Mediterranean and Atlantic Ocean. Previous genetic analysis placed in evidence at least four sibling species. Nevertheless, this research was not conclusive enough to fully resolve the complex or to infer the phylogeny/phylogeography of the group. We designed specific primers aiming at obtaining partial sequences of the mtDNA gene Cytochrome c Oxidase subunit I (COI) of M. lineata, and have identified 25 different haplotypes in 32 analyzed individuals. The dendrogram generated by Neighbor-Joining analysis confirmed the differentiation between Atlantic and Mediterranean siblings, as well as the occurrence of at least two Mediterranean sibling species. Thus validated, the method here presented appears as a valuable tool in population genetics and biodiversity surveys on the Monocelis lineata complex. PMID:21637466

  4. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.


    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M


    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced ?-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in ?-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. PMID:24974333

  5. Phylogenetic relationships within Taenia taeniaeformis variants and other taeniid cestodes inferred from the nucleotide sequence of the cytochrome c oxidase subunit I gene.


    Okamoto, M; Bessho, Y; Kamiya, M; Kurosawa, T; Horii, T


    Nucleotide sequence variations in a region of the mitochondrial cytochrome c oxidase subunit I (COI) gene (391 bp) were examined within seven species of the genus Taenia and two species of the genus Echinococcus, including ten isolates of T. taeniaeformis and six isolates of E. multilocularis. More than a 12% rate of nucleotide differences between taeniid species was found, allowing the species to be distinguished. In E. multilocularis, no sequence variation was observed among isolates, regardless of the host (gray red-backed vole, tundra vole, pig, Norway rat) or area (Japan, Alaska) from which each metacestode had been isolated. In contrast, six distinct sequences were detected among the ten T. taeniaeformis isolates examined. The level of nucleotide variation in the COI gene within T. taeniaeformis isolates except for one isolate from the gray red-backed vole (TtACR), which has been proposed as a distinct strain or a different species, was about 0.3%-4.1%, whereas the COI gene sequence for TtACR differed from those of the other isolates, with levels being 9.0%-9.5%. Phylogenetic trees were then inferred from these sequence data using two different algorithms. PMID:7567901

  6. The origin of the Tibetan Mastiff and species identification of Canis based on mitochondrial cytochrome c oxidase subunit I (COI) gene and COI barcoding.


    Li, Y; Zhao, X; Pan, Z; Xie, Z; Liu, H; Xu, Y; Li, Q


    DNA barcoding is an effective technique to identify species and analyze phylogenesis and evolution. However, research on and application of DNA barcoding in Canis have not been carried out. In this study, we analyzed two species of Canis, Canis lupus (n = 115) and Canis latrans (n = 4), using the cytochrome c oxidase subunit I (COI) gene (1545 bp) and COI barcoding (648 bp DNA sequence of the COI gene). The results showed that the COI gene, as the moderate variant sequence, applied to the analysis of the phylogenesis of Canis members, and COI barcoding applied to species identification of Canis members. Phylogenetic trees and networks showed that domestic dogs had four maternal origins (A to D) and that the Tibetan Mastiff originated from Clade A; this result supports the theory of an East Asian origin of domestic dogs. Clustering analysis and networking revealed the presence of a closer relative between the Tibetan Mastiff and the Old English sheepdog, Newfoundland, Rottweiler and Saint Bernard, which confirms that many well-known large breed dogs in the world, such as the Old English sheepdog, may have the same blood lineage as that of the Tibetan Mastiff. PMID:22440462

  7. Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    PubMed Central


    Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

  8. Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum?

    PubMed Central

    Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutirrez, S.; Monte, E.


    The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

  9. Nuclear respiratory factor 2 senses changing cellular energy demands and its silencing down-regulates cytochrome oxidase and other target gene mRNAs.


    Ongwijitwat, Sakkapol; Liang, Huan Ling; Graboyes, Evan M; Wong-Riley, Margaret T T


    Cytochrome c oxidase (COX), the terminal enzyme of the electron transport chain, is a bigenomic enzyme with 13 subunits. The mechanism coordinating the transcription of these subunits is poorly understood. We investigated the role of nuclear respiratory factor-2 (NRF-2) in intragenomic regulation of nuclear COX genes. Vector-mediated short-hairpin RNA interference against NRF-2alpha reduced all 10 COX nuclear subunit mRNAs and mRNAs of other genes involved in mitochondrial function/biogenesis. NRF-2 binding site was necessary for the rat COX 4i1 promoter to down-regulate in response to decreased energy demands in primary neurons. Over-expression of NRF-2 protein prevented the down-regulation of transcriptional activity by TTX. Finally, NRF-2 binding sites in isolation were sufficient for modulating COX subunit 4i1 and 6A1 promoters' activity in response to decreased energy demand. These results indicate that NRF-2 is a vital part of a molecular mechanism that senses upstream energy signals and modulates COX transcriptional levels in mammalian cells. PMID:16516409

  10. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.


    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab


    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  11. Inhibition of development of experimental abdominal aortic aneurysm by c-jun N-terminal protein kinase inhibitor combined with lysyl oxidase gene modified smooth muscle progenitor cells.


    Chen, Feng; Zhang, ZhenDong; Zhu, XianHua


    Chronic inflammation, imbalance between the extracellular matrix synthesis and degradation, and loss of vascular smooth muscle cells (SMCs) contribute to the development of abdominal aortic aneurysm (AAA). The purpose of this study was to investigate the effect of the therapy with periaortic incubation of c-Jun N-terminal protein kinase inhibitor SP600125 infused from an osmotic pump and subadventitial injection of lysyl oxidase (LOX) gene modified autologous smooth muscle progenitor cells (SPCs) on treatment of AAA in a rabbit model. Obvious dilation of the abdominal aorta in the control group was caused by periaortic incubation of calcium chloride and elastase. But the progression of aortic dilation was significantly decreased after the treatment with SP600125 and LOX gene modified SPCs compared to the treatment with phosphate-buffered saline. This therapy could inhibit matrix metalloproteinases expression, enhance elastin synthesis, improve preservation of elastic laminar integrity, benefit SPCs survival and restore SMCs population. It seemed that this method might provide a novel therapeutic strategy to treat AAA. PMID:26435026

  12. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.


    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  13. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J


    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  14. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernndez, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.


    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting Early Golden (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a GA overdose phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  15. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul


    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  16. Microbial oxidation of arsenite in a subarctic environment: diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser

    PubMed Central


    Background Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10C). Results Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. Conclusions The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates. PMID:20673331

  17. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.


    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul


    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P.elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P.elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P.elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P.elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  18. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  19. Constitutive co-suppression of the GA 20-oxidase1 gene in tomato leads to severe defects in vegetative and reproductive development.


    Olimpieri, Irene; Caccia, Riccardo; Picarella, Maurizio Enea; Pucci, Anna; Santangelo, Enrico; Soressi, Gian Piero; Mazzucato, Andrea


    To dissect the role of gibberellins in tomato development, we have constitutively down-regulated the gene GA 20-oxidase1 (GA20ox1). Plants co-suppressed for GA20ox1 (referred to as CO-6 plants) showed vegetative defects typical of GA deficiency such as darker and mis-shaped leaves and dwarfism. CO-6 plants flowered as the controls, although their flowers had subtle defects in the pedicel and in organ insertion. Analysis of male development revealed defects before, during and after meiosis, and a final pollen viability of 22%. The development of female organs and gametes appeared normal. Pollination experiments indicated that the pollen produced by CO-6 plants was able to fertilize control ovaries, but the analysis of the progeny showed that the construct was not transmitted. Ovaries of CO-6 plants showed high fruit set and normal fruit development when pollinated with control pollen. However these fruits were completely seedless due to a stenospermocarpic behaviour that was evidenced by callose layering in the endothelium between 7 and 15 days after pollination. We conclude that GA20ox1 in tomato exerts specific developmental roles that are not redundantly shared with other members of this gene family. For reproductive male development, silencing of this gene is detrimental for pollen production and either gametophytically lethal or severely hampering seed germination. In the pistil, the co-suppression construct does not affect the progamic phase, nor fruit set and growth, but it interferes with seed development after fertilization leading to seed abortion. PMID:21421397

  20. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.


    Sagor, G H M; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu


    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  1. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu


    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  2. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.


    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov


    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum. PMID:22352719

  3. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains.


    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi


    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3'-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  4. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.


    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N


    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  5. Amine Oxidase Copper-containing 1 (AOC1) Is a Downstream Target Gene of the Wilms Tumor Protein, WT1, during Kidney Development*

    PubMed Central

    Kirschner, Karin M.; Braun, Julian F.W.; Jacobi, Charlotte L.; Rudigier, Lucas J.; Persson, Anja Bondke; Scholz, Holger


    Amine oxidase copper-containing 1 (AOC1; formerly known as amiloride-binding protein 1) is a secreted glycoprotein that catalyzes the degradation of putrescine and histamine. Polyamines and their diamine precursor putrescine are ubiquitous to all organisms and fulfill pivotal functions in cell growth and proliferation. Despite the importance of AOC1 in regulating polyamine breakdown, very little is known about the molecular mechanisms that control its expression. We report here that the Wilms tumor protein, WT1, which is necessary for normal kidney development, activates transcription of the AOC1 gene. Expression of a firefly luciferase reporter under control of the proximal AOC1 promoter was significantly enhanced by co-transfection of a WT1 expression construct. Binding of WT1 protein to a cis-regulatory element in the AOC1 promoter was confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. Antisense inhibition of WT1 protein translation strongly reduced Aoc1 transcripts in cultured murine embryonic kidneys and gonads. Aoc1 mRNA levels correlated with WT1 protein in several cell lines. Double immunofluorescent staining revealed a co-expression of WT1 and AOC1 proteins in the developing genitourinary system of mice and rats. Strikingly, induced changes in polyamine homeostasis affected branching morphogenesis of cultured murine embryonic kidneys in a developmental stage-specific manner. These findings suggest that WT1-dependent control of polyamine breakdown, which is mediated by changes in AOC1 expression, has a role in kidney organogenesis. PMID:25037221

  6. Himantura tutul sp. nov. (Myliobatoidei: Dasyatidae), a new ocellated whipray from the tropical Indo-West Pacific, described from its cytochrome-oxidase I gene sequence.


    Borsa, Philippe; Durand, Jean-Dominique; Shen, Kang-Ning; Arlyza, Irma S; Solihin, Dedy D; Berrebi, Patrick


    It has been previously established that the Leopard Whipray, Himantura leoparda, consists of two genetically isolated, cryptic species, provisionally designated as 'Cluster 1' and 'Cluster 4' (Arlyza et al., Mol. Phylogenet. Evol. 65 (2013) [1]). Here, we show that the two cryptic species differ by the spotting patterns on the dorsal surface of adults: Cluster-4 individuals tend to have larger-ocellated spots, which also more often have a continuous contour than Cluster-1 individuals. We show that H. leoparda's holotype has the typical larger-ocellated spot pattern, designating Cluster 4 as the actual H. leoparda. The other species (Cluster 1) is described as Himantura tutul sp. nov. on the basis of the nucleotide sequence of a 655-base pair fragment of its cytochrome-oxidase I gene (GenBank accession No. JX263335). Nucleotide synapomorphies at this locus clearly distinguish H. tutul sp. nov. from all three other valid species in the H. uarnak species complex, namely H. leoparda, H. uarnak, and H. undulata. H. tutul sp. nov. has a wide distribution in the Indo-West Pacific, from the shores of eastern Africa to the Indo-Malay archipelago. H. leoparda under its new definition has a similarly wide Indo-West Pacific distribution. PMID:23608177

  7. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.


    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  8. Oxygen-dependent expression of cytochrome c oxidase subunit 4-2 gene expression is mediated by transcription factors RBPJ, CXXC5 and CHCHD2

    PubMed Central

    Aras, Siddhesh; Pak, Oleg; Sommer, Natascha; Finley, Russell; Httemann, Maik; Weissmann, Norbert; Grossman, Lawrence I.


    Cytochrome c oxidase (COX) is the terminal enzyme of the electron transport chain, made up of 13 subunits encoded by both mitochondrial and nuclear DNA. Subunit 4 (COX4), a key regulatory subunit, exists as two isoforms, the ubiquitous isoform 1 and the tissue-specific (predominantly lung) isoform 2 (COX4I2). COX4I2 renders lung COX about 2-fold more active compared with liver COX, which lacks COX4I2. We previously identified a highly conserved 13-bp sequence in the proximal promoter of COX4I2 that functions as an oxygen responsive element (ORE), maximally active at a 4% oxygen concentration. Here, we have identified three transcription factors that bind this conserved ORE, namely recombination signal sequencebinding protein J? (RBPJ), coiled-coil-helix-coiled-coil-helix domain 2 (CHCHD2) and CXXC finger protein 5 (CXXC5). We demonstrate that RBPJ and CHCHD2 function towards activating the ORE at 4% oxygen, whereas CXXC5 functions as an inhibitor. To validate results derived from cultured cells, we show using RNA interference a similar effect of these transcription factors in the gene regulation of COX4I2 in primary pulmonary arterial smooth muscle cells. Depending on the oxygen tension, a concerted action of the three transcription factors regulates the expression of COX4I2 that, as we discuss, could augment both COX activity and its ability to cope with altered cellular energy requirements. PMID:23303788

  9. Oxygen-dependent expression of cytochrome c oxidase subunit 4-2 gene expression is mediated by transcription factors RBPJ, CXXC5 and CHCHD2.


    Aras, Siddhesh; Pak, Oleg; Sommer, Natascha; Finley, Russell; Httemann, Maik; Weissmann, Norbert; Grossman, Lawrence I


    Cytochrome c oxidase (COX) is the terminal enzyme of the electron transport chain, made up of 13 subunits encoded by both mitochondrial and nuclear DNA. Subunit 4 (COX4), a key regulatory subunit, exists as two isoforms, the ubiquitous isoform 1 and the tissue-specific (predominantly lung) isoform 2 (COX4I2). COX4I2 renders lung COX about 2-fold more active compared with liver COX, which lacks COX4I2. We previously identified a highly conserved 13-bp sequence in the proximal promoter of COX4I2 that functions as an oxygen responsive element (ORE), maximally active at a 4% oxygen concentration. Here, we have identified three transcription factors that bind this conserved ORE, namely recombination signal sequence-binding protein J? (RBPJ), coiled-coil-helix-coiled-coil-helix domain 2 (CHCHD2) and CXXC finger protein 5 (CXXC5). We demonstrate that RBPJ and CHCHD2 function towards activating the ORE at 4% oxygen, whereas CXXC5 functions as an inhibitor. To validate results derived from cultured cells, we show using RNA interference a similar effect of these transcription factors in the gene regulation of COX4I2 in primary pulmonary arterial smooth muscle cells. Depending on the oxygen tension, a concerted action of the three transcription factors regulates the expression of COX4I2 that, as we discuss, could augment both COX activity and its ability to cope with altered cellular energy requirements. PMID:23303788

  10. Genetic Susceptibility for Individual Cooperation Preferences: The Role of Monoamine Oxidase A Gene (MAOA) in the Voluntary Provision of Public Goods

    PubMed Central

    Mertins, Vanessa; Schote, Andrea B.; Hoffeld, Wolfgang; Griessmair, Michele; Meyer, Jobst


    In the context of social dilemmas, previous research has shown that human cooperation is mainly based on the social norm of conditional cooperation. While in most cases individuals behave according to such a norm, deviant behavior is no exception. Recent research further suggests that heterogeneity in social behavior might be associated with varying genetic predispositions. In this study, we investigated the relationship between individuals' behavior in a public goods experiment and the promoter-region functional repeat polymorphism in the monoamine oxidase A gene (MAOA). In a dynamic setting of increasing information about others' contributions, we analyzed differences in two main components of conditional cooperation, namely the players' own contribution and their beliefs regarding the contribution of other players. We showed that there is a significant association between individuals' behavior in a repeated public goods game and MAOA. Our results suggest that male carriers of the low activity alleles cooperate significantly less than those carrying the high activity alleles given a situation where subjects had to rely on their innate beliefs about others' contributions. With increasing information about the others' cooperativeness, the genetic effect diminishes. Furthermore, significant opposing effects for female subjects carrying two low activity alleles were observed. PMID:21698196

  11. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.


    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom


    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  12. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren


    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  13. l-Arginine oxidase from Pseudomonas sp. TPU 7192: Characterization, gene cloning, heterologous expression, and application to l-arginine determination.


    Matsui, Daisuke; Terai, Anna; Asano, Yasuhisa


    l-Arginine oxidase (AROD, EC 1.4.3.-) was discovered in newly discovered Pseudomonas sp. TPU 7192 and its characteristics were described. The molecular mass (MS) of the enzyme was estimated to be 528kDa, which was accounted for by eight identical subunits with MS of 66kDa each. AROD was identified as a flavin adenine dinucleotide (FAD)-dependent enzyme with 1mol of FAD being contained in each subunit. It catalyzed the oxidative deamination of l-arginine and converted l-arginine to 2-ketoarginine, which was non-enzymatically converted into 4-guanidinobutyric acid when the hydrogen peroxide (H2O2) formed by l-arginine oxidation was not removed. In contrast, 2-ketoarginine was present when H2O2was decomposed. AROD was specific to l-arginine with a Km value of 149?M. It exhibited maximal activity at 55C and pH 5.5. AROD was stable in the pH range 5.5-7.5 and >95% of its original activity was below 60C at pH 7.0. Since these enzymatic properties are considered suitable for the determination of l-arginine, the gene was cloned and expressed in a heterologous expression system. We herein successfully developed a new simple enzymatic method for the determination of l-arginine using Pseudomonas AROD. PMID:26672462

  14. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor


    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  15. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom


    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4?cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  16. N-ethylmaleimide-resistant acyl-coenzyme A oxidase from Arthrobacter ureafaciens NBRC 12140: molecular cloning, gene expression and characterization of the recombinant enzyme.


    Bakke, Mikio; Setoyama, Chiaki; Miura, Retsu; Kajiyama, Naoki


    N-ethylmaleimide (NEM)-resistant acyl-coenzyme A oxidase (ACO) has been desired for the determination of free fatty acids (FFAs). In order to meet this demand, we prepared recombinant ACO from Arthrobacter ureafaciens NBRC 12140. The coding region of the gene was 2109, encoding a protein of 703 amino acids with a predicted molecular mass of 76.5 kDa. The heterologous expression level in Escherichia coli was 520-fold higher than that in the native strain. The purified enzyme retained more than 60% activity after incubation in the presence of 10 mM NEM at 37 degrees C for 4 h, while other commercially available ACOs showed only less than 10% activities after the same NEM treatment. We presume that this is due to the presence of only three cysteines in ACO from A. ureafaciens. Site-directed mutagenesis studies and close scrutiny of the three-dimensional structures of other related ACOs suggested that these cysteines were buried in the protein and unreactive to NEM. The recombinant enzyme was used for the colorimetric determination of free fatty acid, which gave a linear calibration. PMID:17141592

  17. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.


    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned

  18. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.


    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  19. Overexpression of alcohol oxidase in Pichia pastoris.


    de Hoop, M J; Cregg, J; Keizer-Gunnink, I; Sjollema, K; Veenhuis, M; Ab, G


    The protein import capacity of peroxisomes in methylotrophic yeasts was studied using Pichia pastoris containing one or two extra copies of the gene encoding the peroxisomal protein alcohol oxidase. The alcohol oxidase overproduced in this strain was only partially imported and assembled into the active, octameric form of the protein. The excess remained in the cytosol as protein aggregates composed of monomers. These results are discussed in view of the possible application of peroxisomes as storage compartments for heterologous proteins. PMID:1936277

  20. Identification, characterization and nutritional regulation of two isoforms of acyl-coenzyme A oxidase 1 gene in Nile tilapia (Oreochromis niloticus).


    He, An-Yuan; Liu, Cai-Zhi; Chen, Li-Qiao; Ning, Li-Jun; Zhang, Mei-Ling; Li, Er-Chao; Du, Zhen-Yu


    In peroxisome, acyl-coenzyme A oxidase 1 (ACOX1) is the first rate-limiting enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. Two isoforms of acyl-coenzyme A oxidase 1 were firstly identified in Nile tilapia (Oreochromis niloticus) in this study. ACOX1 isoform1 (ACOX1i1) and ACOX1 isoform2 (ACOX1i2) were encoded by the single gene with 661 amino acids in length. The coding region of both isoforms consisted of 14 exons. The residues from 89 to 193 in ACOX1i1 were encoded by exon 3b, while in ACOX1i2 they were encoded by exon 3a. Homologous alignment analysis indicated that the varied region (the residues from 89 to 193) of ACOX1i1 was more conserved than ACOX1i2 in vertebrates (Mammalia, Aves, Amphibia and Pisces). The mRNA expression level of ACOX1i1 and ACOX1i2 was detected separately in eleven tissues and the results indicated that ACOXi1 expression was the highest in liver followed by kidney and brain, while the expression of ACOXi2 was the highest in kidney followed by liver. The normalized levels of both transcript variants were comparable in most tissues, however the level of ACOX1i2 was significantly higher than that of ACOX1i1 in white muscle and kidney (5.1 fold and 3.1 fold), and ACOX1i1 was significantly higher than ACOX1i2 in gill and brain (4.8 fold and 1.9 fold). In different nutritional states, the expression levels of both isoforms in liver were comparable between fasting and most of post-feeding time points, except that the expression at 3h post-feeding was significantly lower than others. The expression of ACOX1i1 in the kidney also showed the similar pattern, indicating the lowest expression at 8h post-feeding, however, no significant change was seen in ACOX2i2 among all nutritional states. These results suggested that ACOX1i1 and i2 may play different roles in tissues, and their expression levels were differently modulated by nutritional stage. PMID:24802117

  1. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.


    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi


    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  2. Molecular Phylogeny of Nematodes (Oxyurida: Travassosinematidae) from Orthoptera (Gryllotalpidae) Inferred by Mitochondrial Cytochrome C Oxidase Subunit 1 Gene

    PubMed Central

    Singh, Neetu; Chaudhary, Anshu; Singh, Hridaya Shanker


    In this study, we sequenced mt Cox 1 gene sequences of five nematode spp. that were infective to arthropod, Gryllotalpa africana. The nematode belongs to Thelastomatoidea, a group of pinworms that parasitizes only invertebrates. Currently, in India spp. of this group are distinguished mainly on the basis of morphological characters that present possible confusions. Therefore, we identified the species through morphological and genetic analysis. We selected mt Cox 1 gene region to show their phylogenetic position with closely related spp. and confirmed their molecular validation. The present findings are important to confirm the phylogenetic position and relationship among five nematode spp. and avoid misidentification regarding their validation, as it is more necessary in that case when many species harbours the same host. PMID:26339150

  3. The Diamine Oxidase Gene Is Associated with Hypersensitivity Response to Non-Steroidal Anti-Inflammatory Drugs

    PubMed Central

    Agndez, Jos A. G.; Ayuso, Pedro; Cornejo-Garca, Jos A.; Blanca, Miguel; Torres, Mara J.; Doa, Inmaculada; Salas, Mara; Blanca-Lpez, Natalia; Canto, Gabriela; Rondon, Carmen; Campo, Paloma; Laguna, Jos J.; Fernndez, Javier; Martnez, Carmen; Garca-Martn, Elena


    Non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191), which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR ?=?1.7 (95% CI ?=?1.32.1; Pc ?=?0.0003) with a gene-dose effect (P?=?0.0001). The association was replicated in two populations from different geographic areas (Pc ?=?0.008 and Pc ?=?0.004, respectively). Conclusions and implications The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response. PMID:23152756

  4. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.


    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corra-Giannella, M L


    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  5. Hormonal cross-talk between auxin and ethylene differentially regulates the expression of two members of the 1-aminocyclopropane-1-carboxylate oxidase gene family in rice (Oryza sativa L.).


    Chae, H S; Cho, Y G; Park, M Y; Lee, M C; Eun, M Y; Kang, B G; Kim, W T


    Two cDNA clones, pOS-ACO2 and pOS-ACO3, encoding 1-aminocyclopropane-1-carboxylate (ACC) oxidase were isolated from rice seedling cDNA library. pOS-ACO3 is a 1,299 bp full-length clone encoding 321 amino acids (Mr=35.9 kDa), while pOS-ACO2 is 1,072 bp long and is a partial cDNA clone encoding 314 amino acids. These two deduced amino acid sequences share 70% identity, and display a high degree of sequence identity (72-92%) with previously isolated pOS-ACO1 of deepwater rice. The chromosomal location studies show that OS-ACO2 is positioned on the long arm of chromosome 9, while OS-ACO3 on the long arm of chromosome 2 of rice genome. A marked increase in the level of OS-ACO2 transcript was observed in IAA-treated etiolated rice seedlings, whereas the OS-ACO3 mRNA was greatly accumulated by ethylene treatment. Results of ethylene inhibitor studies indicated that auxin promotion of the OS-ACO2 transcription was not mediated through the action of auxin-induced ethylene. Thus, it appears that there are two groups of ACC oxidase transcripts in rice plants, either auxin-induced or ethylene-induced. The auxin-induced OS-ACO2 expression was partially inhibited by ethylene, while ethylene induction of OS-ACO3 transcription was completely blocked by auxin. These results indicate that the expression of ACC oxidase genes is regulated by complex hormonal networks in a gene specific manner in rice seedlings. Okadaic acid, a potent inhibitor of protein phosphatase, effectively suppressed the IAA induction of OS-ACO2 expression, suggesting that protein dephosphorylation plays a role in the induction of ACC oxidase by auxin. A scheme of the multiple regulatory pathways for the expression of ACC oxidase gene family by auxin, ethylene and protein phosphatase is presented. PMID:10805599

  6. Molecular relationships and classification of several tufted capuchin lineages (Cebus apella, Cebus xanthosternos and Cebus nigritus, Cebidae), by means of mitochondrial cytochrome oxidase II gene sequences.


    Ruiz-Garca, Manuel; Castillo, Maria Ignacia; Lichiln-Ortiz, Nicols; Pinedo-Castro, Myreya


    The morphological systematics of the tufted capuchins is confusing. In an attempt to clarify the complex systematics and phylogeography of this taxon, we provide a first molecular analysis. We obtained mitochondrial cytochrome oxidase II (mtCOII) gene sequences from 49 tufted capuchins that had exact geographic origins from diverse lineages in Colombia, Peru, Bolivia, French Guyana, Brazil, Argentina and Paraguay and that belonged to clearly recognized morphological taxa. This project had 4 main findings: (1) we determined 2 established and related taxa in the northern Amazon River area, which we named C. a. apella and C. a. fatuellus. C. a. apella is distributed from French Guyana until, at least, the Negro River in the northern Brazilian Amazon, whereas C. a. fatuellus is distributed throughout the Colombian Eastern Llanos and the northern Colombian Amazon. We also determined 2 other southern C. apella taxa, which we named C. a. macrodon and C. a. cay. C. a. macrodon has a western and southern Amazon distribution, while C. a. cay has a more southern distribution outside the Amazon basin. (2) In the upper Amazon basin, there is a unique lineage (C. a. macrocephalus) with 1 widely distributed haplotype. The 4 morphological subspecies (C. a. maranonis, C. a. macrocephalus, C. a. peruanus, C. a. pallidus), and maybe a fifth unknown subspecies, described in this area were molecularly undifferentiated at least for the mitochondrial gene analyzed. (3) Our molecular analysis determined that 1 individual of C. robustus fell into the lineage of C. a. macrocephalus. Therefore, this form does not receive any specific name. (4) The animals classified a priori as C. nigritus and C. xanthosternos (because of their morphological phenotypes and by their geographical origins) were clearly differentiated from the other specimens analyzed with the molecular marker employed. Therefore, we consider that these 2 lineages could be assigned the status of full species following the biological species definition. (5) In 2001, Groves described 4 tufted capuchin species (C. apella, C. libidinosus, C. nigritus and C. xanthosternos), while Silva Jr. determined 7 species (C. apella, C. macrocephalus, C. libidinosus, C. cay, C. nigritus, C. robustus and C. xanthosternos). The tests of Swofford-Olsen-Waddell-Hillis, of Shimodaira and Hasegawa and of Templeton did not fit with either of these two classificatory schemes, although Groves' scheme was better with regard to our data than that of Silva Jr. (6) All the temporal splits among the tufted capuchin taxa studied were estimated to have occurred during the last phase of the Pleistocene by using the ? statistic applied to the median joining haplotype network. PMID:23128150

  7. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.


    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth


    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  8. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth


    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  9. EPR spectra of type 3 copper centers in Rhus vernicifera laccase and Cucumis sativus ascorbate oxidase.


    Sakurai, T; Takahashi, J


    In order to reveal the detailed structure of the trinuclear site composed of type 2 copper and a pair of type 3 copper centers in multicopper oxidases, the action of inhibitors such as azide, thiocyanate, and fluoride on laccase and ascorbate oxidase has been investigated by absorption, CD, and EPR spectroscopies. Anaerobic reactions of inhibitor-treated laccase and ascorbate oxidase with pyrocatechol and L-ascorbate, respectively, gave EPR signals originating from the inhibitor-bound type 3 copper, except for the case of F(-)-laccase. The hyperfine splittings of these EPR signals (Az = 10.10(-3)-18.10(-3) cm-1) were smaller than those of type 2 copper centers (ca. 20.10(-3) cm-1), indicating that type 3 copper has a tetragonal geometry with tetrahedral distortion. The facile detection of a series of the inhibitor-bound type 3 copper centers indicates that the action of the exogenous anionic inhibitors is not only to interfere the access of dioxygen to the trinuclear site, but also to restrain the reduction of type 3 copper by lowering its reduction potential. PMID:7748896

  10. Association of the NAD(P)H oxidase p22 phox gene C242T polymorphism with type 2 diabetes mellitus, diabetic nephropathy, and carotid atherosclerosis with type 2 diabetes mellitus: A meta-analysis

    PubMed Central

    Li, Tao; Xi, Hai-feng; Luo, Hong-min; Liu, Wen-xuan; Gao, Xia; Liu, Dian-wu; Yang, Lei


    Background Several epidemiological studies have evaluated the association between the NAD(P)H oxidase p22 phox gene C242T polymorphism and the risk of type 2 diabetes mellitus (T2DM), diabetic nephropathy (DN), and carotid atherosclerosis with T2DM (CA), but the results are inconclusive. This meta-analysis was therefore designed to clarify these controversies. Methods Systematic searches were performed using electronic databases such as MEDLINE, PubMed, EMBASE, and China National Knowledge Infrastructure, as well as through manual searching of the references of identified articles. A total of 11 publications were eligible for this meta-analysis after running a search on the NAD(P)H oxidase p22 phox gene C242T polymorphism, including 7 with outcomes for T2DM, 7 with outcomes for DN, and 3 with outcomes for CA. The pooled odds ratio (OR) with a 95% confidence interval (CI) was calculated using a fixed effects model (FEM) or a random effects model (REM). Publication bias was tested by Begg's funnel plot analysis. Sensitivity analysis was also performed. Results The results showed a significant association between the NAD(P)H oxidase p22 phox gene C242T polymorphism and T2DM risk in the allelic model (REM: OR=1.23, 95% CI=1.061.43), additive model (FEM: OR=1.61, 95% CI=1.142.26), and recessive model (FEM: OR=1.50, 95% CI=1.102.05). A significant association was also observed for DN in the allelic model (REM: OR=1.25, 95% CI=1.061.47), additive model (FEM: OR=1.61, 95% CI=1.082.38), and dominant model (REM: OR=1.26, 95% CI=1.031.54). However, no association was observed for CA. Similar results were obtained in subgroup analysis based on ethnicity. Conclusions Results of this meta-analysis suggest that the NAD(P)H oxidase p22 phox gene 242T allele might be associated with an increased risk of T2DM and DN, but not CA. PMID:26380814

  11. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.


    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr


    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be characterised, which helps BR function to be understood. The knowledge can also be a good starting point for some breeding companies that are interested in introducing new semi-dwarf barley cultivars. PMID:26752435

  12. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou


    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight and flag leaf chlorophyll content at 5~15 DAA than those in genotype-B and genotype-C, among 102 varieties under various environments. PMID:26714276

  13. Development and evaluation of PCR methods based on cytochrome c oxidase subunit one (cox1) and NADH dehydrogenase subunit one gene (nad1) to detect Opisthorchis viverrini in human fecal samples.


    Buathong, Saiwasan; Leelayoova, Saovanee; Mungthin, Mathirut; Naaglor, Tawee; Taamasri, Paanjit; Suwannahitatorn, Picha; Tan-Ariya, Peerapan


    Opisthorchis viverrini is highly prevalent throughout Southeast Asia. Chronic infection of this parasite leads to cholangiocarcinoma (CCA), a fatal bile duct cancer. The early and accurate detection of this parasite is very important; therefore, new PCR methods targeting cytochrome c oxidase subunit one and NADH dehydrogenase subunit one gene to detect O. viverrini in fecal specimens have been developed. Ninety O. viverrini-positive human fecal samples were used in this study. The PCR sensitivity of both genes was compared with internal transcribe spacer 2 (ITS2)-PCR. The sensitivity of cox1-PCR and nad1-PCR was 66.7 and 50 %, respectively. The sensitivity of cox1-PCR and nad1-PCR achieved 89.1 and 71.7 % in specimens containing O. viverrini eggs of >100 eggs per gram (EPG). Additionally, these primers can be used to provide the information on genetic diversity from mitochondrial genes of O. viverrini. PMID:26239798

  14. [Preparation and identification of recombinant sarcosine oxidase].


    Pu, Jing; Wang, Rui; Yao, Mingdong; He, Zhongjie; Zhao, Ming; Meng, Yao


    An important index determination for clinical diagnosis of renal function is to assay the creatinine concentration in serum. In the analytical process applied with coupled-enzyme, the quality control of sarcosine oxidase (SOX) as a key enzyme is the first problem to be solved. In order to establish an efficient and laboratory-scale production of SOX, the recombinant sarcosine oxidase (r-SOX) gene was a high-level expression in E. coli induced with lactose on a large-scale fermentation in 300 L fermenter. The results suggested that the biomass concentration reached OD600 of 22 and the expression of recombinant sarcosine oxidase in E. coli accounted for about 25% of total soluble protein in culture after fermentation. The cell-free extract obtained from high pressure homogenizer was processed by selective thermal denaturation and then purified with Ni-Sepharose FF chromatography. The sarcosine oxidase with 97% purity, 25 U/mg specific activity and 92.4% activity recovery was obtained. The molecular weight with single peptide chain of 53 kD and 55 kD of recombinant sarcosine oxidase was assessed by SDS-PAGE in presence or absence of 2-mercaptoehanol and Sephacryl S-200 chromatography. This sarcosine oxidase was found to be a conjugated protein, yellow enzyme, which combined with FAD as prosthetic group by covalent linkage. The contaminant of catalase was not detected in the sample pool of this enzyme. In addition, a further test to the thermal stability of sarcosine oxidase was done. According to the above results, the development and utilization of this enzyme has been set up on a reliable foundation. PMID:25764728

  15. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms.


    Groussman, Ryan D; Parker, Micaela S; Armbrust, E Virginia


    Ferroproteins arose early in Earth's history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world's oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This refined view of iron use strategies in diatoms elucidates the history of these adaptations, and provides potential molecular markers for determining the iron nutritional status of different diatom species in environmental samples. PMID:26052941

  16. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms

    PubMed Central

    Groussman, Ryan D.; Parker, Micaela S.; Armbrust, E. Virginia


    Ferroproteins arose early in Earth’s history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world’s oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This refined view of iron use strategies in diatoms elucidates the history of these adaptations, and provides potential molecular markers for determining the iron nutritional status of different diatom species in environmental samples. PMID:26052941

  17. Mitochondrial cytochrome c oxidase deficiency.


    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre


    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance of studying different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  18. Glucose oxidase--an overview.


    Bankar, Sandip B; Bule, Mahesh V; Singhal, Rekha S; Ananthanarayan, Laxmi


    Glucose oxidase (beta-D-glucose:oxygen 1-oxidoreductase; EC catalyzes the oxidation of beta-D-glucose to gluconic acid, by utilizing molecular oxygen as an electron acceptor with simultaneous production of hydrogen peroxide. Microbial glucose oxidase is currently receiving much attention due to its wide applications in chemical, pharmaceutical, food, beverage, clinical chemistry, biotechnology and other industries. Novel applications of glucose oxidase in biosensors have increased the demand in recent years. Present review discusses the production, recovery, characterization, immobilization and applications of glucose oxidase. Production of glucose oxidase by fermentation is detailed, along with recombinant methods. Various purification techniques for higher recovery of glucose oxidase are described here. Issues of enzyme kinetics, stability studies and characterization are addressed. Immobilized preparations of glucose oxidase are also discussed. Applications of glucose oxidase in various industries and as analytical enzymes are having an increasing impact on bioprocessing. PMID:19374943

  19. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.


    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao


    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age  = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  20. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.


    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi


    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. PMID:25749303

  1. The structure and inhibition of human diamine oxidase,

    PubMed Central

    McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O.; Brown, Doreen E; Dooley, David M; Guss, J Mitchell


    Humans have three functioning genes that code for copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 . The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9 % sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 and 2.2 , respectively. They bind non-covalently in the active site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  3. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.


    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon


    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade. PMID:25980806

  4. Mutation of the NADH oxidase gene (nox) reveals an overlap of the oxygen- and acid-mediated stress responses in Streptococcus mutans.


    Derr, Adam M; Faustoferri, Roberta C; Betzenhauser, Matthew J; Gonzalez, Kaisha; Marquis, Robert E; Quivey, Robert G


    NADH oxidase (Nox) is a flavin-containing enzyme used by Streptococcus mutans to reduce dissolved oxygen encountered during growth in the oral cavity. In this study, we characterized the role of the NADH oxidase in the oxidative and acid stress responses of S. mutans. A nox-defective mutant strain of S. mutans and its parental strain, the genomic type strain UA159, were exposed to various oxygen concentrations at pH values of 5 and 7 to better understand the adaptive mechanisms used by the organism to withstand environmental pressures. With the loss of nox, the activities of oxygen stress response enzymes such as superoxide dismutase and glutathione oxidoreductase were elevated compared to those in controls, resulting in a greater adaptation to oxygen stress. In contrast, the loss of nox led to a decreased ability to grow in a low-pH environment despite an increased resistance to severe acid challenge. Analysis of the membrane fatty acid composition revealed that for both the nox mutant and UA159 parent strain, growth in an oxygen-rich environment resulted in high proportions of unsaturated membrane fatty acids, independent of external pH. The data indicate that S. mutans membrane fatty acid composition is responsive to oxidative stress, as well as changes in environmental pH, as previously reported (E. M. Fozo and R. G. Quivey, Jr., Appl. Environ. Microbiol. 70:929-936, 2004). The heightened ability of the nox strain to survive acidic and oxidative environmental stress suggests a multifaceted response system that is partially dependent on oxygen metabolites. PMID:22179247

  5. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  6. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.


    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  7. Rational design for building blocks of DNA-based conductive nanowires through multi-copper incorporation into mismatched base pairs.


    Zhao, Jing; Han, Li; Yang, Hongfang; Liu, Jinxiang; Bu, Yuxiang


    Metal-modified DNA base pairs, which possess potential electrical conductivity and can serve as conductive nanomaterials, have recently attracted much attention. Inspired by our recent finding that multicopper incorporation into natural DNA base pairs could improve the electronic properties of base pairs, herein, we designed two novel multi-copper-mediated mismatched base pairs (G(3Cu)T and A(2Cu)C), and examined their structural and electronic properties by means of density functional theory calculations. The results reveal that these multi-Cu-mediated mismatched base pairs still have planar geometries that are thermodynamically favorable to stability, and their binding energies are close to those of multi-Cu-mediated normal base pairs (G(3Cu)C and A(2Cu)T). Their HOMO-LUMO gaps and ionization potentials decrease significantly compared to the corresponding natural base pairs. As evidenced by the charge transfer excitation transitions, transverse electronic communication of G(3Cu)T and A(2Cu)C is remarkably enhanced, suggesting that they facilitate electron migration along the DNA wires upon incorporation. Further examinations also clarify the possibility to build promising DNA helices using the G(3Cu)T and/or A(2Cu) C base pairs. The calculated electronic properties of the three-layer-stacked multi-Cu-mediated mismatched base pairs illustrate that the Cu(m)-DNA have better conductivity. This work provides perspectives for the development and application of DNA nanowires. PMID:22807419

  8. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.


    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio


    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487?bp fragment, including part of 5.8?S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma. PMID:26336248

  9. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya


    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  10. Segregation and linkage studies of plasma dopamine-beta-hydroxylase (DBH), erythrocyte catechol-O-methyltransferase (COMT), and platelet monoamine oxidase (MAO): possible linkage between the ABO locus and a gene controlling DBH activity.

    PubMed Central

    Goldin, L R; Gershon, E S; Lake, C R; Murphy, D L; McGinniss, M; Sparkes, R S


    Measurements of dopamine-beta-hydroxylase (DBH), catechol-O-methyltransferase (COMT), and monoamine oxidase (MAO) along with 27 polymorphic marker phenotypes were available for 162 patients with major affective disorders and 1,125 of their relatives. Levels of enzymes were previously found not to be associated with illness. Pedigree analysis methods for quantitative traits are used to test single-gene hypotheses for segregation of DBH in 32 families with 411 individuals. COMT in 30 families with 351 individuals, and MAO in 50 families with 309 individuals. The familial distribution of both DBH and COMT are consistent with two codominant alleles at the same locus that account for 56% and 59% of the total variance, respectively. MAO activity cannot be shown to be segregating as a single major gene, but a purely nongenetic hypothesis is also rejected. A possible linkage of a locus for DBH to the ABO locus is indicated by a maximum lod score of 1.82 at 0% and 10% recombination fractions for males and females, respectively. A lod score of 0.61 at 0% recombination for a similar analysis in a single large pedigree was reported by Elston et al., making the combined lod score for the two studies equal to 2.32 at 0% recombination. PMID:6951409

  11. Arabidopsis alternative oxidase sustains Escherichia coli respiration.


    Kumar, A M; Sll, D


    Glutamyl-tRNA reductase, encoded by the hemA gene, is the first enzyme in porphyrin biosynthesis in many organisms. Hemes, important porphyrin derivatives, are essential components of redox enzymes, such as cytochromes. Thus a hemA Escherichia coli strain (SASX41B) is deficient in cytochrome-mediated aerobic respiration. Upon complementation of this strain with an Arabidopsis thaliana cDNA library, we isolated a clone which permitted the SASX41B strain to grow aerobically. The clone encodes the gene for Arabidopsis alternative oxidase, whose deduced amino acid sequence was found to have 71% identity with that of the enzyme from the voodoo lily, Sauromatum guttatum. The Arabidopsis protein is expressed as a 31-kDa protein in E. coli and confers on this organism cyanide-resistant growth, which in turn is sensitive to salicylhydroxamate. This implies that a single polypeptide is sufficient for alternative oxidase activity. Based on these observations we propose that a cyanide-insensitive respiratory pathway operates in the transformed E. coli hemA strain. Introduction of this pathway now opens the way to genetic/molecular biological investigations of alternative oxidase and its cofactor. PMID:1438286

  12. Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach

    NASA Astrophysics Data System (ADS)

    Davis, R.; Tebo, B. M.


    Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn oxidases McoA and MopA. The greater diversity of Mn oxidase pathways in this metagenome suggests a more diverse Mn oxidizing microbial community in the cold pumice sample. Key enzymes for four of the six known carbon fixation pathways (the Calvin Cycle, the reductive TCA cycle, the Wood-Ljungdahl pathway, and the 3-hydroxypropionate/4-hydroxybutyrate Cycle) were also identified in both samples indicating primary production occurs via a diverse community of carbon fixing organisms. Together, these samples contain active, diverse populations of Mn oxidizing bacteria living in association with microbial communities supported by chemoautotrophic carbon fixation.

  13. Natural Compounds as Modulators of NADPH Oxidases

    PubMed Central


    Reactive oxygen species (ROS) are cellular signals generated ubiquitously by all mammalian cells, but their relative unbalance triggers also diseases through intracellular damage to DNA, RNA, proteins, and lipids. NADPH oxidases (NOX) are the only known enzyme family with the sole function to produce ROS. The NOX physiological functions concern host defence, cellular signaling, regulation of gene expression, and cell differentiation. On the other hand, increased NOX activity contributes to a wide range of pathological processes, including cardiovascular diseases, neurodegeneration, organ failure, and cancer. Therefore targeting these enzymatic ROS sources by natural compounds, without affecting the physiological redox state, may be an important tool. This review summarizes the current state of knowledge of the role of NOX enzymes in physiology and pathology and provides an overview of the currently available NADPH oxidase inhibitors derived from natural extracts such as polyphenols. PMID:24381714

  14. Long term liver specific glucokinase gene defect induced diabetic cardiomyopathy by up regulating NADPH oxidase and down regulating insulin receptor and p-AMPK

    PubMed Central


    Background The liver-specific glucokinase knockout (gckw/) mouse experiences long-term hyperglycemia and insulin resistance. This study was designed to evaluate the functional and structural changes in the myocardium of 60week-old gckw/ mice, and to investigate the effect of rosiglitazone on the myocardium in this model. Methods 60week-old gckw/ mice were randomly divided into 3 groups: gckw/, gckw/ mice treated with insulin (1 U/kg) and gckw/ mice treated with rosiglitazone (18mg/kg). Insulin or rosiglitazone treatment was for 4 weeks. Gckw/w litermates were used as controls. Echocardiography, electrocardiogram, biochemical, histopathological, ultrastructural, real time PCR and Western blot studies were performed to examine for structural and functional changes. Results Long-term liver-specific gck knockout in mice elicits hyperglycaemia and insulin resistance. Compared to age matched gckw/w mice, 60 week-old gckw/ mice showed decreased LV internal dimension, increased posterior wall thickness, lengthened PR and QRS intervals, up-regulated MLC2 protein expression, decreased SOD activity, increased MDA levels and up-regulated Cyba mRNA. Morphological studies revealed that there was an increase in the amount of PAS and Masson positively stained material, as did the number and proportion of the cell occupied by mitochondria in the gckw/ mice. Western blot analysis revealed that the levels of the insulin receptor, Akt, phosphorylated AMPK beta and phosphorylated ACC were reduced in gckw/ mice. These effects were partly attenuated or ablated by treatment with rosiglitazone. Conclusions Our results indicate that changes in the myocardium occur in the liver-specific glucokinase knockout mouse and suggest that reduced glucokinase expression in the liver may induce diabetic cardiomyopathy by up regulating NADPH oxidase and down regulating insulin receptor and p-AMPK protein levels. Rosiglitazone treatment may protect against diabetic cardiomyopathy by altering the levels of a set of proteins involved in cardiac damage. PMID:24447392

  15. A complex organization of the gene encoding cytochrome oxidase subunit 1 in the mitochondrial genome of the dinoflagellate, Crypthecodinium cohnii: homologous recombination generates two different cox1 open reading frames.


    Norman, J E; Gray, M W


    In the course of investigating mitochondrial genome organization in Crypthecodinium cohnii, a non-photosynthetic dinoflagellate, we identified four EcoRI fragments that hybridize to a probe specific for cox1, the gene that encodes subunit 1 of cytochrome oxidase. Cloning and sequence characterization of the four fragments (5.7, 5.1, 4.1, 3.5 kilobase pairs) revealed that cox1 exists in four distinct but related contexts in C. cohnii mtDNA, with a central repeat unit flanked by one of two possible upstream (flanking domain 1 or 2) and downstream (flanking domain 3 or 4) regions. The majority of the cox1 gene is located within the central repeat; however, the C-terminal portion of the open reading frame extends into flanking domains 3 and 4, thereby creating two distinct cox1 coding sequences. The 3'-terminal region of one of the cox1 reading frames can assume an elaborate secondary structure, which potentially could act to stabilize the mature mRNA against nucleolytic degradation. In addition, a high density of small inverted repeats (15-22 base pairs) has been identified at the 5'-end of cox1, further suggesting that hairpin structures could be important for gene regulation. The organization of cox1 in C. cohnii mtDNA appears to reflect homologous recombination events within the central repeat between different cox1 sequence contexts. Such recombining repeats are a characteristic feature of plant (angiosperm) mtDNA, but they have not previously been described in the mitochondrial genomes of protists. PMID:11675595


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fruit ripening involves changes in the expression of a large number of genes including the well-characterized 1-Aminocyclopropane-1-caboxylic acid oxidase which catalyzes the conversion of 1-aminocyclopropane-1-caboxylate to ethylene. We isolated a genomic DNA sequence encoding ACC oxidase from pea...

  17. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi


    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 ? m in average length and 5 ? m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and ? =? 90 degrees, ? = 126 degrees.

  18. Cloning and expression pattern of peroxisomal beta-oxidation genes palmitoyl-CoA oxidase, multifunctional protein and 3-ketoacyl-CoA thiolase in mussel Mytilus galloprovincialis and thicklip grey mullet Chelon labrosus.


    Bilbao, Eider; Cajaraville, Miren P; Cancio, Ibon


    Due to the ability to respond after exposure to organic toxic compounds, peroxisome proliferation is used as biomarker of exposure to organic pollutants in mussels and in fish. Mussels are worldwide studied as sentinels of pollution in marine environments while mullets such as the thicklip grey mullet Chelon labrosus have been proposed as appropriate sentinel species since they inhabit highly polluted environments. In order to study genes of the inducible peroxisomal beta-oxidation pathway in mussels Mytilus galloprovincialis and in C. labrosus, genes coding for the three enzymes in the inducible peroxisomal beta-oxidation pathway, palmitoyl-CoA oxidase (AOX1), multifunctional protein (MFP1 in mullet and MFP2 in mussels), and 3-ketoacyl-CoA thiolase (THIO), were cloned. Additionally, a fragment of the peroxisomal Delta(2), Delta(4) dienoyl-CoA reductase 2 (DECR) necessary for the beta-oxidation of unsaturated fatty acids was cloned in mullets. The whole open reading frame of aox1 sequenced in both mussels and mullets revealed high homology with known aox1 sequences, with highly conserved important domains such as the FAD binding motif or the typical peroxisomal targeting signal (PTS1). A thorough in silico analysis of the gene and genome databases allowed to identify in fish and molluscs sequence homologs of all the enzymes necessary for 2 of the 3 different paralog peroxisomal beta-oxidation pathways described in metazoans (AOX1, AOX3, MFP1, MFP2, THIO and sterol carrier protein X). Only the enzyme necessary for the oxidation of branched chain fatty acids, AOX2, described in mammalian, avian and amphibian species, seems to be lacking from the genomes of fish and molluscs. In order to study the expression and regulation capacity of peroxisomal beta-oxidation genes, aox1 and thio expression was determined in different tissues of mature and immature mullets and mussels collected in January and June, both genes being expressed higher in the digestive gland of mussels collected in June compared to January. Finally, in silico studies of the promoter regions in the piscine genomes available in the Ensembl genome repository, allowed the identification of putative peroxisome proliferator response elements that could explain the possible cellular and molecular mechanisms leading to peroxisome proliferation in fish. Further studies are needed to decipher molecular mechanisms of peroxisome proliferation in aquatic organisms under exposure to peroxisome proliferator xenobiotics. PMID:19465092

  19. Overexpression of a GmCnx1 Gene Enhanced Activity of Nitrate Reductase and Aldehyde Oxidase, and Boosted Mosaic Virus Resistance in Soybean

    PubMed Central

    Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao


    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 ?g g-1 h-1 and30 pmol L-1, respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  20. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il


    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  1. Characterization of novel gene expression related to glyoxal oxidase by agro-infiltration of the leaves of accession Baihe-35-1 of Vitis pseudoreticulata involved in production of H2O2 for resistance to Erysiphe necator.


    Zhao, Heqing; Guan, Xin; Xu, Yan; Wang, Yuejin


    Glyoxal oxidase (GLOX), an extracellular H(2)O(2)-producing enzyme, has been reported in Phanerochaete chrysosporium and Ustilago maydis. We previously isolated a grapevine GLOX gene from the highly resistant to Erysiphe necator Chinese wild Vitis pseudoreticulata accession Baihe-35-1 and designated it as VpGLOX (GenBank accession no. DQ201181). Transient expression of VpGLOX can suppress Powdery Mildew in susceptible genotype were studied. To further investigate the function of the VpGLOX gene, real-time PCR and Western blot analysis were performed to examine expression patterns at transcriptional and translational levels, respectively. The results showed that VpGLOX expression at the transcriptional level increased significantly in the disease-resistant accession Baihe-35-1 after Erysiphe necator inoculation, but no significant changes in the susceptible accession, V. pseudoreticulata accession Guangxi-2 could be observed. As evident from a Western blot analysis, VpGLOX protein increased slightly in Baihe-35-1 after E. necator inoculation, but not statistical significant difference changes in Guangxi-2. The immunolocalization via immunogold electron microscopy showed that VpGLOX was mainly located in the adaxial epidermal cell wall of E. necator-inoculated leaves of both Baihe-35-1 and Guangxi-2. Agrobacterium-mediated transient expression assays revealed that VpGLOX expression could produce H(2)O(2), which may directly play a role in defense mechanism during plant-pathogen interactions. Our results could provide further insight into the biological role of VpGLOX in the defense response against E. necator in V. pseudoreticulata. PMID:23090239

  2. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    PubMed Central

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric


    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  3. NADPH oxidase and neurodegeneration.


    Hernandes, Marina S; Britto, Luiz R G


    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  4. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G


    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  5. Characterisation of full-length mitochondrial copies and partial nuclear copies (numts) of the cytochrome b and cytochrome c oxidase subunit I genes of Toxoplasma gondii, Neospora caninum, Hammondia heydorni and Hammondia triffittae (Apicomplexa: Sarcocystidae).


    Gjerde, Bjrn


    Genomic DNA was extracted from three oocyst isolates of Hammondia triffittae from foxes and two oocyst isolates of Hammondia heydorni from dogs, as well as from cell culture-derived tachyzoites of Toxoplasma gondii (RH strain) and Neospora caninum (NC-Liverpool strain), and examined by PCR with primers targeting the cytochrome b (cytb) and the cytochrome c oxidase subunit I (cox1) genes in order to characterise both genes and, if possible, the remainder of the mitochondrial genome of these species. Several primers were designed and used in various combinations to amplify regions within and between both genes and to determine gene order. When certain forward primers targeting cytb were used in combination with certain reverse primers targeting cox1, two overlapping sequences were obtained for each species and isolate studied, which showed that a full-length copy of cytb was followed 36-37bp downstream by a full-length copy of cox1, and these sequences are believed to represent the true mitochondrial genes and the gene order in the mitochondrial genome of the four species examined. The cytb of T. gondii, N. caninum, H. heydorni and H. triffittae comprised a total of 1,080bp (359 amino acids) and used ATG and TAA as start and stop codon, respectively. The cox1 of these species also used TAA as stop codon, whereas the most likely start codon was ATG, resulting in a gene comprising 1,491bp (496 amino acids). Pair-wise sequence comparisons based on either cytb or cox1 clearly separated T. gondii from N. caninum and both of these species from the two Hammondia species, whereas the latter two species were 100% identical at cytb and shared 99.3% identity at cox1. Phylogenetic analyses using the maximum-likelihood method confirmed these findings and placed T. gondii in a clade separate from the three other species and all four Toxoplasmatinae in a sister clade to Eimeria spp. PCR with other primers and/or primer pairs than those used to obtain the full-length mitochondrial genes yielded several types of about 1-1.5kb long sequences, which comprised stretches of the primer-targeted genes at both ends and an intervening non-coding sequence of various length and composition. Thus, portions of cytb could be found both upstream and downstream from portions of cox1 and portions of the same gene could be found adjacent to each other (cytb?cox1; cox1?cytb; cytb?cytb; cox1?cox1). Sequence comparisons revealed that some of these gene fragments were truncated genes, whereas others included the putative start or stop codon of the full-length mitochondrial genes. From the nature of the gene fragments and/or their flanking sequences, they are assumed to be located on the chromosomes of the nuclear genome and to represent nuclear mitochondrial DNA segments (numts) or pseudogenes. In the four species examined, there were no nucleotide differences between the full-length mitochondrial copies of cytb and cox1 and their various incomplete nuclear counterparts. With a few exceptions, identical numt types and closely similar flanking sequences were obtained for all four species, which would indicate that the original transfer of these mitochondrial genes to the nuclear genome and/or the majority of any subsequent rearrangements of these gene fragments within the nuclear genome happened before the four species diverged. Yet, there were species-specific differences in the nucleotide composition of the nuclear gene fragments, identical to the differences in the mitochondrial genes, which would indicate that the incomplete nuclear copies of cytb and cox1 have been continuously updated during evolution to conform to their mitochondrial parent genes. The PCR-based findings of numts were further supported by Basic Local Alignment Search Tool (BLAST) searches against genome sequences of T. gondii and N. caninum using the concatenated mitochondrial cytb/cox1 sequences as queries. These searches revealed the presence of numerous numts of eighth distinct types in both species, with each one having a fixed starting and end point with respect t

  6. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.


    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji


    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley. PMID:25740049

  7. [Identification of Ixodes persulcatus and Ixodes pavlovskyi occidentalis (Ixodidae) by the analysis of the gene fragment COXI (cytochrome oxidase subunit I)].


    Livanova, N N; Tikunova, N V; Livanov, S G; Fomenko, N V


    Ticks of the genus Ixodes were collected in 2010 in the lowland part of Toguchinsk district of Novosibirsk Province (Russia) and in the forest-park area of Novosibirsk Scientific Centre and its outskirts (Sovetskiy district of Novosibirsk), and identified as Ixodes persulcatus (Schulze, 1930) (18 females and 13 males) and Ixodes pavlovskyi (13 females and 10 males). Ten specimens of each sex from each collecting site were examined. The following nine characters were used: the length and width of the scutum (conscutum) and of the gnathosoma in ventral view; the length of palpal segments II-III; the width of the hypostome; the length of idiosoma with scapula, of leg I, of the medial spur on fore coxa (Taiga..., 1985; Filippova, Musatov, 1996; Filippova, Panova, 1998). According to morphometric characters, specimens of Ixodes pavlovskyi collected in the forest-park area of the Novosibirsk Scientific Centre were identified as the subspecies I. p. occidentalis Filippova et Panova, 1998. Nucleotide sequences of the COI mitochondrial gene fragment were determined for 56 ticks. Phylogenetic analysis of the COI gene fragment in representatives of the persulcatus-ricinus species-group dwelling in Asia demonstrated high degree of conservatism. Molecular-genetic methods allow reliable identification of morphologically similar species I. pavlovskyi and I. persulcatus, pathogenic for humans. PMID:23458013

  8. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells

    PubMed Central

    Dassa, Emmanuel P; Dufour, Eric; Gonalves, Srgio; Paupe, Vincent; Hakkaart, Gertjan A J; Jacobs, Howard T; Rustin, Pierre


    Cytochrome c oxidase (COX) deficiency is associated with a wide spectrum of clinical conditions, ranging from early onset devastating encephalomyopathy and cardiomyopathy, to neurological diseases in adulthood and in the elderly. No method of compensating successfully for COX deficiency has been reported so far. In vitro, COX-deficient human cells require additional glucose, pyruvate and uridine for normal growth and are specifically sensitive to oxidative stress. Here, we have tested whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) from Ciona intestinalis could alleviate the metabolic abnormalities of COX-deficient human cells either from a patient harbouring a COX15 pathological mutation or rendered deficient by silencing the COX10 gene using shRNA. We demonstrate that the expression of the AOX, well-tolerated by the cells, compensates for both the growth defect and the pronounced oxidant-sensitivity of COX-deficient human cells. PMID:20049701

  9. The Escherichia coli CydX Protein Is a Member of the CydAB Cytochrome bd Oxidase Complex and Is Required for Cytochrome bd Oxidase Activity

    PubMed Central

    VanOrsdel, Caitlin E.; Bhatt, Shantanu; Allen, Rondine J.; Brenner, Evan P.; Hobson, Jessica J.; Jamil, Aqsa; Haynes, Brittany M.; Genson, Allyson M.


    Cytochrome bd oxidase operons from more than 50 species of bacteria contain a short gene encoding a small protein that ranges from ?30 to 50 amino acids and is predicted to localize to the cell membrane. Although cytochrome bd oxidases have been studied for more than 70 years, little is known about the role of this small protein, denoted CydX, in oxidase activity. Here we report that Escherichia coli mutants lacking CydX exhibit phenotypes associated with reduced oxidase activity. In addition, cell membrane extracts from ?cydX mutant strains have reduced oxidase activity in vitro. Consistent with data showing that CydX is required for cytochrome bd oxidase activity, copurification experiments indicate that CydX interacts with the CydAB cytochrome bd oxidase complex. Together, these data support the hypothesis that CydX is a subunit of the CydAB cytochrome bd oxidase complex that is required for complex activity. The results of mutation analysis of CydX suggest that few individual amino acids in the small protein are essential for function, at least in the context of protein overexpression. In addition, the results of analysis of the paralogous small transmembrane protein AppX show that the two proteins could have some overlapping functionality in the cell and that both have the potential to interact with the CydAB complex. PMID:23749980

  10. The extreme dwarf phenotype of the GA-sensitive mutant of sunflower, dwarf2, is generated by a deletion in the ent-kaurenoic acid oxidase1 (HaKAO1) gene sequence.


    Fambrini, Marco; Mariotti, Lorenzo; Parlanti, Sandro; Picciarelli, Piero; Salvini, Mariangela; Ceccarelli, Nello; Pugliesi, Claudio


    A dwarf mutant, dw arf 2 (dw2), was isolated from sunflower (Helianthus annuus). The most obvious alterations of dw2 plants were the lack of stem growth, reduced size of leaves, petioles and flower organs, retarded flower development. Pollen and ovules were produced but the filaments failed to extrude the anthers from the corolla. The dw2 phenotype was mainly because of reduced cell size. In dw2 leaves, the dark-green color was not so much due to higher pigment content, but was correlated with a changed leaf morphology. The mutant responded to the application of bioactive gibberellins (GAs). The levels of ent-7?-hydroxykaurenoic acid, GA(19), GA(20) and GA(1) in dw2seedlings were severely decreased relative to those in its wild type (WT). ent-Kaurenoic acid was actively converted to ent-7?-hydroxykaurenoic acid in WT plants but quite poorly in dw2 plants. All together these data suggested that the dw2 mutation severely reduced the flux through the biosynthetic pathway leading to active GAs by hampering the conversion of ent-kaurenoic acid to GA(12). Two ent-kaurenoic acid oxidase (KAO) genes were identified. HaKAO1 was expressed everywhere in sunflower organs, while HaKAO2 was mainly expressed in roots. We demonstrated that a DNA deletion in HaKAO1 of dw2 generated aberrant mRNA-splicing, causing a premature stop codon in the amino acid sequence. In dw2 calli, Agrobacterium-mediated transfer of WT HaKAO1 cDNA restored the WT endogenous levels of GAs. In segregating BC(1) progeny, the deletion co-segregated with the dwarf phenotype. The deletion was generated near to a breakpoint of a more complex chromosome rearrangement. PMID:21279813

  11. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).


    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E


    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  12. Benzylamine antihyperglycemic effect is abolished by AOC3 gene invalidation in mice but not rescued by semicarbazide-sensitive amine oxidase expression under the control of aP2 promoter.


    Grs, Sandra; Bour, Sandy; Valet, Philippe; Carpn, Christian


    Semicarbazide-sensitive amine oxidase (SSAO) is a transmembrane enzyme that metabolizes primary amines from endogenous or dietary origin. SSAO is highly expressed in adipose, smooth muscle and endothelial cells. In each of these cell types, SSAO is implicated in different biological functions, such as glucose transport activation, extracellular matrix maturation and leucocyte extravasation, respectively. However, the physiological functions of SSAO and their involvement in pathogenesis remain uncompletely characterized. To better understand the role of adipose tissue SSAO, we investigated whether it was necessary and/or sufficient to produce the antihyperglycemic effect of the SSAO-substrate benzylamine, already reported in mice. Therefore, we crossed SSAO-deficient mice invalidated for AOC3 gene and transgenic mice expected to express human SSAO in an adipocyte-specific manner, under the control of aP2 promoter. The aP2-human AOC3 construct (aP2-hAOC3) was equally expressed in the adipose tissue of mice expressing or not the native murine form and almost absent in other tissues. However, the corresponding SSAO activity found in adipose tissue represented only 20 % that of control mice. As a consequence, the benzylamine antihyperglycemic effect observed during glucose tolerance test in control was abolished in AOC3-KO mice but not rescued in mice expressing aP2-hAOC3. The capacity of benzylamine or methylamine to activate glucose uptake in adipocytes exhibited parallel variations in the corresponding genotypes. Although the aP2-hAOC3 construct did not allow a total rescue of SSAO activity in adipose tissue, it could be assessed from our observations that adipocyte SSAO plays a pivotal role in the increased glucose tolerance promoted by pharmacological doses of benzylamine. PMID:22547093

  13. Novel genetic diversity within Anopheles punctimacula s.l.: Phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2)

    PubMed Central

    Loaiza, Jose R.; Scott, Marilyn E.; Bermingham, Eldredge; Sanjur, Oris I.; Rovira, Jose R.; Dutari, Larissa C.; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E.


    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3 COI), the Barcode region in the five prime end of the COI (5 COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3 COI depicted six highly supported molecular lineages (AF), none of which was An. malefactor. In contrast, phylogenetic inference with the 5 COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3 COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  14. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia


    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  15. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.


    Kang, J-H; Park, J-Y; Choi, T-J


    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

  16. Resurrection of New Caledonian maskray Neotrygon trigonoides (Myliobatoidei: Dasyatidae) from synonymy with N.kuhlii, based on cytochrome-oxidase I gene sequences and spotting patterns.


    Borsa, Philippe; Arlyza, Irma S; Chen, Wei-Jen; Durand, Jean-Dominique; Meekan, Mark G; Shen, Kang-Ning


    The maskray from New Caledonia, Neotrygon trigonoides Castelnau, 1873, has been recently synonymized with the blue-spotted maskray, N.kuhlii (Mller and Henle, 1841), a species with wide Indo-West Pacific distribution, but the reasons for this are unclear. Blue-spotted maskray specimens were collected from the Indian Ocean (Tanzania, Sumatra) and the Coral Triangle (Indonesia, Taiwan, and West Papua), and N.trigonoides specimens were collected from New Caledonia (Coral-Sea). Their partial COI gene sequences were generated to expand the available DNA-barcode database on this species, which currently comprises homologous sequences from Ningaloo Reef, the Coral Triangle and the Great Barrier Reef (Coral-Sea). Spotting patterns were also compared across regions. Haplotypes from the Coral-Sea formed a haplogroup phylogenetically distinct from all other haplotypes sampled in the Indo-West Pacific. No clear-cut geographic composition relative to DNA-barcodes or spotting patterns was apparent in N.kuhlii samples across the Indian Ocean and the Coral Triangle. The New Caledonian maskray had spotting patterns markedly different from all the other samples. This, added to a substantial level of net nucleotide divergence (2.6%) with typical N.kuhlii justifies considering the New Caledonian maskray as a separate species, for which we propose to resurrect the name Neotrygon trigonoides. PMID:23849725

  17. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta


    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  18. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-Andr; Alric, Jean; Johnson, Xenie


    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  19. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.


    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  20. Involvement of polyamine oxidase in wound healing.


    Angelini, Riccardo; Tisi, Alessandra; Rea, Giuseppina; Chen, Martha M; Botta, Maurizio; Federico, Rodolfo; Cona, Alessandra


    Hydrogen peroxide (H(2)O(2)) is involved in plant defense responses that follow mechanical damage, such as those that occur during herbivore or insect attacks, as well as pathogen attack. H(2)O(2) accumulation is induced during wound healing processes as well as by treatment with the wound signal jasmonic acid. Plant polyamine oxidases (PAOs) are H(2)O(2) producing enzymes supposedly involved in cell wall differentiation processes and defense responses. Maize (Zea mays) PAO (ZmPAO) is a developmentally regulated flavoprotein abundant in primary and secondary cell walls of several tissues. In this study, we investigated the effect of wounding on ZmPAO gene expression in the outer tissues of the maize mesocotyl and provide evidence that ZmPAO enzyme activity, protein, and mRNA levels increased in response to wounding as well as jasmonic acid treatment. Histochemically detected ZmPAO activity especially intensified in the epidermis and in the wound periderm, suggesting a tissue-specific involvement of ZmPAO in wound healing. The role played by ZmPAO-derived H(2)O(2) production in peroxidase-mediated wall stiffening events was further investigated by exploiting the in vivo use of N-prenylagmatine (G3), a selective and powerful ZmPAO inhibitor, representing a reliable diagnostic tool in discriminating ZmPAO-mediated H(2)O(2) production from that generated by peroxidase, oxalate oxidase, or by NADPH oxidase activity. Here, we demonstrate that G3 inhibits wound-induced H(2)O(2) production and strongly reduces lignin and suberin polyphenolic domain deposition along the wound, while it is ineffective in inhibiting the deposition of suberin aliphatic domain. Moreover, ZmPAO ectopic expression in the cell wall of transgenic tobacco (Nicotiana tabacum) plants strongly enhanced lignosuberization along the wound periderm, providing evidence for a causal relationship between PAO and peroxidase-mediated events during wound healing. PMID:17993545

  1. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping


    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  2. Hordeum vulgare Seedlings Amine Oxidase

    PubMed Central

    Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni


    Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

  3. Cytochrome c Oxidase Dysfunction in Oxidative Stress

    PubMed Central

    Srinivasan, Satish; Avadhani, Narayan G.


    Cytochrome c Oxidase (CcO) is the terminal oxidase of the mitochondrial electron transport chain. This bigenomic enzyme in mammals contains 13 subunits, of which, three catalytic subunits are encoded by the mitochondrial genes. The remaining ten subunits with suspected roles in the regulation, and/or, assembly are coded by the nuclear genome. The enzyme contains two heme groups (heme a and a3) and two Cu2+ centers (Cu2+ A and Cu2+ B) as catalytic centers and handles more than 90% of molecular O2 respired by the mammalian cells and tissues. CcO is a highly regulated enzyme which is believed to be the pace setter for mitochondrial oxidative metabolism and ATP synthesis. The structure and function of the enzyme is affected in a wide variety of diseases including cancer, neurodegenerative diseases, myocardial ischemia/reperfusion, bone and skeletal diseases and diabetes. Despite handling a high O2 load the role of CcO in the production of reactive oxygen species still remains a subject of debate. However, a volume of evidence suggests that CcO dysfunction is invariably associated with increased mitochondrial reactive oxygen species production and cellular toxicity. In this article we review literature on mechanisms of multimodal regulation of CcO activity by a wide spectrum of physiological and pathological factors. We also review an array of literature on the direct or indirect roles of CcO in reactive oxygen species production. PMID:22841758

  4. Genetic control of aldehyde oxidase activity and cross-reacting-material in Drosophila melanogaster.


    Meidinger, E M; Williamson, J H


    Four different genes are known to affect aldehyde oxidase activity (AO) in Drosophila melanogaster. Mutants at each of these loci eliminate AO activity and simultaneously eliminate detectable AO-crossing reacting material (AO-CRM) even though only one is the structural gene for AO (Aldoxn). The other three genes (cin1, lxd and mal) coordinately "control" the levels of activity of AO and two related enzymes, xanthine dehydrogenase (XDH) and pyridoxal oxidase (PO). Contrary to their effects on AO-CRM, neither of these three mutants eliminate XDH-CRM. A model of interaction of these enzymes and genes controlling their activities is discussed. PMID:94842

  5. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.


    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes


    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  6. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.


    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki


    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments. PMID:23832349

  7. Peroxisomal polyamine oxidase and NADPH-oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

    PubMed Central

    Andronis, Efthimios A.; Moschou, Panagiotis N.; Toumi, Imene; Roubelakis-Angelakis, Kalliopi A.


    Homeostasis of reactive oxygen species (ROS) in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA) are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd) and spermine to putrescine and Spd, respectively, is catalyzed by two peroxisomal PA oxidases (AtPAO). However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI). Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2? ), but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX). On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2? . These results suggest that the ratio of O2? /H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2? by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed. PMID:24765099

  8. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  9. Chromate reduction by rabbit liver aldehyde oxidase

    SciTech Connect

    Banks, R.B.; Cooke, R.T. Jr.


    Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

  10. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )


    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  11. Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.


    Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo


    A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 1663mV (vs. Ag?AgCl?KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.4110(-11)molcm(-2) with the apparent adsorption coefficient of 1.6310(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. PMID:24189123

  12. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.


    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho


    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  13. The Impact of Single Nucleotide Polymorphisms on Human Aldehyde OxidaseS

    PubMed Central

    Hartmann, Tobias; Terao, Mineko; Garattini, Enrico; Teutloff, Christian; Alfaro, Joshua F.; Jones, Jeffrey P.; Leimkhler, Silke


    Aldehyde oxidase (AO) is a complex molybdo-flavoprotein that belongs to the xanthine oxidase family. AO is active as a homodimer, and each 150-kDa monomer binds two distinct [2Fe2S] clusters, FAD, and the molybdenum cofactor. AO has an important role in the metabolism of drugs based on its broad substrate specificity oxidizing aromatic aza-heterocycles, for example, N1-methylnicotinamide and N-methylphthalazinium, or aldehydes, such as benzaldehyde, retinal, and vanillin. Sequencing the 35 coding exons of the human AOX1 gene in a sample of 180 Italian individuals led to the identification of relatively frequent, synonymous, missense and nonsense single-nucleotide polymorphisms (SNPs). Human aldehyde oxidase (hAOX1) was purified after heterologous expression in Escherichia coli. The recombinant protein was obtained with a purity of 95% and a yield of 50 ?g/l E. coli culture. Site-directed mutagenesis of the hAOX1 cDNA allowed the purification of protein variants bearing the amino acid changes R802C, R921H, N1135S, and H1297R, which correspond to some of the identified SNPs. The hAOX1 variants were purified and compared with the wild-type protein relative to activity, oligomerization state, and metal content. Our data show that the mutation of each amino acid residue has a variable impact on the ability of hAOX1 to metabolize selected substrates. Thus, the human population is characterized by the presence of functionally inactive hAOX1 allelic variants as well as variants encoding enzymes with different catalytic activities. Our results indicate that the presence of these allelic variants should be considered for the design of future drugs. PMID:22279051

  14. The bioenergetic role of dioxygen and the terminal oxidase(s) in cyanobacteria.


    Paumann, Martina; Regelsberger, Gnther; Obinger, Christian; Peschek, Gnter A


    Owing to the release of 13 largely or totally sequenced cyanobacterial genomes (see and ), it is now possible to critically assess and compare the most neglected aspect of cyanobacterial physiology, i.e., cyanobacterial respiration, also on the grounds of pure molecular biology (gene sequences). While there is little doubt that cyanobacteria (blue-green algae) do form the largest, most diversified and in both evolutionary and ecological respects most significant group of (micro)organisms on our earth, and that what renders our blue planet earth to what it is, viz. the O(2)-containing atmosphere, dates back to the oxygenic photosynthetic activity of primordial cyanobacteria about 3.2x10(9) years ago, there is still an amazing lack of knowledge on the second half of bioenergetic oxygen metabolism in cyanobacteria, on (aerobic) respiration. Thus, the purpose of this review is threefold: (1) to point out the unprecedented role of the cyanobacteria for maintaining the delicate steady state of our terrestrial biosphere and atmosphere through a major contribution to the poising of oxygenic photosynthesis against aerobic respiration ("the global biological oxygen cycle"); (2) to briefly highlight the membrane-bound electron-transport assemblies of respiration and photosynthesis in the unique two-membrane system of cyanobacteria (comprising cytoplasmic membrane and intracytoplasmic or thylakoid membranes, without obvious anastomoses between them); and (3) to critically compare the (deduced) amino acid sequences of the multitude of hypothetical terminal oxidases in the nine fully sequenced cyanobacterial species plus four additional species where at least the terminal oxidases were sequenced. These will then be compared with sequences of other proton-pumping haem-copper oxidases, with special emphasis on possible mechanisms of electron and proton transfer. PMID:15863101

  15. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  16. A new crystal form of human diamine oxidase.


    McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Dooley, David M; Guss, J Mitchell


    Copper amine oxidases (CAOs) are ubiquitous in nature and catalyse the oxidative deamination of primary amines to the corresponding aldehydes. Humans have three viable CAO genes (AOC1-3). AOC1 encodes human diamine oxidase (hDAO), which is the frontline enzyme for histamine metabolism. hDAO is unique among CAOs in that it has a distinct substrate preference for diamines. The structure of hDAO in space group P2(1)2(1)2(1) with two molecules in the asymmetric unit has recently been reported. Here, the structure of hDAO refined to 2.1 A resolution in space group C222(1) with one molecule in the asymmetric unit is reported. PMID:20124708

  17. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando


    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  18. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.


    Rivera-Hoyos, Claudia M; Morales-lvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmn, Edwin Alfredo; Poutou-Piales, Ral A; Reyes-Montao, Edgar Antonio; Pedroza-Rodrguez, Aura Marina; Rodrguez-Vzquez, Refugio; Cardozo-Bernal, ngela M


    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 6.46 UL-1 compared to activities of 0.13 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  19. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.


    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  20. Glucose oxidase activity of actinomycetes.


    St Vlahov, S


    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  1. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen


    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  2. Involvement of SenC in assembly of cytochrome c oxidase in Rhodobacter capsulatus.


    Swem, Danielle L; Swem, Lee R; Setterdahl, Aaron; Bauer, Carl E


    SenC, a Sco1 homolog found in the purple photosynthetic bacteria, has been implicated in affecting photosynthesis and respiratory gene expression, as well as assembly of cytochrome c oxidase. In this study, we show that SenC from Rhodobacter capsulatus is involved in the assembly of a fully functional cbb(3)-type cytochrome c oxidase, as revealed by decreased cytochrome c oxidase activity in a senC mutant. We also show that a putative copper-binding site in SenC is required for activity and that a SenC deletion phenotype can be rescued by the addition of exogenous copper to the growth medium. In addition, we demonstrate that a SenC mutation has an indirect effect on gene expression caused by a reduction in cytochrome c oxidase activity. A model is proposed whereby a reduction in cytochrome c oxidase activity impedes the flow of electrons through the respiratory pathway, thereby affecting the oxidation/reduction state of the ubiquinone pool, leading to alterations of photosystem and respiratory gene expression. PMID:16291681

  3. Cox11p is required for stable formation of the Cu(B) and magnesium centers of cytochrome c oxidase.


    Hiser, L; Di Valentin, M; Hamer, A G; Hosler, J P


    Assembly of the core subunits of the aa(3)-type cytochrome c oxidase in mitochondria and aerobic bacteria such as Rhodobacter sphaeroides requires the association of three subunits and the formation of five to seven metal centers. Several assembly proteins are required for the late stages of oxidase assembly in eukaryotes; some of these are also present in Rb. sphaeroides. To investigate the role of one of these proteins, Cox11p, the mitochondrial-like oxidase of Rb. sphaeroides was overexpressed and purified from cells that lacked cox11, the gene for Cox11p. The oxidase that assembled in the absence of Cox11p lacked Cu(B) at the active site and contained greatly reduced amounts of metal at the magnesium/manganese-binding site between subunits I and II. This inactive oxidase, however, did contain hemes a and a(3), Cu(A), and all three subunits. These results indicate that Cox11p is required at a late, perhaps final, step in the assembly of cytochrome oxidase, most likely the insertion of Cu(B). Oxidase which assembled in a strain with a low copy number of cox11 appeared nearly wild type, suggesting that Cox11p is required in substoichiometric amounts for its role in oxidase assembly. PMID:10617659

  4. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )


    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  5. Cloning, expression and biochemical characterization of the cholesterol oxidase CgChoA from Chryseobacterium gleum

    PubMed Central


    Background Cholesterol oxidases are important enzymes for applications such as the analysis of cholesterol in clinical samples, the synthesis of steroid derived drugs, and are considered as potential antibacterial drug targets. Results The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector and heterologously expressed in Escherichia coli JM109 co-transformed with pRARE2. The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion chromatography, showed a temperature optimum of 35C, and a pH optimum at 6.75 using 0.011M MOPS buffer under the tested conditions. The purified protein showed a maximum activity of 15.5 U/mg. CgChoA showed a Michaelis-Menten like kinetic behavior only when the substrate was dissolved in water and taurocholate (apparent Km?=?0.5mM). In addition, the conversion of cholesterol by CgChoA was studied via biocatalytic batches at analytical scale, and cholest-4-en-3-one was confirmed as product by HPLC-MS. Conclusion CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other organisms. Thus, the enzyme broadens the available toolbox of cholesterol oxidases for e.g. synthetic and biosensing applications. PMID:24885249

  6. A Broad Distribution of the Alternative Oxidase in Microsporidian Parasites

    PubMed Central

    Williams, Bryony A. P.; Elliot, Catherine; Burri, Lena; Kido, Yasutoshi; Kita, Kiyoshi; Moore, Anthony L.; Keeling, Patrick J.


    Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX), a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1) as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes. PMID:20169184

  7. Kinetic mechanism of monoamine oxidase A.


    Ramsay, R R


    Steady-state kinetic data for monoamine oxidase A in crude extracts suggest an exclusively ping-pong mechanism, in contrast to those for monoamine oxidase B, which indicate alternate mechanisms involving either a binary or ternary complex. In this study, with use of purified monoamine oxidase A, steady-state data for the inhibition by D-amphetamine of the oxidation of primary amines indicate the possibility of a ternary complex mechanism for monoamine oxidase A also. Stopped-flow studies demonstrate that the rate of reoxidation of reduced enzyme is enhanced by substrates but not by the product, 1-methyl-4-phenylpyridinium. Thus, for the A enzyme, the ternary complex with substrate, but not product, is reoxidized at a faster rate than the free, reduced enzyme. For both the A and B forms of monoamine oxidase, the mechanism is determined by competition between alternate pathways on the basis of the relative rate constants and dissociation constants. PMID:2021654

  8. Structure and function of mammalian aldehyde oxidases.


    Terao, Mineko; Romão, Maria João; Leimkühler, Silke; Bolis, Marco; Fratelli, Maddalena; Coelho, Catarina; Santos-Silva, Teresa; Garattini, Enrico


    Mammalian aldehyde oxidases (AOXs; EC1.2.3.1) are a group of conserved proteins belonging to the family of molybdo-flavoenzymes along with the structurally related xanthine dehydrogenase enzyme. AOXs are characterized by broad substrate specificity, oxidizing not only aromatic and aliphatic aldehydes into the corresponding carboxylic acids, but also hydroxylating a series of heteroaromatic rings. The number of AOX isoenzymes expressed in different vertebrate species is variable. The two extremes are represented by humans, which express a single enzyme (AOX1) in many organs and mice or rats which are characterized by tissue-specific expression of four isoforms (AOX1, AOX2, AOX3, and AOX4). In vertebrates each AOX isoenzyme is the product of a distinct gene consisting of 35 highly conserved exons. The extant species-specific complement of AOX isoenzymes is the result of a complex evolutionary process consisting of a first phase characterized by a series of asynchronous gene duplications and a second phase where the pseudogenization and gene deletion events prevail. In the last few years remarkable advances in the elucidation of the structural characteristics and the catalytic mechanisms of mammalian AOXs have been made thanks to the successful crystallization of human AOX1 and mouse AOX3. Much less is known about the physiological function and physiological substrates of human AOX1 and other mammalian AOX isoenzymes, although the importance of these proteins in xenobiotic metabolism is fairly well established and their relevance in drug development is increasing. This review article provides an overview and a discussion of the current knowledge on mammalian AOX. PMID:26920149

  9. Soluble CuA domain of cyanobacterial cytochrome c oxidase.


    Paumann, Martina; Lubura, Borjana; Regelsberger, Gnther; Feichtinger, Markus; Kllensberger, Gunda; Jakopitsch, Christa; Furtmller, Paul G; Peschek, Gnter A; Obinger, Christian


    The genomes of several cyanobacteria show the existence of gene clusters encoding subunits I, II, and III of aa(3)-type cytochrome c oxidase. The enzyme occurs on both plasma and thylakoid membranes of these oxygenic phototrophic prokaryotes. Here we report the expression and purification of a truncated subunit II copper A (Cu(A)) domain (i.e. the electron entry and donor binding site) of cytochrome c oxidase from the cyanobacterium Synechocystis PCC 6803 in high yield. The water-soluble purple redox-active bimetallic center displays a relatively low standard reduction potential of 216 mV. Its absorption spectrum at pH 7 is similar to that of other soluble fragments from aa(3)-type oxidases, but the insensitivity of both absorbance and circular dichroism spectra to pH suggests that it is less exposed to the aqueous milieu compared with other Cu(A) domains. Oxidation of horse heart cytochrome c by the bimetallic center follows monophasic kinetics. At pH 7 and low ionic strength the bimolecular rate constant is (2.1 +/- 0.3) x 10(4) m-1 s(-1), and the rates decrease upon the increase of ionic strength. Sequence alignment and modeling of cyanobacterial Cu(A) domains show several peculiarities such as: (i) a large insertion located between the second transmembrane region and the putative hydrophobic cytochrome c docking site, (ii) the lack of acidic residues shown to be important in the interaction between cytochrome c and Paracoccus Cu(A) domain, and (iii) an extended C terminus similar to Escherichia coli ubiquinol oxidase. PMID:14672950

  10. Purification and properties of two terminal oxidase complexes of Escherichia coli aerobic respiratory chain.


    Kita, K; Konishi, K; Anraku, Y


    Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site. PMID:2856144

  11. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.


    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  12. Alternative oxidase in animals: unique characteristics and taxonomic distribution.


    McDonald, Allison E; Vanlerberghe, Greg C; Staples, James F


    Alternative oxidase (AOX), a ubiquinol oxidase, introduces a branch point into the respiratory electron transport chain, bypassing complexes III and IV and resulting in cyanide-resistant respiration. Previously, AOX was thought to be limited to plants and some fungi and protists but recent work has demonstrated the presence of AOX in most kingdoms of life, including animals. In the present study we identified AOX in 28 animal species representing nine phyla. This expands the known taxonomic distribution of AOX in animals by 10 species and two phyla. Using bioinformatics we found AOX gene sequences in members of the animal phyla Porifera, Placozoa, Cnidaria, Mollusca, Annelida, Nematoda, Echinodermata, Hemichordata and Chordata. Using reverse-transcriptase polymerase chain reaction (RT-PCR) with degenerate primers designed to recognize conserved regions of animal AOX, we demonstrated that AOX genes are transcribed in several animals from different phyla. An analysis of full-length AOX sequences revealed an amino acid motif in the C-terminal region of the protein that is unique to animal AOXs. Animal AOX also lacks an N-terminal cysteine residue that is known to be important for AOX enzyme regulation in plants. We conclude that the presence of AOX is the ancestral state in animals and hypothesize that its absence in some lineages, including vertebrates, is due to gene loss events. PMID:19648408

  13. Cold-adapted arsenite oxidase from a psychrotolerant Polaromonas species.


    Osborne, Thomas H; Heath, Matthew D; Martin, Andrew C R; Pankowski, Jaroslaw A; Hudson-Edwards, Karen A; Santini, Joanne M


    Polaromonas sp. str. GM1 is an aerobic, psychrotolerant, heterotrophic member of the Betaproteobacteria and is the only isolate capable of oxidising arsenite at temperatures below 10 C. Sequencing of the aio gene cluster in GM1 revealed the presence of the aioB and aioA genes, which encode the arsenite oxidase but the regulatory genes typically found upstream of aioB in other members of the Proteobacteria were absent. The GM1 Aio was purified to homogeneity and was found to be a heterodimer. The enzyme contained Mo and Fe as cofactors and had, using the artificial electron acceptor 2,6-dichlorophenolindophenol, a Km for arsenite of 111.70 0.88 ?M and a Vmax of 12.16 0.30 U mg(-1), which is the highest reported specific activity for any known Aio. The temperature-activity profiles of the arsenite oxidases from GM1 and the mesophilic betaproteobacterium Alcaligenes faecalis were compared and showed that the GM1 Aio was more active at low temperatures than that of A. faecalis. A homology model of the GM1 Aio was made using the X-ray crystal structure of the Aio from A. faecalis as the template. Structural changes that account for cold adaptation were identified and it was found that these resulted in increased enzyme flexibility and a reduction in the hydrophobicity of the core. PMID:23150098

  14. Factors Affecting Reaction Kinetics of Glucose Oxidase

    NASA Astrophysics Data System (ADS)

    Johnson, Kristin A.


    Basic principles of enzyme kinetics are demonstrated using the enzyme glucose oxidase. The glucose oxidase enzymatic reaction is coupled to horseradish peroxidase, which in turn catalyzes the oxidation of a dye to a bright blue-green color. The appearance of the blue-green dye is used to monitor the course of the reaction and is quite visible in a classroom setting. A series of reactions are arranged that vary the enzyme concentration, substrate concentration, temperature, and the substrate used in the reaction. By monitoring the rate of the color change in each beaker, the reaction kinetics of glucose oxidase in each series is observed.

  15. Polyamine Oxidase5 Regulates Arabidopsis Growth through Thermospermine Oxidase Activity1[C][W

    PubMed Central

    Kim, Dong Wook; Watanabe, Kanako; Murayama, Chihiro; Izawa, Sho; Niitsu, Masaru; Michael, Anthony J.; Berberich, Thomas; Kusano, Tomonobu


    The major plant polyamines (PAs) are the tetraamines spermine (Spm) and thermospermine (T-Spm), the triamine spermidine, and the diamine putrescine. PA homeostasis is governed by the balance between biosynthesis and catabolism; the latter is catalyzed by polyamine oxidase (PAO). Arabidopsis (Arabidopsis thaliana) has five PAO genes, AtPAO1 to AtPAO5, and all encoded proteins have been biochemically characterized. All AtPAO enzymes function in the back-conversion of tetraamine to triamine and/or triamine to diamine, albeit with different PA specificities. Here, we demonstrate that AtPAO5 loss-of-function mutants (pao5) contain 2-fold higher T-Spm levels and exhibit delayed transition from vegetative to reproductive growth compared with that of wild-type plants. Although the wild type and pao5 are indistinguishable at the early seedling stage, externally supplied low-dose T-Spm, but not other PAs, inhibits aerial growth of pao5 mutants in a dose-dependent manner. Introduction of wild-type AtPAO5 into pao5 mutants rescues growth and reduces the T-Spm content, demonstrating that AtPAO5 is a T-Spm oxidase. Recombinant AtPAO5 catalyzes the conversion of T-Spm and Spm to triamine spermidine in vitro. AtPAO5 specificity for T-Spm in planta may be explained by coexpression with T-Spm synthase but not with Spm synthase. The pao5 mutant lacking T-Spm oxidation and the acl5 mutant lacking T-Spm synthesis both exhibit growth defects. This study indicates a crucial role for T-Spm in plant growth and development. PMID:24906355


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several transcription factors are involved in regulating lipid metabolism in various animal tissues. Peroxisome proliferator activated receptor (PPAR) gamma and PPAR alpha regulate both lipogenesis and fatty acid oxidation. Gene fragments for PPAR gamma, PPAR alpha, and acyl CoA oxidase (ACO) have b...

  17. Antimicrobial properties of milk: dependence on presence of xanthine oxidase and nitrite.


    Hancock, John T; Salisbury, Vyv; Ovejero-Boglione, Maria Cristina; Cherry, Robert; Hoare, Catherine; Eisenthal, Robert; Harrison, Roger


    Human and bovine milk inhibited the metabolic activity of Escherichia coli, as shown by luminescence monitoring of constructs expressing the luxCDABE genes. Inhibition was dependent on both xanthine oxidase (XO) activity and on the presence of nitrite, implying that XO-generated nitric oxide functions as an antibacterial agent. PMID:12234868

  18. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.


    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or 18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles mg?1 chlorophyll hr?1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30 minutes. No single peptide from the digested trypsin was found to be the sole activating factor. About 0.25 ?g of trypsin activated 50% the polyphenol oxidase activity in a standard chloroplast assay containing 2.1 ?g of chlorophyll. Treatment of spinach chloroplasts with tris buffer or ethylenediamine tetraacetate extracted the ATPase activity, but the polyphenol oxidase activity remained with the broken plastids. However these treatments increased the latent polyphenol oxidase activity 50- to 100-fold. Chloroplasts from a second group of plants, including alfalfa, wheat, oats, peas, and sugarcane leaves, oxidized dihydroxyphenylalanine at a rate of 11 to 120 ?moles mg?1 chlorophyll hr?1. Polyphenol oxidase in these chloroplasts required a low intensity of red light for activity. Fifty or 75% activation of the oxidase in wheat chloroplasts required 4 to 6 foot candles of light and more light was required for alfalfa chloroplasts. Blue or far red light were ineffective. Trypsin was inhibitory. Upon aging chloroplasts from wheat leaves, but not alfalfa or peas, for 5 to 7 days at 4 C the total polyphenol oxidase activity did not increase, but the activation characteristics changed to those of chloroplasts from the spinach group. Chloroplasts from a third group of plants, including bean, tomato, and corn leaves, slowly oxidized dihydroxyphenylalanine in the dark and exhibited no latency. PMID:16658308

  19. Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.


    Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui


    Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. PMID:26367330

  20. Deletion of glucose oxidase changes the pattern of organic acid production in Aspergillus carbonarius.


    Yang, Lei; Lbeck, Mette; Lbeck, Peter S


    Aspergillus carbonarius has potential as a cell factory for the production of different organic acids. At pH 5.5, A.carbonarius accumulates high amounts of gluconic acid when it grows on glucose based medium whereas at low pH, it produces citric acid. The conversion of glucose to gluconic acid is carried out by secretion of the enzyme, glucose oxidase. In this work, the gene encoding glucose oxidase was identified and deleted from A. carbonarius with the aim of changing the carbon flux towards other organic acids. The effect of genetic engineering was examined by testing glucose oxidase deficient (?gox) mutants for the production of different organic acids in a defined production medium. The results obtained showed that the gluconic acid accumulation was completely inhibited and increased amounts of citric acid, oxalic acid and malic acid were observed in the ?gox mutants. PMID:25401063

  1. Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes.


    Kersten, Phil; Cullen, Dan


    Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues are conserved, but five subfamilies are recognized. Glyoxal oxidase, the most intensively studied representative, has been shown physiologically connected to lignin peroxidase. Relatively little is known about structure-function relationships among more recently discovered copper radical oxidases. Nevertheless, differences in substrate preferences have been observed in one case and the proteins have been detected in filtrates of various wood-grown cultures. Such diversity may reflect adaptations to host cell wall composition and changing environmental conditions. PMID:24915038

  2. Deletion of glucose oxidase changes the pattern of organic acid production in Aspergillus carbonarius

    PubMed Central


    Aspergillus carbonarius has potential as a cell factory for the production of different organic acids. At pH 5.5, A.carbonarius accumulates high amounts of gluconic acid when it grows on glucose based medium whereas at low pH, it produces citric acid. The conversion of glucose to gluconic acid is carried out by secretion of the enzyme, glucose oxidase. In this work, the gene encoding glucose oxidase was identified and deleted from A. carbonarius with the aim of changing the carbon flux towards other organic acids. The effect of genetic engineering was examined by testing glucose oxidase deficient (Δgox) mutants for the production of different organic acids in a defined production medium. The results obtained showed that the gluconic acid accumulation was completely inhibited and increased amounts of citric acid, oxalic acid and malic acid were observed in the Δgox mutants. PMID:25401063

  3. Azide inhibition of urate oxidase.


    Gabison, Laure; Colloc'h, Nathalie; Prangé, Thierry


    The inhibition of urate oxidase (UOX) by azide was investigated by X-ray diffraction techniques and compared with cyanide inhibition. Two well characterized sites for reagents are present in the enzyme: the dioxygen site and the substrate-binding site. To examine the selectivity of these sites towards azide inhibition, several crystallization conditions were developed. UOX was co-crystallized with azide (N3) in the presence or absence of either uric acid (UA, the natural substrate) or 8-azaxanthine (8AZA, a competitive inhibitor). In a second set of experiments, previously grown orthorhombic crystals of the UOX-UA or UOX-8AZA complexes were soaked in sodium azide solutions. In a third set of experiments, orthorhombic crystals of UOX with the exchangeable ligand 8-nitroxanthine (8NXN) were soaked in a solution containing uric acid and azide simultaneously (competitive soaking). In all assays, the soaking periods were either short (a few hours) or long (one or two months). These different experimental conditions showed that one or other of the sites, or the two sites together, could be inhibited. This also demonstrated that azide not only competes with dioxygen as cyanide does but also competes with the substrate for its enzymatic site. A model in agreement with experimental data would be an azide in equilibrium between two sites, kinetically in favour of the dioxygen site and thermodynamically in favour of the substrate-binding site. PMID:25005084

  4. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.


    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  5. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa


    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  6. Plant and animal glycolate oxidases have a common eukaryotic ancestor and convergently duplicated to evolve long-chain 2-hydroxy acid oxidases.


    Esser, Christian; Kuhn, Anke; Groth, Georg; Lercher, Martin J; Maurino, Veronica G


    Glycolate oxidase (GOX) is a crucial enzyme of plant photorespiration. The encoding gene is thought to have originated from endosymbiotic gene transfer between the eukaryotic host and the cyanobacterial endosymbiont at the base of plantae. However, animals also possess GOX activities. Plant and animal GOX belong to the gene family of (L)-2-hydroxyacid-oxidases ((L)-2-HAOX). We find that all (L)-2-HAOX proteins in animals and archaeplastida go back to one ancestral eukaryotic sequence; the sole exceptions are green algae of the chlorophyta lineage. Chlorophyta replaced the ancestral eukaryotic (L)-2-HAOX with a bacterial ortholog, a lactate oxidase that may have been obtained through the primary endosymbiosis at the base of plantae; independent losses of this gene may explain its absence in other algal lineages (glaucophyta, rhodophyta, and charophyta). We also show that in addition to GOX, plants possess (L)-2-HAOX proteins with different specificities for medium- and long-chain hydroxyacids (lHAOX), likely involved in fatty acid and protein catabolism. Vertebrates possess lHAOX proteins acting on similar substrates as plant lHAOX; however, the existence of GOX and lHAOX subfamilies in both plants and animals is not due to shared ancestry but is the result of convergent evolution in the two most complex eukaryotic lineages. On the basis of targeting sequences and predicted substrate specificities, we conclude that the biological role of plantae (L)-2-HAOX in photorespiration evolved by co-opting an existing peroxisomal protein. PMID:24408912

  7. Early adventitial activation characterized by NADPH oxidase expression and neovascularization in an aortic transplantation model.


    Sun, Mengyao; Ji, Jian; Guo, Xiaotong; Liu, Wenjun; Wang, Yanyan; Ma, Siqin; Hu, Weicheng; Wang, Jianli; Jiang, Fan


    Increasing evidence has suggested that arterial adventitia may contribute to pathological vessel remodeling by producing reactive oxygen species and promoting neovascularization. However, these processes have not been studied yet in transplantation-induced vascular pathologies. We characterized the dynamic changes in NADPH oxidase expression and adventitial angiogenic response in a model of allograft aortic transplantation. The thoracic aorta from Fischer 344 rats were transplanted into the abdominal aorta of Lewis rats. Graft specimens were collected on days 0.5, 3, 7, and 14 for morphometry, immunohistochemistry, immunofluorescence staining, and quantitative PCR tests. Following transplantation, adventitial thickening was found as early as day 3, while neointima was observed from day 7. As compared to normal adventitial tissue, the expression levels of NADPH oxidase subunits gp91phox and p47phox in graft adventitia were elevated from day 3 and further increased up to day 14. Immunohistochemistry staining showed that infiltrating macrophages appeared to be a major source of NADPH oxidase expression. Increases in NADPH oxidase expression were also detected in fibroblasts isolated from the graft adventitia. Gene silencing of p47phox significantly suppressed proliferation and migration of the graft fibroblast cells. We also showed that adventitial thickening was accompanied by increased adventitial neovascularization; at day 14, there was a positive correlation between the density of adventitial microvessels and the neointimal thickness. Transplantation injury induces NADPH oxidase expression and neovascularization in the adventitia, raising the possibility that the activated adventitia may represent a target site for prevention of transplantation-induced transplant vasculopathy. PMID:26655438

  8. Targeting NADPH oxidases in vascular pharmacology

    PubMed Central

    Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J


    Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the selective inhibition of dysfunctional NADPH oxidase homologs. This appears to be the most reasonable approach, potentially much more efficient than non-selective scavenging of all ROS by the administration of antioxidants. PMID:22405985

  9. Comparative characterization of three D-aspartate oxidases and one D-amino acid oxidase from Caenorhabditis elegans.


    Katane, Masumi; Saitoh, Yasuaki; Seida, Yousuke; Sekine, Masae; Furuchi, Takemitsu; Homma, Hiroshi


    Previously, we cloned cDNAs for four Caenorhabditis elegans genes (F20 Hp, C47Ap, F18Ep, and Y69Ap genes) that were annotated in the database as encoding D-amino acid oxidase (DAO) or D-aspartate oxidase (DDO) proteins. These genes were expressed in Escherichia coli, and the recombinant C47Ap and F18Ep were shown to have functional DDO activities, while Y69Ap had functional DAO activity. In this study, we improved the E. coli culture conditions for the production of recombinant F20 Hp and, following purification of the protein, revealed that it has functional DDO activity. The kinetic properties of recombinant C47Ap (DDO-1), F18Ep (DDO-2), F20 Hp (DDO-3), and Y69Ap (DAO) were also determined and compared with recombinant human DDO and DAO. In contrast to the low catalytic efficiency of human DDO for D-Glu, all three C. elegans DDOs showed higher catalytic efficiencies for D-Glu than D-Asp or N-methyl-D-Asp. The catalytic efficiency of C. elegans DAO for D-Ser was substantially lower than that of human DAO, while the C. elegans DAO was more efficient at deamination of basic D-amino acids (D-Arg and D-His) than human DAO. Collectively, our results indicate that C. elegans contains at least three genes that encode functional DDOs, and one gene encoding a functional DAO, and that these enzymes have different and distinctive properties. PMID:20564561

  10. Immunoblot analyses of the elicited Sanguinaria canadensis enzyme, dihydrobenzophenanthridine oxidase: evidence for resolution from a polyphenol oxidase isozyme.


    Ignatov, A; Neuman, M C; Barg, R; Krueger, R J; Coscia, C J


    In our initial purification of dihydrobenzophenanthridine oxidase from Sanguinaria canadensis plant cell cultures, we reported that our most purified preparations contained a major band at 77 kDa and minor lower Mr bands. Here we present evidence on highly purified dihydrobenzophenanthridine oxidase from elicited S. canadensis cultures to indicate that this enzyme is the 77-kDa protein and that lower Mr bands include an isozyme(s) of the polyphenol oxidase family that copurifies with it. An antibody raised against the 77-kDa protein and an anti-polyphenol oxidase antibody that recognizes a 70-kDa band were used to monitor chromatographic fractions by immunoblot analysis of the oxidases. Oxidase-containing eluates from DEAE-Sephadex, CM, and HiTrap blue were compared to corresponding flow-through fractions. Bands at 77 and 88 kDa were detected with anti-dihydrobenzophenanthridine oxidase antibody in eluates displaying high dihydrobenzophenanthridine oxidase activity. Polyphenol oxidase specific activity and immunoreactivity partitioned both in flow-through and eluate fractions of the CM and HiTrap columns. Estimation of the dihydrobenzophenanthridine oxidase and polyphenol oxidase specific activities for each step showed increasing enrichment of alkaloidal enzyme accompanied by variable dihydrobenzophenanthridine oxidase/polyphenol oxidase activity ratios. Taken together these observations indicate that the dihydrobenzophenanthridine and polyphenol oxidases have Mr values of 77 and 70 kDa, respectively, and the two enzymes are different entities. PMID:9367526

  11. The composition of milk xanthine oxidase

    PubMed Central

    Hart, L. I.; McGartoll, Mary A.; Chapman, Helen R.; Bray, R. C.


    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed `de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in `milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed `inactivated xanthine oxidase', causes variability in activity relative to E450 or to Mo content and formation of it decreases these ratios during storage of enzyme samples including samples free from demolybdo-xanthine oxidase. We conclude that even the best purified xanthine oxidase samples described here and by other workers are contaminated by significant amounts of the inactivated form. This may complicate the interpretation of changes in the enzyme taking place during the slow phase of reduction by substrates. Attempts to remove iron from the enzyme by published methods were not successful. ImagesFig. 2. PMID:5441374

  12. The composition of milk xanthine oxidase.


    Hart, L I; McGartoll, M A; Chapman, H R; Bray, R C


    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed ;de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in ;milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed ;inactivated xanthine oxidase', causes variability in activity relative to E(450) or to Mo content and formation of it decreases these ratios during storage of enzyme samples including samples free from demolybdo-xanthine oxidase. We conclude that even the best purified xanthine oxidase samples described here and by other workers are contaminated by significant amounts of the inactivated form. This may complicate the interpretation of changes in the enzyme taking place during the slow phase of reduction by substrates. Attempts to remove iron from the enzyme by published methods were not successful. PMID:5441374

  13. Alternative oxidase: distribution, induction, properties, structure, regulation, and functions.


    Rogov, A G; Sukhanova, E I; Uralskaya, L A; Aliverdieva, D A; Zvyagilskaya, R A


    The respiratory chain in the majority of organisms with aerobic type metabolism features the concomitant existence of the phosphorylating cytochrome pathway and the cyanide- and antimycin A-insensitive oxidative route comprising a so-called alternative oxidase (AOX) as a terminal oxidase. In this review, the history of AOX discovery is described. Considerable evidence is presented that AOX occurs widely in organisms at various levels of organization and is not confined to the plant kingdom. This enzyme has not been found only in Archaea, mammals, some yeasts and protists. Bioinformatics research revealed the sequences characteristic of AOX in representatives of various taxonomic groups. Based on multiple alignments of these sequences, a phylogenetic tree was constructed to infer their possible evolution. The ways of AOX activation, as well as regulatory interactions between AOX and the main respiratory chain are described. Data are summarized concerning the properties of AOX and the AOX-encoding genes whose expression is either constitutive or induced by various factors. Information is presented on the structure of AOX, its active center, and the ubiquinone-binding site. The principal functions of AOX are analyzed, including the cases of cell survival, optimization of respiratory metabolism, protection against excess of reactive oxygen species, and adaptation to variable nutrition sources and to biotic and abiotic stress factors. It is emphasized that different AOX functions complement each other in many instances and are not mutually exclusive. Examples are given to demonstrate that AOX is an important tool to overcome the adverse aftereffects of restricted activity of the main respiratory chain in cells and whole animals. This is the first comprehensive review on alternative oxidases of various organisms ranging from yeasts and protists to vascular plants. PMID:25749168

  14. The impact of single nucleotide polymorphisms on human aldehyde oxidase.


    Hartmann, Tobias; Terao, Mineko; Garattini, Enrico; Teutloff, Christian; Alfaro, Joshua F; Jones, Jeffrey P; Leimkhler, Silke


    Aldehyde oxidase (AO) is a complex molybdo-flavoprotein that belongs to the xanthine oxidase family. AO is active as a homodimer, and each 150-kDa monomer binds two distinct [2Fe2S] clusters, FAD, and the molybdenum cofactor. AO has an important role in the metabolism of drugs based on its broad substrate specificity oxidizing aromatic aza-heterocycles, for example, N(1)-methylnicotinamide and N-methylphthalazinium, or aldehydes, such as benzaldehyde, retinal, and vanillin. Sequencing the 35 coding exons of the human AOX1 gene in a sample of 180 Italian individuals led to the identification of relatively frequent, synonymous, missense and nonsense single-nucleotide polymorphisms (SNPs). Human aldehyde oxidase (hAOX1) was purified after heterologous expression in Escherichia coli. The recombinant protein was obtained with a purity of 95% and a yield of 50 ?g/l E. coli culture. Site-directed mutagenesis of the hAOX1 cDNA allowed the purification of protein variants bearing the amino acid changes R802C, R921H, N1135S, and H1297R, which correspond to some of the identified SNPs. The hAOX1 variants were purified and compared with the wild-type protein relative to activity, oligomerization state, and metal content. Our data show that the mutation of each amino acid residue has a variable impact on the ability of hAOX1 to metabolize selected substrates. Thus, the human population is characterized by the presence of functionally inactive hAOX1 allelic variants as well as variants encoding enzymes with different catalytic activities. Our results indicate that the presence of these allelic variants should be considered for the design of future drugs. PMID:22279051

  15. The interactions of milacemide with monoamine oxidase.


    O'Brien, E M; Tipton, K F; McCrodden, J M; Youdim, M B


    The interactions of the anticonvulsant drug milacemide (2-n-pentylaminoacetamide) with rat liver mitochondrial monoamine oxidases-A and -B have been studied. The compound acts as a substrate for the B-form of the enzyme, with an apparent Km value of 49 +/- 4.7 microM and a Vmax value of 1.1 +/- 0.2 nmol/min/mg. It is also a time-dependent irreversible inhibitor of that enzyme. Any activity of monoamine oxidase-A towards this substrate was too low to allow accurate determinations to be made by either luminometric determination of H2O2 formation or spectrophotometric coupling of aldehyde formation to NAD+ reduction in the presence of aldehyde dehydrogenase. Milacemide was a reversible competitive inhibitor towards monoamine oxidase-A. The inhibitor constant (Ki) was 115 +/- 35 microM indicating a higher affinity than that towards monoamine oxidase-B, which was also competitively inhibited in the absence of enzyme-inhibitor preincubation (Ki = 331 +/- 185 microM). Determination of the formation of H2O2 and the aldehyde product of the oxidative cleavage of milacemide by purified monoamine oxidase-B from ox liver indicated that cleavage resulted solely in the formation of pentanal and glycinamide. There was no evidence for alternative cleavage to pentylamine and oxamaldehyde. PMID:8129740

  16. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    SciTech Connect

    Xu, Yun-Ling; Li, Li; Wu, Keqiang


    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.

  17. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.


    Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A


    The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway. PMID:7604047

  18. Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness

    ERIC Educational Resources Information Center

    Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen


    Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G × E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G × E occurs in infants. We therefore examined whether MAOA G × E predicts infant anger proneness, a temperamental…

  19. Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness

    ERIC Educational Resources Information Center

    Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen


    Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G E occurs in infants. We therefore examined whether MAOA G E predicts infant anger proneness, a temperamental

  20. Complete genome sequence of the melanogenic marine bacterium Marinomonas mediterranea type strain (MMB-1T)

    SciTech Connect

    Lucas-Elio, Patricia; Goodwin, Lynne A.; Woyke, Tanja; Pitluck, Sam; Nolan, Matt; Kyrpides, Nikos C; Detter, J C; Copeland, A; Teshima, Hazuki; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Land, Miriam L; Ivanova, N; Mikhailova, Natalia; Johnston, Andrew W. B.; Sanchez-Amat, Antonio


    Marinomonas mediterranea MMB-1 T Solano & Sanchez-Amat 1999 belongs to the family Oceanospirillaceae within the phylum Proteobacteria. This species is of interest because it is the only species described in the genus Marinomonas to date that can synthesize melanin pigments, which is mediated by the activity of a tyrosinase. M. mediterranea expresses other oxidases of biotechnological interest, such as a multicopper oxidase with laccase activity and a novel L-lysine-epsilon-oxidase. The 4,684,316 bp long genome harbors 4,228 proteincoding genes and 98 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  1. Identification, Purification, and Characterization of Iminodiacetate Oxidase from the EDTA-Degrading Bacterium BNC1

    PubMed Central

    Liu, Yong; Louie, Tai Man; Payne, Jason; Bohuslavek, Jan; Bolton, Harvey; Xun, Luying


    Microbial degradation of synthetic chelating agents, such as EDTA and nitrilotriacetate (NTA), may help immobilizing radionuclides and heavy metals in the environment. The EDTA- and NTA-degrading bacterium BNC1 uses EDTA monooxygenase to oxidize NTA to iminodiacetate (IDA) and EDTA to ethylenediaminediacetate (EDDA). IDA- and EDDA-degrading enzymes have not been purified and characterized to date. In this report, an IDA oxidase was purified to apparent homogeneity from strain BNC1 by using a combination of eight purification steps. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single protein band of 40 kDa, and by using size exclusion chromatography, we estimated the native enzyme to be a homodimer. Flavin adenine dinucleotide was determined as its prosthetic group. The purified enzyme oxidized IDA to glycine and glyoxylate with the consumption of O2. The temperature and pH optima for IDA oxidation were 35°C and 8, respectively. The apparent Km for IDA was 4.0 mM with a kcat of 5.3 s−1. When the N-terminal amino acid sequence was determined, it matched exactly with that encoded by a previously sequenced hypothetical oxidase gene of BNC1. The gene was expressed in Escherichia coli, and the gene product as a C-terminal fusion with a His tag was purified by a one-step nickel affinity chromatography. The purified fusion protein had essentially the same enzymatic activity and properties as the native IDA oxidase. IDA oxidase also oxidized EDDA to ethylenediamine and glyoxylate. Thus, IDA oxidase is likely the second enzyme in both NTA and EDTA degradation pathways in strain BNC1. PMID:11157233

  2. Effect of naphthalene on cytochrome oxidase activity

    SciTech Connect

    Harmon, H.J.


    Previous reports have demonstrated that naphthalene inhibits oxygen consumption in Daphnia magna tissue culture cells, and intact mitochondria and submitochondrial particles. These studies were extended to algal mitochondrial respiration as well as photosynthetic activity. The authors were able to demonstrate the specific site of apparent respiratory inhibition to be coenzyme Q (ubiquinone, UQ) and later to demonstrate the molecular basis of this inhibition at ubiquinone. The authors previously could not demonstrate an effect of naphthalene on cytochrome oxidase activity. However, the observation that naphthalene can stimulate respiration in algae prompted the reinvestigation of the effect of naphthalene on the kinetics of cytochrome oxidase. Cytochrome oxidase is a multi-subunit membranous protein responsible for the oxidation of cytochrome c and the reduction of molecular oxygen to water. Because of the complicated nature and mechanism of this enzyme, the potential exists for multiple and possibly opposite effects of naphthalene on its function.

  3. A comparative study of hydroxyindole oxidases

    PubMed Central

    Blaschko, H.; Levine, W. G.


    A comparative study has been carried out of the oxidation of 5-hydroxytryptamine and related compounds by the oxidase present in the gill plates of Mytilus edulis and of caeruloplasmin, the copper containing oxidase of mammalian plasma. Both preparations oxidized indole derivatives carrying a hydroxyl group in the 4-, 5-, 6-, or 7- position. The oxidation of bufoteni ne was compared with that of its 4- and 6-hydroxy analogues; the 4-hydroxy analogue is psil ocine, a naturally occurring hallucinogenic compound. Bufotenine and the 6-hydroxy analogue were oxidized by both preparations with the formation of brown pigments; psilocine was more rapidly oxidized with the appearance of a blue colour. 4-Hydroxytryptamine and 7-hydroxytryptamine were also oxidized, the former with the formation of a blue compound. The N-1-methyl derivatives of both bufotenine and psilocine were also oxidized. The Mytilus preparation acted also on 4-, 5-, and 7-hydroxytryptophan and on 5-hydroxyindole, none of which was oxidized by caeruloplasmin. The Mytilus enzyme also oxidized 5-hydroxyindoleacetic acid. Paraphenylenediamine, a very good substrate of caeruloplasmin, was much more slowly oxidized by the gill plate enzyme. The evidence suggests that the two enzymes catalyse the same reactions, but that the substrate specificity of the mammalian oxidase is somewhat more restricted. Both enzymes are hydroxyindole oxidases, not specific for 5-hydroxyindoles alone. Inhibitors of the Mytilus oxidase included inhibitors of copper enzymes but not edetate or carbon monoxide. The action of pig serum on 5-hydroxytryptamine was due to caeruloplasmin and not to amine oxidase. PMID:19108143

  4. Relationship of cytochrome caa sub 3 from Thermus thermophilus to other heme- and copper-containing terminal oxidases

    SciTech Connect

    Mather, M.W.; Springer, P.; Fee, J.A.


    Cytochrome oxidases are a key component of the energy metabolism of most aerobic organisms from mammals to bacteria. They are the final enzyme of the membrane associated respiratory chain responsible for converting the chemical energy of reduced substrates to a transmembrane electrochemical potential, which issused by the cell for a wide variety of energy-requiring processes. The most widely studied oxidase is the cytochrome c oxidase of the mammalian mitochondrion. This complex, integral membrane protein contains 13 subunits and four canonical metal centers: heme center a and a{sub 3}; copper centers CU{sub A} and CU{sub B}. It is responsible for electron transfer from reduced chytochrome c to dioxygen with the concomitant reduction of dioxygen to water and the coupled vectorial transfer of protons across the mitochondrial membrane. In this communication we will describe preliminary results of DNA sequencing experiments with the cytochrome caa{sub 3} oxidase, initially undertaken to determine the nature of the subunits of this oxidase and shed light on the distribution of the metal centers. We will speculate on oxidase gene and protein structures and evolutionary relationships in the light of these results and recent sequencing results from other groups. 47 refs., 4 figs., 1 tab.

  5. Thermostable Xanthine Oxidase Activity from Bacillus pumilus RL-2d Isolated from Manikaran Thermal Spring: Production and Characterization.


    Sharma, Nirmal Kant; Thakur, Shikha; Thakur, Neerja; Savitri; Bhalla, Tek Chand


    Xanthine oxidase is an important enzyme of purine metabolism that catalyzes the hydroxylation of hypoxanthine to xanthine and then xanthine to uric acid. A thermostable xanthine oxidase is being reported from a thermophilic organism RL-2d isolated from the Manikaran (Kullu) hot spring of Himachal Pradesh (India). Based on the morphology, physiological tests, and 16S rDNA gene sequence, RL-2d was identified as Bacillus pumilus. Optimization of physiochemical parameters resulted into 4.1-fold increase in the xanthine oxidase activity from 0.051U/mg dcw (dry cell weight) to 0.209U/mg dcw. The xanthine oxidase of B. pumilus RL-2d has exhibited very good thermostability and its t1/2 at 70 and 80C were 5 and 1h, respectively. Activity of this enzyme was strongly inhibited by Hg(2+), Ag(+) and allopurinol. The investigation showed that B. pumilus RL-2d exhibited highest xanthine oxidase activity and remarkable thermostability among the other xanthine oxidases reported so far. PMID:26843701

  6. A human SCO2 mutation helps define the role of Sco1p in the cytochrome oxidase assembly pathway.

    TOXLINE Toxicology Bibliographic Information

    Dickinson EK; Adams DL; Schon EA; Glerum DM


    Deficiencies in cytochrome oxidase, the terminal enzyme of the mitochondrial respiratory chain, are most often caused by an inability to complete assembly of the enzyme. Pathogenic mutations in SCO2, which encodes a cytochrome oxidase assembly factor, were recently described in several cases of fatal infantile cardioencephalomyopathy. To determine the molecular etiology of these disorders, we describe the generation and characterization of the parallel mutations in the homologous yeast SCO1 gene. We show that the E155K yeast sco1 mutant is respiration-competent, whereas the S240F mutant is not. Interestingly, the S240F mutation allows partial but incorrect assembly of cytochrome oxidase, as judged by an altered cytochrome aa(3) peak. Immunoblot analysis reveals a specific absence of subunit 2 from the cytochrome oxidase in this mutant. Taken together, our data suggest that Sco1p provides copper to the Cu(A) site on subunit 2 at a step occurring late in the assembly pathway. This is the first instance of a yeast cytochrome oxidase assembly mutant that is partially assembled. The S240F mutant also represents a powerful new tool with which to elucidate further steps in the cytochrome oxidase assembly pathway.

  7. A diminution in ascorbate oxidase activity affects carbon allocation and improves yield in tomato under water deficit.


    Garchery, Ccile; Gest, No; Do, Phuc T; Alhagdow, Moftah; Baldet, Pierre; Menard, Guillaume; Rothan, Christophe; Massot, Capucine; Gautier, Hlne; Aarrouf, Jawad; Fernie, Alisdair R; Stevens, Rebecca


    The regulation of carbon allocation between photosynthetic source leaves and sink tissues in response to stress is an important factor controlling plant yield. Ascorbate oxidase is an apoplastic enzyme, which controls the redox state of the apoplastic ascorbate pool. RNA interference was used to decrease ascorbate oxidase activity in tomato (Solanum lycopersicum L.). Fruit yield was increased in these lines under three conditions where assimilate became limiting for wild-type plants: when fruit trusses were left unpruned, when leaves were removed or when water supply was limited. Several alterations in the transgenic lines could contribute to the improved yield and favour transport of assimilate from leaves to fruits in the ascorbate oxidase lines. Ascorbate oxidase plants showed increases in stomatal conductance and leaf and fruit sugar content, as well as an altered apoplastic hexose:sucrose ratio. Modifications in gene expression, enzyme activity and the fruit metabolome were coherent with the notion of the ascorbate oxidase RNAi lines showing altered sink strength. Ascorbate oxidase may therefore be a target for strategies aimed at improving water productivity in crop species. PMID:22725103

  8. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2013 CFR


    ... Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase... ingredient that will react with cytochrome oxidase. When cytochrome oxidase is present, the swab turns a...

  9. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2012 CFR


    ... Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase... ingredient that will react with cytochrome oxidase. When cytochrome oxidase is present, the swab turns a...

  10. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2014 CFR


    ... Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase... ingredient that will react with cytochrome oxidase. When cytochrome oxidase is present, the swab turns a...

  11. The Elusive Third Subunit IIa of the Bacterial B-Type Oxidases: The Enzyme from the Hyperthermophile Aquifex aeolicus

    PubMed Central

    Prunetti, Laurence; Brugna, Myriam; Lebrun, Rgine; Giudici-Orticoni, Marie-Thrse; Guiral, Marianne


    The reduction of molecular oxygen to water is catalyzed by complicated membrane-bound metallo-enzymes containing variable numbers of subunits, called cytochrome c oxidases or quinol oxidases. We previously described the cytochrome c oxidase II from the hyperthermophilic bacterium Aquifex aeolicus as a ba3-type two-subunit (subunits I and II) enzyme and showed that it is included in a supercomplex involved in the sulfide-oxygen respiration pathway. It belongs to the B-family of the heme-copper oxidases, enzymes that are far less studied than the ones from family A. Here, we describe the presence in this enzyme of an additional transmembrane helix subunit IIa, which is composed of 41 amino acid residues with a measured molecular mass of 5105 Da. Moreover, we show that subunit II, as expected, is in fact longer than the originally annotated protein (from the genome) and contains a transmembrane domain. Using Aquifex aeolicus genomic sequence analyses, N-terminal sequencing, peptide mass fingerprinting and mass spectrometry analysis on entire subunits, we conclude that the B-type enzyme from this bacterium is a three-subunit complex. It is composed of subunit I (encoded by coxA2) of 59000 Da, subunit II (encoded by coxB2) of 16700 Da and subunit IIa which contain 12, 1 and 1 transmembrane helices respectively. A structural model indicates that the structural organization of the complex strongly resembles that of the ba3 cytochrome c oxidase from the bacterium Thermus thermophilus, the IIa helical subunit being structurally the lacking N-terminal transmembrane helix of subunit II present in the A-type oxidases. Analysis of the genomic context of genes encoding oxidases indicates that this third subunit is present in many of the bacterial oxidases from B-family, enzymes that have been described as two-subunit complexes. PMID:21738733

  12. Cyanobacterial lactate oxidases serve as essential partners in N2 fixation and evolved into photorespiratory glycolate oxidases in plants.


    Hackenberg, Claudia; Kern, Ramona; Hge, Jan; Stal, Lucas J; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin


    Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N(2)-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high L-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N(2)-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N(2) fixation was more sensitive to O(2) in the ?lox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O(2)-scavenging enzyme to protect nitrogenase in extant N(2)-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

  13. Spatiotemporal Localization of d-Amino Acid Oxidase and d-Aspartate Oxidases during Development in Caenorhabditis elegans

    PubMed Central

    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito


    Recent investigations have shown that a variety of d-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. d-Amino acid oxidase (DAO) and d-aspartate oxidase (DDO) are degradative enzymes stereospecific for d-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of d-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several d- and l-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and d-amino acids in multicellular organisms. PMID:22393259

  14. Spatiotemporal localization of D-amino acid oxidase and D-aspartate oxidases during development in Caenorhabditis elegans.


    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito; Homma, Hiroshi


    Recent investigations have shown that a variety of D-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. D-Amino acid oxidase (DAO) and D-aspartate oxidase (DDO) are degradative enzymes stereospecific for D-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of D-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several D- and L-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and D-amino acids in multicellular organisms. PMID:22393259

  15. A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio.


    Hernández-Romero, Diana; Sanchez-Amat, Antonio; Solano, Francisco


    The sequencing of the genome of Ralstonia solanacearum[Salanoubat M, Genin S, Artiguenave F, et al. (2002) Nature 415, 497-502] revealed several genes that putatively code for polyphenol oxidases (PPOs). This soil-borne pathogenic bacterium withers a wide range of plants. We detected the expression of two PPO genes (accession numbers NP_518458 and NP_519622) with high similarity to tyrosinases, both containing the six conserved histidines required to bind the pair of type-3 copper ions at the active site. Generation of null mutants in those genes by homologous recombination mutagenesis and protein purification allowed us to correlate each gene with its enzymatic activity. In contrast with all tyrosinases so far studied, the enzyme NP_518458 shows higher monophenolase than o-diphenolase activity and its initial activity does not depend on the presence of l-dopa cofactor. On the other hand, protein NP_519622 is an enzyme with a clear preference to oxidize o-diphenols and only residual monophenolase activity, behaving as a catechol oxidase. These catalytic characteristics are discussed in relation to two other characteristics apart from the six conserved histidines. One is the putative presence of a seventh histidine which interacts with the carboxy group on the substrate and controls the preference for carboxylated and decarboxylated substrates. The second is the size of the residue isosteric with the aromatic F261 reported in sweet potato catechol oxidase which acts as a gate to control accessibility to CuA at the active site. PMID:16403014

  16. Inhibitory effects of phenolics on xanthine oxidase.


    Chang, W S; Chang, Y H; Lu, F J; Chiang, H C


    The stems of Bougainvillea spectabillis Wild (Nyctaginaceae) have been used in folk medicine against hepatitis. Spinasterol, 22, 23-dihydrospinasterol and caffeic acid were isolated from the plant stems and characterized. Caffeic acid has not been previously isolated from this plant but spinasterol has been isolated from the leaves. Caffeic acid was found to be the active principle exhibiting strong inhibition of xanthine oxidase in this study (IC50 = 39.21 microM). In order to study the structure-activity relationship of the phenolics as regards xanthine oxidase inhibition, twelve naturally occurring phenolics (esculetin, scopoletin, scoparone, barbaloin, berberine chloride, sinomenine, osthole, paeonol, honokiol, magnolol, methyleugenol and 6-gingerol) were tested for their inhibitory effects on xanthine oxidase. The results showed that esculetin displayed the strongest activity (IC50 = 28.4 microM), and induced competitive inhibition of the enzyme with respect to the substrate xanthine. The apparent inhibition constant (Ki) of esculetin was 2.369 x 10(-6) M. Since xanthine oxidase serum levels are increased in hepatic and brain tumors, caffeic acid and esculetin should be tested as anti-hepatitis or/and anticancer agents. PMID:8017853

  17. NADPH oxidase involvement in cellular integrity.


    Macpherson, Neil; Takeda, Seiji; Shang, Zhonglin; Dark, Adeeba; Mortimer, Jennifer C; Brownlee, Colin; Dolan, Liam; Davies, Julia M


    NADPH oxidase activity is involved in plant adaptation and development. The reactive oxygen species sourced by NADPH oxidase activity may contribute to wall strength and protoplast volume adjustment. Root hair bulge apices of the NADPH oxidase mutant rhd2/Atrbohc were more robust than the kjk cellulose synthase mutant, but burst more readily than the wild type (WT). Root epidermal wall appeared impaired in rhd2/Atrbohc, as revealed by the number of protoplasts released by wall-degrading enzymes. Root hair bulges of rhd2/Atrbohc burst more than the WT when challenged in situ with hypo-osmotic low ionic strength medium. Inhibition of NADPH oxidase activity with diphenylene iodonium caused WT to phenocopy the rhd2/Atrbohc bursting in response to hypo-osmotic shock. This implicates RHD2/AtRBOHC in softening the cell wall to permit protoplast expansion. Overall, the results point to a role for RHD2/AtRBOHC in contributing to wall strength. PMID:18317797

  18. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trinco, Jos; Carvalho, Alexandra T. P.; Ramos, Maria Joo; Terao, Mineko; Garattini, Enrico; Leimkhler, Silke; Romo, Maria Joo


    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 ?. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  19. Characterization of Recombinant Lysyl Oxidase Propeptide

    PubMed Central

    Vora, Siddharth R.; Guo, Ying; Stephens, Danielle N.; Salih, Erdjan; Vu, Emile D.; Kirsch, Kathrin H.; Sonenshein, Gail E.; Trackman, Philip C.


    Lysyl oxidase enzyme activity is critical for the biosynthesis of mature and functional collagens and elastin. In addition, lysyl oxidase has tumor suppressor activity that has been shown to depend on the propeptide region (LOX-PP) derived from pro-lysyl oxidase (Pro-LOX), and not on lysyl oxidase enzyme activity. Pro-LOX is secreted as a 50 kDa proenzyme, and then undergoes biosynthetic proteolytic processing to active ~30 kDa LOX enzyme and LOX-PP. The present study reports the efficient recombinant expression and purification of rat LOX-PP. Moreover, using enzymatic deglycosylation and DTT derivatization combined with mass spectrometry technologies, it is shown for the first time that rLOX-PP and naturally occurring LOX-PP contain both N- and O-linked carbohydrates. Structure predictions furthermore suggest that LOX-PP is a mostly disordered protein, which was experimentally confirmed in circular dichroism studies. Due to its high isoelectric point and its disordered structure, we propose that LOX-PP can associate with extracellular and intracellular binding partners to affect its known biological activities as a tumor suppressor and inhibitor of cell proliferation. PMID:20192271

  20. Regulation of NADPH Oxidase Activity in Phagocytes

    PubMed Central

    Debeurme, Franck; Picciocchi, Antoine; Dagher, Marie-Claire; Grunwald, Didier; Beaumel, Sylvain; Fieschi, Franck; Stasia, Marie-Jos


    The X+-linked chronic granulomatous disease (X+-CGD) variants are natural mutants characterized by defective NADPH oxidase activity but with normal Nox2 expression. According to the three-dimensional model of the cytosolic Nox2 domain, most of the X+-CGD mutations are located in/or close to the FAD/NADPH binding regions. A structure/function study of this domain was conducted in X+-CGD PLB-985 cells exactly mimicking 10 human variants: T341K, C369R, G408E, G408R, P415H, P415L, ?507QKT509-HIWAinsert, C537R, L546P, and E568K. Diaphorase activity is defective in all these mutants. NADPH oxidase assembly is normal for P415H/P415L and T341K mutants where mutation occurs in the consensus sequences of NADPH- and FAD-binding sites, respectively. This is in accordance with their buried position in the three-dimensional model of the cytosolic Nox2 domain. FAD incorporation is abolished only in the T341K mutant explaining its absence of diaphorase activity. This demonstrates that NADPH oxidase assembly can occur without FAD incorporation. In addition, a defect of NADPH binding is a plausible explanation for the diaphorase activity inhibition in the P415H, P415L, and C537R mutants. In contrast, Cys-369, Gly-408, Leu-546, and Glu-568 are essential for NADPH oxidase complex assembly. However, according to their position in the three-dimensional model of the cytosolic domain of Nox2, only Cys-369 could be in direct contact with cytosolic factors during oxidase assembly. In addition, the defect in oxidase assembly observed in the C369R, G408E, G408R, and E568K mutants correlates with the lack of FAD incorporation. Thus, the NADPH oxidase assembly process and FAD incorporation are closely related events essential for the diaphorase activity of Nox2. PMID:20724480

  1. Copper distributed by Atx1 is available to copper amine oxidase 1 in Schizosaccharomyces pombe.


    Peter, Chardeen; Lalibert, Julie; Beaudoin, Jude; Labb, Simon


    Copper amine oxidases (CAOs) have been proposed to be involved in the metabolism of xenobiotic and biogenic amines. The requirement for copper is absolute for their activity. In the fission yeast Schizosaccharomyces pombe, cao1(+) and cao2(+) genes are predicted to encode members of the CAO family. While both genes are expressed in wild-type cells, we determined that the expression of only cao1(+) but not cao2(+) results in the production of an active enzyme. Site-directed mutagenesis identified three histidine residues within the C-terminal region of Cao1 that are necessary for amine oxidase activity. By use of a cao1(+)-GFP allele that retained wild-type function, Cao1-GFP was localized in the cytosol (GFP is green fluorescent protein). Under copper-limiting conditions, disruption of ctr4(+), ctr5(+), and cuf1(+) produced a defect in amine oxidase activity, indicating that a functionally active Cao1 requires Ctr4/5-mediated copper transport and the transcription factor Cuf1. Likewise, atx1 null cells exhibited substantially decreased levels of amine oxidase activity. In contrast, deletion of ccc2, cox17, and pccs had no significant effect on Cao1 activity. Residual amine oxidase activity in cells lacking atx1(+) can be restored to normal levels by returning an atx1(+) allele, underscoring the critical importance of the presence of Atx1 in cells. Using two-hybrid analysis, we demonstrated that Cao1 physically interacts with Atx1 and that this association is comparable to that of Atx1 with the N-terminal region of Ccc2. Collectively, these results describe the first example of the ability of Atx1 to act as a copper carrier for a molecule other than Ccc2 and its critical role in delivering copper to Cao1. PMID:18723604

  2. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry


    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  3. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.


    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry


    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis--vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532


    PubMed Central

    van der Vliet, Albert


    The deliberate production of reactive oxygen species (ROS) by phagocyte NADPH oxidase is widely appreciated as a critical component of antimicrobial host defense. Recently, additional homologs of NADPH oxidase (NOX) have been discovered throughout the animal and plant kingdoms, which appear to possess diverse functions in addition to host defense, including cell proliferation, differentiation, and regulation of gene expression. Several of these NOX homologs are also expressed within the respiratory tract, where they participate in innate host defense as well as in epithelial and inflammatory cell signaling and gene expression, and fibroblast and smooth muscle cell proliferation, in response to bacterial or viral infection and environmental stress. Inappropriate expression or activation of NOX/DUOX during various lung pathologies suggests their specific involvement in respiratory disease. This review summarizes the current state of knowledge regarding the general functional properties of mammalian NOX enzymes, and their specific importance in respiratory tract physiology and pathology. PMID:18164271

  5. NADPH oxidases in lung biology and pathology: host defense enzymes, and more.


    van der Vliet, Albert


    The deliberate production of reactive oxygen species (ROS) by phagocyte NADPH oxidase is widely appreciated as a critical component of antimicrobial host defense. Recently, additional homologs of NADPH oxidase (NOX) have been discovered throughout the animal and plant kingdoms, which appear to possess diverse functions in addition to host defense, in cell proliferation, differentiation, and in regulation of gene expression. Several of these NOX homologs are also expressed within the respiratory tract, where they participate in innate host defense as well as in epithelial and inflammatory cell signaling and gene expression, and fibroblast and smooth muscle cell proliferation, in response to bacterial or viral infection and environmental stress. Inappropriate expression or activation of NOX/DUOX during various lung pathologies suggests their specific involvement in respiratory disease. This review summarizes the current state of knowledge regarding the general functional properties of mammalian NOX enzymes, and their specific importance in respiratory tract physiology and pathology. PMID:18164271

  6. Monoclonal antibodies to the alternative oxidase of higher plant mitochondria

    SciTech Connect

    Elthon, T.E.; Nickels, R.L.; McIntosh, L. )


    The higher plant mitochondrial electron transport chain contains, in addition to the cytochrome chain which terminates with cytochrome oxidase, an alternative pathway that terminates with an alternative oxidase. The alternative oxidase of Sauromatum guttatum Schott has recently been identified as a cluster of proteins with apparent M{sub r} of 37, 36, and 35 kilodaltons (kD). Monoclonal antibodies have now been prepared to these proteins and designated as AOA (binding all three proteins of the alternative oxidase cluster), AOU (binding the upper or 37 kD protein), and AOL (binding the lower or 36 and 35 kD proteins). All three antibodies bind to their respective alternative oxidase proteins whether the proteins are in their native or denatured states. AOA and AOU inhibit alternative oxidase activity around 49%, whereas AOL inhibits activity only 14%. When coupled individually to Sepharose 4B, all three monoclonal resins were capable of retaining the entire cluster of alternative oxidase proteins, suggesting that these proteins are physically associated in some manner. The monoclonals were capable of binding similar mitochondrial proteins in a number of thermogenic and nonthermogenic species, indicating that they will be useful in characterizing and purifying the alternative oxidase of different systems. The ability of the monoclonal-Sepharose 4B resins to retain the cluster of previously identified alternative oxidase proteins, along with the inhibition of alternative oxidase activity by these monoclonals, supports the role of these proteins in constituting the alternative oxidase.

  7. Role of the NADPH Oxidases DUOX and NOX4 in Thyroid Oxidative Stress.


    Carvalho, Denise P; Dupuy, Corinne


    Somatic mutations are present at high levels in the rat thyroid gland, indicating that the thyrocyte is under oxidative stress, a state in which cellular oxidant levels are high. The most important class of free radicals, or reactive metabolites, is reactive oxygen species (ROS), such as superoxide anion (O2 (-)), hydroxyl radical (OH) and hydrogen peroxide (H2O2). The main source of ROS in every cell type seems to be mitochondrial respiration; however, recent data support the idea that NADPH:O(2) oxidoreductase flavoproteins or simply NADPH oxidases (NOX) are enzymes specialized in controlled ROS generation at the subcellular level. Several decades ago, high concentrations of H2O2 were detected at the apical surface of thyrocytes, where thyroid hormone biosynthesis takes place. Only in the last decade has the enzymatic source of H2O2 involved in thyroid hormone biosynthesis been well characterized. The cloning of two thyroid genes encoding NADPH oxidases dual oxidases 1 and 2 (DUOX1 and DUOX2) revealed that DUOX2 mutations lead to hereditary hypothyroidism in humans. Recent reports have also described the presence of NOX4 in the thyroid gland and have suggested a pathophysiological role of this member of the NOX family. In the present review, we describe the participation of NADPH oxidases not only in thyroid physiology but also in gland pathophysiology, particularly the involvement of these enzymes in the regulation of thyroid oxidative stress. PMID:24847449

  8. NADPH oxidases, reactive oxygen species, and the kidney: friend and foe.


    Sedeek, Mona; Nasrallah, Rania; Touyz, Rhian M; Hébert, Richard L


    Reactive oxygen species (ROS) play an important role in normal cellular physiology. They regulate different biologic processes such as cell defense, hormone synthesis and signaling, activation of G protein-coupled receptors, and ion channels and kinases/phosphatases. ROS are also important regulators of transcription factors and gene expression. On the other hand, in pathologic conditions, a surplus of ROS in tissue results in oxidative stress with various injurious consequences such as inflammation and fibrosis. NADPH oxidases are one of the many sources of ROS in biologic systems, and there are seven isoforms (Nox1-5, Duox1, Duox2). Nox4 is the predominant form in the kidney, although Nox2 is also expressed. Nox4 has been implicated in the basal production of ROS in the kidney and in pathologic conditions such as diabetic nephropathy and CKD; upregulation of Nox4 may be important in renal oxidative stress and kidney injury. Although there is growing evidence indicating the involvement of NADPH oxidase in renal pathology, there is a paucity of information on the role of NADPH oxidase in the regulation of normal renal function. Here we provide an update on the role of NADPH oxidases and ROS in renal physiology and pathology. PMID:23970124


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

  10. Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

    SciTech Connect

    Imamura, Yutaka; Kubota, Ryo; Wang, Yimin


    In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissues revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.


    PubMed Central

    Bortolato, Marco; Shih, Jean C.


    Monoamine oxidase (MAO) isoenzymes A and B are mitochondrial-bound proteins, catalyzing the oxidative deamination of monoamine neurotransmitters as well as xenobiotic amines. Although they derive from a common ancestral progenitor gene, are located at X-chromosome and display 70% structural identity, their substrate preference, regional distribution, and physiological role are divergent. In fact, while MAO-A has high affinity for serotonin and norepinephrine, MAO-B primarily serves the catabolism of 2-phenylethylamine (PEA) and contributes to the degradation of other trace amines and dopamine. Convergent lines of preclinical and clinical evidence indicate that variations in MAO enzymatic activitydue to either genetic or environmental factorscan exert a profound influence on behavioral regulation and play a role in the pathophysiology of a large spectrum of mental and neurodegenerative disorders, ranging from antisocial personality disorder to Parkinsons disease. Over the past few years, numerous advances have been made in our understanding of the phenotypical variations associated with genetic polymorphisms and mutations of the genes encoding for both isoenzymes. In particular, novel findings on the phenotypes of MAO-deficient mice are highlighting novel potential implications of both isoenzymes in a broad spectrum of mental disorders, ranging from autism and anxiety to impulse-control disorders and ADHD. These studies will lay the foundation for future research on the neurobiological and neurochemical bases of these pathological conditions, as well as the role of gene environment interactions in the vulnerability to several mental disorders. PMID:21971001

  12. Xanthine dehydrogenase to xanthine oxidase conversion in ischemic rat intestine

    SciTech Connect

    McKelvey, T.G.; Engerson, T.D.; Elmore, C.R.; Jones, H.P. )


    The ischemic conversion of the NADH-producing xanthine dehydrogenase (XDH) to an oxidase form, that produces both superoxide radical and hydrogen peroxide, has been proposed as an important step in initiating oxygen radical-mediated ischemia-reperfusion injury. It has also been reported that two forms of converted oxidase are produced in ischemic rat liver; a reversible xanthine oxidase produced through sulfhydryl oxidation, that can be reconverted to XDH by incubation with 10mM dithiothreitol (Dtt) at 37{degrees}C, and a Dtt-irreversible oxidase produced via proteolysis. The authors report that increased oxidase in the ischemic rat intestine results from significant increases in both the Dtt-reversible and Dtt-irreversible forms of xanthine oxidase. Total oxidase activity (Irreversible + Dtt-reversible) was 19% of the total enzyme activity (XDH + XO) in control ileum and distal jejunum, increased to 26% after 1 hour of ischemia at 37{degrees}C, and significantly to 36% after 1.5 hours. After 3 hours 73% of the activity was in the oxidase form. Irreversible oxidase comprised 15% of the total activity in control intestine, significantly increased to 25% after 2 hours, and further to 42% after 3 hours. Dtt-reversible oxidase was 3% of the total activity in controls, increased to 13% after 1.5 hours, and significantly to 29% after 2 hours.

  13. Xanthine oxidase biosensor for monitoring meat spoilage

    NASA Astrophysics Data System (ADS)

    Vanegas, D. C.; Gomes, C.; McLamore, E. S.


    In this study, we have designed an electrochemical biosensor for real-time detection of specific biomarkers of bacterial metabolism related to meat spoilage (hypoxanthine and xanthine). The selective biosensor was developed by assembling a `sandwich' of nanomaterials and enzymes on a platinum-iridium electrode (1.6 mm tip diameter). The materials deposited on the sensor tip include amorphous platinum nanoclusters (i.e. Pt black), reduced graphene oxide, nanoceria, and xanthine oxidase. Xanthine oxidase was encapsulated in laponite hydrogel and used for the biorecognition of hypoxanthine and xanthine (two molecules involved in the rotting of meat by spoilage microorganisms). The developed biosensor demonstrated good electrochemical performance toward xanthine with sensitivity of 2.14 +/- 1.48 ?A/mM, response time of 5.2 +/- 1.5 sec, lower detection limit of 150 +/- 39 nM, and retained at least 88% of its activity after 7 days of continuous use.

  14. Human copper-dependent amine oxidases.


    Finney, Joel; Moon, Hee-Jung; Ronnebaum, Trey; Lantz, Mason; Mure, Minae


    Copper amine oxidases (CAOs) are a class of enzymes that contain Cu(2+) and a tyrosine-derived quinone cofactor, catalyze the conversion of a primary amine functional group to an aldehyde, and generate hydrogen peroxide and ammonia as byproducts. These enzymes can be classified into two non-homologous families: 2,4,5-trihydroxyphenylalanine quinone (TPQ)-dependent CAOs and the lysine tyrosylquinone (LTQ)-dependent lysyl oxidase (LOX) family of proteins. In this review, we will focus on recent developments in the field of research concerning human CAOs and the LOX family of proteins. The aberrant expression of these enzymes is linked to inflammation, fibrosis, tumor metastasis/invasion and other diseases. Consequently, there is a critical need to understand the functions of these proteins at the molecular level, so that strategies targeting these enzymes can be developed to combat human diseases. PMID:24407025

  15. NADPH oxidase activity and reactive oxygen species production in brain and kidney of adult male hypertensive Ren-2 transgenic rats.


    Vokurkov, M; Rauchov, H; ?ez?ov, L; Van??kov, I; Zicha, J


    Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions. PMID:26713567

  16. Ligand interactions with galactose oxidase: mechanistic insights.

    PubMed Central

    Whittaker, M M; Whittaker, J W


    Interactions between galactose oxidase and small molecules have been explored using a combination of optical absorption, circular dichroism, and electron paramagnetic resonance (EPR) spectroscopies to detect complex formation and characterize the products. Anions bind directly to the cupric center in both active and inactive galactose oxidase, converting to complexes with optical and EPR spectra that are distinctly different from those of the starting aquo enzyme. Azide binding is coupled to stoichiometric proton uptake by the enzyme, reflecting the generation of a strong base (pKa > 9) in the active site anion adduct. At low temperature, the aquo enzyme converts to a form that exhibits the characteristic optical and EPR spectra of an anion complex, apparently reflecting deprotonation of the coordinated water. Anion binding results in a loss of the optical transition arising from coordinated tyrosine, implying displacement of the axial tyrosine ligand on forming the adduct. Nitric oxide binds to galactose oxidase, forming a specific complex exhibiting an unusual EPR spectrum with all g values below 2. The absence of Cu splitting in this spectrum and the observation that the cupric EPR signal from the active site metal ion is not significantly decreased in the complex suggest a nonmetal interaction site for NO in galactose oxidase. These results have been interpreted in terms of a mechanistic scheme where substrate binding displaces a tyrosinate ligand from the active site cupric ion, generating a base that may serve to deprotonate the coordinated hydroxyl group of the substrate, activating it for oxidation. The protein-NO interactions may probe a nonmetal O2 binding site in this enzyme. PMID:8386015

  17. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean


    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  18. Unique features of plant mitochondrial sulfhydryl oxidase.


    Levitan, Alexander; Danon, Avihai; Lisowsky, Thomas


    The yeast and human mitochondrial sulfhydryl oxidases of the Erv1/Alr family have been shown to be essential for the biogenesis of mitochondria and the cytosolic iron sulfur cluster assembly. In this study we identified a likely candidate for the first mitochondrial flavin-linked sulfhydryl oxidase of the Erv1-type from a photosynthetic organism. The central core of the plant enzyme (AtErv1) exhibits all of the characteristic features of the Erv1/Alr protein family, including a redox-active YPCXXC motif, noncovalently bound FAD, and sulfhydryl oxidase activity. Transient expression of fusion proteins of AtErv1 and the green fluorescence protein in plant protoplasts showed that the plant enzyme preferentially localizes to the mitochondria. Yet AtErv1 has several unique features, such as the presence of a CXXXXC motif in its carboxyl-terminal domain and the absence of an amino-terminally localized cysteine pair common to yeast and human Erv1/Alr proteins. In addition, the dimerization of AtErv1 is not mediated by its amino terminus but by its unique CXXXXC motif. In vitro assays with purified protein and artificial substrates demonstrate a preference of AtErv1 for dithiols with a defined space between the thiol groups, suggesting a thioredoxin-like substrate. PMID:14996837

  19. Peroxiredoxin-6 and NADPH oxidase activity.


    Ambruso, Daniel R


    Peroxiredoxins (Prdxs) are a family of proteins which catalyze the reduction of H2O2 through the interaction of active site cysteine residues. Conserved within all plant and animal kingdoms, the function of these proteins is related to protection from oxidation or participation of signaling through degradation of H2O2. Peroxiredoxin 6 (Prdx6), a protein belonging to the class of 1-cys Prdxs, was identified in polymorphonuclear leukocytes or neutrophils, defined by amino acid sequence and activity, and found associated with a component of the NADPH oxidase (Nox2), p67(phox). Prdx6 plays an important role in neutrophil function and supports the optimal activity of Nox2. In this chapter, methods are described for determining the Prdx activity of Prdx6. In addition, the approach for assessing the effect of Prdx6 on Nox2 in the SDS-activated, cell-free system of NADPH oxidase activity is presented. Finally, the techniques for suppressing Prdx6 expression in phox-competent K562 cells and cultured myeloid cells with siRNA and shRNA methods are described. With these approaches, the role of Prdx6 in Nox2 activity can be explored with intact cells. The biochemical mechanisms of the Prdx6 effect on the NADPH oxidase can be investigated with the experimental strategies described. PMID:23830630

  20. Reactive Oxygen Species and Angiogenesis: NADPH Oxidase as Target for Cancer Therapy

    PubMed Central

    Ushio-Fukai, Masuko; Nakamura, Yoshimasa


    Angiogenesis is essential for tumor growth, metastasis, arteriosclerosis as well as embryonic development and wound healing. Its process is dependent on cell proliferation, migration and capillary tube formation in endothelia cells (ECs). High levels of reactive oxygen species (ROS) such as superoxide and H2O2 are observed in various cancer cells. Accumulating evidence suggests that ROS function as signaling molecules to mediate various growth-related responses including angiogenesis. ROS-dependent angiogenesis can be regulated by endogenous antioxidant enzymes such as SOD and thioredoxin. Vascular endothelial growth factor (VEGF), one of the major angiogenesis factor, is induced in growing tumors and stimulates EC proliferation and migration primarily through the VEGF receptor type2 (VEGFR2, Flk1/KDR). Major source of ROS in ECs is a NADPH oxidase which consists of Nox1, Nox2, Nox4, Nox5, p22phox, p47phox and the small G protein Rac1. NADPH oxidase is activated by various growth factors including VEGF and angiopoietin-1 as well as hypoxia and ischemia, and ROS derived from this oxidase are involved in VEGFR2 autophosphorylation, and diverse redox signaling pathways leading to induction of transcription factors and genes involved in angiogenesis. Dietary antioxidants appear to be effective for treatment of tumor angiogenesis. The aim of this review is to provide an overview of the recent progress on role of ROS derived from NADPH oxidase and redox signaling events involved in angiogenesis. Understanding these mechanisms may provide insight into the NADPH oxidase and redox signaling components as potential therapeutic targets for tumor angiogenesis. PMID:18406051

  1. Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.


    Cil, M; Bykbayram, A E; Kiralp, S; Toppare, L; Ya?ci, Y


    In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively. PMID:17291580

  2. NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

    SciTech Connect

    Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong


    Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91{sup phox} was dose-dependent. Meanwhile, the cytoplasmic subunit p47{sup phox} was translocated to the cell membrane and localized with p22{sup phox} and gp91{sup phox} to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

  3. Effects of selenium deficiency on aldehyde oxidase 1 in rats.


    Itoh, Kunio; Adachi, Mayuko; Sato, Jun; Shouji, Kanako; Fukiya, Kensuke; Fujii, Keiko; Tanaka, Yorihisa


    Selenium deficiency has been reported to result in an extraordinary decrease of glutathione peroxidase (GSH-Px) and, reversely, an increase of detoxifying enzymes such as glutathione-S-transferase (GST), uridine-5'-diphosphate glucuronosyltransferase (UGT), nicotinamide-dependent quinine oxidoreductase (NQO1; DT-diaphorase), and epoxide hydrolase without significantly affecting cytochrome P450 activity. However, little is known about the effects on aldehyde oxidase 1 (AOX1) activity towards various kinds of aldehydes and N-heterocyclic aromatic compounds. The aim of this study is to clarify the effects of selenium deficiency on AOX1 in rats. As expected, selenium deficiency was confirmed by the extremely low activity of GSH-Px along with the increased activities of GST and DT-diaphorase. AOX1 activity towards vanillin and (S)-RS-8359 was increased by selenium deficiency, and that corresponded to an increase of AOX1 protein level but not to a decreased AOX1 mRNA level. It has been documented that the assembly of the catalytically active holoenzyme forms of the molybdo-flavoenzyme family is very complex and is controlled through transcriptional and translational events by many gene products. In addition, selenium deficiency has been known to cause oxidative stress that leads to an increase of AOX1 activity. Furthermore, aldehyde oxidase homolog 1 (AOH1) with properties similar to AOX1 is present in rodent liver. All the reports suggest that the mechanisms by which selenium deficiency increases AOX1 activity are highly complicated and investigated from different points of view. PMID:19182374

  4. The gibberellin 20-oxidase of Gibberella fujikuroi is a multifunctional monooxygenase.


    Tudzynski, Bettina; Rojas, Mara Cecilia; Gaskin, Paul; Hedden, Peter


    The genes for gibberellin (GA) biosynthesis are clustered in the fungus Gibberella fujikuroi. In addition to genes encoding a GA-specific geranylgeranyl diphosphate synthase and a bifunctional ent-copalyl diphosphate/ent-kaurene synthase, the cluster contains four cytochrome P450 monooxygenase genes (P450-1, -2, -3, -4). Recently it was shown that P450-4 and P450-1 encode multifunctional enzymes catalyzing the three oxidation steps from ent-kaurene to ent-kaurenoic acid and the four oxidation steps from ent-kaurenoic acid to GA14, respectively. Here we describe the functional analysis of the P450-2 gene by gene disruption and by expressing the gene in a mutant that lacks the entire GA biosynthesis gene cluster. Mutants in which P450-2 is inactivated by the insertion of a large piece of DNA accumulated GA14 and lacked biosynthetically more advanced metabolites, indicating that the gene encodes a 20-oxidase. This was confirmed by incubating lines containing P450-2 in the absence of the other GA biosynthesis genes with isotopically labeled substrates. The P450-2 gene product oxidized the 3beta-hydroxylated intermediate, GA14, and its non-hydroxylated analogue GA12 to GA4 and GA9, respectively. Expression of P450-2 is repressed by high amounts of nitrogen in the culture medium but is not affected by the presence of biosynthetically advanced GAs, i.e. there is no evidence for feedback regulation. The fact that the GA 20-oxidase is a cytochrome P450 monooxygenase in G. fujikuroi and not a 2-oxoglutarate-dependent dioxygenase as in plants, together with the significant differences in regulation of gene expression, are further evidence for independent evolution of the GA biosynthetic pathways in plants and fungi. PMID:11943776

  5. NADPH oxidase expression in active multiple sclerosis lesions in relation to oxidative tissue damage and mitochondrial injury.


    Fischer, Marie T; Sharma, Rakhi; Lim, Jamie L; Haider, Lukas; Frischer, Josa M; Drexhage, Joost; Mahad, Don; Bradl, Monika; van Horssen, Jack; Lassmann, Hans


    Multiple sclerosis is a chronic inflammatory disease of the central nervous system, associated with demyelination and neurodegeneration. The mechanisms of tissue injury are poorly understood, but recent data suggest that mitochondrial injury may play an important role in this process. Mitochondrial injury can be triggered by reactive oxygen and nitric oxide species, and we recently provided evidence for oxidative damage of oligodendrocytes and dystrophic axons in early stages of active multiple sclerosis lesions. In this study, we identified potential sources of reactive oxygen and nitrogen species through gene expression in carefully staged and dissected lesion areas and by immunohistochemical analysis of protein expression. Genome-wide microarrays confirmed mitochondrial injury in active multiple sclerosis lesions, which may serve as an important source of reactive oxygen species. In addition, we found differences in the gene expression levels of various nicotinamide adenine dinucleotide phosphate oxidase subunits between initial multiple sclerosis lesions and control white matter. These results were confirmed at the protein level by means of immunohistochemistry, showing upregulation of the subunits gp91phox, p22phox, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 in activated microglia in classical active as well as slowly expanding lesions. The subunits gp91phox and p22phox were constitutively expressed in microglia and were upregulated in the initial lesion. In contrast, p47phox, nicotinamide adenine dinucleotide phosphate oxidase 1 and nicotinamide adenine dinucleotide phosphate oxidase organizer 1 expression were more restricted to the zone of initial damage or to lesions from patients with acute or early relapsing/remitting multiple sclerosis. Double labelling showed co-expression of the nicotinamide adenine dinucleotide phosphate oxidase subunits in activated microglia and infiltrated macrophages, suggesting the assembly of functional complexes. Our data suggest that the inflammation-associated oxidative burst in activated microglia and macrophages plays an important role in demyelination and free radical-mediated tissue injury in the pathogenesis of multiple sclerosis. PMID:22366799

  6. Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).


    Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J


    Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other advanced nanosystem based on directed nucleic acid assemblies, polyamine-induced DNA condensation, and bovine serum amine oxidase may be proposed for futuristic anticancer therapy utilizing nucleic acids, polyamines and BSAO. BSAO based nanoparticles can be employed for the generation of cytotoxic polyamine metabolites. PMID:25333509

  7. Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

    PubMed Central

    Dijkman, Willem P.


    In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

  8. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)


    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  9. Targeting NADPH Oxidases for the Treatment of Cancer and Inflammation

    PubMed Central

    Bonner, Michael Y.; Arbiser, Jack L


    NADPH oxidases are a family of oxidases that utilize molecular oxygen to generate hydrogen peroxide and superoxide, thus indicating physiological functions of these Highly reactive and short lived species. The regulation of these NADPH oxidases (nox) enzymes is complex, with many members of this family exhibiting complexity in subunit composition, cellular location, and tissue specific expression. While the complexity of the nox family (Nox1–5, Duox1,2) is daunting, the complexity also allows for targeting of NADPH oxidases in disease states. This review will discuss which inflammatory and malignant disorders can be targeted by nox inhibitors, as well as clinical experience in the use of nox inhibitors. PMID:22581366

  10. Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants.


    Rea, Giuseppina; de Pinto, Maria Concetta; Tavazza, Raffaela; Biondi, Stefania; Gobbi, Valentina; Ferrante, Paola; De Gara, Laura; Federico, Rodolfo; Angelini, Riccardo; Tavladoraki, Paraskevi


    To test the feasibility of altering polyamine levels by influencing their catabolic pathway, we obtained transgenic tobacco (Nicotiana tabacum) plants constitutively expressing either maize (Zea mays) polyamine oxidase (MPAO) or pea (Pisum sativum) copper amine oxidase (PCuAO), two extracellular and H(2)O(2)-producing enzymes. Despite the high expression levels of the transgenes in the extracellular space, the amount of free polyamines in the homozygous transgenic plants was similar to that in the wild-type ones, suggesting either a tight regulation of polyamine levels or a different compartmentalization of the two recombinant proteins and the bulk amount of endogenous polyamines. Furthermore, no change in lignification levels and plant morphology was observed in the transgenic plants compared to untransformed plants, while a small but significant change in reactive oxygen species-scavenging capacity was verified. Both the MPAO and the PCuAO tobacco transgenic plants produced high amounts of H(2)O(2) only in the presence of exogenously added enzyme substrates. These observations provided evidence for the limiting amount of freely available polyamines in the extracellular space in tobacco plants under physiological conditions, which was further confirmed for untransformed maize and pea plants. The amount of H(2)O(2) produced by exogenously added polyamines in cell suspensions from the MPAO transgenic plants was sufficient to induce programmed cell death, which was sensitive to catalase treatment and required gene expression and caspase-like activity. The MPAO and PCuAO transgenic plants represent excellent tools to study polyamine secretion and conjugation in the extracellular space, as well as to determine when and how polyamine catabolism actually intervenes both in cell wall development and in response to stress. PMID:15064377

  11. Reduced cytochrome oxidase activity in the retrosplenial cortex after lesions to the anterior thalamic nuclei.


    Mendez-Lopez, Magdalena; Arias, Jorge L; Bontempi, Bruno; Wolff, Mathieu


    The anterior thalamic nuclei (ATN) make a critical contribution to hippocampal system functions. Growing experimental work shows that the effects of ATN lesions often resemble those of hippocampal lesions and both markedly reduce the expression of immediate-early gene markers in the retrosplenial cortex, which still appears normal by standard histological means. This study shows that moderate ATN damage was sufficient to produce severe spatial memory impairment as measured in a radial-arm maze. Furthermore, ATN rats exhibited reduced cytochrome oxidase activity in the most superficial cortical layers of the granular retrosplenial cortex, and, to a lesser extent, in the anterior cingulate cortex. By contrast, no change in cytochrome oxidase activity was observed in other limbic cortical regions or in the hippocampal formation. Altogether our results indicate that endogenous long-term brain metabolic capacity within the granular retrosplenial cortex is compromised by even limited ATN damage. PMID:23660649

  12. Nox NADPH Oxidases and the Endoplasmic Reticulum

    PubMed Central

    Araujo, Thaís L.S.; Abrahão, Thalita B.


    Abstract Significance: Understanding isoform- and context-specific subcellular Nox reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase compartmentalization allows relevant functional inferences. This review addresses the interplay between Nox NADPH oxidases and the endoplasmic reticulum (ER), an increasingly evident player in redox pathophysiology given its role in redox protein folding and stress responses. Recent Advances: Catalytic/regulatory transmembrane subunits are synthesized in the ER and their processing includes folding, N-glycosylation, heme insertion, p22phox heterodimerization, as shown for phagocyte Nox2. Dual oxidase (Duox) maturation also involves the regulation by ER-resident Duoxa2. The ER is the activation site for some isoforms, typically Nox4, but potentially other isoforms. Such location influences redox/Nox-mediated calcium signaling regulation via ER targets, such as sarcoendoplasmic reticulum calcium ATPase (SERCA). Growing evidence suggests that Noxes are integral signaling elements of the unfolded protein response during ER stress, with Nox4 playing a dual prosurvival/proapoptotic role in this setting, whereas Nox2 enhances proapoptotic signaling. ER chaperones such as protein disulfide isomerase (PDI) closely interact with Noxes. PDI supports growth factor-dependent Nox1 activation and mRNA expression, as well as migration in smooth muscle cells, and PDI overexpression induces acute spontaneous Nox activation. Critical Issues: Mechanisms of PDI effects include possible support of complex formation and RhoGTPase activation. In phagocytes, PDI supports phagocytosis, Nox activation, and redox-dependent interactions with p47phox. Together, the results implicate PDI as possible Nox organizer. Future Directions: We propose that convergence between Noxes and ER may have evolutive roots given ER-related functional contexts, which paved Nox evolution, namely calcium signaling and pathogen killing. Overall, the interplay between Noxes and the ER may provide relevant insights in Nox-related (patho)physiology. Antioxid. Redox Signal. 20, 2755–2775. PMID:24386930

  13. Magnetic interactions in milk xanthine oxidase.


    Barber, M J; Salerno, J C; Siegel, L M


    The relaxation behavior of the EPR signals of MoV, FAD semiquinone, and the reduced Fe/S I center was measured in the presence and absence of other paramagnetic centers in milk xanthine oxidase. Specific pairs of prosthetic groups were rendered paramagnetic by poising the native enzyme or its desulfo glycol inhibited derivative at appropriate potentials and pH values. Magnetic interactions were found between the following species: Mo--Fe/S I (100-fold increase in microwave power required to saturate the MoV EPR signal at 103 K when Fe/S I is reduced as opposed to oxidized), FAD--Fe/S I and FAD--Fe/S II (70-fold increase in power required to saturate the FADH.EPR signal at 173 K when either Fe/S center is reduced), and Fe/S I--Fe/S II (2.5-fold increase in power to saturate the reduced Fe/S I EPR signal at 20 K when Fe/S II is reduced). The Mo--Fe/S I interaction was also detected as a reduced Fe/S I induced splitting of the MoV EPR spectrum at 30 K. No splittings of the FADH. or Fe/S center spectra were detected. No magnetic interactions were found between FAD and Mo or between Mo and Fe/S II. These results, together with those of Coffman & Buettner [Coffman, R. E., & Buettner, G. R. (1979) J. Phys. Chem. 83, 2392-2400], were used to estimate the following approximate distances between the electron carrying prosthetic groups of milk xamthine oxidase: Mo--Fe/S I, 11 +/- 3 A; Fe/S I-Fe/S II, 15 +/- 4 A; FAD-Fe/S I, 16 +/- 4 A; FAD-Fe/S II, 16 +/- 4 A. A model for the arrangement of these groups within the xanthine oxidase molecule is suggested. PMID:6282313

  14. Ligand Trapping by Cytochrome c Oxidase

    PubMed Central

    Parul, Dzmitry; Palmer, Graham; Fabian, Marian


    Cytochrome c oxidase is a member of the heme-copper family of oxygen reductases in which electron transfer is linked to the pumping of protons across the membrane. Neither the redox center(s) associated with proton pumping nor the pumping mechanism presumably common to all heme-copper oxidases has been established. A possible conformational coupling between the catalytic center (Fea33+CuB2+) and a protein site has been identified earlier from ligand binding studies, whereas a structural change initiated by azide binding to the protein has been proposed to facilitate the access of cyanide to the catalytic center of the oxidized bovine enzyme. Here we show that cytochrome oxidase pretreated with a low concentration of azide exhibits a significant increase in the apparent rate of cyanide binding relative to that of free enzyme. However, this increase in rate does not reflect a conformational change enhancing the rapid formation of a Fea33+CNCuB2+ complex. Instead the cyanide-induced transition of a preformed Fea33+N3CuB2+ to the ternary complex of Fea33+N3 CuB2+CN is the most likely reason for the observed acceleration. Significantly, the slow rate of azide release from the ternary complex indicates that cyanide ligated to CuB blocks a channel between the catalytic site and the solvent. The results suggest that there is a pathway that originates at CuB and that, during catalysis, ligands present at this copper center control access to the iron of heme a3 from the bulk medium. PMID:20037139

  15. Modulation of lysyl oxidase by dietary copper in rats.


    Rucker, R B; Romero-Chapman, N; Wong, T; Lee, J; Steinberg, F M; McGee, C; Clegg, M S; Reiser, K; Kosonen, T; Uriu-Hare, J Y; Murphy, J; Keen, C L


    Lysyl oxidase levels were estimated in rat tissues using an enzyme-linked immunosorption assay (ELISA) and a functional assay standardized against known amounts of purified lysyl oxidase. High concentrations of lysyl oxidase (> or = 150 micrograms/g of tissue or packed cells) were detected in connective tissues, such as tendon and skin. Values for aorta, kidney, lung and liver ranged from 30 to 150 micrograms/g of tissue; values for skeletal muscle and diaphragm were < 30 micrograms/g tissue. Purified rat skin lysyl oxidase catalyzed the release of 50-100 Bq of tritium per micrograms enzyme in assays that used 3H-elastin-rich substrates. In dense connective tissues, good agreement was obtained for the values from ELISA and those derived from measurements of functional activity in aorta, lung, skin and tendon (r2 > 0.9). When egg white-based experimental diets containing 2 or 10 micrograms/g added copper were fed to weanling rats, values for skin lysyl oxidase functional activity in the group fed 2 micrograms/g added copper were one-third to one-half the values for skin lysyl oxidase functional activity in rats fed 10 micrograms/g copper. This reduction in lysyl oxidase activity, however, had minimal effect on indices of collagen maturation in rat skin, e.g., collagen solubility in neutral salt and dilute acid or the levels of acid stable cross-links. Moreover, copper deficiency did not influence the steady-state levels of lysyl oxidase specific mRNA in rat skin or the apparent amounts of lysyl oxidase in rat skin as determined by ELISA. These observations underscore that the concentration of lysyl oxidase is relatively high in dense corrective tissues, and although decreasing dietary copper influences functional activity, there is little apparent effect on the production of lysyl oxidase protein. PMID:8558325

  16. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  17. Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

    PubMed Central

    Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun


    Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

  18. The Arabidopsis NADPH oxidases RbohD and RbohF display differential expression patterns and contributions during plant immunity.


    Morales, Jorge; Kadota, Yasuhiro; Zipfel, Cyril; Molina, Antonio; Torres, Miguel-Angel


    Plant NADPH oxidases, also known as respiratory burst oxidase homologues (RBOHs), produce reactive oxygen species (ROS) that perform a wide range of functions. RbohD and RbohF, two of the 10 Rboh genes present in Arabidopsis, are pleiotropic and mediate diverse physiological processes including the response to pathogens. We hypothesized that the spatio-temporal control of RbohD and RbohF gene expression might be critical in determining their multiplicity of functions. Transgenic Arabidopsis plants with RbohD and RbohF promoter fusions to β-glucuronidase and Luciferase reporter genes were generated. Analysis of these plants revealed a differential expression pattern for RbohD and RbohF throughout plant development and during immune responses. RbohD and RbohF gene expression was differentially modulated by pathogen-associated molecular patterns. Histochemical stains and in vivo expression analysis showed a correlation between the level of RbohD and RbohF promoter activity, H2O2 accumulation and the amount of cell death in response to the pathogenic bacterium Pseudomonas syringae pv. tomato DC3000 and the necrotrophic fungus Plectosphaerella cucumerina. A promoter-swap strategy revealed that the promoter region of RbohD was required to drive production of ROS by this gene in response to pathogens. Moreover, RbohD promoter was activated during Arabidopsis interaction with a non-virulent P. cucumerina isolate, and susceptibility tests with the double mutant rbohD rbohF uncovered a new function for these oxidases in basal resistance. Altogether, our results suggest that differential spatio-temporal expression of the Rboh genes contributes to fine-tune RBOH/NADPH oxidase-dependent ROS production and signaling in Arabidopsis immunity. PMID:26798024

  19. Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

    PubMed Central

    Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.


    Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCm?NOX and pKm?NOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

  20. Extracellular ATP induces the accumulation of superoxide via NADPH oxidases in Arabidopsis.


    Song, Charlotte J; Steinebrunner, Iris; Wang, Xuanzhi; Stout, Stephen C; Roux, Stanley J


    Extracellular ATP can serve as a signaling agent in animal cells, and, as suggested by recent reports, may also do so in plant cells. In animal cells it induces the production of reactive oxygen species through the mediation of NADPH oxidase. Similarly, here we report that in leaves of Arabidopsis (Arabidopsis thaliana), applied ATP, but not AMP or phosphate, induces the accumulation of superoxide (O2-) in a biphasic, dose-dependent manner, with a threshold at 500 nm ATP. This effect did not require ATP hydrolysis for it was mimicked by ATPgammaS. ATP also induced increased levels of Arabidopsis respiratory burst oxidase homolog D (AtrbohD) mRNA, but ATP-treated plants that had disrupted AtrbohD and AtrbohF genes did not accumulate O2-, indicating that NADPH oxidases are responsible for the induced O2- accumulation. Inhibitors of mammalian P2-type ATP receptors abolished ATP-induced O2- production, suggesting that the ATP effects may be mediated through P2-like receptors in plants. Cytosolic Ca2+ and calmodulin are likely to help transduce the ATP responses, as they do in animal cells, because a Ca2+ channel blocker, a Ca2+ chelator, and calmodulin antagonist all reduced ATP-induced O2- accumulation. Furthermore, ATP treatment enhanced the expression of genes that are induced by wounds and other stresses. The ATP measured at wound sites averaged 40 microm, well above the level needed to induce O2- accumulation and gene expression changes. Transgenic plants overexpressing an apyrase gene had reduced O2- production in response to applied ATP and wounding. Together, these data suggest a possible role for extracellular ATP as a signal potentially in wound and stress responses. PMID:16428598

  1. Extracellular ATP Induces the Accumulation of Superoxide via NADPH Oxidases in Arabidopsis1

    PubMed Central

    Song, Charlotte J.; Steinebrunner, Iris; Wang, Xuanzhi; Stout, Stephen C.; Roux, Stanley J.


    Extracellular ATP can serve as a signaling agent in animal cells, and, as suggested by recent reports, may also do so in plant cells. In animal cells it induces the production of reactive oxygen species through the mediation of NADPH oxidase. Similarly, here we report that in leaves of Arabidopsis (Arabidopsis thaliana), applied ATP, but not AMP or phosphate, induces the accumulation of superoxide (O2−) in a biphasic, dose-dependent manner, with a threshold at 500 nm ATP. This effect did not require ATP hydrolysis for it was mimicked by ATPγS. ATP also induced increased levels of Arabidopsis respiratory burst oxidase homolog D (AtrbohD) mRNA, but ATP-treated plants that had disrupted AtrbohD and AtrbohF genes did not accumulate O2−, indicating that NADPH oxidases are responsible for the induced O2− accumulation. Inhibitors of mammalian P2-type ATP receptors abolished ATP-induced O2− production, suggesting that the ATP effects may be mediated through P2-like receptors in plants. Cytosolic Ca2+ and calmodulin are likely to help transduce the ATP responses, as they do in animal cells, because a Ca2+ channel blocker, a Ca2+ chelator, and calmodulin antagonist all reduced ATP-induced O2− accumulation. Furthermore, ATP treatment enhanced the expression of genes that are induced by wounds and other stresses. The ATP measured at wound sites averaged 40 μm, well above the level needed to induce O2− accumulation and gene expression changes. Transgenic plants overexpressing an apyrase gene had reduced O2− production in response to applied ATP and wounding. Together, these data suggest a possible role for extracellular ATP as a signal potentially in wound and stress responses. PMID:16428598

  2. Specific cation binding site in mammalian cytochrome oxidase.


    Kirichenko, A; Vygodina, T; Mkrtchyan, H M; Konstantinov, A


    Calcium ion binds reversibly with cytochrome c oxidase from beef heart mitochondria (Kd approximately 2 microM) shifting alpha- and gamma-absorption bands of heme a to the red. Two sodium ions compete with one Ca2+ for the binding site with an average dissociation constant square root[K1(Na) x K2(Na)] approximately 3.6 mM. The Ca2+-induced spectral shift of heme a is specific for mammalian cytochrome c oxidase and is not observed in bacterial or yeast aa3 oxidases although the Ca2+-binding site has been revealed in the bacterial enzyme [Ostermeier, C., Harrenga, A., Ermler, U. and Michel, H. (1997) Proc. Natl. Acad. Sci. USA 94, 10547-10553]. As His-59 and Gln-63 involved in Ca2+ binding with Subunit I of P. denitrificans oxidase are not conserved in bovine oxidase, these residues have to be substituted by alternative ligands in mammalian enzyme, which is indeed the case as shown by refined structure of bovine heart cytochrome oxidase (S. Yoshikawa, personal communication). We propose that it is interaction of Ca2+ with the species-specific ligand(s) in bovine oxidase that accounts for perturbation of heme a. The Ca2+/Na2+-binding site may be functionally associated with the exit part of 'pore B' proton channel in subunit I of mammalian cytochrome c oxidase. PMID:9515733

  3. Bilirubin oxidase bioelectrocatalytic cathodes: the impact of hydrogen peroxide.


    Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T


    Mediator-less, direct electro-catalytic reduction of oxygen to water by bilirubin oxidase (Myrothecium sp.) was obtained on anthracene-modified, multi-walled carbon nanotubes. H2O2 was found to significantly and irreversibly affect the electro-catalytic activity of bilirubin oxidase, whereas similar electrodes comprised of laccase (Trametes versicolor) were reversibly inhibited. PMID:24185735

  4. Effect of contraceptive steroids on monoamine oxidase activity

    PubMed Central

    Southgate, Jennifer; Collins, G. G. S.; Pryse-Davies, J.; Sandler, M.


    Cyclical variations in monoamine oxidase activity during the human menstrual cycle, specific to the endometrium and modified in women undergoing contraceptive steroid treatment, may reflect changes in hormonal environment. Treatment of rats with individual constituents of the contraceptive pill causes analogous changes: oestrogens inhibit and progestogens potentiate uterine monoamine oxidase activity. ImagesFig. 2Fig. 3

  5. Partial characterization of lysyl oxidase from several human tissues.

    PubMed Central

    Kuivaniemi, H


    Lysyl oxidase activity was assayed in urea extracts of a number of human tissues, proving to be highest in skin. Antibodies to human placental lysyl oxidase completely inhibited the activity of crude lysyl oxidase from all the human tissues studied, with no significant differences in the amounts of antiserum required for 50% inhibition. By contrast, marked differences were found in this value between skin tissue samples from different species. The Mr of lysyl oxidase in crude extracts of human skin and in the medium of cultured human skin fibroblasts was 30 000 by gel filtration, no active species with a higher Mr being detectable. Four forms of lysyl oxidase activity were seen in DEAE-cellulose chromatography of urea extract from human skin, all having Mr 30 000. Antibodies to human placental lysyl oxidase stained a 30 000-Mr protein in urea extracts of all the human tissues studied and in the medium of cultured human skin fibroblasts when examined by immunoblotting after sodium dodecyl sulphate/polyacrylamide-slab-gel electrophoresis, but they also stained high-Mr material. The findings suggest that there are no immunologically distinct lysyl oxidase isoenzymes in the various human tissues and that the true Mr of lysyl oxidase in crude urea extracts is 30 000. Images Fig. 2. PMID:2865951

  6. Interheme electron tunneling in cytochrome c oxidase

    PubMed Central

    Kaila, Ville R. I.; Johansson, Mikael P.; Sundholm, Dage; Wikstrm, Mrten


    Cytochrome c oxidase (CcO) is the terminal enzyme of the respiratory chain that catalyzes respiratory reduction of dioxygen (O2) to water in all eukaryotes and many aerobic bacteria. CcO, and its homologs among the heme-copper oxidases, has an active site composed of an oxygen-binding heme and a copper center in the vicinity, plus another heme group that donates electrons to this site. In most oxidoreduction enzymes, electron transfer (eT) takes place by quantum-mechanical electron tunneling. Here we show by independent molecular dynamics and quantum-chemical methods that the heme-heme eT in CcO differs from the majority of cases in having an exceptionally low reorganization energy. We show that the rate of interheme eT in CcO may nevertheless be predicted by the Moser-Dutton equation if reinterpreted as the average of the eT rates between all individual atoms of the donor and acceptor weighed by the respective packing densities between them. We argue that this modification may be necessary at short donor/acceptor distances comparable to the donor/acceptor radii. PMID:21106766

  7. Oxidation of polysaccharides by galactose oxidase.


    Parikka, Kirsti; Leppnen, Ann-Sofie; Pitknen, Leena; Reunanen, Markku; Willfr, Stefan; Tenkanen, Maija


    Galactose oxidase was used as a catalyst to oxidize selectively the C-6 hydroxyls of terminal galactose to carbonyl groups. The polysaccharides studied included spruce galactoglucomannan, guar galactomannan, larch arabinogalactan, corn fiber arabinoxylan, and tamarind seed xyloglucan, with terminal galactose contents varying from 6% to 40%. A multienzyme system was used, with catalase and horseradish peroxidase to enhance the action of galactose oxidase. An analysis technique was developed for the quantification of the reactive aldehydes with GC-MS, utilizing NaBD4 reduction and acidic methanolysis. The best oxidation degrees of terminal galactosyls were obtained with xyloglucan (85% of galactose) and spruce galactoglucomannan (65% of galactose). The highest oxidation degree based on total carbohydrates was achieved with guar gum (28%), which had the highest galactose content. The oxidation resulted in changes in the physicochemical properties of the polysaccharide solutions, and the changes observed varied between the polysaccharides. The clearest change was in tamarind xyloglucan, which formed a gel after the oxidation. After the oxidation, larger particles were present in the solution of spruce galactoglucomannan, but changes in its rheological properties were not observed. PMID:20000571

  8. Loss of lysyl oxidase-like 3 causes cleft palate and spinal deformity in mice.


    Zhang, Jian; Yang, Rui; Liu, Ziyi; Hou, Congzhe; Zong, Wen; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang


    In mammals, embryonic development are highly regulated morphogenetic processes that are tightly controlled by genetic elements. Failure of any one of these processes can result in embryonic malformation. The lysyl oxidase (LOX) family genes are closely related to human diseases. In this study, we investigated the essential role of lysyl oxidase-like 3 (LOXL3), a member of the LOX family, in embryonic development. Mice lacking LOXL3 exhibited perinatal lethality, and the deletion of the Loxl3 gene led to impaired development of the palate shelves, abnormalities in the cartilage primordia of the thoracic vertebrae and mild alveolar shrinkage. We found that the obvious decrease of collagen cross-links in palate and spine that was induced by the lack of LOXL3 resulted in cleft palate and spinal deformity. Thus, we provide critical in vivo evidence that LOXL3 is indispensable for mouse palatogenesis and vertebral column development. The Loxl3 gene may be a candidate disease gene resulting in cleft palate and spinal deformity. PMID:26307084

  9. Constitutive arsenite oxidase expression detected in arsenic-hypertolerant Pseudomonas xanthomarina S11.


    Koechler, Sandrine; Arsène-Ploetze, Florence; Brochier-Armanet, Céline; Goulhen-Chollet, Florence; Heinrich-Salmeron, Audrey; Jost, Bernard; Lièvremont, Didier; Philipps, Muriel; Plewniak, Frédéric; Bertin, Philippe N; Lett, Marie-Claire


    Pseudomonas xanthomarina S11 is an arsenite-oxidizing bacterium isolated from an arsenic-contaminated former gold mine in Salsigne, France. This bacterium showed high resistance to arsenite and was able to oxidize arsenite to arsenate at concentrations up to 42.72 mM As[III]. The genome of this strain was sequenced and revealed the presence of three ars clusters. One of them is located on a plasmid and is organized as an "arsenic island" harbouring an aio operon and genes involved in phosphorous metabolism, in addition to the ars genes. Neither the aioXRS genes nor a specific sigma-54-dependent promoter located upstream of aioBA genes, both involved in regulation of arsenite oxidase expression in other arsenite-oxidizing bacteria, could be identified in the genome. This observation is in accordance with the fact that no difference was observed in expression of arsenite oxidase in P. xanthomarina S11, whether or not the strain was grown in the presence of As[III]. PMID:25753102

  10. Improvement of Natamycin Production by Cholesterol Oxidase Overexpression in Streptomyces gilvosporeus.


    Wang, Miao; Wang, Shaohua; Zong, Gongli; Hou, Zhongwen; Liu, Fei; Liao, D Joshua; Zhu, Xiqiang


    Natamycin is a widely used antifungal antibiotic. For natamycin biosynthesis, the gene pimE encodes cholesterol oxidase, which acts as a signalling protein. To confirm the positive effect of the gene pimE on natamycin biosynthesis, an additional copy of the gene pimE was inserted into the genome of Streptomyces gilvosporeus 712 under the control of the ermE* promoter (permE*) using intergeneric conjugation. Overexpression of the target protein engendered 72% and 81% increases in the natamycin production and cell productivity, respectively, compared with the control strain. Further improvement in the antibiotic production was achieved in a 1 L fermenter to 7.0 g/l, which was a 153% improvement after 120 h cultivation. Exconjugants highly expressing pimE and pimM were constructed to investigate the effects of both genes on the increase of natamycin production. However, the co-effect of pimE and pimM did not enhance the antibiotic production obviously, compared with the exconjugants highly expressing pimE only. These results suggest not only a new application of cholesterol oxidase but also a useful strategy to genetically engineer natamycin production. PMID:26502732

  11. Loss of lysyl oxidase-like 3 causes cleft palate and spinal deformity in mice

    PubMed Central

    Zhang, Jian; Yang, Rui; Liu, Ziyi; Hou, Congzhe; Zong, Wen; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang


    In mammals, embryonic development are highly regulated morphogenetic processes that are tightly controlled by genetic elements. Failure of any one of these processes can result in embryonic malformation. The lysyl oxidase (LOX) family genes are closely related to human diseases. In this study, we investigated the essential role of lysyl oxidase-like 3 (LOXL3), a member of the LOX family, in embryonic development. Mice lacking LOXL3 exhibited perinatal lethality, and the deletion of the Loxl3 gene led to impaired development of the palate shelves, abnormalities in the cartilage primordia of the thoracic vertebrae and mild alveolar shrinkage. We found that the obvious decrease of collagen cross-links in palate and spine that was induced by the lack of LOXL3 resulted in cleft palate and spinal deformity. Thus, we provide critical in vivo evidence that LOXL3 is indispensable for mouse palatogenesis and vertebral column development. The Loxl3 gene may be a candidate disease gene resulting in cleft palate and spinal deformity. PMID:26307084

  12. The complex roles of NADPH oxidases in fungal infection

    PubMed Central

    Hogan, Deborah; Wheeler, Robert T.


    Summary NADPH oxidases play key roles in immunity and inflammation that go beyond the production of microbicidal reactive oxygen species (ROS). The past decade has brought a new appreciation for the diversity of roles played by ROS in signaling associated with inflammation and immunity. NADPH oxidase activity affects disease outcome during infections by human pathogenic fungi, an important group of emerging and opportunistic pathogens that includes Candida, Aspergillus and Cryptococcus species. Here we review how alternative roles of NADPH oxidase activity impact fungal infection and how ROS signaling affects fungal physiology. Particular attention is paid to roles for NADPH oxidase in immune migration, immunoregulation in pulmonary infection, neutrophil extracellular trap formation, autophagy and inflammasome activity. These recent advances highlight the power and versatility of spatiotemporally controlled redox regulation in the context of infection, and point to a need to understand the molecular consequences of NADPH oxidase activity in the cell. PMID:24905433

  13. [The Nox/Duox family of ROS-generating NADPH oxidases].


    Guichard, Cécile; Pedruzzi, Eric; Fay, Michèle; Ben Mkaddem, Sanae; Coant, Nicolas; Daniel, Fanny; Ogier-Denis, Eric


    Reactive oxygen species (ROS) generated by the NADPH oxidases are conventionally thought to be cytotoxic and mutagenic and at high levels induce an oxidative stress response. The phagocyte NADPH oxidase catalyzes the NADPH-dependent reduction of molecular oxygen to generate superoxide O2-., which can dismute to generate ROS species. Together, these ROS participate in host defence by killing or damaging invading microbes. Flavocytochrome b558 is the catalytic core of the phagocyte NADPH oxidase and consists of a large glycoprotein gp91phox or Nox-2 and a small protein p22phox. The other components of the NADPH oxidase are cytosolic proteins, namely p67phox, p47phox, p40phox and Rac. A defect in any of the genes encoding gp91phox, p22phox, p67phox or p47phox results in chronic granulomatous disease, a genetic disorder characterized by severe and recurrent infections. Evidence is rapidly accumulating that low level of ROS were produced by NADPH oxidase homologs in non-phagocytic cells. To date, six human homologs (Nox-1, Nox-3, Nox-4, Nox-5, Duox-1 and Duox-2) have been recently identified in a variety of non-phagocytic cells. The identification of Nox-1 was quickly followed by the cloning of Nox-3, Nox-4, and Nox-5. In parallel, two very large members of the Nox family were discovered, namely Duox-1 and Duox-2, initially also referred to as thyroid oxidases. The physiological functions of Nox-dependent ROS generation are in progress and still require detailed characterization. Activation mechanisms and tissue distribution of the different members of the Nox family are very different, suggesting distinct physiological functions. Nox family enzymes are likely to be involved in a variety of physiological events including cell proliferation, host defence, differentiation, apoptosis, senescence and activation of growth-related signaling pathways. An increase and a decrease in the function of Nox enzymes can contribute to a wide range of pathological processes. PMID:17101097

  14. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)


    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  15. Polyphenols restore endothelial function in DOCA-salt hypertension: role of endothelin-1 and NADPH oxidase.

    TOXLINE Toxicology Bibliographic Information

    Jimnez R; Lpez-Seplveda R; Kadmiri M; Romero M; Vera R; Snchez M; Vargas F; O'Valle F; Zarzuelo A; Dueas M; Santos-Buelga C; Duarte J


    Red wine polyphenols (RWPs) have been reported to exert beneficial effects in preventing cardiovascular diseases, such as hypertension. We studied the effects of chronic treatment with RWPs and apocynin, an inhibitor of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, on blood pressure, endothelial function, and oxidative status in deoxycorticosterone acetate (DOCA)-salt-induced hypertension. Rats were administered RWPs (40 mg/kg) or apocynin (33 microg/kg) daily by gavage for 5 weeks. Plasma catechin levels were detected only after RWP treatment. RWPs and apocynin prevented both the increase in systolic blood pressure and the proteinuria induced by DOCA-salt. Plasma malonyldialdehyde levels, urinary iso-prostaglandin F(2alpha) excretion, aortic superoxide production, and aortic NADPH oxidase activity were found to be increased in animals of the DOCA group. RWP and apocynin treatments reduced these parameters in DOCA-salt rats, having no effect on control rats. However, only RWPs reduced the increase in plasma endothelin-1 (ET-1) levels and aortic p22(phox) gene overexpression found in DOCA-salt animals. RWPs and apocynin also improved the blunted endothelium-dependent relaxation response to acetylcholine in noradrenaline-precontracted aortic rings. All these results suggest that chronic treatment with RWPs prevents hypertension and vascular dysfunction. RWPs prevent vascular oxidative stress by inhibiting NADPH oxidase activity and/or by reducing ET-1 release.

  16. Enhanced ROS production and redox signaling with combined arsenite and UVA exposure: contribution of NADPH oxidase.


    Cooper, Karen L; Liu, Ke Jian; Hudson, Laurie G


    Solar ultraviolet radiation (UVR) is the major etiological factor in skin carcinogenesis. However, in vivo studies demonstrate that mice exposed to arsenic and UVR exhibit significantly more tumors and oxidative DNA damage than animals treated with either agent alone. Interactions between arsenite and UVR in the production of reactive oxygen species (ROS) and stress-associated signaling may provide a basis for the enhanced carcinogenicity. In this study keratinocytes were pretreated with arsenite (3 microM) and then exposed to UVA (10 kJ/m(2)). We report that exposure to UVA after arsenite pretreatment enhanced ROS production, p38 MAP kinase activation, and induction of a redox-sensitive gene product, heme oxygenase-1, compared to either stimulus alone. UVR exposure resulted in rapid and transient NADPH oxidase activation, whereas the response to arsenite was more pronounced and persistent. Inhibition of NADPH oxidase decreased ROS production in arsenite-treated cells but had little impact on UVA-exposed cells. Furthermore, arsenite-induced, but not UVA-induced, p38 activation and HO-1 expression were dependent upon NADPH oxidase activity. These findings indicate differences in the mechanisms of ROS production by arsenite and UVA that may provide an underlying basis for the observed enhancement of redox-related cellular responses upon combined UVA and arsenite exposure. PMID:19414066

  17. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris a