Science.gov

Sample records for multicopper oxidase gene

  1. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  2. Crystal Structure of a Two-domain Multicopper Oxidase

    PubMed Central

    Lawton, Thomas J.; Sayavedra-Soto, Luis A.; Arp, Daniel J.; Rosenzweig, Amy C.

    2009-01-01

    The two-domain multicopper oxidases are proposed to be key intermediates in the evolution of three-domain multicopper oxidases. A number of two-domain multicopper oxidases have been identified from genome sequences and are classified as type A, type B, or type C on the basis of the predicted location of the type 1 copper center. The crystal structure of blue copper oxidase, a type C two-domain multicopper oxidase from Nitrosomonas europaea, has been determined to 1.9 Å resolution. Blue copper oxidase is a trimer, of which each subunit comprises two cupredoxin domains. Each subunit houses a type 1 copper site in domain 1 and a type 2/type 3 trinuclear copper cluster at the subunit-subunit interface. The coordination geometry at the trinuclear copper site is consistent with reduction of the copper ions. Although the overall architecture of blue copper oxidase is similar to nitrite reductases, detailed structural alignments show that the fold and domain orientation more closely resemble the three-domain multicopper oxidases. These observations have important implications for the evolution of nitrite reductases and multicopper oxidases. PMID:19224923

  3. [Ceruloplasmin, hephaestin and zyklopen: the three multicopper oxidases important for human iron metabolism].

    PubMed

    Wierzbicka, Diana; Gromadzka, Grazyna

    2014-01-01

    Multi-copper oxidases are a group of proteins which demonstrate enzymatic activity and are capable of oxidizing their substrates with the concomitant reduction of dioxygen to two water molecules. For some multi-copper oxidases there has been demonstrated ferroxidase activity which is related to their specific structure characterized by the presence of copper centres and iron-binding sites. Three multi-copper oxidases have been included in this group: ceruloplasmin, hephaestin and zyklopen. Multi-copper oxidases which are expressed in different tissues are capable of oxidizing a wide spectrum of substrates. Multi-copper oxidases are capable of oxidizing a wide spectrum of substrates. Ceruloplasmin exhibits antioxidant activity as well as being involved in many other biological processes. The observations of phenotypic effects of absence or low expression of multi-copper ferroxidase-coding genes suggest that the main role of these proteins is taking part in iron metabolism. The main role of ceruloplasmin in iron turnover is oxidizing Fe2+ into Fe3+, a process which is essential for iron binding to transferrin (the main iron-transporting protein), as well as to ferritin (the main iron-storage protein). The function of hephaestin as ferroxidase is essential for iron binding to apotransferrin in the lamina propria of the intestinal mucosa, a process that is important for further transport of iron to the liver by the portal vein. Available data indicate that zyklopen is responsible for the placental iron transport. The presence of three multi-copper oxidases with ferroxidase activity emphasizes the significance of oxidation for iron metabolism. The distribution of multi-copper ferroxidases in many tissues ensures the proper iron turnover in the body as well as preventing toxic effects related to the presence of Fe2+ ions. These ions contribute to generation of free radicals, including the highly reactive hydroxyl radical, through the Fenton and Haber-Weiss reactions. PMID:24988611

  4. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  5. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed Central

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N

    1994-01-01

    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide product are proposed, indicating that the polypeptide of ORF1 might bind four copper ions: one type 1, one type 2, and two type 3. Images PMID:8282694

  6. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N

    1994-01-01

    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide product are proposed, indicating that the polypeptide of ORF1 might bind four copper ions: one type 1, one type 2, and two type 3. PMID:8282694

  7. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  8. Multicopper manganese oxidase accessory proteins bind Cu and heme.

    PubMed

    Butterfield, Cristina N; Tao, Lizhi; Chacón, Kelly N; Spiro, Thomas G; Blackburn, Ninian J; Casey, William H; Britt, R David; Tebo, Bradley M

    2015-12-01

    Multicopper oxidases (MCOs) catalyze the oxidation of a diverse group of metal ions and organic substrates by successive single-electron transfers to O2 via four bound Cu ions. MnxG, which catalyzes MnO2 mineralization by oxidizing both Mn(II) and Mn(III), is unique among multicopper oxidases in that it carries out two energetically distinct electron transfers and is tightly bound to accessory proteins. There are two of these, MnxE and MnxF, both approximately 12kDa. Although their sequences are similar to those found in the genomes of several Mn-oxidizing Bacillus species, they are dissimilar to those of proteins with known function. Here, MnxE and MnxF are co-expressed independent of MnxG and are found to oligomerize into a higher order stoichiometry, likely a hexamer. They bind copper and heme, which have been characterized by electron paramagnetic resonance (EPR), X-ray absorption spectroscopy (XAS), and UV-visible (UV-vis) spectrophotometry. Cu is found in two distinct type 2 (T2) copper centers, one of which appears to be novel; heme is bound as a low-spin species, implying coordination by two axial ligands. MnxE and MnxF do not oxidize Mn in the absence of MnxG and are the first accessory proteins to be required by an MCO. This may indicate that Cu and heme play roles in electron transfer and/or Cu trafficking. PMID:26327317

  9. A Multicopper Oxidase-Related Protein Is Essential for Insect Viability, Longevity and Ovary Development

    PubMed Central

    Peng, Zeyu; Green, Peter G.; Arakane, Yasuyuki; Kanost, Michael R.; Gorman, Maureen J.

    2014-01-01

    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests. PMID:25330116

  10. A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

    PubMed

    Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

    2014-01-01

    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests. PMID:25330116

  11. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10?6±0.21 M·min?1 and 0.32±0.02 s?1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a potential biocatalyst for Mn(II) removal. PMID:23577125

  12. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.

    PubMed

    Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J

    2015-04-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  13. Multicopper Oxidase-3 Is a Laccase Associated with the Peritrophic Matrix of Anopheles gambiae

    PubMed Central

    Lang, Minglin; Kanost, Michael R.; Gorman, Maureen J.

    2012-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

  14. A multicopper oxidase contributes to the copper tolerance of Brucella melitensis 16M.

    PubMed

    Wu, Tonglei; Wang, Shaohua; Wang, Zhen; Peng, Xiaowei; Lu, Yanli; Wu, Qingmin

    2015-06-01

    Copper is a potent antimicrobial agent. Multiple mechanisms of copper tolerance are utilized by some pathogenic bacteria. BMEII0580, which is significantly similar to the multicopper oxidase from Escherichia coli, was predicted to be the probable blue copper protein YacK precursor in Brucella melitensis 16M, and was designated as Brucella multicopper oxidase (BmcO). A bioinformatics analysis indicated that the typical motifs of multicopper oxidases are present in BmcO. BmcO, the expression of which was up-regulated by copper, could catalyze the oxidation of 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), dimethoxyphenol (DMP) and para-phenylenediamine (pPD), which are widely used as substrates for multicopper oxidase. Additionally, BmcO exhibited ferroxidase activity, which indicated that it might play an important role in the Fe(2+) uptake of B. melitensis. Importantly, the mutant strain 16M?bmcO was more sensitive to copper than the wild-type strain B. melitensis 16M as well as its complementation strain 16M?bmcO(bmcO). The infection assays of cells showed that similar bacterial numbers of B. melitensis 16M, 16M?bmcO and 16M?bmcO(bmcO) strains were recovered from the infected macrophages. This result indicated that BmcO was not essential for B. melitensis intracellular growth. In conclusion, our results confirm that BmcO is a multicopper oxidase and contributes to the copper tolerance of B. melitensis 16M. PMID:25956175

  15. Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub

    PubMed Central

    Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L

    2012-01-01

    Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

  16. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

    PubMed Central

    Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

    2013-01-01

    Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

  17. Catalytic Cycle of Multicopper Oxidases Studied by Combined Quantum- and Molecular-Mechanical Free-Energy Perturbation Methods.

    PubMed

    Li, Jilai; Farrokhnia, Maryam; Rulíšek, Lubomír; Ryde, Ulf

    2015-07-01

    We have used combined quantum mechanical and molecular mechanical free-energy perturbation methods in combination with explicit solvent simulations to study the reaction mechanism of the multicopper oxidases, in particular, the regeneration of the reduced state from the native intermediate. For 52 putative states of the trinuclear copper cluster, differing in the oxidation states of the copper ions and the protonation states of water- and O2-derived ligands, we have studied redox potentials, acidity constants, isomerization reactions, as well as water- and O2 binding reactions. Thereby, we can propose a full reaction mechanism of the multicopper oxidases with atomic detail. We also show that the two copper sites in the protein communicate so that redox potentials and acidity constants of one site are affected by up to 0.2 V or 3 pKa units by a change in the oxidation state of the other site. PMID:26039490

  18. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli.

    PubMed

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  19. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  20. Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression.

    PubMed

    Ye, Mao; Li, Gang; Liang, Wei Qu; Liu, Yu Huan

    2010-07-01

    Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg of purified enzyme from 1 l induced culture, which is the highest expression report for bacterial laccase genes so far. Furthermore, the recombinant enzyme demonstrated activity toward classical laccase substrates syringaldazine (SGZ), guaiacol, and 2, 6-dimethoxyphenol (2, 6-DMP). The purified Lac591 exhibited maximal activity at 55 degrees C and pH 7.5 with guaiacol as substrate and was found to be stable in the pH range of 7.0-10.0. The substrate specificity on different substrates was studied with the purified enzyme, and the optimal substrates were in the order of 2, 6-DMP > catechol > alpha-naphthol > guaiacol > SGZ > 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid). The alkaline activity and highly soluble expression of Lac591 make it a good candidate of laccases in industrial applications for which classical laccases are unsuitable, such as biobleaching of paper pulp and dyestuffs processing. PMID:20358193

  1. A putative multicopper oxidase, IoxA, is involved in iodide oxidation by Roseovarius sp. strain A-2.

    PubMed

    Shiroyama, Kanna; Kawasaki, Yasutaka; Unno, Yusuke; Amachi, Seigo

    2015-11-01

    Roseovarius sp. strain A-2 is an aerobic heterotrophic bacterium with a capacity for oxidizing iodide ion (I(-)) to form molecular iodine (I2). In this study, iodide-oxidizing enzyme of strain A-2 was characterized. The enzyme was an extracellular protein, and Cu(2+) ion significantly enhanced the enzyme activity in the culture supernatant. When iodide was used as the substrate, the crude enzyme showed Km and Vmax values of 4.78 mM and 25.1 U mg(-1), respectively. The enzyme was inhibited by NaN3, EDTA, KCN, and o-phenanthroline, and also had significant activities toward p-phenylenediamine and hydroquinone. Tandem mass spectrometric analysis of an active band excised from SDS-PAGE gel revealed that at least two proteins are involved in the enzyme. One of these proteins was closely related with IoxA, a multicopper oxidase previously found as a component of iodide-oxidizing enzyme of Alphaproteobacterium strain Q-1. Furthermore, a terrestrial bacterium Rhodanobacter denitrificans 116-2, which possesses an ioxA-like gene in its genome, was found to oxidize iodide. These results suggest that IoxA catalyzes the oxidation of iodide in phylogenetically distinct bacteria. PMID:26041311

  2. Multireference Ab Initio Calculations of g tensors for Trinuclear Copper Clusters in Multicopper Oxidases

    PubMed Central

    Vancoillie, Steven; Chalupský, Jakub; Ryde, Ulf; Solomon, Edward I.; Pierloot, Kristine; Neese, Frank; Rulíšek, Lubomír

    2010-01-01

    EPR spectroscopy has proven to be an indispensable tool in elucidating the structure of metal sites in proteins. In recent years, experimental EPR data have been complemented by theoretical calculations, which have become a standard tool of many quantum chemical packages. However, there have only been a few attempts to calculate EPR g tensors for exchange-coupled systems with more than two spins. In this work, we present a quantum chemical study of structural, electronic, and magnetic properties of intermediates in the reaction cycle of multicopper oxidases and of their inorganic models. All these systems contain three copper(II) ions bridged by hydroxide or O2? anions and their ground states are antiferromagnetically coupled doublets. We demonstrate that only multireference methods, such as CASSCF/CASPT2 or MRCI can yield qualitatively correct results (compared to the experimental values) and consider the accuracy of the calculated EPR g tensors as the current benchmark of quantum chemical methods. By decomposing the calculated g tensors into terms arising from interactions of the ground state with the various excited states, the origin of the zero-field splitting is explained. The results of the study demonstrate that a truly quantitative prediction of the g tensors of exchange-coupled systems is a great challenge to contemporary theory. The predictions strongly depend on small energy differences that are difficult to predict with sufficient accuracy by any quantum chemical method that is applicable to systems of the size of our target systems. PMID:20469875

  3. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera.

    PubMed

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng

    2015-01-01

    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  4. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera

    PubMed Central

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng

    2015-01-01

    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  5. Characterization of a novel high-pH-tolerant laccase-like multicopper oxidase and its sequence diversity in Thioalkalivibrio sp.

    PubMed

    Ausec, Luka; ?rnigoj, Miha; Šnajder, Marko; Ulrih, Nataša Poklar; Mandic-Mulec, Ines

    2015-12-01

    Laccases are oxidoreductases mostly studied in fungi, while bacterial laccases remain poorly studied despite their high genetic diversity and potential for biotechnological application. Our previous bioinformatic analysis identified alkaliphilic bacterial strains Thioalkalivibrio sp. as potential sources of robust bacterial laccases that would be stable at high pH. In the present work, a gene for a laccase-like enzyme from Thioalkalivibrio sp. ALRh was cloned and expressed as a 6× His-tagged protein in Escherichia coli. The purified enzyme was a pH-tolerant laccase stable in the pH range between 2.1 and 9.9 at 20 °C as shown by intrinsic fluorescence emission spectrometry. It had optimal activities at pH 5.0 and pH 9.5 with the laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 2,6-dimethoxyphenol, respectively. In addition, it could oxidize several other monophenolic compounds and potassium hexacyanoferrate(II) but not tyrosine. It showed highest activity at 50 °C, making it suitable for prolonged incubations at this temperature. The present study shows that Thioalkalivibrio sp. encodes an active, alkaliphilic, and thermo-tolerant laccase and contributes to our understanding of the versatility of bacterial laccase-like multicopper oxidases in general. PMID:26227413

  6. Thermostable multicopper oxidase from Thermusthermophilus HB27: crystallization and preliminaryX-ray diffraction analysis of apo and holo forms

    SciTech Connect

    Serrano-Posada H.; Stojanoff V.; Valderrama B.; Rudino-Pinera E.

    2011-09-17

    A thermostable multicopper oxidase from Thermus thermophilus HB27 (Tth-MCO) was successfully crystallized using the sitting-drop and hanging-drop vapour-diffusion methods. Crystallization conditions and preliminary X-ray diffraction data to 1.5 {angstrom} resolution obtained using synchrotron radiation at 100 K are reported. The crystals belonged to space group C222{sub 1}, with unit-cell parameters a = 93.6, b = 110.3, c = 96.3 {angstrom}. A monomer in the asymmetric unit yielded a Matthews coefficient (V{sub M}) of 2.60 {angstrom}{sup 3} Da{sup -1} and a solvent content of 53%. An inactive enzyme form, apo-Tth-MCO, was also crystallized and diffraction data were collected to 1.7 {angstrom} resolution. In addition, a second inactive form of the enzyme, Hg-Tth-MCO, was obtained by soaking apo-Tth-MCO crystals with mercury(II) chloride and data were collected to a resolution of 1.7 {angstrom}.

  7. Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.

    PubMed

    Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen

    2014-07-14

    The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions. PMID:24875125

  8. A novel enzyme-based antimicrobial system comprising iodide and a multicopper oxidase isolated from Alphaproteobacterium strain Q-1.

    PubMed

    Yuliana, Tri; Ebihara, Kyota; Suzuki, Mio; Shimonaka, Chie; Amachi, Seigo

    2015-12-01

    Alphaproteobacterium strain Q-1 produces an extracellular multicopper oxidase (IOX), which catalyzes iodide (I(-)) oxidation to form molecular iodine (I2). In this study, the antimicrobial activity of the IOX/iodide system was determined. Both Gram-positive and Gram-negative bacteria tested were killed completely within 5 min by 50 mU mL(-1) of IOX and 10 mM iodide. The sporicidal activity of the system was also tested and compared with a common iodophor, povidone-iodine (PVP-I). IOX (300 mU mL(-1)) killed Bacillus cereus, B. subtilis, and Geobacillus stearothermophilus spores with decimal reduction times of 2.58, 7.62, and 40.9 min, respectively. However, 0.1 % PVP-I killed these spores with much longer decimal reduction times of 5.46, 38.0, and 260 min, respectively. To evaluate the more superior sporicidal activity of the IOX system over PVP-I, the amount of free iodine (non-complexed I2) was determined by an equilibrium dialysis technique. The IOX system included more than 40 mg L(-1) of free iodine, while PVP-I included at most 25 mg L(-1) free iodine. Our results suggest that the new enzyme-based antimicrobial system is effective against a wide variety of microorganisms and bacterial spores, and that its strong biocidal activity is due to its high free iodine content, which is probably maintained by re-oxidation of iodide released after oxidation of cell components by I2. PMID:26254787

  9. Mechanism of the Reduction of the Native Intermediate in the Multicopper Oxidases: Insights into Rapid Intramolecular Electron Transfer in Turnover

    PubMed Central

    2015-01-01

    The multicopper oxidases (MCOs) are the family of enzymes that catalyze the 4-electron reduction of O2 to H2O coupled to the four 1-electron oxidations of substrate. In the catalytic cycle electrons are transferred intramolecularly over ?13 Å from a Type 1 (T1) Cu site that accepts electrons from substrate to a trinuclear Cu cluster (TNC) where O2 is reduced to H2O at rapid rates consistent with turnover (560 s–1). The oxygen reduction mechanism for the MCOs is well-characterized, whereas the rereduction is less understood. Our initial study of Rhus vernicifera Laccase (Heppner et al. J. Am. Chem. Soc.2013, 135, 12212) experimentally established that the native intermediate (NI), the species formed upon O–O bond cleavage, is reduced with an IET rate >700 s–1 and is the catalytically relevant fully oxidized form of the enzyme, rather than the resting state. In this report, we present kinetic and spectroscopic results coupled to DFT calculations that evaluate the mechanism of the 3 e–/3 H+ reduction of NI, where all three catalytically relevant intramolecular electron transfer (IET) steps are rapid and involve three different structural changes. These three rapid IET processes reflect the sophisticated mechanistic control of the TNC to enable rapid turnover. All three IET processes are fast due to the associated protonation of the bridging oxo and hydroxo ligands, generated by O–O cleavage, to form water products that are extruded from the TNC upon full reduction, thereby defining a unifying mechanism for oxygen reduction and rapid IET by the TNC in the catalytic cycle of the MCOs. PMID:25490729

  10. Molecular Dynamics of a Thermostable Multicopper Oxidase from Thermus thermophilus HB27: Structural Differences between the Apo and Holo Forms

    PubMed Central

    Bello, Martiniano; Valderrama, Brenda; Serrano-Posada, Hugo; Rudiño-Piñera, Enrique

    2012-01-01

    Molecular dynamic (MD) simulations have been performed on Tth-MCO, a hyperthermophilic multicopper oxidase from thermus thermophilus HB27, in the apo as well as the holo form, with the aim of exploring the structural dynamic properties common to the two conformational states. According to structural comparison between this enzyme and other MCOs, the substrate in process to electron transfer in an outer-sphere event seems to transiently occupy a shallow and overall hydrophobic cavity near the Cu type 1 (T1Cu). The linker connecting the ?-strands 21 and 24 of the second domain (loop (?21–?24)D2) has the same conformation in both states, forming a flexible lid at the entrance of the electron-transfer cavity. Loop (?21–?24)D2 has been tentatively assigned a role occluding the access to the electron-transfer site. The dynamic of the loop (?21–?24)D2 has been investigated by MD simulation, and results show that the structures of both species have the same secondary and tertiary structure during almost all the MD simulations. In the simulation, loop (?21–?24)D2 of the holo form undergoes a higher mobility than in the apo form. In fact, loop (?21–?24)D2 of the holo form experiences a conformational change which enables exposure to the electron-transfer site (open conformation), while in the apo form the opposite effect takes place (closed conformation). To confirm the hypothesis that the open conformation might facilitate the transient electron-donor molecule occupation of the site, the simulation was extended another 40 ns with the electron-donor molecule docked into the protein cavity. Upon electron-donor molecule stabilization, loops near the cavity reduce their mobility. These findings show that coordination between the copper and the protein might play an important role in the general mobility of the enzyme, and that the open conformation seems to be required for the electron transfer process to T1Cu. PMID:22808237

  11. Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta

    PubMed Central

    Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.

    2009-01-01

    Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect’s cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-?-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min?1, 80 min?1, and 290 min?1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2?-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min?1 and 180 min?1. These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

  12. X-ray-induced catalytic active-site reduction of a multicopper oxidase: structural insights into the proton-relay mechanism and O2-reduction states.

    PubMed

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia; Rodríguez-Almazán, Claudia; Stojanoff, Vivian; Rudiño-Piñera, Enrique

    2015-12-01

    During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O2 to 2H2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth-MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O2 reduction was found in a double conformation: Glu451a (?7?Å from the TNC) and Glu451b (?4.5?Å from the TNC). A positive peak of electron density above 3.5? in an Fo - Fc map for Glu451a?O(?2) indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth-MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth-MCO-C1-8) with different X-ray-absorbed doses allowed the observation of different O2-reduction states, and a total depletion of T2Cu at doses higher than 0.2?MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure. PMID:26627648

  13. The three heavy-chain precursors for the inter-alpha-inhibitor family in mouse: new members of the multicopper oxidase protein group with differential transcription in liver and brain.

    PubMed Central

    Chan, P; Risler, J L; Raguenez, G; Salier, J P

    1995-01-01

    The inter-alpha-inhibitor (I alpha I) family is comprised of the plasma protease inhibitors I alpha I, inter-alpha-like inhibitor (I alpha LI), pre-alpha-inhibitor (P alpha I) and bikunin. I alpha I, I alpha LI and P alpha I are distinct assemblies of bikunin with one of three heavy (H) chains designated H1, H2 and H3. These H chains and bikunin are respectively encoded by a set of three H genes and an alpha 1-microglobulin/bikunin precursor (AMBP) gene. All four gene products undergo maturation steps from precursor polypeptides. The full-length cDNAs for the H1-, H2- and H3-chain precursors were cloned from a mouse liver cDNA library and sequenced. Extensive searches of amino acid sequence similarities to other proteins in databanks revealed (i) a highly significant similarity of the C-terminal sequence in the three H-chain precursors to the multicopper-binding domain in the group of multicopper oxidase proteins and (ii) the presence of von Willebrand type-A domains in the mature H chains. Amino acid sequence comparisons between the three mouse H1-, H2- and H3-chain precursors and their human counterparts allowed us to appraise the timing and order of occurrence of the three H-chain genes from a shared ancestor during mammalian evolution. Owing to a multiple alignment of the six mouse and human nucleotide sequences for these H-chain precursors, a reverse transcriptase PCR assay with degenerate oligonucleotides was designed, allowing us to (i) present evidence that no mRNAs for further H genes exist in mouse liver and (ii) demonstrate a previously undescribed transcription of the H2- and H3-chain mRNAs in mouse brain, which contrasts with the expression of all four, H1, H2, H3 and AMBP, mRNAs in liver. Images Figure 2 Figure 5 Figure 6 PMID:7534067

  14. Simulation of the cavity-binding site of three bacterial multicopper oxidases upon complex stabilization: interactional profile and electron transference pathways.

    PubMed

    Bello, Martiniano; Correa-Basurto, Jose; Rudiño-Piñera, Enrique

    2014-01-01

    Previous studies have shown that multicopper oxidases (MCOs) oxidize organic and inorganic compounds through oxidation-reduction reactions in which three structurally and functionally arranged copper centers coordinate the uptake of an electron from a reduced substrate. Structural comparisons among three bacterial MCOs, with high structural homology and available three-dimensional information, reveal that the primary structural differences between these MCOs are located near the mononuclear copper center (T1Cu), where substrate oxidation occurs, as opposed to where the reduction of oxygen to water occurs at the trinuclear center. Nevertheless, this substrate oxidation is achieved through an outer-sphere electron transfer mechanism that does not generate a stable substrate-enzyme complex. In this study, MCOs from Thermus thermophilus (Tth-MCO), Bacillus subtilis (CotA), and Escherichia coli (CueO), which have been previously determined through X-ray crystallography, were used as models to analyze the binding modes of these MCOs to three organic molecules, with specific interest in the substrate-binding site. The binding mode of the electron-donor molecule to the electron transfer binding site was primarily attributed to hydrophobic contacts, which likely play an important role in the determination of substrate specificity. Some complexes generated in this study showed an electron donor molecule conformation in which an electron could be directly transferred to the histidines coordinating T1Cu, while for others additional electron transference pathways were also possible through the participation of charged residues during electron transfer. PMID:23859715

  15. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals.

    PubMed

    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin

    2015-01-01

    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

  16. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals

    PubMed Central

    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin

    2015-01-01

    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

  17. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    PubMed Central

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-01-01

    X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-­ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

  18. Crystal Structures of Multicopper Oxidase CueO Bound to Copper(I) and Silver(I): Functional Role of a Methonine-Rich Sequence

    SciTech Connect

    Singh, Satish K.; Roberts, Sue A.; McDevitt, Sylvia F.; Weichsel, Andrzej; Wildner, Guenter F.; Grass, Gregor B.; Rensing, Christopher; Montfort, William R.

    2011-10-24

    The multicopper oxidase CueO oxidizes toxic Cu(I) and is required for copper homeostasis in Escherichia coli. Like many proteins involved in copper homeostasis, CueO has a methionine-rich segment that is thought to be critical for copper handling. How such segments function is poorly understood. Here, we report the crystal structure of CueO at 1.1 {angstrom} with the 45-residue methionine-rich segment fully resolved, revealing an N-terminal helical segment with methionine residues juxtaposed for Cu(I) ligation and a C-terminal highly mobile segment rich in methionine and histidine residues. We also report structures of CueO with a C500S mutation, which leads to loss of the T1 copper, and CueO with six methionines changed to serine. Soaking C500S CueO crystals with Cu(I), or wild-type CueO crystals with Ag(I), leads to occupancy of three sites, the previously identified substrate-binding site and two new sites along the methionine-rich helix, involving methionines 358, 362, 368, and 376. Mutation of these residues leads to a {approx}4-fold reduction in kcat for Cu(I) oxidation. Ag(I), which often appears with copper in nature, strongly inhibits CueO oxidase activities in vitro and compromises copper tolerance in vivo, particularly in the absence of the complementary copper efflux cus system. Together, these studies demonstrate a role for the methionine-rich insert of CueO in the binding and oxidation of Cu(I) and highlight the interplay among cue and cus systems in copper and silver homeostasis.

  19. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    SciTech Connect

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-05-01

    Radiation-induced reduction, radiolysis of copper sites and the effect of pH value together with the concomitant geometrical distortions of the active centres were analysed in several fungal (C. gallica) laccase structures collected at cryotemperature. This study emphasizes the importance of careful interpretation when the crystallographic structure of a metalloprotein is described. X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O{sub 2}. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O{sub 2} reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account.

  20. The Escherichia coli cell division protein and model Tat substrate SufI (FtsP) localizes to the septal ring and has a multicopper oxidase-like structure.

    PubMed

    Tarry, Michael; Arends, S J Ryan; Roversi, Pietro; Piette, Evan; Sargent, Frank; Berks, Ben C; Weiss, David S; Lea, Susan M

    2009-02-20

    The Escherichia coli protein SufI (FtsP) has recently been proposed to be a component of the cell division apparatus. The SufI protein is also in widespread experimental use as a model substrate in studies of the Tat (twin arginine translocation) protein transport system. We have used SufI-GFP (green fluorescent protein) fusions to show that SufI localizes to the septal ring in the dividing cell. We have also determined the structure of SufI by X-ray crystallography to a resolution of 1.9 A. SufI is structurally related to the multicopper oxidase superfamily but lacks metal cofactors. The structure of SufI suggests it serves a scaffolding rather than an enzymatic role in the septal ring and reveals regions of the protein likely to be involved in the protein-protein interactions required to assemble SufI at the septal ring. PMID:19135451

  1. Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites

    SciTech Connect

    Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

    2009-04-30

    The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

  2. Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

    PubMed

    Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

    2011-03-01

    "Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores. PMID:21239558

  3. Structural comparison of the Pichia pastoris alcohol oxidase genes.

    PubMed

    Koutz, P; Davis, G R; Stillman, C; Barringer, K; Cregg, J; Thill, G

    1989-01-01

    In methylotrophic yeasts, alcohol oxidase is the first enzyme in the methanol-utilization pathway. The genome of one such yeast, Pichia pastoris, contains two alcohol oxidase genes, AOX1 and AOX2. Sequence analysis indicated that each gene encodes a similar protein of 663 amino acids. The protein-coding regions of the genes were 92% and 97% homologous at the nucleotide and predicted amino acid sequence levels, respectively. In contrast to homology observed within the protein-coding portions of the AOX genes, no homology was found in either the 5' or 3' non-coding regions. Although alcohol oxidase is found in peroxisomes of P. pastoris, the AOX amino acid sequences did not contain a peptide sequence similar to the peroxisomal transport sequence found at the C-terminus of some peroxisomally located proteins in higher eukaryotes. PMID:2660463

  4. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  5. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central

    2010-01-01

    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (?54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 ?54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  6. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation.

    PubMed

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D P

    2009-02-17

    Monoamine oxidase A gene (MAOA) has earned the nickname "warrior gene" because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as "altruistic" punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  7. Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha.

    PubMed

    Bruinenberg, P G; Evers, M; Waterham, H R; Kuipers, J; Arnberg, A C; AB, G

    1989-07-01

    We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence of a 3.6 kilobase stretch of DNA containing the amine oxidase (AMO) gene was determined. The AMO gene contains an open reading frame of 692 amino acids, with a relative molecular mass of 77,435. The 5' and 3' ends of the gene were mapped and show that the transcribed region measures 2134 nucleotides. The derived amino-acid sequence was confirmed by sequencing an internal proteolytic fragment of the purified protein. Amine oxidase contains the tripeptide sequence Ser-Arg-Leu, located 9 residues from the carboxy terminus, which may represent the topogenic signal for protein import into microbodies. PMID:2500147

  8. Suppression substractive hybridisation (SSH) and real time PCR reveal differential gene expression in the Pacific cupped oyster, Crassostrea gigas, challenged with Ostreid herpesvirus 1.

    PubMed

    Renault, T; Faury, N; Barbosa-Solomieu, V; Moreau, K

    2011-07-01

    Virus-induced genes were identified using suppression subtractive hybridisation (SSH) from Pacific cupped oyster, Crassostrea gigas, haemocytes challenged by OsHV-1. A total of 304 clones from SSH forward library were sequenced. Among these sequences, some homologues corresponded to (i) immune related genes (macrophage express protein, IK cytokine, interferon-induced protein 44 or multicopper oxidase), (ii) apoptosis related genes (Bcl-2) and (iii) cell signalling and virus receptor genes (glypican). Molecular characterization and phylogenic analysis of 3 immune-related genes (macrophage expressed protein, multicopper oxidase and immunoglobulin domain cell adhesion molecule) were performed. Finally, quantitative PCR revealed significant changes in the expression of immune related genes (multicopper oxidase, macrophage expressed protein, myeloid differentiation factor 88 and interferon-induced protein 44) in oysters experimentally challenged with OsHV-1. These findings provide a first basis for studying the role of innate immunity in response to viruses in bivalves and identified genes may serve as markers of interest in breeding programs in order to obtain selected oysters presenting OsHV-1 resistance. PMID:21371503

  9. Two peanut germin-like genes and the potential superoxidase dismutase and oxalate oxidase activities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Germins and germin-like proteins (GLPs) genes are members of large multigene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity leadin...

  10. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development. PMID:24374939

  11. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  12. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  13. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  14. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  15. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  16. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities

    PubMed Central

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L.; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-01-01

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1–4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Polpo) and aldehyde oxidase-1 (Aldox-1n1) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Polpo-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Polpo allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1n1 phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  17. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  18. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  19. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  20. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  1. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H?O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P??. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  2. The alternative oxidase (AOX) gene in Vibrio fischeri is controlled by NsrR and upregulated in response to

    E-print Network

    McFall-Ngai, Margaret

    The alternative oxidase (AOX) gene in Vibrio fischeri is controlled by NsrR and upregulated Vibrio fischeri, we explore the regulation of aox expression and AOX function. Using quantitative PCR-encoding gene in Vibrio fischeri ES114, a bioluminescent marine bacterium that forms a symbiotic relationship

  3. Cloning, characterization, and expression in Escherichia coli of the genes encoding the cytochrome d oxidase complex from Azotobacter vinelandii.

    PubMed Central

    Moshiri, F; Chawla, A; Maier, R J

    1991-01-01

    Azotobacter vinelandii is a free-living nitrogen-fixing bacterium that has one of the highest respiratory rates of all aerobic organisms. Based on various physiological studies, a d-type cytochrome has been postulated to be the terminal oxidase of a vigorously respiring but apparently uncoupled branch of the electron transport system in the membranes of this organism. We cloned and characterized the structural genes of the two subunits of this oxidase. The deduced amino acid sequences of both subunits of the A. vinelandii oxidase have extensive regions of homology with those of the two subunits of the Escherichia coli cytochrome d complex. Most notably, the histidine residues proposed to be the axial ligands for the b hemes of the E. coli oxidase and an 11-amino-acid stretch proposed to be part of the ubiquinone binding site are all conserved in subunit I of the A. vinelandii oxidase. The A. vinelandii cytochrome d was expressed in a spectrally and functionally active form in the membranes of E. coli, under the control of the lac or tac promoter. The spectral features of the A. vinelandii cytochrome d expressed in E. coli are very similar to those of the E. coli cytochrome d. The expressed oxidase was active as a quinol oxidase and could reconstitute an NADH to oxygen electron transport chain. Images PMID:1655703

  4. A dinucleotide repeat polymorphism at the gene for monoamine oxidase A and measures of aggressiveness.

    PubMed

    Vanyukov, M M; Moss, H B; Yu, L M; Deka, R

    1995-11-29

    The relationship between measures of aggressiveness (personality questionnaire scales, conduct disorder diagnosis, and symptom count) and a recently discovered dinucleotide repeat length polymorphism at the monoamine oxidase type A (MAOA) gene (MAOCA-1) as a candidate locus was examined in adolescents using polymerase chain reaction. No significant correlation between aggression scales and repeat length at the MAOCA-1 marker was found, whereas the categorical diagnosis of conduct disorder showed a nonsignificant trend for an association with the marker. Alternative explanations of this trend are discussed. The data obtained suggest that the polymorphism studied is not associated with the variation in aggressiveness. PMID:8771218

  5. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene. PMID:26546307

  6. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics

    PubMed Central

    Mootha, Vamsi K.; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A.; Morin, Charles; Mann, Matthias; Hudson, Thomas J.; Robinson, Brian; Rioux, John D.; Lander, Eric S.

    2003-01-01

    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a “score” reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  7. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.

    PubMed

    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S

    2003-01-21

    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  8. Apple ACC-oxidase and polygalacturonase: ripening-specific gene expression and promoter analysis in transgenic tomato.

    PubMed

    Atkinson, R G; Bolitho, K M; Wright, M A; Iturriagagoitia-Bueno, T; Reid, S J; Ross, G S

    1998-10-01

    Levels of 1-aminocyclopropane-1-carboxylate (ACC) oxidase and polygalacturonase (PG) mRNAs were characterized during ripening of Royal Gala, Braeburn and Granny Smith apples. Both ACC-oxidase and PG mRNAs were up-regulated in ripening fruit of all three cultivars. Expression in Royal Gala was detected earlier than in Braeburn and Granny Smith, relative to internal ethylene concentration. Genomic clones corresponding to the ACC-oxidase and PG mRNAs expressed in ripe apple fruit were isolated and ca. 2 kb of each promoter was sequenced. The start point of transcription in each gene was mapped by primer extension, and sequences homologous to elements in other ethylene-responsive or PG promoters were identified. The fruit specificity of the apple ACC-oxidase and PG promoters was investigated in transgenic tomato plants using a nested set of promoter fragments fused to the beta-glucuronidase (gusA) reporter gene. For the ACC-oxidase gene, 450 bp of 5' promoter sequence was sufficient to drive GUS expression, although this expression was not specific to ripening fruit. Larger fragments of 1966 and 1159 bp showed both fruit and ripening specificity. For the PG gene, promoter fragments of 1460 and 532 bp conferred ripening-specific expression in transgenic tomato fruit. However GUS expression was down-regulated by 2356 bp of promoter, suggesting the presence of a negative regulatory element between positions -1460 and -2356. PMID:9747852

  9. Cloning and sequence analysis of a mitochondrial gene cluster encoding cytochrome C oxidase subunit III from Trichoderma pseudokoningii.

    PubMed

    Wang, Tian-Hong; Wu, Zhi-Hong; Liu, Shi-Li; Huang, Wei

    2002-10-01

    A mitochondrial gene cluster encoding cytochrome c oxidase subunit III (COX3), an ORF (called ORF250) similar to NADH dehydrogenase subunit VI (ND6), ten tRNA molecules, partial rRNA small subunit and rRNA large subunit from Trichoderma pseudokoningii S38 was cloned and sequenced. These genes are tandemly clustered on the mitochondrial genome of Trichoderma pseudokoningii S38. Phylogenetic analysis showed that cytochrome C oxidase subunits III exhibited high degree of similarity to sequences from Hypocrea jecorina, Verticillium lecanii, Podospora anserine, Neurospora crassa and Magnaporthe grisea (99, 90, 84, 82 and 79% identity, respectively). Prediction of transmembrane helices revealed that COX3 was a transmembrane protein. Northern dot blot analysis showed that the cytochrome c oxidase subunits III gene we had cloned is actively transcribed in the T. pseudokoningii mitochondria. PMID:12592707

  10. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M

    1998-01-01

    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  11. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 ?mol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  12. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  13. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on primary sequence data. The dynamic nature of this gene family differentiates PPO from other oxidative enzymes, and is consistent with a protein important for a diversity of functions relating to environmental adaptation. PMID:22897796

  14. Behavioural alterations in male mice lacking the gene for D-aspartate oxidase.

    PubMed

    Weil, Zachary M; Huang, Alex S; Beigneux, Anne; Kim, Paul M; Molliver, Mark E; Blackshaw, Seth; Young, Stephen G; Nelson, Randy J; Snyder, Solomon H

    2006-08-10

    D-serine and D-aspartate are important regulators of mammalian physiology. D-aspartate is found in nervous and endocrine tissue, specifically in hypothalamic supraoptic and paraventricular nuclei, pituitary, and adrenal medullary cells. Endogenous D-aspartate is selectively degraded by D-aspartate oxidase. We previously reported that adult male mice lacking the gene for D-aspartate oxidase (Ddo(-/-) mice) display elevated concentrations of D-aspartate in several neuronal and neuroendocrine tissues as well as impaired sexual performance and altered autogrooming behaviour. In the present study, we analyzed behaviours relevant to affect, cognition, and motor control in Ddo(-/-) mice. Ddo(-/-) mice display deficits in sensorimotor gating and motor coordination as well as reduced immobility in the forced swim test. Basal corticosterone concentrations are elevated. The Ddo(-/-) mice have D-aspartate immunoreactive cells in the cerebellum and adrenal glands that are not observed in the wild-type mice. However, no differences in anxiety-like behaviour are detected in open field or light-dark preference tests. Also, Ddo(-/-) mice do not differ from wild-type mice in either passive avoidance or spontaneous alternation tasks. Although many of these behavioural deficits may be due to the lack of Ddo during development, our results are consistent with the widespread distribution of D-aspartate and the hypothesis that endogenous D-aspartate serves diverse behavioural functions. PMID:16725213

  15. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  16. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  17. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated ?-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  18. A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

    PubMed Central

    Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

    2014-01-01

    Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s?1) and nicotine (Km = 2.03 mM, kcat = 0.396 s?1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

  19. Molecular cloning, expression profiles, and characterization of a novel polyphenol oxidase (PPO) gene in Hevea brasiliensis.

    PubMed

    Li, Dejun; Deng, Zhi; Liu, Changren; Zhao, Manman; Guo, Huina; Xia, Zhihui; Liu, Hui

    2014-01-01

    The polyphenol oxidase (PPO) is involved in undesirable browning in many plant foods. Although the PPOs have been studied by several researchers, the isolation and expression profiles of PPO gene were not reported in rubber tree. In this study, a new PPO gene, HbPPO, was isolated from Hevea brasiliensis. The sequence alignment showed that HbPPO indicated high identities to plant PPOs and belonged to dicot branch. The cis-acting regulatory elements related to stress/hormone responses were predicted in the promoter region of HbPPO. Real-time RT-PCR analyses showed that HbPPO expression varied widely depending on different tissues and developmental stages of leaves. Besides being associated with tapping panel dryness, the HbPPO transcripts were regulated by ethrel, wounding, H2O2, and methyl jasmonate treatments. Moreover, the correlation between latex coagulation rate and PPO activity was further confirmed in this study. Our results lay the foundation for further analyzing the function of HbPPO in rubber tree. PMID:25051980

  20. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  1. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 ?M/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 ?M/min and Km (NADH) 51.3 ?M, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  2. Brd1 Gene in Maize Encodes a Brassinosteroid C-6 Oxidase

    PubMed Central

    Makarevitch, Irina; Thompson, Addie; Muehlbauer, Gary J.; Springer, Nathan M.

    2012-01-01

    The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1–m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system. PMID:22292043

  3. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  4. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  5. Expression and characterization of six mutations in the protoporphyrinogen oxidase gene among Finnish variegate porphyria patients.

    PubMed Central

    von und zu Fraunberg, M.; Tenhunen, R.; Kauppinen, R.

    2001-01-01

    BACKGROUND: Variegate porphyria (VP) is an inherited disorder of heme biosynthesis that results from a partial deficiency of protoporphyrinogen oxidase (PPOX). Patients with VP may experience acute neurovisceral attacks and cutaneous photosensitivity. To date we have characterized 109 VP patients representing 19 VP families in the Finnish population of 5 million, both biochemically and clinically. MATERIALS AND METHODS: Mutations were identified by direct sequencing of the patients' genomic DNA. The effect of the mutations was determined by sequencing the reverse transcriptase polymerase chain reaction (RT-PCR) product amplified from total RNA extracted from the patients' lymphoblast cell lines and expressing the mutations in E. coli and COS-1 cells. RESULTS: Of the six mutations identified in the PPOX gene, three mutations (IVS2-2a-->c, 338G-->C, and 470A-->4C) caused splicing defects, one produced a frameshift (78insC) and two mutations (R152C and L401F) caused amino acid substitutions. In RT-PCR, the IVS2-2a-->c mutation caused a retention of a 36-bp fragment in the 3' end of intron 2, the 338G-->C mutation caused an exon 4 deletion, and the 470A-->C mutation caused an exon 5 deletion with retention of a 19-bp fragment of the 3' end of intron 5. In both prokaryotic and eukaryotic expression systems, the PPOX activities of five mutants were decreased to 0-5% of the normal activity. CONCLUSIONS: This study describes five novel mutations and one earlier described major mutation among Finnish VP patients. All mutations produced detectable transcripts, but resulted in decreased PPOX activity confirming the causality of the mutations and the biochemical defects in these patients. PMID:11474578

  6. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  7. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M

    1997-01-01

    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship between expression of thiC and production of the cbb3 terminal oxidase. This is consistent with the proposition that a purine-related metabolite, 5-aminoimidazole-4-carboxamide ribonucleotide, is a negative effector of the production of the symbiotic terminal oxidase cbb3 in R. etli. PMID:9371431

  8. Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon.

    PubMed

    Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G

    1999-10-01

    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

  9. Isolation and partial nucleotide sequence of the laccase gene from Neurospora crassa: amino acid sequence homology of the protein to human ceruloplasmin.

    PubMed Central

    Germann, U A; Lerch, K

    1986-01-01

    The laccase (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) gene from Neurospora crassa was cloned and part of its nucleotide sequence corresponding to the carboxyl-terminal region of the protein has been determined. The gene was cloned by cDNA synthesis with a laccase-specific synthetic deoxyundecanucleotide as primer and poly(A) RNA isolated from cycloheximide-treated N. crassa cultures as template. Based on the nucleotide sequence of the cDNA obtained, a unique 21-mer was synthesized and used to screen a genomic DNA library from N. crassa. Five different positive clones were isolated and shown to share an overlapping DNA region with the same pattern of restriction sites. Sequence analysis of the common 1.36-kilobase Sal I fragment revealed an open reading frame of 726 nucleotides. The amino acid sequence deduced is in complete agreement with the primary structures of several tryptic peptides isolated previously from N. crassa laccase. The analyzed carboxyl-terminal region of laccase exhibits a striking sequence homology to the carboxyl-terminal part of the third homology unit of the multicopper oxidase ceruloplasmin and to a smaller extent, to the low molecular weight blue copper proteins plastocyanin and azurin. Based on amino acid sequence comparison between these proteins, putative copper ligands of N. crassa laccase are proposed. Moreover, these data further support the hypothesis that the small blue copper proteins and the multicopper oxidases have evolved from the same ancestral gene. Images PMID:2947240

  10. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  11. Cytochrome oxidase subunit 2 gene allows simultaneous detection and typing of Trypanosoma rangeli and Trypanosoma cruzi

    PubMed Central

    2013-01-01

    Background The parasites Trypanosoma rangeli and Trypanosoma cruzi share vectors and hosts over a wide geographical area in Latin America. In this study, we propose a single molecular approach for simultaneous detection and typing of T. rangeli and T. cruzi. Methods A restriction fragment length polymorphism analysis of the mitochondrial cytochrome oxidase II gene (COII-RFLP) using enzyme AluI and different amounts of DNA from the major genetic groups of T. rangeli and T. cruzi (KP1+/KP1- and DTU-I/DTU-II) was carried out. The same marker was tested on the other T. cruzi DTUs (DTU-III to DTU-VI) and on DNA extracted from gut contents of experimentally infected triatomines. Results The COII PCR generates a ~400 bp fragment, which after digestion with AluI (COII-RFLP) can be used to distinguish T. rangeli from T. cruzi and simultaneously differentiate the major genetic groups of T. rangeli (KP1+ and KP1-) and T. cruzi (DTU-I and DTU-II). The COII-RFLP generated bands of ~120 bp and ~280 bp for KP1+, whereas for KP1- no amplicon cleavage was observed. For T. cruzi, digestion of COII revealed a ~300 bp band for DTU-I and a ~250 bp band for DTU-II. For DTU-III to DTU-VI, COII-RFLP generated bands ranging from ~310 to ~330 bp, but the differentiation of these DTUs was not as clear as the separation between DTU-I and DTU-II. After AluI digestion, a species-specific fragment of ~80 bp was observed for all DTUs of T. cruzi. No cross-amplification was observed for Leishmania spp., T. vivax or T. evansi. Conclusions The COII-RFLP allowed simultaneous detection and typing of T. rangeli and T. cruzi strains according to their major genetic groups (KP1+/KP1- and DTU-I/DTU-II) in vitro and in vivo, providing a reliable and sensitive tool for epidemiological studies in areas where T. rangeli and T. cruzi coexist. PMID:24360167

  12. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  13. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  14. Identification of Panulirus homarus puerulus larvae by restriction fragment length polymorphism of mitochondrial cytochrome oxidase I gene.

    PubMed

    Dharani, G; Maitrayee, G A; Karthikayalu, S; Kumar, T S; Anbarasu, M; Vijayakumaran, M

    2009-02-01

    Molecular identification of puerulus larvae of Panulirus homarus of the genus Panulirus from Indian coast was studied by employing Polymerase Chain Reaction, Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of the mitochondrial DNA (mtDNA) Cytochrome Oxidase Gene (COI) by agarose gel electrophoresis and Denaturing Gradient Gel Electrophoresis (DGGE). The size of amplified fragment of COI gene was estimated to be approximately 1300 base pairs (bp). Single fragment amplification was recorded during different stages of the life cycle. The RFLP digestion was carried out using five different restriction enzymes (BsplI, HhaI, RsaI, TaqI and AluI). The RFLP profile of the different endonucleases, varied between 1-5 restriction types. RFLP analysis using endonuclease TaqI enabled identification of P. homarus during different stages of its life history. PMID:19579959

  15. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID:25018760

  16. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  17. Diversity of laccase-coding genes in Fusarium oxysporum genomes

    PubMed Central

    Kwiatos, Natalia; Ryngaj??o, Ma?gorzata; Bielecki, Stanis?aw

    2015-01-01

    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  18. Diversity of laccase-coding genes in Fusarium oxysporum genomes.

    PubMed

    Kwiatos, Natalia; Ryngaj??o, Ma?gorzata; Bielecki, Stanis?aw

    2015-01-01

    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  19. Environmental factors shaping the abundance and distribution of laccase-encoding bacterial community with potential phenolic oxidase capacity during composting.

    PubMed

    Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Guo, Jinsong; Zhang, Jiachao; Chen, Ming; Wu, Haipeng; Yuan, Yujie; He, Xiaoxiao; He, Yan

    2015-11-01

    Increasing molecular evidence points to a wide occurrence of laccase-like multicopper oxidase (LMCO)-encoding genes in bacteria. Most researches mainly focused on the bacterial LMCO diversity, whereas the processes and the environmental factors responsible for structuring bacterial LMCO communities remain relatively unknown in a composting system. Six gene libraries were constructed from samples in representative stages during composting. A total of 185 sequences obtained from sample DNA extracts were classified to 59 operational taxonomic units (OTUs) based on 10 % cutoff. The distribution profile of bacterial LMCO genes showed that proteobacterial- and actinobacterial-associated species were the dominant communities during composting. Pearson correlation analysis indicated that the pile temperature and water-soluble carbon (WSC) content were significantly positively correlated with bacterial LMCO gene OTU numbers, Chao1 and Shannon index, whereas the humic acid (HA)-like carbon content had the most significant effect on the distribution of the bacterial LMCO genes during composting by redundancy analysis. These findings will improve the understanding of the mutual relationship between environmental factors and bacterial LMCO community compositions in composting. PMID:26104868

  20. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  1. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes contributed to browning reactions in tuber tissues but their effect was not equal. Different PPO genes may be regulated independently reflecting their diversified functions. Our results show that amiRNAs can be used to suppress closely related members of highly conserved multi-gene family. This approach also suggests a new strategy for breeding low-browning crops using small DNA inserts. PMID:24618103

  2. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor ?1 (TGF-?1). Ishikawa cells treated with TGF-?1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-? receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-? signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  3. The Multicopper Ferroxidase Hephaestin Enhances Intestinal Iron Absorption in Mice

    PubMed Central

    Fuqua, Brie K.; Lu, Yan; Darshan, Deepak; Frazer, David M.; Wilkins, Sarah J.; Wolkow, Natalie; Bell, Austin G.; Hsu, JoAnn; Yu, Catherine C.; Chen, Huijun; Dunaief, Joshua L.; Anderson, Gregory J.; Vulpe, Chris D.

    2014-01-01

    Hephaestin is a vertebrate multicopper ferroxidase important for the transfer of dietary iron from intestinal cells to the blood. Hephaestin is mutated in the sex-linked anemia mouse, resulting in iron deficiency. However, sex-linked anemia mice still retain some hephaestin ferroxidase activity. They survive, breed, and their anemia improves with age. To gain a better understanding of the role of hephaestin in iron homeostasis, we used the Cre-lox system to generate knockout mouse models with whole body or intestine-specific (Villin promoter) ablation of hephaestin. Both types of mice were viable, indicating that hephaestin is not essential and that other mechanisms, multicopper ferroxidase-dependent or not, must compensate for hephaestin deficiency. The knockout strains, however, both developed a microcytic, hypochromic anemia, suggesting severe iron deficiency and confirming that hephaestin plays an important role in body iron acquisition. Consistent with this, the knockout mice accumulated iron in duodenal enterocytes and had reduced intestinal iron absorption. In addition, the similarities of the phenotypes of the whole body and intestine-specific hephaestin knockout mice clarify the important role of hephaestin specifically in intestinal enterocytes in maintaining whole body iron homeostasis. These mouse models will serve as valuable tools to study the role of hephaestin and associated proteins in iron transport in the small intestine and other tissues. PMID:24896847

  4. The multicopper ferroxidase hephaestin enhances intestinal iron absorption in mice.

    PubMed

    Fuqua, Brie K; Lu, Yan; Darshan, Deepak; Frazer, David M; Wilkins, Sarah J; Wolkow, Natalie; Bell, Austin G; Hsu, JoAnn; Yu, Catherine C; Chen, Huijun; Dunaief, Joshua L; Anderson, Gregory J; Vulpe, Chris D

    2014-01-01

    Hephaestin is a vertebrate multicopper ferroxidase important for the transfer of dietary iron from intestinal cells to the blood. Hephaestin is mutated in the sex-linked anemia mouse, resulting in iron deficiency. However, sex-linked anemia mice still retain some hephaestin ferroxidase activity. They survive, breed, and their anemia improves with age. To gain a better understanding of the role of hephaestin in iron homeostasis, we used the Cre-lox system to generate knockout mouse models with whole body or intestine-specific (Villin promoter) ablation of hephaestin. Both types of mice were viable, indicating that hephaestin is not essential and that other mechanisms, multicopper ferroxidase-dependent or not, must compensate for hephaestin deficiency. The knockout strains, however, both developed a microcytic, hypochromic anemia, suggesting severe iron deficiency and confirming that hephaestin plays an important role in body iron acquisition. Consistent with this, the knockout mice accumulated iron in duodenal enterocytes and had reduced intestinal iron absorption. In addition, the similarities of the phenotypes of the whole body and intestine-specific hephaestin knockout mice clarify the important role of hephaestin specifically in intestinal enterocytes in maintaining whole body iron homeostasis. These mouse models will serve as valuable tools to study the role of hephaestin and associated proteins in iron transport in the small intestine and other tissues. PMID:24896847

  5. The genetic basis of "Scarsdale Gourmet Diet" variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed

    Frank, J; Poh-Fitzpatrick, M B; King, L E; Christiano, A M

    1998-08-01

    The porphyrias are disorders of porphyrin or porphyrin-precursor metabolism that result from inherited or acquired aberrations in the control of the porphyrin-heme biosynthetic pathway. Variegate porphyria (VP), one of the acute hepatic porphyrias, is characterized by a partial reduction in the activity of protoporphyrinogen oxidase (PPO), and recently, mutations in the PPO gene on chromosome 1q22-23 have been described. Our purpose was to identify the underlying genetic lesion in a severely affected patient with VP and to detect the silent mutation carriers in her family. The disease in this patient was precipitated by carbohydrate restriction as outlined in the "Scarsdale Gourmet Diet". Our mutation detection and confirmation strategy included PCR, automated sequencing, and restriction enzyme digestion. We identified a missense mutation in the patient and five family members. The mutation consisted of a previously unreported C-to-T transition in exon 5 of the PPO gene, resulting in the substitution of arginine by cysteine, designated R152C. This arginine residue is evolutionarily highly conserved in humans, mice, bacteria, yeast, and plants, indicating the importance of this residue in PPO. Our study established that a missense mutation in the PPO gene was the underlying mutation in this patient with VP and explained the occurrence of the phenotype in this family. PMID:9763307

  6. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

    2013-01-01

    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  7. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    PubMed

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed. PMID:10945344

  8. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  9. Reduction of coproporphyrinogen oxidase level by antisense RNA synthesis leads to deregulated gene expression of plastid proteins and affects the oxidative defense system.

    PubMed Central

    Kruse, E; Mock, H P; Grimm, B

    1995-01-01

    A full-length cDNA sequence encoding coproporphyrinogen oxidase was inserted in inverse orientation behind a CaMV promoter and transferred to tobacco (Nicotiana tabacum) by standard transformation techniques. Transformants showed reduced coproporphyrinogen oxidase activity and accumulation of photosensitive coproporphyrin(ogen), indicating antisense RNA expression. An inverse correlation was observed between the level of coproporphyrinogen oxidase and transformant phenotype. The latter is characterized by a broad range of growth retardation and necrosis, indicating oxidative leaf damage. Coproporphyrinogen is an apparent chromophore and its excitation finally leads to the production of reactive oxygen. Evidence is presented that indicates a direct correlation between the accumulation of non-metabolized coproporphyrinogen and oxidative damage to cellular structural components. Enzymatic and non-enzymatic antioxidants were investigated. Whereas superoxide dismutase activity increased in transgenic plants, catalase and ascorbate peroxidase activity remained constant. Tocopherol, rather than carotene or zeaxanthin, seemed to be involved in detoxification, indicating the putative localization and allocation of coproporphyrinogen. Expression of coproporphyrinogen oxidase antisense RNA did not significantly influence the level of other enzymes in the chlorophyll metabolic pathway, but deregulated gene expression of nuclear encoded plastid proteins. Accumulation of coproporphyrinogen and/or the resulting effects, such as oxidative stress, impairs a plastid/nuclear signal which may adapt gene expression to the plastid state. Images PMID:7641690

  10. Directional substitution and evolution of nucleotide content in the cytochrome oxidase II gene in earwigs (dermapteran insects).

    PubMed

    Wirth, T; Le Guellec, R; Veuille, M

    1999-12-01

    The cytochrome oxidase subunit II (COII) gene was sequenced for six dermapteran species. The nucleotide composition of this gene is biased in most animals. While the CG content of other insect orders is low (mean, 27.6%; range, 19.5%-33.1%), species from the Forficula genus showed unusually high values (mean, 42.4%; range, 37.3%-44.1%), mostly due to high CG frequencies at third codon positions: the mean CG content at these positions was around 45% (range, 43.9%-46.9%) for Forficula, compared with only 13.3% for other insects. This effect was so strong that in one species, Forficula lesnei, there was no significant difference between the frequencies of the four bases. During evolution, this loss of bias has involved a significant increase in the synonymous substitution rate and an increase of transitions over transversions compared with other insects. A strong directionality of substitutions has favored T-->C and A-->G changes. This phenomenon was also observed between two conspecific populations of Forficula auricularia. A species from a closely related genus, Anechura bipunctata, was intermediate between Forficula and other insects for these parameters, while two remotely related dermapteran species, Labidura riparia and Euborellia moesta, were similar to other insects. These results suggest that the evolution of Forficula DNA content has been both rapid and recent. PMID:10605107

  11. Apparent selection intensity for the cytochrome oxidase subunit I gene varies with mode of reproduction in echinoderms.

    PubMed

    Foltz, David W; Hrincevich, Adam W; Rocha-Olivares, Axayácatl

    2004-10-01

    When most amino acid substitutions in protein-coding genes are slightly deleterious rather than selectively neutral, life history differences can potentially modify the effective population size or the selective regime, resulting in altered ratios of non-synonymous to synonymous substitutions among taxa. We studied substitution patterns for the mitochondrial cytochrome oxidase subunit I (COI) gene in a sea star genus (Leptasterias spp.) with an obligate brood-protecting mode of reproduction and small-scale population genetic subdivision, and compared the results to available COI sequences in nine other genera of echinoderms with pelagic larvae: three sea stars, five sea urchins and one brittle star. We predicted that this life history difference would be associated with differences in the ratio of non-synonymous (dN) to synonymous (dS) substitution rates. Leptasterias had a significantly greater dN/dS ratio (both between species and within species), a significantly smaller transition/transversion rate ratio, and a significantly lower average nucleotide diversity within species, than did the non-brooding genera. Other explanations for the results, such as altered mutation rates or selective sweeps, were not supported by the data analysis. These findings highlight the potential influence of reproductive traits and other life history factors on patterns of nucleotide substitution within and between species. PMID:15609571

  12. Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity

    PubMed Central

    Shetty, Rohit; Sathyanarayanamoorthy, Arunapriya; Ramachandra, Reshma Airody; Arora, Vishal; Ghosh, Anuprita; Srivatsa, Purnima Raman; Pahuja, Natasha; Nuijts, Rudy M. M. A.; Sinha-Roy, Abhijit; Ghosh, Arkasubhra

    2015-01-01

    Purpose Keratoconus (KC) is characterized by progressive vision loss due to corneal thinning and structural abnormalities. It is hypothesized that KC is caused by deregulated collagen levels and collagen fibril-maturating enzyme lysyl oxidase (LOX). Further, it is currently not understood whether the gene expression deregulated by the corneal epithelium influences KC pathogenesis. We studied (i) the expressions of the LOX, collagen I (COL IA1), collagen IV (COL IVA1), MMP9, and IL6 genes in KC corneal epithelia, (ii) validated their expression levels in patient tissues, and (iii) correlated expression levels with KC disease severity. The primary goal of this study was to evaluate the importance of these genes in the progression of KC. Methods We analyzed the gene expression levels of the key proteins LOX, collagens (COL IA1 and COL IVA1), MMP9, and IL6 in debrided corneal epithelia from a large cohort of KC patients (90 eyes) and compared them to control patients (52 eyes) without KC. We measured the total LOX activity in the tears of KC patients compared to controls. We also correlated the protein expression levels of LOX and collagens by immunohistochemistry (IHC) in primary tissues from KC patients (27 eyes) undergoing keratoplasty compared to healthy donor corneas (15 eyes). Results We observed a significant reduction in LOX transcript levels in KC corneal epithelia, and LOX activity in KC tears correlated with disease severity. Collagen transcripts were also reduced in KC while MMP9 transcript levels were upregulated and correlated with disease severity. IL6 was moderately increased in KC patients. IHC demonstrated a reduction in the protein expression levels of LOX in the epithelium and collagen IV in the basement membrane of KC patients compared to healthy donor corneas. Conclusions The data demonstrates that the structural deformity of the KC cornea may be dependent on reduced expressions of collagens and LOX, as well as on MMP9 elevated by the corneal epithelium. PMID:25593510

  13. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 ?g/L) in neutral or alkaline springs than in acidic springs (on average 30.88 ?g/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

  14. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics

    E-print Network

    Mootha, Vamsi K.

    involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly DNA, mRNA, and protein (Fig. 1) to facilitate disease-gene identification. We report the successful

  15. The interleukin-6, serotonin transporter, and monoamine oxidase A genes and endurance performance during the South African Ironman Triathlon.

    PubMed

    de Milander, Liesl; Stein, Dan J; Collins, Malcolm

    2009-10-01

    Previous studies have identified an association of genetic variants believed to alter physiological and biochemical processes locally within the skeletal muscle and therefore performance in the Ironman triathlon. There is growing evidence that the serotonergic system and circulating interleukin (IL)-6 levels are also involved in mediating endurance capacity. Investigators have demonstrated that recombinant human IL-6 administration and serotonergic neurotransmission manipulation, with 5-hydroxytryptamine transporter (5-HTT) and monoamine oxidase A (MAO-A) inhibitors, prior to exercise, can alter running performance, consistent with a central governor hypothesis. The aim of this study was to investigate possible associations of functional polymorphisms within the IL-6, 5-HTT, and MAO-A genes with endurance performance of Ironman triathletes. Four hundred sixty-eight male Caucasian triathletes who completed the 2000 and (or) 2001 South African Ironman Triathlon and 200 healthy Caucasian male controls were genotyped for the -174 IL-6 G/C, 5-HTT 40 base pair (bp) insertion-deletion and 30 bp variable number of tandem repeats (VNTR) MAO-A gene polymorphisms. There were no significant differences in the relative genotype distributions within the IL-6 (p = 0.636), 5-HTT (p = 0.659), and MOA-A (p = 0.227) polymorphisms when the fastest-fnishing, middle-finishing, and slowest-finishing triathletes, as well as the control groups, were compared. There were no direct associations between the IL-6 -174 G/C, 5-HTT 44 bp insertion-deletion, and MAO-A 30 bp VNTR gene polymorphisms and endurance performance in the 2000 and (or) 2001 South African Ironman Triathlons. The neurogenetic basis of the central governor requires further investigation. PMID:19935847

  16. CYP99A3: functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice.

    PubMed

    Wang, Qiang; Hillwig, Matthew L; Peters, Reuben J

    2011-01-01

    Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochrome P450 (CYP) mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNA interference double knock-down of this pair of closely related CYPs reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which was ultimately achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al, and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-?-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al, and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene-derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  17. Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences.

    PubMed

    Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R

    2013-07-01

    Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus. PMID:23778610

  18. Current issues in species identification for forensic science and the validity of using the cytochrome oxidase I (COI) gene.

    PubMed

    Wilson-Wilde, Linzi; Norman, Janette; Robertson, James; Sarre, Stephen; Georges, Arthur

    2010-09-01

    Species identification techniques commonly utilized in Australian Forensic Science laboratories are gel immunodifussion antigen antibody reactions and hair comparison analysis. Both of these techniques have significant limitations and should be considered indicative opinion based tests. The Barcode of Life Initiative aims to sequence a section of DNA (~648 base pairs) for the Cytochrome Oxidase I mitochondrial gene (COI) in all living species on Earth, with the data generated being uploaded to the Barcode of Life Database (BOLD) which can then be used for species identification. The COI gene therefore offers forensics scientists an opportunity to use the marker to analyze unknown samples and compare sequences generated in BOLD. Once sequences from enough species are on the database, it is anticipated that routine identification of an unknown species may be possible. However, most forensic laboratories are not yet suited to this type of analysis and do not have the expertise to fully interpret the implications of matches and non matches involving a poorly sampled taxa (for example where there are cryptic species) and in providing the required opinion evidence. Currently, the use of BOLD is limited by the number of relevant species held in the database and the quality assurance and regulation of sequences that are there. In this paper, the COI methodology and BOLD are tested on a selection of introduced and Australian mammals in a forensic environment as the first step necessary in the implementation of this approach in the Australian context. Our data indicates that the COI methodology performs well on distinct species but needs further exploration when identifying more closely related species. It is evident from our study that changes will be required to implement DNA based wildlife forensics using the BOLD approach for forensic applications and recommendations are made for the future adoption of this technology into forensic laboratories. PMID:20563888

  19. Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

    PubMed Central

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

    2010-01-01

    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  20. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  1. Oxyphil cell metaplasia in the parathyroids is characterized by somatic mitochondrial DNA mutations in NADH dehydrogenase genes and cytochrome c oxidase activity-impairing genes.

    PubMed

    Müller-Höcker, Josef; Schäfer, Sabine; Krebs, Stefan; Blum, Helmut; Zsurka, Gábor; Kunz, Wolfram S; Prokisch, Holger; Seibel, Peter; Jung, Andreas

    2014-11-01

    Oxyphil cell transformation of epithelial cells due to the accumulation of mitochondria occurs often during cellular aging. To understand the pathogenic mechanisms, we studied mitochondrial DNA (mtDNA) alterations in the three cell types of the parathyroids using multiplex real-time PCR and next-generation sequencing. mtDNA was analyzed from cytochrome c oxidase (COX)-positive and COX-negative areas of 19 parathyroids. Mitochondria-rich pre-oxyphil/oxyphil cells were more prone to develop COX defects than the mitochondria-poor clear chief cells (P < 0.001). mtDNA increased approximately 2.5-fold from clear chief to oxyphil cells. In COX deficiency, the increase was even more pronounced, and COX-negative oxyphil cells had approximately two times more mtDNA than COX-positive oxyphil cells (P < 0.001), illustrating the influence of COX deficiency on mtDNA biosynthesis, probably as a consequence of insufficient ATP synthesis. Next-generation sequencing revealed a broad spectrum of putative pathogenic mtDNA point mutations affecting NADH dehydrogenase and COX genes as well as regulatory elements of mtDNA. NADH dehydrogenase gene mutations preferentially accumulated in COX-positive pre-oxyphil/oxyphil cells and, therefore, could be essential for inducing oxyphil cell transformation by increasing mtDNA/mitochondrial biogenesis. In contrast, COX-negative cells predominantly harbored mutations in the MT-CO1 and MT-CO3 genes and in regulatory mtDNA elements, but only rarely NADH dehydrogenase mutations. Thus, multiple hits in NADH dehydrogenase and COX activity-impairing genes represent the molecular basis of oxyphil cell transformation in the parathyroids. PMID:25418474

  2. Sterol uptake induced by an impairment of pyridoxal phosphate synthesis in Saccharomyces cerevisiae: cloning and sequencing of the PDX3 gene encoding pyridoxine (pyridoxamine) phosphate oxidase.

    PubMed Central

    Loubbardi, A; Marcireau, C; Karst, F; Guilloton, M

    1995-01-01

    Exogenous sterols do not permeate wild-type Saccharomyces cerevisiae in aerobic conditions. However, mutant strain FKerg7, affected in lanosterol synthase, is a sterol auxotroph which is able to grow aerobically in the presence of ergosterol. Viability of this strain depends on the presence of an additional mutation, aux30, that leads to sterol permeability. Cells bearing the aux30 mutation fail to grow in standard yeast nitrogen base medium containing pyridoxine but grow normally if pyridoxine is replaced by either pyridoxal or pyridoxamine. These mutants are characterized by a lack in pyridoxine (pyridoxamine) phosphate oxidase [P(N/M)P oxidase] (EC 1.4.3.5) activity. The pleiotropic phenotype induced by the aux30 mutation includes a strong perturbation in amino acid biosynthesis. Strains bearing the aux30 mutation also display atypic fatty acid, sterol, and cytochrome patterns. Transformation of an aux30 strain with a replicative vector carrying the wild-type PDX3 gene encoding P(N/M)P oxidase restored wild-type fatty acid, sterol, and cytochrome patterns and suppressed exogenous sterol accumulation. It is proposed that sterol permeation of aux30 strains in mainly the consequence of their leaky Hem- character. The amino acid sequence of S. cerevisiae P(N/M)P oxidase inferred from the nucleotide sequence of PDX3 shows a high percentage of homology with the corresponding enzymes from Escherichia coli and Myxococcus xanthus. Several putative Gcn4p binding sequences are present in the PDX3 promoter region, leading to the assumption that transcription of this gene is under the general control of nitrogen metabolism. PMID:7896706

  3. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    PubMed

    He, X Y; He, Z H; Zhang, L P; Sun, D J; Morris, C F; Fuerst, E P; Xia, X C

    2007-06-01

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the present study, complete genomic DNA sequences of two PPO genes, one each located on chromosomes 2A and 2D and their allelic variants were characterized by means of in silico cloning and experimental validation. Sequences were aligned at both DNA and protein levels. Two haplotypes on chromosome 2D showed 95.2% sequence identity at the DNA level, indicating much more sequence diversity than those on chromosome 2A with 99.6% sequence identity. Both of the PPO genes on chromosomes 2A and 2D contain an open reading frame (ORF) of 1,731 bp, encoding a PPO precursor peptide of 577 amino acids with a predicted molecular mass of approximately 64 kD. Two complementary dominant STS markers, PPO16 and PPO29, were developed based on the PPO gene haplotypes located on chromosome 2D; they amplify a 713-bp fragment in cultivars with low PPO activity and a 490-bp fragment in those with high PPO activity, respectively. The two markers were mapped on chromosome 2DL using a doubled haploid population derived from the cross Zhongyou 9507/CA9632, and a set of nullisomic-tetrasomic lines and ditelosomic line 2DS of Chinese Spring. QTL analysis indicated that the PPO gene co-segregated with the two STS markers and was closely linked to SSR marker Xwmc41 on chromosome 2DL, explaining from 9.6 to 24.4% of the phenotypic variance for PPO activity across three environments. In order to simultaneously detect PPO loci on chromosomes 2A and 2D, a multiplexed marker combination PPO33/PPO16 was developed and yielded distinguishable DNA patterns in a number of cultivars. The STS marker PPO33 for the PPO gene on chromosome 2A was developed from the same gene sequences as PPO18 that we reported previously, and can amplify a 481-bp and a 290-bp fragment from cultivars with low and high PPO activity, respectively. A total of 217 Chinese wheat cultivars and advanced lines were used to validate the association between the polymorphic fragments and grain PPO activity. The results showed that the marker combination PPO33/PPO16 is efficient and reliable for evaluating PPO activity and can be used in wheat breeding programs aimed for noodle and other end product quality improvement. PMID:17426955

  4. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  5. Cytochrome c oxidase subunit III (COX3) gene, an informative marker for phylogenetic analysis and differentiation of Babesia species in China.

    PubMed

    Tian, Zhancheng; Liu, Guangyuan; Yin, Hong; Luo, Jianxun; Guan, Guiquan; Xie, Junren; Luo, Jin; Zheng, Jinfeng; Tian, Meiyuan; Yuan, Xiaosong; Wang, Fangfang; Chen, Ronggui; Wang, Haijun

    2013-08-01

    In this study a 552-bp region of the cytochrome c oxidase subunit III (COX3) was amplified by polymerase chain reaction (PCR) and sequenced from individual Babesia species. Sequence variation between Babesia species from China ranged between 0 and 32.4%. We analyzed the phylogenetic performance of the partial sequence of the COX3 gene to resolve Babesia relationships as compared to the nuclear 18S rRNA and the mitochondrial cytochrome b (COB) gene, These data indicate that the COX3 gene seems to be superior to the COB gene and the 18S rRNA in recognizing close lineages among some Babesia species. Our work indicates that the COX3 gene does complement and corroborate the phylogenetic inferences observed with the nuclear 18S rRNA and the COB gene previously reported. The combined phylogenetic analysis based on the nuclear 18S rRNA and the COX3 gene significantly improved (bootstrap) intraspecies support of the phylogenetic relationship. The presence of additional variable sites in the COX3 gene allowed an improved interspecies differentiation of Babesia species in this study. The data could be applicable for the survey of parasite dynamics, epidemiological studies as well as prevention and control of the disease. PMID:23619098

  6. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-?m plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  7. Cloning and sequencing of the alcohol oxidase-encoding gene (AOD1) from the formaldehyde-producing asporogeneous methylotrophic yeast, Candida boidinii S2.

    PubMed

    Sakai, Y; Tani, Y

    1992-05-01

    Alcohol oxidase (AOD) is the first key enzyme for methanol metabolism in methylotrophic yeasts. AOD activity is strictly regulated by carbon source. The AOD1 gene was cloned from a gene library of the asporogenous formaldehyde-producing methylotrophic yeast, Candida boidinii S2. The complete nucleotide sequence of the gene and its 5'- and 3'-flanking regions (4174 bp) were determined. To identify the conserved and divergent sequences of the AOD1 gene and its 5'-flanking sequences among different species of methylotrophic yeasts, the AOD-encoding genes from C. boidinii S2 (AOD1), Hansenula polymorpha (MOX) and Pichia pastoris (AOX1 and AOX2) were compared. In addition to conserved amino acid sequences, several DNA segments in the G+C-rich region of 5'-flanking sequences were also found to be conserved. Northern analysis showed that the AOD1 gene transcript was induced by methanol, but was not detected when cells were grown on ethanol or glucose. Thus, as in ascosporogenous methylotrophic yeasts, AOD1 gene expression in C. boidinii appears to be controlled at the RNA level. PMID:1587486

  8. Investigation of the C242T polymorphism of NAD(P)H oxidase p22 phox gene and ischaemic heart disease using family-based association methods.

    PubMed

    Spence, M S; McGlinchey, P G; Patterson, C C; Allen, A R; Murphy, G; Bayraktutan, U; Fogarty, D G; Evans, A E; McKeown, P P

    2003-12-01

    Ischaemic heart disease is a complex phenotype arising from the interaction of genetic and environmental factors. Excessive production of reactive oxygen species leading to endothelial dysfunction is believed to be important in the pathogenesis of ischaemic heart disease. The NAD(P)H oxidase system generates superoxide anions in vascular cells; however, the role of the C242T polymorphism of the NAD(P)H oxidase p22 phox gene in ischaemic heart disease is unclear due to contradictory results from case-control studies. Consequently, we applied family-based association tests to investigate the role of this polymorphism in ischaemic heart disease in a well-defined Irish population. A total of 1023 individuals from 388 families (discordant sibships and parent/child trios) were recruited. Linkage disequilibrium between the polymorphism and ischaemic heart disease was tested using the combined transmission disequilibrium test (TDT)/sib-TDT (cTDT) and pedigree disequilibrium test (PDT). Both cTDT and PDT analyses found no statistically significant excess transmission of either allele to affected individuals (P =0.30 and P =0.28, respectively). Using robust family-based association tests specifically designed for the study of complex diseases, we found no evidence that the C242T polymorphism of the p22 phox gene has a significant role in the development of ischaemic heart disease in our population. PMID:12877653

  9. Phylogenetic relationships of Habronema microstoma and Habronema muscae (Spirurida: Habronematidae) within the order Spirurida inferred using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene analysis.

    PubMed

    Iorio, Raffaella; Slapeta, Jan; Otranto, Domenico; Paoletti, Barbara; Giangaspero, Annunziata; Traversa, Donato

    2009-04-01

    The present study investigated genetic variability within a population of Habronema microstoma and Habronema muscae (Spirurida: Habronematidae) affecting horses in an endemic area of central Italy using polymerase chain reaction (PCR)-coupled sequencing of the mitochondrial cytochrome c oxidase subunit 1 gene (cox1). No different cox1 sequences were detected in any of the H. muscae individual, while two haplotypes representing H. microstoma individuals differed for one substitution. The pairwise distance between the H. muscae and H. microstoma was 11%, coding for five amino acid changes. The sequence of an informative region within the cox1 gene of H. microstoma and H. muscae was analyzed by Maximum Likelihood and Bayesian phylogenetic methods using available mitochondrial sequences spirurid taxa belonging to Filarioidea, Thelazioidea, and Habronematoidea. Phylogenetic analysis supported the split of the tree into two sister spirurid groups, Habronematoidea and Filarioidea + Thelazioidea. The phylogenetic and evolutionary implications of Habronema with Filaroidea and Thelazioidea are discussed. PMID:19057927

  10. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium.

    PubMed

    Vanden Wymelenberg, Amber; Sabat, Grzegorz; Mozuch, Michael; Kersten, Philip J; Cullen, Dan; Blanchette, Robert A

    2006-07-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences with significant similarity to GLX and designated cro1 through cro6. The predicted mature protein sequences diverge substantially from one another, but the residues coordinating copper and constituting the radical redox site are conserved. Transcript profiles, microscopic examination, and lignin analysis of inoculated thin wood sections are consistent with differential regulation as decay advances. The cro2-encoded protein was detected by liquid chromatography-tandem mass spectrometry in defined medium. The cro2 cDNA was successfully expressed in Aspergillus nidulans under the control of the A. niger glucoamylase promoter and secretion signal. The recombinant CRO2 protein had a substantially different substrate preference than GLX. The role of structurally and functionally diverse cro genes in lignocellulose degradation remains to be established. PMID:16820482

  11. A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

  12. Study on dioxygen reduction by mutational modifications of the hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase

    SciTech Connect

    Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige; Sakurai, Takeshi

    2014-07-18

    Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The single turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.

  13. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti?sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti?sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  14. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

    PubMed

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

    2014-07-15

    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced ?-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in ?-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. PMID:24974333

  15. Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum?†

    PubMed Central

    Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

    2011-01-01

    The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

  16. Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.

    PubMed

    Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy

    2014-07-01

    Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded. PMID:24956508

  17. Inhibition of development of experimental abdominal aortic aneurysm by c-jun N-terminal protein kinase inhibitor combined with lysyl oxidase gene modified smooth muscle progenitor cells.

    PubMed

    Chen, Feng; Zhang, ZhenDong; Zhu, XianHua

    2015-11-01

    Chronic inflammation, imbalance between the extracellular matrix synthesis and degradation, and loss of vascular smooth muscle cells (SMCs) contribute to the development of abdominal aortic aneurysm (AAA). The purpose of this study was to investigate the effect of the therapy with periaortic incubation of c-Jun N-terminal protein kinase inhibitor SP600125 infused from an osmotic pump and subadventitial injection of lysyl oxidase (LOX) gene modified autologous smooth muscle progenitor cells (SPCs) on treatment of AAA in a rabbit model. Obvious dilation of the abdominal aorta in the control group was caused by periaortic incubation of calcium chloride and elastase. But the progression of aortic dilation was significantly decreased after the treatment with SP600125 and LOX gene modified SPCs compared to the treatment with phosphate-buffered saline. This therapy could inhibit matrix metalloproteinases expression, enhance elastin synthesis, improve preservation of elastic laminar integrity, benefit SPCs survival and restore SMCs population. It seemed that this method might provide a novel therapeutic strategy to treat AAA. PMID:26435026

  18. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  19. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g?1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  20. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

    PubMed

    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

    2015-07-01

    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-? and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-?- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP) that regulate MAOA gene expression in a coordinated manner. Aberrant MAOA expression under pathophysiological conditions including inflammation and ischemia is mediated by altered binding of GATA2/Sp1/TBP with MAOA proximal promoter. Thus, these findings provide new insights into pathogenesis of several common diseases. GATA2, GATA-binding protein 2; Sp1, specificity protein 1; TBP, TATA-binding protein. PMID:25810277

  1. Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter.

    PubMed

    Baurain, Denis; Dinant, Monique; Coosemans, Nadine; Matagne, René F

    2003-03-01

    In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga Chlamydomonas reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless arylsulfatase (Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (-253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source. PMID:12644691

  2. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3?-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  3. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-01-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  4. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

    2012-01-01

    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  5. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  6. Overexpression of alcohol oxidase in Pichia pastoris.

    PubMed

    de Hoop, M J; Cregg, J; Keizer-Gunnink, I; Sjollema, K; Veenhuis, M; Ab, G

    1991-10-21

    The protein import capacity of peroxisomes in methylotrophic yeasts was studied using Pichia pastoris containing one or two extra copies of the gene encoding the peroxisomal protein alcohol oxidase. The alcohol oxidase overproduced in this strain was only partially imported and assembled into the active, octameric form of the protein. The excess remained in the cytosol as protein aggregates composed of monomers. These results are discussed in view of the possible application of peroxisomes as storage compartments for heterologous proteins. PMID:1936277

  7. New restriction fragment length polymorphisms in the cytochrome oxidase I gene facilitate host strain identification of fall armyworm (Lepidoptera: Noctuidae) populations in the southeastern United States.

    PubMed

    Nagoshi, Rod N; Meagher, Robert L; Adamczyk, John J; Braman, S Kristine; Brandenburg, Rick L; Nuessly, Gregg

    2006-06-01

    Several restriction sites in the cytochrome oxidase I gene of fall armyworm, Spodoptera frugiperda (J.E. Smith), were identified by sequence analysis as potentially being specific to one of the two host strains. Strain specificity was demonstrated for populations in Florida, Texas, Mississippi, Georgia, and North Carolina, with an AciI and SacI site specific to the rice (Oryjza spp.)-strain and a BsmI and HinfI site joining an already characterized MspI site as diagnostic of the corn (Zea mays L.)-strain. All four of these sites can be detected by digestion of a single 568-bp polymerase chain reaction-amplified fragment, but the use of two enzymes in separate digests was found to provide accurate and rapid determination of strain identity. The effectiveness of this method was demonstrated by the analysis of almost 200 adult and larval specimens from the Mississippi delta region. The results indicated that the corn-strain is likely to be the primary strain infesting cotton (Gossypium spp.) and that an unexpected outbreak of fall armyworm on the ornamental tree Paulownia tomentosa (Thunb.) Sieb. & Zucc. ex Steud. was due almost entirely to the rice-strain. PMID:16813297

  8. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4?cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  9. Amine Oxidase Copper-containing 1 (AOC1) Is a Downstream Target Gene of the Wilms Tumor Protein, WT1, during Kidney Development*

    PubMed Central

    Kirschner, Karin M.; Braun, Julian F.W.; Jacobi, Charlotte L.; Rudigier, Lucas J.; Persson, Anja Bondke; Scholz, Holger

    2014-01-01

    Amine oxidase copper-containing 1 (AOC1; formerly known as amiloride-binding protein 1) is a secreted glycoprotein that catalyzes the degradation of putrescine and histamine. Polyamines and their diamine precursor putrescine are ubiquitous to all organisms and fulfill pivotal functions in cell growth and proliferation. Despite the importance of AOC1 in regulating polyamine breakdown, very little is known about the molecular mechanisms that control its expression. We report here that the Wilms tumor protein, WT1, which is necessary for normal kidney development, activates transcription of the AOC1 gene. Expression of a firefly luciferase reporter under control of the proximal AOC1 promoter was significantly enhanced by co-transfection of a WT1 expression construct. Binding of WT1 protein to a cis-regulatory element in the AOC1 promoter was confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. Antisense inhibition of WT1 protein translation strongly reduced Aoc1 transcripts in cultured murine embryonic kidneys and gonads. Aoc1 mRNA levels correlated with WT1 protein in several cell lines. Double immunofluorescent staining revealed a co-expression of WT1 and AOC1 proteins in the developing genitourinary system of mice and rats. Strikingly, induced changes in polyamine homeostasis affected branching morphogenesis of cultured murine embryonic kidneys in a developmental stage-specific manner. These findings suggest that WT1-dependent control of polyamine breakdown, which is mediated by changes in AOC1 expression, has a role in kidney organogenesis. PMID:25037221

  10. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A ?cox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a ?cox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  11. l-Arginine oxidase from Pseudomonas sp. TPU 7192: Characterization, gene cloning, heterologous expression, and application to l-arginine determination.

    PubMed

    Matsui, Daisuke; Terai, Anna; Asano, Yasuhisa

    2016-01-01

    l-Arginine oxidase (AROD, EC 1.4.3.-) was discovered in newly discovered Pseudomonas sp. TPU 7192 and its characteristics were described. The molecular mass (MS) of the enzyme was estimated to be 528kDa, which was accounted for by eight identical subunits with MS of 66kDa each. AROD was identified as a flavin adenine dinucleotide (FAD)-dependent enzyme with 1mol of FAD being contained in each subunit. It catalyzed the oxidative deamination of l-arginine and converted l-arginine to 2-ketoarginine, which was non-enzymatically converted into 4-guanidinobutyric acid when the hydrogen peroxide (H2O2) formed by l-arginine oxidation was not removed. In contrast, 2-ketoarginine was present when H2O2was decomposed. AROD was specific to l-arginine with a Km value of 149?M. It exhibited maximal activity at 55°C and pH 5.5. AROD was stable in the pH range 5.5-7.5 and >95% of its original activity was below 60°C at pH 7.0. Since these enzymatic properties are considered suitable for the determination of l-arginine, the gene was cloned and expressed in a heterologous expression system. We herein successfully developed a new simple enzymatic method for the determination of l-arginine using Pseudomonas AROD. PMID:26672462

  12. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes.

    PubMed

    Makouloutou, P; Setsuda, A; Yokoyama, M; Tsuji, T; Saita, E; Torii, H; Kaneshiro, Y; Sasaki, M; Maeda, K; Une, Y; Hasegawa, H; Sato, H

    2013-09-01

    The gullet worm (Gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. Due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. To investigate this notion, the ribosomal RNA gene (rDNA), mainly regions of the internal transcribed spacers (ITS) 1 and 2, and a cytochrome c oxidase subunit I (COI) region of mitochondrial DNA of G. pulchrum were characterized using parasites from the following hosts located in Japan: cattle, sika deer, wild boars, Japanese macaques, a feral Reeves's muntjac and captive squirrel monkeys. The rDNA nucleotide sequences of G. pulchrum were generally well conserved regardless of their host origin. However, a few insertions/deletions of nucleotides along with a few base substitutions in the ITS1 and ITS2 regions were observed in G. pulchrum from sika deer, wild boars and Japanese macaques, and those differed from G. pulchrum in cattle, the feral Reeves's muntjac and captive squirrel monkeys. The COI sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes, i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated. Our findings indicate that domestic and sylvatic transmission cycles of the gullet worm are currently present, at least in Japan. PMID:22967753

  13. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  14. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  15. Molecular Phylogeny of Nematodes (Oxyurida: Travassosinematidae) from Orthoptera (Gryllotalpidae) Inferred by Mitochondrial Cytochrome C Oxidase Subunit 1 Gene

    PubMed Central

    Singh, Neetu; Chaudhary, Anshu; Singh, Hridaya Shanker

    2015-01-01

    In this study, we sequenced mt Cox 1 gene sequences of five nematode spp. that were infective to arthropod, Gryllotalpa africana. The nematode belongs to Thelastomatoidea, a group of pinworms that parasitizes only invertebrates. Currently, in India spp. of this group are distinguished mainly on the basis of morphological characters that present possible confusions. Therefore, we identified the species through morphological and genetic analysis. We selected mt Cox 1 gene region to show their phylogenetic position with closely related spp. and confirmed their molecular validation. The present findings are important to confirm the phylogenetic position and relationship among five nematode spp. and avoid misidentification regarding their validation, as it is more necessary in that case when many species harbours the same host. PMID:26339150

  16. Molecular and computational approaches to characterize thermostable laccase gene from two xerophytic plant species.

    PubMed

    Kumar, Gali Nirmal; Srikumar, Kotteazeth

    2014-02-01

    Laccases are blue multicopper oxidases that carry out single electron transfers in the oxidation of phenols to quinones. In plants, they confer structural stability to the cell wall. Thermostable laccases were identified in xerophytes Cereus pterogonus and Opuntia vulgaris that could be used in biotechnology and industrial processes. Polyclonal anti-laccase antibodies were generated against purified laccase enzyme isoforms capable of 98-99% inhibition of the catalytic activity. Antibodies raised against lower molecular weight isoforms inhibited 70% of the catalytic activity of higher molecular forms. Only 20% inhibition was noted when assayed in reverse. A partial gene sequence of thermostable xerophytic laccase comprising 712 and 880 bp was identified employing cDNA as template. The nucleotide sequence was submitted to GenBank. The gene sequence was in silico translated into protein sequence and a 3-D structure was predicted using I-Tasser and Genesilico online servers that justified the experimental observations. Anti-laccase antibodies and nucleotide gene sequence of this thermostable plant laccase can be utilized for predicting laccase antigenic sequences and for cloning and expression of the thermostable eukaryotic laccase. PMID:24218182

  17. [Analysis of nucleotide diversity at the cytochrome b and cytochrome oxidase 1 genes at the population, species, and genus levels].

    PubMed

    Kartavtsev, Iu F; Lee, J S

    2006-04-01

    Algorithms of nucleotide diversity measures and other measures of genetic divergence at the molecular level are analyzed. Based on a database of p-distances, we have compared genetic divergence of populations (1) and taxa of different rank, such as sibling species (2), species within a genus (3), and species from different genera within a family (4). Based on the theory and algorithms of distance calculation from the primary DNA sequences, as well as the actual distances estimated from literature, it is recommended to use in analysis of experimental data a specific model selected from the eight available ones. The empirical data for more than 24,000 vertebrate and invertebrate species demonstrate that the data series are realistic and interpretable when p-distance or its various estimates are used. This testifies to the applicability of p-distance for most interspecies and intraspecies comparisons of genetic divergence up to the family level by two genes compared. Data on p-distances revealed various and increasing levels of genetic divergence of the sequences of genes Cyt-b and Co-1 in four groups compared. Mean unweighted scores of distances for the four groups were as follows: Cyt-b (1) 1.55 +/- 0.56, (2) 5.52 +/- 1.34, (3) 10.69 +/- 1.34, (4) 18.51 +/- 2.09 and Co-1 (1) 0.55 +/- 0.19, (2) 4.91 +/- 0.83, (3) 9.66 +/- 0.72, (4) 14.69 +/- 1.02. Differences in divergence between the genes themselves at the four levels were also found, although the total mean distances for the two genes did not show statistically significant differences. This conforms to the ample evidence showing different and nonuniform evolution rates of these and other genes and their various regions. The results of the analysis of the nucleotide and allozyme divergence within species and higher taxa of animals, first, are in a good agreement with these results, including data on protein gene markers, and, second, this evidence suggests that in animals, phyletic evolution is likely to prevail at the molecular level, while speciation mainly corresponds to the type D1 geographic model). The prevalence of the D1 speciation mode does not mean that the other modes are absent. There are at least seven various modes of speciation. Recognition of speciation modes is a task that seems to require construction of a quantitative genetic model (theory) of speciation. Although, in view of a vast diversity of the possible causes of reproductive isolating barriers (RIBs) and speciation initiation, as well as the "empirical nature" of the formalized approach, proposed in the present work, some newly arising questions may be left without an answer. Their solution probably lied in increasing the number of descriptors and members of equations, proposed in this study, on the basis of DNA markers and other genomic characteristics. PMID:16756064

  18. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  19. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-01-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  20. Promoter analyses and transcriptional profiling of eggplant polyphenol oxidase 1 gene (SmePPO1) reveal differential response to exogenous methyl jasmonate and salicylic acid.

    PubMed

    Shetty, Santoshkumar M; Chandrashekar, Arun; Venkatesh, Yeldur P

    2012-05-01

    The transcriptional regulation of multigenic eggplant (Solanum melongena) polyphenol oxidase genes (SmePPO) is orchestrated by their corresponding promoters which mediate developmentally regulated expression in response to myriad biotic and abiotic factors. However, information on structural features of SmePPO promoters and modulation of their expression by plant defense signals are lacking. In the present study, SmePPOPROMOTERs were cloned by genome walking, and their transcription start sites (TSS) were determined by RLM-RACE. Extensive sequence analyses revealed the presence of evolutionarily conserved and over-represented putative cis-acting elements involved in light-regulated transcription, biosynthetic pathways (phenylpropanoid/flavonoid), hormone signaling (abscisic acid, gibberellic acid, jasmonate and salicylate), elicitor and stress responses (cold/dehydration responses), sugar metabolism and plant defense signaling (W-BOX/WRKY) that are common to SmePPOPROMOTER1 and 2. The TSS for SmePPO genes are located 9-15bp upstream of ATG with variable lengths of 5' untranslated regions. Transcriptional profiling of SmePPOs in eggplant seedlings has indicated differential response to methyl jasmonate (MeJA) or salicylic acid (SA) treatment. In planta, while MeJA elicited expression of all the six SmePPOs, SA was only able to induce the expression of SmePPO4-6. Interestingly, in dual treatment, SA considerably repressed the MeJA-induced expression of SmePPOs. Functional dissection of SmePPOPROMOTER1 by deletion analyses using Agrobacterium-mediated transient expression in tobacco leaves has shown that MeJA enhances the SmePPOPROMOTER1-?-glucuronidase (GUS) expression in vivo, while SA does not. Histochemical and quantitative GUS assays have also indicated the negative effect of SA on MeJA-induced expression of SmePPOPROMOTER1. By combining in silico analyses, transcriptional profiling and expression of SmePPOPROMOTER1-GUS fusions, the role of SA on the modulation of MeJA-induced SmePPO1 expression has been elucidated. It is concluded that similar to the coding regions of multigenic SmePPOs, the regulatory elements are also evolutionarily conserved and fall into two distinct sub-classes based on their responses to MeJA and SA. PMID:22377322

  1. Association of the NAD(P)H oxidase p22 phox gene C242T polymorphism with type 2 diabetes mellitus, diabetic nephropathy, and carotid atherosclerosis with type 2 diabetes mellitus: A meta-analysis

    PubMed Central

    Li, Tao; Xi, Hai-feng; Luo, Hong-min; Liu, Wen-xuan; Gao, Xia; Liu, Dian-wu; Yang, Lei

    2015-01-01

    Background Several epidemiological studies have evaluated the association between the NAD(P)H oxidase p22 phox gene C242T polymorphism and the risk of type 2 diabetes mellitus (T2DM), diabetic nephropathy (DN), and carotid atherosclerosis with T2DM (CA), but the results are inconclusive. This meta-analysis was therefore designed to clarify these controversies. Methods Systematic searches were performed using electronic databases such as MEDLINE, PubMed, EMBASE, and China National Knowledge Infrastructure, as well as through manual searching of the references of identified articles. A total of 11 publications were eligible for this meta-analysis after running a search on the NAD(P)H oxidase p22 phox gene C242T polymorphism, including 7 with outcomes for T2DM, 7 with outcomes for DN, and 3 with outcomes for CA. The pooled odds ratio (OR) with a 95% confidence interval (CI) was calculated using a fixed effects model (FEM) or a random effects model (REM). Publication bias was tested by Begg's funnel plot analysis. Sensitivity analysis was also performed. Results The results showed a significant association between the NAD(P)H oxidase p22 phox gene C242T polymorphism and T2DM risk in the allelic model (REM: OR = 1.23, 95% CI = 1.06–1.43), additive model (FEM: OR = 1.61, 95% CI = 1.14–2.26), and recessive model (FEM: OR = 1.50, 95% CI = 1.10–2.05). A significant association was also observed for DN in the allelic model (REM: OR = 1.25, 95% CI = 1.06–1.47), additive model (FEM: OR = 1.61, 95% CI = 1.08–2.38), and dominant model (REM: OR = 1.26, 95% CI = 1.03–1.54). However, no association was observed for CA. Similar results were obtained in subgroup analysis based on ethnicity. Conclusions Results of this meta-analysis suggest that the NAD(P)H oxidase p22 phox gene 242T allele might be associated with an increased risk of T2DM and DN, but not CA. PMID:26380814

  2. The LOXL2 Gene Encodes a New Lysyl Oxidase-like Protein and Is Expressed at High Levels in Reproductive Tissues*

    E-print Network

    Bryant-Greenwood, Gillian D.

    in Reproductive Tissues* (Received for publication, January 11, 1999) Claude Jourdan-Le Saux, Heike Tronecker and a member of an emerging family of human lysyl oxidases. The predicted amino acid sequence, from several overlapping cDNA clones isolated from placenta and spleen cDNA libraries, shared extensive sequence homology

  3. Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

    PubMed

    Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

    2014-01-01

    Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(?), lac8(?) and mco(?) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(?), lac7(?), mco(?) and lac6(?) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. PMID:24102726

  4. Azorhizobium caulinodans respires with at least four terminal oxidases.

    PubMed Central

    Kitts, C L; Ludwig, R A

    1994-01-01

    In culture, Azorhizobium caulinodans used at least four terminal oxidases, cytochrome aa3 (cytaa3), cytd, cyto, and a second a-type cytochrome, which together mediated general, respiratory electron (e-) transport to O2. To genetically dissect physiological roles for these various terminal oxidases, corresponding Azorhizobium apocytochrome genes were cloned, and three cytaa3 mutants, a cytd mutant, and a cytaa3, cytd double mutant were constructed by reverse genetics. These cytochrome oxidase mutants were tested for growth, oxidase activities, and N2 fixation properties both in culture and in symbiosis with the host plant Sesbania rostrata. The cytaa3 mutants grew normally, fixed N2 normally, and remained fully able to oxidize general respiratory e- donors (NADH, succinate) which utilize a cytc-dependent oxidase. By difference spectroscopy, a second, a-type cytochrome was detected in the cytaa3 mutants. This alternative a-type cytochrome (Amax = 610 nm) was also present in the wild type but was masked by bona fide cytaa3 (Amax = 605 nm). In late exponential-phase cultures, the cytaa3 mutants induced a new, membrane-bound, CO-binding cytc550, which also might serve as a cytc oxidase (a fifth terminal oxidase). The cloned Azorhizobium cytaa3 genes were strongly expressed during exponential growth but were deactivated prior to onset of stationary phase. Azorhizobium cytd mutants showed 40% lower N2 fixation rates in culture and in planta, but aerobic growth rates were wild type. The cytaa3, cytd double mutant showed 70% lower N2 fixation rates in planta. Pleiotropic cytc mutants were isolated by screening for strains unable to use N,N,N',N'-tetramethyl-p-phenylenediamine as a respiratory e- donor. These mutants synthesized no detectable cytc, excreted coproporphyrin, grew normally in aerobic minimal medium, grew poorly in rich medium, and fixed N2 poorly both in culture and in planta. Therefore, while aerobic growth was sustained by quinol oxidases alone, N2 fixation required cytc oxidase activities. Assuming that the terminal oxidases function as do their homologs in other bacteria, Azorhizobium respiration simultaneously employs both quinol and cytc oxidases. Because Azorhizobium terminal oxidase mutants were able to reformulate their terminal oxidase mix and grow more or less normally in aerobic culture, these terminal oxidases are somewhat degenerate. Its extensive terminal oxidase repertoire might allow Azorhizobium spp. to flourish in wide-ranging O2 environments. Images PMID:8300541

  5. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms.

    PubMed

    Groussman, Ryan D; Parker, Micaela S; Armbrust, E Virginia

    2015-01-01

    Ferroproteins arose early in Earth's history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world's oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This refined view of iron use strategies in diatoms elucidates the history of these adaptations, and provides potential molecular markers for determining the iron nutritional status of different diatom species in environmental samples. PMID:26052941

  6. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms

    PubMed Central

    Groussman, Ryan D.; Parker, Micaela S.; Armbrust, E. Virginia

    2015-01-01

    Ferroproteins arose early in Earth’s history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world’s oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This refined view of iron use strategies in diatoms elucidates the history of these adaptations, and provides potential molecular markers for determining the iron nutritional status of different diatom species in environmental samples. PMID:26052941

  7. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human d-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    d-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. PMID:25749303

  8. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  9. Autocrine growth factor regulation of lysyl oxidase expression in transformed fibroblasts.

    PubMed

    Palamakumbura, Amitha H; Sommer, Pascal; Trackman, Philip C

    2003-08-15

    Lysyl oxidase catalyzes oxidative deamination of peptidyl-lysine and hydroxylysine residues in collagens and lysine residues in elastin to form peptidyl aldehydes that are required for the formation of covalent cross-links in normal extracellular matrix biosynthesis. Lysyl oxidase in addition has tumor suppressor activity, and phenotypic reversion of transformed cell lines is accompanied by increased lysyl oxidase expression. The mechanism of low expression of lysyl oxidase in tumor cells is unknown. The present study investigates the hypothesis that autocrine growth factor pathways maintain low lysyl oxidase expression levels in c-H-ras-transformed fibroblasts (RS485 cell line). Autocrine pathways were blocked with suramin, a general inhibitor of growth factor receptor binding, and resulted in more than a 10-fold increase in lysyl oxidase expression and proenzyme production. This regulation was found to be reversible and occurred at the transcriptional level determined using lysyl oxidase promoter/reporter gene assays. Function blocking anti-fibroblast growth factor-2 (FGF-2) antibody enhanced lysyl oxidase expression in the absence of suramin. Finally, the addition of FGF-2 to suramin-treated cells completely reversed suramin stimulation of lysyl oxidase mRNA levels. Data support that an FGF-2 autocrine pathway inhibits lysyl oxidase transcription in the tumorigenic-transformed RS485 cell line. This finding may be of therapeutic significance and, in addition, provides a new experimental approach to investigate the mechanism of the tumor suppressor activity of lysyl oxidase. PMID:12788924

  10. Segregation and linkage studies of plasma dopamine-beta-hydroxylase (DBH), erythrocyte catechol-O-methyltransferase (COMT), and platelet monoamine oxidase (MAO): possible linkage between the ABO locus and a gene controlling DBH activity.

    PubMed Central

    Goldin, L R; Gershon, E S; Lake, C R; Murphy, D L; McGinniss, M; Sparkes, R S

    1982-01-01

    Measurements of dopamine-beta-hydroxylase (DBH), catechol-O-methyltransferase (COMT), and monoamine oxidase (MAO) along with 27 polymorphic marker phenotypes were available for 162 patients with major affective disorders and 1,125 of their relatives. Levels of enzymes were previously found not to be associated with illness. Pedigree analysis methods for quantitative traits are used to test single-gene hypotheses for segregation of DBH in 32 families with 411 individuals. COMT in 30 families with 351 individuals, and MAO in 50 families with 309 individuals. The familial distribution of both DBH and COMT are consistent with two codominant alleles at the same locus that account for 56% and 59% of the total variance, respectively. MAO activity cannot be shown to be segregating as a single major gene, but a purely nongenetic hypothesis is also rejected. A possible linkage of a locus for DBH to the ABO locus is indicated by a maximum lod score of 1.82 at 0% and 10% recombination fractions for males and females, respectively. A lod score of 0.61 at 0% recombination for a similar analysis in a single large pedigree was reported by Elston et al., making the combined lod score for the two studies equal to 2.32 at 0% recombination. PMID:6951409

  11. Arabidopsis alternative oxidase sustains Escherichia coli respiration.

    PubMed

    Kumar, A M; Söll, D

    1992-11-15

    Glutamyl-tRNA reductase, encoded by the hemA gene, is the first enzyme in porphyrin biosynthesis in many organisms. Hemes, important porphyrin derivatives, are essential components of redox enzymes, such as cytochromes. Thus a hemA Escherichia coli strain (SASX41B) is deficient in cytochrome-mediated aerobic respiration. Upon complementation of this strain with an Arabidopsis thaliana cDNA library, we isolated a clone which permitted the SASX41B strain to grow aerobically. The clone encodes the gene for Arabidopsis alternative oxidase, whose deduced amino acid sequence was found to have 71% identity with that of the enzyme from the voodoo lily, Sauromatum guttatum. The Arabidopsis protein is expressed as a 31-kDa protein in E. coli and confers on this organism cyanide-resistant growth, which in turn is sensitive to salicylhydroxamate. This implies that a single polypeptide is sufficient for alternative oxidase activity. Based on these observations we propose that a cyanide-insensitive respiratory pathway operates in the transformed E. coli hemA strain. Introduction of this pathway now opens the way to genetic/molecular biological investigations of alternative oxidase and its cofactor. PMID:1438286

  12. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.

    PubMed

    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio

    2015-11-01

    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487?bp fragment, including part of 5.8?S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma. PMID:26336248

  13. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya

    2008-10-24

    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  14. Cytokinin Oxidase from Wheat

    PubMed Central

    Laloue, Michel; Fox, J. Eugene

    1989-01-01

    As part of the study of the possible role(s) of CBF-1, a cytokinin-binding protein abundant in wheat embryo, a cytokinin oxidase was found in wheat (Triticum aestivum L.) germ and partially purified by conventional purification techniques and high performance chromatofocusing. This preparation catalyzes conversion of N6-(?2-isopentenyl)adenosine to adenosine at a Vmax of 0.4 nanomol per milligram protein per minute at 30°C and pH 7.5, the Km being 0.3 micromolar. This high affinity and the apparent molecular weight of 40,000 estimated by high performance gel permeation on a Spherogel TSK-3000 SW column indicate that this enzyme is different from other cytokinin oxidases previously reported. Oxygen is required for the reaction, as for other cytokinin oxidases already described. N6-(?2-isopentenyl)adenine and zeatin riboside are also degraded, but N6-(?2-isopentenyl)adenosine-5?-monophosphate is apparently not a substrate. Benzyladenine is degraded, but to a small extent, and it inhibits slightly the degradation of N6-(?2-isopentenyl)adenosine. The degradation of N6-(?2-isopentenyl)adenosine is strongly inhibited by diphenylurea and its highly active derivative N-(2-chloro-4-pyridyl)-N?-phenylurea. PMID:16666895

  15. Hydrogen peroxide-producing NADH oxidase (nox-1) from Lactococcus lactis

    E-print Network

    Hydrogen peroxide-producing NADH oxidase (nox-1) from Lactococcus lactis Rongrong Jiang and Andreas applied the sequence comparison-based approach to develop a novel hydrogen peroxide-forming NADH oxidase (nox-1) from Lactococcus lactis (L. lactis) that reduces oxygen to hydrogen peroxide. The nox-1 gene

  16. DEVELOPMENTAL REGULATION OF PEACH ACC OXIDASE-GUS FUSIONS IN TRANSGENIC TOMATO FRUITS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fruit ripening involves changes in the expression of a large number of genes including the well-characterized 1-Aminocyclopropane-1-caboxylic acid oxidase which catalyzes the conversion of 1-aminocyclopropane-1-caboxylate to ethylene. We isolated a genomic DNA sequence encoding ACC oxidase from pea...

  17. Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach

    NASA Astrophysics Data System (ADS)

    Davis, R.; Tebo, B. M.

    2013-12-01

    Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43°C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4°C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn oxidases McoA and MopA. The greater diversity of Mn oxidase pathways in this metagenome suggests a more diverse Mn oxidizing microbial community in the cold pumice sample. Key enzymes for four of the six known carbon fixation pathways (the Calvin Cycle, the reductive TCA cycle, the Wood-Ljungdahl pathway, and the 3-hydroxypropionate/4-hydroxybutyrate Cycle) were also identified in both samples indicating primary production occurs via a diverse community of carbon fixing organisms. Together, these samples contain active, diverse populations of Mn oxidizing bacteria living in association with microbial communities supported by chemoautotrophic carbon fixation.

  18. The propeptide domain of lysyl oxidase induces phenotypic reversion of ras-transformed cells.

    PubMed

    Palamakumbura, Amitha H; Jeay, Sébastien; Guo, Ying; Pischon, Nicole; Sommer, Pascal; Sonenshein, Gail E; Trackman, Philip C

    2004-09-24

    Lysyl oxidase is an extracellular enzyme critical for the normal biosynthesis of collagens and elastin. In addition, lysyl oxidase reverts ras-mediated transformation, and lysyl oxidase expression is down-regulated in human cancers. Since suramin inhibits growth factor signaling pathways and induces lysyl oxidase in ras-transformed NIH3T3 cells (RS485 cells), we sought to investigate the effects of suramin on the phenotype of transformed cells and the role of lysyl oxidase in mediating these effects. Suramin treatment resulted in a more normal phenotype as judged by growth rate, cell cycle parameters, and morphology. beta-aminopropionitrile, the selective inhibitor of lysyl oxidase enzyme activity, was remarkably unable to block suramin-induced reversion. By contrast, ectopic antisense lysyl oxidase demonstrated that lysyl oxidase gene expression mediated phenotypic reversion. Since lysyl oxidase is synthesized as a 50 kDa precursor and processed to a 30 kDa active enzyme and 18 kDa propeptide, the effects of these two products on the transformed phenotype of RS485 cells were then directly assessed in the absence of suramin. Here we report, for the first time, that the lysyl oxidase propeptide, and not the lysyl oxidase enzyme, inhibits ras-dependent transformation as determined by effects on cell proliferation assays, growth in soft agar, and Akt-dependent induction of NF-kappaB activity. Thus, the lysyl oxidase propeptide, which is released during extracellular proteolytic processing of pro-lysyl oxidase, functions to inhibit ras-dependent cell transformation. PMID:15277520

  19. Characterization of novel gene expression related to glyoxal oxidase by agro-infiltration of the leaves of accession Baihe-35-1 of Vitis pseudoreticulata involved in production of H2O2 for resistance to Erysiphe necator.

    PubMed

    Zhao, Heqing; Guan, Xin; Xu, Yan; Wang, Yuejin

    2013-06-01

    Glyoxal oxidase (GLOX), an extracellular H(2)O(2)-producing enzyme, has been reported in Phanerochaete chrysosporium and Ustilago maydis. We previously isolated a grapevine GLOX gene from the highly resistant to Erysiphe necator Chinese wild Vitis pseudoreticulata accession Baihe-35-1 and designated it as VpGLOX (GenBank accession no. DQ201181). Transient expression of VpGLOX can suppress Powdery Mildew in susceptible genotype were studied. To further investigate the function of the VpGLOX gene, real-time PCR and Western blot analysis were performed to examine expression patterns at transcriptional and translational levels, respectively. The results showed that VpGLOX expression at the transcriptional level increased significantly in the disease-resistant accession Baihe-35-1 after Erysiphe necator inoculation, but no significant changes in the susceptible accession, V. pseudoreticulata accession Guangxi-2 could be observed. As evident from a Western blot analysis, VpGLOX protein increased slightly in Baihe-35-1 after E. necator inoculation, but not statistical significant difference changes in Guangxi-2. The immunolocalization via immunogold electron microscopy showed that VpGLOX was mainly located in the adaxial epidermal cell wall of E. necator-inoculated leaves of both Baihe-35-1 and Guangxi-2. Agrobacterium-mediated transient expression assays revealed that VpGLOX expression could produce H(2)O(2), which may directly play a role in defense mechanism during plant-pathogen interactions. Our results could provide further insight into the biological role of VpGLOX in the defense response against E. necator in V. pseudoreticulata. PMID:23090239

  20. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  1. Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

    PubMed

    Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

    2009-01-01

    The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle. PMID:17899443

  2. Overexpression of a GmCnx1 Gene Enhanced Activity of Nitrate Reductase and Aldehyde Oxidase, and Boosted Mosaic Virus Resistance in Soybean

    PubMed Central

    Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

    2015-01-01

    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 ?g g-1 h-1 and30 pmol L-1, respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  3. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    PubMed Central

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

    2013-01-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  4. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    PubMed

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley. PMID:25740049

  5. GLUCOSE OXIDASE REDUCES OXIDATION IN FROZEN SHRIMP

    E-print Network

    GLUCOSE OXIDASE REDUCES OXIDATION IN FROZEN SHRIMP Carolyn Kelley Glucose oxidase-cat alase role oxygen can have during storage of foods (Scott, 1958). Glucose oxidase-catalase preparations are used to carry out the net reaction: 2 glucose + oxygen glucose oxidase > 2 gluconic acid. catalase

  6. [Identification of Ixodes persulcatus and Ixodes pavlovskyi occidentalis (Ixodidae) by the analysis of the gene fragment COXI (cytochrome oxidase subunit I)].

    PubMed

    Livanova, N N; Tikunova, N V; Livanov, S G; Fomenko, N V

    2012-01-01

    Ticks of the genus Ixodes were collected in 2010 in the lowland part of Toguchinsk district of Novosibirsk Province (Russia) and in the forest-park area of Novosibirsk Scientific Centre and its outskirts (Sovetskiy district of Novosibirsk), and identified as Ixodes persulcatus (Schulze, 1930) (18 females and 13 males) and Ixodes pavlovskyi (13 females and 10 males). Ten specimens of each sex from each collecting site were examined. The following nine characters were used: the length and width of the scutum (conscutum) and of the gnathosoma in ventral view; the length of palpal segments II-III; the width of the hypostome; the length of idiosoma with scapula, of leg I, of the medial spur on fore coxa (Taiga..., 1985; Filippova, Musatov, 1996; Filippova, Panova, 1998). According to morphometric characters, specimens of Ixodes pavlovskyi collected in the forest-park area of the Novosibirsk Scientific Centre were identified as the subspecies I. p. occidentalis Filippova et Panova, 1998. Nucleotide sequences of the COI mitochondrial gene fragment were determined for 56 ticks. Phylogenetic analysis of the COI gene fragment in representatives of the persulcatus-ricinus species-group dwelling in Asia demonstrated high degree of conservatism. Molecular-genetic methods allow reliable identification of morphologically similar species I. pavlovskyi and I. persulcatus, pathogenic for humans. PMID:23458013

  7. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  8. Resurrection of New Caledonian maskray Neotrygon trigonoides (Myliobatoidei: Dasyatidae) from synonymy with N. kuhlii, based on cytochrome-oxidase I gene sequences and spotting patterns.

    PubMed

    Borsa, Philippe; Arlyza, Irma S; Chen, Wei-Jen; Durand, Jean-Dominique; Meekan, Mark G; Shen, Kang-Ning

    2013-04-01

    The maskray from New Caledonia, Neotrygon trigonoides Castelnau, 1873, has been recently synonymized with the blue-spotted maskray, N. kuhlii (Müller and Henle, 1841), a species with wide Indo-West Pacific distribution, but the reasons for this are unclear. Blue-spotted maskray specimens were collected from the Indian Ocean (Tanzania, Sumatra) and the Coral Triangle (Indonesia, Taiwan, and West Papua), and N. trigonoides specimens were collected from New Caledonia (Coral-Sea). Their partial COI gene sequences were generated to expand the available DNA-barcode database on this species, which currently comprises homologous sequences from Ningaloo Reef, the Coral Triangle and the Great Barrier Reef (Coral-Sea). Spotting patterns were also compared across regions. Haplotypes from the Coral-Sea formed a haplogroup phylogenetically distinct from all other haplotypes sampled in the Indo-West Pacific. No clear-cut geographic composition relative to DNA-barcodes or spotting patterns was apparent in N. kuhlii samples across the Indian Ocean and the Coral Triangle. The New Caledonian maskray had spotting patterns markedly different from all the other samples. This, added to a substantial level of net nucleotide divergence (2.6%) with typical N. kuhlii justifies considering the New Caledonian maskray as a separate species, for which we propose to resurrect the name Neotrygon trigonoides. PMID:23849725

  9. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.

    PubMed

    Kang, J-H; Park, J-Y; Choi, T-J

    2012-01-01

    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

  10. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-André; Alric, Jean; Johnson, Xenie

    2011-01-01

    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  11. Genetic control of aldehyde oxidase activity and cross-reacting-material in Drosophila melanogaster.

    PubMed

    Meidinger, E M; Williamson, J H

    1978-12-01

    Four different genes are known to affect aldehyde oxidase activity (AO) in Drosophila melanogaster. Mutants at each of these loci eliminate AO activity and simultaneously eliminate detectable AO-crossing reacting material (AO-CRM) even though only one is the structural gene for AO (Aldoxn). The other three genes (cin1, lxd and mal) coordinately "control" the levels of activity of AO and two related enzymes, xanthine dehydrogenase (XDH) and pyridoxal oxidase (PO). Contrary to their effects on AO-CRM, neither of these three mutants eliminate XDH-CRM. A model of interaction of these enzymes and genes controlling their activities is discussed. PMID:94842

  12. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

    2014-01-01

    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  13. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  14. Vitamer Levels, Stress Response, Enzyme Activity, and Gene Regulation of Arabidopsis Lines Mutant in the Pyridoxine/Pyridoxamine 5?-Phosphate Oxidase (PDX3) and the Pyridoxal Kinase (SOS4) Genes Involved in the Vitamin B6 Salvage Pathway1[W][OA

    PubMed Central

    González, Eugenia; Danehower, David; Daub, Margaret E.

    2007-01-01

    PDX3 and SALT OVERLY SENSITIVE4 (SOS4), encoding pyridoxine/pyridoxamine 5?-phosphate oxidase and pyridoxal kinase, respectively, are the only known genes involved in the salvage pathway of pyridoxal 5?-phosphate in plants. In this study, we determined the phenotype, stress responses, vitamer levels, and regulation of the vitamin B6 pathway genes in Arabidopsis (Arabidopsis thaliana) plants mutant in PDX3 and SOS4. sos4 mutant plants showed a distinct phenotype characterized by chlorosis and reduced plant size, as well as hypersensitivity to sucrose in addition to the previously noted NaCl sensitivity. This mutant had higher levels of pyridoxine, pyridoxamine, and pyridoxal 5?-phosphate than the wild type, reflected in an increase in total vitamin B6 observed through HPLC analysis and yeast bioassay. The sos4 mutant showed increased activity of PDX3 as well as of the B6 de novo pathway enzyme PDX1, correlating with increased total B6 levels. Two independent lines with T-DNA insertions in the promoter region of PDX3 (pdx3-1 and pdx3-2) had decreased PDX3 activity. Both also had decreased activity of PDX1, which correlated with lower levels of total vitamin B6 observed using the yeast bioassay; however, no differences were noted in levels of individual vitamers by HPLC analysis. Both pdx3 mutants showed growth reduction in vitro and in vivo as well as an inability to increase growth under high light conditions. Increased expression of salvage and some of the de novo pathway genes was observed in both the pdx3 and sos4 mutants. In all mutants, increased expression was more dramatic for the salvage pathway genes. PMID:17873088

  15. Studies on the mechanism of alcohol oxidase 

    E-print Network

    Menon, Vipin

    1994-01-01

    The flavoprotein alcohol oxidase from the yeast Candida boidinii catalyzes the oxidation of primary alcohols to aidehydes with transfer of the electrons to molecular oxygen to form hydrogen peroxide. The mechanism of alcohol oxidase with beta...

  16. Purification of sulfide oxidase from rat liver 

    E-print Network

    Pu, Lixia

    1994-01-01

    The present study represents an initial investigative effort to purify sulfide oxidase from rat liver. Two methods to determine sulfide oxidase activity have been established and both are based on measuring substrate ...

  17. Catecholamines oxidation by xanthine oxidase.

    PubMed

    Foppoli, C; Coccia, R; Cini, C; Rosei, M A

    1997-03-15

    Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5. Activation of the peroxidative reaction is also elicited by catechol compounds through a redox cycle mechanism. Implications about the possible biochemical relevance of xanthine oxidase activity on catecholamines oxidation are discussed. PMID:9101714

  18. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )

    1989-04-01

    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  19. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  20. Cholesterol oxidase with high catalytic activity from Pseudomonas aeruginosa: Screening, molecular genetic analysis, expression and characterization.

    PubMed

    Doukyu, Noriyuki; Nihei, Shyou

    2015-07-01

    An extracellular cholesterol oxidase producer, Pseudomonas aeruginosa strain PA157, was isolated by a screening method to detect 6?-hydroperoxycholest-4-en-3-one-forming cholesterol oxidase. On the basis of a putative cholesterol oxidase gene sequence in the genome sequence data of P. aeruginosa strain PAO1, the cholesterol oxidase gene from strain PA157 was cloned. The mature form of the enzyme was overexpressed in Escherichia coli cells. The overexpressed enzyme formed inclusion bodies in recombinant E. coli cells grown at 20 °C and 30 °C. A soluble and active PA157 enzyme was obtained when the recombinant cells were grown at 10 °C. The purified enzyme was stable at pH 5.5 to 10 and was most active at pH 7.5-8.0, showing optimal activity at pH 7.0 and 70 °C. The enzyme retained about 90% of its activity after incubation for 30 min at 70 °C. The enzyme oxidized 3?-hydroxysteroids such as cholesterol, ?-cholestanol, and ?-sitosterol at high rates. The Km value and Vmax value for the cholesterol were 92.6 ?M and 15.9 ?mol/min/mg of protein, respectively. The Vmax value of the enzyme was higher than those of commercially available cholesterol oxidases. This is the first report to characterize a cholesterol oxidase from P. aeruginosa. PMID:25573142

  1. Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.

    PubMed

    Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo

    2014-02-01

    A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag?AgCl?KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. PMID:24189123

  2. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  3. Cloning, expression and biochemical characterization of the cholesterol oxidase CgChoA from Chryseobacterium gleum

    PubMed Central

    2014-01-01

    Background Cholesterol oxidases are important enzymes for applications such as the analysis of cholesterol in clinical samples, the synthesis of steroid derived drugs, and are considered as potential antibacterial drug targets. Results The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector and heterologously expressed in Escherichia coli JM109 co-transformed with pRARE2. The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion chromatography, showed a temperature optimum of 35°C, and a pH optimum at 6.75 using 0.011 M MOPS buffer under the tested conditions. The purified protein showed a maximum activity of 15.5 U/mg. CgChoA showed a Michaelis-Menten like kinetic behavior only when the substrate was dissolved in water and taurocholate (apparent Km?=?0.5 mM). In addition, the conversion of cholesterol by CgChoA was studied via biocatalytic batches at analytical scale, and cholest-4-en-3-one was confirmed as product by HPLC-MS. Conclusion CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other organisms. Thus, the enzyme broadens the available toolbox of cholesterol oxidases for e.g. synthetic and biosensing applications. PMID:24885249

  4. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  5. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  6. Photoreactions of cytochrome C oxidase.

    PubMed

    Winterle, John S; Einarsdóttir, Olöf

    2006-01-01

    The photoreduction of oxidized bovine heart cytochrome c oxidase (CcO) by visible and UV radiation was investigated in the absence and presence of external reagents. In the former case, the quantum yields for direct photoreduction of heme A (heme a + heme a(3)) were 2.6 +/- 0.5 x 10(-3), 4 +/- 1 x 10(-4), and 4 +/- 2 x 10(-6) with pulsed laser irradiation at 266, 355 and 532 nm, respectively. Within experimental uncertainty, the quantum yields did not depend on pulse energy, implying that the mechanism is monophotonic. Irradiation with 355 nm light resulted in spectral changes similar to those produced independently by reduction with dithionite, whereby the low-spin heme a and Cu(A) are reduced first. Extended illumination at 355 and 532 nm yielded substantial amounts of reduced heme a(3). Heme decomposition was noted with 266 nm light. In the presence of formate and cyanide ions, which bind at the binuclear heme a(3)/copper center in CcO, irradiation at 355 nm caused selective reduction of only the low-spin heme a and Cu(A). The addition of ferrioxalate ion dramatically increased the efficiency of cytochrome c oxidase photoreduction. The quantum efficiency for heme A reduction was found to be near unity, significantly greater than for other known methods of photoreduction. The active reductant is most likely ferrous iron, and its reduction of the enzyme is thermodynamically driven by the reformation of ferrioxalate in the presence of excess oxalate ion. Other metalloenzymes with redox potentials similar to those of cytochrome c oxidase should be amenable to indirect photoreduction by this method. PMID:16789843

  7. Glucose oxidase activity of actinomycetes.

    PubMed

    St Vlahov, S

    1978-01-01

    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  8. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen

    1990-01-01

    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  9. Kinetic mechanism of monoamine oxidase A.

    PubMed

    Ramsay, R R

    1991-05-01

    Steady-state kinetic data for monoamine oxidase A in crude extracts suggest an exclusively ping-pong mechanism, in contrast to those for monoamine oxidase B, which indicate alternate mechanisms involving either a binary or ternary complex. In this study, with use of purified monoamine oxidase A, steady-state data for the inhibition by D-amphetamine of the oxidation of primary amines indicate the possibility of a ternary complex mechanism for monoamine oxidase A also. Stopped-flow studies demonstrate that the rate of reoxidation of reduced enzyme is enhanced by substrates but not by the product, 1-methyl-4-phenylpyridinium. Thus, for the A enzyme, the ternary complex with substrate, but not product, is reoxidized at a faster rate than the free, reduced enzyme. For both the A and B forms of monoamine oxidase, the mechanism is determined by competition between alternate pathways on the basis of the relative rate constants and dissociation constants. PMID:2021654

  10. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.

    1999-01-01

    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  11. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  12. HypC is the anthrone oxidase involved in aflatoxin biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

  13. EXPRESSION OF TURKEY TRANSCRIPTION FACTORS AND ACYL COA OXIDASE IN DIFFERENT TISSUES AND GENETIC POPULATIONS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several transcription factors are involved in regulating lipid metabolism in various animal tissues. Peroxisome proliferator activated receptor (PPAR) gamma and PPAR alpha regulate both lipogenesis and fatty acid oxidation. Gene fragments for PPAR gamma, PPAR alpha, and acyl CoA oxidase (ACO) have b...

  14. Alternative oxidase in animals: unique characteristics and taxonomic distribution.

    PubMed

    McDonald, Allison E; Vanlerberghe, Greg C; Staples, James F

    2009-08-01

    Alternative oxidase (AOX), a ubiquinol oxidase, introduces a branch point into the respiratory electron transport chain, bypassing complexes III and IV and resulting in cyanide-resistant respiration. Previously, AOX was thought to be limited to plants and some fungi and protists but recent work has demonstrated the presence of AOX in most kingdoms of life, including animals. In the present study we identified AOX in 28 animal species representing nine phyla. This expands the known taxonomic distribution of AOX in animals by 10 species and two phyla. Using bioinformatics we found AOX gene sequences in members of the animal phyla Porifera, Placozoa, Cnidaria, Mollusca, Annelida, Nematoda, Echinodermata, Hemichordata and Chordata. Using reverse-transcriptase polymerase chain reaction (RT-PCR) with degenerate primers designed to recognize conserved regions of animal AOX, we demonstrated that AOX genes are transcribed in several animals from different phyla. An analysis of full-length AOX sequences revealed an amino acid motif in the C-terminal region of the protein that is unique to animal AOXs. Animal AOX also lacks an N-terminal cysteine residue that is known to be important for AOX enzyme regulation in plants. We conclude that the presence of AOX is the ancestral state in animals and hypothesize that its absence in some lineages, including vertebrates, is due to gene loss events. PMID:19648408

  15. Cold-adapted arsenite oxidase from a psychrotolerant Polaromonas species.

    PubMed

    Osborne, Thomas H; Heath, Matthew D; Martin, Andrew C R; Pankowski, Jaroslaw A; Hudson-Edwards, Karen A; Santini, Joanne M

    2013-04-01

    Polaromonas sp. str. GM1 is an aerobic, psychrotolerant, heterotrophic member of the Betaproteobacteria and is the only isolate capable of oxidising arsenite at temperatures below 10 °C. Sequencing of the aio gene cluster in GM1 revealed the presence of the aioB and aioA genes, which encode the arsenite oxidase but the regulatory genes typically found upstream of aioB in other members of the Proteobacteria were absent. The GM1 Aio was purified to homogeneity and was found to be a heterodimer. The enzyme contained Mo and Fe as cofactors and had, using the artificial electron acceptor 2,6-dichlorophenolindophenol, a Km for arsenite of 111.70 ± 0.88 ?M and a Vmax of 12.16 ± 0.30 U mg(-1), which is the highest reported specific activity for any known Aio. The temperature-activity profiles of the arsenite oxidases from GM1 and the mesophilic betaproteobacterium Alcaligenes faecalis were compared and showed that the GM1 Aio was more active at low temperatures than that of A. faecalis. A homology model of the GM1 Aio was made using the X-ray crystal structure of the Aio from A. faecalis as the template. Structural changes that account for cold adaptation were identified and it was found that these resulted in increased enzyme flexibility and a reduction in the hydrophobicity of the core. PMID:23150098

  16. Dietary inhibitors of monoamine oxidase A.

    PubMed

    Dixon Clarke, Sarah E; Ramsay, Rona R

    2011-07-01

    Inhibition of monoamine oxidase is one way to treat depression and anxiety. The information now available on the pharmacokinetics of flavonoids and of the components of tobacco prompted an exploration of whether a healthy diet (with or without smoking) provides active compounds in amounts sufficient to partially inhibit monoamine oxidase. A literature search was used to identify dietary monoamine oxidase inhibitors, the levels of these compounds in foods, the pharmacokinetics of the absorption and distribution, and tissue levels observed. An estimated daily intake and the expected tissue concentrations were compared with the measured efficacies of the compounds as inhibitors of monoamine oxidases. Norharman, harman and quercetin dietary presence, pharmacokinetics, and tissue levels were consistent with significant levels reaching neuronal monoamine oxidase from the diet or smoking; 1,2,3,4-tetrahydroisoquinoline, eugenol, 1-piperoylpiperidine, and coumarin were not. Quercetin was equipotent with norharman as a monoamine oxidase A inhibitor and its metabolite, isorhamnetin, also inhibits. Total quercetin was the highest of the compounds in the sample diet. Although bioavailability was variable depending on the source, a healthy diet contains amounts of quercetin that might give sufficient amounts in brain to induce, by monoamine oxidase A inhibition, a small decrease in neurotransmitter breakdown. PMID:21190052

  17. Polyamine Oxidase5 Regulates Arabidopsis Growth through Thermospermine Oxidase Activity1[C][W

    PubMed Central

    Kim, Dong Wook; Watanabe, Kanako; Murayama, Chihiro; Izawa, Sho; Niitsu, Masaru; Michael, Anthony J.; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    The major plant polyamines (PAs) are the tetraamines spermine (Spm) and thermospermine (T-Spm), the triamine spermidine, and the diamine putrescine. PA homeostasis is governed by the balance between biosynthesis and catabolism; the latter is catalyzed by polyamine oxidase (PAO). Arabidopsis (Arabidopsis thaliana) has five PAO genes, AtPAO1 to AtPAO5, and all encoded proteins have been biochemically characterized. All AtPAO enzymes function in the back-conversion of tetraamine to triamine and/or triamine to diamine, albeit with different PA specificities. Here, we demonstrate that AtPAO5 loss-of-function mutants (pao5) contain 2-fold higher T-Spm levels and exhibit delayed transition from vegetative to reproductive growth compared with that of wild-type plants. Although the wild type and pao5 are indistinguishable at the early seedling stage, externally supplied low-dose T-Spm, but not other PAs, inhibits aerial growth of pao5 mutants in a dose-dependent manner. Introduction of wild-type AtPAO5 into pao5 mutants rescues growth and reduces the T-Spm content, demonstrating that AtPAO5 is a T-Spm oxidase. Recombinant AtPAO5 catalyzes the conversion of T-Spm and Spm to triamine spermidine in vitro. AtPAO5 specificity for T-Spm in planta may be explained by coexpression with T-Spm synthase but not with Spm synthase. The pao5 mutant lacking T-Spm oxidation and the acl5 mutant lacking T-Spm synthesis both exhibit growth defects. This study indicates a crucial role for T-Spm in plant growth and development. PMID:24906355

  18. ABUSE OF MONOAMINE OXIDASE INHIBITORS

    PubMed Central

    Ananth, Jambur; Swartz, J. Randolph; Gadasally, Rangaswamy; Burgoyne, Karl

    1995-01-01

    Abuse of monoamine oxidase inhibitors is not common but there are a few cases of addiction in the literature. Most of these patients had an additional diagnosis, either history of past drug abuse or personality disorder and MAOI withdrawal symptoms have been reported. We encountered three patients who received MAOI under psychiatric care. They were all self medicated by increasing the doses on their own, experienced euphoria and visited various physicians to obtain MAOI prescriptions and manifested toxic states. One of our patients had a normal, another a schizoid and the third, an addictive personality. Two were addicted in the past to amphetamine. Therefore, it is important not to prescribe MAOI's to patients who have a history of amphetamine and other addictions. PMID:21743737

  19. Abuse of monoamine oxidase inhibitors.

    PubMed

    Ananth, J; Swartz, J R; Gadasally, R; Burgoyne, K

    1995-07-01

    Abuse of monoamine oxidase inhibitors is not common but there are a few cases of addiction in the literature. Most of these patients had an additional diagnosis, either history of past drug abuse or personality disorder and MAOI withdrawal symptoms have been reported. We encountered three patients who received MAOI under psychiatric care. They were all self medicated by increasing the doses on their own, experienced euphoria and visited various physicians to obtain MAOI prescriptions and manifested toxic states. One of our patients had a normal, another a schizoid and the third, an addictive personality. Two were addicted in the past to amphetamine. Therefore, it is important not to prescribe MAOI's to patients who have a history of amphetamine and other addictions. PMID:21743737

  20. Plant and animal glycolate oxidases have a common eukaryotic ancestor and convergently duplicated to evolve long-chain 2-hydroxy acid oxidases.

    PubMed

    Esser, Christian; Kuhn, Anke; Groth, Georg; Lercher, Martin J; Maurino, Veronica G

    2014-05-01

    Glycolate oxidase (GOX) is a crucial enzyme of plant photorespiration. The encoding gene is thought to have originated from endosymbiotic gene transfer between the eukaryotic host and the cyanobacterial endosymbiont at the base of plantae. However, animals also possess GOX activities. Plant and animal GOX belong to the gene family of (L)-2-hydroxyacid-oxidases ((L)-2-HAOX). We find that all (L)-2-HAOX proteins in animals and archaeplastida go back to one ancestral eukaryotic sequence; the sole exceptions are green algae of the chlorophyta lineage. Chlorophyta replaced the ancestral eukaryotic (L)-2-HAOX with a bacterial ortholog, a lactate oxidase that may have been obtained through the primary endosymbiosis at the base of plantae; independent losses of this gene may explain its absence in other algal lineages (glaucophyta, rhodophyta, and charophyta). We also show that in addition to GOX, plants possess (L)-2-HAOX proteins with different specificities for medium- and long-chain hydroxyacids (lHAOX), likely involved in fatty acid and protein catabolism. Vertebrates possess lHAOX proteins acting on similar substrates as plant lHAOX; however, the existence of GOX and lHAOX subfamilies in both plants and animals is not due to shared ancestry but is the result of convergent evolution in the two most complex eukaryotic lineages. On the basis of targeting sequences and predicted substrate specificities, we conclude that the biological role of plantae (L)-2-HAOX in photorespiration evolved by co-opting an existing peroxisomal protein. PMID:24408912

  1. Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

    PubMed

    Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

    2016-01-10

    Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. PMID:26367330

  2. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.

    1973-01-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg?1 chlorophyll × hr?1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30 minutes. No single peptide from the digested trypsin was found to be the sole activating factor. About 0.25 ?g of trypsin activated 50% the polyphenol oxidase activity in a standard chloroplast assay containing 2.1 ?g of chlorophyll. Treatment of spinach chloroplasts with tris buffer or ethylenediamine tetraacetate extracted the ATPase activity, but the polyphenol oxidase activity remained with the broken plastids. However these treatments increased the latent polyphenol oxidase activity 50- to 100-fold. Chloroplasts from a second group of plants, including alfalfa, wheat, oats, peas, and sugarcane leaves, oxidized dihydroxyphenylalanine at a rate of 11 to 120 ?moles × mg?1 chlorophyll × hr?1. Polyphenol oxidase in these chloroplasts required a low intensity of red light for activity. Fifty or 75% activation of the oxidase in wheat chloroplasts required 4 to 6 foot candles of light and more light was required for alfalfa chloroplasts. Blue or far red light were ineffective. Trypsin was inhibitory. Upon aging chloroplasts from wheat leaves, but not alfalfa or peas, for 5 to 7 days at 4 C the total polyphenol oxidase activity did not increase, but the activation characteristics changed to those of chloroplasts from the spinach group. Chloroplasts from a third group of plants, including bean, tomato, and corn leaves, slowly oxidized dihydroxyphenylalanine in the dark and exhibited no latency. PMID:16658308

  3. Cloning and characterization of a fourth human lysyl oxidase isoenzyme.

    PubMed Central

    Mäki, J M; Kivirikko, K I

    2001-01-01

    We report here the complete cDNA sequence and exon-intron organization of the human lysyl oxidase-like (LOXL)3 gene, a new member of the lysyl oxidase (LO) gene family. The predicted polypeptide is 753 amino acids in length, including a signal peptide of 25 residues. The C-terminal region, residues 529-729, contains a LO domain similar to those in the LOX (the first characterized LO isoenzyme), LOXL and LOXL2 polypeptides. It possesses the putative copper binding sequence, and the lysine and tyrosine residues that form the lysyltyrosyl quinone cofactor. The N-terminal region, which is similar to that in LOXL2 but not those in LOX and LOXL, contains four subregions similar to scavenger receptor cysteine-rich domains and a putative nuclear localization signal. Recombinant LOXL3, expressed in HT-1080 cells, was secreted into the culture medium but was not detected by immunofluorescence staining in nuclei. The LOXL3 mRNA is 3.1 kb in size and is expressed in many tissues, the highest levels among the tissues studied being seen in the placenta, heart, ovary, testis, small intestine and spleen. PMID:11284725

  4. A systematic mutation screen of 10 nuclear and 25 mitochondrial candidate genes in 21 patients with cytochrome c oxidase (COX) deficiency shows tRNA(Ser)(UCN) mutations in a subgroup with syndromal encephalopathy.

    PubMed Central

    Jaksch, M; Hofmann, S; Kleinle, S; Liechti-Gallati, S; Pongratz, D E; Müller-Höcker, J; Jedele, K B; Meitinger, T; Gerbitz, K D

    1998-01-01

    COX deficiency is believed to be the most common defect in neonates and infants with mitochondrial diseases. To explore the causes of this group of disorders, we examined 25 mitochondrial genes (three COX subunit genes and 22 tRNA genes) and 10 nuclear COX subunit genes for disease associated mutations using PCR-SSCP and direct sequencing of polymorphic SSCP fragments. DNA from one patient with severe COX deficiency and with consanguineous parents was entirely sequenced. The patient population consisted of 21 unrelated index patients with mitochondrial disorders and predominant (n=7) or isolated (n=14) COX deficiency. We detected two distinct tRNA(Ser)(UCN) mutations, which have been recently described in single kindreds, in a subgroup of four patients with COX deficiency, deafness, myoclonic epilepsy, ataxia, and mental retardation. Besides a number of nucleotide variants, a single novel missense mutation, which may contribute to the disease phenotype, was found in the mitochondrial encoded COX 1 gene (G6480A). Mutations in nuclear encoded COX subunit genes were not detected in this study. PMID:9832034

  5. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    SciTech Connect

    Xu, Yun-Ling; Li, Li; Wu, Keqiang

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.

  6. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.

    1996-11-01

    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  7. The chemical defensome: Environmental sensing and response genes in the Strongylocentrotus purpuratus genome

    E-print Network

    The chemical defensome: Environmental sensing and response genes in the Strongylocentrotus families thought to protect against chemical stressors; these genes collectively comprise the `chemical defensome.' Chemical defense genes include cytochromes P450 and other oxidases, various conjugating enzymes

  8. The composition of milk xanthine oxidase.

    PubMed

    Hart, L I; McGartoll, M A; Chapman, H R; Bray, R C

    1970-03-01

    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed ;de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in ;milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed ;inactivated xanthine oxidase', causes variability in activity relative to E(450) or to Mo content and formation of it decreases these ratios during storage of enzyme samples including samples free from demolybdo-xanthine oxidase. We conclude that even the best purified xanthine oxidase samples described here and by other workers are contaminated by significant amounts of the inactivated form. This may complicate the interpretation of changes in the enzyme taking place during the slow phase of reduction by substrates. Attempts to remove iron from the enzyme by published methods were not successful. PMID:5441374

  9. Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness

    ERIC Educational Resources Information Center

    Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen

    2013-01-01

    Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G × E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G × E occurs in infants. We therefore examined whether MAOA G × E predicts infant anger proneness, a temperamental…

  10. Relationship of cytochrome caa sub 3 from Thermus thermophilus to other heme- and copper-containing terminal oxidases

    SciTech Connect

    Mather, M.W.; Springer, P.; Fee, J.A.

    1990-01-01

    Cytochrome oxidases are a key component of the energy metabolism of most aerobic organisms from mammals to bacteria. They are the final enzyme of the membrane associated respiratory chain responsible for converting the chemical energy of reduced substrates to a transmembrane electrochemical potential, which issused by the cell for a wide variety of energy-requiring processes. The most widely studied oxidase is the cytochrome c oxidase of the mammalian mitochondrion. This complex, integral membrane protein contains 13 subunits and four canonical metal centers: heme center a and a{sub 3}; copper centers CU{sub A} and CU{sub B}. It is responsible for electron transfer from reduced chytochrome c to dioxygen with the concomitant reduction of dioxygen to water and the coupled vectorial transfer of protons across the mitochondrial membrane. In this communication we will describe preliminary results of DNA sequencing experiments with the cytochrome caa{sub 3} oxidase, initially undertaken to determine the nature of the subunits of this oxidase and shed light on the distribution of the metal centers. We will speculate on oxidase gene and protein structures and evolutionary relationships in the light of these results and recent sequencing results from other groups. 47 refs., 4 figs., 1 tab.

  11. Proline dehydrogenase (oxidase) in cancer.

    PubMed

    Liu, Wei; Phang, James M

    2012-01-01

    Proline dehydrogenase (oxidase, PRODH/POX), the first enzyme in the proline degradative pathway, plays a special role in tumorigenesis and tumor development. Proline metabolism catalyzed by PRODH/POX is closely linked with the tricarboxylic acid (TCA) cycle and urea cycle. The proline cycle formed by the interconversion of proline and ?(1) -pyrroline-5-carboxylate (P5C) between mitochondria and cytosol interlocks with pentose phosphate pathway. Importantly, by catalyzing proline to P5C, PRODH/POX donates electrons into the electron transport chain to generate ROS or ATP. In earlier studies, we found that PRODH/POX functions as a tumor suppressor to initiate apoptosis, inhibit tumor growth, and block the cell cycle, all by ROS signaling. It also suppresses hypoxia inducible factor signaling by increasing ?-ketoglutarate. During tumor progression, PRODH/POX is under the control of various tumor-associated factors, such as tumor suppressor p53, inflammatory factor peroxisome proliferator-activated receptor gamma (PPAR?), onco-miRNA miR-23b*, and oncogenic transcription factor c-MYC. Recent studies revealed the two-sided features of PRODH/POX-mediated regulation. Under metabolic stress such as oxygen and glucose deprivation, PRODH/POX can be induced to serve as a tumor survival factor through ATP production or ROS-induced autophagy. The paradoxical roles of PRODH/POX can be understood considering the temporal and spatial context of the tumor. Further studies will provide additional insights into this protein and on its metabolic effects in tumors, which may lead to new therapeutic strategies. PMID:22886911

  12. Paradoxical Activation of Endothelial Nitric Oxide Synthase by NADPH oxidase

    PubMed Central

    Zhang, Qian; Malik, Pulkit; Pandey, Deepesh; Gupta, Sonali; Jagnandan, Davin; de Chantemele, Eric Belin; Banfi, Botond; Marrero, Mario B.; Rudic, R Daniel; Stepp, David W.; Fulton, David J.R.

    2009-01-01

    Objectives Increased formation of reactive oxygen species (ROS) has been identified as a causative factor in endothelial dysfunction by reducing NO bioavailability and uncoupling endothelial nitric oxide synthase (eNOS). However, the specific contribution of ROS to endothelial function is not well understood. Methods and Results A major source of intracellular ROS is the NADPH oxidase (Nox) family of enzymes. The goal of the current study was to directly assess the contribution of NADPH oxidase derived superoxide to eNOS function by expressing Nox5, a single gene product that constitutively produces superoxide within cells. Paradoxically, we found that instead of inhibiting eNOS, co-expression of Nox5 increased NO release from both bovine and human endothelial cells. To establish the functional significance of this observation in intact blood vessels, the endothelium of mouse aorta was transduced with Nox5 or control adenoviruses. Nox5 potently inhibited Ach-induced relaxation and potentiated contractile responses to phenylephrine. In precontracted aortae, acute exposure to superoxide dismutase induced significant vascular relaxation in vessels exposed to Nox5 versus control and unmasked the ability of Nox5 to activate eNOS in blood vessel endothelium. Conclusions These findings suggest that ROS inhibit eNOS function via consumption of NO rather than direct inhibition of enzymatic activity. PMID:18556569

  13. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...Identification. An oxidase screening test for gonorrhea is an in vitro device that consists of the articles intended to identify...of cytochrome oxidase with this device indicates presumptive infection of the patient with the causative agent of gonorrhea....

  14. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...Identification. An oxidase screening test for gonorrhea is an in vitro device that consists of the articles intended to identify...of cytochrome oxidase with this device indicates presumptive infection of the patient with the causative agent of gonorrhea....

  15. Spatiotemporal Localization of d-Amino Acid Oxidase and d-Aspartate Oxidases during Development in Caenorhabditis elegans

    PubMed Central

    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito

    2012-01-01

    Recent investigations have shown that a variety of d-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. d-Amino acid oxidase (DAO) and d-aspartate oxidase (DDO) are degradative enzymes stereospecific for d-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of d-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several d- and l-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and d-amino acids in multicellular organisms. PMID:22393259

  16. Respiratory burst oxidase and three of four oxidase-related polypeptides are associated with the cytoskeleton of human neutrophils.

    PubMed Central

    Woodman, R C; Ruedi, J M; Jesaitis, A J; Okamura, N; Quinn, M T; Smith, R M; Curnutte, J T; Babior, B M

    1991-01-01

    Resting and phorbol-activated human neutrophils were separated by treatment with Triton X-100 into detergent-extractable and cytoskeleton fractions. Respiratory burst oxidase activity was restricted entirely to the cytoskeleton. The cytoskeleton also contained approximately 15% of the neutrophil cytochrome b558, an oxidase-associated heme protein, as well as most of the oxidase-related cytosolic polypeptide p67phox. In contrast, the components of the oxidase-associated phosphoprotein family p47phox were found almost exclusively in the detergent extract, suggesting that p47phox is needed for oxidase activation but not for O2- production by the activated oxidase. Activation of the oxidase had no apparent effect on the distribution of any of these species between the cytoskeleton and the detergent extract. Our results support earlier studies implying that the cytoskeleton participates in an important way in regulating the activity of the O2(-)-forming respiratory burst oxidase of neutrophils. Images PMID:1849148

  17. Complete genome sequence of the melanogenic marine bacterium Marinomonas mediterranea type strain (MMB-1T)

    SciTech Connect

    Lucas-Elio, Patricia; Goodwin, Lynne A.; Woyke, Tanja; Pitluck, Sam; Nolan, Matt; Kyrpides, Nikos C; Detter, J C; Copeland, A; Teshima, Hazuki; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Land, Miriam L; Ivanova, N; Mikhailova, Natalia; Johnston, Andrew W. B.; Sanchez-Amat, Antonio

    2012-01-01

    Marinomonas mediterranea MMB-1 T Solano & Sanchez-Amat 1999 belongs to the family Oceanospirillaceae within the phylum Proteobacteria. This species is of interest because it is the only species described in the genus Marinomonas to date that can synthesize melanin pigments, which is mediated by the activity of a tyrosinase. M. mediterranea expresses other oxidases of biotechnological interest, such as a multicopper oxidase with laccase activity and a novel L-lysine-epsilon-oxidase. The 4,684,316 bp long genome harbors 4,228 proteincoding genes and 98 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  18. MECHANISM OF POLYPHENOL OXIDASE ACTION IN REDUCING LIPOLYSIS AND PROTEOLYSIS IN RED CLOVER DURING BATCH CULTURE INCUBATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

  19. Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

    SciTech Connect

    Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

    1997-03-01

    In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissues revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.

  20. Effects of oximes on mitochondrial oxidase activity.

    PubMed

    Sakurada, Koichi; Ikegaya, Hiroshi; Ohta, Hikoto; Fukushima, Hisayo; Akutsu, Tomoko; Watanabe, Ken

    2009-09-10

    Oximes, including 2-pyridinealdoxime methiodide (2-PAM), are reactivators of acetylcholinesterase (AChE) inhibited by organophosphate poisoning. Unfortunately, their clinical use has been limited by their toxicity. To investigate the mechanism of this toxicity, the effects of oximes on the enzymes choline oxidase (ChOD) and cytochrome c oxidase (CyCOD) of the respiratory chain in mitochondria were examined. The oximes 2-PAM, obidoxime, and diacetylmonoxime significantly (P<0.01) inhibited ChOD activity, and the extent of inhibition correlated with the ability to reactivate inhibited AChE. When ChOD activity in mitochondrial extracts was tested, 2-PAM inhibited the activity by 75%, obidoxime and diacetylmonoxime did not significantly inhibit it, and 4-[(hydroxy-imino)methyl]-1-decylpyridinium bromide (4-PAD), which has greater toxicity, increased the amount of product generated in the assay to approximately 200% of normal levels. Similarly, 2-PAM inhibited the activity of CyCOD in mitochondrial extracts whereas obidoxime and diacetylmonoxime did not. One explanation for these findings is that, in addition to their inhibition of mitochondrial oxidases, the oximes may produce excessive reactive oxygen species such as H(2)O(2) in the mitochondrial fraction, which may account for some of their toxicity. This is a preliminary report related to the toxicities of oximes that may participate in the inactivation of mitochondrial oxidase enzymes. This hypothesis should be further investigated by in vivo study, including kinetic determination and free radical work. PMID:19465093

  1. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

    2012-01-01

    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 ?. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  2. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.

    PubMed

    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  3. NADPH oxidase activity and reactive oxygen species production in brain and kidney of adult male hypertensive Ren-2 transgenic rats.

    PubMed

    Vokurková, M; Rauchová, H; ?ezá?ová, L; Van??ková, I; Zicha, J

    2015-12-29

    Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions. PMID:26713567

  4. Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

    PubMed Central

    Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

    2001-01-01

    The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the ?-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that cytochrome bd is an important terminal oxidase in M. smegmatis. PMID:11717265

  5. NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

    SciTech Connect

    Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong

    2008-12-19

    Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91{sup phox} was dose-dependent. Meanwhile, the cytoplasmic subunit p47{sup phox} was translocated to the cell membrane and localized with p22{sup phox} and gp91{sup phox} to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

  6. Reactive Oxygen Species and Angiogenesis: NADPH Oxidase as Target for Cancer Therapy

    PubMed Central

    Ushio-Fukai, Masuko; Nakamura, Yoshimasa

    2009-01-01

    Angiogenesis is essential for tumor growth, metastasis, arteriosclerosis as well as embryonic development and wound healing. Its process is dependent on cell proliferation, migration and capillary tube formation in endothelia cells (ECs). High levels of reactive oxygen species (ROS) such as superoxide and H2O2 are observed in various cancer cells. Accumulating evidence suggests that ROS function as signaling molecules to mediate various growth-related responses including angiogenesis. ROS-dependent angiogenesis can be regulated by endogenous antioxidant enzymes such as SOD and thioredoxin. Vascular endothelial growth factor (VEGF), one of the major angiogenesis factor, is induced in growing tumors and stimulates EC proliferation and migration primarily through the VEGF receptor type2 (VEGFR2, Flk1/KDR). Major source of ROS in ECs is a NADPH oxidase which consists of Nox1, Nox2, Nox4, Nox5, p22phox, p47phox and the small G protein Rac1. NADPH oxidase is activated by various growth factors including VEGF and angiopoietin-1 as well as hypoxia and ischemia, and ROS derived from this oxidase are involved in VEGFR2 autophosphorylation, and diverse redox signaling pathways leading to induction of transcription factors and genes involved in angiogenesis. Dietary antioxidants appear to be effective for treatment of tumor angiogenesis. The aim of this review is to provide an overview of the recent progress on role of ROS derived from NADPH oxidase and redox signaling events involved in angiogenesis. Understanding these mechanisms may provide insight into the NADPH oxidase and redox signaling components as potential therapeutic targets for tumor angiogenesis. PMID:18406051

  7. Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).

    PubMed

    Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

    2015-01-01

    Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other advanced nanosystem based on directed nucleic acid assemblies, polyamine-induced DNA condensation, and bovine serum amine oxidase may be proposed for futuristic anticancer therapy utilizing nucleic acids, polyamines and BSAO. BSAO based nanoparticles can be employed for the generation of cytotoxic polyamine metabolites. PMID:25333509

  8. The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.

    PubMed

    Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

    2008-05-01

    The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus. PMID:18705873

  9. Xanthine oxidase biosensor for monitoring meat spoilage

    NASA Astrophysics Data System (ADS)

    Vanegas, D. C.; Gomes, C.; McLamore, E. S.

    2014-05-01

    In this study, we have designed an electrochemical biosensor for real-time detection of specific biomarkers of bacterial metabolism related to meat spoilage (hypoxanthine and xanthine). The selective biosensor was developed by assembling a `sandwich' of nanomaterials and enzymes on a platinum-iridium electrode (1.6 mm tip diameter). The materials deposited on the sensor tip include amorphous platinum nanoclusters (i.e. Pt black), reduced graphene oxide, nanoceria, and xanthine oxidase. Xanthine oxidase was encapsulated in laponite hydrogel and used for the biorecognition of hypoxanthine and xanthine (two molecules involved in the rotting of meat by spoilage microorganisms). The developed biosensor demonstrated good electrochemical performance toward xanthine with sensitivity of 2.14 +/- 1.48 ?A/mM, response time of 5.2 +/- 1.5 sec, lower detection limit of 150 +/- 39 nM, and retained at least 88% of its activity after 7 days of continuous use.

  10. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-11-10

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  11. Reduced cytochrome oxidase activity in the retrosplenial cortex after lesions to the anterior thalamic nuclei.

    PubMed

    Mendez-Lopez, Magdalena; Arias, Jorge L; Bontempi, Bruno; Wolff, Mathieu

    2013-08-01

    The anterior thalamic nuclei (ATN) make a critical contribution to hippocampal system functions. Growing experimental work shows that the effects of ATN lesions often resemble those of hippocampal lesions and both markedly reduce the expression of immediate-early gene markers in the retrosplenial cortex, which still appears normal by standard histological means. This study shows that moderate ATN damage was sufficient to produce severe spatial memory impairment as measured in a radial-arm maze. Furthermore, ATN rats exhibited reduced cytochrome oxidase activity in the most superficial cortical layers of the granular retrosplenial cortex, and, to a lesser extent, in the anterior cingulate cortex. By contrast, no change in cytochrome oxidase activity was observed in other limbic cortical regions or in the hippocampal formation. Altogether our results indicate that endogenous long-term brain metabolic capacity within the granular retrosplenial cortex is compromised by even limited ATN damage. PMID:23660649

  12. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)

    2002-01-01

    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  13. Targeting NADPH Oxidases for the Treatment of Cancer and Inflammation

    PubMed Central

    Bonner, Michael Y.; Arbiser, Jack L

    2015-01-01

    NADPH oxidases are a family of oxidases that utilize molecular oxygen to generate hydrogen peroxide and superoxide, thus indicating physiological functions of these Highly reactive and short lived species. The regulation of these NADPH oxidases (nox) enzymes is complex, with many members of this family exhibiting complexity in subunit composition, cellular location, and tissue specific expression. While the complexity of the nox family (Nox1–5, Duox1,2) is daunting, the complexity also allows for targeting of NADPH oxidases in disease states. This review will discuss which inflammatory and malignant disorders can be targeted by nox inhibitors, as well as clinical experience in the use of nox inhibitors. PMID:22581366

  14. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

  15. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

  16. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

  17. Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

    PubMed Central

    Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.

    1999-01-01

    Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCm?NOX and pKm?NOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

  18. Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

    PubMed Central

    Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

    2015-01-01

    Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

  19. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

    2012-01-01

    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 ?m for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  20. Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.

    PubMed

    Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J

    2012-12-14

    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 ?m for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  1. Loss of lysyl oxidase-like 3 causes cleft palate and spinal deformity in mice.

    PubMed

    Zhang, Jian; Yang, Rui; Liu, Ziyi; Hou, Congzhe; Zong, Wen; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang

    2015-11-01

    In mammals, embryonic development are highly regulated morphogenetic processes that are tightly controlled by genetic elements. Failure of any one of these processes can result in embryonic malformation. The lysyl oxidase (LOX) family genes are closely related to human diseases. In this study, we investigated the essential role of lysyl oxidase-like 3 (LOXL3), a member of the LOX family, in embryonic development. Mice lacking LOXL3 exhibited perinatal lethality, and the deletion of the Loxl3 gene led to impaired development of the palate shelves, abnormalities in the cartilage primordia of the thoracic vertebrae and mild alveolar shrinkage. We found that the obvious decrease of collagen cross-links in palate and spine that was induced by the lack of LOXL3 resulted in cleft palate and spinal deformity. Thus, we provide critical in vivo evidence that LOXL3 is indispensable for mouse palatogenesis and vertebral column development. The Loxl3 gene may be a candidate disease gene resulting in cleft palate and spinal deformity. PMID:26307084

  2. Loss of lysyl oxidase-like 3 causes cleft palate and spinal deformity in mice

    PubMed Central

    Zhang, Jian; Yang, Rui; Liu, Ziyi; Hou, Congzhe; Zong, Wen; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang

    2015-01-01

    In mammals, embryonic development are highly regulated morphogenetic processes that are tightly controlled by genetic elements. Failure of any one of these processes can result in embryonic malformation. The lysyl oxidase (LOX) family genes are closely related to human diseases. In this study, we investigated the essential role of lysyl oxidase-like 3 (LOXL3), a member of the LOX family, in embryonic development. Mice lacking LOXL3 exhibited perinatal lethality, and the deletion of the Loxl3 gene led to impaired development of the palate shelves, abnormalities in the cartilage primordia of the thoracic vertebrae and mild alveolar shrinkage. We found that the obvious decrease of collagen cross-links in palate and spine that was induced by the lack of LOXL3 resulted in cleft palate and spinal deformity. Thus, we provide critical in vivo evidence that LOXL3 is indispensable for mouse palatogenesis and vertebral column development. The Loxl3 gene may be a candidate disease gene resulting in cleft palate and spinal deformity. PMID:26307084

  3. Modulation of lysyl oxidase by dietary copper in rats.

    PubMed

    Rucker, R B; Romero-Chapman, N; Wong, T; Lee, J; Steinberg, F M; McGee, C; Clegg, M S; Reiser, K; Kosonen, T; Uriu-Hare, J Y; Murphy, J; Keen, C L

    1996-01-01

    Lysyl oxidase levels were estimated in rat tissues using an enzyme-linked immunosorption assay (ELISA) and a functional assay standardized against known amounts of purified lysyl oxidase. High concentrations of lysyl oxidase (> or = 150 micrograms/g of tissue or packed cells) were detected in connective tissues, such as tendon and skin. Values for aorta, kidney, lung and liver ranged from 30 to 150 micrograms/g of tissue; values for skeletal muscle and diaphragm were < 30 micrograms/g tissue. Purified rat skin lysyl oxidase catalyzed the release of 50-100 Bq of tritium per micrograms enzyme in assays that used 3H-elastin-rich substrates. In dense connective tissues, good agreement was obtained for the values from ELISA and those derived from measurements of functional activity in aorta, lung, skin and tendon (r2 > 0.9). When egg white-based experimental diets containing 2 or 10 micrograms/g added copper were fed to weanling rats, values for skin lysyl oxidase functional activity in the group fed 2 micrograms/g added copper were one-third to one-half the values for skin lysyl oxidase functional activity in rats fed 10 micrograms/g copper. This reduction in lysyl oxidase activity, however, had minimal effect on indices of collagen maturation in rat skin, e.g., collagen solubility in neutral salt and dilute acid or the levels of acid stable cross-links. Moreover, copper deficiency did not influence the steady-state levels of lysyl oxidase specific mRNA in rat skin or the apparent amounts of lysyl oxidase in rat skin as determined by ELISA. These observations underscore that the concentration of lysyl oxidase is relatively high in dense corrective tissues, and although decreasing dietary copper influences functional activity, there is little apparent effect on the production of lysyl oxidase protein. PMID:8558325

  4. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  5. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  6. Structure and expression of cDNAs encoding 1-aminocyclopropane-1-carboxylate oxidase homologs isolated from excised mung bean hypocotyls.

    PubMed

    Kim, W T; Yang, S F

    1994-01-01

    By screening a mung bean (Vigna radiata L.) hypocotyl cDNA library using a combination of apple (pAE12) and tomato (pTOM13) 1-aminocyclopropane 1-carboxylate (ACC)-oxidase cDNAs as probes, putative ACC-oxidase clones were isolated. Based on restriction-enzyme map and DNA-sequencing analyses, they can be divided into two homology classes, represented by pVR-ACO1 and pVR-ACO2. While pVR-ACO1 and pVR-ACO2 exhibit close homology in their coding regions, their 3'-noncoding regions are divergent. pVR-ACO1 is a 1312-bp full-length clone and contains a single open reading frame encoding 317 amino acids (MW = 35.8 kDa), while pVR-ACO2 is 1172 bp long and is a partial cDNA clone encoding 308 amino acids. These two deduced amino-acid sequences share 83% identity, and display considerable sequence conservation (73-86%) to other ACC oxidases from various plant species. Northern blot analyses of RNAs isolated from hypocotyl, leaf, and stem tissues using gene-specific probes indicate that the pVR-ACO1 transcript is present in all parts of the seedling and that the expression in hypocotyls is further increased following excision. The maximum induction of ACC-oxidase transcripts occurred at about 6 h after excision, while the maximum enzyme activity was observed at 24 h. When excised hypocotyls were treated with ethylene a further enhanced level of transcripts was observed. Aminooxyacetic acid, an inhibitor of ACC-synthase activity, and 2,5-norbornadiene, an inhibitor of ethylene action, suppressed the wound-induced accumulation of ACC-oxidase mRNA, while an addition of ethylene in these tissues restored the accumulation of ACC-oxidase mRNA.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7765118

  7. Prolonged exposure to LPS increases iron, heme, and p22phox levels and NADPH oxidase activity in human aortic endothelial cells: Inhibition by desferrioxamine

    PubMed Central

    Li, Lixin; Frei, Balz

    2009-01-01

    Objective Vascular oxidative stress and inflammation are contributing factors in atherosclerosis. We recently found that the iron chelator, desferrioxamine (DFO), suppresses NADPH oxidase-mediated oxidative stress and expression of cellular adhesion molecules in mice treated with lipopolysaccharide (LPS). The objective of the present study was to investigate whether and how LPS and iron enhance, and DFO inhibits, NADPH oxidase activity in human aortic endothelial cells (HAEC). Methods and Results Incubation of HAEC for 24 hrs with 5 ?g/mL LPS led to a four-fold increase in NADPH oxidase activity, which was strongly suppressed by pretreatment of the cells for 24 hrs with 100 ?mol/L DFO. Incubating HAEC with LPS also significantly increased cellular iron and heme levels and mRNA and protein levels of p22phox, a heme-containing, catalytic subunit of NADPH oxidase. All of these effects of LPS on HAEC were strongly inhibited by DFO. Exposing HAEC to 100 mol/L iron (ferric citrate) for 48 hrs exerted similar effects as LPS, and these effects were strongly inhibited by co-incubation with DFO. Furthermore, neither LPS nor DFO affected mRNA and protein levels of p47phox, a non-heme containing, regulatory subunit of NADPH oxidase, or the mRNA level of NOX4, an isoform of the principal catalytic subunit of NADPH oxidase in endothelial cells. In contrast, heme oxygenase-1 was strongly suppressed by DFO, both in the absence and presence of LPS or iron. Conclusions Our data indicate that prolonged exposure to LPS or iron increases endothelial NADPH oxidase activity by increasing p22phox gene transcription and cellular levels of iron, heme, and p22phox protein. Iron chelation by DFO effectively suppresses endothelial NADPH oxidase activity, which may be helpful as an adjunct in reducing vascular oxidative stress and inflammation in atherosclerosis. PMID:19251588

  8. Magnetic interactions in milk xanthine oxidase.

    PubMed

    Barber, M J; Salerno, J C; Siegel, L M

    1982-03-30

    The relaxation behavior of the EPR signals of MoV, FAD semiquinone, and the reduced Fe/S I center was measured in the presence and absence of other paramagnetic centers in milk xanthine oxidase. Specific pairs of prosthetic groups were rendered paramagnetic by poising the native enzyme or its desulfo glycol inhibited derivative at appropriate potentials and pH values. Magnetic interactions were found between the following species: Mo--Fe/S I (100-fold increase in microwave power required to saturate the MoV EPR signal at 103 K when Fe/S I is reduced as opposed to oxidized), FAD--Fe/S I and FAD--Fe/S II (70-fold increase in power required to saturate the FADH.EPR signal at 173 K when either Fe/S center is reduced), and Fe/S I--Fe/S II (2.5-fold increase in power to saturate the reduced Fe/S I EPR signal at 20 K when Fe/S II is reduced). The Mo--Fe/S I interaction was also detected as a reduced Fe/S I induced splitting of the MoV EPR spectrum at 30 K. No splittings of the FADH. or Fe/S center spectra were detected. No magnetic interactions were found between FAD and Mo or between Mo and Fe/S II. These results, together with those of Coffman & Buettner [Coffman, R. E., & Buettner, G. R. (1979) J. Phys. Chem. 83, 2392-2400], were used to estimate the following approximate distances between the electron carrying prosthetic groups of milk xamthine oxidase: Mo--Fe/S I, 11 +/- 3 A; Fe/S I-Fe/S II, 15 +/- 4 A; FAD-Fe/S I, 16 +/- 4 A; FAD-Fe/S II, 16 +/- 4 A. A model for the arrangement of these groups within the xanthine oxidase molecule is suggested. PMID:6282313

  9. Initial characerization of human spermine oxidase 

    E-print Network

    Juarez, Paul Ramon

    2009-05-15

    -Acetyl spermine is a substrate of spermine oxidase. The parameters k cat app and k cat /K m of N1-acetyl spermine differed from spermine by three orders of magnitude (Table 7). The slow catalysis may be attributed to the acetyl group on one end... of the compound creating a less than favorable orientation (with respect to spermine) within the active site. 28 Table 7: The apparent steady state parameters of spermine versus N1-acetyl spermine at pH 8.5, 25 ?C. Substrate k cat app (s...

  10. Enhanced ROS production and redox signaling with combined arsenite and UVA exposure: contribution of NADPH oxidase.

    PubMed

    Cooper, Karen L; Liu, Ke Jian; Hudson, Laurie G

    2009-08-15

    Solar ultraviolet radiation (UVR) is the major etiological factor in skin carcinogenesis. However, in vivo studies demonstrate that mice exposed to arsenic and UVR exhibit significantly more tumors and oxidative DNA damage than animals treated with either agent alone. Interactions between arsenite and UVR in the production of reactive oxygen species (ROS) and stress-associated signaling may provide a basis for the enhanced carcinogenicity. In this study keratinocytes were pretreated with arsenite (3 microM) and then exposed to UVA (10 kJ/m(2)). We report that exposure to UVA after arsenite pretreatment enhanced ROS production, p38 MAP kinase activation, and induction of a redox-sensitive gene product, heme oxygenase-1, compared to either stimulus alone. UVR exposure resulted in rapid and transient NADPH oxidase activation, whereas the response to arsenite was more pronounced and persistent. Inhibition of NADPH oxidase decreased ROS production in arsenite-treated cells but had little impact on UVA-exposed cells. Furthermore, arsenite-induced, but not UVA-induced, p38 activation and HO-1 expression were dependent upon NADPH oxidase activity. These findings indicate differences in the mechanisms of ROS production by arsenite and UVA that may provide an underlying basis for the observed enhancement of redox-related cellular responses upon combined UVA and arsenite exposure. PMID:19414066

  11. Cofactor Regeneration of NAD Novel Water-Forming NADH Oxidases

    E-print Network

    solution is the oxidation of NADH to NAD with concomitant reduction of oxygen catalyzed by NADH oxidase (E machine-annotat- ed NADH oxidase function. We have overexpressed the corresponding proteins and could, amines, and lactones are increasingly useful in the pharmaceutical, food, and crop protection industries

  12. The complex roles of NADPH oxidases in fungal infection

    PubMed Central

    Hogan, Deborah; Wheeler, Robert T.

    2014-01-01

    Summary NADPH oxidases play key roles in immunity and inflammation that go beyond the production of microbicidal reactive oxygen species (ROS). The past decade has brought a new appreciation for the diversity of roles played by ROS in signaling associated with inflammation and immunity. NADPH oxidase activity affects disease outcome during infections by human pathogenic fungi, an important group of emerging and opportunistic pathogens that includes Candida, Aspergillus and Cryptococcus species. Here we review how alternative roles of NADPH oxidase activity impact fungal infection and how ROS signaling affects fungal physiology. Particular attention is paid to roles for NADPH oxidase in immune migration, immunoregulation in pulmonary infection, neutrophil extracellular trap formation, autophagy and inflammasome activity. These recent advances highlight the power and versatility of spatiotemporally controlled redox regulation in the context of infection, and point to a need to understand the molecular consequences of NADPH oxidase activity in the cell. PMID:24905433

  13. Leptin regulates cardiomyocyte contractile function through endothelin-1 receptor-NADPH oxidase pathway.

    PubMed

    Dong, Feng; Zhang, Xiaochun; Ren, Jun

    2006-02-01

    Leptin, the obese gene product, plays an important role in the regulation of cardiac function. However, the mechanism behind leptin-induced cardiomyocyte contractile response is poorly understood. This study was designed to examine whether endothelin-1 receptor and NADPH oxidase play any role in leptin-induced cardiac contractile response. Isolated murine cardiomyocytes were exposed to leptin (5, 50, and 100 nmol/L) for 60 minutes in the absence or presence of the ETA receptor antagonist BQ123 (1 micromol/L), the ETB receptor antagonist BQ788 (1 micromol/L), or the NADPH oxidase inhibitor apocynin (100 micromol/L) before mechanical function was studied. Superoxide levels were measured by dihydroethidium fluorescent dye and the superoxide dismutase-inhibitable reduction of cytochrome c. NADPH oxidase subunit expression (p22phox, p47phox, p67phox, and gp91phox) was evaluated with Western blot. Leptin depressed peak shortening and maximal velocity of shortening/relengthening (+/-dL/dt), prolonged the duration of relengthening (TR90) without affecting the time-to-peak cell shortening. Consistent with the mechanical characteristics, myocytes treated with leptin displayed a reduced electrically stimulated rise in intracellular Ca2+ (change in fura-2 fluorescence intensity) associated with a prolonged intracellular Ca2+ decay rate. All of the abnormalities were significantly attenuated by apocynin, BQ123, or BQ788. Intracellular superoxide generation was enhanced after leptin treatment, which was partially blocked by apocynin, BQ123, or BQ788. Leptin had no effect on p22phox and gp91phox but upregulated protein expression of p67phox and p47phox, both of which were inhibited by apocynin, BQ123, or BQ788. These results suggest that leptin suppresses cardiac contractile function in ventricular myocytes through the endothelin-1 receptor and NADPH oxidase-mediated pathway. PMID:16380530

  14. Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

    PubMed Central

    Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

    2013-01-01

    Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

  15. The Apoplastic Copper AMINE OXIDASE1 Mediates Jasmonic Acid-Induced Protoxylem Differentiation in Arabidopsis Roots.

    PubMed

    Ghuge, Sandip A; Carucci, Andrea; Rodrigues-Pousada, Renato A; Tisi, Alessandra; Franchi, Stefano; Tavladoraki, Paraskevi; Angelini, Riccardo; Cona, Alessandra

    2015-06-01

    Polyamines are involved in key developmental processes and stress responses. Copper amine oxidases oxidize the polyamine putrescine (Put), producing an aldehyde, ammonia, and hydrogen peroxide (H2O2). The Arabidopsis (Arabidopsis thaliana) amine oxidase gene At4g14940 (AtAO1) encodes an apoplastic copper amine oxidase expressed at the early stages of vascular tissue differentiation in roots. Here, its role in root development and xylem differentiation was explored by pharmacological and forward/reverse genetic approaches. Analysis of the AtAO1 expression pattern in roots by a promoter::green fluorescent protein-?-glucuronidase fusion revealed strong gene expression in the protoxylem at the transition, elongation, and maturation zones. Methyl jasmonate (MeJA) induced AtAO1 gene expression in vascular tissues, especially at the transition and elongation zones. Early protoxylem differentiation was observed upon MeJA treatment along with Put level decrease and H2O2 accumulation in wild-type roots, whereas Atao1 loss-of-function mutants were unresponsive to the hormone. The H2O2 scavenger N,N(1)-dimethylthiourea reversed the MeJA-induced early protoxylem differentiation in wild-type seedlings. Likewise, Put, which had no effect on Atao1 mutants, induced early protoxylem differentiation in the wild type, this event being counteracted by N,N(1)-dimethylthiourea treatment. Consistently, AtAO1-overexpressing plants showed lower Put levels and early protoxylem differentiation concurrent with H2O2 accumulation in the root zone where the first protoxylem cells with fully developed secondary wall thickenings are found. These results show that the H2O2 produced via AtAO1-driven Put oxidation plays a role in MeJA signaling leading to early protoxylem differentiation in root. PMID:25883242

  16. Dual oxidase in the intestinal epithelium of zebrafish larvae has anti-bacterial properties.

    PubMed

    Flores, Maria Vega; Crawford, Katie C; Pullin, Lisa M; Hall, Christopher J; Crosier, Kathryn E; Crosier, Philip S

    2010-09-10

    Reactive oxygen species (ROS) function in a range of physiological processes such as growth, metabolism and signaling, and also have a pathological role. Recent research highlighted the requirement for ROS generated by dual oxidase (DUOX) in host-defence responses in innate immunity and inflammatory disorders such as inflammatory bowel disease (IBD), but in vivo evidence to support this has, to date, been lacking. In order to investigate the involvement of Duox in gut immunity, we characterized the zebrafish ortholog of the human DUOX genes. Zebrafish duox is highly expressed in intestinal epithelial cells. Knockdown of Duox impaired larval capacity to control enteric Salmonella infection. PMID:20709024

  17. Cell transformation by the superoxide-generating oxidase Mox1.

    PubMed

    Suh, Y A; Arnold, R S; Lassegue, B; Shi, J; Xu, X; Sorescu, D; Chung, A B; Griendling, K K; Lambeth, J D

    1999-09-01

    Reactive oxygen species (ROS) generated in some non-phagocytic cells are implicated in mitogenic signalling and cancer. Many cancer cells show increased production of ROS, and normal cells exposed to hydrogen peroxide or superoxide show increased proliferation and express growth-related genes. ROS are generated in response to growth factors, and may affect cell growth, for example in vascular smooth-muscle cells. Increased ROS in Ras-transformed fibroblasts correlates with increased mitogenic rate. Here we describe the cloning of mox1, which encodes a homologue of the catalytic subunit of the superoxide-generating NADPH oxidase of phagocytes, gp91phox. mox1 messenger RNA is expressed in colon, prostate, uterus and vascular smooth muscle, but not in peripheral blood leukocytes. In smooth-muscle cells, platelet-derived growth factor induces mox1 mRNA production, while antisense mox1 mRNA decreases superoxide generation and serum-stimulated growth. Overexpression of mox1 in NIH3T3 cells increases superoxide generation and cell growth. Cells expressing mox1 have a transformed appearance, show anchorage-independent growth and produce tumours in athymic mice. These data link ROS production by Mox1 to growth control in non-phagocytic cells. PMID:10485709

  18. Molecular Cloning and Characterization of Apricot Fruit Polyphenol Oxidase

    PubMed Central

    Chevalier, Tony; de Rigal, David; Mbéguié-A-Mbéguié, Didier; Gauillard, Frédéric; Richard-Forget, Florence; Fils-Lycaon, Bernard R.

    1999-01-01

    A reverse transcriptase-polymerase chain reaction experiment was done to synthesize a homologous polyphenol oxidase (PPO) probe from apricot (Prunus armeniaca var Bergeron) fruit. This probe was further used to isolate a full-length PPO cDNA, PA-PPO (accession no. AF020786), from an immature-green fruit cDNA library. PA-PPO is 2070 bp long and contains a single open reading frame encoding a PPO precursor peptide of 597 amino acids with a calculated molecular mass of 67.1 kD and an isoelectric point of 6.84. The mature protein has a predicted molecular mass of 56.2 kD and an isoelectric point of 5.84. PA-PPO belongs to a multigene family. The gene is highly expressed in young, immature-green fruit and is turned off early in the ripening process. The ratio of PPO protein to total proteins per fruit apparently remains stable regardless of the stage of development, whereas PPO specific activity peaks at the breaker stage. These results suggest that, in addition to a transcriptional control of PPO expression, other regulation factors such as translational and posttranslational controls also occur. PMID:10198084

  19. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

    PubMed

    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

    2001-02-01

    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus. PMID:11302173

  20. ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

    USGS Publications Warehouse

    Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

    2012-01-01

    Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

  1. Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

    PubMed Central

    Lermontova, Inna; Grimm, Bernhard

    2000-01-01

    The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251

  2. Comparison of kinetic properties between plant and fungal amine oxidases.

    PubMed

    Luhová, L; Slavík, L; Frébort, I; Sebela, M; Zajoncová, L; Pec, P

    1996-01-01

    Kinetic properties of novel amine oxidases isolated from a mold Aspergillus niger AKU 3302 were compared to those of typical plant amine oxidase from pea seedling (EC 1.4.3.6). Pea amine oxidase showed highest affinity with diamines, such as putrescine and cadaverine, while fungal enzymes oxidized preferably n-hexylamine and tyramine. All enzymes were inhibited by carbonyl reagents, copper chelating agents, some substrate analogs and alkaloids, but there were quite significant differences in the sensitivity and inhibition modes. Aminoguanidine, which strongly inhibited pea amine oxidases showed only little effect on fungal enzymes. Substrate analogs such as 1.5-diamino-3-pentanone and 1-amino-3-phenyl-3-propanone, which were potent competitive inhibitors of pea amine oxidases, inhibited fungal enzymes much more weakly and non competitively. Also various alkaloids behaving as competitive inhibitors of pea amine oxidase inhibited the fungal enzymes non competitively. Very surprising was the potent inhibition of fungal enzymes by artificial substrates of pea amine oxidases, E- and Z-1,4-diamino-2-butene. The relationships between the different inhibition modes and possible binding at the active site are discussed. PMID:8872745

  3. Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

    PubMed

    Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

    2010-05-01

    Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching. PMID:19763895

  4. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  5. Current status of NADPH oxidase research in cardiovascular pharmacology

    PubMed Central

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel

    2013-01-01

    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new inhibitors. All this knowledge and the research presently underway will likely result in development of new drugs for inhibition of NADPH oxidase and application of therapeutic approaches based on their action, for the treatment of cardiovascular disease in the next few years. PMID:23983473

  6. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.

    1996-12-31

    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  7. Glucose oxidase immobilization onto carbon nanotube networking

    E-print Network

    Karachevtsev, V A; Zarudnev, E S; Karachevtsev, M V; Leontiev, V S; Linnik, A S; Lytvyn, O S; Plokhotnichenko, A M; Stepanian, S G

    2012-01-01

    When elaborating the biosensor based on single-walled carbon nanotubes (SWNTs), it is necessary to solve such an important problem as the immobilization of a target biomolecule on the nanotube surface. In this work, the enzyme (glucose oxidase (GOX)) was immobilized on the surface of a nanotube network, which was created by the deposition of nanotubes from their solution in 1,2-dichlorobenzene by the spray method. 1-Pyrenebutanoic acid succinimide ester (PSE) was used to form the molecular interface, the bifunctional molecule of which provides the covalent binding with the enzyme shell, and its other part (pyrene) is adsorbed onto the nanotube surface. First, the usage of such a molecular interface leaves out the direct adsorption of the enzyme (in this case, its activity decreases) onto the nanotube surface, and, second, it ensures the enzyme localization near the nanotube. The comparison of the resonance Raman (RR) spectrum of pristine nanotubes with their spectrum in the PSE environment evidences the creat...

  8. Degradation of pentachlorophenol by potato polyphenol oxidase.

    PubMed

    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

    2011-11-01

    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  9. Enzymatic polymerization of dihydroquercetin using bilirubin oxidase.

    PubMed

    Khlupova, M E; Vasil'eva, I S; Shumakovich, G P; Morozova, O V; Chertkov, V A; Shestakova, A K; Kisin, A V; Yaropolov, A I

    2015-02-01

    Dihydroquercetin (or taxifolin) is one of the most famous flavonoids and is abundant in Siberian larch (Larix sibirica). The oxidative polymerization of dihydroquercetin (DHQ) using bilirubin oxidase as a biocatalyst was investigated and some physicochemical properties of the products were studied. DHQ oligomers (oligoDHQ) with molecular mass of 2800 and polydispersity of 8.6 were obtained by enzymatic reaction under optimal conditions. The oligomers appeared to be soluble in dimethylsulfoxide, dimethylformamide, and methanol. UV-visible spectra of oligoDHQ in dimethylsulfoxide indicated the presence of highly conjugated bonds. The synthesized oligoDHQ was also characterized by FTIR and (1)H and (13)C NMR spectroscopy. Comparison of NMR spectra of oligoDHQ with DHQ monomer and the parent flavonoids revealed irregular structure of a polymer formed via the enzymatic oxidation of DHQ followed by nonselective radical polymerization. As compared with the monomer, oligoDHQ demonstrated higher thermal stability and high antioxidant activity. PMID:25756538

  10. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

    2014-01-01

    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  11. NADPH oxidase deficiency in X-linked chronic granulomatous disease.

    PubMed Central

    Hohn, D C; Lehrer, R I

    1975-01-01

    We measured the cyanide-insensitive pyridine nucleotide oxidase activity of fractionated resting and phagocytic neutrophils from 11 normal donors, 1 patient with hereditary deficiency of myeloperoxidase, and 7 patients with X-linked chronic granulomatous disease (CGD). When measured under optimal conditions (at pH 5.5 and in the presence of 0.5 mM Mn++), NADPH oxidase activity increased fourfold with phagocytosis and was six-fold higher than with NADH. Phagocytic neutrophils from patients with CGD were markedly deficient in NADPH oxidase activity. Images PMID:235560

  12. Effects of hydrogen peroxide on mitochondrial gene expression of intestinal epithelial cells

    PubMed Central

    Li, Jian-Ming; Cai, Qian; Zhou, Hong; Xiao, Guang-Xia

    2002-01-01

    AIM: To study the effects of hydrogen peroxide on mitochondrial gene expression of intestinal epithelial cells in in vitro model of hydrogen peroxide-stimulated SW-480 cells. METHODS: RNA of hydrogen peroxide-induced SW-480 cells was isolated, and reverse-transcriptional polymerase chain reaction was performed to study gene expression of ATPase subunit 6, ATPase subunit 8, cytochrome c oxidase subunit I (COI), cytochrome coxidase subuit II (COII) and cytochrome c oxidase subunit III (COIII). Mitochondria were isolated and activities of mitochondrial cytochrome c oxidase and ATPase were also measured simultaneously. RESULTS: Hydrogen peroxide led to differential expression of mitochondrial genes with some genes up-regulated or down-regulated in a dose dependent manner. Differences were very obvious in expressions of mitochondrial genes of cells treated with hydrogen peroxide in a concentration of 400 ?mol/L or 4 mmol/L. In general, differential expression of mitochondrial genes was characterized by up-regulation of mitochondrial genes in the concentration of 400 ?mol/L and down-regulation in the concentration of 4 mmol/L. In consistence with changes in mitochondrial gene expressions, hydrogen peroxide resulted in decreased activities of cytochrome c oxidase and ATPase. CONCLUSION: The differential expression of mitochondrial genes encoding cytochrome c oxidase and ATPase is involved in apoptosis of intestinal epithelial cells by affecting activities of cytochorme c oxidase and ATPase. PMID:12439937

  13. Experimental Evidence for a Revision in the Annotation of Putative Pyridoxamine 5'-Phosphate Oxidases P(N/M)P from Fungi

    PubMed Central

    da Silva, Tiago Fernandes; Palhano, Fernando L.

    2015-01-01

    Pyridoxinamine 5'-phosphate oxidases (P(N/M)P oxidases) that bind flavin mononucleotide (FMN) and oxidize pyridoxine 5'-phosphate or pyridoxamine 5'-phosphate to form pyridoxal 5'-phosphate (PLP) are an important class of enzymes that play a central role in cell metabolism. Failure to generate an adequate supply of PLP is very detrimental to most organisms and is often clinically manifested as a neurological disorder in mammals. In this study, we analyzed the function of YLR456W and YPR172W, two homologous genes of unknown function from S. cerevisiae that have been annotated as putative P(N/M)P oxidases based on sequence homology. Different experimental approaches indicated that neither protein catalyzes PLP formation nor binds FMN. On the other hand, our analysis confirmed the enzymatic activity of Pdx3, the S. cerevisiae protein previously implicated in PLP biosynthesis by genetic and structural characterization. After a careful sequence analysis comparing the putative and confirmed P(N/M)P oxidases, we found that the protein domain (PF01243) that led to the YLR456W and YPR172W annotation is a poor indicator of P(N/M)P oxidase activity. We suggest that a combination of two Pfam domains (PF01243 and PF10590) present in Pdx3 and other confirmed P(N/M)P oxidases would be a stronger predictor of this molecular function. This work exemplifies the importance of experimental validation to rectify genome annotation and proposes a revision in the annotation of at least 400 sequences from a wide variety of fungal species that are homologous to YLR456W and are currently misrepresented as putative P(N/M)P oxidases. PMID:26327315

  14. Effects of Transgenic Hybrid Aspen Overexpressing Polyphenol Oxidase on Rhizosphere Diversity?

    PubMed Central

    Oliver, Kathryn L.; Hamelin, Richard C.; Hintz, William E.

    2008-01-01

    This study assessed the potential effects of transgenic aspen overexpressing a polyphenol oxidase gene on diversity in rhizosphere communities. Cultivation-independent methods were used to better delineate bacterial and fungal populations associated with transgenic and nontransgenic trees. Gene libraries for the bacterial component of the rhizosphere were established using 16S rRNA and chaperonin-60 (CPN-60) gene sequences, while the fungal community was characterized using 18S rRNA gene sequences. The 16S rRNA gene libraries were dominated by alphaproteobacterial sequences, while the CPN-60 gene libraries were dominated by members of the Bacteroidetes/Chlorobi group. In both the CPN-60 and 16S rRNA libraries, there were differences in only minor components of the bacterial community between transgenic and unmodified trees, and no significant differences in species diversity were observed. Compared to the bacterial gene libraries, greater coverage of the underlying population was achieved with the fungal 18S rRNA libraries. Members of the Zygomycota, Chytridiomycota, Ascomycota, and Basidiomycota were recovered from both libraries. The dominant groups of fungi associated with each tree type were very similar, although there were some qualitative differences in the recovery of less-abundant fungi, likely as a result of the underlying heterogeneity of the fungal population. The methods employed revealed only minor differences between the bacterial and fungal communities associated with transgenic and unmodified trees. PMID:18552195

  15. Genetics Home Reference: Peroxisomal acyl-CoA oxidase deficiency

    MedlinePLUS

    ... body. It is unclear exactly how VLCFA accumulation leads to the specific features of peroxisomal acyl-CoA oxidase deficiency. However, researchers suggest that the abnormal fatty acid accumulation triggers inflammation in the nervous system that ...

  16. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.

    2015-01-01

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  17. Exploring ORFan Domains in Giant Viruses: Structure of Mimivirus Sulfhydryl Oxidase R596

    PubMed Central

    Hakim, Motti; Ezerina, Daria; Alon, Assaf; Vonshak, Ohad; Fass, Deborah

    2012-01-01

    The mimivirus genome contains many genes that lack homologs in the sequence database and are thus known as ORFans. In addition, mimivirus genes that encode proteins belonging to known fold families are in some cases fused to domain-sized segments that cannot be classified. One such ORFan region is present in the mimivirus enzyme R596, a member of the Erv family of sulfhydryl oxidases. We determined the structure of a variant of full-length R596 and observed that the carboxy-terminal region of R596 assumes a folded, compact domain, demonstrating that these ORFan segments can be stable structural units. Moreover, the R596 ORFan domain fold is novel, hinting at the potential wealth of protein structural innovation yet to be discovered in large double-stranded DNA viruses. In the context of the R596 dimer, the ORFan domain contributes to formation of a broad cleft enriched with exposed aromatic groups and basic side chains, which may function in binding target proteins or localization of the enzyme within the virus factory or virions. Finally, we find evidence for an intermolecular dithiol/disulfide relay within the mimivirus R596 dimer, the first such extended, intersubunit redox-active site identified in a viral sulfhydryl oxidase. PMID:23209798

  18. Discovery and characterization of a putrescine oxidase from Rhodococcus erythropolis NCIMB 11540

    PubMed Central

    van Hellemond, Erik W.; van Dijk, Marianne; Heuts, Dominic P. H. M.; Janssen, Dick B.

    2008-01-01

    A gene encoding a putrescine oxidase (PuORh, EC 1.4.3.10) was identified from the genome of Rhodococcus erythropolis NCIMB 11540. The gene was cloned in the pBAD vector and overexpressed at high levels in Escherichia coli. The purified enzyme was shown to be a soluble dimeric flavoprotein consisting of subunits of 50 kDa and contains non-covalently bound flavin adenine dinucleotide as a cofactor. From all substrates, the highest catalytic efficiency was found with putrescine (KM?=?8.2 ?M, kcat?=?26 s?1). PuORh accepts longer polyamines, while short diamines and monoamines strongly inhibit activity. PuORh is a reasonably thermostable enzyme with t1/2 at 50°C of 2 h. Based on the crystal structure of human monoamine oxidase B, we constructed a model structure of PuORh, which hinted to a crucial role of Glu324 for substrate binding. Mutation of this residue resulted in a drastic drop (five orders of magnitude) in catalytic efficiency. Interestingly, the mutant enzyme showed activity with monoamines, which are not accepted by wt-PuORh. Electronic supplementary material The online version of this article (doi:10.1007/s00253-007-1310-4) contains supplementary material, which is available to authorized users. PMID:18183391

  19. Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

    PubMed Central

    Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

    1995-01-01

    Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes. PMID:7630935

  20. Silencing C19-GA 2-oxidases induces parthenocarpic development and inhibits lateral branching in tomato plants

    PubMed Central

    Martínez-Bello, Liliam; Moritz, Thomas; López-Díaz, Isabel

    2015-01-01

    Gibberellins (GAs) are phytohormones that regulate a wide range of developmental processes in plants. Levels of active GAs are regulated by biosynthetic and catabolic enzymes like the GA 2-oxidases (GA2oxs). In tomato (Solanum lycopersicum L.) C19 GA2oxs are encoded by a small multigenic family of five members with some degree of redundancy. In order to investigate their roles in tomato, the silencing of all five genes in transgenic plants was induced. A significant increase in active GA4 content was found in the ovaries of transgenic plants. In addition, the transgenic unfertilized ovaries were much bigger than wild-type ovaries (about 30 times) and a certain proportion (5–37%) were able to develop parthenocarpically. Among the GA2ox family, genes GA2ox1 and -2 seem to be the most relevant for this phenotype since their expression was induced in unfertilized ovaries and repressed in developing fruits, inversely correlating with ovary growth. Interestingly, transgenic lines exhibited a significant inhibition of branching and a higher content of active GA4 in axillary buds. This phenotype was reverted, in transgenic plants, by the application of paclobutrazol, a GA biosynthesis inhibitor, suggesting a role for GAs as repressors of branching. In summary, this work demonstrates that GA 2-oxidases regulate gibberellin levels in ovaries and axillary buds of tomato plants and their silencing is responsible for parthenocarpic fruit growth and branching inhibition. PMID:26093022

  1. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    PubMed

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. PMID:23628925

  2. beta-aminobutyric acid primes an NADPH oxidase-dependent reactive oxygen species production during grapevine-triggered immunity.

    PubMed

    Dubreuil-Maurizi, Carole; Trouvelot, Sophie; Frettinger, Patrick; Pugin, Alain; Wendehenne, David; Poinssot, Benoît

    2010-08-01

    The molecular mechanisms underlying the process of priming are poorly understood. In the present study, we investigated the early signaling events triggered by beta-aminobutyric acid (BABA), a well-known priming-mediated plant resistance inducer. Our results indicate that, in contrast to oligogalacturonides (OG), BABA does not elicit typical defense-related early signaling events nor defense-gene expression in grapevine. However, in OG-elicited cells pretreated with BABA, production of reactive oxygen species (ROS) and expression of the respiratory-burst oxidase homolog RbohD gene were primed. In response to the causal agent of downy mildew Plasmopara viticola, a stronger ROS production was specifically observed in BABA-treated leaves. This process was correlated with an increased resistance. The NADPH oxidase inhibitor diphenylene iodonium (DPI) abolished this primed ROS production and reduced the BABA-induced resistance (BABA-IR). These results suggest that priming of an NADPH oxidase-dependent ROS production contributes to BABA-IR in the Vitis-Plasmopara pathosystem. PMID:20615112

  3. Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis

    PubMed Central

    Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

    2013-01-01

    Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

  4. Yeast cytochrome c oxidase: A model system to study mitochondrial forms of the haem–copper oxidase superfamily?

    PubMed Central

    Maréchal, Amandine; Meunier, Brigitte; Lee, David; Orengo, Christine; Rich, Peter R.

    2015-01-01

    The known subunits of yeast mitochondrial cytochrome c oxidase are reviewed. The structures of all eleven of its subunits are explored by building homology models based on the published structures of the homologous bovine subunits and similarities and differences are highlighted, particularly of the core functional subunit I. Yeast genetic techniques to enable introduction of mutations into the three core mitochondrially-encoded subunits are reviewed. This article is part of a Special Issue entitled: Respiratory Oxidases. PMID:21925484

  5. Sulfhydryl oxidases: sources, properties, production and applications.

    PubMed

    Faccio, Greta; Nivala, Outi; Kruus, Kristiina; Buchert, Johanna; Saloheimo, Markku

    2011-08-01

    The formation of disulfide bonds in proteins and small molecules can greatly affect their functionality. Sulfhydryl oxidases (SOXs) are enzymes capable of oxidising the free sulfhydryl groups in proteins and thiol-containing small molecules by using molecular oxygen as an electron acceptor. SOXs have been isolated from the intracellular compartments of many organisms, but also secreted SOXs are known. These latter enzymes are generally active on small compounds and their physiological role is unknown, whereas the intracellular enzymes prefer proteins as substrates and are involved in protein folding. An increasing number of scientific publications and patent applications on SOXs have been published in recent years. The present mini-review provides an up-to-date summary of SOXs from various families, their production and their actual or suggested applications. The sequence features and domain organisation of the characterised SOXs are reviewed, and special attention is paid to the physicochemical features of the enzymes. A review of patents and patent applications regarding this class of enzymes is also provided. PMID:21732243

  6. MONOAMINE OXIDASE: RADIOTRACER DEVELOPMENT AND HUMAN STUDIES.

    SciTech Connect

    FOWLER,J.S.; LOGAN,J.; VOLKOW,N.D.; WANG,G.J.; MACGREGOR,R.R.; DING,Y.S.

    2000-09-28

    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  7. Crystallization of carbohydrate oxidase from Microdochium nivale.

    PubMed

    Dusková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Stepánková, Andrea; Hasek, Jindrich

    2009-06-01

    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 A resolution, with unit-cell parameters a = b = 55.7, c = 610.4 A and apparent space group P6(2)22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 A, beta = 95.7 degrees . Data sets were collected to a resolution of 2.4 A. The structure was solved by the molecular-replacement method. Model refinement is currently in progress. PMID:19478452

  8. Binding of cetylpyridinum chloride to glucose oxidase.

    PubMed

    Bordbar, Abdol-Khalegh; Hosseinzadeh, Reza

    2006-12-01

    The binding of cetylpyridinum chloride (CPC) with glucose oxidase (GOD) has been extensively studied at various experimental conditions such as ionic strength, urea concentration and pH at 25 degrees C, using ion-selective membrane electrodes, UV-vis absorption spectroscopy and enzyme activity assay method. The accurate binding isotherms have been obtained and analyzed in terms of Scatchard plot and binding capacity concept. The results represent two binding set system for most of studied conditions. The values of Hill equation parameters have been estimated and used for calculation of intrinsic Gibbs free energy of binding. The results have been interpreted in terms of structural viewpoint of GOD and nature of interactions in the solution. The interpretations are in good agreement with denaturation experiment. Activity measurements represent the significant activation of enzyme due to binding of first CPC molecules. However, the binding of subsequent CPC diminished the activity of enzyme which may be due to the binding of second CPC to enzyme active site. The complete deactivation of enzyme is reached due to binding of about five CPC ions. PMID:17110091

  9. Monoamine oxidase: Radiotracer chemistry and human studies

    SciTech Connect

    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.

    2015-03-01

    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variables which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.

  10. Monoamine oxidase: Radiotracer chemistry and human studies

    DOE PAGESBeta

    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.

    2015-03-01

    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variablesmore »which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.« less

  11. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).

    PubMed

    Neves, Valdir Augusto; da Silva, Maraiza Aparecida

    2007-03-21

    Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  12. Properties of wheat bran polyphenol oxidase.

    PubMed

    Soysal, Ci?dem; Söylemez, Zerrin

    2004-02-01

    Polyphenol oxidase (PPO) obtained from wheat bran catalyzed the oxidation of 4-methyl catechol. Phenolic compounds found naturally in crude extract played role as an endogeneous substrate and activity of crude extract needed correction. Activity versus enzyme concentration gave a linear plot at high substrate concentration whereas a nonlinear plot was obtained at low substrate concentration which proved the presence of endogeneous substrate. Adsorption on celite and extraction with polyvinylpyrrolidone (PVPP) caused the removal of phenols. Adsorption of PPO on celite yielded a 4-fold increase in specific activity whereas extraction with PVPP yielded a 2.5-fold increase in specific activity compared to the crude extract. The kinetics of PPO catalyzed oxidation obeyed Michaelis-Menten model; Km and Vmax values were found as 218 mM and 99 microM/min, respectively. The enzyme was inhibited by ethyl alcohol, dithiothreitol (DTT) and isoproterenol and exhibited heat stability up to a temperature of 90 degrees C. The optimum pH of the enzyme was found to be 5.0. PMID:15053343

  13. Electron transfer pathways in cytochrome c oxidase.

    PubMed

    Lucas, M Fátima; Rousseau, Denis L; Guallar, Victor

    2011-10-01

    Mixed quantum mechanical/molecular mechanics calculations were used to explore the electron pathway of the terminal electron transfer enzyme, cytochrome c oxidase. This enzyme catalyzes the reduction of molecular oxygen to water in a multiple step process. Density functional calculations on the three redox centers allowed for the characterization of the electron transfer mechanism, following the sequence Cu(A)?heme a?heme a(3). This process is largely affected by the presence of positive charges, confirming the possibility of a proton coupled electron transfer. An extensive mapping of all residues involved in the electron transfer, between the Cu(A) center (donor) and the O(2) reduction site heme a(3)-Cu(B) (receptor), was obtained by selectively activating/deactivating different quantum regions. The method employed, called QM/MM e-pathway, allowed the identification of key residues along the possible electron transfer paths, consistent with experimental data. In particular, the role of arginines 481 and 482 appears crucial in the Cu(A)?heme a and in the heme a?heme a(3) electron transfer processes. This article is part of a Special Issue entitled: Allosteric cooperativity in respiratory proteins. PMID:21419097

  14. Novel reiterated Fnr-type proteins control the production of the symbiotic terminal oxidase cbb3 in Rhizobium etli CFN42.

    PubMed

    Granados-Baeza, Manuel J; Gómez-Hernández, Nicolás; Mora, Yolanda; Delgado, María J; Romero, David; Girard, Lourdes

    2007-10-01

    Symbiotic nitrogen-fixing bacteria express a terminal oxidase with a high oxygen affinity, the cbb3-type oxidase encoded by the fixNOQP operon. Previously, we have shown that, in Rhizobium etli CFN42, the repeatedfixNOQP operons (fixNOQPd and fixNOQPf) have a differential role in nitrogen fixation. Only the fixNOQPd operon is required for the establishment of an effective symbiosis; microaerobic induction of this operon is under the control of at least three transcriptional regulators, FixKf, FnrNd, and FnrNchr, belonging to the Crp/Fnr family. In this work, we describe two novel Crp/Fnr-type transcriptional regulators (StoRd and StoRf, symbiotic terminal oxidase regulators) that play differential roles in the control of key genes for nitrogen fixation. Mutations either in stoRd or stoRf enhance the microaerobic expression of both fixNOQP reiterations, increasing also the synthesis of the cbb3-type oxidase in nodules. Despite their structural similarity, a differential role of these genes was also revealed, since a mutation in stoRd but not in stoRf enhanced both the expression of fixKf and the nitrogen-fixing capacity of R. etli CFN42. PMID:17918626

  15. NOS1 induces NADPH oxidases and impairs contraction kinetics in aged murine ventricular myocytes.

    PubMed

    Villmow, Marten; Klöckner, Udo; Heymes, Christophe; Gekle, Michael; Rueckschloss, Uwe

    2015-09-01

    Nitric oxide (NO) modulates calcium transients and contraction of cardiomyocytes. However, it is largely unknown whether NO contributes also to alterations in the contractile function of cardiomyocytes during aging. Therefore, we analyzed the putative role of nitric oxide synthases and NO for the age-related alterations of cardiomyocyte contraction. We used C57BL/6 mice, nitric oxide synthase 1 (NOS1)-deficient mice (NOS1(-/-)) and mice with cardiomyocyte-specific NOS1-overexpression to analyze contractions, calcium transients (Indo-1 fluorescence), acto-myosin ATPase activity (malachite green assay), NADPH oxidase activity (lucigenin chemiluminescence) of isolated ventricular myocytes and cardiac gene expression (Western blots, qPCR). In C57BL/6 mice, cardiac expression of NOS1 was upregulated by aging. Since we found a negative regulation of NOS1 expression by cAMP in isolated cardiomyocytes, we suggest that reduced efficacy of ?-adrenergic signaling that is evident in aged hearts promotes upregulation of NOS1. Shortening and relengthening of cardiomyocytes from aged C57BL/6 mice were decelerated, but were normalized by pharmacological inhibition of NOS1/NO. Cardiomyocytes from NOS1(-/-) mice displayed no age-related changes in contraction, calcium transients or acto-myosin ATPase activity. Aging increased cardiac expression of NADPH oxidase subunits NOX2 and NOX4 in C57BL/6 mice, but not in NOS1(-/-) mice. Similarly, cardiac expression of NOX2 and NOX4 was upregulated in a murine model with cardiomyocyte-specific overexpression of NOS1. We conclude that age-dependently upregulated NOS1, putatively via reduced efficacy of ?-adrenergic signaling, induces NADPH oxidases. By increasing nitrosative and oxidative stress, both enzyme systems act synergistically to decelerate contraction of aged cardiomyocytes. PMID:26173391

  16. Antisense downregulation of polyphenol oxidase results in enhanced disease susceptibility.

    PubMed

    Thipyapong, Piyada; Hunt, Michelle D; Steffens, John C

    2004-11-01

    Polyphenol oxidases (PPOs; EC 1.14.18.1 or EC 1.10.3.2) catalyze the oxidation of phenolics to quinones, highly reactive intermediates whose secondary reactions are responsible for much of the oxidative browning that accompanies plant senescence, wounding, and responses to pathogens. To assess the impact of PPO expression on resistance to Pseudomonas syringae pv. tomato we introduced a chimeric antisense potato PPO cDNA into tomato (Lycopersicon esculentum L.). Oxidation of caffeic acid, the dominant o-diphenolic aglycone of tomato foliage, was decreased ca. 40-fold by antisense expression of PPO. All members of the PPO gene family were downregulated: neither immunoreactive PPO nor PPO-specific mRNA were detectable in the transgenic plants. In addition, the antisense PPO construct suppressed inducible increases in PPO activity. Downregulation of PPO in antisense plants did not affect growth, development, or reproduction of greenhouse-grown plants. However, antisense PPO expression dramatically increased susceptibility to P. syringae expressing the avirulence gene avrPto in both Pto and pto backgrounds. In a compatible (pto) interaction, plants constitutively expressing an antisense PPO construct exhibited a 55-fold increase in bacterial growth, three times larger lesion area, and ten times more lesions cm(-2) than nontransformed plants. In an incompatible (Pto) interaction, antisense PPO plants exhibited 100-fold increases in bacterial growth and ten times more lesions cm(-2) than nontransformed plants. Although it is not clear whether hypersusceptibility of antisense plants is due to low constitutive PPO levels or failure to induce PPO upon infection, these findings suggest a critical role for PPO-catalyzed phenolic oxidation in limiting disease development. As a preliminary effort to understand the role of induced PPO in limiting disease development, we also examined the response of PPO promoter::beta-glucuronidase constructs when plants are challenged with P. syringae in both Pto and pto backgrounds. While PPO B inducibility was the same in both compatible and incompatible interactions, PPO D, E and F were induced to higher levels and with different expression patterns in incompatible interactions. PMID:15300439

  17. NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

    SciTech Connect

    Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin; Park, Ji-hoon; Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook; Kim, Soon Ha

    2012-08-15

    Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 ?M. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ? NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ? NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ? NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ? NecroX-7 effectively inhibited NADPH oxidase activation. ? Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

  18. The identification of an integral membrane, cytochrome c urate oxidase completes the catalytic repertoire of a therapeutic enzyme

    PubMed Central

    Doniselli, Nicola; Monzeglio, Enrico; Dal Palù, Alessandro; Merli, Angelo; Percudani, Riccardo

    2015-01-01

    In living organisms, the conversion of urate into allantoin requires three consecutive enzymes. The pathway was lost in hominid, predisposing humans to hyperuricemia and gout. Among other species, the genomic distribution of the two last enzymes of the pathway is wider than that of urate oxidase (Uox), suggesting the presence of unknown genes encoding Uox. Here we combine gene network analysis with association rule learning to identify the missing urate oxidase. In contrast with the known soluble Uox, the identified gene (puuD) encodes a membrane protein with a C-terminal cytochrome c. The 8-helix transmembrane domain corresponds to DUF989, a family without similarity to known proteins. Gene deletion in a PuuD-encoding organism (Agrobacterium fabrum) abolished urate degradation capacity; the phenotype was fully restored by complementation with a cytosolic Uox from zebrafish. Consistent with H2O2 production by zfUox, urate oxidation in the complemented strain caused a four-fold increase of catalase. No increase was observed in the wild-type, suggesting that urate oxidation by PuuD proceeds through cytochrome c-mediated electron transfer. These findings identify a missing link in purine catabolism, assign a biochemical activity to a domain of unknown function (DUF989), and complete the catalytic repertoire of an enzyme useful for human therapy. PMID:26349049

  19. Isolation and characterization of polyphenol oxidase isozymes of clingstone peach.

    PubMed

    Wong, T C; Luh, B S; Whitaker, J R

    1971-07-01

    The polyphenol oxidase system in clingstone peach (Prunus persica) was investigated. Polyacrylamide disc-gel electrophoresis indicated four bands with polyphenol oxidase activity in extracts from acetone powder of clingstone peach. These four isozymes were then isolated from a buffer extract of peach acetone powder by cold acetone precipitation, followed by diethylaminoethyl cellulose column chromatography. All isozymes had different heat stabilities. At 55 C, polyphenol oxidases A, B, and D had half-lives of 5.4, 14.6, and 14.1 minutes, respectively. Polyphenol oxidase C was stable over a period of 50 minutes of incubation at 55 C, but had a half-life of 2.2 minutes at 76 C. None of the isozymes had monophenolase activity, and they varied in their specificity for several diphenols. The following values were found for polyphenol oxidases A, B, C, and D, respectively, with catechol as substrate: optimal pH: 6.8, 6.5, 7.2, and 7.0; Michaelis constant: 6.6, 4.2, 7.0, and 36 mm; V(max)/(E(0)): 4.95, 39.4, 2.16, and 80.0 (DeltaA min(-1) mg(-1)). Each isozyme showed a different amount of inhibition by NaHSO(3), NaCl, NaCN, l-ascorbic acid, glutathione, ethylenediaminetetraacetate, and sodium diethyldithiocarbamate. PMID:16657726

  20. Characterization of polyphenol oxidase in coffee.

    PubMed

    Mazzafera, P; Robinson, S P

    2000-10-01

    Polyphenol oxidase (PPO) was characterized in partially purified extracts of leaves (PPO-L) and fruit endosperm (PPO-E) of coffee (Coffea arabica L.). PPO activity was higher in early developmental stages of both leaves and endosperm of fruits. Wounding or exposure of coffee leaves to methyl jasmonate increased PPO activity 1.5-4-fold. PPO was not latent and was not activated by protease treatment. PPO activity was stimulated 10-15% with sodium dodecyl sulphate (SDS) at 0.35-1.75 mM, but at higher concentrations activities were similar to the control samples, without detergent. Prolonged incubation of extracts with trypsin or proteinase K inhibited PPO activity but pepsin had no effect. Inhibition of PPO with proteinase K was increased in the presence of SDS. PPO activity from both tissues was optimal at pH 6-7 and at an assay temperature of 30 degrees C. Activity was highest with chlorogenic acid as substrate with a Km of 0.882 mM (PPO-L) and 2.27 mM (PPO-E). Hexadecyl trimethyl-ammonium bromide, polyvinylpyrrolidone 40. cinnamic acid and salicylhydroxamic acid inhibited PPO from both tissues. Both enzymes were inactivated by heat but the activity in endosperm extracts was more heat labile than that from leaves. The apparent Mr determined by gel filtration was 46 (PPO-L) and 50 kDa (PPO-E). Activity-stained SDS polyacrylamide gel electrophoresis (PAGE) gels and western blots probed with PPO antibodies suggested the existence of a 67 kDa PPO which is susceptible to proteolytic cleavage that generates a 45 kDa active form. PMID:11117875

  1. Thylakoid Terminal Oxidases Are Essential for the Cyanobacterium Synechocystis sp. PCC 6803 to Survive Rapidly Changing Light Intensities1[C][W][OA

    PubMed Central

    Lea-Smith, David J.; Ross, Nic; Zori, Maria; Bendall, Derek S.; Dennis, John S.; Scott, Stuart A.; Smith, Alison G.; Howe, Christopher J.

    2013-01-01

    Cyanobacteria perform photosynthesis and respiration in the thylakoid membrane, suggesting that the two processes are interlinked. However, the role of the respiratory electron transfer chain under natural environmental conditions has not been established. Through targeted gene disruption, mutants of Synechocystis sp. PCC 6803 were generated that lacked combinations of the three terminal oxidases: the thylakoid membrane-localized cytochrome c oxidase (COX) and quinol oxidase (Cyd) and the cytoplasmic membrane-localized alternative respiratory terminal oxidase. All strains demonstrated similar growth under continuous moderate or high light or 12-h moderate-light/dark square-wave cycles. However, under 12-h high-light/dark square-wave cycles, the COX/Cyd mutant displayed impaired growth and was completely photobleached after approximately 2 d. In contrast, use of sinusoidal light/dark cycles to simulate natural diurnal conditions resulted in little photobleaching, although growth was slower. Under high-light/dark square-wave cycles, the COX/Cyd mutant suffered a significant loss of photosynthetic efficiency during dark periods, a greater level of oxidative stress, and reduced glycogen degradation compared with the wild type. The mutant was susceptible to photoinhibition under pulsing but not constant light. These findings confirm a role for thylakoid-localized terminal oxidases in efficient dark respiration, reduction of oxidative stress, and accommodation of sudden light changes, demonstrating the strong selective pressure to maintain linked photosynthetic and respiratory electron chains within the thylakoid membrane. To our knowledge, this study is the first to report a phenotypic difference in growth between terminal oxidase mutants and wild-type cells and highlights the need to examine mutant phenotypes under a range of conditions. PMID:23463783

  2. Dithiocarbamates are teratogenic to developing zebrafish through inhibition of lysyl oxidase activity

    SciTech Connect

    Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette

    2010-04-15

    Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.

  3. Endoplasmic Reticulum Thiol Oxidase Deficiency Leads to Ascorbic Acid Depletion and Noncanonical Scurvy in Mice

    PubMed Central

    Zito, Ester; Hansen, Henning Gram; Yeo, Giles S.H.; Fujii, Junichi; Ron, David

    2012-01-01

    Summary Endoplasmic reticulum (ER) thiol oxidases initiate a disulfide relay to oxidatively fold secreted proteins. We found that combined loss-of-function mutations in genes encoding the ER thiol oxidases ERO1?, ERO1?, and PRDX4 compromised the extracellular matrix in mice and interfered with the intracellular maturation of procollagen. These severe abnormalities were associated with an unexpectedly modest delay in disulfide bond formation in secreted proteins but a profound, 5-fold lower procollagen 4-hydroxyproline content and enhanced cysteinyl sulfenic acid modification of ER proteins. Tissue ascorbic acid content was lower in mutant mice, and ascorbic acid supplementation improved procollagen maturation and lowered sulfenic acid content in vivo. In vitro, the presence of a sulfenic acid donor accelerated the oxidative inactivation of ascorbate by an H2O2-generating system. Compromised ER disulfide relay thus exposes protein thiols to competing oxidation to sulfenic acid, resulting in depletion of ascorbic acid, impaired procollagen proline 4-hydroxylation, and a noncanonical form of scurvy. PMID:22981861

  4. NADPH oxidases: an overview from structure to innate immunity-associated pathologies

    PubMed Central

    Panday, Arvind; Sahoo, Malaya K; Osorio, Diana; Batra, Sanjay

    2015-01-01

    Oxygen-derived free radicals, collectively termed reactive oxygen species (ROS), play important roles in immunity, cell growth, and cell signaling. In excess, however, ROS are lethal to cells, and the overproduction of these molecules leads to a myriad of devastating diseases. The key producers of ROS in many cells are the NOX family of NADPH oxidases, of which there are seven members, with various tissue distributions and activation mechanisms. NADPH oxidase is a multisubunit enzyme comprising membrane and cytosolic components, which actively communicate during the host responses to a wide variety of stimuli, including viral and bacterial infections. This enzymatic complex has been implicated in many functions ranging from host defense to cellular signaling and the regulation of gene expression. NOX deficiency might lead to immunosuppression, while the intracellular accumulation of ROS results in the inhibition of viral propagation and apoptosis. However, excess ROS production causes cellular stress, leading to various lethal diseases, including autoimmune diseases and cancer. During the later stages of injury, NOX promotes tissue repair through the induction of angiogenesis and cell proliferation. Therefore, a complete understanding of the function of NOX is important to direct the role of this enzyme towards host defense and tissue repair or increase resistance to stress in a timely and disease-specific manner. PMID:25263488

  5. Expression in Escherichia coli of the catalytic domain of human proline oxidase.

    PubMed

    Tallarita, Elena; Pollegioni, Loredano; Servi, Stefano; Molla, Gianluca

    2012-04-01

    The human PRODH gene has been shown to have unique roles in regulating cell survival and apoptotic pathways and it has been related to velocardiofacial syndrome/DiGeorge syndrome and increased susceptibility to schizophrenia. It encodes for the flavoprotein proline oxidase (PO), which catalyzes the conversion of l-proline to ?(1)-pyrroline-5-carboxylate. Despite the important physiological and medical interest in human PO, up to now only microbial homologues of PO have been expressed as recombinant protein and fully characterized. By using a bioinformatics analysis aimed at identifying the catalytic domain and the regions with a high intrinsic propensity to structural disorder, we designed deletion variants of human PO that were successfully expressed in Escherichia coli as soluble proteins in fairly high amounts (up to 10mg/L of fermentation broth). The His-tagged PO-barrelN protein was isolated as an active (the specific activity is 0.032U/mg protein), dimeric holoenzyme showing the typical spectral properties of FAD-containing flavoprotein oxidases. These results pave the way for elucidating structure-function relationships of this human flavoenzyme and clarifying the effect of the reported polymorphisms associated with disease states. PMID:22333530

  6. Ovarian dual oxidase (Duox) activity is essential for insect eggshell hardening and waterproofing.

    PubMed

    Dias, Felipe A; Gandara, Ana Caroline P; Queiroz-Barros, Fernanda G; Oliveira, Raquel L L; Sorgine, Marcos H F; Braz, Glória R C; Oliveira, Pedro L

    2013-12-01

    In insects, eggshell hardening involves cross-linking of chorion proteins via their tyrosine residues. This process is catalyzed by peroxidases at the expense of H2O2 and confers physical and biological protection to the developing embryo. Here, working with Rhodnius prolixus, the insect vector of Chagas disease, we show that an ovary dual oxidase (Duox), a NADPH oxidase, is the source of the H2O2 that supports dityrosine-mediated protein cross-linking and eggshell hardening. RNAi silencing of Duox activity decreased H2O2 generation followed by a failure in embryo development caused by a reduced resistance to water loss, which, in turn, caused embryos to dry out following oviposition. Phenotypes of Duox-silenced eggs were reversed by incubation in a water-saturated atmosphere, simultaneous silencing of the Duox and catalase genes, or H2O2 injection into the female hemocoel. Taken together, our results show that Duox-generated H2O2 fuels egg chorion hardening and that this process plays an essential role during eggshell waterproofing. PMID:24174530

  7. Role of NADPH oxidase in interleukin-4-induced monocyte chemoattractant protein-1 expression in vascular endothelium

    PubMed Central

    Lee, Won Hee; Kim, Paul H.

    2010-01-01

    Objective and design The pro-oxidative and pro-inflammatory pathways in vascular endothelium have been implicated in the development of atherosclerosis. In the present study, we investigated effect of interleukin-4 (IL-4) on monocyte chemoattractant protein-1 (MCP-1) expression in vascular endothelium and examined the role of distinct sources of reactive oxygen species (ROS) in this process. Methods and results Real-time reverse transcriptase-polymerase chain reaction and enzyme-linked immunosorbent assay showed that IL-4 significantly up-regulated mRNA and protein expression of MCP-1 in human aortic endothelial cells (HAEC) and C57BL/6 mice. A significant and dose-dependent inhibition of IL-4-induced MCP-1 expression was observed in HAEC pre-treated with antioxidants, such as pyrrolidine dithiocarbamate and epigallocatechin gallate, indicating that IL-4-induced MCP-1 expression is mediated via a ROS-dependent mechanism. Additionally, pharmacological inhibitors of NADPH oxidase (NOX) significantly attenuated IL-4-induced MCP-1 expression in HAEC. Furthermore, the disruption of the NOX gene dramatically reduced IL-4-induced MCP-1 expression in NOX knockout mice (B6.129S6-Cybbtm1Din/J). In contrast, overexpression of MCP-1 in IL-4-stimulated HAEC was not affected by inhibiting other ROS generating pathways, such as xanthine oxidase and the mitochondrial electron transport chain. Conclusions These results demonstrate that IL-4 up-regulates MCP-1 expression in vascular endothelium through NOX-mediated ROS generation. PMID:20349326

  8. Ovarian Dual Oxidase (Duox) Activity Is Essential for Insect Eggshell Hardening and Waterproofing*

    PubMed Central

    Dias, Felipe A.; Gandara, Ana Caroline P.; Queiroz-Barros, Fernanda G.; Oliveira, Raquel L. L.; Sorgine, Marcos H. F.; Braz, Glória R. C.; Oliveira, Pedro L.

    2013-01-01

    In insects, eggshell hardening involves cross-linking of chorion proteins via their tyrosine residues. This process is catalyzed by peroxidases at the expense of H2O2 and confers physical and biological protection to the developing embryo. Here, working with Rhodnius prolixus, the insect vector of Chagas disease, we show that an ovary dual oxidase (Duox), a NADPH oxidase, is the source of the H2O2 that supports dityrosine-mediated protein cross-linking and eggshell hardening. RNAi silencing of Duox activity decreased H2O2 generation followed by a failure in embryo development caused by a reduced resistance to water loss, which, in turn, caused embryos to dry out following oviposition. Phenotypes of Duox-silenced eggs were reversed by incubation in a water-saturated atmosphere, simultaneous silencing of the Duox and catalase genes, or H2O2 injection into the female hemocoel. Taken together, our results show that Duox-generated H2O2 fuels egg chorion hardening and that this process plays an essential role during eggshell waterproofing. PMID:24174530

  9. NADPH oxidases: an overview from structure to innate immunity-associated pathologies.

    PubMed

    Panday, Arvind; Sahoo, Malaya K; Osorio, Diana; Batra, Sanjay

    2015-01-01

    Oxygen-derived free radicals, collectively termed reactive oxygen species (ROS), play important roles in immunity, cell growth, and cell signaling. In excess, however, ROS are lethal to cells, and the overproduction of these molecules leads to a myriad of devastating diseases. The key producers of ROS in many cells are the NOX family of NADPH oxidases, of which there are seven members, with various tissue distributions and activation mechanisms. NADPH oxidase is a multisubunit enzyme comprising membrane and cytosolic components, which actively communicate during the host responses to a wide variety of stimuli, including viral and bacterial infections. This enzymatic complex has been implicated in many functions ranging from host defense to cellular signaling and the regulation of gene expression. NOX deficiency might lead to immunosuppression, while the intracellular accumulation of ROS results in the inhibition of viral propagation and apoptosis. However, excess ROS production causes cellular stress, leading to various lethal diseases, including autoimmune diseases and cancer. During the later stages of injury, NOX promotes tissue repair through the induction of angiogenesis and cell proliferation. Therefore, a complete understanding of the function of NOX is important to direct the role of this enzyme towards host defense and tissue repair or increase resistance to stress in a timely and disease-specific manner. PMID:25263488

  10. Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris

    SciTech Connect

    Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W. . E-mail: jim@ebs.ogi.edu

    2007-05-18

    High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an {alpha}-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10{sup 4} U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions.

  11. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

    SciTech Connect

    Long, C.M.; Rohrmann, G.F.; Merrill, G.F.

    2009-06-05

    Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

  12. In vitro import and assembly of the nucleus-encoded mitochondrial subunit III of cytochrome c oxidase (Cox3).

    PubMed

    Vázquez-Acevedo, Miriam; Rubalcava-Gracia, Diana; González-Halphen, Diego

    2014-11-01

    The cox3 gene, encoding subunit III of cytochrome c oxidase (Cox3) is in mitochondrial genomes except in chlorophycean algae, where it is localized in the nucleus. Therefore, algae like Chlamydomonas reinhardtii, Polytomella sp. and Volvox carteri, synthesize the Cox3 polypeptide in the cytosol, import it into mitochondria, and integrate it into the cytochrome c oxidase complex. In this work, we followed the in vitro internalization of the Cox3 precursor by isolated, import-competent mitochondria of Polytomella sp. In this colorless alga, the precursor Cox3 protein is synthesized with a long, cleavable, N-terminal mitochondrial targeting sequence (MTS) of 98 residues. In an import time course, a transient Cox3 intermediate was identified, suggesting that the long MTS is processed more than once. The first processing step is sensitive to the metalo-protease inhibitor 1,10-ortophenantroline, suggesting that it is probably carried out by the matrix-located Mitochondrial Processing Protease. Cox3 is readily imported through an energy-dependent import pathway and integrated into the inner mitochondrial membrane, becoming resistant to carbonate extraction. Furthermore, the imported Cox3 protein was assembled into cytochrome c oxidase, as judged by the presence of a labeled band co-migrating with complex IV in Blue Native Electrophoresis. A model for the biogenesis of Cox3 in chlorophycean algae is proposed. This is the first time that the in vitro mitochondrial import of a cytosol-synthesized Cox3 subunit is described. PMID:24561572

  13. NADPH oxidase-derived reactive oxygen species mediate decidualization of human endometrial stromal cells in response to cyclic AMP signaling.

    PubMed

    Al-Sabbagh, Marwa; Fusi, Luca; Higham, Jenny; Lee, Yun; Lei, Kaiyu; Hanyaloglu, Aylin C; Lam, Eric W-F; Christian, Mark; Brosens, Jan J

    2011-02-01

    Differentiation of human endometrial stromal cells into specialized decidual cells is critical for embryo implantation and survival of the conceptus. Initiation of this differentiation process is strictly dependent on elevated cAMP levels, but the signal intermediates that control the expression of decidual marker genes, such as prolactin (PRL) and IGFBP1, remain poorly characterized. Here we show that cAMP-dependent decidualization can be attenuated or enhanced upon treatment of primary cultures with a nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitor (diphenylen iodonium) or activator (apocynin), respectively. Time-course analysis demonstrated that cAMP enhances endogenous reactive oxygen species production, apparent after 12 h of stimulation, which coincides with a dramatic increase in decidual PRL and IGFBP1 expression. Knockdown of the Rho GTPase RAC1, which disables activation of the NADPH oxidase homologs NADPH oxidase (NOX)-1, NOX-2, and NOX-3, had no effect on PRL or IGFBP1 expression. In contrast, silencing of NOX-4, or its cofactor p22(PHOX), inhibited the expression of both decidual markers. Finally, we show that the NOX-4/p22(PHOX) complex regulates the DNA-binding activity of CCAAT/enhancer binding protein-?, a key regulator of human endometrial stromal cell differentiation. Thus, NOX-4 activation and reactive oxygen species signaling play an integral role in initiating the endometrial decidual response in preparation of pregnancy. PMID:21159852

  14. A Conserved Steroid Binding Site in Cytochrome c Oxidase

    SciTech Connect

    Qin, Ling; Mills, Denise A.; Buhrow, Leann; Hiser, Carrie; Ferguson-Miller, Shelagh

    2010-09-02

    Micromolar concentrations of the bile salt deoxycholate are shown to rescue the activity of an inactive mutant, E101A, in the K proton pathway of Rhodobacter sphaeroides cytochrome c oxidase. A crystal structure of the wild-type enzyme reveals, as predicted, deoxycholate bound with its carboxyl group at the entrance of the K path. Since cholate is a known potent inhibitor of bovine oxidase and is seen in a similar position in the bovine structure, the crystallographically defined, conserved steroid binding site could reveal a regulatory site for steroids or structurally related molecules that act on the essential K proton path.

  15. NAD(P)H oxidases and their relevance to atherosclerosis.

    PubMed

    Sorescu, D; Szöcs, K; Griendling, K K

    2001-01-01

    Studies performed during the last decade have identified NAD(P)H oxidases unique to nonphagocytic vascular cells. The reactive oxygen species released from these enzymes regulate fundamental cellular functions such as growth (hyperplastic or hypertrophic), endothelial dysfunction, migration and inflammation, which have been demonstrated to play a role in atherogenesis. Evidence from experimental animal and human studies implicate the nonphagocytic NAD(P)H oxidases in multiple aspects of atherogenesis, suggesting that these enzymes may be important determinants of the course of vascular disease. PMID:11686001

  16. Adsorption of Glucose Oxidase onto Single-Walled Carbon Nanotubes and Its Application in

    E-print Network

    Resasco, Daniel

    Adsorption of Glucose Oxidase onto Single-Walled Carbon Nanotubes and Its Application in Layer suspension-dialysis method to adsorb the redox enzyme glucose oxidase (GOX) onto single-walled carbon nano. To test this we used the enzyme glucose oxidase (GOX), which is * To whom correspondence should

  17. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.

    2014-01-01

    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of the forage and therefore not related to PPO activity. PMID:25538724

  18. Forage polyphenol oxidase and ruminant livestock nutrition.

    PubMed

    Lee, Michael R F

    2014-01-01

    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of the forage and therefore not related to PPO activity. PMID:25538724

  19. Enhanced Nitrogen Fixation in a Rhizobium etli ntrC Mutant That Overproduces the Bradyrhizobium japonicum Symbiotic Terminal Oxidase cbb3

    PubMed Central

    Soberón, Mario; López, Oswaldo; Morera, Claudia; Girard, Maria de Lourdes; Tabche, Maria Luisa; Miranda, Juan

    1999-01-01

    The ntrC gene codes for a transcriptional activator protein that modulates gene expression in response to nitrogen. The cytochrome production pattern of a Rhizobium etli ntrC mutant (CFN2012) was studied. CO difference spectral analysis of membranes showed that CFN2012 produced a terminal oxidase similar to the symbiotic terminal oxidase of bacteroids in free-living cells under aerobic conditions, with a characteristic trough at 553 nm. CFN2012 produced two c-type cytochromes with molecular masses of 27 and 32 kDa, in contrast with the wild-type strain, which produced only a 32-kDa c-type cytochrome. The expression levels of the R. etli fixNOQP operon, which codes for terminal oxidase cbb3, were not affected by the ntrC mutation. However, the production levels of the two c-type cytochromes (27 and 32 kDa) were enhanced at least eightfold when the Bradyrhizobium japonicum fixNOQP operon was expressed in CFN2012 from the nptII promoter (pMSfixc), suggesting that these proteins are subunits FixO (27 kDa) and FixP (32 kDa) of cbb3 and that CFN2012/pMSfixc overproduced this terminal oxidase. CFN2012/pMSfixc showed a significant increase in its symbiotic performance as judged by the determination of nitrogenase activities of plants inoculated with this strain, suggesting that the overproduction of cbb3 terminal oxidase correlates with an enhancement in symbiotic nitrogen fixation. PMID:10223993

  20. Enhanced nitrogen fixation in a Rhizobium etli ntrC mutant that overproduces the Bradyrhizobium japonicum symbiotic terminal oxidase cbb{sub 3}

    SciTech Connect

    Soberon, M.; Lopez, O.; Morera, C.; Girard, M.L.; Tabche, M.L.; Miranda, J.

    1999-05-01

    The ntrC gene codes for a transcriptional activator protein that modulates gene expression in response to nitrogen. The cytochrome production pattern of a Rhizobium etli ntrC mutant (CFN2012) was studied. CO difference spectral analysis of membranes showed that CFN2012 produced a terminal oxidase similar to the symbiotic terminal oxidase of bacteroids in free-living cells under aerobic conditions, with a characteristic trough at 553 nm. CFN2012 produced two c-type cytochromes with molecular masses of 27 and 32 kDa in contrast with the wild-type strain, which produced only a 32-kDa c-tye cytochrome. The expression levels of the R. etli fix/NOQP operon, which codes for terminal oxidase cbb{sub 3}, were not affected by the ntrC mutation. However, the production levels of the two c-type cytochromes (27 and 32 kDa) were enhanced at least eightfold when the Bradyrhizobium japonicum fixNOQP operon was expressed in CFN2012 from the nptII promoter (pMSfix{sup c}), suggesting that these proteins are subunits FixO (27 kDa) and FixP (32 kDa) of cbb{sub 3} and that CFN2012/pMSfix{sup c} overproduced this terminal oxidase. CFN2012/pMSfix{sup c} showed a significant increase in its symbiotic performance as judged by the determination of nitrogenase activities of plants inoculated with this strain, suggesting that the overproduction of cbb{sub 3} terminal oxidase correlates with an enhancement in symbiotic nitrogen fixation.

  1. Host-Directed Evolution of a Novel Lactate Oxidase in Streptococcus iniae Isolates from Barramundi (Lates calcarifer)?

    PubMed Central

    Nawawi, Roslina A.; Baiano, Justice C. F.; Kvennefors, E. Charlotte E.; Barnes, Andrew C.

    2009-01-01

    In Streptococcus iniae, lactate metabolism is dependent upon two proteins, lactate permease that mediates uptake and lactate oxidase, a flavin mononucleotide-dependent enzyme that catalyzes oxidation of ?-hydroxyacids. A novel variant of the lactate oxidase gene, lctO, in Australian isolates of S. iniae from diseased barramundi was found during a diagnostic screen using LOX-1 and LOX-2 primers, yielding amplicons of 920 bp instead of the expected 869 bp. Sequencing of the novel gene variant (type 2) revealed a 51-nucleotide insertion in lctO, resulting in a 17-amino-acid repeat in the gene product, and three-dimensional modeling indicated formation of an extra loop in the monomeric protein structure. The activities of the lactate oxidase enzyme variants expressed in Escherichia coli were examined, indicating that the higher-molecular-weight type 2 enzyme exhibited higher activity. Growth rates of S. iniae expressing the novel type 2 enzyme were not reduced at lactate concentrations of 0.3% and 0.5%, whereas a strain expressing the type 1 enzyme exhibited reduced growth rates at these lactate concentrations. During a retrospective screen of 105 isolates of S. iniae from Australia, the United States, Canada, Israel, Réunion Island, and Thailand, the type 2 variant arose only in isolates from a single marine farm with unusually high tidal flow in the Northern Territory, Australia. Elevated plasma lactate levels in the fish, resulting from the effort of swimming in tidal flows of up to 3 knots, may exert sufficient selective pressure to maintain the novel, high-molecular-weight enzyme variant. PMID:19270123

  2. Host-directed evolution of a novel lactate oxidase in Streptococcus iniae isolates from barramundi (Lates calcarifer).

    PubMed

    Nawawi, Roslina A; Baiano, Justice C F; Kvennefors, E Charlotte E; Barnes, Andrew C

    2009-05-01

    In Streptococcus iniae, lactate metabolism is dependent upon two proteins, lactate permease that mediates uptake and lactate oxidase, a flavin mononucleotide-dependent enzyme that catalyzes oxidation of alpha-hydroxyacids. A novel variant of the lactate oxidase gene, lctO, in Australian isolates of S. iniae from diseased barramundi was found during a diagnostic screen using LOX-1 and LOX-2 primers, yielding amplicons of 920 bp instead of the expected 869 bp. Sequencing of the novel gene variant (type 2) revealed a 51-nucleotide insertion in lctO, resulting in a 17-amino-acid repeat in the gene product, and three-dimensional modeling indicated formation of an extra loop in the monomeric protein structure. The activities of the lactate oxidase enzyme variants expressed in Escherichia coli were examined, indicating that the higher-molecular-weight type 2 enzyme exhibited higher activity. Growth rates of S. iniae expressing the novel type 2 enzyme were not reduced at lactate concentrations of 0.3% and 0.5%, whereas a strain expressing the type 1 enzyme exhibited reduced growth rates at these lactate concentrations. During a retrospective screen of 105 isolates of S. iniae from Australia, the United States, Canada, Israel, Réunion Island, and Thailand, the type 2 variant arose only in isolates from a single marine farm with unusually high tidal flow in the Northern Territory, Australia. Elevated plasma lactate levels in the fish, resulting from the effort of swimming in tidal flows of up to 3 knots, may exert sufficient selective pressure to maintain the novel, high-molecular-weight enzyme variant. PMID:19270123

  3. Association study between schizophrenia and monoamine oxidase A and B DNA polymorphisms.

    PubMed

    Coron, B; Campion, D; Thibaut, F; Dollfus, S; Preterre, P; Langlois, S; Vasse, T; Moreau, V; Martin, C; Charbonnier, F; Laurent, C; Mallet, J; Petit, M; Frebourg, T

    1996-06-01

    Monoamine oxidases (MAO) A and B, which are encoded by two distinct genes located on the human X chromosome, are both involved in the oxidative metabolism of dopamine. Decreased levels of platelet MAO-B activity has been reported in patients with schizophrenia and genetic variation in MAO activity had been proposed as a significant factor in the etiology of this disease. We carried out an association study using two intragenic polymorphisms within the MAO-A and MAO-B genes in 110 schizophrenic patients and 87 control subjects. For each polymorphic marker, no significant difference in allelic frequencies was observed between patients and controls. Nevertheless, a trend toward an association between allele 1 of the MAO-B gene and paranoid schizophrenia was found. Our results do not support the hypothesis that inherited variants of MAO genes might play a major role in a genetic predisposition to schizophrenia. Since several previous reports found a low MAO-B platelet activity in patients with paranoid schizophrenia, the identification of polymorphisms related to enzyme activity would be useful. PMID:8804132

  4. cDNA sequences of variant forms of human placenta diamine oxidase

    SciTech Connect

    Zhang, X.; Kim, J.; McIntire, S.

    1995-08-01

    Genes for two forms of human placenta diamine oxidase (dao) were cloned from a cDNA library and sequenced. One gene, pdao1, is identical in length to human kidney dao but differs from it by two bases in the coding region and differs slightly in the 3{prime} - and 5{prime}-noncoding regions. The second gene, pdao2, is nearly identical to these genes in the coding region, except that it has an extra 57-nucleotide coding segment near the 3{prime} end of this region. This segment corresponds to the contiguous sequence of the 3{prime} end of intron 3 of human kidney dao. pdao2 also differs significantly from pdao1 and human kidney dao in a 13-base sequence in the t{prime}-noncoding region. It is proposed that pdao1 and human kidney dao are polymorphic forms of the same allele. Whether pdao2 is a polymorph of these two is not certain, because of the significant differences in the coding and noncoding regions. pdao2 may represent a different allele. 21 refs., 2 figs.

  5. Preliminary evidence for a link between schizophrenia and NMDA-glycine site receptor ligand metabolic enzymes, d-amino acid oxidase (DAAO) and kynurenine aminotransferase-1 (KAT-1).

    PubMed

    Kapoor, Ranjna; Lim, Kelly S Y; Cheng, Alice; Garrick, Therese; Kapoor, Vimal

    2006-08-23

    Preliminary investigations, studying gene expression and biochemical activities of enzymes d-amino acid oxidase (DAAO) and kynurenine aminotransferase-1 (KAT-1), revealed elevated cerebellar KAT-1 and DAAO activities in post-mortem brain samples from schizophrenic versus normal individuals. In addition, we have identified a transcript of DAAO, which was expressed in significantly higher quantities in the diseased cerebellum but not detected in the parietal cortex where DAAO activity is absent. PMID:16828464

  6. Diiron centre mutations in Ciona intestinalis alternative oxidase abolish enzymatic activity and prevent rescue of cytochrome oxidase deficiency in flies

    PubMed Central

    Andjelkovi?, Ana; Oliveira, Marcos T.; Cannino, Giuseppe; Yalgin, Cagri; Dhandapani, Praveen K.; Dufour, Eric; Rustin, Pierre; Szibor, Marten; Jacobs, Howard T.

    2015-01-01

    The mitochondrial alternative oxidase, AOX, carries out the non proton-motive re-oxidation of ubiquinol by oxygen in lower eukaryotes, plants and some animals. Here we created a modified version of AOX from Ciona instestinalis, carrying mutations at conserved residues predicted to be required for chelation of the diiron prosthetic group. The modified protein was stably expressed in mammalian cells or flies, but lacked enzymatic activity and was unable to rescue the phenotypes of flies knocked down for a subunit of cytochrome oxidase. The mutated AOX transgene is thus a potentially useful tool in studies of the physiological effects of AOX expression. PMID:26672986

  7. Mam33 promotes cytochrome c oxidase subunit I translation in Saccharomyces cerevisiae mitochondria

    PubMed Central

    Roloff, Gabrielle A.; Henry, Michael F.

    2015-01-01

    Three mitochondrial DNA–encoded proteins, Cox1, Cox2, and Cox3, comprise the core of the cytochrome c oxidase complex. Gene-specific translational activators ensure that these respiratory chain subunits are synthesized at the correct location and in stoichiometric ratios to prevent unassembled protein products from generating free oxygen radicals. In the yeast Saccharomyces cerevisiae, the nuclear-encoded proteins Mss51 and Pet309 specifically activate mitochondrial translation of the largest subunit, Cox1. Here we report that Mam33 is a third COX1 translational activator in yeast mitochondria. Mam33 is required for cells to adapt efficiently from fermentation to respiration. In the absence of Mam33, Cox1 translation is impaired, and cells poorly adapt to respiratory conditions because they lack basal fermentative levels of Cox1. PMID:26108620

  8. The effects of molybate, tungstate and lxd on aldehyde oxidase and xanthine dehydrogenase in Drosophila melanogaster.

    PubMed

    Bentley, M M; Williamson, J H; Oliver, M J

    1981-01-01

    The effects of dietary sodium molybdate and sodium tungstate on eye color and aldehyde oxidase and xanthine dehydrogenase activities have been determined in Drosophila melanogaster. Dietary sodium tungstate administration has been used as a screening procedure to identify two new lxd alleles. Tungstate administration results in increased frequencies of "brown-eyed" flies in lxd stocks and a coordinate decrease in AO and XDH activities in all genotypes tested. The two new lxd alleles affect AO and XDH in a qualitatively but not quantitatively similar fashion to the original lxd allele. AO and XDH activity and AO-CRM levels appear much more sensitive to mutational perturbations of this gene-enzyme than do XDH-CRM levels in the genotypes tested. PMID:6804069

  9. Regulation of cytochrome c oxidase activity by c-Src in osteoclasts

    PubMed Central

    Miyazaki, Tsuyoshi; Neff, Lynn; Tanaka, Sakae; Horne, William C.; Baron, Roland

    2003-01-01

    The function of the nonreceptor tyrosine kinase c-Src as a plasma membrane–associated molecular effector of a variety of extracellular stimuli is well known. Here, we show that c-Src is also present within mitochondria, where it phosphorylates cytochrome c oxidase (Cox). Deleting the c-src gene reduces Cox activity, and this inhibitory effect is restored by expressing exogenous c-Src. Furthermore, reducing endogenous Src kinase activity down-regulates Cox activity, whereas activating Src has the opposite effect. Src-induced Cox activity is required for normal function of cells that require high levels of ATP, such as mitochondria-rich osteoclasts. The peptide hormone calcitonin, which inhibits osteoclast function, also down-regulates Cox activity. Increasing Src kinase activity prevented the inhibitory effect of calcitonin on Cox activity and osteoclast function. These results suggest that c-Src plays a previously unrecognized role in maintaining cellular energy stores by activating Cox in mitochondria. PMID:12615910

  10. Ultra-high-throughput screening method for the directed evolution of glucose oxidase.

    PubMed

    Ostafe, Raluca; Prodanovic, Radivoje; Nazor, Jovana; Fischer, Rainer

    2014-03-20

    Glucose oxidase (GOx) is used in many industrial processes that could benefit from improved versions of the enzyme. Some improvements like higher activity under physiological conditions and thermal stability could be useful for GOx applications in biosensors and biofuel cells. Directed evolution is one of the currently available methods to engineer improved GOx variants. Here, we describe an ultra-high-throughput screening system for sorting the best enzyme variants generated by directed evolution that incorporates several methodological refinements: flow cytometry, in vitro compartmentalization, yeast surface display, fluorescent labeling of the expressed enzyme, delivery of glucose substrate to the reaction mixture through the oil phase, and covalent labeling of the cells with fluorescein-tyramide. The method enables quantitative screening of gene libraries to identify clones with improved activity and it also allows cells to be selected based not only on the overall activity but also on the specific activity of the enzyme. PMID:24613019

  11. Rv2607 from Mycobacterium tuberculosis Is a Pyridoxine 5?-Phosphate Oxidase with Unusual Substrate Specificity

    PubMed Central

    Mashalidis, Ellene H.; Mukherjee, Tathagata; ?led?, Pawe?; Matak-Vinkovi?, Dijana; Boshoff, Helena; Abell, Chris; Barry, Clifton E.

    2011-01-01

    Despite intensive effort, the majority of the annotated Mycobacterium tuberculosis genome consists of genes encoding proteins of unknown or poorly understood function. For example, there are seven conserved hypothetical proteins annotated as homologs of pyridoxine 5?-phosphate oxidase (PNPOx), an enzyme that oxidizes pyridoxine 5?-phosphate (PNP) or pyridoxamine 5?-phosphate (PMP) to form pyridoxal 5?-phosphate (PLP). We have characterized the function of Rv2607 from Mycobacterium tuberculosis H37Rv and shown that it encodes a PNPOx that oxidizes PNP to PLP. The kcat and KM for this reaction were 0.01 s?1 and 360 µM, respectively. Unlike many PNPOx enzymes, Rv2607 does not recognize PMP as a substrate. PMID:22110704

  12. Inhibition of arsenic induced-rat liver injury by grape seed exact through suppression of NADPH oxidase and TGF-{beta}/Smad activation

    SciTech Connect

    Pan Xinjuan; Dai Yujie; Li Xing; Niu Nannan; Li Wenjie; Liu Fangli; Zhao Yang; Yu Zengli

    2011-08-01

    Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3 phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. > GSE reduced arsenic-mediated Smad2/3 phosphorylation and NADPH oxidase subunits (Nox2, Nox4 and p47phox). > Beneficial effects of GSE on As-induced liver injury was via inhibition of NADPH oxidase and TGF-{beta}/Smad activation.

  13. Limitations of cytochrome oxidase I for the barcoding of Neritidae (Mollusca: Gastropoda) as revealed by Bayesian analysis.

    PubMed

    Chee, S Y

    2015-01-01

    The mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) gene has been universally and successfully utilized as a barcoding gene, mainly because it can be amplified easily, applied across a wide range of taxa, and results can be obtained cheaply and quickly. However, in rare cases, the gene can fail to distinguish between species, particularly when exposed to highly sensitive methods of data analysis, such as the Bayesian method, or when taxa have undergone introgressive hybridization, over-splitting, or incomplete lineage sorting. Such cases require the use of alternative markers, and nuclear DNA markers are commonly used. In this study, a dendrogram produced by Bayesian analysis of an mtDNA COI dataset was compared with that of a nuclear DNA ATPS-? dataset, in order to evaluate the efficiency of COI in barcoding Malaysian nerites (Neritidae). In the COI dendrogram, most of the species were in individual clusters, except for two species: Nerita chamaeleon and N. histrio. These two species were placed in the same subcluster, whereas in the ATPS-? dendrogram they were in their own subclusters. Analysis of the ATPS-? gene also placed the two genera of nerites (Nerita and Neritina) in separate clusters, whereas COI gene analysis placed both genera in the same cluster. Therefore, in the case of the Neritidae, the ATPS-? gene is a better barcoding gene than the COI gene. PMID:26125766

  14. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens (Ara h 1 and Ara h 2). Because high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts were treated with each of th...

  15. Detection of peroxisomal fatty acyl-coenzyme A oxidase activity.

    PubMed Central

    Inestrosa, N C; Bronfman, M; Leighton, F

    1979-01-01

    It has been postulated that the peroxisomal fatty acid-oxidizing system [Lazarow & de Duve (1976) Proc. Natl. Acad. Sci. U.S.A. 73, 2043--2046; Lazarow (1978) J. Biol. Chem. 253, 1522--1528] resembles that of mitochondria, except for the first oxidative reaction. In this step, O2 would be directly reduced to H2O2 by an oxidase. Two specific procedures developed to detect the activity of the characteristic enzyme fatty acyl-CoA oxidase are presented, namely polarographic detection of palmitoyl-CoA-dependent cyanide-insensitive O2 consumption and palmitoyl-CoA-dependent H2O2 generation coupled to the peroxidation of methanol in an antimycin A-insensitive reaction. Fatty acyl-CoA oxidase activity is stimulated by FAD, which supports the flavoprotein nature postulated for this enzyme. Its activity increases 7-fold per g wet wt. of liver in rats treated with nafenopin, a hypolipidaemic drug. Subcellular fractionation of livers from normal and nafenopin-treated animals provides evidence for its peroxisomal localization. The stoicheiometry for palmitoyl-CoA-dependent O2 consumption, H2O2 generation and NAD+ reduction is 1 : 1 : 1. This suggests that fatty acyl-CoA oxidase is the rate-limiting enzyme of the peroxisomal fatty acid-oxidizing system. PMID:518563

  16. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catecholase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and oth...

  17. Studies on the mechanism of D-amino acid oxidase 

    E-print Network

    Kurtz, Kevin Anthony

    2000-01-01

    The mechanism of D-amino acid oxidase has been examined using nitroalkane anions, viscosity effects, mutant proteins, and ¹?N kinetic isotope effects. From the studies on the effects of pH on the V/K[] values for the ...

  18. Molybdopterin in carbon monoxide oxidase from carboxydotrophic bacteria.

    PubMed

    Meyer, O; Rajagopalan, K V

    1984-02-01

    The carbon monoxide oxidases (COXs) purified from the carboxydotrophic bacteria Pseudomonas carboxydohydrogena and Pseudomonas carboxydoflava were found to be molybdenum hydroxylases, identical in cofactor composition and spectral properties to the recently characterized enzyme from Pseudomonas carboxydovorans (O. Meyer, J. Biol. Chem. 257:1333-1341, 1982). All three enzymes exhibited a cofactor composition of two flavin adenine dinucleotides, two molybdenums, eight irons and eight labile sulfides per dimeric molecule, typical for molybdenum-containing iron-sulfur flavoproteins. The millimolar extinction coefficient of the COXs at 450 nm was 72 (per two flavin adenine dinucleotides), a value similar to that of milk xanthine oxidase and chicken liver xanthine dehydrogenase at 450 nm. That molybdopterin, the novel prosthetic group of the molybdenum cofactor of a variety of molybdoenzymes (J. Johnson and K. V. Rajagopalan, Proc. Natl. Acad. Sci. U.S.A. 79:6856-6860, 1982) is also a constituent of COXs from carboxydotrophic bacteria is indicated by the formation of identical fluorescent cofactor derivatives, by complementation of the nitrate reductase activity in extracts of Neurospora crassa nit-l, and by the presence of organic phosphate additional to flavin adenine dinucleotides. Molybdopterin is tightly but noncovalently bound to the protein. COX, sulfite oxidase, xanthine oxidase, and xanthine dehydrogenase each contains 2 mol of molybdopterin per mol of enzyme. The presence of a trichloroacetic acid-releasable, so-far-unidentified, phosphorous-containing moiety in COX is suggested by the results of phosphate analysis. PMID:6582059

  19. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  20. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  1. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  2. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  3. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  4. WHEAT FLOUR PROTEINS AS AFFECTED BY TRANSGLUTAMINASE AND GLUCOSE OXIDASE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzymes are good tools to modify wheat proteins by creating new bonds between the protein chains. In this study, the effect of the addition of glucose oxidase (GO) and transglutaminase (TG) on the wheat flour proteins is presented. The modification of wheat proteins was determined by analyzing the...

  5. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.

    PubMed

    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie

    2015-09-01

    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols. PMID:26305170

  6. Effect of mitoguazone on polyamine oxidase activity in rat liver

    SciTech Connect

    Ferioli, Maria Elena . E-mail: MariaElena.Ferioli@unimi.it; Berselli, Debora; Caimi, Samuela

    2004-12-01

    Mitoguazone is a known inhibitor of polyamine biosynthesis through competitive inhibition of S-adenosylmethionine decarboxylase. A recent renewed interest in mitoguazone as an antineoplastic agent prompted us to investigate the effect of the drug on polyamine catabolism in rat liver, since the organ plays an important role in detoxification mechanisms. Thus, the purpose of this work was to evaluate the effect of in vivo mitoguazone administration on polyamine catabolic enzymes. In particular, our interest was directed to the changes in polyamine oxidase activity, since this enzyme has been recently confirmed to exert important functions that until now were underestimated. Mitoguazone administration induced hepatic polyamine oxidase activity starting at 4 h after administration, and the enzyme returned to basal levels 96 h after treatment. The changes in enzyme activity were accompanied by changes in putrescine concentrations, which increased starting at 4 h until 72 h after treatment. We also evaluated the activity of the newly identified spermine oxidase, which was not significantly changed by mitoguazone treatment. Therefore, we hypothesized that the enzyme involved in mitoguazone response of the liver is the polyamine oxidase, which acts on acetylated polyamines as substrate.

  7. Structural Changes and Proton Transfer in Cytochrome c Oxidase

    PubMed Central

    Vilhjálmsdóttir, Jóhanna; Johansson, Ann-Louise; Brzezinski, Peter

    2015-01-01

    In cytochrome c oxidase electron transfer from cytochrome c to O2 is linked to transmembrane proton pumping, which contributes to maintaining a proton electrochemical gradient across the membrane. The mechanism by which cytochrome c oxidase couples the exergonic electron transfer to the endergonic proton translocation is not known, but it presumably involves local structural changes that control the alternating proton access to the two sides of the membrane. Such redox-induced structural changes have been observed in X-ray crystallographic studies at residues 423–425 (in the R. sphaeroides oxidase), located near heme a. The aim of the present study is to investigate the functional effects of these structural changes on reaction steps associated with proton pumping. Residue Ser425 was modified using site-directed mutagenesis and time-resolved spectroscopy was used to investigate coupled electron-proton transfer upon reaction of the oxidase with O2. The data indicate that the structural change at position 425 propagates to the D proton pathway, which suggests a link between redox changes at heme a and modulation of intramolecular proton-transfer rates. PMID:26310633

  8. Molecular dynamics in cytochrome c oxidase Moessbauer spectra deconvolution

    SciTech Connect

    Bossis, Fabrizio; Palese, Luigi L.

    2011-01-07

    Research highlights: {yields} Cytochrome c oxidase molecular dynamics serve to predict Moessbauer lineshape widths. {yields} Half height widths are used in modeling of Lorentzian doublets. {yields} Such spectral deconvolutions are useful in detecting the enzyme intermediates. -- Abstract: In this work low temperature molecular dynamics simulations of cytochrome c oxidase are used to predict an experimentally observable, namely Moessbauer spectra width. Predicted lineshapes are used to model Lorentzian doublets, with which published cytochrome c oxidase Moessbauer spectra were simulated. Molecular dynamics imposed constraints to spectral lineshapes permit to obtain useful information, like the presence of multiple chemical species in the binuclear center of cytochrome c oxidase. Moreover, a benchmark of quality for molecular dynamic simulations can be obtained. Despite the overwhelming importance of dynamics in electron-proton transfer systems, limited work has been devoted to unravel how much realistic are molecular dynamics simulations results. In this work, molecular dynamics based predictions are found to be in good agreement with published experimental spectra, showing that we can confidently rely on actual simulations. Molecular dynamics based deconvolution of Moessbauer spectra will lead to a renewed interest for application of this approach in bioenergetics.

  9. Polyphenol oxidase activity in co-ensiled temperate grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) and its o-diphenol substrates have been shown to effectively decrease proteolytic activity during the ensiling of forages such as red clover. Orchardgrass and smooth bromegrass both contain high levels of PPO activity, but lack appropriate levels of o-diphenols to adequately...

  10. The glucose oxidase-peroxidase assay for glucose

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The glucose oxidase-peroxidase assay for glucose has served as a very specific, sensitive, and repeatable assay for detection of glucose in biological samples. It has been used successfully for analysis of glucose in samples from blood and urine, to analysis of glucose released from starch or glycog...

  11. The subunit composition of mammalian cytochrome c oxidase.

    PubMed

    Merle, P; Kadenbach, B

    1980-04-01

    Cytochrome c oxidase from rat liver mitochondria was separated into 12 different protein subunits by application of a highly resolving sodium dodecylsulfate/gel electrophoretic system of different compositions. The 12 protein subunits are shown to represent integral components of mammalian type cytochrome c oxidase for the following reasons. 1. All 12 subunits copurify through various purification procedures. 2. The subunit composition of the isolated enzyme is identical to that of the immunoprecipitated one. 3. All 12 subunits are present in the complex at one to one stoichiometric amounts. 4. A similar composition of 12 subunits was also found for cytochrome c oxidase from rat kidney, pig heart, rabbit liver and stone-marten liver. The difference between our results and all other published data on the subunit composition of mammalian-type cytochrome c oxidase, based on gel electrophoretic analysis, is due to the insufficient resolving power of previously used gel systems and the very similar molecular weight of subunits VIa, b, c, and VIIa, b, c. PMID:6245883

  12. BRAINA JOURNAL OF NEUROLOGY NADPH oxidase expression in active multiple

    E-print Network

    Hayar, Abdallah

    BRAINA JOURNAL OF NEUROLOGY NADPH oxidase expression in active multiple sclerosis lesions.lassmann@meduniwien.ac.at Multiple sclerosis is a chronic inflammatory disease of the central nervous system, associated damage of oligodendrocytes and dystrophic axons in early stages of active multiple sclerosis lesions

  13. Purification of gibberellin sub 53 -oxidase from spinach

    SciTech Connect

    Wilson, T.M.; Zeevaart, J.A.D. )

    1989-04-01

    Spinach is a long-day rosette plants, in which stem growth is mediated by gibberellins. It has been shown that two enzymatic steps, GA{sub 53}-oxidase and GA{sub 19}-oxidase, are controlled by light. To develop an understanding into this light regulation, purification of GA{sub 53}-oxidase has been undertaken. The original assay relied on the HPLC separation of the product and substrate, but was considered too slow for the development of a purification scheme. A TLC system was developed which in conjunction with improvements to the assay conditions was sensitive and gave rapid results. The partial purification of the GA{sub 53}-oxidase is achieved by a high speed centrifugation, 40-55% ammonium sulfate precipitation, an hydroxyapatite column, Sephadex G-100 column and an anion exchange FPLC column, Mono Q HR10/10, yielding 1000-fold purification and 15% recovery. Monoclonal antibodies to the protein will be raised and used to further characterize the enzyme.

  14. PURIFICATION AND ANALYSIS OF WHEAT GRAIN POLYPHENOL OXIDASE PROTEIN

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat breeding programs have used various whole-seed assays for estimating polyphenol oxidase (PPO)-like activity and thereby identify germplasm that has a greater chance of producing consumer products with superior color characteristics. Yet, the biochemistry underlying these assays is poorly under...

  15. Tomato polyphenol oxidase B is spatially and temporally regulated during development and in response to ethylene.

    PubMed

    Newman, Sally M; Tantasawat, Piyada; Steffens, John C

    2011-01-01

    Plant polyphenol oxidases (PPOs) are ubiquitous plastid-localized enzymes. A precise analysis of PPO function in plants has been complicated by the presence of several family members with immunological cross reactivity. Previously we reported the isolation of genomic clones coding for the seven members of the tomato (Solanum lycopersicum) PPO family (A, A', B, C, D, E, and F). Here we report the complex spatial and temporal expression of one of the members, PPO B. The PPO B promoter was sequenced and subjected to homology analysis. Sequence similarities were found to nucleotide sequences of genes encoding enzymes/proteins active in the following systems: phenylpropanoid biosynthesis, signal transduction and responsiveness to hormones and stresses, fruit and seed proteins/enzymes, and photosynthesis. Chimeric gene fusions were constructed linking PPO B 5' flanking regions to the reporter gene, b-glucuronidase (GUS). The resultant transgenic plants were histochemically analyzed for GUS activity in various vegetative and reproductive tissues, and evaluated for PPO B responsiveness to ethylene induction. It was shown that PPO B expression was tissue specific, developmentally regulated, ethylene induced, and localized predominantly to mitotic or apoptotic tissues. PMID:21224781

  16. Myoclonic epilepsy and ragged-red fibers with cytochrome oxidase deficiency: neuropathology, biochemistry, and molecular genetics.

    PubMed

    Lombes, A; Mendell, J R; Nakase, H; Barohn, R J; Bonilla, E; Zeviani, M; Yates, A J; Omerza, J; Gales, T L; Nakahara, K

    1989-07-01

    A 36-year-old man with myoclonic epilepsy and ragged-red fibers (MERRF) died after more than 18 years of follow-up study. He was 1 of 3 affected siblings and the offspring of an affected mother, suggesting maternal transmission. At autopsy, there was neuronal loss and gliosis in the dentate nucleus of the cerebellum and in the inferior olivary nucleus. Skeletal muscle showed ragged-red fibers, and paracrystalline inclusions in mitochondria by electron microscopy. Biochemical analysis showed a generalized partial defect of cytochrome c oxidase (COX) in mitochondria isolated from all tissues, including brain, heart, skeletal muscle, kidney, and liver. The Michaelis constant (Km) for cytochrome c was abnormally low, suggesting a defect of the mitochondrially encoded subunit II of COX. Immunological studies (enzyme-linked immunosorbent assay, dot-blot, Western blot, and immunohistochemistry) showed that the holoenzyme was decreased but subunit II was decreased more than the holocomplex or the nuclearly encoded subunit IV. However, Northern and Southern blots showed that the gene for subunit II, as well as the genes for subunits I, III, IV, and VIII, were of normal size and were normally transcribed. A point mutation or a small deletion of mitochondrial DNA, probably affecting the COX-II gene, may be responsible for the COX deficiency in this case of MERRF. PMID:2549843

  17. Molybdenum hydroxylases in Drosophila. II. Molybdenum cofactor in xanthine dehydrogenase, aldehyde oxidase and pyridoxal oxidase.

    PubMed

    Warner, C K; Finnerty, V

    1981-01-01

    The molybdenum hydroxylases are a ubiquitous class of enzymes which contain molybdenum in association with a low molecular weight cofactor. Genetic evidence suggests that the Drosophila loci, ma--1, cin and lxd are concerned with this cofactor because mutants for any one of these loci simultaneously interrupt activity for two molybdenum hydroxylases, XDH and A0. A third enzyme activity, P0, is also absent in each of the three mutants but evidence classifying P0 as a molybdoenzyme has been lacking. This study utilizes the known tungsten sensitivity of molybdoenzymes to demonstrate directly that pyridoxal oxidase is also molybdoenzyme. The low molecular weight molybdenum cofactor is found to be severely reduced in extracts of the 1xd and cin mutants but ma--1 mutants have high levels of cofactor. A partially purified preparation of XDH crossreacting material from ma--1 was also shown to contain the molybdenum cofactor. These results, considered with data from other workers are taken to indicate that the functions of all three of the loci examined could be concerned with some aspect of cofactor biosynthesis. PMID:6950197

  18. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Sty?a, K.; Szajdak, L.

    2009-04-01

    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Pozna?, West Polish Lowland). The sites of investigation were located along Wysko? ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at ?max=525 nm with catechol as substrate by method of Perucci et al. (2000). In peat the highest activities of phenol oxidase was observed in the combinations marked as Shelterbelt and whereas the lowest - in Zbechy, Bridge and Hirudo. Activities of this enzyme in peat ranged from 15.35 to 38.33 ?mol h-1g d.m soil. Increased activities of phenol oxidase have been recorded on the depth 50-100cm - catotelm (21.74-38.33 ?mol h-1g d.m soil) in comparison with the depth 0-50cm - acrotelm (15.35-28.32 ?mol h-1g d.m soil). References Freeman, C., Ostle N.J., Fener, N., Kang H. 2004. A regulatory role for phenol oxidase during decomposition in peatlands. Soil Biology and Biochemistry, 36, 1663-1667. Matocha Ch.J., Haszler G.R., Grove J.H. 2004. Nitrogen fertilization suppresses soil phenol oxidase enzyme activity in no-tillage systems. Soil Science, 169/10, 708-714. Perucci P., Casucci C., Dumontet S. 2000. An improved method to evaluate the o-diphenol oxidase activity of soil. Soil Biology and Biochemistry, 32, 1927-1933. Sokolowska Z., Szajdak L., Matyka-Sarzy?ska D. 2005. Impact of the degree of secondary transformation on amid-base properties of organic compounds in mucks. Geoderma, 127, 80-90. Szajdak L., Szczepa?ski M., Bogacz A. 2007. Impact of secondary transformation of peat-moorsh soils on the decrease of nitrogen and carbon compounds in ground water. Agronomy Research, 5/2, 189-200.

  19. Differential accumulation of transcripts for ACC synthase and ACC oxidase homologs in etiolated mung bean hypocotyls in response to various stimuli.

    PubMed

    Yu, S J; Kim, S; Lee, J S; Lee, D H

    1998-06-30

    Ethylene can be produced by a variety of developmental and environmental factors such as ripening, the plant hormone auxin, and mechanical wounding via a biosynthetic pathway including AdoMet synthase, ACC synthase, and ACC oxidase steps. ACC synthase and ACC oxidase are known to be encoded by multigene families, and are believed to be differentially expressed in response to various stimuli. In mung bean, ACC synthase is encoded by 7 genes, ACS1, ACS2 ACS3, ACS4, ACS5, ACS6, and ACS7, and ACC oxidase by 2 genes, ACO1 and ACO2. In this study, was have investigated differential accumulation of transcripts for ACC synthase and ACC oxidase homologs in etiolated mung bean hypocotyls under various conditions by the semiquantitative RT-PCR method. Primers which can specifically bind and amplify each cDNAs of ACS1, ACS2, ACS3, ACS4, ACS5, ACS6, ACS7, and ACO1, and ACO2 were designed and used to monitor the responses to various stimuli. Transcripts of ACO1 and ACO2 were accumulated constitutively in the hypocotyl segments even without andy treatment. After cold treatment on intact plant, transcripts of ACS5, ACS6, and ACS7 were accumulated in the hypocotyl segments. We also found the excision of hypocotyl segments and incubation in a buffer solution, a typical way of chemical treatments to hypocotyl segments, lowered the level of ACO2 transcripts with little change of the level of ACO1 transcripts. In response to incubation with IAA (0.1 mM) of excised hypocotyl segments, transcripts of ACS1, ACS6, and ACS7 were accumulated and the level of ACO2 transcripts was increased. Transcripts of ACS1, ACS2, ACS3, ACS5, ACS6 and ACS7 were induced by incubation with OGA (50 micrograms/ml), while the transcripts of ACS4 were accumulated and the level of ACO2 transcripts was increased by incubation with 1 mM LiCl. Our results strongly suggest that all seven ACC synthase genes and two ACC oxidase genes must be active and each gene is differentially regulated by a different subset of the inducing factors. PMID:9666474

  20. Eggplant polyphenol oxidase multigene family: cloning, phylogeny, expression analyses and immunolocalization in response to wounding.

    PubMed

    Shetty, Santoshkumar M; Chandrashekar, Arun; Venkatesh, Yeldur P

    2011-12-01

    Though polyphenol oxidase (PPO) genes from tomato and potato have been extensively studied, information about PPO genes in eggplant (Solanum melongena) is lacking. The main objective of this study is to understand the structural and functional aspects of eggplant PPO genes. Six eggplant PPO genes (SmePPO1-6) cloned by RACE and genome walking were found to be intronless and correspond to eight eggplant unigenes. Comprehensive sequence analyses indicated that the eggplant PPO genes exhibit considerable variation in the transit peptide regions, copper-binding domains and UTRs, and fall into two distinct structural classes. Further, PPO gene members appear to exist in clusters on eggplant chromosome 8 as seen in the case of tomato and potato PPOs. During normal growth and development, SmePPO1 and 2 are expressed in roots, whereas the transcript levels of all the eggplant PPO genes vary considerably in leaves, flowers and fruits. SmePPO1 was expressed in Escherichia coli as a GST fusion protein, and immunoblot using rabbit polyclonal antiserum to GST-SmePPO1 detected a major protein band (~70 kDa) and a minor band (~67 kDa) in eggplant fruit extract. Tissue printing indicated the predominant presence of PPO in the exocarp and the areas surrounding the seeds in the mesocarp of eggplant fruits. Immunolocalization of PPOs in eggplant infested with shoot-and-fruit borer revealed localization of the PPO at the site of infection in tender shoots and fruits, and further inside the mature tissues. The upregulation of eggplant PPO gene transcripts following mechanical injury shows that all the genes except SmePPO2 are induced in the fruit over 6h. On the contrary, the transcripts of SmePPO2 and PPO3 are not detectable in the stem, and expression seems to be prominent over a 2h period for SmePPO1 and SmePPO4-6. Our results show that eggplant PPO genes are structurally different, and are differentially expressed in various tissues of eggplant indicating their functional diversity. PMID:21945722

  1. Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase

    PubMed Central

    Shao, Beili; Bayraktutan, Ulvi

    2014-01-01

    Blood–brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2•- generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2•- by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2•- production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase. PMID:24936444

  2. Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase.

    PubMed

    Shao, Beili; Bayraktutan, Ulvi

    2014-01-01

    Blood-brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2 (•-) generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2 (•-) by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2 (•-) production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase. PMID:24936444

  3. Inhibition of arsenic-induced rat liver injury by grape seed exact through suppression of NADPH oxidase and TGF-?/Smad activation.

    PubMed

    Pan, Xinjuan; Dai, Yujie; Li, Xing; Niu, Nannan; Li, Wenjie; Liu, Fangli; Zhao, Yang; Yu, Zengli

    2011-08-01

    Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30ppm) with or without GSE (100mg/kg, every other day by oral gavage) for 12months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3 phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-?1, type I procollagen (Coll-I) and ?-smooth muscle actin (?-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-?1-induced transactivation of the TGF-?-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-?1-induced mRNA expression of Coll-I and ?-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-?/Smad activation. PMID:21605584

  4. Salivary Glucose Oxidase from Caterpillars Mediates the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant

    PubMed Central

    Tian, Donglan; Peiffer, Michelle; Shoemaker, Erica; Tooker, John; Haubruge, Eric; Francis, Frederic; Luthe, Dawn S.; Felton, Gary W.

    2012-01-01

    Caterpillars produce oral secretions that may serve as cues to elicit plant defenses, but in other cases these secretions have been shown to suppress plant defenses. Ongoing work in our laboratory has focused on the salivary secretions of the tomato fruitworm, Helicoverpa zea. In previous studies we have shown that saliva and its principal component glucose oxidase acts as an effector by suppressing defenses in tobacco. In this current study, we report that saliva elicits a burst of jasmonic acid (JA) and the induction of late responding defense genes such as proteinase inhibitor 2 (Pin2). Transcripts encoding early response genes associated with the JA pathway were not affected by saliva. We also observed a delayed response to saliva with increased densities of Type VI glandular trichomes in newly emerged leaves. Proteomic analysis of saliva revealed glucose oxidase (GOX) was the most abundant protein identified and we confirmed that it plays a primary role in the induction of defenses in tomato. These results suggest that the recognition of GOX in tomato may represent a case for effector-triggered immunity. Examination of saliva from other caterpillar species indicates that saliva from the noctuids Spodoptera exigua and Heliothis virescens also induced Pin2 transcripts. PMID:22558369

  5. Defects in cytochrome c oxidase expression induce a metabolic shift to glycolysis and carcinogenesis

    PubMed Central

    Dong, Dawei W.; Srinivasan, Satish; Guha, Manti; Avadhani, Narayan G.

    2015-01-01

    Mitochondrial metabolic dysfunction is often seen in cancers. This paper shows that the defect in a mitochondrial electron transport component, the cytochrome c oxidase (CcO), leads to increased glycolysis and carcinogenesis. Using whole genome microarray expression analysis we show that genetic silencing of the CcO subunit Cox4i1 in mouse C2C12 myoblasts resulted in metabolic shift to glycolysis, activated a retrograde stress signaling, and induced carcinogenesis. In the knockdown cells, the expression of Cox4i1 was less than 5% of the control and the expression of the irreversible glycolytic enzymes (Hk1, Pfkm and Pkm) increased two folds, facilitating metabolic shift to glycolysis. The expression of Ca2+ sensitive Calcineurin (Ppp3ca) and the expression of PI3-kinase (Pik3r4 and Pik3cb) increased by two folds. This Ca2+/Calcineurin/PI3K retrograde stress signaling induced the up-regulation of many nuclear genes involved in tumor progression. Overall, we found 1047 genes with 2-folds expression change (with p-value less than 0.01) between the knockdown and the control, among which were 35 up-regulated genes in pathways in cancer (enrichment p-value less than 10? 5). Functional analysis revealed that the up-regulated genes in pathways in cancer were dominated by genes in signal transduction, regulation of transcription and PI3K signaling pathway. These results suggest that a defect in CcO complex initiates a retrograde signaling which can induce tumor progression. Physiological studies of these cells and esophageal tumors from human patients support these results. GEO accession number = GSE68525.

  6. The role of lysyl oxidase-like 1 DNA copy number variants in exfoliation glaucoma

    PubMed Central

    Liu, Yutao; Whigham, Benjamin T.; Wheeler, Joshua; Williams, Susan E. I.; Rautenbach, Robyn M.; Ziskind, Ari; Ramsay, Michele; Carmichael, Trevor R.; Ashley-Koch, Allison E.; Allingham, R. Rand

    2012-01-01

    Purpose To investigate whether DNA copy number variants (CNVs) in the lysyl oxidase-like 1 (LOXL1) gene are associated with exfoliation glaucoma (XFG) in black South Africans. Methods Black South African subjects with XFG and age-matched unaffected controls were recruited from the St. John Eye Hospital in Soweto (Johannesburg, South Africa) and East London Hospital Complex (Eastern Cape, South Africa) using standard clinical examination techniques. A customized array comparative genomic hybridization (aCGH) from Roche NimbleGen was designed to cover a 1.5 million base genomic region centered on the LOXL1 gene on chromosome 15. Twenty selected XFG cases were examined using this custom aCGH to identify common CNVs in the LOXL1 gene. The potential DNA copy number variants identified from aCGH were further validated using TaqMan probe-based CNV real-time PCR in a data set containing 91 XFG cases and 52 controls. The frequencies of CNVs in the LOXL1 region were compared between the XFG cases and the controls using Fisher's exact test. Results Several DNA CNV variants were identified in the LOXL1 genomic region using aCGH in the selected XFG cases. However, we were unable to validate these candidate CNVs using real-time PCR-based TaqMan CNV assays. There was no significant difference in the frequency of the DNA copy number variants in the LOXL1 region between the XFG cases and the controls. Conclusions This represents the first DNA CNV study of LOXL1 in the black South African population with XFG. Our study did not identify any significant DNA copy number alterations in the genomic region containing the LOXL1 gene. This suggests that other as yet unknown causal variants of LOXL1 or variants in other genes in linkage disequilibrium with the LOXL1 locus contribute to the genetic risk of XFG in black South Africans. PMID:23288989

  7. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

    PubMed Central

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-01-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  8. NADPH oxidase-derived reactive oxygen species in cardiac pathophysiology

    PubMed Central

    Cave, Alison; Grieve, David; Johar, Sofian; Zhang, Min; Shah, Ajay M

    2005-01-01

    Chronic heart failure, secondary to left ventricular hypertrophy or myocardial infarction, is a condition with increasing morbidity and mortality. Although the mechanisms underlying the development and progression of this condition remain a subject of intense interest, there is now growing evidence that redox-sensitive pathways play an important role. This article focuses on the involvement of reactive oxygen species derived from a family of superoxide-generating enzymes, termed NADPH oxidases (NOXs), in the pathophysiology of ventricular hypertrophy, the accompanying interstitial fibrosis and subsequent heart failure. In particular, the apparent ability of the different NADPH oxidase isoforms to define the response of a cell to a range of physiological and pathophysiological stimuli is reviewed. If confirmed, these data would suggest that independently targeting different members of the NOX family may hold the potential for therapeutic intervention in the treatment of cardiac disease. PMID:16321803

  9. The nitrate reductase activity of milk xanthine oxidase.

    PubMed

    Sergeev, N S; Ananiadi, L I; L'vov, N P; Kretovich, W L

    1985-04-01

    Milk xanthine oxidase oxidizes xanthine at pH 9.6 and reduces nitrates at pH 5.2. It is shown that the nitrate reductase activity requires molybdenum and sulfur-containing sites in the enzyme, whereas oxidation of xanthine also requires iron-containing sites and FAD. As the pH changes from 5.2 to 9.6, the conformation of the enzyme molecule is modified as demonstrated by changes in the absorption, fluorescence, and circular dichroism spectra. When the enzyme is treated with dithioerythritol, it may pass from the oxidase to the dehydrogenase form with a marked increase in the nitrate reductase activity. PMID:3840469

  10. Oxygen reactivity of mammalian sulfite oxidase provides a concept for the treatment of sulfite oxidase deficiency.

    PubMed

    Belaidi, Abdel A; Röper, Juliane; Arjune, Sita; Krizowski, Sabina; Trifunovic, Aleksandra; Schwarz, Guenter

    2015-07-15

    Mammalian sulfite oxidase (SO) is a dimeric enzyme consisting of a molybdenum cofactor- (Moco) and haem-containing domain and catalyses the oxidation of toxic sulfite to sulfate. Following sulfite oxidation, electrons are passed from Moco via the haem cofactor to cytochrome c, the terminal electron acceptor. In contrast, plant SO (PSO) lacks the haem domain and electrons shuttle from Moco to molecular oxygen. Given the high similarity between plant and mammalian SO Moco domains, factors that determine the reactivity of PSO towards oxygen, remained unknown. In the present study, we generated mammalian haem-deficient and truncated SO variants and demonstrated their oxygen reactivity by hydrogen peroxide formation and oxygen-consumption studies. We found that intramolecular electron transfer between Moco and haem showed an inverse correlation to SO oxygen reactivity. Haem-deficient SO variants exhibited oxygen-dependent sulfite oxidation similar to PSO, which was confirmed further using haem-deficient human SO in a cell-based assay. This finding suggests the possibility to use oxygen-reactive SO variants in sulfite detoxification, as the loss of SO activity is causing severe neurodegeneration. Therefore we evaluated the potential use of PEG attachment (PEGylation) as a modification method for future enzyme substitution therapies using oxygen-reactive SO variants, which might use blood-dissolved oxygen as the electron acceptor. PEGylation has been shown to increase the half-life of other therapeutic proteins. PEGylation resulted in the modification of up to eight surface-exposed lysine residues of SO, an increased conformational stability and similar kinetic properties compared with wild-type SO. PMID:26171830

  11. The role of sterol-C4-methyl oxidase in epidermal biology

    PubMed Central

    He, Miao; Smith, Laurie D.; Chang, Richard; Li, Xueli; Vockley, Jerry

    2013-01-01

    Deficiency of sterol C4 methyl oxidase, encoded by the SC4MOL gene, has recently been described in four patients from three different families. All of the patients presented with microcephaly, congenital cataracts, and growth delay in infancy. The first patient has suffered since the age of six years from severe, diffuse, psoriasiform dermatitis, sparing only her palms. She is now 20 years old. The second patient is a 5 year old girl who has just started to develop dry skin and hair changes. The third and fourth patients are a pair of affected siblings with a severe skin condition since infancy. Quantitative sterol analysis of plasma and skin scales from all four patients showed marked elevation of 4?-methyl- and 4, 4?-dimethylsterols, consistent with a deficiency in the first step of sterol C4 demethylation in cholesterol biosynthesis. Mutations in the SC4MOL have been identified in all of the patients. SC4MOL deficiency is the first autosomal recessive disorder identified in the sterol demethylation complex. Cellular studies with patient-derived fibroblasts have shown a higher mitotic rate than control cells in cholesterol-depleted medium, with increased de novo cholesterol biosynthesis and accumulation of methylsterols. Immunologic analyses of granulocytes and B cells from patients and obligate carriers in the patients’ families indicated dysregulation of immune-related receptors. Inhibition of sterol C4 methyl oxidase in human transformed lymphoblasts induced activation of the cell cycle. Additional studies also demonstrated diminished EGFR signaling and disrupted vesicular trafficking in cells from the affected patients. These findings suggest that methylsterols play an important role in epidermal biology by their influence on cell proliferation, intracellular signaling, vesicular trafficking and immune response. SC4MOL is situated within the psoriasis susceptibility locus PSORS9, and may be a genetic risk factor for common skin conditions. PMID:24144731

  12. Studies of GA sub 53 oxidase from spinach

    SciTech Connect

    Wilson, T.; Zeevaart, J.A.D. )

    1990-05-01

    GA{sub 53} oxidase was purified 1,750-fold with 1% recovery of activity from spinach after exposure to 8 long days. This preparation was injected into balb/c mice and hybridomas from spleen cells were produced. Upon preliminary screening by immunoprecipitation of enzyme activity, three positive cell lines were selected. These are being cloned to select a true monoclonal antibody cell line. This antibody will be used to study the light/dark regulation of this enzyme.

  13. Potential xanthine oxidase inhibitory activity of endophytic Lasiodiplodia pseudotheobromae.

    PubMed

    Kapoor, Neha; Saxena, Sanjai

    2014-07-01

    Xanthine oxidase is considered as a potential target for treatment of hyperuricemia. Hyperuricemia is predisposing factor for gout, chronic heart failure, atherosclerosis, tissue injury, and ischemia. To date, only two inhibitors of xanthine oxidase viz. allopurinol and febuxostat have been clinically approved for used as drugs. In the process of searching for new xanthine oxidase inhibitors, we screened culture filtrates of 42 endophytic fungi using in vitro qualitative and quantitative XO inhibitory assays. The qualitative assay exhibited potential XO inhibition by culture filtrates of four isolates viz. #1048 AMSTITYEL, #2CCSTITD, #6AMLWLS, and #96 CMSTITNEY. The XO inhibitory activity was present only in the chloroform extract of the culture filtrates. Chloroform extract of culture filtrate #1048 AMSTITYEL exhibited the highest inhibition of XO with an IC50 value of 0.61 ?g ml(-1) which was better than allopurinol exhibiting an IC50 of 0.937 ?g ml(-1) while febuxostat exhibited a much lower IC50 of 0.076 ?g ml(-1). Further, molecular phylogenetic tools and morphological studies were used to identify #1048 AMSTITYEL as Lasiodiplodia pseudotheobromae. This is the first report of an endophytic Lasiodiplodia pseudotheobromae from Aegle marmelos exhibiting potential XO Inhibitory activity. PMID:24801403

  14. Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress

    PubMed Central

    Li, Xiaohui; Zhang, Huijuan; Tian, Limei; Huang, Lei; Liu, Shixia; Li, Dayong; Song, Fengming

    2015-01-01

    NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) are key enzymes that catalyze the generation of reactive oxygen species (ROS) in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of other SlRbohs did not affect the resistance. Compared to non-silenced plants, the SlRbohB-silenced plants accumulated more ROS and displayed attenuated expression of defense genes after infection with B. cinerea. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI). Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and the altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI, and drought tolerance in tomato. PMID:26157450

  15. Plant Respiratory Burst Oxidase Homologs Impinge on Wound Responsiveness and Development in Lycopersicon esculentumW?

    PubMed Central

    Sagi, Moshe; Davydov, Olga; Orazova, Saltanat; Yesbergenova, Zhazira; Ophir, Ron; Stratmann, Johannes W.; Fluhr, Robert

    2004-01-01

    Plant respiratory burst oxidase homologs (Rboh) are homologs of the human neutrophil pathogen-related gp91phox. Antisense technology was employed to ascertain the biological function of Lycopersicon esculentum (tomato) Rboh. Lines with diminished Rboh activity showed a reduced level of reactive oxygen species (ROS) in the leaf, implying a role for Rboh in establishing the cellular redox milieu. Surprisingly, the antisense plants acquired a highly branched phenotype, switched from indeterminate to determinate growth habit, and had fasciated reproductive organs. Wound-induced systemic expression of proteinase inhibitor II was compromised in the antisense lines, indicating that ROS intermediates supplied by Rboh are required for this wound response. Extending these observations by transcriptome analysis revealed ectopic leaf expression of homeotic MADS box genes that are normally expressed only in reproductive organs. In addition, both Rboh-dependent and -independent wound-induced gene induction was detected as well as transcript changes related to redox maintenance. The results provide novel insights into how the steady state cellular level of ROS is controlled and portrays the role of Rboh as a signal transducer of stress and developmental responses. PMID:14973161

  16. Longevity and aging. Role of free radicals and xanthine oxidase. A review.

    PubMed

    Labat-Robert, J; Robert, L

    2014-04-01

    Longevity and aging are differently regulated. Longevity has an important part of genetic determinants, aging is essentially post-genetic. Among the genes involved in longevity determination, sirtuins, activated also by calorie restriction and some others as the TOR pathway, attracted special interest after the insulin–IGF pathway first shown to regulate longevity in model organisms. For most of these genes, postponement of life-threatening diseases is the basis of their action which never exceeds about 35% of all determinants, in humans. Among the post-genetic mechanisms responsible for age-related decline of function, free radicals attracted early interest as well as the Maillard reaction, generating also free radicals. Most attempts to remediate to free radical damage failed however, although different scavenger mechanisms and protective substances are present in the organism. Synthetic protectors were also tested without success. The only example of a successful treatment of a free radical mediated pathology is the case of xanthine oxidase, involved in cardiovascular pathology, essentially during the ischemia-reperfusion process. Its inhibition by allopurinol is currently used to fight this deadly syndrome. PMID:24650523

  17. NNK, a Tobacco-Specific Carcinogen, Inhibits the Expression of Lysyl Oxidase, a Tumor Suppressor

    PubMed Central

    Cheng, Guang; Li, Jianmin; Zheng, Maoguen; Zhao, Yinzhi; Zhou, Jing; Li, Wande

    2014-01-01

    A tobacco-specific carcinogen, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), is believed to contribute to the cancer burden in cigarette smokers. To evaluate NNK effects on the expression of lysyl oxidase (LOX), a tumor suppressor, we examined this enzyme at various levels in NNK-treated rat fetal lung fibroblasts (RFL6). Exposure of cells to NNK reduced levels of steady-states LOX mRNA and new transcript synthesis. NNK inhibited all LOX protein species in a dose-dependent manner. Although 300 µM NNK markedly decreased the level in the 46 kDa preproenzyme, under same conditions, there was no detectable amounts of the 50 kDa proenzyme and the 32 kDa mature enzyme suggesting NNK perturbing the LOX protein processing to its mature form. Moreover, NNK also suppressed LOX activities in conditioned media of treated cells. At the promoter level, NNK enhanced methylation of CpG, but decreased acetylation of histone H3 at the core promoter region of the LOX gene. These results indicated that transcriptional and translational processes of LOX are major targets for NNK. Thus, inactivation of tumor suppressor gene LOX may play a critical role in NNK carcinogenesis. PMID:25546273

  18. Pyruvate Carboxylase Is an Essential Protein in the Assembly of Yeast Peroxisomal Oligomeric Alcohol Oxidase

    PubMed Central

    Ozimek, Paulina; van Dijk, Ralf; Latchev, Kantcho; Gancedo, Carlos; Wang, Dong Yuan; van der Klei, Ida J.; Veenhuis, Marten

    2003-01-01

    Hansenula polymorpha ass3 mutants are characterized by the accumulation of inactive alcohol oxidase (AO) monomers in the cytosol, whereas other peroxisomal matrix proteins are normally activated and sorted to peroxisomes. These mutants also have a glutamate or aspartate requirement on minimal media. Cloning of the corresponding gene resulted in the isolation of the H. polymorpha PYC gene that encodes pyruvate carboxylase (HpPyc1p). HpPyc1p is a cytosolic, anapleurotic enzyme that replenishes the tricarboxylic acid cycle with oxaloacetate. The absence of this enzyme can be compensated by addition of aspartate or glutamate to the growth media. We show that HpPyc1p protein but not the enzyme activity is essential for import and assembly of AO. Similar results were obtained in the related yeast Pichia pastoris. In vitro studies revealed that HpPyc1p has affinity for FAD and is capable to physically interact with AO protein. These data suggest that in methylotrophic yeast pyruvate carboxylase plays a dual role in that, besides its well-characterized metabolic function as anapleurotic enzyme, the protein fulfils a specific role in the AO sorting and assembly process, possibly by mediating FAD-binding to AO monomers. PMID:12589070

  19. Molecular phylogenetic analysis of Acridoidea (Orthoptera: Caelifera) based on mitochondrial cytochrome oxidase subunit sequences.

    PubMed

    Dong, Lijun; Shi, Jianping; Zhang, Xiaohong; Zhang, Yulong; Li, Xinjiang; Yin, Hong

    2015-01-01

    Phylogenetic relationships of Acridoidea were examined using mitochondrial cytochrome oxidase subunit sequences (COI, COII and COIII, total 2970bp). Fourteen grasshopper species of thirteen genera from seven families were sequenced to obtain mitochondrial genes data, along with twenty-two grasshopper species were obtained from the GenBank nucleotide database. The purpose of this study is to infer the phylogenetic relationships among families within Acridoidea and testing the monophyly of Acridoidea and each families of it. Phylogenic trees were reconstructed using Maximum Likelihood (ML) and Maximum Parsimony (MP) methods with Tettigonioidea and Gryllotalpoidea as outgroups. The putative initiation codon for COI is CCG in thirteen studied species and ATC in Bryodema luctuosum luctuosum. The 2970 bp concatenated sequences included 1431 conserved sites, 1539 variable sites, and 1216 parsimony-informative sites, the nucleotide compositions were significantly biased toward A and T (68.8%). The resulted phylogenetic trees supported the monophyly of Acridoidea, but did not entirely agree with the traditional morphology-based taxonomic system of grasshoppers within Acridoidea. The monophyly of three families of Acrididae, Catantopidae and Arcypteridae were not supported; Gomphoceridae and Arcypteridae were recovered together as a monophyletic group because of closer phylogenetic relationships; Pyrgomorphidae and Chrotogonidae have the same closer relationships; Pneumoridae, Pyrgomorphidae and Chrotogonidae were the most basal groups; while the taxonomic status of Pamphagidae, which was revealed as a monophyletic group, was not clear in this analysis. Moreover, the results indicate that a phylogeny inferred from the combination of several genes is more reliable than that from only a single gene sequence, and the third codon positions of protein coding genes can improve the topology and node supports of the phylogenetic trees. PMID:26624048

  20. A nutritional conditional lethal mutant due to pyridoxine 5'-phosphate oxidase deficiency in Drosophila melanogaster.

    PubMed

    Chi, Wanhao; Zhang, Li; Du, Wei; Zhuang, Xiaoxi

    2014-06-01

    The concept of auxotrophic complementation has been proposed as an approach to identify genes in essential metabolic pathways in Drosophila melanogaster. However, it has achieved limited success to date, possibly due to the low probability of finding mutations fit with the chemically defined profile. Instead of using the chemically defined culture media lacking specific nutrients, we used bare minimum culture medium, i.e., 4% sucrose, for adult Drosophila. We identified a nutritional conditional lethal mutant and localized a c.95C > A mutation in the Drosophila pyridoxine 5'-phosphate oxidase gene [dPNPO or sugarlethal (sgll)] using meiotic recombination mapping, deficiency mapping, and whole genome sequencing. PNPO converts dietary vitamin B6 such as pyridoxine to its active form pyridoxal 5'-phosphate (PLP). The missense mutation (sgll(95)) results in the substitution of alanine to aspartate (p.Ala32Asp). The sgll(95) flies survive well on complete medium but all die within 6 d on 4% sucrose only diet, which can be rescued by pyridoxine or PLP supplement, suggesting that the mutation does not cause the complete loss of PNPO activity. The sgll knockdown further confirms its function as the Drosophila PNPO. Because better tools for positional cloning and cheaper whole genome sequencing have made the identification of point mutations much easier than before, alleviating the necessity to pinpoint specific metabolic pathways before gene identification, we propose that nutritional conditional screens based on bare minimum growth media like ours represent promising approaches for discovering important genes and mutations in metabolic pathways, thereby accelerating the establishment of in vivo models that recapitulate human metabolic diseases. PMID:24739647

  1. A Nutritional Conditional Lethal Mutant Due to Pyridoxine 5?-Phosphate Oxidase Deficiency in Drosophila melanogaster

    PubMed Central

    Chi, Wanhao; Zhang, Li; Du, Wei; Zhuang, Xiaoxi

    2014-01-01

    The concept of auxotrophic complementation has been proposed as an approach to identify genes in essential metabolic pathways in Drosophila melanogaster. However, it has achieved limited success to date, possibly due to the low probability of finding mutations fit with the chemically defined profile. Instead of using the chemically defined culture media lacking specific nutrients, we used bare minimum culture medium, i.e., 4% sucrose, for adult Drosophila. We identified a nutritional conditional lethal mutant and localized a c.95C > A mutation in the Drosophila pyridoxine 5?-phosphate oxidase gene [dPNPO or sugarlethal (sgll)] using meiotic recombination mapping, deficiency mapping, and whole genome sequencing. PNPO converts dietary vitamin B6 such as pyridoxine to its active form pyridoxal 5?-phosphate (PLP). The missense mutation (sgll95) results in the substitution of alanine to aspartate (p.Ala32Asp). The sgll95 flies survive well on complete medium but all die within 6 d on 4% sucrose only diet, which can be rescued by pyridoxine or PLP supplement, suggesting that the mutation does not cause the complete loss of PNPO activity. The sgll knockdown further confirms its function as the Drosophila PNPO. Because better tools for positional cloning and cheaper whole genome sequencing have made the identification of point mutations much easier than before, alleviating the necessity to pinpoint specific metabolic pathways before gene identification, we propose that nutritional conditional screens based on bare minimum growth media like ours represent promising approaches for discovering important genes and mutations in metabolic pathways, thereby accelerating the establishment of in vivo models that recapitulate human metabolic diseases. PMID:24739647

  2. Phylogenetic relationship of Turkish Apis mellifera subspecies based on sequencing of mitochondrial cytochrome C oxidase I region.

    PubMed

    Özdil, F; ?lhan, F

    2012-01-01

    Mitochondrial DNA sequence variation can be used to infer honey bee evolutionary relationships. We examined DNA sequence diversity in the cytochrome C oxidase I (COI or Cox1) gene segment of the mitochondrial genome in 112 samples of Apis mellifera from 15 different populations in Turkey. Six novel haplotypes were found for the COI gene segment. There were eight variable sites in the COI gene, although only three were parsimony-informative sites. The mean pairwise genetic distance was 0.3% for the COI gene segment. Neighbor-joining (NJ) trees of the COI gene segment were constructed with the published sequences of A. mellifera haplotypes that are available in GenBank; the genetic variation was compared among the different honeybee haplotypes. The NJ dendogram based on the COI sequences available in GenBank showed that Eastern European races were clustered together, whereas the Mellifera and Iberian haplotypes were clustered far apart. The haplotypes found in this study were clustered together with A. mellifera ligustica and some of the Greek honey bees (accession Nos. GU056169 and GU056170) found in NCBI GenBank database. This study expands the knowledge about the mitochondrial COI region and presents the first comprehensive sequence analysis of this region in Turkish honeybees. PMID:22614282

  3. Streptococcus mutans NADH Oxidase Lies at the Intersection of Overlapping Regulons Controlled by Oxygen and NAD+ Levels

    PubMed Central

    Baker, J. L.; Derr, A. M.; Karuppaiah, K.; MacGilvray, M. E.; Kajfasz, J. K.; Faustoferri, R. C.; Rivera-Ramos, I.; Bitoun, J. P.; Lemos, J. A.; Wen, Z. T.

    2014-01-01

    NADH oxidase (Nox, encoded by nox) is a flavin-containing enzyme used by the oral pathogen Streptococcus mutans to reduce diatomic oxygen to water while oxidizing NADH to NAD+. The critical nature of Nox is 2-fold: it serves to regenerate NAD+, a carbon cycle metabolite, and to reduce intracellular oxygen, preventing formation of destructive reactive oxygen species (ROS). As oxygen and NAD+ have been shown to modulate the activity of the global transcription factors Spx and Rex, respectively, Nox is potentially poised at a critical junction of two stress regulons. In this study, microarray data showed that either addition of oxygen or loss of nox resulted in altered expression of genes involved in energy metabolism and transport and the upregulation of genes encoding ROS-metabolizing enzymes. Loss of nox also resulted in upregulation of several genes encoding transcription factors and signaling molecules, including the redox-sensing regulator gene rex. Characterization of the nox promoter revealed that nox was regulated by oxygen, through SpxA, and by Rex. These data suggest a regulatory loop in which the roles of nox in reduction of oxygen and regeneration of NAD+ affect the activity levels of Spx and Rex, respectively, and their regulons, which control several genes, including nox, crucial to growth of S. mutans under conditions of oxidative stress. PMID:24682329

  4. Identification of two peanut germin-like genes and the potential superoxide dismutase activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Germin and germin-like protein (GLP) genes are members of large multigene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity, leading ...

  5. Genes and Gene Therapy

    MedlinePLUS

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  6. Licorice ?-amyrin 11-oxidase, a cytochrome P450 with a key role in the biosynthesis of the triterpene sweetener glycyrrhizin

    PubMed Central

    Seki, Hikaru; Ohyama, Kiyoshi; Sawai, Satoru; Mizutani, Masaharu; Ohnishi, Toshiyuki; Sudo, Hiroshi; Akashi, Tomoyoshi; Aoki, Toshio; Saito, Kazuki; Muranaka, Toshiya

    2008-01-01

    Glycyrrhizin, a major bioactive compound derived from the underground parts of Glycyrrhiza (licorice) plants, is a triterpene saponin that possesses a wide range of pharmacological properties and is used worldwide as a natural sweetener. Because of its economic value, the biosynthesis of glycyrrhizin has received considerable attention. Glycyrrhizin is most likely derived from the triterpene ?-amyrin, an initial product of the cyclization of 2,3-oxidosqualene. The subsequent steps in glycyrrhizin biosynthesis are believed to involve a series of oxidative reactions at the C-11 and C-30 positions, followed by glycosyl transfers to the C-3 hydroxyl group; however, no genes encoding relevant oxidases or glycosyltransferases have been identified. Here we report the successful identification of CYP88D6, a cytochrome P450 monooxygenase (P450) gene, as a glycyrrhizin-biosynthetic gene, by transcript profiling-based selection from a collection of licorice expressed sequence tags (ESTs). CYP88D6 was characterized by in vitro enzymatic activity assays and shown to catalyze the sequential two-step oxidation of ?-amyrin at C-11 to produce 11-oxo-?-amyrin, a possible biosynthetic intermediate between ?-amyrin and glycyrrhizin. CYP88D6 coexpressed with ?-amyrin synthase in yeast also catalyzed in vivo oxidation of ?-amyrin to 11-oxo-?-amyrin. CYP88D6 expression was detected in the roots and stolons by RT-PCR; however, no amplification was observed in the leaves or stems, which is consistent with the accumulation pattern of glycyrrhizin in planta. These results suggest a role for CYP88D6 as a ?-amyrin 11-oxidase in the glycyrrhizin pathway. PMID:18779566

  7. Curly Encodes Dual Oxidase, Which Acts with Heme Peroxidase Curly Su to Shape the Adult Drosophila Wing

    PubMed Central

    Hurd, Thomas Ryan; Liang, Feng-Xia; Lehmann, Ruth

    2015-01-01

    Abstract Curly, described almost a century ago, is one of the most frequently used markers in Drosophila genetics. Despite this the molecular identity of Curly has remained obscure. Here we show that Curly mutations arise in the gene dual oxidase (duox), which encodes a reactive oxygen species (ROS) generating NADPH oxidase. Using Curly mutations and RNA interference (RNAi), we demonstrate that Duox autonomously stabilizes the wing on the last day of pupal development. Through genetic suppression studies, we identify a novel heme peroxidase, Curly Su (Cysu) that acts with Duox to form the wing. Ultrastructural analysis suggests that Duox and Cysu are required in the wing to bond and adhere the dorsal and ventral cuticle surfaces during its maturation. In Drosophila, Duox is best known for its role in the killing of pathogens by generating bactericidal ROS. Our work adds to a growing number of studies suggesting that Duox’s primary function is more structural, helping to form extracellular and cuticle structures in conjunction with peroxidases. PMID:26587980

  8. Curly Encodes Dual Oxidase, Which Acts with Heme Peroxidase Curly Su to Shape the Adult Drosophila Wing.

    PubMed

    Hurd, Thomas Ryan; Liang, Feng-Xia; Lehmann, Ruth

    2015-11-01

    Curly, described almost a century ago, is one of the most frequently used markers in Drosophila genetics. Despite this the molecular identity of Curly has remained obscure. Here we show that Curly mutations arise in the gene dual oxidase (duox), which encodes a reactive oxygen species (ROS) generating NADPH oxidase. Using Curly mutations and RNA interference (RNAi), we demonstrate that Duox autonomously stabilizes the wing on the last day of pupal development. Through genetic suppression studies, we identify a novel heme peroxidase, Curly Su (Cysu) that acts with Duox to form the wing. Ultrastructural analysis suggests that Duox and Cysu are required in the wing to bond and adhere the dorsal and ventral cuticle surfaces during its maturation. In Drosophila, Duox is best known for its role in the killing of pathogens by generating bactericidal ROS. Our work adds to a growing number of studies suggesting that Duox's primary function is more structural, helping to form extracellular and cuticle structures in conjunction with peroxidases. PMID:26587980

  9. Microevolution of Cytochrome bd Oxidase in Staphylococci and Its Implication in Resistance to Respiratory Toxins Released by Pseudomonas†

    PubMed Central

    Voggu, Lalitha; Schlag, Steffen; Biswas, Raja; Rosenstein, Ralf; Rausch, Christian; Götz, Friedrich

    2006-01-01

    Pseudomonas aeruginosa and Staphylococcus aureus are opportunistic pathogens and frequently coinfect the lungs of cystic fibrosis patients. P. aeruginosa secretes an arsenal of small respiratory inhibitors, like pyocyanin, hydrogen cyanide, or quinoline N-oxides, that may act against the commensal flora as well as host cells. Here, we show that with respect to their susceptibility to these respiratory inhibitors, staphylococcal species can be divided into two groups: the sensitive group, comprised of pathogenic species such as S. aureus and S. epidermidis, and the resistant group, represented by nonpathogenic species such as S. carnosus, S. piscifermentans, and S. gallinarum. The resistance in the latter group of species was due to cydAB genes that encode a pyocyanin- and cyanide-insensitive cytochrome bd quinol oxidase. By exchanging cydB in S. aureus with the S. carnosus-specific cydB, we could demonstrate that CydB determines resistance. The resistant or sensitive phenotype was based on structural alterations in CydB, which is part of CydAB, the cytochrome bd quinol oxidase. CydB represents a prime example of both microevolution and the asymmetric pattern of evolutionary change. PMID:17108291

  10. Alternative Oxidase: A Mitochondrial Respiratory Pathway to Maintain Metabolic and Signaling Homeostasis during Abiotic and Biotic Stress in Plants

    PubMed Central

    Vanlerberghe, Greg C.

    2013-01-01

    Alternative oxidase (AOX) is a non-energy conserving terminal oxidase in the plant mitochondrial electron transport chain. While respiratory carbon oxidation pathways, electron transport, and ATP turnover are tightly coupled processes, AOX provides a means to relax this coupling, thus providing a degree of metabolic homeostasis to carbon and energy metabolism. Beside their role in primary metabolism, plant mitochondria also act as “signaling organelles”, able to influence processes such as nuclear gene expression. AOX activity can control the level of potential mitochondrial signaling molecules such as superoxide, nitric oxide and important redox couples. In this way, AOX also provides a degree of signaling homeostasis to the organelle. Evidence suggests that AOX function in metabolic and signaling homeostasis is particularly important during stress. These include abiotic stresses such as low temperature, drought, and nutrient deficiency, as well as biotic stresses such as bacterial infection. This review provides an introduction to the genetic and biochemical control of AOX respiration, as well as providing generalized examples of how AOX activity can provide metabolic and signaling homeostasis. This review also examines abiotic and biotic stresses in which AOX respiration has been critically evaluated, and considers the overall role of AOX in growth and stress tolerance. PMID:23531539

  11. Involvement of Acyl Coenzyme A Oxidase Isozymes in Biotransformation of Methyl Ricinoleate into ?-Decalactone by Yarrowia lipolytica

    PubMed Central

    Waché, Yves; Laroche, Céline; Bergmark, Karin; Møller-Andersen, Charlotte; Aguedo, Mario; Le Dall, Marie-Thérèse; Wang, Huijie; Nicaud, Jean-Marc; Belin, Jean-Marc

    2000-01-01

    We reported previously on the function of acyl coenzyme A (acyl-CoA) oxidase isozymes in the yeast Yarrowia lipolytica by investigating strains disrupted in one or several acyl-CoA oxidase-encoding genes (POX1 through POX5) (H. Wang et al., J. Bacteriol. 181:5140–5148, 1999). Here, these mutants were studied for lactone production. Monodisrupted strains produced similar levels of lactone as the wild-type strain (50 mg/liter) except for ?pox3, which produced 220 mg of ?-decalactone per liter after 24 h. The ?pox2 ?pox3 double-disrupted strain, although slightly affected in growth, produced about 150 mg of lactone per liter, indicating that Aox2p was not essential for the biotransformation. The ?pox2 ?pox3 ?pox5 triple-disrupted strain produced and consumed lactone very slowly. On the contrary, the ?pox2 ?pox3 ?pox4 ?pox5 multidisrupted strain did not grow or biotransform methyl ricinoleate into ?-decalactone, demonstrating that Aox4p is essential for the biotransformation. PMID:10698800

  12. Alternative oxidase: what information can protein sequence comparisons give us?

    PubMed

    McDonald, Allison E

    2009-12-01

    The finding that alternative oxidase (AOX) is present in most kingdoms of life has resulted in a large number of AOX sequences that are available for analyses. Multiple sequence alignments of AOX proteins from evolutionarily divergent organisms represent a valuable tool and can be used to identify amino acids and domains that may play a role in catalysis, membrane association and post-translational regulation, especially when these data are coupled with the structural model for the enzyme. I validate the use of this approach by demonstrating that it detects the conserved glutamate and histidine residues in AOX that initially led to its identification as a di-iron carboxylate protein and the generation of a structural model for the protein. A comparative analysis using a larger dataset identified 35 additional amino acids that are conserved in all AOXs examined, 30 of which have not been investigated to date. I hypothesize that these residues will be involved in the quinol terminal oxidase activity or membrane association of AOX. Major differences in AOX protein sequences between kingdoms are revealed, and it is hypothesized that two angiosperm-specific domains may be responsible for the non-covalent dimerization of AOX, whereas two indels in the aplastidic AOXs may play a role in their post-translational regulation. A scheme for predicting whether a particular AOX protein will be recognized by the alternative oxidase monoclonal antibody generated against the AOX of Sauromatum guttatum (Voodoo lily) is presented. The number of functional sites in AOX is greater than expected, and determining the structure of AOX will prove extremely valuable to future research. PMID:19493309

  13. Reductive trapping of substrate to bovine plasma amine oxidase

    SciTech Connect

    Hartmann, C.; Klinman, J.P.

    1987-01-25

    Plasma amine oxidases catalyze the oxidative deamination of amines to aldehydes, followed by a 2e- reduction of O/sub 2/ to H/sub 2/O/sub 2/. Pyrroloquinoline quinone (PQQ), previously believed to be restricted to prokaryotes, has recently been proposed to be the cofactor undergoing reduction in the first half-reaction of bovine plasma amine oxidase (Ameyama, M., Hayashi, U., Matsushita, K., Shinagawa, E., and Adachi, O. (1984) Agric. Biol. Chem. 48, 561-565; Lobenstein-Verbeek, C. L., Jongejan, J. A., Frank, J., and Duine, J. A. (1984) FEBS Lett. 170, 305-309). This result is unexpected, since model studies with PQQ implicate Schiff's base formation between a reactive carbonyl and substrates, whereas experiments with bovine plasma amine oxidase have failed to provide evidence for a carbonyl cofactor. We have, therefore, re-examined putative adducts between substrate and enzyme-bound cofactor, employing a combination of (/sup 14/C)benzylamine and (/sup 3/H)NaCNBH/sub 3/. The use of the relatively weak reductant, NaCNBH/sub 3/, affords Schiff's base specificity and permits the study of enzyme below pH 7.0. As we show, enzyme can only be inactivated by NaCNBH/sub 3/ in the presence of substrate, leading to the incorporation of 1 mol of (/sup 14/C)benzylamine/mol of enzyme subunit at complete inactivation. By contrast, we are unable to detect any labeling with (/sup 3/H)NaCNBH/sub 3/, analogous to an earlier study with (/sup 3/H)NaCNBH/sub 4/ (Suva, R. H., and Abeles, R. H. (1978) Biochemistry 17, 3538-3545). We conclude, first, that our inability to obtain adducts containing both carbon 14 and tritium rules out the reductive trapping either of amine substrate with pyridoxal phosphate or of aldehyde product with a lysyl side chain and, second, that the observed pattern of labeling is fully consistent with the presence of PQQ at the active site of bovine plasma amine oxidase.

  14. 9-Benzoyl 9-deazaguanines as potent xanthine oxidase inhibitors.

    PubMed

    Rodrigues, Marili V N; Barbosa, Alexandre F; da Silva, Júlia F; Dos Santos, Deborah A; Vanzolini, Kenia L; de Moraes, Marcela C; Corrêa, Arlene G; Cass, Quezia B

    2016-01-15

    A novel potent xanthine oxidase inhibitor, 3-nitrobenzoyl 9-deazaguanine (LSPN451), was selected from a series of 10 synthetic derivatives. The enzymatic assays were carried out using an on-flow bidimensional liquid chromatography (2D LC) system, which allowed the screening¸ the measurement of the kinetic inhibition constant and the characterization of the inhibition mode. This compound showed a non-competitive inhibition mechanism with more affinity for the enzyme-substrate complex than for the free enzyme, and inhibition constant of 55.1±9.80nM, about thirty times more potent than allopurinol. Further details of synthesis and enzymatic studies are presented herein. PMID:26712096

  15. Kinetics of proton pumping in cytochrome c oxidase

    E-print Network

    Anatoly Yu. Smirnov; Lev G. Mourokh; Franco Nori

    2009-12-04

    We propose a simple model of cytochrome c oxidase, including four redox centers and four protonable sites, to study the time evolution of electrostatically coupled electron and proton transfers initiated by the injection of a single electron into the enzyme. We derive a system of master equations for electron and proton state probabilities and show that an efficient pumping of protons across the membrane can be obtained for a reasonable set of parameters. All four experimentally observed kinetic phases appear naturally from our model. We also calculate the dependence of the pumping efficiency on the transmembrane voltage at different temperatures and discuss a possible mechanism of the redox-driven proton translocation.

  16. The Role of Monoamine Oxidase Inhibitors in Current Psychiatric Practice

    PubMed Central

    Fiedorowicz, Jess G.; Swartz, Karen L.

    2007-01-01

    The use of monoamine oxidase inhibitors (MAOIs) by psychiatrists has declined over the past several decades with the expansion of psychiatrists’ pharmacologic armamentarium. This trend has also been driven by concern about food and drug interactions and side effects, as well as waning physician experience with these medications. Many psychiatrists, in fact, never prescribe MAOIs. Recent research has liberalized the MAOI diet and identified symptom presentations more likely to respond to these medications. Thus, clinicians must continue to familiarize themselves with the properties of and indications for prescribing MAOIs. PMID:15552546

  17. Chemical modification of milk xanthine oxidase with different modifiers.

    PubMed

    Aboul-Enein, Hassan Y; Refaie, Mohamed O I; El-Gazzar, Hayam; El-Aziz, Magda Abd

    2003-08-01

    Xanthine oxidase (XO), purified from buttermilk was subjected to modification with N-phenylmaleimide, p-toluene-sulfonyl chloride, and 2-mercaptobenzimidazole. Spectrophotometric monitoring of the enzyme before and after treatment with these modifiers are presented. The results show that the interaction of XO with the modifiers was accompained by a change in UV absorption, as compared with untreated enzyme. The data indicate that these modifiers caused conformational changes in the polypeptide chain of milk XO due to interaction of these modifiers with sulfahydryl and/or hydroxyl groups. Moreover, the modifiers induce uptake inhibition of milk XO and appeared to be dependant upon either the concentration or incubation time. PMID:12916809

  18. Evolution of the oxygen sensitivity of cytochrome c oxidase subunit 4.

    PubMed

    Kocha, K M; Reilly, K; Porplycia, D S M; McDonald, J; Snider, T; Moyes, C D

    2015-02-15

    Vertebrates possess two paralogs of cytochrome c oxidase (COX) subunit 4: a ubiquitous COX4-1 and a hypoxia-linked COX4-2. Mammalian COX4-2 is thought to have a role in relation to fine-tuning metabolism in low oxygen levels, conferred through both structural differences in the subunit protein structure and regulatory differences in the gene. We sought to elucidate the pervasiveness of this feature across vertebrates. The ratio of COX4-2/4-1 mRNA is generally low in mammals, but this ratio was higher in fish and reptiles, particularly turtles. The COX4-2 gene appeared unresponsive to low oxygen in nonmammalian models (zebrafish, goldfish, tilapia, anoles, and turtles) and fish cell lines. Reporter genes constructed from the amphibian and reptile homologues of the mammalian oxygen-responsive elements and hypoxia-responsive elements did not respond to low oxygen. Unlike the rodent ortholog, the promoter of goldfish COX4-2 did not respond to hypoxia or anoxia. The protein sequences of the COX4-2 peptide showed that the disulfide bridge seen in human and rodent orthologs would be precluded in other mammalian lineages and lower vertebrates, all of which lack the requisite pair of cysteines. The coordinating ligands of the ATP-binding site are largely conserved across mammals and reptiles, but in Xenopus and fish, sequence variations may disrupt the ability of the protein to bind ATP at this site. Collectively, these results suggest that many of the genetic and structural features of COX4-2 that impart responsiveness and benefits in hypoxia may be restricted to the Euarchontoglires lineage that includes primates, lagomorphs, and rodents. PMID:25519729

  19. Changes in the location of polyphenol oxidase in potato (Solanum tuberosum L.) tuber during cell death in response to impact injury: comparison with wound tissue.

    PubMed

    Partington, J C; Smith, C; Bolwell, G P

    1999-01-01

    In order to elucidate the nature of the response of potato to impact injury at the biochemical level, changes in the location of the enzyme responsible for the discoloration, polyphenol oxidase, were determined using immunogold location with an antibody specific for potato tuber polyphenol oxidase. Tissue printing revealed that the enzyme was distributed throughout the tuber. Following impact injury, both tissue printing and quantitative electron microscopy indicated that there was no increase in the level of the enzyme although there was subcellular redistribution of polyphenol oxidase. This redistribution was first apparent at 12 h after impact, as determined by the use of confocal immunolocation, and coincided with loss of membrane integrity. These changes were examined in parallel with a number of stress-related parameters in both impact and wound responses. Wounding was accompanied by active gene expression and protein synthesis, leading to metabolic activity and tissue repair. In contrast, the bruising response was characterised by a limited active response and vital-staining methods indicated that after 16 h the tissue undergoes cell death. PMID:9951737

  20. The NADPH-oxidase AtrbohB plays a role in Arabidopsis seed after-ripening

    E-print Network

    Leubner, Gerhard

    The NADPH-oxidase AtrbohB plays a role in Arabidopsis seed after-ripening Kerstin Mu¨ller1 , Anna), seed dormancy, seed germination, NADPH-oxidase (Rboh). Summary · Seeds can enter a state of dormancy, in which they do not germinate under optimal environmental conditions. Dormancy can be broken during seed

  1. The hemibiotrophic cacao pathogen Moniliophthora perniciosa depends on a mitochondrial alternative oxidase for biotrophic development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The mitochondrial alternative oxidase (AOX) is a non-energy conserving ubiquinol oxidase found in most fungal genomes studied to date. With the development of fungicides containing cytochrome-dependent respiratory chain (CRC) inhibitors, a strong interest in studying AOX functions in phytopathogenic...

  2. Generation of protonic potential by the bd-type quinol oxidase of Azotobacter vinelandii.

    PubMed

    Bertsova, Y V; Bogachev, A V; Skulachev, V P

    1997-09-01

    Inside-out subcellular vesicles of Azotobacter vinelandii are found to produce delta pH and delta psi (interior acidic and positive) when oxidising malate or menadiol. These effects are inherent in both Cyd+ Cyo- (lacking the o-type oxidase) and Cyd- Cyo+ (lacking the bd-type oxidase) strains. They appear to be myxothiazol-sensitive in the Cyd- Cyo+ strain but not in the Cyd+ Cyo- strain. The H+/e- ratio for the terminal part of respiratory chain of a bd-type oxidase overproducing strain is established as being close to 1. It is also shown that NADH oxidation by the vesicles from the Cyd- Cyo+ strain is sensitive to low concentrations of myxothiazol and antimycin A whereas that of the Cyd+ Cyo- strain is resistant to these Q-cycle inhibitors. It is concluded that (i) the bd-type oxidase of A. vinelandii is competent in generating a protonic potential but its efficiency is lower than that of the o-type oxidase and (ii) Q-cycle does operate in the o-type cytochrome oxidase terminated branch of the A. vinelandii respiratory chain and does not in the bd-type quinol oxidase terminated branch. These relationships are discussed in the context of the respiratory protection function of the bd-type oxidase in A. vinelandii. PMID:9315721

  3. Adaptive evolution of cytochrome c oxidase: Infrastructure for a carnivorous plant radiation

    E-print Network

    Nielsen, Rasmus

    Adaptive evolution of cytochrome c oxidase: Infrastructure for a carnivorous plant radiation of cytochrome c oxidase (COX) from an active-trapping lineage of carnivorous plants is caused by positive of molecular substitution rates among the carnivorous plant sister-groups Genlisea Utricularia and Pinguicula

  4. Glucose Oxidase-Mediated Gelation: A Simple Test To Detect Glucose in Food Products

    E-print Network

    Raghavan, Srinivasa

    Glucose Oxidase-Mediated Gelation: A Simple Test To Detect Glucose in Food Products Yi Liu,, Vishal: This paper reports a simple, rapid, and sugar-selective method to induce gelation from glucose-containing samples. This method employs glucose oxidase (GOx) to selectively "recognize" and oxidize glucose

  5. Fronts and pulses in an enzymatic reaction catalyzed by glucose oxidase

    E-print Network

    Epstein, Irving R.

    Fronts and pulses in an enzymatic reaction catalyzed by glucose oxidase David G. Míguez* , Vladimir as catalysts and regulators. We present a reaction­diffusion system catalyzed by the enzyme glucose oxidase previously studied the temporal dynamics of the enzymatic autocatalytic reaction between glucose and ferricya

  6. Role of NADPH Oxidase versus Neutrophil Proteases in Antimicrobial Host Defense

    PubMed Central

    Grimm, Melissa J.; Lewandowski, David C.; Pham, Christine T. N.; Blackwell, Timothy S.; Petraitiene, Ruta; Petraitis, Vidmantas; Walsh, Thomas J.; Urban, Constantin F.; Segal, Brahm H.

    2011-01-01

    NADPH oxidase is a crucial enzyme in mediating antimicrobial host defense and in regulating inflammation. Patients with chronic granulomatous disease, an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates (ROIs), suffer from life-threatening bacterial and fungal infections. The mechanisms by which NADPH oxidase mediate host defense are unclear. In addition to ROI generation, neutrophil NADPH oxidase activation is linked to the release of sequestered proteases that are posited to be critical effectors of host defense. To definitively determine the contribution of NADPH oxidase versus neutrophil serine proteases, we evaluated susceptibility to fungal and bacterial infection in mice with engineered disruptions of these pathways. NADPH oxidase-deficient mice (p47phox?/?) were highly susceptible to pulmonary infection with Aspergillus fumigatus. In contrast, double knockout neutrophil elastase (NE)?/?×cathepsin G (CG)?/? mice and lysosomal cysteine protease cathepsin C/dipeptidyl peptidase I (DPPI)-deficient mice that are defective in neutrophil serine protease activation demonstrated no impairment in antifungal host defense. In separate studies of systemic Burkholderia cepacia infection, uniform fatality occurred in p47phox?/? mice, whereas NE?/?×CG?/? mice cleared infection. Together, these results show a critical role for NADPH oxidase in antimicrobial host defense against A. fumigatus and B. cepacia, whereas the proteases we evaluated were dispensable. Our results indicate that NADPH oxidase dependent pathways separate from neutrophil serine protease activation are required for host defense against specific pathogens. PMID:22163282

  7. Purification, characterization and decolorization of bilirubin oxidase from Myrothecium verrucaria 3.2190

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...

  8. Calculated Proton Uptake on Anaerobic Reduction of Cytochrome c Oxidase: Is the Reaction Electroneutral?

    E-print Network

    Gunner, Marilyn

    Calculated Proton Uptake on Anaerobic Reduction of Cytochrome c Oxidase: Is the ReactionVised Manuscript ReceiVed April 17, 2006 ABSTRACT: Cytochrome c oxidase is a transmembrane proton pump that builds ranging from fully oxidized to fully reduced. One long-standing problem is how proton uptake is coupled

  9. [Experimental rationale for the parameters of a rapid method for oxidase activity determination].

    PubMed

    Butorina, N N

    2010-01-01

    Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005. PMID:21341494

  10. Risk-taking: behind the warrior gene story.

    PubMed

    Merriman, Tony; Cameron, Vicky

    2007-01-01

    In 2006, the monoamine oxidase-A gene was widely reported in the media as being associated with risk-taking and aggressive behaviour in M?ori. We examine the scientific evidence underlying this claim. Whilst there is credible evidence for a contribution of a monoamine oxidase-A genetic variant to antisocial behaviour in Caucasians, there is no direct evidence to support such an association in M?ori. Insufficient rigour in interpreting and applying the relevant literature, and in generating new data, has (in conjunction with a lack of scientific investigative journalism) done science and M?ori a disservice. PMID:17339896

  11. Reconstitution of the membrane-bound, ubiquinone-dependent pyruvate oxidase respiratory chain of Escherichia coli with the cytochrome d terminal oxidase

    SciTech Connect

    Koland, J.G.; Miller, M.J.; Gennis, R.B.

    1984-01-31

    Pyruvate oxidase is a flavoprotein dehydrogenase located on the inner surface of the Escherichia coli cytoplasmic membrane and coupled to the E. coli aerobic respiratory chain. The role of quinones in the pyruvate oxidase system is investigated, and a minimal respiratory chain is described consisting of only two pure proteins plus ubiquinone 8 incorporated in phospholipid vesicles. The enzymes used in this reconstitution are the flavorprotein and the recently purified E. coli cytochrome d terminal oxidase. The catalytic velocity of the reconstituted liposome system is about 30% of that observed when the flavoprotein is reconstituted with E. coli membranes. It is also shown that electron transport from pyruvate to oxygen in the liposome system generates a transmembrane potential of at least 180 mV (negative inside), which is sensitive to the uncouplers carbonyl cyanide p-(trichloromethoxy)phenylhydrazone and valinomycin. A transmembrane potential is also generated by the oxidation of ubiquinol 1 by the terminal oxidase in the absence of the flavoprotein. It is concluded that: the flavoprotein can directly reduce ubiquinone 8 within the phospholipid bilayer; menaquinone 8 will not effectively substitute for ubiquinone 8 in this electron-transfer chain; and the cytochrome d terminal oxidase functions as a ubiquinol 8 oxidase and serves as a coupling site in the E. coli aerobic respiratory chain. These investigations suggest a relatively simple organization for the E. coli respiratory chain.

  12. Neuronal NAD(P)H Oxidases Contribute to ROS Production and Mediate RGC Death after Ischemia

    PubMed Central

    Dvoriantchikova, Galina; Grant, Jeff; Santos, Andrea Rachelle C.; Hernandez, Eleut; Ivanov, Dmitry

    2012-01-01

    Purpose. To study the role of neuronal nicotinamide adenine dinucleotide phosphate [NAD(P)H] oxidase–dependent reactive oxygen species (ROS) production in retinal ganglion cell (RGC) death after ischemia. Methods. Ischemic injury was induced by unilateral elevation of intraocular pressure via direct corneal cannulation. For in vitro experiments, RGCs isolated by immunopanning from retinas were exposed to oxygen and glucose deprivation (OGD). The expression levels of NAD(P)H oxidase subunits were evaluated by quantitative PCR, immunocytochemistry, and immunohistochemistry. The level of ROS generated was assayed by dihydroethidium. The NAD(P)H oxidase inhibitors were then tested to determine if inhibition of NAD(P)H oxidase altered the production of ROS within the RGCs and promoted cell survival. Results. It was reported that RGCs express catalytic Nox1, Nox2, Nox4, Duox1, as well as regulatory Ncf1/p47phox, Ncf2/p67phox, Cyba/p22phox, Noxo1, and Noxa1 subunits of NAD(P)H oxidases under normal conditions and after ischemia. However, whereas RGCs express only low levels of catalytic Nox2, Nox4, and Duox1, and regulatory Ncf1/p47, Ncf2/p67 subunits, they exhibit significantly higher levels of catalytic subunit Nox1 and the subunits required for optimal activity of Nox1. It was observed that the nonselective NAD(P)H oxidase inhibitors VAS-2870, AEBSF, and the Nox1 NAD(P)H oxidase–specific inhibitor ML-090 decreased the ROS burst stimulated by OGD, which was associated with a decreased level of RGC death. Conclusions. The findings suggest that NAD(P)H oxidase activity in RGCs renders them vulnerable to ischemic death. Importantly, high levels of Nox1 NAD(P)H oxidase subunits in RGCs suggest that this enzyme could be a major source of ROS in RGCs produced by NAD(P)H oxidases. PMID:22467573

  13. Type-3 copper proteins: recent advances on polyphenol oxidases.

    PubMed

    Kaintz, Cornelia; Mauracher, Stephan Gerhard; Rompel, Annette

    2014-01-01

    Recent investigations in the study of plant, fungal, and bacterial type-3 copper proteins are reviewed. Focus is given to three enzymes: catechol oxidases (CO), tyrosinases, and aureusidin synthase. CO were mostly found in plants, however, in 2010 the first fungal CO was published. The first plant-originated tyrosinase was published in 2014, before tyrosinases were only reported in fungi, bacteria, and human. Aureusidin synthase from yellow snapdragon (Antirrhinum majus) was first published in 2000, as part of yellow flower coloration pathway. In the last years, many important results on type-3 copper enzymes originated from X-ray crystallographic investigations. In addition, studies on site-directed mutagenesis of amino acids around the active site were performed to identify the regions determining monophenolase and/or diphenolase activity. Although X-ray crystallographic structures of CO and tyrosinases are available, many questions like the response for the activation via proteases, sequence-based or structural-based differences between CO, as well as the physiological roles of many polyphenol oxidases still remain to be addressed. PMID:25458353

  14. Functionalized Polyacrylonitrile Nanofibrous Membranes for Covalent Immobilization of Glucose Oxidase.

    PubMed

    Manuel, James; Kim, Miso; Dharela, Rohini; Chauhan, Ghanshyam S; Fapyane, Deby; Lee, Soo-Jin; Chang, In Seop; Kang, Seo-Hee; Kim, Seon-Won; Ahn, Jou-Hyeon

    2015-01-01

    Nanofibrous membrane (NFM) with uniform morphology and large surface area was prepared from 10% solution of polyacrylonitrile (PAN) in N,N-dimethylformamide by electrospinning technique. NFM was chemically modified for use as a support for the immobilization of glucose oxidase. Chemical modification of NFM was carried out by two different methods. In the first method, the cyano groups of PAN were modified to amino groups by a two-step process, while in the second method the carboxylic groups were generated first and then further reacted with hexamethylene diamine to create a reactive spacer arm for the immobilization of enzyme. Scanning electron microscopy studies showed that the surface morphology of NFM was not changed by chemical modification and its mechanical strength was improved. The immobilized glucose oxidase (GOx) retained 54 and 60% of its original activity up to 25 cycles with the PAN NFMs modified by the first and the second method, respectively. The GOx-immobilized NFM from the second method showed promising performance with higher enzyme immobilization, activity retention, and favorable kinetic parameters. PMID:26301308

  15. Partial purification and characterization of polyphenol oxidase from persimmon.

    PubMed

    Navarro, José L; Tárrega, Amparo; Sentandreu, Miguel A; Sentandreu, Enrique

    2014-08-15

    Activity of polyphenol oxidase (PPO) from "Rojo Brillante" persimmon (Diospyros kaki L.) fruits was characterized. Crude extracts were used for characterization of enzyme activity and stability at different temperatures (60, 70 and 80 °C), pHs (from 3.5 to 7.5) and substrate concentrations (catechol from 0 to 0.5M). Maximum enzyme activity was reached at pH 5.5 and 55 °C. Enzyme stability was higher than PPO activities found in other natural sources, since above pH 5.5 the minimum time needed to achieve an enzyme inactivation of 90% was 70 min at 80 °C. However, at pH 4.0 the enzyme stability decreased, reaching inactivation levels above 90% after 10 min even at 60 °C. Thus it was concluded that acidification can circumvent browning problems caused by PPO activity. Moreover, polyacrylamide gel electrophoresis of the enriched extract revealed the presence of at least four bands with strong oxidase activity, suggesting the existence of different PPO isoforms. PMID:24679782

  16. Lysyl oxidase propeptide inhibits smooth muscle cell signaling and proliferation

    SciTech Connect

    Hurtado, Paola A.; Vora, Siddharth; Sume, Siddika Selva; Yang, Dan; Hilaire, Cynthia St.; Guo Ying; Palamakumbura, Amitha H.; Schreiber, Barbara M.; Ravid, Katya; Trackman, Philip C.

    2008-02-01

    Lysyl oxidase is required for the normal biosynthesis and maturation of collagen and elastin. It is expressed by vascular smooth muscle cells, and its increased expression has been previously found in atherosclerosis and in models of balloon angioplasty. The lysyl oxidase propeptide (LOX-PP) has more recently been found to have biological activity as a tumor suppressor, and it inhibits Erk1/2 Map kinase activation. We reasoned that LOX-PP may have functions in normal non-transformed cells. We, therefore, investigated its effects on smooth muscle cells, focusing on important biological processes mediated by Erk1/2-dependent signaling pathways including proliferation and matrix metalloproteinase-9 (MMP-9) expression. In addition, we investigated whether evidence for accumulation of LOX-PP could be found in vivo in a femoral artery injury model. Recombinant LOX-PP was expressed and purified, and was found to inhibit primary rat aorta smooth muscle cell proliferation and DNA synthesis by more than 50%. TNF-{alpha}-stimulated MMP-9 expression and Erk1/2 activation were both significantly inhibited by LOX-PP. Immunohistochemistry studies carried out with affinity purified anti-LOX-PP antibody showed that LOX-PP epitopes were expressed at elevated levels in vascular lesions of injured arteries. These novel data suggest that LOX-PP may provide a feedback control mechanism that serves to inhibit properties associated with the development of vascular pathology.

  17. Differential roles of NADPH oxidases in vascular physiology and pathophysiology

    PubMed Central

    Amanso, Angelica M.; Griendling, Kathy K.

    2012-01-01

    Reactive oxygen species (ROS) are produced by all vascular cells and regulate the major physiological functions of the vasculature. Production and removal of ROS are tightly controlled and occur in discrete subcellular locations, allowing for specific, compartmentalized signaling. Among the many sources of ROS in the vessel wall, NADPH oxidases are implicated in physiological functions such as control of vasomotor tone, regulation of extracellular matrix and phenotypic modulation of vascular smooth muscle cells. They are involved in the response to injury, whether as an oxygen sensor during hypoxia, as a regulator of protein processing, as an angiogenic stimulus, or as a mechanism of wound healing. These enzymes have also been linked to processes leading to disease development, including migration, proliferation, hypertrophy, apoptosis and autophagy. As a result, NADPH oxidases participate in atherogenesis, systemic and pulmonary hypertension and diabetic vascular disease. The role of ROS in each of these processes and diseases is complex, and a more full understanding of the sources, targets, cell-specific responses and counterbalancing mechanisms is critical for the rational development of future therapeutics. PMID:22202108

  18. Multivariate modular engineering of the protein secretory pathway for production of heterologous glucose oxidase in Pichia pastoris.

    PubMed

    Gu, Lei; Zhang, Juan; Du, Guocheng; Chen, Jian

    2015-01-01

    Limitations in protein production and secretion have been attributed to the inefficient folding rate of overexpressed proteins and the cellular response to the presence of overexpressed proteins in the endoplasmic reticulum (ER). In this study, we improved the yield of glucose oxidase (GOD) by manipulating genes involved in protein folding machinery and abnormal folding stress responses. First, genes with folding and secretion functions were used to modulate the folding rate of GOD in the ER and its secretion level in the cytoplasm. Next, the potential benefits of the ERAD elements were determined. Cellular resistance to ER derived stress was then strengthened by overexpressing the stress response gene GCN4. Furthermore, a module combination strategy, which co-expressed the SEC53, CNE1 and GCN4 genes, was employed to construct the Pichia pastoris strain S17. This increased the yield of GOD to 21.81g/L, with an activity of 1972.9U/mL, which were 2.53- and 5.11-fold higher, respectively, than the control strain. The work described here improved GOD production significantly, and the strategies employed in this study provide novel information for the large-scale production of heterologous proteins. PMID:25435503

  19. Peroxisomal amine oxidase of Hansenula polymorpha does not require its SRL-containing C-terminal sequence for targeting.

    PubMed

    Faber, K N; Haima, P; de Hoop, M J; Harder, W; Veenhuis, M; Ab, G

    1993-04-01

    Amine oxidase (AMO) is a peroxisomal matrix protein of Hansenula polymorpha, which is induced during growth of the yeast in media containing primary amines as a sole nitrogen source. The deduced amino acid sequence of the protein contains an SRL sequence at nine amino acids from the C-terminus. In this study, we have examined the possible role of the SRL motif in sorting of AMO to peroxisomes by mutating the corresponding gene sequence. For this purpose, we have developed a DNA construct that is specifically integrated into the AMO locus of the H. polymorpha genome, placing the mutant gene under the control of the endogenous AMO promoter and eliminating expression of the wild-type gene. Analysis of a stable transformant, containing the desired gene configuration, showed that mutation of the C-terminal sequence neither interfered with correct targeting of the protein into the peroxisome nor displayed significant effects on its activity. From this, it was concluded that the SRL-containing C-terminus is not essential for peroxisomal targeting of AMO in H. polymorpha. PMID:8511963

  20. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation?

    PubMed Central

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette

    2014-01-01

    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80 kb (cgAUS1) and 1.85 kb (cgAUS2a, 2b), encoding for proteins of 68–69 kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9 kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS–PAGE and shot-gun type nanoUHPLC–ESI-MS/MS. PMID:25109778

  1. Aldehyde oxidase cross-reacting material in the Aldoxn, cin, mal, and lxd mutants of Drosophila melanogaster.

    PubMed

    Browder, L W; Wilkes, J; Tucker, L

    1982-02-01

    Rocker immunoelectrophoresis was used to estimate aldehyde oxidase cross-reacting material (AO-CRM) in larval hemolymph and adult fly extracts in mutants with reduced AO enzymatic activity. Hemolymph of larvae homozygous for Aldoxn, which is a mutation of the presumed structural gene for AO, contains 30% of the wild-type CRM. The demonstration of AO-CRM in Aldoxn larval hemolymph is surprising since this genotype has been reported to lack CRM. By contrast, adult Aldoxn flies lack detectable CRM. The other AO-deficient mutants that were examined are cin, mal, and lxd; each has appreciable levels of CRM in both larval hemolymph and adult extract. Detection of CRM in these mutants helps to clarify conflicting reports in the literature. PMID:6178394

  2. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation.

    PubMed

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette

    2014-09-17

    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80kb (cgAUS1) and 1.85kb (cgAUS2a, 2b), encoding for proteins of 68-69kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS-PAGE and shot-gun type nanoUHPLC-ESI-MS/MS. PMID:25109778

  3. Polyphenol oxidase in potato. A multigene family that exhibits differential expression patterns.

    PubMed Central

    Thygesen, P W; Dry, I B; Robinson, S P

    1995-01-01

    Polyphenol oxidase (PPO) activity in potato (Solanum tuberosum) plants was high in stolons, tubers, roots, and flowers but low in leaves and stems. PPO activity per tuber continued to increase throughout tuber development but was highest on a fresh weight basis in developing tubers. PPO activity was greatest at the tuber exterior, including the skin and cortex tissue 1 to 2 mm beneath the skin. Flowers had high PPO activity throughout development, particularly in the anthers and ovary. Five distinct cDNA clones encoding PPO were isolated from developing tuber RNA. POT32 was the major form expressed in tubers and was found in all parts of the tuber and at all stages of tuber development. It was also expressed in roots but not in photosynthetic tissues. POT33 was expressed in tubers but mainly in the tissue near the skin. POT72 was detected in roots and at low levels in developing tubers. NOR333 was identical with the P2 PPO clone previously isolated from potato leaves (M.D. Hunt, N.T. Eannetta, Y. Haifeng, S.M. Newman, J.C. Steffens [1993] Plant Mol Biol 21: 59-68) and was detected in young leaves and in tissue near the tuber skin but was highly expressed in flowers. The results indicate that PPO is present as a small multigene family in potato and that each gene has a specific temporal and spatial pattern of expression. PMID:7480344

  4. Is fetal brain monoamine oxidase inhibition the missing link between maternal smoking and conduct disorders?

    PubMed

    Baler, Ruben D; Volkow, Nora D; Fowler, Joanna S; Benveniste, Helene

    2008-05-01

    Smoking is the leading cause of preventable illness in the world today. Prenatal cigarette smoke exposure (PCSE) is a particularly insidious form because so many of its associated health effects befall the unborn child and produce behavioural outcomes that manifest themselves only years later. Among these are the associations between PCSE and conduct disorders, which have been mostly ascribed to the deleterious effects of nicotine on the fetal brain. Here we hypothesize that inhibition of brain monoamine oxidase (MAO) during fetal brain development, secondary to maternal cigarette smoking and in addition to nicotine, is a likely contributor to this association. MAOs play a central role in monoaminergic balance in the brain, and their inhibition during fetal development - but not during adult life - is known to result in an aggressive phenotype in laboratory animals. This paper provides theoretical and experimental support for the notion that cigarette smoke-induced inhibition of MAO in the fetal brain, particularly when it occurs in combination with polymorphisms in the MAOA gene that lead to lower enzyme concentration in the brain, may result in brain morphologic and functional changes that enhance the risk of irritability, poor self-control and aggression in the offspring. It also encourages research to evaluate whether the interaction of smoking exposure during fetal development and MAOA genotype increases the risk for conduct disorder over that incurred by mere fetal exposure to tobacco smoke. PMID:18592036

  5. Polyphenol oxidase in potato. A multigene family that exhibits differential expression patterns.

    PubMed

    Thygesen, P W; Dry, I B; Robinson, S P

    1995-10-01

    Polyphenol oxidase (PPO) activity in potato (Solanum tuberosum) plants was high in stolons, tubers, roots, and flowers but low in leaves and stems. PPO activity per tuber continued to increase throughout tuber development but was highest on a fresh weight basis in developing tubers. PPO activity was greatest at the tuber exterior, including the skin and cortex tissue 1 to 2 mm beneath the skin. Flowers had high PPO activity throughout development, particularly in the anthers and ovary. Five distinct cDNA clones encoding PPO were isolated from developing tuber RNA. POT32 was the major form expressed in tubers and was found in all parts of the tuber and at all stages of tuber development. It was also expressed in roots but not in photosynthetic tissues. POT33 was expressed in tubers but mainly in the tissue near the skin. POT72 was detected in roots and at low levels in developing tubers. NOR333 was identical with the P2 PPO clone previously isolated from potato leaves (M.D. Hunt, N.T. Eannetta, Y. Haifeng, S.M. Newman, J.C. Steffens [1993] Plant Mol Biol 21: 59-68) and was detected in young leaves and in tissue near the tuber skin but was highly expressed in flowers. The results indicate that PPO is present as a small multigene family in potato and that each gene has a specific temporal and spatial pattern of expression. PMID:7480344

  6. Lipid Accumulation, Lipid Body Formation, and Acyl Coenzyme A Oxidases of the Yeast Yarrowia lipolytica

    PubMed Central

    Mlí?ková, Kate?ina; Roux, Emeline; Athenstaedt, Karin; d'Andrea, Sabine; Daum, Günther; Chardot, Thierry; Nicaud, Jean-Marc

    2004-01-01

    Yarrowia lipolytica contains five acyl-coenzyme A oxidases (Aox), encoded by the POX1 to POX5 genes, that catalyze the limiting step of peroxisomal ?-oxidation. In this study, we analyzed morphological changes of Y. lipolytica growing in an oleic acid medium and the effect of POX deletions on lipid accumulation. Protrusions involved in the uptake of lipid droplets (LDs) from the medium were seen in electron micrographs of the surfaces of wild-type cells grown on oleic acid. The number of protrusions and surface-bound LDs increased during growth, but the sizes of the LDs decreased. The sizes of intracellular lipid bodies (LBs) and their composition depended on the POX genotype. Only a few, small, intracellular LBs were observed in the mutant expressing only Aox4p (?pox2 ?pox3 ?pox5), but strains expressing either Aox3p or both Aox3p and Aox4p had the same number of LBs as did the wild type. In contrast, strains expressing either Aox2p or both Aox2p and Aox4p formed fewer, but larger, LBs than did the wild type. The size of the LBs increased proportionately with the amount of triacylglycerols in the LBs of the mutants. In summary, Aox2p expression regulates the size of cellular triacylglycerol pools and the size and number of LBs in which these fatty acids accumulate. PMID:15240264

  7. NDUFA4 Mutations Underlie Dysfunction of a Cytochrome c Oxidase Subunit Linked to Human Neurological Disease

    PubMed Central

    Pitceathly, Robert D.S.; Rahman, Shamima; Wedatilake, Yehani; Polke, James M.; Cirak, Sebahattin; Foley, A. Reghan; Sailer, Anna; Hurles, Matthew E.; Stalker, Jim; Hargreaves, Iain; Woodward, Cathy E.; Sweeney, Mary G.; Muntoni, Francesco; Houlden, Henry; Taanman, Jan-Willem; Hanna, Michael G.

    2013-01-01

    Summary The molecular basis of cytochrome c oxidase (COX, complex IV) deficiency remains genetically undetermined in many cases. Homozygosity mapping and whole-exome sequencing were performed in a consanguineous pedigree with isolated COX deficiency linked to a Leigh syndrome neurological phenotype. Unexpectedly, affected individuals harbored homozygous splice donor site mutations in NDUFA4, a gene previously assigned to encode a mitochondrial respiratory chain complex I (NADH:ubiquinone oxidoreductase) subunit. Western blot analysis of denaturing gels and immunocytochemistry revealed undetectable steady-state NDUFA4 protein levels, indicating that the mutation causes a loss-of-function effect in the homozygous state. Analysis of one- and two-dimensional blue-native polyacrylamide gels confirmed an interaction between NDUFA4 and the COX enzyme complex in control muscle, whereas the COX enzyme complex without NDUFA4 was detectable with no abnormal subassemblies in patient muscle. These observations support recent work in cell lines suggesting that NDUFA4 is an additional COX subunit and demonstrate that NDUFA4 mutations cause human disease. Our findings support reassignment of the NDUFA4 protein to complex IV and suggest that patients with unexplained COX deficiency should be screened for NDUFA4 mutations. PMID:23746447

  8. Characterization of a new aryl-alcohol oxidase secreted by the phytopathogenic fungus Ustilago maydis.

    PubMed

    Couturier, Marie; Mathieu, Yann; Li, Ai; Navarro, David; Drula, Elodie; Haon, Mireille; Grisel, Sacha; Ludwig, Roland; Berrin, Jean-Guy

    2016-01-01

    The discovery of novel fungal lignocellulolytic enzymes is essential to improve the breakdown of plant biomass for the production of second-generation biofuels or biobased materials in green biorefineries. We previously reported that Ustilago maydis grown on maize secreted a diverse set of lignocellulose-acting enzymes including hemicellulases and putative oxidoreductases. One of the most abundant proteins of the secretome was a putative glucose-methanol-choline (GMC) oxidoreductase. The phylogenetic prediction of its function was hampered by the few characterized members within its clade. Therefore, we cloned the gene and produced the recombinant protein to high yield in Pichia pastoris. Functional screening using a library of substrates revealed that this enzyme was able to oxidize several aromatic alcohols. Of the tested aryl-alcohols, the highest oxidation rate was obtained with 4-anisyl alcohol. Oxygen, 1,4-benzoquinone, and 2,6-dichloroindophenol can serve as electron acceptors. This GMC oxidoreductase displays the characteristics of an aryl-alcohol oxidase (E.C.1.1.3.7), which is suggested to act on the lignin fraction in biomass. PMID:26452496

  9. Higd1a is a positive regulator of cytochrome c oxidase

    PubMed Central

    Hayashi, Takaharu; Asano, Yoshihiro; Shintani, Yasunori; Aoyama, Hiroshi; Kioka, Hidetaka; Tsukamoto, Osamu; Hikita, Masahide; Shinzawa-Itoh, Kyoko; Takafuji, Kazuaki; Higo, Shuichiro; Kato, Hisakazu; Yamazaki, Satoru; Matsuoka, Ken; Nakano, Atsushi; Asanuma, Hiroshi; Asakura, Masanori; Minamino, Tetsuo; Goto, Yu-ichi; Ogura, Takashi; Kitakaze, Masafumi; Komuro, Issei; Sakata, Yasushi; Tsukihara, Tomitake; Yoshikawa, Shinya; Takashima, Seiji

    2015-01-01

    Cytochrome c oxidase (CcO) is the only enzyme that uses oxygen to produce a proton gradient for ATP production during mitochondrial oxidative phosphorylation. Although CcO activity increases in response to hypoxia, the underlying regulatory mechanism remains elusive. By screening for hypoxia-inducible genes in cardiomyocytes, we identified hypoxia inducible domain family, member 1A (Higd1a) as a positive regulator of CcO. Recombinant Higd1a directly integrated into highly purified CcO and increased its activity. Resonance Raman analysis revealed that Higd1a caused structural changes around heme a, the active center that drives the proton pump. Using a mitochondria-targeted ATP biosensor, we showed that knockdown of endogenous Higd1a reduced oxygen consumption and subsequent mitochondrial ATP synthesis, leading to increased cell death in response to hypoxia; all of these phenotypes were rescued by exogenous Higd1a. These results suggest that Higd1a is a previously unidentified regulatory component of CcO, and represents a therapeutic target for diseases associated with reduced CcO activity. PMID:25605899

  10. Ectopic expression of ecdysone oxidase impairs tissue degeneration in Bombyx mori.

    PubMed

    Li, Zhiqian; You, Lang; Zeng, Baosheng; Ling, Lin; Xu, Jun; Chen, Xu; Zhang, Zhongjie; Palli, Subba Reddy; Huang, Yongping; Tan, Anjiang

    2015-06-22

    Metamorphosis in insects includes a series of programmed tissue histolysis and remolding processes that are controlled by two major classes of hormones, juvenile hormones and ecdysteroids. Precise pulses of ecdysteroids (the most active ecdysteroid is 20-hydroxyecdysone, 20E), are regulated by both biosynthesis and metabolism. In this study, we show that ecdysone oxidase (EO), a 20E inactivation enzyme, expresses predominantly in the midgut during the early pupal stage in the lepidopteran model insect, Bombyx mori. Depletion of BmEO using the transgenic CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/RNA-guided Cas9 nucleases) system extended the duration of the final instar larval stage. Ubiquitous transgenic overexpression of BmEO using the Gal4/UAS system induced lethality during the larval-pupal transition. When BmEO was specifically overexpressed in the middle silk gland (MSG), degeneration of MSG at the onset of metamorphosis was blocked. Transmission electron microscope and LysoTracker analyses showed that the autophagy pathway in MSG is inhibited by BmEO ectopic expression. Furthermore, RNA-seq analysis revealed that the genes involved in autophagic cell death and the mTOR signal pathway are affected by overexpression of BmEO. Taken together, BmEO functional studies reported here provide insights into ecdysone regulation of tissue degeneration during metamorphosis. PMID:26041352

  11. Contributions of spinal d-amino acid oxidase to chronic morphine-induced hyperalgesia.

    PubMed

    Ma, Shuai; Li, Xin-Yan; Gong, Nian; Wang, Yong-Xiang

    2015-12-10

    Spinal d-amino acid oxidase (DAAO) is an FAD-dependent peroxisomal flavoenzyme which mediates the conversion of neutral and polar d-amino acids (including d-serine) to the corresponding ?-keto acids, and simultaneously produces hydrogen peroxide and ammonia. This study has aimed to explore the potential contributions of spinal DAAO and its mediated hydrogen peroxide/d-serine metabolism to the development of morphine-induced hyperalgesia. Bi-daily subcutaneous injections of morphine to mice over 7 days induced thermal hyperalgesia as measured by both the hot-plate and tail-immersion tests, and spinal astroglial activation with increased spinal gene expression of DAAO, glial fibrillary acidic protein (GFAP) and pro-inflammatory cytokines (interleukin-1? (IL-1?), interleukin-6 (IL-6) and tumor necrosis factor-? (TNF-?)). Subcutaneous injections of the potent DAAO inhibitor CBIO (5-chloro-benzo[d]isoxazol-3-ol) prevented and reversed the chronic morphine-induced hyperalgesia. CBIO also inhibited both astrocyte activation and the expression of pro-inflammatory cytokines. Intrathecal injection of the hydrogen peroxide scavenger PBN (phenyl-N-tert-butylnitrone) and of catalase completely reversed established morphine hyperalgesia, whereas subcutaneous injections of exogenous d-serine failed to alter chronic morphine-induced hyperalgesia. These results provided evidence that spinal DAAO and its subsequent production of hydrogen peroxide rather than the d-serine metabolism contributed to the development of morphine-induced hyperalgesia. PMID:25850373

  12. Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

    PubMed

    Jung, Sunyo; Back, Kyoungwhan

    2005-05-01

    We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria. PMID:15890521

  13. Proline oxidase-adipose triglyceride lipase pathway restrains adipose cell death and tissue inflammation.

    PubMed

    Lettieri Barbato, D; Aquilano, K; Baldelli, S; Cannata, S M; Bernardini, S; Rotilio, G; Ciriolo, M R

    2014-01-01

    The nutrient-sensing lipolytic enzyme adipose triglyceride lipase (ATGL) has a key role in adipose tissue function, and alterations in its activity have been implicated in many age-related metabolic disorders. In adipose tissue reduced blood vessel density is related to hypoxia state, cell death and inflammation. Here we demonstrate that adipocytes of poorly vascularized enlarged visceral adipose tissue (i.e. adipose tissue of old mice) suffer from limited nutrient delivery. In particular, nutrient starvation elicits increased activity of mitochondrial proline oxidase/dehydrogenase (POX/PRODH) that is causal in triggering a ROS-dependent induction of ATGL. We demonstrate that ATGL promotes the expression of genes related to mitochondrial oxidative metabolism (peroxisome proliferator-activated receptor-?, peroxisome proliferator-activated receptor-? coactivator-1?), thus setting a metabolic switch towards fat utilization that supplies energy to starved adipocytes and prevents cell death, as well as adipose tissue inflammation. Taken together, these results identify ATGL as a stress resistance mediator in adipocytes, restraining visceral adipose tissue dysfunction typical of age-related metabolic disorders. PMID:24096872

  14. Oxidized low-density lipoproteins upregulate proline oxidase to initiate ROS-dependent autophagy.

    PubMed

    Zabirnyk, Olga; Liu, Wei; Khalil, Shadi; Sharma, Anit; Phang, James M

    2010-03-01

    Epidemiological studies showed that high levels of oxidized low-density lipoproteins (oxLDLs) are associated with increased cancer risk. We examined the direct effect of physiologic concentrations oxLDL on cancer cells. OxLDLs were cytotoxic and activate both apoptosis and autophagy. OxLDLs have ligands for peroxisome proliferator-activated receptor gamma and upregulated proline oxidase (POX) through this nuclear receptor. We identified 7-ketocholesterol (7KC) as a main component responsible for the latter. To elucidate the role of POX in oxLDL-mediated cytotoxicity, we knocked down POX via small interfering RNA and found that this (i) further reduced viability of cancer cells treated with oxLDL; (ii) decreased oxLDL-associated reactive oxygen species generation; (iii) decreased autophagy measured via beclin-1 protein level and light-chain 3 protein (LC3)-I into LC3-II conversion. Using POX-expressing cell model, we established that single POX overexpression was sufficient to activate autophagy. Thus, it led to autophagosomes accumulation and increased conversion of LC3-I into LC3-II. Moreover, beclin-1 gene expression was directly dependent on POX catalytic activity, namely the generation of POX-dependent superoxide. We conclude that POX is critical in the cellular response to the noxious effects of oxLDL by activating protective autophagy. PMID:19942609

  15. Evolution of the couple cytochrome c and cytochrome c oxidase in Primates

    PubMed Central

    Pierron, Denis; Wildman, Derek E.; Hüttemann, Maik; Letellier, Thierry; Grossman, Lawrence I.

    2013-01-01

    Mitochondrial energy metabolism has been affected by a broad set of ancient and recent evolutionary events. The oldest example is the endosymbiosis theory that led to mitochondria and a recently proposed example is adaptation to cold climate by anatomically modern human lineages. Mitochondrial energy metabolism has also been associated with an important area in anthropology and evolutionary biology, brain enlargement in human evolution. Indeed, several studies have pointed to the need for a major metabolic rearrangement to supply a sufficient amount of energy for brain development in primates. The gene encoding for the coupled cytochrome c (cyt c) / cytochrome c oxidase (COX, complex IV, EC 1.9.3.1) seems to have an exceptional pattern of evolution in the anthropoid lineage. It has been proposed that this evolution was linked to the rearrangement of energy metabolism needed for brain enlargement. This hypothesis is reinforced by the fact that the COX enzyme was proposed to have a large role in control of the respiratory chain and thereby global energy production. After summarizing major events that occurred during the evolution of COX and cytochrome c on the primate lineage, we review the different evolutionary forces that could have influenced primate COX evolution and discuss the probable causes and consequence of this evolution. Finally, we discuss and review the co-occurring primate phenotypic evolution. PMID:22729859

  16. Platelet monoamine oxidase (MAO) activity: evidence for a single major locus.

    PubMed Central

    Rice, J; McGuffin, P; Goldin, L R; Shaskan, E G; Gershon, E S

    1984-01-01

    Monoamine oxidase (MAO), a mitochondrial enzyme involved in the degradation of biogenic amines, has been associated with psychiatric morbidity. Although twin and family studies have indicated that MAO activity is familial, the exact mode of transmission is unclear. We performed segregation analysis on 154 nuclear families containing 419 individuals using the mixed model, which allows for a single major locus with a polygenic background. We were able to reject a dominant and additive locus with or without a heritable background and a recessive locus without background. The acceptable models were: (1) a codominant model without background where the mean of the heterozygote distribution was 30% of the distance from the low to the high homozygote distributions, and (2) a recessive locus with heritable background. In both cases, the gene frequency for the high-MAO allele is approximately .25--at odds with suggestions that low-MAO represents a genetic marker for a disorder such as schizophrenia with a lifetime risk of only 0.85%. To ensure that results were not artifacts from a familial, skewed distribution, the data were also analyzed after power transformation. In addition, hypotheses were tested using both the joint and conditional likelihoods to examine for possible misspecification of the model with respect to intergenerational differences. Finally, we allowed for non-Mendelian transmission probabilities to provide another class of alternatives against which to test the hypothesis of a major locus. All these approaches provided additional confirmation for the presence of a major locus segregating within these families. PMID:6695924

  17. Polyphenol oxidase overexpression in transgenic Populus enhances resistance to herbivory by forest tent caterpillar (Malacosoma disstria).

    PubMed

    Wang, Jiehua; Constabel, C Peter

    2004-11-01

    In order to functionally analyze the predicted defensive role of leaf polyphenol oxidase (PPO; EC 1.10.3.1) in Populus, transgenic hybrid aspen (Populus tremula x P. alba) plants overexpressing a hybrid poplar (Populus trichocarpa x P. deltoides) PtdPPO1 gene were constructed. Regenerated transgenic plants showed high PPO enzyme activity, PtdPPO1 mRNA levels and PPO protein accumulation. In leaf disk bioassays, forest tent caterpillar (Malacosoma disstria) larvae feeding on PPO-overexpressing transgenics experienced significantly higher mortality and reduced average weight gain compared to larvae feeding on control leaves. However, this effect was observed only when older egg masses were used and the resulting larvae showed reduced growth and vigor. In choice tests, no effect of PPO overexpression was detected. Although PPO in poplar leaves is latent and requires activation with detergents or trypsin for full enzymatic activity, in caterpillar frass the enzyme was extracted in the fully activated form. This activation correlated with partial proteolytic cleavage, suggesting that PPO latency and activation during digestion could be an adaptive and defense-related feature of poplar PPO. PMID:15309534

  18. Low expression of the antibacterial factor L-amino acid oxidase in bovine mammary gland.

    PubMed

    Nagaoka, Kentaro; Zhang, Haolin; Arakuni, Masahiro; Taya, Kazuyoshi; Watanabe, Gen

    2014-12-01

    In the mouse, L-amino acid oxidase (LAO) produces hydrogen peroxide by utilizing free amino acids and is a proven antibacterial factor in mammary glands. Mastitis, a bacterial infection of the mammary gland, is the most frequent disease in dairy cattle. Here, we investigate whether LAO is expressed in the mammary gland of dairy cattle and is antibacterial. In dairy cattle, the expression level of LAO mRNA in the mammary gland was considerably lower than that in mice, and LAO activity was not observed in cattle milk that produced hydrogen peroxide. The expression of LAO mRNA was also low in Japanese Black cattle, the same as in Holstein cattle. A higher LAO mRNA expression was observed in the mastitis glands than in the lactating glands. Furthermore, spleen and lymph nodes expressed high levels of LAO mRNA in dairy cattle. We conclude that mammary glands in dairy cattle have lower ability to express the LAO gene compared to that in mice, which may result in a high incidence of mastitis. PMID:24961772

  19. Expression, purification, and characterization of galactose oxidase of Fusarium sambucinum in E. coli

    PubMed Central

    Paukner, Regina; Staudigl, Petra; Choosri, Withu; Haltrich, Dietmar; Leitner, Christian

    2015-01-01

    A gene encoding a galactose oxidase (GalOx) was isolated from Fusarium sambucinum cultures and overexpressed in Escherichia coli yielding 4.4 mg enzyme per L of growth culture with a specific activity of 159 U mg?1. By adding a C-terminal His-tag the enzyme could be easily purified with a single affinity chromatography step with high recovery rate (90%). The enzyme showed a single band on SDS–PAGE with an apparent molecular mass of 68.5 kDa. The pH optimum for the oxidation of galactose was in the range of pH 6–7.5. Optimum temperature for the enzyme activity was 35 °C, with a half-life of 11.2 min, 5.3 min, and 2.7 min for incubation at 40 °C, 50 °C, and 60 °C, respectively. From all tested substrates, the highest relative activity was found for 1-methyl-?-galactopyranoside (226 U mg?1) and the highest catalytic efficiency (kcat/Km) for melibiose (2700 mM?1 s?1). The enzyme was highly specific for molecular oxygen as an electron acceptor, and showed no appreciable activity with a range of alternative acceptors investigated. Different chemicals were tested for their effect on GalOx activity. The activity was significantly reduced by EDTA, NaN3, and KCN. PMID:25543085

  20. The xanthine oxidase inhibitor febuxostat suppresses development of nonalcoholic steatohepatitis in a rodent model.

    PubMed

    Nakatsu, Yusuke; Seno, Yasuyuki; Kushiyama, Akifumi; Sakoda, Hideyuki; Fujishiro, Midori; Katasako, Aya; Mori, Keiichi; Matsunaga, Yasuka; Fukushima, Toshiaki; Kanaoka, Ryuhei; Yamamotoya, Takeshi; Kamata, Hideaki; Asano, Tomoichiro

    2015-07-01

    Xanthine oxidase (XO) is an enzyme involved in the production of uric acid (UA) from purine nucleotides. Numerous recent studies have revealed the likelihood of metabolic syndrome including nonalcoholic fatty liver disease (NAFLD) or steatohepatitis (NASH) to be related to hyperuricemia. However, it remains unclear whether elevated serum UA during the development of NAFLD or NASH is a cause or a consequence of these diseases. In this study, the XO inhibitor febuxostat was administered to two types of NASH model mice. Febuxostat exerted a strong protective effect against NASH development induced by a high-fat diet containing trans fatty acid (HFDT). In contrast, methionine choline-deficient-diet-induced NASH development not accompanied by hyperuricemia showed no UA normalization, suggesting that the ameliorating effect of febuxostat occurs via the normalization of hyperuricemia itself and/or accompanying molecular mechanism(s) such as oxidative stress. In the HFDT-fed mice, hyperuricemia, elevated alanine aminotransferase, and increased Tunnel-positive cells in the liver were normalized by febuxostat administration. In addition, upregulation of fatty acid oxidation-related genes, fibrotic change, and increases in collagen deposition, inflammatory cytokine expressions, and lipid peroxidation in the HFDT-fed mice were also normalized by febuxostat administration. Taken together, these observations indicate that administration of febuxostat has a protective effect against HFDT-induced NASH development, suggesting the importance of XO in its pathogenesis. Thus XO inhibitors are potentially potent therapies for patients with NASH, particularly that associated with hyperuricemia. PMID:25999428

  1. Nox Family NADPH Oxidases in Mechano-Transduction: Mechanisms and Consequences

    PubMed Central

    Weissmann, Norbert; Schröder, Katrin

    2014-01-01

    Abstract Significance: The majority of cells in a multi-cellular organism are continuously exposed to ever-changing physical forces. Mechano-transduction links these events to appropriate reactions of the cells involving stimulation of signaling cascades, reorganization of the cytoskeleton and alteration of gene expression. Recent Advances: Mechano-transduction alters the cellular redox balance and the formation of reactive oxygen species (ROS). Nicotine amide adenine dinucleotide reduced form (NADPH) oxidases of the Nox family are prominent ROS generators and thus, contribute to this stress-induced ROS formation. Critical Issues: Different types and patterns of mechano-stress lead to Nox-dependent ROS formation and Nox-mediated ROS formation contributes to cellular responses and adaptation to physical forces. Thereby, Nox enzymes can mediate vascular protection during physiological mechano-stress. Despite this, over-activation and induction of Nox enzymes and a subsequent substantial increase in ROS formation also promotes oxidative stress in pathological situations like disturbed blood flow or extensive stretch. Future Directions: Individual protein targets of Nox-mediated redox-signaling will be identified to better understand the specificity of Nox-dependent ROS signaling in mechano-transduction. Nox-inhibitors will be tested to reduce cellular activation in response to mechano-stimuli. Antioxid. Redox Signal. 20, 887–898. PMID:23682993

  2. Lysyl Oxidase Activity Is Required for Ordered Collagen Fibrillogenesis by Tendon Cells.

    PubMed

    Herchenhan, Andreas; Uhlenbrock, Franziska; Eliasson, Pernilla; Weis, MaryAnn; Eyre, David; Kadler, Karl E; Magnusson, S Peter; Kjaer, Michael

    2015-06-26

    Lysyl oxidases (LOXs) are a family of copper-dependent oxido-deaminases that can modify the side chain of lysyl residues in collagen and elastin, thereby leading to the spontaneous formation of non-reducible aldehyde-derived interpolypeptide chain cross-links. The consequences of LOX inhibition in producing lathyrism are well documented, but the consequences on collagen fibril formation are less clear. Here we used ?-aminoproprionitrile (BAPN) to inhibit LOX in tendon-like constructs (prepared from human tenocytes), which are an experimental model of cell-mediated collagen fibril formation. The improvement in structure and strength seen with time in control constructs was absent in constructs treated with BAPN. As expected, BAPN inhibited the formation of aldimine-derived cross-links in collagen, and the constructs were mechanically weak. However, an unexpected finding was that BAPN treatment led to structurally abnormal collagen fibrils with irregular profiles and widely dispersed diameters. Of special interest, the abnormal fibril profiles resembled those seen in some Ehlers-Danlos Syndrome phenotypes. Importantly, the total collagen content developed normally, and there was no difference in COL1A1 gene expression. Collagen type V, decorin, fibromodulin, and tenascin-X proteins were unaffected by the cross-link inhibition, suggesting that LOX regulates fibrillogenesis independently of these molecules. Collectively, the data show the importance of LOX for the mechanical development of early collagenous tissues and that LOX is essential for correct collagen fibril shape formation. PMID:25979340

  3. The MeJA-inducible copper amine oxidase AtAO1 is expressed in xylem tissue and guard cells.

    PubMed

    Ghuge, Sandip A; Carucci, Andrea; Rodrigues-Pousada, Renato A; Tisi, Alessandra; Franchi, Stefano; Tavladoraki, Paraskevi; Angelini, Riccardo; Cona, Alessandra

    2015-10-01

    Copper amine oxidases oxidize the polyamine putrescine to 4-aminobutanal with the production of the plant signal molecule hydrogen peroxide (H2O2) and ammonia. The Arabidopsis (Arabidopsis thaliana) gene At4g14940 (AtAO1, previously referred to as ATAO1) encodes an apoplastic copper amine oxidase expressed in lateral root cap cells and developing xylem, especially in root protoxylem and metaxylem precursors. In our recent study, we demonstrated that AtAO1 expression is strongly induced in the root vascular tissues by the wound-signal hormone methyl jasmonate (MeJA). Furthermore, we also demonstrated that the H2O2 derived by the AtAO1-driven oxidation of putrescine, mediates the MeJA-induced early protoxylem differentiation in Arabidopsis roots. H2O2 may contribute to protoxylem differentiation by signaling developmental cell death and by acting as co-substrate in peroxidase-mediated cell wall stiffening and lignin polymerization. Here, by the means of AtAO1 promoter::green fluorescent protein-?-glucuronidase (AtAO1::GFP-GUS) fusion analysis, we show that a strong AtAO1 gene expression occurs also in guard cells of leaves and flowers. The high expression levels of AtAO1 in tissues or cell types regulating water supply and water loss may suggest a role of the encoded protein in water balance homeostasis, by modulating coordinated adjustments in anatomical and functional features of xylem tissue and guard cells during acclimation to adverse environmental conditions. PMID:26241131

  4. "Peroxidatic" form of cytochrome oxidase as studied by X-ray absorption spectroscopy.

    PubMed Central

    Chance, B; Kumar, C; Powers, L; Ching, Y C

    1983-01-01

    X-ray absorption spectroscopy shows pulsed oxidase to be similar to resting oxidase but to lack the sulfur bridge between iron and copper of active sites (Powers, L., Y. Ching, B. Chance, and B. Muhoberac, 1982, Biophys. J., 37[2, Pt. 2]: 403a. [Abstr.] ) The first shell ligands and bond lengths of the pulsed oxidase active site heme most clearly fit the ferric peroxidases from horseradish and yeast, and the pulsed oxidase cyanide compound resembles the low spin hemoprotein cyanide compounds. The structural results are consistent with an aquo or a peroxo form for pulsed oxidase as is also observed by optical studies. These structural and chemical data are consistent with a role for the pulsed forms in a cyclic peroxidatic side reaction in which the pulsed and pulsed peroxide compounds act as peroxide scavengers. The peroxidatic role of cytochrome oxidase in the nonsulfur bridged form suggests the renaming of the "oxygenated" or "pulsed" forms on a functional basis as "peroxidatic" forms of cytochrome oxidase. PMID:6318841

  5. NADPH oxidase mediates the expression of MMP-9 in cerebral tissue after ischemia-reperfusion damage.

    PubMed

    Tang, Xiangqi; Zhong, Wei; Tu, Qiuyun; Ding, Binrong

    2014-02-01

    Oxygen free radicals and their reactive lipid peroxidation are known to be elements promoting ischemia-reperfusion damage. NADPH oxidase is a major factor in peroxide production. Excessive production of oxygen free radicals is considered as an important mechanism in the expression of matrix metalloproteinase (MMP)-9 and in damage to the blood-brain barrier (BBB). In this study, we evaluated changes in the expression of the NADPH oxidase catalytic subunit gp91(phox) and oxidase activity, as well as the involvement of NADPH oxidase catalysis in the expression of MMP-9 in cerebral tissue after ischemia-reperfusion damage. A middle cerebral artery occlusion (MCAO) model was established using male Sprague-Dawley (SD) rats. Brain tissue was isolated for triphenyltetrazolium chloride (TTC) staining, gp91(phox) mRNA quantitative PCR analysis, western blot analysis, NADPH oxidase activity determination (detection), and MMP-9 gelatin zymography analysis. In the MCAO rats, gp91(phox) and MMP-9 expression was upregulated in the ischemic hemisphere of the brain tissue after 90 minutes of MCAO with 22·5 hours of reperfusion. Inhibition of NADPH oxidase with apocynin reduced the increase in MMP-9. These results suggest that NADPH oxidase is a major precipitating factor for the expression of MMP-9 in the ischemic brain tissue. PMID:24131725

  6. Partial purification of gibberellin oxidases from spinach leaves. [Spinacia oleracea L

    SciTech Connect

    Gilmour, S.J.; Bleecker, A.B.; Zeevaart, J.A.D.

    1987-09-01

    Four enzyme activities catalyzing the following oxidative steps in the gibberellin (GA) biosynthetic pathway have been extracted from spinach (Spinacia oleracea L.) leaves after exposure to 8 long days: GA/sub 12/ ..-->.. GA/sub 53/ ..-->.. GA/sub 44/ ..-->.. GA/sub 19/ ..-->.. GA/sub 20/. Two of these, GA/sub 53/ oxidase and GA/sup 19/ oxidase, were separable from the other two, GA/sub 44/ oxidase and GA/sub 12/ 13-hydroxylase, by anion exchange high performance liquid chromatography (HPLC). Apparent molecular weights of the four enzymes as determined by gel filtration HLPL are: GA/sub 12/ 13-hydroxylase, 28,400; GA/sub 43/ oxidase, 42,500; GA/sub 44/ oxidase, 38,100; GA/sub 19/ oxidase, 39,500. GA/sub 44/ oxidase was purified approximately 100-fold in 0.3% yield by a combination of ammonium sulfate fractionation, anion exchange HPLC, phenyl-Sepharose chromatography and gel filtration HLPC.

  7. Regulation of NADPH Oxidase in Vascular Endothelium: The Role of Phospholipases, Protein Kinases, and Cytoskeletal Proteins

    PubMed Central

    Pendyala, Srikanth; Usatyuk, Peter V.; Gorshkova, Irina A.; Garcia, Joe G.N.

    2009-01-01

    The generation of reactive oxygen species (ROS) in the vasculature plays a major role in the genesis of endothelial cell (EC) activation and barrier function. Of the several potential sources of ROS in the vasculature, the endothelial NADPH oxidase family of proteins is a major contributor of ROS associated with lung inflammation, ischemia/reperfusion injury, sepsis, hyperoxia, and ventilator-associated lung injury. The NADPH oxidase in lung ECs has most of the components found in phagocytic oxidase, and recent studies show the expression of several homologues of Nox proteins in vascular cells. Activation of NADPH oxidase of nonphagocytic vascular cells is complex and involves assembly of the cytosolic (p47phox, p67phox, and Rac1) and membrane-associated components (Noxes and p22phox). Signaling pathways leading to NADPH oxidase activation are not completely defined; however, they do appear to involve the cytoskeleton and posttranslation modification of the components regulated by protein kinases, protein phosphatases, and phospholipases. Furthermore, several key components regulating NADPH oxidase recruitment, assembly, and activation are enriched in lipid microdomains to form a functional signaling platform. Future studies on temporal and spatial localization of Nox isoforms will provide new insights into the role of NADPH oxidase–derived ROS in the pathobiology of lung diseases. Antioxid. Redox Signal. 11, 841–860. PMID:18828698

  8. Conserved evolutionary units in the heme-copper oxidase superfamily revealed by novel homologous protein families

    PubMed Central

    Pei, Jimin; Li, Wenlin; Kinch, Lisa N; Grishin, Nick V

    2014-01-01

    The heme-copper oxidase (HCO) superfamily includes HCOs in aerobic respiratory chains and nitric oxide reductases (NORs) in the denitrification pathway. The HCO/NOR catalytic subunit has a core structure consisting of 12 transmembrane helices (TMHs) arranged in three-fold rotational pseudosymmetry, with six conserved histidines for heme and metal binding. Using sensitive sequence similarity searches, we detected a number of novel HCO/NOR homologs and named them HCO Homology (HCOH) proteins. Several HCOH families possess only four TMHs that exhibit the most pronounced similarity to the last four TMHs (TMHs 9–12) of HCOs/NORs. Encoded by independent genes, four-TMH HCOH proteins represent a single evolutionary unit (EU) that relates to each of the three homologous EUs of HCOs/NORs comprising TMHs 1–4, TMHs 5–8, and TMHs 9–12. Single-EU HCOH proteins could form homotrimers or heterotrimers to maintain the general structure and ligand-binding sites defined by the HCO/NOR catalytic subunit fold. The remaining HCOH families, including NnrS, have 12-TMHs and three EUs. Most three-EU HCOH proteins possess two conserved histidines and could bind a single heme. Limited experimental studies and genomic context analysis suggest that many HCOH proteins could function in the denitrification pathway and in detoxification of reactive molecules such as nitric oxide. HCO/NOR catalytic subunits exhibit remarkable structural similarity to the homotrimers of MAPEG (membrane-associated proteins in eicosanoid and glutathione metabolism) proteins. Gene duplication, fusion, and fission likely play important roles in the evolution of HCOs/NORs and HCOH proteins. PMID:24931479

  9. Patterns of Protein Evolution in Cytochrome c Oxidase 1 (COI) from the Class Arachnida

    PubMed Central

    Young, Monica R; Hebert, Paul D. N.

    2015-01-01

    Because sequence information is now available for the 648bp barcode region of cytochrome c oxidase 1 (COI) from more than 400,000 animal species, this gene segment can be used to probe patterns of mitochondrial evolution. The present study examines levels of amino acid substitution and the frequency of indels in COI from 4177 species of arachnids, including representatives from all 16 orders and 43% of its families (267/625). It examines divergences at three taxonomic levels—among members of each order to an outgroup, among families in each order and among BINs, a species proxy, in each family. Order Distances vary fourfold (0.10–0.39), while the mean of the Family Distances for the ten orders ranges fivefold (0.07–0.35). BIN Distances show great variation, ranging from 0.01 or less in 12 families to more than 0.25 in eight families. Patterns of amino acid substitution in COI are generally congruent with previously reported variation in nucleotide substitution rates in arachnids, but provide some new insights, such as clear rate acceleration in the Opiliones. By revealing a strong association between elevated rates of nucleotide and amino acid substitution, this study builds evidence for the selective importance of the rate variation among arachnid lineages. Moreover, it establishes that groups whose COI genes have elevated levels of amino acid substitution also regularly possess indels, a dramatic form of protein reconfiguration. Overall, this study suggests that the mitochondrial genome of some arachnid groups is dynamic with high rates of amino acid substitution and frequent indels, while it is ‘locked down’ in others. Dynamic genomes are most prevalent in arachnids with short generation times, but the possible impact of breeding system deserves investigation since many of the rapidly evolving lineages reproduce by haplodiploidy, a mode of reproduction absent in ‘locked down’ taxa. PMID:26308206

  10. Traumatic Brain Injury and NADPH Oxidase: A Deep Relationship

    PubMed Central

    Prata, Cecilia; Vieceli Dalla Sega, Francesco; Piperno, Roberto; Hrelia, Silvana

    2015-01-01

    Traumatic brain injury (TBI) represents one of the major causes of mortality and disability in the world. TBI is characterized by primary damage resulting from the mechanical forces applied to the head as a direct result of the trauma and by the subsequent secondary injury due to a complex cascade of biochemical events that eventually lead to neuronal cell death. Oxidative stress plays a pivotal role in the genesis of the delayed harmful effects contributing to permanent damage. NADPH oxidases (Nox), ubiquitary membrane multisubunit enzymes whose unique function is the production of reactive oxygen species (ROS), have been shown to be a major source of ROS in the brain and to be involved in several neurological diseases. Emerging evidence demonstrates that Nox is upregulated after TBI, suggesting Nox critical role in the onset and development of this pathology. In this review, we summarize the current evidence about the role of Nox enzymes in the pathophysiology of TBI. PMID:25918580

  11. Increased activity of monoamine oxidase by epoxy resin hardeners.

    PubMed

    Yano, E

    1987-06-01

    In order to investigate the potency of amines to cause metabolic changes which are related to scleroderma, serum monoamine oxidase (MAO) activity to workers in an epoxy resin handling process was measured. Mean serum MAO activity of 15 workers exposed to amine was 33.5 +/- 6.4 units, whilst that of control workers was 28.9 +/- 7.8 (P less than 0.05). The finding was confirmed in an in vitro experiment. After 24 h treatment with amine, the MAO activity of cultured skin fibroblasts was elevated in a dose-response manner. These results suggested the potency of amine to produce an increase in MAO activity, and this phenomenon seems to be related to the cases of occupational scleroderma-like disorder which were observed in an epoxy resin polymerizing process. PMID:3590227

  12. Potential role of NADPH oxidase in pathogenesis of pancreatitis

    PubMed Central

    Cao, Wei-Li; Xiang, Xiao-Hui; Chen, Kai; Xu, Wei; Xia, Shi-Hai

    2014-01-01

    Studies have demonstrated that reactive oxygen species (ROS) are closely related to inflammatory disorders. Nicotinamide adenine dinucleotide phosphate oxidase (NOX), originally found in phagocytes, is the main source of ROS in nonphagocytic cells. Besides directly producing the detrimental highly reactive ROS to act on biomolecules (lipids, proteins, and nucleic acids), NOX can also activate multiple signal transduction pathways, which regulate cell growth, proliferation, differentiation and apoptosis by producing ROS. Recently, research on pancreatic NOX is no longer limited to inflammatory cells, but extends to the aspect of pancreatic acinar cells and pancreatic stellate cells, which are considered to be potentially associated with pancreatitis. In this review, we summarize the literature on NOX protein structure, activation, function and its role in the pathogenesis of pancreatitis. PMID:25133019

  13. Resolution of thylakoid polyphenol oxidase and a protein kinase

    SciTech Connect

    Race, H.L.; Davenport, J.W.; Hind, G.

    1995-12-31

    The predominant protein kinase activity in octylglucoside (OG) extracts of spinach thylakoids has been attributed to a 64-kDa protein, tp64. Recent work calls into question the relation between tp64 and protein kinase activity, which were fractionated apart using fluid phase IEF and hydroxylapatite chromatography. Hind et al. sequenced tp64 from the cDNA and showed it to be a polyphenol oxidase (PPO) homolog. Its transit peptide indicates a location for the mature protein within the thylakoid lumen, where there is presumably no ATP and where it is remote from the presumed kinase substrates: the stromally exposed regions of integral PS-II membrane proteins. Here the authors suggest that the kinase is a 64-kDa protein distinct from tp64.

  14. Comparative studies in series of cytochrome c oxidase models.

    PubMed

    Melin, F; Trivella, A; Lo, M; Ruzié, C; Hijazi, I; Oueslati, N; Wytko, J A; Boitrel, B; Boudon, C; Hellwig, P; Weiss, J

    2012-03-01

    This study compares the behavior as cytochrome c oxidase (CcO) functional and structural models of a series of reported and unreported ligands that provide either a binding site for copper without a built-in proximal base, or both a flexible binding site for copper and a built-in proximal base, or a fixed binding site for copper with a built-in proximal base. The comparisons of the models show that the relative position of the two metal sites is not only a crucial parameter in the control of the catalytic behavior but also essential in mimicking other features of the enzyme such as CO exchange between the ferrous heme a(3) and the cuprous Cu(B) center. PMID:22197476

  15. Structure and properties of recombinant human pyridoxine 5?-phosphate oxidase

    PubMed Central

    Musayev, Faik N.; Di Salvo, Martino L.; Ko, Tzu-Ping; Schirch, Verne; Safo, Martin K.

    2003-01-01

    Pyridoxine 5?-phosphate oxidase catalyzes the terminal step in the synthesis of pyridoxal 5?-phosphate. The cDNA for the human enzyme has been cloned and expressed in Escherichia coli. The purified human enzyme is a homodimer that exhibits a low catalytic rate constant of ?0.2 sec?1 and Km values in the low micromolar range for both pyridoxine 5?phosphate and pyridoxamine 5?-phosphate. Pyridoxal 5?-phosphate is an effective product inhibitor. The three-dimensional fold of the human enzyme is very similar to those of the E. coli and yeast enzymes. The human and E. coli enzymes share 39% sequence identity, but the binding sites for the tightly bound FMN and substrate are highly conserved. As observed with the E. coli enzyme, the human enzyme binds one molecule of pyridoxal 5?-phosphate tightly on each subunit. PMID:12824491

  16. [Functional groups involved in the nitrate reductase activity of milk xanthine oxidase].

    PubMed

    Ananiadi, L I; Sergeev, N S; Kil'dibekov, N A; L'vov, N P; Kretovich, V L

    1983-06-01

    Milk xanthine oxidase possesses the nitrate reductase activity at pH 5.2; the pH optimum of the xanthine oxidase activity for the enzyme lies at 9.6. After removal of FAD and binding of Mo and Fe with a simultaneous measurement at the pH optima of the above activities it was found that only the Mo-containing site is necessary for the nitrate reductase activity. The switch-over of the enzyme from the xanthine oxidase to the nitrate reductase activity is associated with considerable conformational changes of the enzyme molecule. PMID:6688366

  17. Transformation of catalytic characteristics of cerebral monoamine oxidases in experimental posttraumatic stress disorders.

    PubMed

    Kolesnikova, L I; Popova, A S; Deev, R V; Sinitskii, A I; Krupitskaya, L I

    2015-03-01

    We studied the contribution of the transformation of the catalytic properties of cerebral monoamine oxidase in the development of behavioral disorders during stress. Monoamine oxidase activities and catalytic characteristics, LPO intensity, and oxidative modification of proteins in suspension of the brain mitochondria were evaluated over the course of experimental posttraumatic stress disorder. The detected shifts were comparable with the results of neuroethologic testing. The development of behavioral disorders presented by low exploratory activity and high anxiety was associated with transformation of catalytic characteristics of cerebral monoamine oxidases, associated with the development of oxidative stress with predominant intensification of metal-catalyzed protein oxidation. PMID:25778651

  18. On-line radiochemical assay for monoamine oxidase utilizing high-performance liquid chromatography

    SciTech Connect

    Nissinen, E.; Linko-Loeppoenen SMae; Maennistoe P4

    1984-12-01

    A fast and sensitive assay for the determination of monoamine oxidase activity was developed. The method is based on the separation and quantitation of /sup 14/C-labeled assay products by high-performance liquid chromatography, which is interfaced directly into a flow-through radioactivity detector. This allows on-line quantitation of the radioactive compounds with picomole sensitivity. The method makes possible the complete separation and detection of the deaminated products of monoamine oxidase A and B substrates benzylamine and 5-hydroxytryptamine, respectively. This assay has been applied to the measurement of monoamine oxidase A and B activities in rat brain.

  19. The Cytochrome bd Oxidase of Porphyromonas gingivalis Contributes to Oxidative Stress Resistance and Dioxygen Tolerance

    PubMed Central

    Leclerc, Julia; Rosenfeld, Eric; Trainini, Mathieu; Martin, Bénédicte; Meuric, Vincent; Bonnaure-Mallet, Martine; Baysse, Christine

    2015-01-01

    Porphyromonas gingivalis is an etiologic agent of periodontal disease in humans. The disease is associated with the formation of a mixed oral biofilm which is exposed to oxygen and environmental stress, such as oxidative stress. To investigate possible roles for cytochrome bd oxidase in the growth and persistence of this anaerobic bacterium inside the oral biofilm, mutant strains deficient in cytochrome bd oxidase activity were characterized. This study demonstrated that the cytochrome bd oxidase of Porphyromonas gingivalis, encoded by cydAB, was able to catalyse O2 consumption and was involved in peroxide and superoxide resistance, and dioxygen tolerance. PMID:26629705

  20. Physiological role of alternative oxidase (from yeasts to plants).

    PubMed

    Rogov, A G; Zvyagilskaya, R A

    2015-04-01

    Mitochondria of all so far studied organisms, with the exception of Archaea, mammals, some yeasts, and protists, contain, along with the classical phosphorylating cytochrome pathway, a so-called cyanide-insensitive alternative oxidase (AOX) localized on the matrix side of the mitochondrial inner membrane, and electron transport through which is not coupled with ATP synthesis and energy accumulation. Mechanisms underlying plentiful functions of AOX in organisms at various levels of organization ranging from yeasts to plants are considered. First and foremost, AOX provides a chance of cell survival after inhibiting the terminal components of the main respiratory chain or losing the ability to synthesize these components. The vitally important role of AOX is obvious in thermogenesis of thermogenic plant organs where it becomes the only terminal oxidase with a very high activity, and the energy of substrate oxidation by this respiratory pathway is converted into heat, thus promoting evaporation of volatile substances attracting pollinating insects. AOX plays a fundamentally significant role in alleviating or preventing oxidative stress, thus ensuring the defense against a wide range of stresses and adverse environmental conditions, such as changes in temperature and light intensities, osmotic stress, drought, and attack by incompatible strains of bacterial pathogens, phytopathogens, or their elicitors. Participation of AOX in pathogen survival during its existence inside the host, in antivirus defense, as well as in metabolic rearrangements in plants during embryogenesis and cell differentiation is described. Examples are given to demonstrate that AOX might be an important tool to overcome the adverse aftereffects of restricted activity of the main respiratory chain in cells and whole animals. PMID:25869356

  1. Putrescine biosensor based on putrescine oxidase from Kocuria rosea.

    PubMed

    Bóka, Beáta; Adányi, Nóra; Szamos, Jen?; Virág, Diána; Kiss, Attila

    2012-10-10

    The novel putrescine oxidase based amperometric biosensor selectively measures putrescine, which can be considered as an indicator of microbial spoilage. Putrescine oxidase (PUOX, EC 1.4.3.10) was isolated from Kocuria rosea (Micrococcus rubens) by an improved and simplified purification process. Cells were grown on brain heart infusion medium supplemented with putrescine. Cell-free extract was prepared in Tris buffer (pH 8.0) by Bead-beater. A newly elaborated step based on three-phase partitioning (TPP) was applied in the purification protocol of PUOX. The purified enzyme was immobilized on the surface of a spectroscopic graphite electrode in redox hydrogel with horseradish peroxidase, Os mediator and poly(ethylene glycol) (400) diglycidyl ether (PEGDGE) as crosslinking agent. This modified working electrode was used in wall-jet type amperometric cell together with the Ag/AgCl (0.1M KCl) reference electrode and a platinum wire as auxiliary electrode in flow injection analysis system (FIA). Hydrogel composition, pH and potential dependence were studied. Optimal working conditions were 0.45 mLmin(-1) flow rate of phosphate buffer (66 mM, pH 8.0) and +50 mV polarizing potential vs. Ag/AgCl. The linear measuring range of the method was 0.01-0.25 mM putrescine, while the detection limit was 5 ?M. Beer samples were investigated by the putrescine biosensor and the results were compared by those of HPLC reference method. PMID:22975122

  2. Mitochondrial alternative oxidase is involved in both compatible and incompatible host-virus combinations in Nicotiana benthamiana.

    PubMed

    Zhu, Feng; Deng, Xing-Guang; Xu, Fei; Jian, Wei; Peng, Xing-Ji; Zhu, Tong; Xi, De-Hui; Lin, Hong-Hui

    2015-10-01

    The alternative oxidase (AOX) functions in the resistance to biotic stress. However, the mechanisms of AOX in the systemic antiviral defense response and N (a typical resistance gene)-mediated resistance to Tobacco mosaic virus (TMV) are elusive. A chemical approach was undertaken to investigate the role of NbAOX in the systemic resistance to RNA viruses. Furthermore, we used a virus-induced gene-silencing (VIGS)-based genetics approach to investigate the function of AOX in the N-mediated resistance to TMV. The inoculation of virus significantly increased the NbAOX transcript and protein levels and the cyanide-resistant respiration in the upper un-inoculated leaves. Pretreatment with potassium cyanide greatly increased the plant's systemic resistance, whereas the application of salicylhydroxamic acid significantly compromised the plant's systemic resistance. Additionally, in NbAOX1a-silenced N-transgenic Nicotiana benthamiana plants, the inoculated leaf collapsed and the movement of TMV into the systemic tissue eventually led to the spreading of HR-PCD and the death of the whole plant. The hypersensitive response marker gene HIN1 was significantly increased in the NbAOX1a-silenced plants. Significant amounts of TMV-CP mRNA and protein were detected in the NbAOX1a-silenced plants but not in the control plants. Overall, evidence is provided that AOX plays important roles in both compatible and incompatible plant-virus combinations. PMID:26398788

  3. Two C4-sterol methyl oxidases (Erg25) catalyse ergosterol intermediate demethylation and impact environmental stress adaptation in Aspergillus fumigatus

    PubMed Central

    Blosser, Sara J.; Merriman, Brittney; Grahl, Nora; Chung, Dawoon

    2014-01-01

    The human pathogen Aspergillus fumigatus adapts to stress encountered in the mammalian host as part of its ability to cause disease. The transcription factor SrbA plays a significant role in this process by regulating genes involved in hypoxia and low-iron adaptation, antifungal drug responses and virulence. SrbA is a direct transcriptional regulator of genes encoding key enzymes in the ergosterol biosynthesis pathway, including erg25A and erg25B, and ?srbA accumulates C4-methyl sterols, suggesting a loss of Erg25 activity [C4-sterol methyl oxidase (SMO)]. Characterization of the two genes encoding SMOs in Aspergillus fumigatus revealed that both serve as functional C4-demethylases, with Erg25A serving in a primary role, as ?erg25A accumulates more C4-methyl sterol intermediates than ?erg25B. Single deletion of these SMOs revealed alterations in canonical ergosterol biosynthesis, indicating that ergosterol may be produced in an alternative fashion in the absence of SMO activity. A ?erg25A strain displayed moderate susceptibility to hypoxia and the endoplasmic reticulum stress-inducing agent DTT, but was not required for virulence in murine or insect models of invasive aspergillosis. Inducing expression of erg25A partially restored the hypoxia growth defect of ?srbA. These findings implicated Aspergillus fumigatus SMOs in the maintenance of canonical ergosterol biosynthesis and indicated an overall involvement in the fungal stress response. PMID:25107308

  4. Effect of polymerization on antioxidant and xanthine oxidase inhibitory potential of sea buckthorn (H. rhamnoides) proanthocyanidins.

    PubMed

    Arimboor, Ranjith; Arumughan, C

    2012-10-01

    Inhibitory potential of sea buckthorn (Hippophae rhamnoides L) seed proanthocyanidins against oxidative stress and xanthine oxidase activity was evaluated. Composition of antioxidant proanthocyanidins was profiled by analyzing the cleavage products obtained by the acid catalyzed hydrolysis in the presence of phloroglucinol. Catechin, epicatechin, gallocatechin, and epigallocatechin were found as the extension and terminal subunits of proanthocyanidins with an average degree of polymerization (ADP) of 14.7. Seed proanthocyanidins showed considerably high antioxidant and xanthine oxidase inhibitory potentials. Antioxidant and xanthine oxidase inhibitory capacity evaluation of proanthocyanidin fractions with varying ADP showed that proanthocyanidins with lower molecular size were more effective as superoxide anion (ADP ? 4.2) and hydroxyl radical (ADP ? 5.9) scavengers and xanthine oxidase (ADP ? 3.1) inhibitors. ADP of the studied proanthocyanidin fractions did not show significant influence on their DPPH and ABTS radical scavenging and ferric reduction capacities. PMID:22938149

  5. Electron-microscopic cytochemical localization of diamine and polyamine oxidases in pea and maize tissues

    NASA Technical Reports Server (NTRS)

    Slocum, R. D.; Furey MJ, 3. d.

    1991-01-01

    An electron-microscopic cytochemical method was used to localize diamine oxidase (DAO) in pea and polyamine oxidase (PAO) in maize (Zea mays L.). The method, based on the precipitation of amine-oxidase-generated H2O2 by CeCl3, was shown to be specific for DAO and PAO and permitted their localization in plant tissues with a high degree of resolution. Both enzymes are localized exclusively in the cell wall. Both DAO- and PAO-activity staining is most intense in the middle lamellar region of the wall and in cells exhibiting highly lignified walls. The oxidases could provide H2O2 for peroxidase-mediated cross-linking reactions in the cell wall and may, in this capacity, play a role in the regulation of plant growth.

  6. Enhancing plasma membrane NADPH oxidase activity increases current output by diatoms in biophotovoltaic devices

    E-print Network

    Laohavisit, Anuphon; Anderson, Alexander; Bombelli, Paolo; Jacobs, Matthew; Howe, Christopher J.; Davies, Julia M.; Smith, Alison G.

    2015-08-31

    Biophotovoltaic (BPV) devices employ the photosynthetic activity of microalgae or cyanobacteria to harvest light energy and generate electrical current directly as a result of the release of electrons from the algal cells. NADPH oxidases (NOX...

  7. [Thermostabilities of plant phenol oxidase and peroxidase, determining the technology of their use in food industry].

    PubMed

    Mchedlishvili, N I; Omiadze, N T; Gulua, L K; Sadunishvili, T A; Zamtaradze, R K; Abutidze, M O; Bendeliani, E G; Kvesitadze, G I

    2005-01-01

    Stabilities of phenol oxidase and peroxidase from tea plant (Camellia sinensis L.) clone Kolkhida leaves, apple (Malus domestica L.) cultivar Kekhura fruits, walnut (Juglans regia L.) green pericarp, and horseradish (Armoracia lapathifolia Gilib) roots were studied using different storage temperature modes and storage duration. It was demonstrated that both enzymes retained residual activities (approximately 10%) upon 20-min incubation at 80 degrees C. Phenol oxidases from tea, walnut, and, especially, apple, as well as tea peroxidase were stable during storage. A technology for treatment of plant oxidases was proposed, based on the use of a natural inhibitor phenol oxidase and peroxidase, isolated from tea leaves, which solving the problem of residual activities of these enzymes, arising during pasteurization and storage of beverages and juices. It was demonstrated that browning of apple juice during pasteurization and beer turbidity during storage could be efficiently prevented using the natural inhibitor of these enzymes. PMID:15859458

  8. Polystyrene Attached Pt(IV)–Azomethine, Synthesis and Immobilization of Glucose Oxidase Enzyme

    PubMed Central

    Sar?, Nur?en; Antepli, Esin; Nartop, Dilek; Yetim, Nurdan Kurnaz

    2012-01-01

    Modified polystyrene with Pt(IV)–azomethine (APS–Sch–Pt) was synthesized by means of condensation and demonstrated to be a promising enzyme support by studying the enzymatic properties of glucose oxidase enzyme (GOx) immobilized on it. The characteristics of the immobilized glucose oxidase (APS–Sch–Pt–GOx) enzyme showed two optimum pH values that were pH = 4.0 and pH = 7. The insertion of stable Pt(IV)–azomethine spacers between the polystyrene backbone and the immobilized GOx, (APS–Sch–Pt–GOx), increases the enzymes’ activity and improves their affinity towards the substrate even at pH = 4. The influence of temperature, reusability and storage capacity on the free and immobilized glucose oxidase enzyme was investigated. The storage stability of the immobilized glucose oxidase was shown to be eleven months in dry conditions at +4 °C. PMID:23109888

  9. NADPH oxidases are critical targets for prevention of ethanol-induced bone loss

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The molecular mechanisms through which chronic alcohol consumption induce bone loss and osteoporosis are largely unknown. Ethanol increases expression and activates NADPH (nicotinamide adenine dinucleotide phosphate) oxidase enzymes (Nox) in osteoblasts leading to accumulation of reactive oxygen spe...

  10. Cyclic voltammetry at TCNQ and TTF-TCNQ modified platinum electrodes: A study of the glucose oxidase/glucose and galactose oxidase/galactose systems

    SciTech Connect

    Hale, P.D.; Skotheim, T.A.

    1988-01-01

    Recent work has shown that the synthetic metal TTF-TCNQ can be used as an electrode material for the oxidation of enzymes containing the prosthetic group flavin adenine dinucleotide (FAD). This direct electron transfer (direct in the sense that oxygen is not a mediator) between reduced enzyme and electrode, a process which does not occur to any measurable extent at a typical metal electrode, is not very well understood. In the present work, electron transfer between reduced glucose oxidase and TTF-TCNQ is investigated using cyclic voltammetry, and it is also shown that TCNQ itself can mediate this electron transfer between the enzyme and a platinum electrode. In addition to the glucose oxidase studies, cyclic voltammetric experiments have been performed on the galactose oxidase system, which contains a copper redox center rather than FAD. The results of these experiments demonstrate that the catalytic ability of TTF-TCNQ in enzyme-based electrochemical sensors is quite general. 15 refs., 4 figs.

  11. Upregulation of NAD(P)H oxidase 1 in hypoxia activates hypoxia-inducible factor 1 via increase in reactive oxygen species.

    PubMed

    Goyal, Parag; Weissmann, Norbert; Grimminger, Friedrich; Hegel, Cornelia; Bader, Lucius; Rose, Frank; Fink, Ludger; Ghofrani, Hossein A; Schermuly, Ralph T; Schmidt, Harald H H W; Seeger, Werner; Hänze, Jörg

    2004-05-15

    Hypoxia sensing and related signaling events, including activation of hypoxia-inducible factor 1 (HIF-1), represent key features in cell physiology and lung function. Using cultured A549 cells, we investigated the role of NAD(P)H oxidase 1 (Nox1), suggested to be a subunit of a low-output NAD(P)H oxidase complex, in hypoxia signaling. Nox1 expression was detected on both the mRNA and protein levels. Upregulation of Nox1 mRNA and protein occurred during hypoxia, accompanied by enhanced reactive oxygen species (ROS) generation. A549 cells, which were transfected with a Nox1 expression vector, revealed an increase in ROS generation accompanied by activation of HIF-1-dependent target gene expression (heme oxygenase 1 mRNA, hypoxia-responsive-element reporter gene activity). In A549 cells stably overexpressing Nox1, accumulation of HIF-1alpha in normoxia and an additional increase in hypoxia were noted. Interference with ROS metabolism by the flavoprotein inhibitor diphenylene iodonium (DPI) and catalase inhibited HIF-1 induction. This suggests that H2O2 links Nox1 and HIF-1 activation. We conclude that hypoxic upregulation of Nox1 and subsequently augmented ROS generation may activate HIF-1-dependent pathways. PMID:15110393

  12. Molecular mechanism of cell death induced by king cobra (Ophiophagus hannah) venom l-amino acid oxidase.

    PubMed

    Fung, Shin Yee; Lee, Mui Li; Tan, Nget Hong

    2015-03-01

    Snake venom LAAOs have been reported to exhibit a wide range of pharmacological activities, including cytotoxic, edema-inducing, platelet aggregation-inducing/platelet aggregation-inhibiting, bactericidal and antiviral activities. A heat-stable form of l-amino acid oxidase isolated from king cobra (Ophiophagus hannah) venom (OH-LAAO) has been shown to exhibit very potent cytotoxicity against human tumorigenic cells but not in their non-tumorigenic counterparts, and the cytotoxicity was due to the apoptosis-inducing effect of the enzyme. In this work, the molecular mechanism of cell death induced by OH-LAAO was investigated. The enzyme exerts its apoptosis-inducing effect presumably via both intrinsic and extrinsic pathways as suggested by the increase in caspase-8 and -9 activities. Oligonucleotide microarray analysis showed that the expression of a total of 178 genes was significantly altered as a result of oxidative stress induced by the hydrogen peroxide generated by the enzyme. Of the 178 genes, at least 27 genes are involved in apoptosis and cell death. These alterations of gene expression was presumably caused by the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidative modifications of signaling molecules that eventually lead to apoptosis and cell death. The very substantial up-regulation of cytochrome P450 genes may also contribute to the potent cytotoxic action of OH-LAAO by producing excessive reactive oxygen species (ROS). In conclusion, the potent apoptosis inducing activity of OH-LAAO was likely due to the direct cytotoxic effect of H2O2 generated during the enzymatic reaction, as well as the non-specific oxidation of signalling molecules. PMID:25615711

  13. Evidence for methoxatin (pyrroloquinolinequinone) as the cofactor in bovine plasma amine oxidase from resonance Raman spectroscopy.

    PubMed Central

    Moog, R S; McGuirl, M A; Cote, C E; Dooley, D M

    1986-01-01

    Resonance Raman spectra of the 2,4-dinitrophenylhydrazine derivatives of bovine plasma amine oxidase [amine:oxygen oxidoreductase (deaminating) (copper-containing), EC 1.4.3.6] have been measured. Detailed comparisons to the spectra of the corresponding derivatives of methoxatin (pyrroloquinolinequinone), pyridoxal, and other aldehydes and diones provide further evidence that covalently bound methoxatin or a closely similar derivative is the organic cofactor in copper-containing amine oxidases. PMID:3464962

  14. Enzymatic Characterization and In Vivo Function of Five Terminal Oxidases in Pseudomonas aeruginosa

    PubMed Central

    Kawakami, Takuro; Osamura, Tatsuya; Hirai, Takehiro; Sakai, Yoshiaki; Ishii, Masaharu

    2014-01-01

    The ubiquitous opportunistic pathogen Pseudomonas aeruginosa has five aerobic terminal oxidases: bo3-type quinol oxidase (Cyo), cyanide-insensitive oxidase (CIO), aa3-type cytochrome c oxidase (aa3), and two cbb3-type cytochrome c oxidases (cbb3-1 and cbb3-2). These terminal oxidases are differentially regulated under various growth conditions and are thought to contribute to the survival of this microorganism in a wide variety of environmental niches. Here, we constructed multiple mutant strains of P. aeruginosa that express only one aerobic terminal oxidase to investigate the enzymatic characteristics and in vivo function of each enzyme. The Km values of Cyo, CIO, and aa3 for oxygen were similar and were 1 order of magnitude higher than those of cbb3-1 and cbb3-2, indicating that Cyo, CIO, and aa3 are low-affinity enzymes and that cbb3-1 and cbb3-2 are high-affinity enzymes. Although cbb3-1 and cbb3-2 exhibited different expression patterns in response to oxygen concentration, they had similar Km values for oxygen. Both cbb3-1 and cbb3-2 utilized cytochrome c4 as the main electron donor under normal growth conditions. The electron transport chains terminated by cbb3-1 and cbb3-2 generate a proton gradient across the cell membrane with similar efficiencies. The electron transport chain of aa3 had the highest proton translocation efficiency, whereas that of CIO had the lowest efficiency. The enzymatic properties of the terminal oxidases reported here are partially in agreement with their regulatory patterns and may explain the environmental adaptability and versatility of P. aeruginosa. PMID:25182500

  15. Bifunctionalized mesoporous silica-supported gold nanoparticles: intrinsic oxidase and peroxidase catalytic activities for antibacterial applications.

    PubMed

    Tao, Yu; Ju, Enguo; Ren, Jinsong; Qu, Xiaogang

    2015-02-11

    Bifunctionalized mesoporous silica-supported gold nanoparticles as oxidase and peroxidase mimics for antibacterial applications are demonstrated. For the first time, these mesoporous silica-supported gold nanoparticles are applied as oxidase and peroxidase mimics. Taking advantage of their prominent enzyme activities, the MSN-AuNPs show excellent antibacterial properties against both Gram-negative and Gram-positive bacteria. Furthermore, MSN-AuNPs also exhibit outstanding performance in biofilm elimination . PMID:25655182

  16. NADH oxidase and alkyl hydroperoxide reductase subunit C (peroxiredoxin) from Amphibacillus xylanus form an oligomeric assembly

    PubMed Central

    Arai, Toshiaki; Kimata, Shinya; Mochizuki, Daichi; Hara, Keita; Zako, Tamotsu; Odaka, Masafumi; Yohda, Masafumi; Arisaka, Fumio; Kanamaru, Shuji; Matsumoto, Takashi; Yajima, Shunsuke; Sato, Junichi; Kawasaki, Shinji; Niimura, Youichi

    2015-01-01

    The NADH oxidase–peroxiredoxin (Prx) system of Amphibacillus xylanus reduces hydroperoxides with the highest turnover rate among the known hydroperoxide-scavenging enzymes. The high electron transfer rate suggests that there exists close interaction between NADH oxidase and Prx