Science.gov

Sample records for multicopper oxidase gene

  1. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  2. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.

    1999-01-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  3. Molecular cloning and heterologous expression of the gene encoding dihydrogeodin oxidase, a multicopper blue enzyme from Aspergillus terreus.

    PubMed

    Huang, K X; Fujii, I; Ebizuka, Y; Gomi, K; Sankawa, U

    1995-09-15

    Aspergillus terreus dihydrogeodin oxidase (DHGO) is an enzyme catalyzing the stereospecific phenol oxidative coupling reaction converting dihydrogeodin to (+)- geodin. We previously reported the purification of DHGO from A. terreus and raised polyclonal antibody against DHGO. From the first cDNA library constructed in lambda gt11 using mRNA from 3-day-old mycelium of A. terreus, four clones were identified using anti-DHGO antibody, but all contained partial cDNA inserts around 280 base pairs. This cDNA fragment was used as a probe to clone the genomic DNA and cDNA for dihydrogeodin oxidase from A. terreus. The sequence of the cloned DHGO genomic DNA and cDNA predicted that the DHGO polypeptide consists of 605 amino acids showing significant homology with multicopper blue proteins such as laccase and ascorbate oxidase. Four potential copper binding domains exist in DHGO polypeptide. The DHGO gene consists of seven exons separated by six short introns. Expression of the DHGO gene in Aspergillus nidulans under the starch or maltose-inducible Taka-amylase A promoter as an active enzyme established the functional identity of the gene. Also, introduction of the genomic DNA for DHGO into Penicillium frequentans led to the production of DHGO polypeptide as judged by Western blot analysis. PMID:7665560

  4. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.

    2001-01-01

    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  5. Modeling dioxygen reduction at multicopper oxidase cathodes.

    PubMed

    Agbo, Peter; Heath, James R; Gray, Harry B

    2014-10-01

    We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate. PMID:25188422

  6. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.

    1999-04-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  7. Diversity of laccase-like multicopper oxidase genes in Morchellaceae: identification of genes potentially involved in extracellular activities related to plant litter decay.

    PubMed

    Kellner, Harald; Luis, Patricia; Buscot, François

    2007-07-01

    Despite the important role played by soil-inhabiting ascomycetes in plant litter decay processes, studies on the diversity and function of their laccase-like multicopper oxidase (LMCO) genes are scarce. In the present work, the LMCO gene diversity in 15 strains representing nine Morchellaceae and one Discinaceae species was evaluated by PCR. One to six different genes were found within the species, representing 26 different sequence types. Cluster analysis revealed LMCO genes belonging to four main gene families encoding different protein classes (Class I-IV). To identify the genes related to extracellular activities and potentially involved in litter decay processes, liquid cultures were induced by different aromatic compounds. Morchella conica and Verpa conica showed the strongest LMCO activity enhancement in the presence of the naturally occurring phenolic compound guaiacol, and their expressed LMCO genes were identified by sequencing. Only genes belonging to the gene families encoding the Class II and III proteins were expressed. Both genes (Class II and III) of the mycorrhizal-like strain M. conica were exclusively expressed in the presence of guaiacol. In contrast to the saprotrophic strain V. conica, the gene encoding the Class III protein was constitutively expressed as it was also found in control cultures without guaiacol. PMID:17466024

  8. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.

    2013-01-01

    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  9. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  10. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  11. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  12. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.

    2015-01-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  13. Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

    PubMed Central

    Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

    2008-01-01

    Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

  14. Transcriptional and Posttranscriptional Events Control Copper-Responsive Expression of a Rhodobacter capsulatus Multicopper Oxidase

    PubMed Central

    Rademacher, Corinna; Moser, Roman; Lackmann, Jan-Wilm; Klinkert, Birgit; Narberhaus, Franz

    2012-01-01

    The copper-regulated Rhodobacter capsulatus cutO (multicopper oxidase) gene confers copper tolerance and is carried in the tricistronic orf635-cutO-cutR operon. Transcription of cutO strictly depends on the promoter upstream of orf635, as demonstrated by lacZ reporter fusions to nested promoter fragments. Remarkably, orf635 expression was not affected by copper availability, whereas cutO and cutR were expressed only in the presence of copper. Differential regulation was abolished by site-directed mutations within the orf635-cutO intergenic region, suggesting that this region encodes a copper-responsive mRNA element. Bioinformatic predictions and RNA structure probing experiments revealed an intergenic stem-loop structure as the candidate mRNA element. This is the first posttranscriptional copper response mechanism reported in bacteria. PMID:22287514

  15. Crystal Structure of a Two-domain Multicopper Oxidase: Implications for the Evolution of Multicooper Blue Proteins

    SciTech Connect

    Lawton, Thomas J.; Sayavedra-Soto, Luis A.; Arp, Daniel J.; Rosenzweig, Amy C.

    2009-06-01

    The two-domain multicopper oxidases are proposed to be key intermediates in the evolution of three-domain multicopper oxidases. A number of two-domain multicopper oxidases have been identified from genome sequences and are classified as type A, type B, or type C on the basis of the predicted location of the type 1 copper center. The crystal structure of blue copper oxidase, a type C two-domain multicopper oxidase from Nitrosomonas europaea, has been determined to 1.9 A resolution. Blue copper oxidase is a trimer, of which each subunit comprises two cupredoxin domains. Each subunit houses a type 1 copper site in domain 1 and a type 2/type 3 trinuclear copper cluster at the subunit-subunit interface. The coordination geometry at the trinuclear copper site is consistent with reduction of the copper ions. Although the overall architecture of blue copper oxidase is similar to nitrite reductases, detailed structural alignments show that the fold and domain orientation more closely resemble the three-domain multicopper oxidases. These observations have important implications for the evolution of nitrite reductases and multicopper oxidases.

  16. A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity

    PubMed Central

    Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

    2003-01-01

    Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2′-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 μM. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088

  17. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    PubMed Central

    2012-01-01

    Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

  18. Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub

    PubMed Central

    Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L

    2012-01-01

    Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

  19. Determining the Role of Multicopper Oxidases in Manganese(II) Oxidation by Marine Bacillus Spores

    NASA Astrophysics Data System (ADS)

    Dick, G. J.; Tebo, B. M.

    2005-12-01

    Bacteria play an important role in the environmental cycling of Mn by oxidizing soluble Mn(II) and forming insoluble Mn(III/IV) oxides. These biogenic Mn oxides are renowned for their strong sorptive and oxidative properties, which control the speciation and availability of many metals and organic compounds. A wide variety of bacteria are known to catalyze the oxidation of Mn(II); one of the most frequently isolated types are Bacillus species that oxidize Mn(II) only as metabolically dormant spores. We are using genetic and biochemical methods to study the molecular mechanisms of this process in these organisms. mnxG, a gene related to the multicopper oxidase (MCO) family of enzymes, is required for Mn(II) oxidation in the model organism, Bacillus sp. strain SG-1. Mn(II)-oxidizing activity can be detected in crude protein extracts of the exosporium and as a discrete band in SDS-PAGE gels, however previous attempts to purify or identify this Mn(II)-oxidizing enzyme have failed. A direct link between the Mn(II)-oxidizing enzyme and the MCO gene suspected to encode it has never been made. We used genetic and biochemical methods to investigate the role of the MCO in the mechanism of Mn(II) oxidation. Comparative analysis of the mnx operon from several diverse Mn(II)-oxidizing Bacillus spores revealed that mnxG is the most highly conserved gene in the operon, and that copper binding sites are highly conserved. As with Mn(II) oxidases from other organisms, heterologous expression of the Bacillus mnxG in E. coli did not yield an active Mn(II) oxidase. Purifying sufficient quantities of the native Mn(II) oxidase from Bacillus species for biochemical characterization has proven difficult because the enzyme does not appear to be abundant, and it is highly insoluble. We were able to partially purify the Mn(II) oxidase, and to analyze the active band by in-gel trypsin digestion followed by tandem mass spectrometry (MS/MS). MS/MS spectra provided a conclusive match to mnx

  20. Atmospheric N Deposition Increases Bacterial Laccase-Like Multicopper Oxidases: Implications for Organic Matter Decay

    PubMed Central

    Zak, Donald R.

    2014-01-01

    Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize β-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

  1. Iodide Oxidation by a Novel Multicopper Oxidase from the Alphaproteobacterium Strain Q-1

    PubMed Central

    Suzuki, Mio; Eda, Yoshifumi; Ohsawa, Shiaki; Kanesaki, Yu; Yoshikawa, Hirofumi; Tanaka, Kan; Muramatsu, Yasuyuki; Yoshikawa, Jun; Sato, Ikuo; Fujii, Takaaki

    2012-01-01

    Alphaproteobacterium strain Q-1 is able to oxidize iodide (I−) to molecular iodine (I2) by an oxidase-like enzyme. One of the two isoforms of the iodide-oxidizing enzyme (IOE-II) produced by this strain was excised from a native polyacrylamide gel, eluted, and purified. IOE-II appeared as a single band (51 kDa) and showed significant in-gel iodide-oxidizing activity in sodium dodecyl sulfate-polyacrylamide gel electrophoresis without heat treatment. However, at least two bands with much higher molecular masses (150 and 230 kDa) were observed with heat treatment (95°C, 3 min). IOE-II was inhibited by NaN3, KCN, EDTA, and a copper chelator, o-phenanthroline. In addition to iodide, IOE-II showed significant activities toward phenolic compounds such as syringaldazine, 2,6-dimethoxy phenol, and p-phenylenediamine. IOE-II contained copper atoms as prosthetic groups and had UV/VIS absorption peaks at 320 and 590 nm. Comparison of several internal amino acid sequences obtained from trypsin-digested IOE-II with a draft genome sequence of strain Q-1 revealed that the products of two open reading frames (IoxA and IoxC), with predicted molecular masses of 62 and 71 kDa, are involved in iodide oxidation. Furthermore, subsequent tandem mass spectrometric analysis repeatedly detected peptides from IoxA and IoxC with high sequence coverage (32 to 40%). IoxA showed homology with the family of multicopper oxidases and included four copper-binding regions that are highly conserved among various multicopper oxidases. These results suggest that IOE-II is a multicopper oxidase and that it may occur as a multimeric complex in which at least two proteins (IoxA and IoxC) are associated. PMID:22447601

  2. O2 Reduction to H2O by the Multicopper Oxidases

    PubMed Central

    Solomon, Edward I.; Augustine, Anthony J.; Yoon, Jungjoo

    2010-01-01

    In nature the four electron reduction of O2 to H2O is carried out by Cytochrome c Oxidase (CcO) and the multicopper oxidases (MCOs). In the former, Cytochrome c provides electrons for pumping protons to produce a gradient for ATP synthesis, while in the MCOs the function is the oxidation of substrates, either organic or metal ions. In the MCOs the reduction of O2 is carried out at a trinuclear Cu cluster (TNC). Oxygen intermediates have been trapped which exhibit unique spectroscopic features that reflect novel geometric and electronic structures. These intermediates have both intact and cleaved O-O bonds, allowing the reductive cleavage of the O-O bond to be studied in detail both experimentally and computationally. These studies show that the topology of the TNC provides a unique geometric and electronic structure particularly suited to carry out this key reaction in Nature. PMID:18648693

  3. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

    PubMed Central

    Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

    2013-01-01

    Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

  4. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli.

    PubMed

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  5. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  6. A putative multicopper oxidase, IoxA, is involved in iodide oxidation by Roseovarius sp. strain A-2.

    PubMed

    Shiroyama, Kanna; Kawasaki, Yasutaka; Unno, Yusuke; Amachi, Seigo

    2015-01-01

    Roseovarius sp. strain A-2 is an aerobic heterotrophic bacterium with a capacity for oxidizing iodide ion (I(-)) to form molecular iodine (I2). In this study, iodide-oxidizing enzyme of strain A-2 was characterized. The enzyme was an extracellular protein, and Cu(2+) ion significantly enhanced the enzyme activity in the culture supernatant. When iodide was used as the substrate, the crude enzyme showed Km and Vmax values of 4.78 mM and 25.1 U mg(-1), respectively. The enzyme was inhibited by NaN3, EDTA, KCN, and o-phenanthroline, and also had significant activities toward p-phenylenediamine and hydroquinone. Tandem mass spectrometric analysis of an active band excised from SDS-PAGE gel revealed that at least two proteins are involved in the enzyme. One of these proteins was closely related with IoxA, a multicopper oxidase previously found as a component of iodide-oxidizing enzyme of Alphaproteobacterium strain Q-1. Furthermore, a terrestrial bacterium Rhodanobacter denitrificans 116-2, which possesses an ioxA-like gene in its genome, was found to oxidize iodide. These results suggest that IoxA catalyzes the oxidation of iodide in phylogenetically distinct bacteria. PMID:26041311

  7. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera

    PubMed Central

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng

    2015-01-01

    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  8. Cell-free protein synthesis enables high yielding synthesis of an active multicopper oxidase.

    PubMed

    Li, Jian; Lawton, Thomas J; Kostecki, Jan S; Nisthal, Alex; Fang, Jia; Mayo, Stephen L; Rosenzweig, Amy C; Jewett, Michael C

    2016-02-01

    Multicopper oxidases (MCOs) are broadly distributed in all kingdoms of life and perform a variety of important oxidative reactions. These enzymes have potential biotechnological applications; however, the applications are impeded by low expression yields in traditional recombinant hosts, solubility issues, and poor copper cofactor assembly. As an alternative to traditional recombinant protein expression, we show the ability to use cell-free protein synthesis (CFPS) to produce complex MCO proteins with high soluble titers. Specifically, we report the production of MCOs in an Escherichia coli-based cell-free transcription-translation system. Total yields as high as 1.2 mg mL(-1) were observed after a 20-h batch reaction. More than 95% of the protein was soluble and activity was obtained by simple post-CFPS addition of copper ions in the form of CuSO4 . Scale-up reactions were achieved from 15 to 100 µL without a decrease in productivity and solubility. CFPS titers were higher than in vivo expression titers and more soluble, avoiding the formation of inclusion bodies. Our work extends the utility of the cell-free platform to the production of active proteins containing copper cofactors and demonstrates a simple method for producing MCOs. PMID:26356243

  9. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera.

    PubMed

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng

    2015-01-01

    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  10. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

    PubMed Central

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.

    2013-01-01

    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

  11. Agaricus bisporus and related Agaricus species on lignocellulose: production of manganese peroxidase and multicopper oxidases.

    PubMed

    Hildén, Kristiina; Mäkelä, Miia R; Lankinen, Pauliina; Lundell, Taina

    2013-06-01

    Biotechnological, microbiological, and genetic studies of Agaricus species other than A. bisporus, the white button mushroom, have been limited so far. To expand the knowledge in the genus Agaricus, six novel wild-type isolates of Agaricus spp. were studied on their nutritional demands for enzyme production and mycelial growth. All the selected Agaricus species produced extracellular manganese peroxidase (MnP) and laccase activities in semi-solid rye bran cultures. Moderate MnP activities were measured for A. bisporus, A. bernardii and A. campestris. The highest laccase activities were obtained for A. bisporus and A. campestris. On soy medium, the highest mycelial tyrosinase activity was determined for A. bernardii. For A. bisporus, addition of copper caused no increase in laccase or tyrosinase activities on soy or malt extract media. Hyphal growth rate of the isolates was studied on lignocellulose amended agar plates. Fastest growth was obtained for A. bisporus on wheat bran and birch leaf litter agar. Except for A. bernardii, hyphal growth rates correlated well with MnP and laccase production levels between Agaricus species. Molecular taxonomy of the novel Agaricus spp. positioned them to distinct phylogenetic clusters with species-level identity. In conclusion, our data point to the importance of both MnP and multicopper enzymes in Agaricus spp. while growing on lignocelluloses. PMID:23454218

  12. Magnetic Ganoderma lucidum spore microspheres: A novel material to immobilize CotA multicopper oxidase for dye decolorization.

    PubMed

    Fan, Lili; Wang, Yan; Zhao, Min; Song, Jinzhu; Wang, Jueyu; Jin, Zijing

    2016-08-01

    In this study, hollow microspheres were obtained from Ganoderma lucidum spores. Then the hollow microspheres were loaded with Fe3O4 nanoparticles to prepare novel magnetic spore microspheres. TEM images and X-ray diffractometry demonstrated that the Fe3O4 nanoparticles were incorporated throughout the spore microsphere. CotA multicopper oxidase was chosen as biomacromolecule to study the loading ability of the magnetic spore microspheres. The combination of the CotA enzyme with the microsphere was observed by laser scanning confocal microscope. The loaded amount of CotA on the microspheres was 75mg/g when the CotA concentration was 1.2mg/mL and the activity recovery of the immobilized CotA was 81%. The magnetic microspheres loaded with CotA, which can be easily and quickly recovered by an external magnetic field, were used for dye decolorization. After 1h decolorization, 99% of the indigo carmine has been removed by 10mg microspheres. In addition, the immobilized CotA retained 75% of activity after 10 consecutive cycles, which indicated that the magnetic spore microspheres are good support material for immobilization of the enzyme. PMID:27058768

  13. Two-Electron Reduction versus One-Electron Oxidation of the Type 3 Pair in the Multicopper Oxidases.

    PubMed

    Kjaergaard, Christian H; Jones, Stephen M; Gounel, Sébastien; Mano, Nicolas; Solomon, Edward I

    2015-07-15

    Multicopper oxidases (MCOs) utilize an electron shuttling Type 1 Cu (T1) site in conjunction with a mononuclear Type 2 (T2) and a binuclear Type 3 (T3) site, arranged in a trinuclear copper cluster (TNC), to reduce O2 to H2O. Reduction of O2 occurs with limited overpotential indicating that all the coppers in the active site can be reduced via high-potential electron donors. Two forms of the resting enzyme have been observed in MCOs: the alternative resting form (AR), where only one of the three TNC Cu's is oxidized, and the resting oxidized form (RO), where all three TNC Cu's are oxidized. In contrast to the AR form, we show that in the RO form of a high-potential MCO, the binuclear T3 Cu(II) site can be reduced via the 700 mV T1 Cu. Systematic spectroscopic evaluation reveals that this proceeds by a two-electron process, where delivery of the first electron, forming a high energy, metastable half reduced T3 state, is followed by the rapid delivery of a second energetically favorable electron to fully reduce the T3 site. Alternatively, when this fully reduced binuclear T3 site is oxidized via the T1 Cu, a different thermodynamically favored half oxidized T3 form, i.e., the AR site, is generated. This behavior is evaluated by DFT calculations, which reveal that the protein backbone plays a significant role in controlling the environment of the active site coppers. This allows for the formation of the metastable, half reduced state and thus the complete reductive activation of the enzyme for catalysis. PMID:26075678

  14. Two-electron Reduction versus One-electron Oxidation of the Type 3 Pair in the Multicopper Oxidases

    PubMed Central

    Kjaergaard, Christian H.; Jones, Stephen M.; Gounel, Sébastien; Mano, Nicolas; Solomon, Edward I.

    2015-01-01

    Multicopper Oxidases (MCOs) utilize an electron shuttling Type 1 Cu (T1) site in conjunction with a mononuclear Type 2 (T2) and a binuclear Type 3 (T3) site, arranged in a trinuclear copper cluster (TNC), to reduce O2 to H2O. Reduction of O2 occurs with limited overpotential indicating that all the coppers in the active site can be reduced via high-potential electron donors. Two forms of the resting enzyme have been observed in MCOs: the Alternative Resting form (AR), where only one of the three TNC Cu’s is oxidized, and the Resting Oxidized form (RO), where all three TNC Cu’s are oxidized. In contrast to the AR form, we show that in the RO form of a high-potential MCO, the binuclear T3 Cu(II) site can be reduced via the 700 mV T1 Cu. Systematic spectroscopic evaluation reveals that this proceeds by a two-electron process, where delivery of the first electron, forming a high energy, meta-stable half reduced T3 state, is followed by the rapid delivery of a second energetically favorable electron to fully reduce the T3 site. Alternatively, when this fully reduced binuclear T3 site is oxidized via the T1 Cu, a different thermodynamically favored half oxidized T3 form, i.e. the AR site, is generated. This behavior is evaluated by DFT calculations, which reveal that the protein backbone plays a significant role in controlling the environment of the active site coppers. This allows for the formation of the meta-stable, half reduced state and thus the complete reductive activation of the enzyme for catalysis. PMID:26075678

  15. Mechanism of the reduction of the native intermediate in the multicopper oxidases: insights into rapid intramolecular electron transfer in turnover.

    PubMed

    Heppner, David E; Kjaergaard, Christian H; Solomon, Edward I

    2014-12-24

    The multicopper oxidases (MCOs) are the family of enzymes that catalyze the 4-electron reduction of O2 to H2O coupled to the four 1-electron oxidations of substrate. In the catalytic cycle electrons are transferred intramolecularly over ∼13 Å from a Type 1 (T1) Cu site that accepts electrons from substrate to a trinuclear Cu cluster (TNC) where O2 is reduced to H2O at rapid rates consistent with turnover (560 s(-1)). The oxygen reduction mechanism for the MCOs is well-characterized, whereas the rereduction is less understood. Our initial study of Rhus vernicifera Laccase (Heppner et al. J. Am. Chem. Soc. 2013, 135, 12212) experimentally established that the native intermediate (NI), the species formed upon O-O bond cleavage, is reduced with an IET rate >700 s(-1) and is the catalytically relevant fully oxidized form of the enzyme, rather than the resting state. In this report, we present kinetic and spectroscopic results coupled to DFT calculations that evaluate the mechanism of the 3 e(-)/3 H(+) reduction of NI, where all three catalytically relevant intramolecular electron transfer (IET) steps are rapid and involve three different structural changes. These three rapid IET processes reflect the sophisticated mechanistic control of the TNC to enable rapid turnover. All three IET processes are fast due to the associated protonation of the bridging oxo and hydroxo ligands, generated by O-O cleavage, to form water products that are extruded from the TNC upon full reduction, thereby defining a unifying mechanism for oxygen reduction and rapid IET by the TNC in the catalytic cycle of the MCOs. PMID:25490729

  16. A novel enzyme-based antimicrobial system comprising iodide and a multicopper oxidase isolated from Alphaproteobacterium strain Q-1.

    PubMed

    Yuliana, Tri; Ebihara, Kyota; Suzuki, Mio; Shimonaka, Chie; Amachi, Seigo

    2015-12-01

    Alphaproteobacterium strain Q-1 produces an extracellular multicopper oxidase (IOX), which catalyzes iodide (I-) oxidation to form molecular iodine (I2). In this study, the antimicrobial activity of the IOX/iodide system was determined. Both Gram-positive and Gram-negative bacteria tested were killed completely within 5 min by 50 mU mL(-1) of IOX and 10 mM iodide. The sporicidal activity of the system was also tested and compared with a common iodophor, povidone-iodine (PVP-I). IOX (300 mU mL(-1)) killed Bacillus cereus, B. subtilis, and Geobacillus stearothermophilus spores with decimal reduction times of 2.58, 7.62, and 40.9 min, respectively. However, 0.1% PVP-I killed these spores with much longer decimal reduction times of 5.46, 38.0, and 260 min, respectively. To evaluate the more superior sporicidal activity of the IOX system over PVP-I, the amount of free iodine (non-complexed I2) was determined by an equilibrium dialysis technique. The IOX system included more than 40 mg L(-1) of free iodine, while PVP-I included at most 25 mg L(-1) free iodine. Our results suggest that the new enzyme-based antimicrobial system is effective against a wide variety of microorganisms and bacterial spores, and that its strong biocidal activity is due to its high free iodine content, which is probably maintained by re-oxidation of iodide released after oxidation of cell components by I2. PMID:26254787

  17. Molecular Dynamics of a Thermostable Multicopper Oxidase from Thermus thermophilus HB27: Structural Differences between the Apo and Holo Forms

    PubMed Central

    Bello, Martiniano; Valderrama, Brenda; Serrano-Posada, Hugo; Rudiño-Piñera, Enrique

    2012-01-01

    Molecular dynamic (MD) simulations have been performed on Tth-MCO, a hyperthermophilic multicopper oxidase from thermus thermophilus HB27, in the apo as well as the holo form, with the aim of exploring the structural dynamic properties common to the two conformational states. According to structural comparison between this enzyme and other MCOs, the substrate in process to electron transfer in an outer-sphere event seems to transiently occupy a shallow and overall hydrophobic cavity near the Cu type 1 (T1Cu). The linker connecting the β-strands 21 and 24 of the second domain (loop (β21–β24)D2) has the same conformation in both states, forming a flexible lid at the entrance of the electron-transfer cavity. Loop (β21–β24)D2 has been tentatively assigned a role occluding the access to the electron-transfer site. The dynamic of the loop (β21–β24)D2 has been investigated by MD simulation, and results show that the structures of both species have the same secondary and tertiary structure during almost all the MD simulations. In the simulation, loop (β21–β24)D2 of the holo form undergoes a higher mobility than in the apo form. In fact, loop (β21–β24)D2 of the holo form experiences a conformational change which enables exposure to the electron-transfer site (open conformation), while in the apo form the opposite effect takes place (closed conformation). To confirm the hypothesis that the open conformation might facilitate the transient electron-donor molecule occupation of the site, the simulation was extended another 40 ns with the electron-donor molecule docked into the protein cavity. Upon electron-donor molecule stabilization, loops near the cavity reduce their mobility. These findings show that coordination between the copper and the protein might play an important role in the general mobility of the enzyme, and that the open conformation seems to be required for the electron transfer process to T1Cu. PMID:22808237

  18. Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta

    PubMed Central

    Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.

    2009-01-01

    Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect’s cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-β-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min−1, 80 min−1, and 290 min−1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min−1 and 180 min−1. These results enhance our understanding of cuticle sclerotization, and may aid in the

  19. Crystal structure of a blue laccase from Lentinus tigrinus: evidences for intermediates in the molecular oxygen reductive splitting by multicopper oxidases

    PubMed Central

    Ferraroni, Marta; Myasoedova, Nina M; Schmatchenko, Vadim; Leontievsky, Alexey A; Golovleva, Ludmila A; Scozzafava, Andrea; Briganti, Fabrizio

    2007-01-01

    Background Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in pathogenesis, immunogenesis and morphogenesis of organisms and in the metabolic turnover of complex organic substances. They catalyze the coupling between the four one-electron oxidations of a broad range of substrates with the four-electron reduction of dioxygen to water. These catalytic processes are made possible by the contemporaneous presence of at least four copper ion sites, classified according to their spectroscopic properties: one type 1 (T1) site where the electrons from the reducing substrates are accepted, one type 2 (T2), and a coupled binuclear type 3 pair (T3) which are assembled in a T2/T3 trinuclear cluster where the electrons are transferred to perform the O2 reduction to H2O. Results The structure of a laccase from the white-rot fungus Lentinus (Panus) tigrinus, a glycoenzyme involved in lignin biodegradation, was solved at 1.5 Å. It reveals a asymmetric unit containing two laccase molecules (A and B). The progressive reduction of the copper ions centers obtained by the long-term exposure of the crystals to the high-intensity X-ray synchrotron beam radiation under aerobic conditions and high pH allowed us to detect two sequential intermediates in the molecular oxygen reduction pathway: the "peroxide" and the "native" intermediates, previously hypothesized through spectroscopic, kinetic and molecular mechanics studies. Specifically the electron-density maps revealed the presence of an end-on bridging, μ-η1:η1 peroxide ion between the two T3 coppers in molecule B, result of a two-electrons reduction, whereas in molecule A an oxo ion bridging the three coppers of the T2/T3 cluster (μ3-oxo bridge) together with an hydroxide ion externally bridging the two T3 copper ions, products of the four-electrons reduction of molecular oxygen, were best modelled. Conclusion This is the first structure of a multicopper oxidase which

  20. X-ray-induced catalytic active-site reduction of a multicopper oxidase: structural insights into the proton-relay mechanism and O2-reduction states.

    PubMed

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia Patricia; Rodríguez-Almazán, Claudia; Stojanoff, Vivian; Rudiño-Piñera, Enrique

    2015-12-01

    During X-ray data collection from a multicopper oxidase (MCO) crystal, electrons and protons are mainly released into the system by the radiolysis of water molecules, leading to the X-ray-induced reduction of O2 to 2H2O at the trinuclear copper cluster (TNC) of the enzyme. In this work, 12 crystallographic structures of Thermus thermophilus HB27 multicopper oxidase (Tth-MCO) in holo, apo and Hg-bound forms and with different X-ray absorbed doses have been determined. In holo Tth-MCO structures with four Cu atoms, the proton-donor residue Glu451 involved in O2 reduction was found in a double conformation: Glu451a (∼7 Å from the TNC) and Glu451b (∼4.5 Å from the TNC). A positive peak of electron density above 3.5σ in an Fo - Fc map for Glu451a O(ℇ2) indicates the presence of a carboxyl functional group at the side chain, while its significant absence in Glu451b strongly suggests a carboxylate functional group. In contrast, for apo Tth-MCO and in Hg-bound structures neither the positive peak nor double conformations were observed. Together, these observations provide the first structural evidence for a proton-relay mechanism in the MCO family and also support previous studies indicating that Asp106 does not provide protons for this mechanism. In addition, eight composite structures (Tth-MCO-C1-8) with different X-ray-absorbed doses allowed the observation of different O2-reduction states, and a total depletion of T2Cu at doses higher than 0.2 MGy showed the high susceptibility of this Cu atom to radiation damage, highlighting the importance of taking radiation effects into account in biochemical interpretations of an MCO structure. PMID:26627648

  1. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals

    PubMed Central

    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin

    2015-01-01

    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

  2. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    PubMed Central

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-01-01

    X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-­ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

  3. Crystal Structures of Multicopper Oxidase CueO Bound to Copper(I) and Silver(I): Functional Role of a Methonine-Rich Sequence

    SciTech Connect

    Singh, Satish K.; Roberts, Sue A.; McDevitt, Sylvia F.; Weichsel, Andrzej; Wildner, Guenter F.; Grass, Gregor B.; Rensing, Christopher; Montfort, William R.

    2011-10-24

    The multicopper oxidase CueO oxidizes toxic Cu(I) and is required for copper homeostasis in Escherichia coli. Like many proteins involved in copper homeostasis, CueO has a methionine-rich segment that is thought to be critical for copper handling. How such segments function is poorly understood. Here, we report the crystal structure of CueO at 1.1 {angstrom} with the 45-residue methionine-rich segment fully resolved, revealing an N-terminal helical segment with methionine residues juxtaposed for Cu(I) ligation and a C-terminal highly mobile segment rich in methionine and histidine residues. We also report structures of CueO with a C500S mutation, which leads to loss of the T1 copper, and CueO with six methionines changed to serine. Soaking C500S CueO crystals with Cu(I), or wild-type CueO crystals with Ag(I), leads to occupancy of three sites, the previously identified substrate-binding site and two new sites along the methionine-rich helix, involving methionines 358, 362, 368, and 376. Mutation of these residues leads to a {approx}4-fold reduction in kcat for Cu(I) oxidation. Ag(I), which often appears with copper in nature, strongly inhibits CueO oxidase activities in vitro and compromises copper tolerance in vivo, particularly in the absence of the complementary copper efflux cus system. Together, these studies demonstrate a role for the methionine-rich insert of CueO in the binding and oxidation of Cu(I) and highlight the interplay among cue and cus systems in copper and silver homeostasis.

  4. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    SciTech Connect

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-05-01

    Radiation-induced reduction, radiolysis of copper sites and the effect of pH value together with the concomitant geometrical distortions of the active centres were analysed in several fungal (C. gallica) laccase structures collected at cryotemperature. This study emphasizes the importance of careful interpretation when the crystallographic structure of a metalloprotein is described. X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O{sub 2}. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O{sub 2} reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account.

  5. The Two Oxidized Forms of the Trinuclear Cu Cluster in the Multicopper Oxidases And Mechanism for the Decay of the Native Intermediate

    SciTech Connect

    Yoon, J.; Liboiron, B.D.; Sarangi, R.; Hodgson, K.O.; Hedman, B.; Solomona, E.I.; /Stanford U., Chem. Dept. /SLAC, SSRL

    2007-10-10

    Multicopper oxidases (MCOs) catalyze the 4e{sup -} reduction of O2 to H2O. The reaction of the fully reduced enzyme with O2 generates the native intermediate (NI), which undergoes a slow decay to the resting enzyme in the absence of substrate. NI is a fully oxidized form, but its spectral features are very different from those of the resting form (also fully oxidized), because the type 2 and the coupled-binuclear type 3 Cu centers in the O2-reducing trinuclear Cu cluster site are isolated in the resting enzyme, whereas these are all bridged by a {mu}3-oxo ligand in NI. Notably, the one azide-bound NI (NI{sub Az}) exhibits spectral features very similar to those of NI, in which the {mu}3-oxo ligand in NI has been replaced by a {mu}3-bridged azide. Comparison of the spectral features of NI and NIAz, combined with density functional theory (DFT) calculations, allows refinement of the NI structure. The decay of NI to the resting enzyme proceeds via successive proton-assisted steps, whereas the rate-limiting step involves structural rearrangement of the {mu}3-oxo-bridge from inside to outside the cluster. This phenomenon is consistent with the slow rate of NI decay that uncouples the resting enzyme from the catalytic cycle, leaving NI as the catalytically relevant fully oxidized form of the MCO active site. The all-bridged structure of NI would facilitate electron transfer to all three Cu centers of the trinuclear cluster for rapid proton-coupled reduction of NI to the fully reduced form for catalytic turnover.

  6. Ground State Electronic and Magnetic Properties of a μ3-Oxo Bridged Trinuclear Cu(II) Complex: Correlation to the Native Intermediate of the Multicopper Oxidases

    PubMed Central

    Yoon, Jungjoo; Solomon, Edward I.

    2008-01-01

    The ground state electronic and magnetic properties of one of the possible structures of the trinuclear CuII site in the native intermediate (NI) of the multicopper oxidases, the μ3-oxo bridged structure, are evaluated using the C3-symmetric Cu3II complex, μ3O. μ3O is unique in that no ligand, other than the oxo, contributes to the exchange coupling. However, μ3O has a ferromagnetic ground state, inconsistent with that of NI. Therefore, two perturbations have been considered: protonation of the μ3-oxo ligand and relaxation of the μ3-oxo ligand into the Cu3 plane. Notably, when the oxo-ligand is sufficiently close to the Cu3 plane (< 0.3 Å), the ground state of μ3O becomes antiferromagnetic and can be correlated to that of NI. In addition, the ferromagnetic 4A ground state of μ3O is found from variable-temperature EPR to undergo a zero-field splitting (ZFS) of 2D = -5.0 cm-1, which derives from the second-order anisotropic exchange. This allows evaluation of the σ-to-π excited state exchange pathways and provides experimental evidence that the orbitally-degenerate 2E ground state of the antiferromagnetic μ3O would also undergo a ZFS by the first-order antisymmetric exchange that has the same physical origin as the anisotropic exchange. The important contribution of the μ3-oxo bridge to the ground-to-ground and ground-to-excited state superexchange pathways that are responsible for the isotropic, antisymmetric and anisotropic exchange are discussed. PMID:16241158

  7. The Escherichia coli cell division protein and model Tat substrate SufI (FtsP) localizes to the septal ring and has a multicopper oxidase-like structure.

    PubMed

    Tarry, Michael; Arends, S J Ryan; Roversi, Pietro; Piette, Evan; Sargent, Frank; Berks, Ben C; Weiss, David S; Lea, Susan M

    2009-02-20

    The Escherichia coli protein SufI (FtsP) has recently been proposed to be a component of the cell division apparatus. The SufI protein is also in widespread experimental use as a model substrate in studies of the Tat (twin arginine translocation) protein transport system. We have used SufI-GFP (green fluorescent protein) fusions to show that SufI localizes to the septal ring in the dividing cell. We have also determined the structure of SufI by X-ray crystallography to a resolution of 1.9 A. SufI is structurally related to the multicopper oxidase superfamily but lacks metal cofactors. The structure of SufI suggests it serves a scaffolding rather than an enzymatic role in the septal ring and reveals regions of the protein likely to be involved in the protein-protein interactions required to assemble SufI at the septal ring. PMID:19135451

  8. Highly efficient perturbative + variational strategy based on orthogonal valence bond theory for the evaluation of magnetic coupling constants. Application to the trinuclear Cu(ii) site of multicopper oxidases.

    PubMed

    Tenti, Lorenzo; Maynau, Daniel; Angeli, Celestino; Calzado, Carmen J

    2016-07-21

    A new strategy based on orthogonal valence-bond analysis of the wave function combined with intermediate Hamiltonian theory has been applied to the evaluation of the magnetic coupling constants in two AF systems. This approach provides both a quantitative estimate of the J value and a detailed analysis of the main physical mechanisms controlling the coupling, using a combined perturbative + variational scheme. The procedure requires a selection of the dominant excitations to be treated variationally. Two methods have been employed: a brute-force selection, using a logic similar to that of the CIPSI approach, or entanglement measures, which identify the most interacting orbitals in the system. Once a reduced set of excitations (about 300 determinants) is established, the interaction matrix is dressed at the second-order of perturbation by the remaining excitations of the CI space. The diagonalization of the dressed matrix provides J values in good agreement with experimental ones, at a very low-cost. This approach demonstrates the key role of d → d* excitations in the quantitative description of the magnetic coupling, as well as the importance of using an extended active space, including the bridging ligand orbitals, for the binuclear model of the intermediates of multicopper oxidases. The method is a promising tool for dealing with complex systems containing several active centers, as an alternative to both pure variational and DFT approaches. PMID:27336417

  9. Covalent linkage of the type-2 and type-3 structural mimics to model the active site structure of multicopper oxidases: synthesis and magneto- structural properties of two angular trinuclear copper(II) complexes.

    PubMed

    Mukherjee, Arindam; Rudra, Indranil; Naik, Sunil G; Ramasesha, Suryanarayanasastry; Nethaji, Munirathinam; Chakravarty, Akhil R

    2003-09-01

    Two new angular trinuclear copper(II) complexes of formulation [Cu(3)(HL)LL'](ClO(4)), where L' is imidazole (Him, 1) or 1-methylimidazole (1-MeIm, 2) and H(3)L is a Schiff base obtained from the condensation of salicylaldehyde and 1,3-diaminopropan-2-ol (2:1 mole ratio), are prepared from a reaction of [Cu(2)L(mu-Br)] and [Cu(HL)] in the presence of L' and isolated as perchlorate salts. The crystal structures of 1 and 2 consist of a trinuclear copper(II) unit formed by the covalent linkage of monomeric type-2 mimic and dimeric type-3 mimic precursor complexes to give an angular arrangement of the metal atoms in the core which is a model for the active site structure of blue multicopper oxidases. In 1 and 2, the coordination geometry of two terminal copper atoms is distorted square-planar. The central copper has a distorted square-pyramidal (4 + 1) geometry. The mean Cu...Cu distance is approximately 3.3 A. The complex has a diphenoxo-bridged dicopper(II) unit with the phenoxo oxygen atoms showing a planar geometry. In addition, the complex has an endogenous alkoxo-bridged dicopper(II) unit showing a pyramidal geometry for the oxygen atom. The 1:1 electrolytic complexes show a d-d band at 607 nm. Cyclic voltammetry of the complexes in MeCN containing 0.1 M TBAP using a glassy carbon working electrode displays a Cu(3)(II)/Cu(2)(II)Cu(I) couple near -1.0 V (vs SCE). The variable temperature magnetic susceptibility measurements in the range 300-18 K show antiferromagnetic coupling in the complexes giving magnetic moments of approximately 3.0 mu(B) at 300 K and approximately 2.1 mu(B) at 18 K for the tricopper(II) unit. The experimental susceptibility data are theoretically fitted using a model with Heisenberg spin-(1)/(2) Hamiltonian for a trimer of spin-(1)/(2) copper(II) ions having two exchange parameters involving the alkoxo-bridged dicopper(II) (J1) and the diphenoxo-bridged dicopper(II) (J2) units, giving J1 and J2 values of -82.7, -73 cm(-1) for 1 and -98

  10. Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites

    SciTech Connect

    Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

    2009-04-30

    The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

  11. Diazonium Functionalisation of Carbon Nanotubes for Specific Orientation of Multicopper Oxidases: Controlling Electron Entry Points and Oxygen Diffusion to the Enzyme.

    PubMed

    Lalaoui, Noémie; Holzinger, Michael; Le Goff, Alan; Cosnier, Serge

    2016-07-18

    We report the controlled orientation of bilirubin oxidases (BOD) from Myrothecium verrucaria on multiwalled carbon nanotubes (MWCNTs) functionalised by electrografting of 6-carboxynaphthalenediazonium and 4-(2-aminoethyl)benzenediazonium salts. On negatively charged naphthoate-modified MWCNTs, a high-potential (0.44 V vs. SCE) oxygen reduction electrocatalysis is observed, occurring via the T1 copper centre. On positively charged ammonium-modified MWCNTs, a low-potential (0.15 V) oxygen reduction electrocatalysis is observed, occurring through a partially oxidised state of the T2/T3 trinuclear copper cluster. Finally, chemically modified naphthoate MWCNTs exhibit high bioelectrocatalytic current densities of 3.9 mA cm(-2) under air at gas-diffusion electrode. PMID:27328033

  12. Identification of Zyklopen, a New Member of the Vertebrate Multicopper Ferroxidase Family, and Characterization in Rodents and Human Cells123

    PubMed Central

    Chen, Huijun; Attieh, Zouhair K.; Syed, Basharut A.; Kuo, Yien‐Ming; Stevens, Valerie; Fuqua, Brie K.; Andersen, Henriette S.; Naylor, Claire E.; Evans, Robert W.; Gambling, Lorraine; Danzeisen, Ruth; Bacouri‐Haidar, Mhenia; Usta, Julnar; Vulpe, Chris D.; McArdle, Harry J.

    2010-01-01

    We previously detected a membrane-bound, copper-containing oxidase that may be involved in iron efflux in BeWo cells, a human placental cell line. We have now identified a gene encoding a predicted multicopper ferroxidase (MCF) with a putative C-terminal membrane-spanning sequence and high sequence identity to hephaestin (Heph) and ceruloplasmin (Cp), the other known vertebrate MCF. Molecular modeling revealed conservation of all type I, II, and III copper-binding sites as well as a putative iron-binding site. Protein expression was observed in multiple diverse mouse tissues, including placenta and mammary gland, and the expression pattern was distinct from that of Cp and Heph. The protein possessed ferroxidase activity, and protein levels decreased in cellular copper deficiency. Knockdown with small interfering RNA in BeWo cells indicates that this gene represents the previously detected oxidase. We propose calling this new member of the MCF family “zyklopen.” PMID:20685892

  13. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.

    PubMed

    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N

    1999-04-21

    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a

  14. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  15. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central

    2010-01-01

    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  16. Four novel mutations of the coproporphyrinogen III oxidase gene.

    PubMed

    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

    2009-01-01

    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  17. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  18. Evolution of the primate cytochrome c oxidase subunit II gene.

    PubMed

    Adkins, R M; Honeycutt, R L

    1994-03-01

    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  19. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation

    PubMed Central

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D. P.

    2009-01-01

    Monoamine oxidase A gene (MAOA) has earned the nickname “warrior gene” because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as “altruistic” punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  20. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  1. A putative multicopper protein secreted by an atypical type II secretion system involved in the reduction of insoluble electron acceptors in Geobacter sulfurreducens.

    PubMed

    Mehta, Teena; Childers, Susan E; Glaven, Richard; Lovley, Derek R; Mester, Tünde

    2006-08-01

    Extracellular electron transfer onto Fe(III) oxides in Geobacter sulfurreducens is considered to require proteins that must be exported to the outer surface of the cell. In order to investigate this, the putative gene for OxpG, the pseudopilin involved in a type II general secretion pathway of Gram-negative bacteria, was deleted. The mutant was unable to grow with insoluble Fe(III) oxide as the electron acceptor. Growth on soluble Fe(III) was not affected. An analysis of proteins that accumulated in the periplasm of the oxpG mutant, but not in the wild-type, led to the identification of a secreted protein, OmpB. OmpB is predicted to be a multicopper protein, with highest homology to the manganese oxidase, MofA, from Leptothrix discophora. OmpB contains a potential Fe(III)-binding site and a fibronectin type III domain, suggesting a possible role for this protein in accessing Fe(III) oxides. OmpB was localized to the membrane fraction of G. sulfurreducens and in the supernatant of growing cultures, consistent with the type II secretion system exporting OmpB. A mutant in which ompB was deleted had the same phenotype as the oxpG mutant, suggesting that the failure to export OmpB was responsible for the inability of the oxpG-deficient mutant to reduce Fe(III) oxide. This is the first report that proposes a role for a multicopper oxidase-like protein in an anaerobic organism. These results further emphasize the importance of outer-membrane proteins in Fe(III) oxide reduction and suggest that outer-membrane proteins other than c-type cytochromes are required for Fe(III) oxide reduction in Geobacter species. PMID:16849792

  2. The expression of lysyl-oxidase gene family members in myeloproliferative neoplasms.

    PubMed

    Tadmor, T; Bejar, J; Attias, D; Mischenko, E; Sabo, E; Neufeld, G; Vadasz, Z

    2013-05-01

    Myeloproliferative neoplasms (MPNs) are malignant disorders originating from clonal expansion of a single neoplastic stem cell and characteristically show an increase in bone marrow reticulin fibers. Lysyl oxidases (LOXs) are copper-dependent amine oxidases that play a critical role in the biogenesis of connective tissue by crosslinking extracellular matrix proteins, collagen and elastin. Expression of LOX gene family members is increased in disorders associated with increased fibrosis. To evaluate involvement of LOX gene family in various MPNs. In-situ hybridization was used to detect Lysyl-Oxidase family members in bone marrow biopsies from patients with different MPNs. We compared normal bone marrows and those from patients with polycythemia vera, essential thrombocythemia, chronic myeloid leukemia, and primary myelofibrosis (PMF). Serum levels of lysyl-oxidase from patients with PMF and healthy controls were also examined. LOX gene family was not detected in normal bone marrows. All members of the LOX gene family were over expressed in PMF. In other MPNs a differential pattern of expression was observed. Differences in gene expression were statistically significant (P < 0.010). The medianserum LOX levels in normal controls was 28.4 ± 2.5 ng\\ml and 44.6 ± 9.44 ng\\ml in PMF (P = 0.02). The varying pattern of expression of LOX genes may reflect differences in the pathophysiology of bone marrow fibrosis in these MPNs. These observations could be used as the basis for future targeted therapy directed against bone marrow fibrosis. PMID:23494965

  3. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development. PMID:24374939

  4. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

  5. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel

    1983-01-01

    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  6. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  7. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  8. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  9. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  10. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  11. Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

    PubMed Central

    Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

    2001-01-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  12. Production of dwarf lettuce by overexpressing a pumpkin gibberellin 20-oxidase gene.

    PubMed

    Niki, T; Nishijima, T; Nakayama, M; Hisamatsu, T; Oyama-Okubo, N; Yamazaki, H; Hedden, P; Lange, T; Mander, L N; Koshioka, M

    2001-07-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2-35S-Omega). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T(2) generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T(2) generation, indicating that the transgene was stable and dominant. The endogenous levels of GA(1) and GA(4) were reduced in the dwarfs, whereas large amounts of GA(17) and GA(25), which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  13. Characterization of two peanut oxalate oxidase genes and development of peanut cultivars resistant to stem rot (Sclerotium rolfsii)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

  14. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  15. In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes

    PubMed Central

    Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.

    2014-01-01

    NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

  16. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  17. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  18. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.

    PubMed

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-12-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  19. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-01-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  20. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  1. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.

    PubMed

    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N

    1995-12-01

    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  2. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  3. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  4. Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

  5. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  6. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  7. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  8. Characterization of Rice NADPH Oxidase Genes and Their Expression under Various Environmental Conditions

    PubMed Central

    Wang, Gang-Feng; Li, Wen-Qiang; Li, Wen-Yan; Wu, Guo-Li; Zhou, Cong-Yi; Chen, Kun-Ming

    2013-01-01

    Plasma membrane NADPH oxidases (Noxs) are key producers of reactive oxygen species under both normal and stress conditions in plants. We demonstrate that at least eleven genes in the genome of rice (Oryza sativa L.) were predicted to encode Nox proteins, including nine genes (OsNox1–9) that encode typical Noxs and two that encode ancient Nox forms (ferric reduction oxidase 1 and 7, OsFRO1 and OsFRO7). Phylogenetic analysis divided the Noxs from nine plant species into six subfamilies, with rice Nox genes distributed among subfamilies I to V. Gene expression analysis using semi-quantitative RT-PCR and real-time qRT-PCR indicated that the expression of rice Nox genes depends on organs and environmental conditions. Exogenous calcium strongly stimulated the expression of OsNox3, OsNox5, OsNox7, and OsNox8, but depressed the expression of OsFRO1. Drought stress substantially upregulated the expression of OsNox1–3, OsNox5, OsNox9, and OsFRO1, but downregulated OsNox6. High temperature upregulated OsNox5–9, but significantly downregulated OsNox1–3 and OsFRO1. NaCl treatment increased the expression of OsNox2, OsNox8, OsFRO1, and OsFRO7, but decreased that of OsNox1, OsNox3, OsNox5, and OsNox6. These results suggest that the expression profiles of rice Nox genes have unique stress-response characteristics, reflecting their related but distinct functions in response to different environmental stresses. PMID:23629674

  9. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.

    PubMed

    Pu, Xiao-jun; Lv, Xin; Lin, Hong-hui

    2015-11-01

    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors--WRKY, NAC, bZIP and MYB--are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  10. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.

    PubMed

    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S

    2003-01-21

    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  11. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.

    PubMed

    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire

    2003-01-01

    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  12. Identification of a nitroalkane oxidase gene: naoA related to the growth of Streptomyces ansochromogenes.

    PubMed

    Li, Yanhua; Zhang, Jihui; Tan, Huarong

    2008-12-01

    naoA, encoding a nitroalkane oxidase that can catalyze toxic nitroalkanes to their corresponding aldehydes or ketones and hydrogen peroxide, was cloned from Streptomyces ansochromogenes, but its function related to the growth of Streptomyces is unknown. naoA was disrupted by the insertion of a kanamycin-resistance gene; the resulting strain can grow earlier than a wild-type strain under the same conditions. It was shown that naoA disruption accelerated growth of the naoA-disruption mutant, which could restore its phenotype and morphology as a wild-type strain by complementation of a single copy number of naoA inserted into the chromosome. The introduction of an extra copy of naoA into the wild-type strain resulted in delayed growth. The result suggested that naoA is an important gene related to the growth of S. ansochromogenes. PMID:18810541

  13. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M

    1998-01-01

    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  14. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  15. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  16. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  17. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  18. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  19. Bigenomic transcriptional regulation of all thirteen cytochrome c oxidase subunit genes by specificity protein 1

    PubMed Central

    Dhar, Shilpa S.; Johar, Kaid; Wong-Riley, Margaret T. T.

    2013-01-01

    Cytochrome c oxidase (COX) is one of only four known bigenomic proteins, with three mitochondria-encoded subunits and 10 nucleus-encoded ones derived from nine different chromosomes. The mechanism of regulating this multi-subunit, bigenomic enzyme is not fully understood. We hypothesize that specificity protein 1 (Sp1) functionally regulates the 10 nucleus-encoded COX subunit genes directly and the three mitochondrial COX subunit genes indirectly by regulating mitochondrial transcription factors A and B (TFAM, TFB1M and TFB2M) in neurons. By means of in silico analysis, electrophoretic mobility shift and supershift assays, chromatin immunoprecipitation, RNA interference and over-expression experiments, the present study documents that Sp1 is a critical regulator of all 13 COX subunit genes in neurons. This regulation is intimately associated with neuronal activity. Silencing of Sp1 prevented the upregulation of all COX subunits by KCl, and over-expressing Sp1 rescued all COX subunits from being downregulated by tetrodotoxin. Thus, Sp1 and our previously described nuclear respiratory factors 1 and 2 are the three key regulators of all 13 COX subunit genes in neurons. The binding sites for Sp1 on all 10 nucleus-encoded COX subunits, TFAM, TFB1M and TFB2M are highly conserved among mice, rats and humans. PMID:23516108

  20. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  1. cDNA cloning and gene expression of ascorbate oxidase in tobacco.

    PubMed

    Kato, N; Esaka, M

    1996-02-01

    A cDNA clone for ascorbate oxidase (AAO) has been isolated from a cDNA library of tobacco (Nicotiana tabacum) cells. The identity of the amino acid sequence deduced from tobacco AAO cDNA to that from pumpkin AAO cDNA was 68%, which was much lower than the identity (80%) between pumpkin and cucumber AAO. AAO activity in tobacco cells was much lower than that in pumpkin cells, whereas the immunoreactive protein in tobacco cells was more abundant than that in pumpkin cells. We suppose that AAO protein in tobacco cells may be less active than that in pumpkin cells. Genomic Southern blotting suggested that AAO in tobacco was encoded by a single-copy gene. Nothern blotting revealed that mRNA of AAO was highly expressed in young and growing tissues of tobacco plant. PMID:8624413

  2. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  3. Cloning and Characterization of Three Fatty Alcohol Oxidase Genes from Candida tropicalis Strain ATCC 20336

    PubMed Central

    Eirich, L. Dudley; Craft, David L.; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H.; Stols, Lucy; Donnelly, Mark I.; Wilson, C. Ron

    2004-01-01

    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of ω-hydroxy fatty acids to ω-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and Km values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes ω-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not ω-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the Km values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  4. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

    PubMed

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  5. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  6. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.

    PubMed

    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury

    2016-08-01

    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  7. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  8. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  9. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 μM/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 μM/min and Km (NADH) 51.3 μM, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  10. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  11. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  12. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  13. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  14. The Involvement of Gibberellin 20-Oxidase Genes in Phytochrome-Regulated Petiole Elongation of Arabidopsis

    PubMed Central

    Hisamatsu, Tamotsu; King, Rod W.; Helliwell, Chris A.; Koshioka, Masaji

    2005-01-01

    Long day (LD) exposure of rosette plants causes rapid stem/petiole elongation, a more vertical growth habit, and flowering; all changes are suggestive of a role for the gibberellin (GA) plant growth regulators. For Arabidopsis (Arabidopsis thaliana) L. (Heynh), we show that enhancement of petiole elongation by a far-red (FR)-rich LD is mimicked by a brief (10 min) end-of-day (EOD) FR exposure in short day (SD). The EOD response shows red (R)/FR photoreversibility and is not affected in a phytochrome (PHY) A mutant so it is mediated by PHYB and related PHYs. FR photoconversion of PHYB to an inactive form activates a signaling pathway, leading to increased GA biosynthesis. Of 10 GA biosynthetic genes, expression of the 20-oxidase, AtGA20ox2, responded most to FR (up to a 40-fold increase within 3 h). AtGA20ox1 also responded but to a lesser extent. Stimulation of petiole elongation by EOD FR is reduced in a transgenic AtGA20ox2 hairpin gene silencing line. By contrast, it was only in SD that a T-DNA insertional mutant of AtGA20ox1 (ga5-3) showed reduced response. Circadian entrainment to a daytime pattern provides an explanation for the SD expression of AtGA20ox1. Conversely, the strong EOD/LD FR responses of AtGA20ox2 may reflect its independence of circadian regulation. While FR acting via PHYB increases expression of AtGA20ox2, other GA biosynthetic genes are known to respond to R rather than FR light and/or to other PHYs. Thus, there must be different signal transduction pathways, one at least showing a positive response to active PHYB and another showing a negative response. PMID:15923331

  15. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  16. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis.

    PubMed

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-05-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  17. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  18. Mitochondrial Cytochrome Oxidase I Gene Sequence Analysis of Aedes Albopictus in Malaysia.

    PubMed

    Ismail, Nurul-Ain; Dom, Nazri Che; Ismail, Rodziah; Ahmad, Abu Hassan; Zaki, Afiq; Camalxaman, Siti Nazrina

    2015-12-01

    A study was conducted to establish polymorphic variation of the mitochondrial DNA encoding the cytochrome oxidase subunit 1 (CO1) gene in Aedes albopictus isolated from 2 hot spot dengue-infested areas in the Subang Jaya District, Malaysia. A phylogenetic analysis was performed with the use of sequences obtained from USJ6 and Taman Subang Mas (TSM). Comparison of the local CO1 sequences with a laboratory strain (USM), alongside reference strains derived from the GenBank database revealed low genetic variation in terms of nucleotide differences and haplotype diversity. Four methods were used to construct a phylogenetic tree and illustrate the genetic relationship of the 37 Ae. albopictus populations based on the CO1 sequences, namely neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian method, which revealed a distinct relationship between isolates from USJ6 and TSM. Our findings provide new information regarding the genetic diversity among morphologically similar Ae. albopictus, which has not been reported to date. PMID:26675451

  19. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  20. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  1. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    PubMed

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants. PMID:27315932

  2. Divergent biochemical and enzymatic properties of oxalate oxidase isoforms encoded by four similar genes in rice.

    PubMed

    Li, Xiao Chun; Liao, Yuan Yang; Leung, David W M; Wang, Hai Yan; Chen, Bai Ling; Peng, Xin Xiang; Liu, E E

    2015-10-01

    The biochemical and enzymatic properties of four highly similar rice oxalate oxidase proteins (OsOxO1-4) were compared after their purification from the leaves of transgenic plants each overexpressing the respective OsOxO1-4 genes. Although alignment of their amino acid sequences has revealed divergence mainly in the signal peptides and they catalyze the same enzymic (oxalate oxidase) reaction, divergence in apparent molecular mass, Km, optimum pH, stability and responses to inhibitors and activators was uncovered by biochemical characterization of the purified OsOxO1-4 proteins. The apparent molecular mass of oligomer OsOxO1 was found to be similar to that of OsOxO3 but lower than the other two. The molecular mass of the subunit of OsOxO1 was lower than that of OsOxO3. The Km value of OsOxO3 was higher than the other three which had similar Km. OsOxO1 and OsOxO4 possessed peak activity at pH 8.5 which was close to that at the optimum pH 4.0. The activity of OsOxO2 at pH 8.5 was only 65% of that at its optimum pH 3.5, while the activity of OsOxO3 did not vary much at pH 6-9 and was also much lower than that at its optimum pH 3. OsOxO2 and OsOxO3 still maintained all their activities after being heated at 70°C for 1h while OsOxO1 and OsOxO4 lost about 30% of their activities. Pyruvate and oxaloacetic acid inhibited the activity of OsOxO3 more strongly than the other three. Interestingly, glucose 6-phosphate, fructose 6-phosphate and fructose 1,6-biphosphate related to photosynthetic assimilation of triose phosphate greatly increased the activities of OsOxO3 and OsOxO4. In addition to the differences in the biochemical properties of the four OsOxO proteins, an intriguing finding is that the purified OsOxO1-4 exhibited substrate inhibition, which is a typical of the classical Michaelis-Menten enzyme kinetics exhibited by a majority of other enzymes. PMID:26347131

  3. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  4. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

    2008-01-01

    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  5. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  6. X-ray analysis of bilirubin oxidase from Myrothecium verrucaria at 2.3 Å resolution using a twinned crystal

    PubMed Central

    Mizutani, Kimihiko; Toyoda, Mayuko; Sagara, Kenta; Takahashi, Nobuyuki; Sato, Atsuko; Kamitaka, Yuji; Tsujimura, Seiya; Nakanishi, Yuji; Sugiura, Toshiyuki; Yamaguchi, Shotaro; Kano, Kenji; Mikami, Bunzo

    2010-01-01

    Bilirubin oxidase (BOD), a multicopper oxidase found in Myrothecium verrucaria, catalyzes the oxidation of bilirubin to biliverdin. Oxygen is the electron acceptor and is reduced to water. BOD is used for diagnostic analysis of bilirubin in serum and has attracted considerable attention as an enzymatic catalyst for the cathode of biofuel cells that work under neutral conditions. Here, the crystal structure of BOD is reported for the first time. Blue bipyramid-shaped crystals of BOD obtained in 2-methyl-2,4-pentanediol (MPD) and ammonium sulfate solution were merohedrally twinned in space group P63. Structure determination was achieved by the single anomalous diffraction (SAD) method using the anomalous diffraction of Cu atoms and synchrotron radiation and twin refinement was performed in the resolution range 33–2.3 Å. The overall organization of BOD is almost the same as that of other multicopper oxidases: the protein is folded into three domains and a total of four copper-binding sites are found in domains 1 and 3. Although the four copper-binding sites were almost identical to those of other multicopper oxidases, the hydrophilic Asn residue (at the same position as a hydrophobic residue such as Leu in other multicopper oxidases) very close to the type I copper might contribute to the characteristically high redox potential of BOD. PMID:20606269

  7. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  8. Characterization and Functional Analysis of the poxB Gene, Which Encodes Pyruvate Oxidase in Lactobacillus plantarum

    PubMed Central

    Lorquet, Frédérique; Goffin, Philippe; Muscariello, Lidia; Baudry, Jean-Bernard; Ladero, Victor; Sacco, Margherita; Kleerebezem, Michiel; Hols, Pascal

    2004-01-01

    The pyruvate oxidase gene (poxB) from Lactobacillus plantarum Lp80 was cloned and characterized. Northern blot and primer extension analyses revealed that transcription of poxB is monocistronic and under the control of a vegetative promoter. poxB mRNA expression was strongly induced by aeration and was repressed by glucose. Moreover, Northern blotting performed at different stages of growth showed that poxB expression is maximal in the early stationary phase when glucose is exhausted. Primer extension and in vivo footprint analyses revealed that glucose repression of poxB is mediated by CcpA binding to the cre site identified in the promoter region. The functional role of the PoxB enzyme was studied by using gene overexpression and knockout in order to evaluate its implications for acetate production. Constitutive overproduction of PoxB in L. plantarum revealed the predominant role of pyruvate oxidase in the control of acetate production under aerobic conditions. The ΔpoxB mutant strain exhibited a moderate (20 to 25%) decrease in acetate production when it was grown on glucose as the carbon source, and residual pyruvate oxidase activity that was between 20 and 85% of the wild-type activity was observed with glucose limitation (0.2% glucose). In contrast, when the organism was grown on maltose, the poxB mutation resulted in a large (60 to 80%) decrease in acetate production. In agreement with the latter observation, the level of residual pyruvate oxidase activity with maltose limitation (0.2% maltose) was less than 10% of the wild-type level of activity. PMID:15175288

  9. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.

    PubMed

    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P

    1993-06-01

    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  10. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R

    1984-01-01

    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  11. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  12. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  13. DGGE analysis of the coproporphyrinogen oxidase gene: two new mutations in DNA from Danish patients with hereditary coproporphyria.

    PubMed

    Petersen, N E; Käehne, M; Christiansen, L; Brock, A; Hother-Nielsen, O; Rasmussen, K

    2000-11-01

    The knowledge of at least 21 different mutations and several polymorphisms in the coproporphyrinogen oxidase (CPO) gene demonstrates that the molecular basis of hereditary coproporphyria is heterogeneous. We developed a DGGE-based assay for the analysis of exons 2 to 7, including 14-96 nucleotides of the flanking intronic sequences of the CPO gene. To render it suitable for the clinical diagnostic laboratory, we designed the assay to allow use of identical PCR conditions and the same DGGE gel for analyses of all the regions. Using this assay, and subsequent sequencing of gene regions containing interallelic variations, two novel mutations in the CPO gene were identified: a missense mutation (607G-->A), leading to the substitution of an alanine with a threonine, and a nonsense mutation (1281G-->A), giving rise to a stop codon 28 codons upstream to the wild-type stop codon. PMID:11202054

  14. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

    1989-01-01

    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  15. Changes in Cytokinin Content and Cytokinin Oxidase Activity in Response to Derepression of ipt Gene Transcription in Transgenic Tobacco Calli and Plants.

    PubMed Central

    Motyka, V.; Faiss, M.; Strand, M.; Kaminek, M.; Schmulling, T.

    1996-01-01

    Metabolic control of cytokinin oxidase by its substrate was investigated in planta using wild-type (WT) and conditionally ipt gene-expressing transgenic (IPT) tobacco (Nicotiana tabacum L.) callus cultures and plants. The derepression of the tetracycline (Tc)-dependent ipt gene transcription was followed by a progressive, more than 100-fold increase in total cytokinin content in IPT calli. The activity of cytokinin oxidase extracted from these calli began to increase 16 to 20 h after gene derepression, and after 13 d it was 10-fold higher than from Tc-treated WT calli. An increase in cytokinin oxidase activity, as a consequence of elevated cytokinin levels, was found in detached leaves (8-fold after 4 d) and in roots of intact plants (4-fold after 3 d). The partially purified cytokinin oxidase from WT, repressed IPT, and Tc-derepressed IPT tobacco calli exhibited similar characteristics. It had the same broad pH optimum (pH 6.5-8.5), its activity in vitro was enhanced 4-fold in the presence of copper-imidazole, and the apparent Km(N6-[[delta]2iso-pentenyl]adenine) values were in the range of 3.1 to 4.9 [mu]M. The increase in cytokinin oxidase activity in cytokinin-overproducing tissue was associated with the accumulation of a glycosylated form of the enzyme. The present data indicate the substrate induction of cytokinin oxidase activity in different tobacco tissues, which may contribute to hormone homeostasis. PMID:12226431

  16. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  17. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  18. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  19. Hereditary Coproporphyria Associated with the Q306X Mutation in the Coproporphyrin Oxidase Gene Presenting with Acute Ataxia

    PubMed Central

    Jiménez-Jiménez, Félix Javier; Agúndez, José A. G.; Martínez, Carmen; Navacerrada, Francisco; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Alonso-Navarro, Hortensia; García-Martín, Elena

    2013-01-01

    Background Hereditary coproporphyria (HCPO) is a low-penetrance, autosomal dominant, acute hepatic porphyria characterized by the overproduction and excretion of coproporphyrin. The most common neurological manifestations of this entity include peripheral, predominantly motor dysfunction, and central nervous system dysfunction. Ataxia associated with HCPO has not been reported previously. The aim of this article is to report a patient with HCPO presenting with acute ataxia. Case Report We describe a 44-year-old patient presenting clinically with acute ataxia who was diagnosed with HCPO; mutations were analyzed in the coproporphyrin-oxidase III (CPOX) gene in the patient and in six asymptomatic first-degree relatives. Discussion The patient was heterozygous for a mutation causing the amino acid exchange Q306X in the CPOX gene. No relatives carried the same or another mutation in the CPOX gene. HCPO should be considered in the differential diagnosis for patients presenting with ataxia. PMID:24156084

  20. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.

    PubMed

    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

    2013-01-01

    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion. PMID:24265769

  1. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  2. A newly identified fatty alcohol oxidase gene is mainly responsible for the oxidation of long-chain ω-hydroxy fatty acids in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Förster, André; Bär, Kati; Winter, Miriam; Otto, Christina; Petzsch, Patrick; Ježková, Michaela; Bahr, Katrin; Pfeiffer, Melanie; Matthäus, Falk; Barth, Gerold

    2014-09-01

    Nine potential (fatty) alcohol dehydrogenase genes and one alcohol oxidase gene were identified in Yarrowia lipolytica by comparative sequence analysis. All relevant genes were deleted in Y. lipolytica H222ΔP which is lacking β-oxidation. Resulting transformants were tested for their ability to accumulate ω-hydroxy fatty acids and dicarboxylic acids in the culture medium. The deletion of eight alcohol dehydrogenase genes (FADH, ADH1-7), which may be involved in ω-oxidation, led only to a slightly increased accumulation of ω-hydroxy fatty acids, whereas the deletion of the fatty alcohol oxidase gene (FAO1), which has not been described yet in Y. lipolytica, exhibited a considerably higher effect. The combined deletion of the eight (fatty) alcohol dehydrogenase genes and the alcohol oxidase gene further reduced the formation of dicarboxylic acids. These results indicate that both (fatty) alcohol dehydrogenases and an alcohol oxidase are involved in ω-oxidation of long-chain fatty acids whereby latter plays the major role. This insight marks the first step toward the biotechnological production of long-chain ω-hydroxy fatty acids with the help of the nonconventional yeast Y. lipolytica. The overexpression of FAO1 can be further used to improve existing strains for the production of dicarboxylic acids. PMID:24931727

  3. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  4. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  5. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  6. The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

    PubMed

    Nawathean, P; Maslov, D A

    2000-08-01

    By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs. PMID:10975258

  7. The copper-iron connection in biology: Structure of the metallo-oxidase Fet3p

    SciTech Connect

    Taylor, A. B.; Stoj, C. S.; Ziegler, L.; Kosman, D. J.; Hart, P. J.

    2005-10-17

    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O2 to H2O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase.

  8. Environmental factors shaping the abundance and distribution of laccase-encoding bacterial community with potential phenolic oxidase capacity during composting.

    PubMed

    Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Guo, Jinsong; Zhang, Jiachao; Chen, Ming; Wu, Haipeng; Yuan, Yujie; He, Xiaoxiao; He, Yan

    2015-11-01

    Increasing molecular evidence points to a wide occurrence of laccase-like multicopper oxidase (LMCO)-encoding genes in bacteria. Most researches mainly focused on the bacterial LMCO diversity, whereas the processes and the environmental factors responsible for structuring bacterial LMCO communities remain relatively unknown in a composting system. Six gene libraries were constructed from samples in representative stages during composting. A total of 185 sequences obtained from sample DNA extracts were classified to 59 operational taxonomic units (OTUs) based on 10 % cutoff. The distribution profile of bacterial LMCO genes showed that proteobacterial- and actinobacterial-associated species were the dominant communities during composting. Pearson correlation analysis indicated that the pile temperature and water-soluble carbon (WSC) content were significantly positively correlated with bacterial LMCO gene OTU numbers, Chao1 and Shannon index, whereas the humic acid (HA)-like carbon content had the most significant effect on the distribution of the bacterial LMCO genes during composting by redundancy analysis. These findings will improve the understanding of the mutual relationship between environmental factors and bacterial LMCO community compositions in composting. PMID:26104868

  9. Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission

    PubMed Central

    Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei

    2014-01-01

    Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

  10. THE ISOAMYL OXIDASE GENE IN PENICILLIUM GRISEOFULVUM IS PART OF THE PATULIN BIOSYNTHETIC PATHWAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

  11. Nitric oxide mediated amelioration of arsenic toxicity which alters the alternative oxidase (Aox1) gene expression in Hordeum vulgare L.

    PubMed

    Shukla, Pratiksha; Singh, Shalini; Dubey, Pragyan; Singh, Aradhana; Singh, A K

    2015-10-01

    The role of nitric oxide (NO) as a key molecule in the signal transduction pathway of a biotic stress response has already been described. Recent studies indicate that it also participate in the signaling of abiotic stresses. In the present study, we showed the altered expression of stress responsive gene alternative oxidase (Aox1) in seedlings of barley (Hordeum vulgare L.) in response to arsenic toxicity. Arsenic toxicity decreased the germination percentage, biomass, chlorophyll and carotenoid content whereas, arsenic toxicity enhanced the MDA content and proline content in a dose dependent manner. Other enzyme activities like catalase and superoxide dismutase increased with the increase in concentrations but it fell down at higher concentration of arsenic. Pretreatment of nitric oxide results in the enhanced expression of alternative oxidase which showed the adaptation of alternative pathway during the arsenic stress and it also enhances the growth ability and adaptability towards the arsenic stress. The results support the conclusion that nitric oxide ameliorates the arsenic toxicity not only at the level of antioxidant defense but also by affecting other mechanism of detoxification. PMID:26036416

  12. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  13. Characterization and expression of a new class of zinc finger protein that binds to silencer region of ascorbate oxidase gene.

    PubMed

    Kisu, Y; Ono, T; Shimofurutani, N; Suzuki, M; Esaka, M

    1998-10-01

    A unique A/T-rich sequence (5'-AAAAAGTAAAAA-GTAAAAAAGTAAAAAG-3), referred to as the AGTA repeat, is found in the silencer region of the pumpkin ascorbate oxidase gene. A cDNA for protein (AOBP) that binds to the AGTA repeat was isolated from pumpkin by the southwestern method. The AOBP protein has a new class of zinc/DNA-binding domain named Dof/MOA domain that is highly conserved in many plant proteins and is significantly related to those of steroid hormone receptors and GATA1. Gel retardation analysis indicated that AOBP bound to the AGTA repeat through the Dof/MOA domain. Metal chelators, 1,10-phenanthroline and EDTA, specifically inhibited the DNA binding of AOBP, indicating that metal coordination plays an important role in DNA binding of AOBP. Thus, the Dof/MOA domain acts as a zinc/DNA-binding domain in AOBP. Gel retardation analysis with mutated oligonucleotides suggested that the Dof/MOA domain recognized the AGTA core sequence. AOBP mRNA was expressed in mature tissues of pumpkin, but was expressed only in small amounts or was not expressed in growing tissues. Furthermore, the expression was auxin-independent. The expression pattern of AOBP and that of ascorbate oxidase did not show a positive correlation. PMID:9871365

  14. Isolation and characterization of the human aldehyde oxidase gene: conservation of intron/exon boundaries with the xanthine oxidoreductase gene indicates a common origin.

    PubMed Central

    Terao, M; Kurosaki, M; Demontis, S; Zanotta, S; Garattini, E

    1998-01-01

    Aldehyde oxidase (AO) is a molybdo-flavo enzyme involved in the metabolism of various endogenous and exogenous N-heterocyclic compounds of pharmacological and toxicological importance. The enzyme is the product of a gene which is implicated in the aetio-pathogenesis of familial recessive amyotrophic lateral sclerosis. Here, we report the cloning and structural characterization of the human AO gene. AO is a single copy gene approximately 85 kb long with 35 transcribed exons. The transcription-initiation site and the sequence of the 5'-flanking region, containing several putative regulatory elements, were determined. The 5'-flanking region contains a functional promoter, as assessed by appropriate reporter constructs in transient transfection experiments. Comparison of the AO gene structure shows conservation of the position and type of exon/intron junctions relative to those observed in the gene coding for another molybdo-flavoprotein, i.e. xanthine oxidoreductase (XOR). As the two genes code for proteins with a high level of amino acid identity, our results strongly suggest that the AO and XOR genetic loci arose as the consequence of a duplication event. Southern blot analysis conducted on genomic DNA from various animal species with specific cDNA probes indicates that the AO gene is less conserved than the XOR gene during evolution. PMID:9601067

  15. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  16. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  17. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  18. The role of the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of COX (cytochrome c oxidase) I and COX III mRNA.

    PubMed

    Xu, Fenghao; Morin, Charles; Mitchell, Grant; Ackerley, Cameron; Robinson, Brian H

    2004-08-15

    Leigh syndrome French Canadian (LSFC) is a variant of cytochrome oxidase deficiency found in Québec and caused by mutations in the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene. Northern blots showed that the LRPPRC mRNA levels seen in skeletal muscle>heart>placenta>kidney>liver>lung=brain were proportionally almost opposite in strength to the severity of the enzymic cytochrome oxidase defect. The levels of COX (cytochrome c oxidase) I and COX III mRNA visible on Northern blots were reduced in LSFC patients due to the common (A354V, Ala354-->Val) founder mutation. The amount of LRPPRC protein found in both fibroblast and liver mitochondria from LSFC patients was consistently reduced to <30% of control levels. Import of [(35)S]methionine LRPPRC into rat liver mitochondria was slower for the mutant (A354V) protein. A titre of LRPPRC protein was also found in nuclear fractions that could not be easily accounted for by mitochondrial contamination. [35S]Methionine labelling of mitochondrial translation products showed that the translation of COX I, and perhaps COX III, was specifically reduced in the presence of the mutation. These results suggest that the gene product of LRPPRC, like PET 309p, has a role in the translation or stability of the mRNA for mitochondrially encoded COX subunits. A more diffuse distribution of LRPPRC in LSFC cells compared with controls was evident when viewed by immunofluorescence microscopy, with less LRPPRC present in peripheral mitochondria. PMID:15139850

  19. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  20. Molecular characterization of fire ants, Solenopsis spp., from Brazil based on analysis of mtDNA gene cytochrome oxidase I.

    PubMed

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  1. Molecular Characterization of Fire Ants, Solenopsis spp., from Brazil Based on Analysis of mtDNA Gene Cytochrome Oxidase I

    PubMed Central

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  2. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  3. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  4. Effects of hydrogen sulfide on alternative pathway respiration and induction of alternative oxidase gene expression in rice suspension cells.

    PubMed

    Xiao, Man; Ma, Jun; Li, Hongyu; Jin, Han; Feng, Hanqing

    2010-01-01

    The toxic effects of H2S on plants are well documented. However, the molecular mechanisms reponsible for inhibition of plants by H2S are still not completely understood. We determined the effects of NaHS in the range of 0.5-10 mM on the growth of rice suspension culture cells, as well as on the expression of the alternative oxidase (AOX) gene. AOX is the terminal oxidase of the alternative pathway (AP) and exists in plant mitochondria. The results showed that H2S treatment enhanced the AP activity. During the process of H2S treatment for 4 h, the AP activity increased dramatically and achieved the peak value at a concentration of 2 mM NaHS. Then it declined at higher concentrations of NaHS (5-10 mM) and maintained a steady level. The AOX1 gene transcript level also showed a similar change as the AP activity. Interestingly, different NaHS concentrations seemed to have different effects on the expression of AOX1a, AOX1b, and AOX1c. The induction of AOX expression by low concentrations of NaHS was inferred through a reactive oxygen species (ROS)-independent pathway. At the same time, rice cells grown in culture were very sensitive to H2S, different H2S concentrations induced an increase in the cell viability. These results indicate that the H2S-induced AOX induction might play a role in inhibiting the ROS production and have an influence on cell viability. PMID:20737915

  5. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  6. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  7. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    PubMed

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed. PMID:10945344

  8. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

    2013-01-01

    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  9. Mutations of the SCO1 Gene in Mitochondrial Cytochrome c Oxidase Deficiency with Neonatal-Onset Hepatic Failure and Encephalopathy

    PubMed Central

    Valnot, Isabelle; Osmond, Sandrine; Gigarel, Nadine; Mehaye, Blandine; Amiel, Jeanne; Cormier-Daire, Valérie; Munnich, Arnold; Bonnefont, Jean-Paul; Rustin, Pierre; Rötig, Agnès

    2000-01-01

    Cytochrome c oxidase (COX) catalyzes both electron transfer from cytochrome c to molecular oxygen and the concomitant vectorial proton pumping across the inner mitochondrial membrane. Studying a large family with multiple cases of neonatal ketoacidotic comas and isolated COX deficiency, we have mapped the disease locus to chromosome 17p13.1, in a region encompassing two candidate genes involved in COX assembly—namely, SCO1 and COX10. Mutation screening revealed compound heterozygosity for SCO1 gene mutations in the patients. The mutated allele, inherited from the father, harbored a 2-bp frameshift deletion (ΔGA; nt 363–364) resulting in both a premature stop codon and a highly unstable mRNA. The maternally inherited mutation (C520T) changed a highly conserved proline into a leucine in the protein (P174L). This proline, adjacent to the CxxxC copper-binding domain of SCO1, is likely to play a crucial role in the tridimentional structure of the domain. Interestingly, the clinical presentation of SCO1-deficient patients markedly differs from that of patients harboring mutations in other COX assembly and/or maturation genes. PMID:11013136

  10. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  11. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli. PMID:26369789

  12. Dual gene defects involving delta-aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient.

    PubMed

    Akagi, Reiko; Inoue, Rikako; Muranaka, Shikibu; Tahara, Tsuyoshi; Taketani, Shigeru; Anderson, Karl E; Phillips, John D; Sassa, Shigeru

    2006-01-01

    Summary A Caucasian male had symptoms of acute porphyria, with increases in urinary delta-aminolaevulinic acid (ALA), porphobilinogen (PBG) and coproporphyrin that were consistent with hereditary coproporphyria (HCP). However, a greater than expected increase in ALA, compared with PBG, and a substantial increase in erythrocyte zinc protoporphyrin, suggested additional ALA dehydratase (ALAD) deficiency. Nucleotide sequence analysis of coproporphyrinogen oxidase (CPO) cDNA of the patient, but not of the parents, revealed a novel nucleotide transition G835-->C, resulting in an amino acid change, G279R. The mutant CPO protein expressed in Escherichia coli was unstable, and produced about 5% of activity compared with the wild-type CPO. Erythrocyte ALAD activity was 32% of normal in the proband. Nucleotide sequence analysis of cloned ALAD cDNAs from the patient revealed a C36-->G base transition (F12L amino acid change). The F12L ALAD mutation, which was found in the mother and a brother, was previously described, and is known to lack any enzyme activity. This patient thus represents the first case of porphyria where both CPO and ALAD deficiencies were demonstrated at the molecular level. PMID:16398658

  13. Reduction of coproporphyrinogen oxidase level by antisense RNA synthesis leads to deregulated gene expression of plastid proteins and affects the oxidative defense system.

    PubMed Central

    Kruse, E; Mock, H P; Grimm, B

    1995-01-01

    A full-length cDNA sequence encoding coproporphyrinogen oxidase was inserted in inverse orientation behind a CaMV promoter and transferred to tobacco (Nicotiana tabacum) by standard transformation techniques. Transformants showed reduced coproporphyrinogen oxidase activity and accumulation of photosensitive coproporphyrin(ogen), indicating antisense RNA expression. An inverse correlation was observed between the level of coproporphyrinogen oxidase and transformant phenotype. The latter is characterized by a broad range of growth retardation and necrosis, indicating oxidative leaf damage. Coproporphyrinogen is an apparent chromophore and its excitation finally leads to the production of reactive oxygen. Evidence is presented that indicates a direct correlation between the accumulation of non-metabolized coproporphyrinogen and oxidative damage to cellular structural components. Enzymatic and non-enzymatic antioxidants were investigated. Whereas superoxide dismutase activity increased in transgenic plants, catalase and ascorbate peroxidase activity remained constant. Tocopherol, rather than carotene or zeaxanthin, seemed to be involved in detoxification, indicating the putative localization and allocation of coproporphyrinogen. Expression of coproporphyrinogen oxidase antisense RNA did not significantly influence the level of other enzymes in the chlorophyll metabolic pathway, but deregulated gene expression of nuclear encoded plastid proteins. Accumulation of coproporphyrinogen and/or the resulting effects, such as oxidative stress, impairs a plastid/nuclear signal which may adapt gene expression to the plastid state. Images PMID:7641690

  14. [Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].

    PubMed

    Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A

    2014-10-01

    This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

  15. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

  16. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  17. Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity

    PubMed Central

    Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan

    2013-01-01

    The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

  18. Elevated Transcription of the Gene QSOX1 Encoding Quiescin Q6 Sulfhydryl Oxidase 1 in Breast Cancer

    PubMed Central

    Soloviev, Mikhail; Esteves, Michelle P.; Amiri, Fakhria; Crompton, Mark R.; Rider, Christopher C.

    2013-01-01

    The q arm of chromosome 1 is frequently amplified at the gene level in breast cancer. Since the significance of this is unclear we investigated whether 1q genes are overexpressed in this disease. The cDNA levels of 1q-located genes were analysed in a search for overexpressed genes. 26 genes mapping to the 1q arm show highly significant (P≤0.01) overexpression of transcripts in breast cancer compared to normal breast tissue. Amongst those showing the highest levels of overexpression in both expressed sequence tag (EST) and serial analysis of gene expression (SAGE) databases was enzyme quiescin Q6 sulfhydryl oxidase 1 (QSOX1). We investigated QSOX1 cDNA derived from T47D breast carcinoma cells by RT-PCR and 3′-RACE PCR and identified a novel extended form of QSOX1 transcript, containing a long 3′UTR, nearly double the size of the previously reported QSOX1 cDNA, and confirmed its 3′ end nucleotide sequence using RACE-PCR. We also used quantitative real-time PCR to analyse a panel of cDNAs derived from 50 clinically-graded normal and malignant breast tissue samples for the expression of QSOX1 mRNAs. QSOX1 transcription was elevated in an increasing proportion in the grade 2 and grade 3 tumours (graded according to the Nottingham prognostic index), with 10 of the 15 grade 3 tumours (67%) examined exceeding the normal range. There was a significant correlation between relative transcript level and clinical grade (P≤0.01) for all qPCR primer sets tested. QSOX1 mRNA levels, based on SAGE expression data, did not correlate with either Estrogen Receptor (ER) or Epidermal Growth Factor Receptor 2 (ErbB-2 or HER2/neu) expression. Our data indicate that QSOX1 is a potential new prognostic marker which may prove of use in the staging of breast tumours and the stratification of breast cancer patients. PMID:23460839

  19. Molecular characterization of Echinococcus granulosus from Peru by sequencing of the mitochondrial cytochrome C oxidase subunit 1 gene.

    PubMed

    Sánchez, Elizabeth; Cáceres, Omar; Náquira, César; Garcia, David; Patiño, Gladys; Silvia, Herrera; Volotão, Aline C; Fernandes, Octavio

    2010-09-01

    Echinococcus granulosus, the etiologic agent of cystic echinococcosis (CE) in humans and other animal species, is distributed worldwide. Ten intra-specific variants, or genotypes (G1-G10), have been defined based on genetic diversity. To determine the genotypes present in endemic areas of Peru, samples were collected from cattle (44), sheep (41) and humans (14) from Junín, Puno Huancavelica, Cusco, Arequipa and Ayacucho. DNA was extracted from protoscolex and/or germinal layers derived from 99 E. granulosus isolates and used as templates to amplify the mitochondrial cytochrome C oxidase subunit 1 gene. The resulting polymerase chain reaction products were sequenced and further examined by sequence analysis. All isolates, independent of the host, exhibited the G1 genotype. Phylogenetic analysis showed that three isolates from Ayacucho shared the same cluster with microvariant G1(4). The G1 genotype is considered the most widespread and infectious form of E. granulosus worldwide and our results confirm that the same patterns apply to this country. Therefore, these findings should be taken into consideration in developing prevention strategies and control programs for CE in Peru. PMID:20944997

  20. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

    PubMed

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-01-01

    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma. PMID:21921941

  1. Mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence of Spirocerca lupi (Nematoda, Spirurida): avenues for potential implications.

    PubMed

    Traversa, Donato; Costanzo, Francesca; Iorio, Raffaella; Aroch, Itamar; Lavy, Eran

    2007-05-31

    Canine spirocercosis is a life-threatening parasitosis caused by Spirocerca lupi (Nematoda, Spirurida) that is presently emerging in several countries. This study characterised an informative region within the mitochondrial (mtDNA) gene encoding for the cytochrome c oxidase subunit 1 (cox1) of S. lupi by Polymerase Chain Reaction (PCR)-coupled sequencing. Specimens from five different countries in Europe, Asia and Africa were examined and two different sequence variants of cox1 (i.e. haplotypes) were determined, displaying nucleotidic variation at 6 of 689 positions. All of these positions were invariable among all the parasite individuals from Europe (haplotype 1) and among the African and Asian individuals (haplotype 2), but differed between Europe and Asia/Africa. The S. lupi cox1 sequences were consistent with those of other common Spirurida previously reported at both nucleotidic and phylogenetic levels. This study provides molecular information essential for identification of the nematode, irrespective of its life cycle stage. Crucial implications for the specific molecular diagnosis of clinical spirocercosis and investigation of the evolution, population genetics, ecology and epidemiology of S. lupi are discussed. PMID:17428608

  2. Bilirubin oxidases in bioelectrochemistry: features and recent findings.

    PubMed

    Mano, Nicolas; Edembe, Lise

    2013-12-15

    Bilirubin oxidases, a sub class of the Multicopper oxidases family, were discovered in 1981 by Tanaka and Murao (Murao and Tanaka, 1981) and first used for the detection of bilirubin. Since 2001 and the pioneering work of Tsujimura, these BODs have attracted a lot of attention for the reduction of O2. Unlike laccases, these BODs are stable in physiological conditions (20mM phosphate buffer, pH 7.4, 0.14 M NaCl, 37 °C) and more than 120 papers have been published in the last 7 years. Here, we will first briefly describe some general features of BODs and then review the use of BODs for bilirubin biosensors and the recent achievements and progress toward the elaboration of efficient O2 reducing cathodes. PMID:23911663

  3. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs.

    PubMed

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-04-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5' homology arm (HA) of 8 kb and 3'HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3'HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  4. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  5. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  6. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.

    PubMed

    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  7. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    PubMed

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul). PMID:20924414

  8. Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

    PubMed Central

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

    2010-01-01

    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  9. Finding new enzymes from bacterial physiology: a successful approach illustrated by the detection of novel oxidases in Marinomonas mediterranea.

    PubMed

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

    2010-01-01

    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid L-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for L-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  10. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  11. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  12. Species delimitation and phylogenetic relationships of Chinese Leishmania isolates reexamined using kinetoplast cytochrome oxidase II gene sequences.

    PubMed

    Cao, De-Ping; Guo, Xian-Guang; Chen, Da-Li; Chen, Jian-Ping

    2011-07-01

    Leishmaniasis is a geographically widespread disease caused by protozoan parasites belonging to the genus Leishmania and transmitted by certain species of sand fly. This disease still remains endemic in China, especially in the west and northwest frontier regions. A recent ITS1 phylogeny of Chinese Leishmania isolates has challenged some aspects for their traditional taxonomy and cladistic hypotheses of their phylogeny. However, disagreement with respect to relationships within Chinese Leishmania isolates highlights the need for additional data and analyses. Here, we test the phylogenetic relationships among Chinese isolates and their relatives by analyzing kinetoplast cytochrome oxidase II (COII) gene sequences, including 14 Chinese isolates and three isolates from other countries plus 17 sequences retrieved from GenBank. The COII gene might have experienced little substitution saturation, and its evolutionary process was likely to have been stationary, reversible, and homogeneous. Both neighbor-joining and Bayesian analyses reveal a moderately supported group comprising ten newly determined isolates, which is closely related to Leishmania tarentolae and Endotrypanum monterogeii. In combination with genetic distance analysis as well as Bayesian hypothesis testing, this further corroborates the occurrence of an undescribed species of Leishmania. Our results also suggest that (1) isolate MHOM/CN/93/GS7 and isolate IPHL/CN/77/XJ771 are Leishmania donovani; (2) isolate MHOM/CN/84/JS1 is Leishmania tropica; (3) the status referring to an isolate MRHO/CN/62/GS-GER20 from a great gerbil in Gansu, China, as Leishmania gerbilli, formerly based on multilocus enzyme electrophoresis, is recognized; and (4) E. monterogeii is nested within the genus Leishmania, resulting in a paraphyletic Leishmania. In addition, the results of this study enrich our understanding of the heterogeneity and relationships of Chinese Leishmania isolates. PMID:21221640

  13. Secretory expression and purification of Aspergillus niger glucose oxidase in Saccharomyces cerevisiae mutant deficient in PMR1 gene.

    PubMed

    Ko, Ji-Hyun; Hahm, Moon Sun; Kang, Hyun Ah; Nam, Soo Wan; Chung, Bong Hyun

    2002-08-01

    The gene encoding glucose oxidase (GOD) from Aspergillus niger was expressed as a secretory product in the yeast Saccharomyces cerevisiae. Six consecutive histidine residues were fused to the C-terminus of GOD to facilitate purification. The recombinant GOD-His(6) secreted by S. cerevisiae migrated as a broad diffuse band on SDS-PAGE, with an apparent molecular weight higher than that in natural A. niger GOD. To investigate the effects of hyperglycosylation on the secretion efficiency and enzyme properties, GOD-His(6) was expressed and secreted in a S. cerevisiae mutant in which the PMR1 gene encoding Ca(++)-ATPase was disrupted. The pmr1 null mutant strain secreted an amount of GOD-His(6) per unit cell mass higher than that in the wild-type strain. In contrast to the hyperglycosylated GOD-His(6) secreted in the wild-type strain, the pmr1 mutant strain secreted GOD-His(6) in a homogeneous form with a protein band pattern similar to that in natural A. niger GOD, based on SDS-PAGE. The hyperglycosylated and pmr1Delta mutant-derived GOD-His(6) enzymes were purified to homogeneity by immobilized metal ion-affinity chromatography and their specific activities and stabilities were compared. The specific activity of the pmr1Delta mutant-derived GOD-His(6) on a protein basis was very similar to that of the hyperglycosylated GOD-His(6), although its pH and thermal stabilities were lower than those of the hyperglycosylated GOD-His(6). PMID:12182830

  14. Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations.

    PubMed

    Kovářová, Nikola; Cížková Vrbacká, Alena; Pecina, Petr; Stránecký, Viktor; Pronicka, Ewa; Kmoch, Stanislav; Houštěk, Josef

    2012-07-01

    The loss of Surf1 protein leads to a severe COX deficiency manifested as a fatal neurodegenerative disorder, the Leigh syndrome (LS(COX)). Surf1 appears to be involved in the early step of COX assembly but its function remains unknown. The aim of the study was to find out how SURF1 gene mutations influence expression of OXPHOS and other pro-mitochondrial genes and to further characterize the altered COX assembly. Analysis of fibroblast cell lines from 9 patients with SURF1 mutations revealed a 70% decrease of the COX complex content to be associated with 32-54% upregulation of respiratory chain complexes I, III and V and accumulation of Cox5a subunit. Whole genome expression profiling showed a general decrease of transcriptional activity in LS(COX) cells and indicated that the adaptive changes in OXPHOS complexes are due to a posttranscriptional compensatory mechanism. Electrophoretic and WB analysis showed that in mitochondria of LS(COX) cells compared to controls, the assembled COX is present entirely in a supercomplex form, as I-III₂-IV supercomplex but not as larger supercomplexes. The lack of COX also caused an accumulation of I-III₂ supercomplex. The accumulated Cox5a was mainly present as a free subunit. We have found out that the major COX assembly subcomplexes accumulated due to SURF1 mutations range in size between approximately 85-140kDa. In addition to the originally proposed S2 intermediate they might also represent Cox1-containing complexes lacking other COX subunits. Unlike the assembled COX, subcomplexes are unable to associate with complexes I and III. PMID:22465034

  15. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  16. The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase.

    PubMed

    Altamura, N; Capitanio, N; Bonnefoy, N; Papa, S; Dujardin, G

    1996-03-11

    The nuclear gene OXA1 was first isolated in Saccharomyces cerevisiae and found to be required at a post-translational step in cytochrome c oxidase biogenesis, probably at the level of assembly. Mutations in OXA1 lead to a complete respiratory deficiency. The protein Oxa1p is conserved through evolution and a human homolog has been isolated by functional complementation of a yeast oxa1- mutant. In order to further our understanding of the role of Oxa1p, we have constructed two yeast strains in which the OXA1 open reading frame was almost totally deleted. Cytochrome spectra and enzymatic activity measurements show the absence of heme aa3 and of a cytochrome c oxido-reductase activity and dramatic decrease of the oligomycin sensitive ATPase activity. Analysis of the respiratory complexes in non-denaturing gels reveals that Oxa1p is necessary for the correct assembly of the cytochrome c oxidase and the ATP synthase complex. PMID:8612730

  17. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.

    2013-01-01

    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  18. CYP99A3: functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice.

    PubMed

    Wang, Qiang; Hillwig, Matthew L; Peters, Reuben J

    2011-01-01

    Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochrome P450 (CYP) mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNA interference double knock-down of this pair of closely related CYPs reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which was ultimately achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al, and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al, and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene-derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  19. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  20. Cloning and expression in Escherichia coli of the D-aspartate oxidase gene from the yeast Cryptococcus humicola and characterization of the recombinant enzyme.

    PubMed

    Takahashi, Shouji; Takahashi, Toshiyuki; Kera, Yoshio; Matsunaga, Ryuji; Shibuya, Hiroo; Yamada, Ryo-hei

    2004-04-01

    The D-aspartate oxidase (DDO) from the yeast Cryptococcus humicola UJ1 (ChDDO) is highly specific to D-aspartate. The gene encoding ChDDO was cloned and expressed in Escherichia coli. Sequence analysis of the ChDDO gene showed that an open reading frame of 1,110 bp interrupted by two introns encodes a protein of 370 amino acids. The deduced amino acid sequence showed an FAD-binding motif and a peroxisomal targeting signal 1 in the N-terminal region and at the C-terminus, respectively, and also the presence of certain catalytically important amino acid residues corresponding to those catalytically important in D-amino acid oxidase (DAO). The sequence exhibited only a moderate identity to human (27.4%) and bovine (28.0%) DDOs, and a rather higher identity to yeast and fungal DAOs (30.4-33.2%). Similarly, phylogenetic analysis showed that ChDDO is more closely related to yeast and fungal DAOs than to mammalian DDOs. The gene expression was regulated at the transcriptional level and specifically induced by the presence of D-aspartate as the sole nitrogen source. ChDDO was expressed in an active form in E. coli to an approximately 5-fold greater extent than in yeast. The purified recombinant enzyme was identical to the native enzyme in physicochemical and catalytic properties. PMID:15115779

  1. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  2. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  3. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  4. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.

    PubMed

    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  5. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  6. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.

    PubMed

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

    2012-01-01

    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  7. The sequence divergence in cytochrome C oxidase I gene of Culex quinquefasciatus mosquito and its comparison with four other Culex species.

    PubMed

    Tahir, Hafiz Muhammad; Kanwal, Naila; Mehwish

    2016-07-01

    The genetic diversity of Culex quinquefasciatus mosquito based on the standard barcode region of cytochrome C oxidase I (COI) gene fragment was studied in the present study. The COI gene sequences of Cx. quinquefasciatus were also compared with four other species of Genus Culex (i.e. Cx. tritaeniorhynchus, Cx. fuscocephala, Cx. pipiens, and Cx. theileri). Our data set included sequences of Culex mosquitoes from 16 different countries of world. The average intraspecific and interspecific divergences recorded were 0.67% and 8.27%, respectively. The clades for five species were clearly separated except Cx. quinquefasciatus and Cx. pipiens. It is concluded that the DNA barcoding is effective and reliable tool for the identification of selected Culex species but create little problem in case of sister species. PMID:26258502

  8. Study on dioxygen reduction by mutational modifications of the hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase

    SciTech Connect

    Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige; Sakurai, Takeshi

    2014-07-18

    Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The single turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.

  9. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.

    PubMed

    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing

    2014-09-01

    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function. PMID:24890187

  10. A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

  11. Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae

    PubMed Central

    LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

    2006-01-01

    • Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60 kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

  12. Decreased shoot stature and grain alpha-amylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat.

    PubMed

    Appleford, Nigel E J; Wilkinson, Mark D; Ma, Qian; Evans, Daniel J; Stone, Marlon C; Pearce, Stephen P; Powers, Stephen J; Thomas, Stephen G; Jones, Huw D; Phillips, Andrew L; Hedden, Peter; Lenton, John R

    2007-01-01

    Ectopic expression of a gibberellin 2-oxidase gene (PcGA2ox1) decreased the content of bioactive gibberellins (GAs) in transgenic wheat, producing a range of dwarf plants with different degrees of severity. In at least one case, a single transformation event gave rise to T(1) plants with different degrees of dwarfism, the phenotypes being stably inherited over at least four generations. The dwarf phenotype, which included dark-green leaves, increased tillering and, in severe cases, a prostrate growth habit, was replicated by the application of a GA biosynthesis inhibitor to the wild type. Ear rachis length, grain set, and grain size were also decreased in the wheat transformants, compared with an azygous (null) line. The extent of post-germination alpha-amylase production in grains reflected the severity of the shoot phenotype of the transformants and both developmental processes were restored to normal by the application of gibberellic acid (GA(3)). Expression of two GA biosynthesis genes (TaGA20ox1 and TaGA3ox2) was up-regulated, and that of two alpha-amylase gene families (alpha-Amy1 and alpha-Amy2) down regulated, in scutella of semi-dwarf lines, compared with controls. The marked decline in transcript abundance of both alpha-amylase gene families in aleurone was associated with a decreased content of bioactive GAs in grains of the semi-dwarf lines. PMID:17916639

  13. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  14. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

    PubMed

    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step. PMID:26287950

  15. [Genetic variation and differentiation of wood mice from the genus Sylvaemus inferred from sequencing of the cytochrome oxidase subunit 1 gene fragment].

    PubMed

    Bogdanov, A S; Stakheev, V V; Zykov, A E; Iakimenko, V V; Mal'kova, M G

    2012-02-01

    To ascertain intra- and interspecific differentiation patterns of some Sylvaemus wood mice species (S. uralensis, S. sylvaticus, S. ponticus, S. flavicollis, and S. fulvipectus), sequence variation of the mitochondrial cytochrome oxidase subunit I gene (COI) fragment (654 bp) was analyzed and the data obtained using several molecular genetic markers were compared. Distinct isolation of all Sylvaemus species (including closely related allopatric S. flavicollis and S. ponticus), as well as of the European and Asian races of pygmy wood mouse S. uralensis at the COI gene was demonstrated. However, genetic differences of the Sylvaemus species were 1.5 times and more higher than the distance (D) between the races of S. uralenciis. This finding provides no ample grounds to treat the latter as the independent species. The only specimen of Pamir-Alay subspecies S. uralensis pallipes examined showed closest relatedness to to the Asian race, although was rather distant from it (D = 0.038). No reliable isolation of the eastern European and southern European chromosomal forms, representing the European race of S. uralensis, as well as of their presumptive hybrids from the outskirts of the city of Sal'sk, Rostov region, at the COI gene was revealed. A hybrid origin of the populations of pygmy wood mouse from the outskirts of the Talapker railway station, Novovarshavsky district, Omsk region, was confirmed. In preliminary studies, based on karyotypic characters, these populations were diagnosed as distant hybrids of the eastern European chromosomal form and the Asian race. In yellow-necked wood mouse S. flavicollis from the territory of Russia and Ukraine, weak differentiation into northern and southern lineages (with mean genetic distance between them of 0.020) was observed. Considerably different relative genetic distances between the races of S. uralensis and the S. flavicollis--S. ponticus species pair, inferred from the mitochondrial cytochrome oxidase and cytochrome b gene

  16. Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    PubMed Central

    2013-01-01

    Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

  17. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  18. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  19. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  20. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  1. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.

    PubMed

    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

    2012-08-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  2. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.

    PubMed

    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A

    2016-08-30

    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  3. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants. PMID:22009051

  4. Laccase Gene Family in Cerrena sp. HYB07: Sequences, Heterologous Expression and Transcriptional Analysis.

    PubMed

    Yang, Jie; Xu, Xinqi; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

    2016-01-01

    Laccases are a class of multi-copper oxidases with industrial potential. In this study, eight laccases (Lac1-8) from Cerrena sp. strain HYB07, a white-rot fungus with high laccase yields, were analyzed. The laccases showed moderate identities to each other as well as with other fungal laccases and were predicted to have high redox potentials except for Lac6. Selected laccase isozymes were heterologously expressed in the yeast Pichia pastoris, and different enzymatic properties were observed. Transcription of the eight laccase genes was differentially regulated during submerged and solid state fermentation, as shown by quantitative real-time polymerase chain reaction and validated reference genes. During 6-day submerged fermentation, Lac7 and 2 were successively the predominantly expressed laccase gene, accounting for over 95% of all laccase transcripts. Interestingly, accompanying Lac7 downregulation, Lac2 transcription was drastically upregulated on days 3 and 5 to 9958-fold of the level on day 1. Consistent with high mRNA abundance, Lac2 and 7, but not other laccases, were identified in the fermentation broth by LC-MS/MS. In solid state fermentation, less dramatic differences in transcript abundance were observed, and Lac3, 7 and 8 were more highly expressed than other laccase genes. Elucidating the properties and expression profiles of the laccase gene family will facilitate understanding, production and commercialization of the fungal strain and its laccases. PMID:27527131

  5. Manganese(IV) Oxide Production by Acremonium sp. Strain KR21-2 and Extracellular Mn(II) Oxidase Activity

    PubMed Central

    Miyata, Naoyuki; Tani, Yukinori; Maruo, Kanako; Tsuno, Hiroshi; Sakata, Masahiro; Iwahori, Keisuke

    2006-01-01

    Ascomycetes that can deposit Mn(III, IV) oxides are widespread in aquatic and soil environments, yet the mechanism(s) involved in Mn oxide deposition remains unclear. A Mn(II)-oxidizing ascomycete, Acremonium sp. strain KR21-2, produced a Mn oxide phase with filamentous nanostructures. X-ray absorption near-edge structure (XANES) spectroscopy showed that the Mn phase was primarily Mn(IV). We purified to homogeneity a laccase-like enzyme with Mn(II) oxidase activity from cultures of strain KR21-2. The purified enzyme oxidized Mn(II) to yield suspended Mn particles; XANES spectra indicated that Mn(II) had been converted to Mn(IV). The pH optimum for Mn(II) oxidation was 7.0, and the apparent half-saturation constant was 0.20 mM. The enzyme oxidized ABTS [2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)] (pH optimum, 5.5; Km, 1.2 mM) and contained two copper atoms per molecule. Moreover, the N-terminal amino acid sequence (residues 3 to 25) was 61% identical with the corresponding sequence of an Acremonium polyphenol oxidase and 57% identical with that of a Myrothecium bilirubin oxidase. These results provide the first evidence that a fungal multicopper oxidase can convert Mn(II) to Mn(IV) oxide. The present study reinforces the notion of the contribution of multicopper oxidase to microbially mediated precipitation of Mn oxides and suggests that Acremonium sp. strain KR21-2 is a good model for understanding the oxidation of Mn in diverse ascomycetes. PMID:17021194

  6. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  7. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  8. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  9. Microbial oxidation of arsenite in a subarctic environment: diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser

    PubMed Central

    2010-01-01

    Background Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10°C). Results Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25°C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. Conclusions The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10°C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates. PMID:20673331

  10. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

    2012-01-01

    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  11. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  12. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  13. Increased tolerance to oxidative stress in transgenic tobacco expressing a wheat oxalate oxidase gene via induction of antioxidant enzymes is mediated by H2O2.

    PubMed

    Wan, Xiaoqing; Tan, Jiali; Lu, Shaoyun; Lin, Chuyu; Hu, Yihong; Guo, Zhenfei

    2009-05-01

    Hydrogen peroxide (H(2)O(2)) plays a key role in the regulation of plant responses to various environmental stresses and modulates the expression of related genes including those encoding antioxidant enzymes. A wheat oxalate oxidase (OxO) gene was transformed and expressed in tobacco for production of H(2)O(2). The transgenic plants exhibited enhanced OxO activities and H(2)O(2) concentrations, which was blocked by inhibitors of OxO. The transgenic plants showed increased tolerance to methyl viologen (MV) or high light-induced oxidative stress in both short-time and long-time tests by measuring their maximal photochemical efficiency of PSII (F(v)/F(m)), ion leakage and malondialdehyde. Higher activities and transcripts of antioxidant enzymes (superoxide dismutase, catalase, ascorbate peroxidase and glutathione reductase) were observed in the transgenic plants compared to their wild-type controls under normal growth conditions. Pretreatments with inhibitors of OxO and scavenger of H(2)O(2) blocked the increase of tolerance to MV-induced or high light-induced oxidative stress, as well as the induction of antioxidant enzyme activities. Pretreatments with H(2)O(2) increased tolerance to oxidative stresses and antioxidant enzyme activities. It is suggested that H(2)O(2) produced by OxO in the transgenic tobacco plants triggers the signaling pathways to upregulate expressions of antioxidant enzyme genes, which in turn results in the increase of tolerance to MV-induced and high light-induced oxidative stresses. PMID:19508366

  14. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  15. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-08-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  16. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.

    PubMed

    Sagor, G H M; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  17. Constitutive co-suppression of the GA 20-oxidase1 gene in tomato leads to severe defects in vegetative and reproductive development.

    PubMed

    Olimpieri, Irene; Caccia, Riccardo; Picarella, Maurizio Enea; Pucci, Anna; Santangelo, Enrico; Soressi, Gian Piero; Mazzucato, Andrea

    2011-03-01

    To dissect the role of gibberellins in tomato development, we have constitutively down-regulated the gene GA 20-oxidase1 (GA20ox1). Plants co-suppressed for GA20ox1 (referred to as CO-6 plants) showed vegetative defects typical of GA deficiency such as darker and mis-shaped leaves and dwarfism. CO-6 plants flowered as the controls, although their flowers had subtle defects in the pedicel and in organ insertion. Analysis of male development revealed defects before, during and after meiosis, and a final pollen viability of 22%. The development of female organs and gametes appeared normal. Pollination experiments indicated that the pollen produced by CO-6 plants was able to fertilize control ovaries, but the analysis of the progeny showed that the construct was not transmitted. Ovaries of CO-6 plants showed high fruit set and normal fruit development when pollinated with control pollen. However these fruits were completely seedless due to a stenospermocarpic behaviour that was evidenced by callose layering in the endothelium between 7 and 15 days after pollination. We conclude that GA20ox1 in tomato exerts specific developmental roles that are not redundantly shared with other members of this gene family. For reproductive male development, silencing of this gene is detrimental for pollen production and either gametophytically lethal or severely hampering seed germination. In the pistil, the co-suppression construct does not affect the progamic phase, nor fruit set and growth, but it interferes with seed development after fertilization leading to seed abortion. PMID:21421397

  18. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-01-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  19. Regulation of the Alternative Oxidase Aox1 Gene in Chlamydomonas reinhardtii. Role of the Nitrogen Source on the Expression of a Reporter Gene under the Control of the Aox1 Promoter1

    PubMed Central

    Baurain, Denis; Dinant, Monique; Coosemans, Nadine; Matagne, René F.

    2003-01-01

    In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga Chlamydomonas reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless arylsulfatase (Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (−253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source. PMID:12644691

  20. Potentially novel copper resistance genes in copper-enriched activated sludge revealed by metagenomic analysis.

    PubMed

    Li, Li-Guan; Cai, Lin; Zhang, Xu-Xiang; Zhang, Tong

    2014-12-01

    In this study, we utilized the Illumina high-throughput metagenomic approach to investigate diversity and abundance of both microbial community and copper resistance genes (CuRGs) in activated sludge (AS) which was enriched under copper selective stress up to 800 mg/L. The raw datasets (~3.5 Gb for each sample, i.e., the copper-enriched AS and the control AS) were merged and normalized for the BLAST analyses against the SILVA SSU rRNA gene database and self-constructed copper resistance protein database (CuRD). Also, the raw metagenomic sequences were assembled into contigs and analyzed based on Open Reading Frames (ORFs) to identify potentially novel copper resistance genes. Among the different resistance systems for copper detoxification under the high copper stress condition, the Cus system was the most enriched system. The results also indicated that genes encoding multi-copper oxidase played a more important role than those encoding efflux proteins. More significantly, several potentially novel copper resistance ORFs were identified by Pfam search and phylogenic analysis. This study demonstrated a new understanding of microbial-mediated copper resistance under high copper stress using high-throughput shotgun sequencing technique. PMID:25081552

  1. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  2. New restriction fragment length polymorphisms in the cytochrome oxidase I gene facilitate host strain identification of fall armyworm (Lepidoptera: Noctuidae) populations in the southeastern United States.

    PubMed

    Nagoshi, Rod N; Meagher, Robert L; Adamczyk, John J; Braman, S Kristine; Brandenburg, Rick L; Nuessly, Gregg

    2006-06-01

    Several restriction sites in the cytochrome oxidase I gene of fall armyworm, Spodoptera frugiperda (J.E. Smith), were identified by sequence analysis as potentially being specific to one of the two host strains. Strain specificity was demonstrated for populations in Florida, Texas, Mississippi, Georgia, and North Carolina, with an AciI and SacI site specific to the rice (Oryjza spp.)-strain and a BsmI and HinfI site joining an already characterized MspI site as diagnostic of the corn (Zea mays L.)-strain. All four of these sites can be detected by digestion of a single 568-bp polymerase chain reaction-amplified fragment, but the use of two enzymes in separate digests was found to provide accurate and rapid determination of strain identity. The effectiveness of this method was demonstrated by the analysis of almost 200 adult and larval specimens from the Mississippi delta region. The results indicated that the corn-strain is likely to be the primary strain infesting cotton (Gossypium spp.) and that an unexpected outbreak of fall armyworm on the ornamental tree Paulownia tomentosa (Thunb.) Sieb. & Zucc. ex Steud. was due almost entirely to the rice-strain. PMID:16813297

  3. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  4. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  5. Neuron-specific specificity protein 4 (Sp4) bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons

    PubMed Central

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T. T.

    2013-01-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically-regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1, that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. PMID:24032355

  6. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  7. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata)

    PubMed Central

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

    2010-01-01

    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

  8. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  9. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  10. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  11. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  12. Silencing of the HvCKX1 gene decreases the cytokinin oxidase/dehydrogenase level in barley and leads to higher plant productivity.

    PubMed

    Zalewski, Wojciech; Galuszka, Petr; Gasparis, Sebastian; Orczyk, Wacław; Nadolska-Orczyk, Anna

    2010-06-01

    Stable RNA interference-based technology was used to silence the expression of the HvCKX1 gene in barley and the TaCKX1 gene in wheat and triticale. The silencing cassettes containing the fragments of these genes in the sense and antisense orientations were cloned into the pMCG161 binary vector and used for Agrobacterium-based transformation. Out of the five cultivars representing the three studied species, transgenic plants were obtained from one barley cultivar Golden Promise, one wheat cultivar Kontesa, and one triticale cultivar Wanad. Almost 80% of 52 regenerated lines of Golden Promise exhibited significantly decreased cytokinin oxidase/dehydrogenase (CKX) enzyme activity in bulked samples of their T(1) roots. There was a positive correlation between the enzyme activity and the plant productivity, expressed as the yield, the number of seeds per plant, and the 1000 grain weight. Additionally, these traits were associated with a greater root mass. Lower CKX activity led to a higher plant yield and root weight. This higher plant productivity and altered plant architecture were maintained in a population of segregating T(1) plants. The levels of HvCKX1 transcript accumulation were measured in various tissues of Golden Promise and Scarlett non-transgenic barley plants in order to choose the most appropriate plant organs to study the expression and/or silencing of the gene in those transgenic lines. The highest levels of the HvCKX1 transcript were detected in spikes 0 days after pollination (0 DAP), 7 DAP, and 14 DAP, and in the seedling roots. The analysis of HvCKX1 gene expression and CKX enzyme activity and the evaluation of the phenotype were performed in the progeny of seven selected transgenic T(1) lines. The relative expression of HvCKX1 measured in the spikes 0 DAP and 14 DAP, respectively, ranged from 0.52+/-0.04 to 1.15+/-0.26 and from 0.47+/-0.07 to 0.89+/-0.15. The lowest relative values were obtained for the enzyme activity in the spikes at 0 DAP

  13. Molecular Phylogeny of Nematodes (Oxyurida: Travassosinematidae) from Orthoptera (Gryllotalpidae) Inferred by Mitochondrial Cytochrome C Oxidase Subunit 1 Gene

    PubMed Central

    Singh, Neetu; Chaudhary, Anshu; Singh, Hridaya Shanker

    2015-01-01

    In this study, we sequenced mt Cox 1 gene sequences of five nematode spp. that were infective to arthropod, Gryllotalpa africana. The nematode belongs to Thelastomatoidea, a group of pinworms that parasitizes only invertebrates. Currently, in India spp. of this group are distinguished mainly on the basis of morphological characters that present possible confusions. Therefore, we identified the species through morphological and genetic analysis. We selected mt Cox 1 gene region to show their phylogenetic position with closely related spp. and confirmed their molecular validation. The present findings are important to confirm the phylogenetic position and relationship among five nematode spp. and avoid misidentification regarding their validation, as it is more necessary in that case when many species harbours the same host. PMID:26339150

  14. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-05-01

    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  15. Increasing the catalytic activity of Bilirubin oxidase from Bacillus pumilus: Importance of host strain and chaperones proteins.

    PubMed

    Gounel, Sébastien; Rouhana, Jad; Stines-Chaumeil, Claire; Cadet, Marine; Mano, Nicolas

    2016-07-20

    Aggregation of recombinant proteins into inclusion bodies (IBs) is the main problem of the expression of multicopper oxidase in Escherichia coli. It is usually attributed to inefficient folding of proteins due to the lack of copper and/or unavailability of chaperone proteins. The general strategies reported to overcome this issue have been focused on increasing the intracellular copper concentration. Here we report a complementary method to optimize the expression in E. coli of a promising Bilirubin oxidase (BOD) isolated from Bacillus pumilus. First, as this BOD has a disulfide bridge, we switched E.coli strain from BL21 (DE3) to Origami B (DE3), known to promote the formation of disulfide bridges in the bacterial cytoplasm. In a second step, we investigate the effect of co-expression of chaperone proteins on the protein production and specific activity. Our strategy allowed increasing the final amount of enzyme by 858% and its catalytic rate constant by 83%. PMID:27165502

  16. Physiologic responses and gene diversity indicate olive alternative oxidase as a potential source for markers involved in efficient adventitious root induction.

    PubMed

    Santos Macedo, Elisete; Cardoso, Hélia G; Hernández, Alejandro; Peixe, Augusto A; Polidoros, Alexios; Ferreira, Alexandre; Cordeiro, António; Arnholdt-Schmitt, Birgit

    2009-12-01

    Olive (Olea europaea L.) trees are mainly propagated by adventitious rooting of semi-hardwood cuttings. However, efficient commercial propagation of valuable olive tree cultivars or landraces by semi-hardwood cuttings can often be restricted by a low rooting capacity. We hypothesize that root induction is a plant cell reaction linked to oxidative stress and that activity of stress-induced alternative oxidase (AOX) is importantly involved in adventitious rooting. To identify AOX as a source for potential functional marker sequences that may assist tree breeding, genetic variability has to be demonstrated that can affect gene regulation. The paper presents an applied, multidisciplinary research approach demonstrating first indications of an important relationship between AOX activity and differential adventitious rooting in semi-hardwood cuttings. Root induction in the easy-to-root Portuguese cultivar 'Cobrançosa' could be significantly reduced by treatment with salicyl-hydroxamic acid, an inhibitor of AOX activity. On the contrary, treatment with H2O2 or pyruvate, both known to induce AOX activity, increased the degree of rooting. Recently, identification of several O. europaea (Oe) AOX gene sequences has been reported from our group. Here we present for the first time partial sequences of OeAOX2. To search for polymorphisms inside of OeAOX genes, partial OeAOX2 sequences from the cultivars 'Galega vulgar', 'Cobrançosa' and 'Picual' were cloned from genomic DNA and cDNA, including exon, intron and 3'-untranslated regions (3'-UTRs) sequences. The data revealed polymorphic sites in several regions of OeAOX2. The 3'-UTR was the most important source for polymorphisms showing 5.7% of variability. Variability in the exon region accounted 3.4 and 2% in the intron. Further, analysis performed at the cDNA from microshoots of 'Galega vulgar' revealed transcript length variation for the 3'-UTR of OeAOX2 ranging between 76 and 301 bp. The identified polymorphisms and 3'-UTR

  17. The Diamine Oxidase Gene Is Associated with Hypersensitivity Response to Non-Steroidal Anti-Inflammatory Drugs

    PubMed Central

    Agúndez, José A. G.; Ayuso, Pedro; Cornejo-García, José A.; Blanca, Miguel; Torres, María J.; Doña, Inmaculada; Salas, María; Blanca-López, Natalia; Canto, Gabriela; Rondon, Carmen; Campo, Paloma; Laguna, José J.; Fernández, Javier; Martínez, Carmen; García-Martín, Elena

    2012-01-01

    Non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191), which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR  = 1.7 (95% CI  = 1.3–2.1; Pc  = 0.0003) with a gene-dose effect (P = 0.0001). The association was replicated in two populations from different geographic areas (Pc  = 0.008 and Pc  = 0.004, respectively). Conclusions and implications The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response. PMID:23152756

  18. Contingency tests of neutrality using intra/interspecific gene trees: the rejection of neutrality for the evolution of the mitochondrial cytochrome oxidase II gene in the hominoid primates.

    PubMed

    Templeton, A R

    1996-11-01

    Contingency tests of neutrality are performed using mitochondrial cytochrome oxidase II (COII) DNA sequences from hominoid primates, including humans. An intra-/interspecific haplotype tree is estimated, including a statistical assessment of ambiguities in tree topology and branch lengths. Four functional mutational categories are considered: silent and replacement substitutions in the transmembrane portion of the COII molecule, and silent and replacement substitutions in the cytosolic portion. Three tree topological mutational categories are used: intraspecific tips, intraspecific interiors, and interspecific fixed mutations. A full contingency analysis is performed, followed by nested contingency analyses. The analyses indicate that replacement mutations in the cytosolic portion are deleterious, and replacement mutations in the transmembrane portion and silent mutations throughout tend to be neutral. These conclusions are robust to ambiguities in tree topology and branch lengths. These inferences would have been impossible with an analysis that only contrasts silent and replacement vs. polymorphic and fixed. Also, intraspecific interior mutations have similar evolutionary dynamics to fixed mutations, so pooling tip and interior mutations into a single "polymorphic" class reduces power. Finally, the detected deleterious selection causes lowered inbreeding effective sizes, so arguments for small effective sizes in recent human evolutionary history based upon mitochondrial DNA may be invalid. PMID:8913766

  19. A new oxygen-regulated operon in Escherichia coli comprises the genes for a putative third cytochrome oxidase and for pH 2.5 acid phosphatase (appA)

    PubMed

    Dassa, J; Fsihi, H; Marck, C; Dion, M; Kieffer-Bontemps, M; Boquet, P L

    1991-10-01

    The Escherichia coli acid phosphatase gene appA is expressed in response to oxygen deprivation and is positively controlled by the product of appR (katF) which encodes a putative new sigma transcription-initiation factor. However, transcription of appA from its nearest promoter (P1) did not account for total pH 2.5 acid phosphatase expression and was not subject to regulation. The cloned region upstream of appA was extended and analyzed by insertions of transposon TnphoA and by fusions with lacZ. It contains two new genes, appC and appB, which both encode extracytoplasmic proteins. appC and appB are expressed from a promoter (P2) lying just upstream of appC. Both genes are regulated by oxygen, as is appA, and by appR gene product exactly as previously shown for appA. Analysis of the nucleotide sequence and of the origins of transcription have confirmed that the P2-appC-appB- (ORFX)-P1-appA region is organized on the chromosome as an operon transcribed clockwise from P2 and that P1 is a minor promoter for appA alone. Genes appC and appB encode proteins of Mr 58,133 and 42,377, respectively, which have the characteristics of integral membrane proteins. The deduced amino acid sequences of appC and appB show 60% and 57% homology, respectively, with subunits I and II of the E. coli cytochrome d oxidase (encoded by genes cydA and cydB). The notion that the AppC and AppB proteins constitute a new cytochrome oxidase or a new oxygen-detoxifying system is supported by the observation of enhanced sensitivity to oxygen of mutants lacking all three genes, cyo (cytochrome o oxidase), cyd (cytochrome d oxidase) and appB, compared to that of cyo cyd double mutants. PMID:1658595

  20. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  1. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  2. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-01-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  3. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.

    2015-01-01

    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  4. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.

    PubMed

    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr

    2016-02-01

    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be

  5. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  6. Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA

    PubMed Central

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.

    2011-01-01

    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

  7. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-01-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  8. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms

    PubMed Central

    Groussman, Ryan D.; Parker, Micaela S.; Armbrust, E. Virginia

    2015-01-01

    Ferroproteins arose early in Earth’s history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world’s oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This

  9. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

    PubMed

    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

    2016-04-01

    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  10. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. PMID:25749303

  11. Activity-stability relationships revisited in blue oxidases catalyzing electron transfer at extreme temperatures.

    PubMed

    Roulling, Frédéric; Godin, Amandine; Cipolla, Alexandre; Collins, Tony; Miyazaki, Kentaro; Feller, Georges

    2016-09-01

    Cuproxidases are a subset of the blue multicopper oxidases that catalyze the oxidation of toxic Cu(I) ions into less harmful Cu(II) in the bacterial periplasm. Cuproxidases from psychrophilic, mesophilic, and thermophilic bacteria display the canonical features of temperature adaptation, such as increases in structural stability and apparent optimal temperature for activity with environmental temperature as well as increases in the binding affinity for catalytic and substrate copper ions. In contrast, the oxidative activities at 25 °C for both the psychrophilic and thermophilic enzymes are similar, suggesting that the nearly temperature-independent electron transfer rate does not require peculiar adjustments. Furthermore, the structural flexibilities of both the psychrophilic and thermophilic enzymes are also similar, indicating that the firm and precise bindings of the four catalytic copper ions are essential for the oxidase function. These results show that the requirements for enzymatic electron transfer, in the absence of the selective pressure of temperature on electron transfer rates, produce a specific adaptive pattern, which is distinct from that observed in enzymes possessing a well-defined active site and relying on conformational changes such as for the induced fit mechanism. PMID:27315165

  12. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  13. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.

    PubMed

    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon

    2015-06-10

    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade. PMID:25980806

  14. Regulation of cyclooxygenase-2 and cytosolic phospholipase A2 gene expression by lipopolysaccharide through the RNA-binding protein HuR: involvement of NADPH oxidase, reactive oxygen species and mitogen-activated protein kinases

    PubMed Central

    Lin, Wei-Ning; Lin, Chih-Chung; Cheng, Hsin-Yi; Yang, Chuen-Mao

    2011-01-01

    BACKGROUND AND PURPOSE Lipopolysaccharide (LPS)-induced expression of cyclooxygenase-2 (COX-2) and cytosolic phospholipase A2 (cPLA2) has been implicated in several respiratory diseases. HuR is known to enhance the expression of genes by binding to 3′-untranslated region (3′-UTR) of mRNA and stabilizing mRNA. However, the exact mechanisms by which HuR affects the stability of mRNA and modulates LPS-induced COX-2 and cPLA2 expression in human tracheal smooth muscle cells (HTSMCs) are not known. EXPERIMENTAL APPROACH The expression of prostaglandin E2 (PGE2) was measured by ELISA, and pro-inflammatory proteins were determined by use of a promoter assay, PCR or Western blot analysis. Overexpression of siRNAs to knock down the target components was used to manipulate the expression of HuR. Release of reactive oxygen species (ROS) was detected by fluorescence dye. The activation of signalling components was assessed by comparing phosphorylation levels, localization of protein kinases or coimmunoprecipitation assay. KEY RESULTS LPS induced COX-2 and cPLA2 expression via post-translational regulation of mRNA stabilization, which were attenuated by transfection with HuR siRNA in HTSMCs. In addition, LPS-stimulated NADPH oxidase activation and ROS generation were attenuated by the NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and apocynin (APO). Generation of ROS induced phosphorylation of p42/p44 mitogen-activated protein kinase (MAPK), p38 MAPK and JNK1/2, which was attenuated by DPI and APO and the ROS scavenger N-acetylcysteine. CONCLUSIONS AND IMPLICATIONS These results suggested that in HTSMCs, LPS-induced COX-2 and cPLA2 expression is mediated through NADPH oxidase/ROS-dependent MAPKs associated with HuR accumulation in the cytoplasm. Activated MAPKs may regulate the nucleocytoplasmic shuttling of HuR, and thus induce the cytoplasmic accumulation of HuR. PMID:21391979

  15. De novo microdeletion of Xp11.3 exclusively encompassing the monoamine oxidase A and B genes in a male infant with episodic hypotonia: A genomics approach to personalized medicine

    PubMed Central

    O’Leary, Ryan E.; Shih, Jean C.; Hyland, Keith; Kramer, Nancy; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Monoamine oxidase A and B (MAOA and MAOB) play key roles in deaminating neurotransmitters and various other biogenic amines. Patients deficient in one or both enzymes have distinct metabolic and neurologic profiles. MAOB deficient patients exhibit normal clinical characteristics and behavior, while MAOA deficient patients have borderline intellectual deficiency and impaired impulse control. Patients who lack both MAOA and MAOB have the most extreme laboratory values (urine, blood, and CSF serotonin 4–6 times normal, with elevated O-methylated amine metabolites and reduced deaminated metabolites) in addition to severe intellectual deficiency and behavioral problems. Mice lacking maoa and moab exhibit decreased proliferation of neural stem cells beginning in late gestation and persisting into adulthood These mice show significantly increased monoamine levels, particularly serotonin, as well as anxiety-like behaviors as adults, suggesting that brain maturation in late embryonic development is adversely affected by elevated serotonin levels. We report the case of a male infant with a de novo Xp11.3 microdeletion exclusively encompassing the MAOA and MAOB genes. This newly recognized X-linked disorder is characterized by severe intellectual disability and unusual episodes of hypotonia, which resemble atonic seizures, but have no EEG correlate. A customized low dietary amine diet was implemented in an attempt to prevent the cardiovascular complications that can result from the excessive intake of these compounds. This is the second report of this deletion and the first attempt to maintain the patient’s cardiovascular health through dietary manipulation. Even though a diet low in tyramine, phenylethylamine, and dopa/dopamine is necessary for long-term management, it will not rescue the abnormal monoamine profile seen in combined MAOA and MAOB deficiency. Our patient displays markedly elevated levels of serotonin in blood, serum, urine, and CSF while on this diet

  16. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.

    PubMed

    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  17. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  18. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.

    PubMed

    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio

    2015-11-01

    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487 bp fragment, including part of 5.8 S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma. PMID:26336248

  19. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya

    2008-10-24

    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  20. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population

    PubMed Central

    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande

    2016-01-01

    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  1. Two novel mutations and coexistence of the 991C>T and the 1339C>T mutation on a single allele in the coproporphyrinogen oxidase gene in Swedish patients with hereditary coproporphyria.

    PubMed

    Wiman, Asa; Floderus, Ylva; Harper, Pauline

    2002-01-01

    Hereditary coproporphyria (HCP) is an autosomal dominant disorder, resulting from a partial deficiency of the enzyme coproporphyrinogen oxidase (CPO). This enzyme catalyzes the sixth step of the heme biosynthetic pathway, and mutations in the CPO gene have been coupled to HCP. The present study was undertaken to identify disease-producing mutations in the CPOgene in nine Swedish families with HCP. Exon 1 of the CPO gene of the nine probands was analyzed directly by sequencing, and exons 2-7 were screened by denaturating gradient gel electrophoresis, followed by sequencing of exons showing abnormal band pattern. Mutations were detected in five of the nine families. In two of these families, the novel mutations 623C>T (S208F, exon 2) and 982C>T (R328C, exon 5) were identified, respectively. In the affected members of the other three families, the previously reported mutations 991C>T (R331W, exon 5) and 1339C>T (R447C, exon 7) were shown to coexist on one allele. The present study contributes 2 novel mutations to the 34 that have been previously reported to cause HCP. In addition, this is the first report on patients carrying two HCP-coupled mutations on one allele. PMID:12181641

  2. Coupling of energy metabolism and synaptic transmission at the transcriptional level: Role of nuclear respiratory factor 1 in regulating both cytochrome c oxidase and NMDA glutamate receptor subunit genes

    PubMed Central

    Dhar, Shilpa S.; Wong-Riley, Margaret T. T.

    2009-01-01

    Neuronal activity and energy metabolism are tightly coupled processes. Regions high in neuronal activity, especially of the glutamatergic type, have high levels of cytochrome c oxidase (COX). Perturbations in neuronal activity affect the expressions of COX and glutamatergic N-methyl-D-aspartate receptor subunit 1 (NR1). The present study sought to test our hypothesis that the coupling extends to the transcriptional level, whereby NR1 and possibly other NR subunits and COX are co-regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), which regulates all COX subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutations, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Grin 1 (NR1), Grin 2b (NR2b) and COX subunit genes, but not of Grin2a and Grin3a genes. These transcripts were up-regulated by KCl and down-regulated by TTX in cultured primary neurons. However, silencing of NRF-1 with small interference RNA blocked the up-regulation of Grin1, Grin2b, and COX induced by KCl, and over-expression of NRF-1 rescued these transcripts that were suppressed by TTX. NRF-1 binding sites on Grin1 and Grin2b genes are also highly conserved among mice, rats, and humans. Thus, NRF-1 is an essential transcription factor critical in the co-regulation of NR1, NR2b, and COX, and coupling exists at the transcriptional level to ensure coordinated expressions of proteins important for synaptic transmission and energy metabolism. PMID:19144849

  3. NADPH oxidases in the arbuscular mycorrhizal symbiosis.

    PubMed

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-04-01

    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  4. Modifications of laccase activities of copper efflux oxidase, CueO by synergistic mutations in the first and second coordination spheres of the type I copper center.

    PubMed

    Kataoka, Kunishige; Kogi, Hiroki; Tsujimura, Seiya; Sakurai, Takeshi

    2013-02-15

    The redox potential of type I copper in the Escherichia coli multicopper oxidase CueO was shifted in the positive or negative direction as a result of the single, double, and triple mutations in the first and second coordination spheres: the formation of the NH···S(-)(Cys500 ligand) hydrogen bond, the breakdown of the NH(His443 ligand)···O(-)(Asp439) hydrogen bond, and the substitution of the Met510 ligand for the non-coordinating Leu or coordinating Gln. Laccase activities of CueO were maximally enhanced 140-fold by virtue of the synergistic effect of mild mutations at and at around the ligand groups to type I copper. PMID:23337502

  5. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.

    PubMed

    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu

    2014-10-01

    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  6. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.

    PubMed

    Papagianni, Maria; Avramidis, Nicholaos

    2012-08-10

    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. PMID:22759530

  7. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  8. Transcriptional coupling of synaptic transmission and energy metabolism: Role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons

    PubMed Central

    Dhar, Shilpa S.; Liang, Huan Ling; Wong-Riley, Margaret T. T.

    2009-01-01

    SUMMARY Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts downregulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level. PMID:19615412

  9. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.

    PubMed

    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa

    2015-04-01

    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  10. Overexpression of a GmCnx1 gene enhanced activity of nitrate reductase and aldehyde oxidase, and boosted mosaic virus resistance in soybean.

    PubMed

    Zhou, Zheng; He, Hongli; Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

    2015-01-01

    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g(-1) h(-1) and 30 pmol L(-1), respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  11. Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach

    NASA Astrophysics Data System (ADS)

    Davis, R.; Tebo, B. M.

    2013-12-01

    Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43°C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4°C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn

  12. Characterisation of full-length mitochondrial copies and partial nuclear copies (numts) of the cytochrome b and cytochrome c oxidase subunit I genes of Toxoplasma gondii, Neospora caninum, Hammondia heydorni and Hammondia triffittae (Apicomplexa: Sarcocystidae).

    PubMed

    Gjerde, Bjørn

    2013-04-01

    Genomic DNA was extracted from three oocyst isolates of Hammondia triffittae from foxes and two oocyst isolates of Hammondia heydorni from dogs, as well as from cell culture-derived tachyzoites of Toxoplasma gondii (RH strain) and Neospora caninum (NC-Liverpool strain), and examined by PCR with primers targeting the cytochrome b (cytb) and the cytochrome c oxidase subunit I (cox1) genes in order to characterise both genes and, if possible, the remainder of the mitochondrial genome of these species. Several primers were designed and used in various combinations to amplify regions within and between both genes and to determine gene order. When certain forward primers targeting cytb were used in combination with certain reverse primers targeting cox1, two overlapping sequences were obtained for each species and isolate studied, which showed that a full-length copy of cytb was followed 36-37 bp downstream by a full-length copy of cox1, and these sequences are believed to represent the true mitochondrial genes and the gene order in the mitochondrial genome of the four species examined. The cytb of T. gondii, N. caninum, H. heydorni and H. triffittae comprised a total of 1,080 bp (359 amino acids) and used ATG and TAA as start and stop codon, respectively. The cox1 of these species also used TAA as stop codon, whereas the most likely start codon was ATG, resulting in a gene comprising 1,491 bp (496 amino acids). Pair-wise sequence comparisons based on either cytb or cox1 clearly separated T. gondii from N. caninum and both of these species from the two Hammondia species, whereas the latter two species were 100 % identical at cytb and shared 99.3 % identity at cox1. Phylogenetic analyses using the maximum-likelihood method confirmed these findings and placed T. gondii in a clade separate from the three other species and all four Toxoplasmatinae in a sister clade to Eimeria spp. PCR with other primers and/or primer pairs than those used to obtain the full

  13. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    PubMed Central

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

    2013-01-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  14. Molecular phylogeny of the subfamily Gerbillinae (Muridae, Rodentia) with emphasis on species living in the Xinjiang-Uygur Autonomous Region of China and based on the mitochondrial cytochrome b and cytochrome c oxidase subunit II genes.

    PubMed

    Ito, Mamoru; Jiang, Wei; Sato, Jun J; Zhen, Qiang; Jiao, Wei; Goto, Kazuo; Sato, Hiroshi; Ishiwata, Kenji; Oku, Yuzaburo; Chai, June-Jie; Kamiya, Haruo

    2010-03-01

    Rodents belonging to the subfamily Gerbillinae and living in the Xinjiang-Uygur autonomous region of China were collected in field surveys between 2001 and 2003. We found four Meriones species, including M. chengi M. liycus, M. meridianus, and M. tamariscinus, as well as related species from different genera, Rhombomys opimus and Brachiones przewaliskii For phylogenetic analyses of these gerbilline species, DNA sequences of parts of the mitochondrial cytochrome b (Cytb) and cytochrome c oxidase subunit II (COII) genes were examined with the neighbor Joining, maximum parsimony, maximum likelihood, and Bayesian inference methods. Our phylogenetic analyses suggest that the genus Meriones is not monophyletic and place M. tamaricinus as the sister taxon to a clade comprising Brachiones, Psammomys, Rhombomys, and the other Meriones species. The remaining Meriones species separate into three lineages: M. meridianus (including M. chengi), Meriones unguiculatus, and a clade that includes multiple Meriones species originating from Asia, the Middle East, and Africa. The phylogenetic relationships among the genera Brachines, Meriones, Psammomys, and Rhombomys remain ambiguous, probably due to the saturation of mutations that occurs in fast-evolving mitochondrial DNA. In addition, intraspecific variation was observed for M. meridianus, and this mostly correlated with collection localities, i.e., the northern and southern parts of the Xinjiang region. This variation corresponded to interspecific levels of divergence among other lineages of Meriones. Interestingly, no differences were observed in either the Cytb or COII gene sequences isolated from M. chengi collected from the Turfan Basin in the north and those from M. meridianus in the south, suggesting that M. chengi may be a synonym of M. meridianus. PMID:20192696

  15. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  16. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  17. HypC, the anthrone oxidase involved in aflatoxin biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

  18. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells

    PubMed Central

    Dassa, Emmanuel P; Dufour, Eric; Gonçalves, Sérgio; Paupe, Vincent; Hakkaart, Gertjan A J; Jacobs, Howard T; Rustin, Pierre

    2009-01-01

    Cytochrome c oxidase (COX) deficiency is associated with a wide spectrum of clinical conditions, ranging from early onset devastating encephalomyopathy and cardiomyopathy, to neurological diseases in adulthood and in the elderly. No method of compensating successfully for COX deficiency has been reported so far. In vitro, COX-deficient human cells require additional glucose, pyruvate and uridine for normal growth and are specifically sensitive to oxidative stress. Here, we have tested whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) from Ciona intestinalis could alleviate the metabolic abnormalities of COX-deficient human cells either from a patient harbouring a COX15 pathological mutation or rendered deficient by silencing the COX10 gene using shRNA. We demonstrate that the expression of the AOX, well-tolerated by the cells, compensates for both the growth defect and the pronounced oxidant-sensitivity of COX-deficient human cells. PMID:20049701

  19. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).

    PubMed

    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E

    2013-10-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  20. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  1. Novel genetic diversity within Anopheles punctimacula s.l.: Phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2)

    PubMed Central

    Loaiza, Jose R.; Scott, Marilyn E.; Bermingham, Eldredge; Sanjur, Oris I.; Rovira, Jose R.; Dutari, Larissa C.; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E.

    2013-01-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3´ COI), the Barcode region in the five prime end of the COI (5´ COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3´ COI depicted six highly supported molecular lineages (A–F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5´ COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3´ COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  2. Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.

    PubMed

    Kang, J-H; Park, J-Y; Choi, T-J

    2012-01-01

    Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

  3. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun

    2016-09-01

    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population. PMID:26394200

  4. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  5. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

    PubMed

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-07-25

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25061821

  6. Coupling in cytochrome c oxidase

    PubMed Central

    Kessler, R. J.; Blondin, G. A.; Zande, H. Vande; Haworth, R. A.; Green, D. E.

    1977-01-01

    Cytochrome c oxidase (ferrocytochrome c: oxygen oxidoreductase; EC 1.9.3.1) can be resolved into an electron transfer complex (ETC) and an ionophore transfer complex (ITC). Coupling requires an interaction between the moving electron in the ETC and a moving, positively charged ionophore-cation adduct in the ITC. The duplex character of cytochrome oxidase facilitates this interaction. The ITC mediates cyclical cation transport. It can be replaced as the coupling partner by the combination of valinomycin and nigericin in the presence of K+ when cytochrome oxidase is incorporated into liposomes containing acidic phospholipids or by the combination of lipid cytochrome c and bile acids in an ITC-resolved preparation of the ETC. Respiratory control can be induced by incorporating cytochrome oxidase into vesicles of unfractionated whole mitochondrial lipid. The activity of the ITC is suppressed by such incorporation and this suppression leads to the emergence of respiratory control. The ionophoroproteins of the ITC can be extracted into organic solvents; some 50% of the total protein of cytochrome oxidase is extractable. The release of free ionophore is achieved by tryptic digestion of the ionophoroprotein. Preliminary to this release the ionophoroprotein is degraded to an ionophoropeptide. Electrogenic ionophores, as well as uncoupler, are liberated by such proteolysis. The ITC contains a set of ionophoroproteins imbedded in a matrix of phospholipid. Images PMID:198794

  7. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  8. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-01-01

    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  9. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  10. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  11. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.

    PubMed

    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki

    2013-01-01

    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments. PMID:23832349

  12. Optimization of glucose oxidase production by Aspergillus niger using genetic- and process-engineering techniques.

    PubMed

    Hellmuth, K; Pluschkell, S; Jung, J K; Ruttkowski, E; Rinas, U

    1995-11-01

    Wild-type Aspergillus niger NRRL-3 was transformed with multiple copies of the glucose oxidase structural gene (god). The gene was placed under the control of the gpdA promoter of A. nidulans. For more efficient secretion the alpha-amylase signal peptide from A. oryzae was inserted in front of god. Compared to the wild type, the recombinant strain NRRL-3 (GOD3-18) produced up to four times more extracellular glucose oxidase under identical culture conditions. Addition of yeast extract (2 gl-1) to a mineral salts medium containing only glucose as carbon source increased volumetric and specific extracellular glucose oxidase activities by 130% and 50% respectively. With the same medium composition and inoculum size, volumetric and specific extracellular glucose oxidase activities increased more than ten times in bioreactor cultivations compared to shake-flask cultures. PMID:8590664

  13. Drugs related to monoamine oxidase activity.

    PubMed

    Fišar, Zdeněk

    2016-08-01

    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions. PMID:26944656

  14. Chromate reduction by rabbit liver aldehyde oxidase

    SciTech Connect

    Banks, R.B.; Cooke, R.T. Jr.

    1986-05-29

    Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

  15. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )

    1989-04-01

    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  16. Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity

    PubMed Central

    Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

    2013-01-01

    Abstract A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. PMID:23873697

  17. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.

    PubMed

    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

    2014-12-01

    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  18. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea.

    PubMed

    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano

    2016-07-01

    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  19. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  20. Cholesterol oxidase with high catalytic activity from Pseudomonas aeruginosa: Screening, molecular genetic analysis, expression and characterization.

    PubMed

    Doukyu, Noriyuki; Nihei, Shyou

    2015-07-01

    An extracellular cholesterol oxidase producer, Pseudomonas aeruginosa strain PA157, was isolated by a screening method to detect 6β-hydroperoxycholest-4-en-3-one-forming cholesterol oxidase. On the basis of a putative cholesterol oxidase gene sequence in the genome sequence data of P. aeruginosa strain PAO1, the cholesterol oxidase gene from strain PA157 was cloned. The mature form of the enzyme was overexpressed in Escherichia coli cells. The overexpressed enzyme formed inclusion bodies in recombinant E. coli cells grown at 20 °C and 30 °C. A soluble and active PA157 enzyme was obtained when the recombinant cells were grown at 10 °C. The purified enzyme was stable at pH 5.5 to 10 and was most active at pH 7.5-8.0, showing optimal activity at pH 7.0 and 70 °C. The enzyme retained about 90% of its activity after incubation for 30 min at 70 °C. The enzyme oxidized 3β-hydroxysteroids such as cholesterol, β-cholestanol, and β-sitosterol at high rates. The Km value and Vmax value for the cholesterol were 92.6 μM and 15.9 μmol/min/mg of protein, respectively. The Vmax value of the enzyme was higher than those of commercially available cholesterol oxidases. This is the first report to characterize a cholesterol oxidase from P. aeruginosa. PMID:25573142

  1. Incorporation of copper into lysyl oxidase.

    PubMed

    Kosonen, T; Uriu-Hare, J Y; Clegg, M S; Keen, C L; Rucker, R B

    1997-10-01

    Lysyl oxidase is a copper-dependent enzyme involved in extracellular processing of collagens and elastin. Although it is known that copper is essential for the functional activity of the enzyme, there is little information on the incorporation of copper. In the present study we examined the insertion of copper into lysyl oxidase using 67Cu in cell-free transcription/translation assays and in normal skin fibroblast culture systems. When a full-length lysyl oxidase cDNA was used as a template for transcription/translation reactions in vitro, unprocessed prolysyl oxidase appeared to bind copper. To examine further the post-translational incorporation of copper into lysyl oxidase, confluent skin fibroblasts were incubated with inhibitors of protein synthesis (cycloheximide, 10 microg/ml), glycosylation (tunicamycin, 10 microg/ml), protein secretion (brefeldin A, 10 microg/ml) and prolysyl oxidase processing (procollagen C-peptidase inhibitor, 2.5 microg/ml) together with 300 microCi of carrier-free 67Cu. It was observed that protein synthesis was a prerequisite for copper incorporation, but inhibition of glycosylation by tunicamycin did not affect the secretion of 67Cu as lysyl oxidase. Brefeldin A inhibited the secretion of 67Ci-labelled lysyl oxidase by 46%, but the intracellular incorporation of copper into lysyl oxidase was not affected. In addition, the inhibition of the extracellular proteolytic processing of prolysyl oxidase to lysyl oxidase had minimal effects on the secretion of protein-bound 67Cu. Our results indicate that, similar to caeruloplasmin processing [Sato and Gitlin (1991) J. Biol. Chem. 266, 5128-5134], copper is inserted into prolysyl oxidase independently of glycosylation. PMID:9355764

  2. L-amino acid oxidases with specificity for basic L-amino acids in cyanobacteria.

    PubMed

    Gau, Achim E; Heindl, Achim; Nodop, Anke; Kahmann, Uwe; Pistorius, Elfriede K

    2007-01-01

    The two closely related fresh water cyanobacteria Synechococcus elongatus PCC 6301 and Synechococcus elongatus PCC 7942 have previously been shown to constitutively express a FAD-containing L-amino acid oxidase with high specificity for basic L-amino acids (L-arginine being the best substrate). In this paper we show that such an enzyme is also present in the fresh water cyanobacterium Synechococcus cedrorum PCC 6908. In addition, an improved evaluation of the nucleotide/amino acid sequence of the L-amino acid oxidase of Synechococcus elongatus PCC 6301 (encoded by the aoxA gene) with respect to the FAD-binding site and a translocation pathway signal sequence will be given. Moreover, the genome sequences of 24 cyanobacteria will be evaluated for the occurrence of an aoxA-similar gene. In the evaluated cyanobacteria 15 genes encoding an L-amino acid oxidase-similar protein will be found. PMID:17542496

  3. A new crystal form of human diamine oxidase.

    PubMed

    McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Dooley, David M; Guss, J Mitchell

    2010-02-01

    Copper amine oxidases (CAOs) are ubiquitous in nature and catalyse the oxidative deamination of primary amines to the corresponding aldehydes. Humans have three viable CAO genes (AOC1-3). AOC1 encodes human diamine oxidase (hDAO), which is the frontline enzyme for histamine metabolism. hDAO is unique among CAOs in that it has a distinct substrate preference for diamines. The structure of hDAO in space group P2(1)2(1)2(1) with two molecules in the asymmetric unit has recently been reported. Here, the structure of hDAO refined to 2.1 A resolution in space group C222(1) with one molecule in the asymmetric unit is reported. PMID:20124708

  4. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  5. Origin and evolution of lysyl oxidases.

    PubMed

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea - which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  6. Studies on the Mechanism of Aldehyde Oxidase and Xanthine Oxidase

    PubMed Central

    Alfaro, Joshua F.

    2009-01-01

    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp2 carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the anti-bonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations, and tend to support this mechanism. PMID:18998731

  7. Studies on the mechanism of aldehyde oxidase and xanthine oxidase.

    PubMed

    Alfaro, Joshua F; Jones, Jeffrey P

    2008-12-01

    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp(2) carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the antibonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations and tend to support this mechanism. PMID:18998731

  8. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen

    1990-01-01

    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  9. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    PubMed Central

    Moreno, Beatriz

    2016-01-01

    Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management). Materials and Methods: Humic C (> 104 Da) was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE) for functional bacterial laccase-like multicopper oxidase (LMCO)-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from vegetation decay

  10. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  11. Structure and function of mammalian aldehyde oxidases.

    PubMed

    Terao, Mineko; Romão, Maria João; Leimkühler, Silke; Bolis, Marco; Fratelli, Maddalena; Coelho, Catarina; Santos-Silva, Teresa; Garattini, Enrico

    2016-04-01

    Mammalian aldehyde oxidases (AOXs; EC1.2.3.1) are a group of conserved proteins belonging to the family of molybdo-flavoenzymes along with the structurally related xanthine dehydrogenase enzyme. AOXs are characterized by broad substrate specificity, oxidizing not only aromatic and aliphatic aldehydes into the corresponding carboxylic acids, but also hydroxylating a series of heteroaromatic rings. The number of AOX isoenzymes expressed in different vertebrate species is variable. The two extremes are represented by humans, which express a single enzyme (AOX1) in many organs and mice or rats which are characterized by tissue-specific expression of four isoforms (AOX1, AOX2, AOX3, and AOX4). In vertebrates each AOX isoenzyme is the product of a distinct gene consisting of 35 highly conserved exons. The extant species-specific complement of AOX isoenzymes is the result of a complex evolutionary process consisting of a first phase characterized by a series of asynchronous gene duplications and a second phase where the pseudogenization and gene deletion events prevail. In the last few years remarkable advances in the elucidation of the structural characteristics and the catalytic mechanisms of mammalian AOXs have been made thanks to the successful crystallization of human AOX1 and mouse AOX3. Much less is known about the physiological function and physiological substrates of human AOX1 and other mammalian AOX isoenzymes, although the importance of these proteins in xenobiotic metabolism is fairly well established and their relevance in drug development is increasing. This review article provides an overview and a discussion of the current knowledge on mammalian AOX. PMID:26920149

  12. Cloning, expression and biochemical characterization of the cholesterol oxidase CgChoA from Chryseobacterium gleum

    PubMed Central

    2014-01-01

    Background Cholesterol oxidases are important enzymes for applications such as the analysis of cholesterol in clinical samples, the synthesis of steroid derived drugs, and are considered as potential antibacterial drug targets. Results The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector and heterologously expressed in Escherichia coli JM109 co-transformed with pRARE2. The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion chromatography, showed a temperature optimum of 35°C, and a pH optimum at 6.75 using 0.011 M MOPS buffer under the tested conditions. The purified protein showed a maximum activity of 15.5 U/mg. CgChoA showed a Michaelis-Menten like kinetic behavior only when the substrate was dissolved in water and taurocholate (apparent Km = 0.5 mM). In addition, the conversion of cholesterol by CgChoA was studied via biocatalytic batches at analytical scale, and cholest-4-en-3-one was confirmed as product by HPLC-MS. Conclusion CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other organisms. Thus, the enzyme broadens the available toolbox of cholesterol oxidases for e.g. synthetic and biosensing applications. PMID:24885249

  13. Ectopic Expression of Pumpkin Gibberellin Oxidases Alters Gibberellin Biosynthesis and Development of Transgenic Arabidopsis Plants1

    PubMed Central

    Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

    2006-01-01

    Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902

  14. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

  15. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

  16. Identification of candidate aldehyde oxidases from the silkworm Bombyx mori potentially involved in antennal pheromone degradation.

    PubMed

    Pelletier, Julien; Bozzolan, Françoise; Solvar, Marthe; François, Marie-Christine; Jacquin-Joly, Emmanuelle; Maïbèche-Coisne, Martine

    2007-12-01

    Signal inactivation is a crucial step in the dynamic of olfactory process and involves various Odorant-Degrading Enzymes. In the silkworm Bombyx mori, one of the best models for studying olfaction in insects, the involvement of an antennal-specific aldehyde oxidase in the degradation of the sex pheromone component bombykal has been demonstrated over the three past decades by biochemical studies. However, the corresponding enzyme has never been characterized at the molecular level. Bioinformatic screening of B. mori genome and molecular approaches have been used to isolate several candidate sequences of aldehyde oxidases. Two interesting antennal-expressed genes have been further characterized and their putative functions are discussed in regard to their respective expression pattern and to our knowledge on aldehyde oxidase properties. Interestingly, one gene appeared as specifically expressed in the antennae of B. mori and associated in males with the bombykal-sensitive sensilla, strongly suggesting that it could encode for the previously biochemically characterized enzyme. PMID:17904312

  17. RRM analysis of protoporphyrinogen oxidase.

    PubMed

    Sauren, M; Pirogova, E; Cosic, I

    2004-12-01

    Enzymes are crucial in accelerating metabolic reactions in living organisms. Protoporphyrinogen oxidase (PpOI) is an enzyme that catalyses the production of protoporphyrin IX (PpIX), a protein used in a cancer treatment known as photodynamic therapy (PDT). In this study, a structure-function analysis of PpOI was carried out using the Resonant Recognition Model (RRM), a physico-mathematical approach for analysis of proteins interactions. This method is based on the finding that the distribution of delocalised electron energies along the protein plays a crucial role in determining the protein's biological activity. Two digital signal processing (DSP) methods were used: Fourier Transform (FT) and Continuous Wavelet Transform (CWT). Here we have determined the characteristic frequencies and the "hot spot" amino acids, and predicted the location of proteins' active site(s). Several proteins that potentially belong to the PpOI functional group were also analysed to distinguish their viability in this role. PMID:15712584

  18. Crosstalk between mitochondria and NADPH oxidases

    PubMed Central

    Dikalov, Sergey

    2011-01-01

    Reactive oxygen species (ROS) play an important role in physiological and pathological processes. In recent years, a feed-forward regulation of the ROS sources has been reported. The interaction between main cellular sources of ROS, such as mitochondria and NADPH oxidases, however, remain obscure. This work summarizes the latest findings on the role of crosstalk between mitochondria and NADPH oxidases in pathophysiological processes. Mitochondria have the highest levels of antioxidants in the cell and play an important role in the maintenance of cellular redox status, thereby acting as an ROS and redox sink and limiting NADPH oxidase activity. Mitochondria, however, are not only a target for ROS produced by NADPH oxidase but also a significant source of ROS, which under certain condition may stimulate NADPH oxidases. This crosstalk between mitochondria and NADPH oxidases, therefore, may represent a feed-forward vicious cycle of ROS production which can be pharmacologically targeted under conditions of oxidative stress. It has been demonstrated that mitochondria-targeted antioxidants break this vicious cycle, inhibiting ROS production by mitochondria and reducing NADPH oxidase activity. This may provide a novel strategy for treatment of many pathological conditions including aging, atherosclerosis, diabetes, hypertension and degenerative neurological disorders in which mitochondrial oxidative stress seems to play a role. It is conceivable that the use of mitochondria-targeted treatments would be effective in these conditions. PMID:21777669

  19. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.

    1999-01-01

    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  20. Cold-adapted arsenite oxidase from a psychrotolerant Polaromonas species.

    PubMed

    Osborne, Thomas H; Heath, Matthew D; Martin, Andrew C R; Pankowski, Jaroslaw A; Hudson-Edwards, Karen A; Santini, Joanne M

    2013-04-01

    Polaromonas sp. str. GM1 is an aerobic, psychrotolerant, heterotrophic member of the Betaproteobacteria and is the only isolate capable of oxidising arsenite at temperatures below 10 °C. Sequencing of the aio gene cluster in GM1 revealed the presence of the aioB and aioA genes, which encode the arsenite oxidase but the regulatory genes typically found upstream of aioB in other members of the Proteobacteria were absent. The GM1 Aio was purified to homogeneity and was found to be a heterodimer. The enzyme contained Mo and Fe as cofactors and had, using the artificial electron acceptor 2,6-dichlorophenolindophenol, a Km for arsenite of 111.70 ± 0.88 μM and a Vmax of 12.16 ± 0.30 U mg(-1), which is the highest reported specific activity for any known Aio. The temperature-activity profiles of the arsenite oxidases from GM1 and the mesophilic betaproteobacterium Alcaligenes faecalis were compared and showed that the GM1 Aio was more active at low temperatures than that of A. faecalis. A homology model of the GM1 Aio was made using the X-ray crystal structure of the Aio from A. faecalis as the template. Structural changes that account for cold adaptation were identified and it was found that these resulted in increased enzyme flexibility and a reduction in the hydrophobicity of the core. PMID:23150098

  1. Alternative oxidase in animals: unique characteristics and taxonomic distribution.

    PubMed

    McDonald, Allison E; Vanlerberghe, Greg C; Staples, James F

    2009-08-01

    Alternative oxidase (AOX), a ubiquinol oxidase, introduces a branch point into the respiratory electron transport chain, bypassing complexes III and IV and resulting in cyanide-resistant respiration. Previously, AOX was thought to be limited to plants and some fungi and protists but recent work has demonstrated the presence of AOX in most kingdoms of life, including animals. In the present study we identified AOX in 28 animal species representing nine phyla. This expands the known taxonomic distribution of AOX in animals by 10 species and two phyla. Using bioinformatics we found AOX gene sequences in members of the animal phyla Porifera, Placozoa, Cnidaria, Mollusca, Annelida, Nematoda, Echinodermata, Hemichordata and Chordata. Using reverse-transcriptase polymerase chain reaction (RT-PCR) with degenerate primers designed to recognize conserved regions of animal AOX, we demonstrated that AOX genes are transcribed in several animals from different phyla. An analysis of full-length AOX sequences revealed an amino acid motif in the C-terminal region of the protein that is unique to animal AOXs. Animal AOX also lacks an N-terminal cysteine residue that is known to be important for AOX enzyme regulation in plants. We conclude that the presence of AOX is the ancestral state in animals and hypothesize that its absence in some lineages, including vertebrates, is due to gene loss events. PMID:19648408

  2. Human lysyl oxidase-like 2.

    PubMed

    Moon, Hee-Jung; Finney, Joel; Ronnebaum, Trey; Mure, Minae

    2014-12-01

    Lysyl oxidase like-2 (LOXL2) belongs to the lysyl oxidase (LOX) family, which comprises Cu(2+)- and lysine tyrosylquinone (LTQ)-dependent amine oxidases. LOXL2 is proposed to function similarly to LOX in the extracellular matrix (ECM) by promoting crosslinking of collagen and elastin. LOXL2 has also been proposed to regulate extracellular and intracellular cell signaling pathways. Dysregulation of LOXL2 has been linked to many diseases, including cancer, pro-oncogenic angiogenesis, fibrosis and heart diseases. In this review, we will give an overview of the current understandings and hypotheses regarding the molecular functions of LOXL2. PMID:25146937

  3. NADPH Oxidases and Angiotensin II Receptor Signaling

    PubMed Central

    Garrido, Abel Martin; Griendling, Kathy K.

    2010-01-01

    Over the last decade many studies have demonstrated the importance of reactive oxygen species (ROS) production by NADPH oxidases in angiotensin II (Ang II) signaling, as well as a role for ROS in the development of different diseases in which Ang II is a central component. In this review, we summarize the mechanism of activation of NADPH oxidases by Ang II and describe the molecular targets of ROS in Ang II signaling in the vasculature, kidney and brain. We also discuss the effects of genetic manipulation of NADPH oxidase function on the physiology and pathophysiology of the renin angiotensin system. PMID:19059306

  4. Monoamine oxidase and agitation in psychiatric patients.

    PubMed

    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela

    2016-08-01

    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. PMID:26851573

  5. Polyamine Oxidase5 Regulates Arabidopsis Growth through Thermospermine Oxidase Activity1[C][W

    PubMed Central

    Kim, Dong Wook; Watanabe, Kanako; Murayama, Chihiro; Izawa, Sho; Niitsu, Masaru; Michael, Anthony J.; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    The major plant polyamines (PAs) are the tetraamines spermine (Spm) and thermospermine (T-Spm), the triamine spermidine, and the diamine putrescine. PA homeostasis is governed by the balance between biosynthesis and catabolism; the latter is catalyzed by polyamine oxidase (PAO). Arabidopsis (Arabidopsis thaliana) has five PAO genes, AtPAO1 to AtPAO5, and all encoded proteins have been biochemically characterized. All AtPAO enzymes function in the back-conversion of tetraamine to triamine and/or triamine to diamine, albeit with different PA specificities. Here, we demonstrate that AtPAO5 loss-of-function mutants (pao5) contain 2-fold higher T-Spm levels and exhibit delayed transition from vegetative to reproductive growth compared with that of wild-type plants. Although the wild type and pao5 are indistinguishable at the early seedling stage, externally supplied low-dose T-Spm, but not other PAs, inhibits aerial growth of pao5 mutants in a dose-dependent manner. Introduction of wild-type AtPAO5 into pao5 mutants rescues growth and reduces the T-Spm content, demonstrating that AtPAO5 is a T-Spm oxidase. Recombinant AtPAO5 catalyzes the conversion of T-Spm and Spm to triamine spermidine in vitro. AtPAO5 specificity for T-Spm in planta may be explained by coexpression with T-Spm synthase but not with Spm synthase. The pao5 mutant lacking T-Spm oxidation and the acl5 mutant lacking T-Spm synthesis both exhibit growth defects. This study indicates a crucial role for T-Spm in plant growth and development. PMID:24906355

  6. EXPRESSION OF TURKEY TRANSCRIPTION FACTORS AND ACYL COA OXIDASE IN DIFFERENT TISSUES AND GENETIC POPULATIONS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several transcription factors are involved in regulating lipid metabolism in various animal tissues. Peroxisome proliferator activated receptor (PPAR) gamma and PPAR alpha regulate both lipogenesis and fatty acid oxidation. Gene fragments for PPAR gamma, PPAR alpha, and acyl CoA oxidase (ACO) have b...

  7. Molecular differences in the mitochondrial cytochrome oxidase I (mtCOI) gene and development of a species-specific marker for onion thrips, Thrips tabaci Lindeman, and melon thrips, T. palmi Karny (Thysanoptera: Thripidae), vectors of tospoviruses (Bunyaviridae).

    PubMed

    Asokan, R; Krishna Kumar, N K; Kumar, Vikas; Ranganath, H R

    2007-10-01

    A quick and developmental-stage non-limiting method of the identification of vectors of tospoviruses, such as Thrips tabaci and T. palmi, is important in the study of vector transmission, insecticide resistance, biological control, etc. Morphological identification of these thrips vectors is often a stumbling block in the absence of a specialist and limited by polymorphism, sex, stage of development, etc. Molecular identification, on the other hand, is not hampered by the above factors and can easily be followed by a non-specialist with a little training. The mitochondrial cytochrome oxidase I (mtCOI) exhibits reliable inter-species variations as compared to the other markers. In this communication, we present the differences in the mtCOI partial sequence of morphologically identified specimens of T. tabaci and T. palmi collected from onion and watermelon, respectively. Species-specific markers, identified in this study, could successfully determine T. tabaci and T. palmi, which corroborated the morphological identification. Phylogenetic analyses showed that both T. tabaci and T. palmi formed different clades as compared to the other NCBI accessions. The implication of these variations in vector efficiency has to be investigated further. The result of this investigation is useful in the quick identification of T. tabaci and T. palmi, a critical factor in understanding the epidemiology of the tospoviruses, their management and also in quarantine. PMID:17916265

  8. Regulation of NADPH oxidases in skeletal muscle.

    PubMed

    Ferreira, Leonardo F; Laitano, Orlando

    2016-09-01

    The only known function of NAD(P)H oxidases is to produce reactive oxygen species (ROS). Skeletal muscles express three isoforms of NAD(P)H oxidases (Nox1, Nox2, and Nox4) that have been identified as critical modulators of redox homeostasis. Nox2 acts as the main source of skeletal muscle ROS during contractions, participates in insulin signaling and glucose transport, and mediates the myocyte response to osmotic stress. Nox2 and Nox4 contribute to skeletal muscle abnormalities elicited by angiotensin II, muscular dystrophy, heart failure, and high fat diet. Our review addresses the expression and regulation of NAD(P)H oxidases with emphasis on aspects that are relevant to skeletal muscle. We also summarize: i) the most widely used NAD(P)H oxidases activity assays and inhibitors, and ii) studies that have defined Nox enzymes as protagonists of skeletal muscle redox homeostasis in a variety of health and disease conditions. PMID:27184955

  9. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.

    1973-01-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg−1 chlorophyll × hr−1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  10. Lysyl oxidase modulates the osteoblast differentiation of primary mouse calvaria cells.

    PubMed

    Sharma-Bhandari, Anjali; Park, Sun-Hyang; Kim, Ju-Young; Oh, Jaemin; Kim, Youngho

    2015-12-01

    Lysyl oxidase (LOX) is an extracellular amine oxidase that mediates the formation of collagen fibers. Thus far, five LOX family genes [LOX, lysyl oxidase-like (LOXL)1, LOXL2, LOXL3 and LOXL4] have been identified in humans, each encoding the characteristic C-terminal domains that are required for amine oxidase activity. During osteoblastogenesis, collagen fibers function as a three-dimensional scaffold for organizing mineral deposition. In this study, to assess the functional roles of the LOX family members in osteoblastogenesis, we investigated the temporal expression of these genes as a function of phenotypic development during the osteoblast differentiation of primary cultured mouse calvaria cells. Of the LOX family members, only LOX was prominently expressed during osteoblast differentiation. LOX expression was highest on day 9 of differentiation, as shown by RT-PCR and western blot analysis. The expression pattern of collagen, type I, alpha 2 (COL1A2), which encodes the α2-chain of mouse collagen type I, was similar to that of LOX. The total amine oxidase activity of the differentiating calvaria cells exhibited a temporal pattern that paralleled LOX expression, reaching the highest level on day 9 of differentiation. We also noted that the inhibition of the amine oxidase activity of LOX significantly suppressed both mineral nodule formation and the expression of osteoblast marker genes during the differentiation of primary calvaria cells. Taken together, these findings suggest that the LOX-mediated organization of collagen fibers in the extracellular matrix is an important regulator of osteoblastogenesis. PMID:26497171

  11. A description of an HPLC assay of coproporphyrinogen III oxidase activity in mononuclear cells.

    PubMed

    Gross, U; Gerlach, R; Kühnel, A; Seifert, V; Doss, M O

    2003-01-01

    Coproporphyrinogen III oxidase is deficient in hereditary coproporphyria. An activity assay for this enzyme in mononuclear cells, besides the preparation of the substrate, are presented. The separation conditions for the product of the test protoporphyrin IX by gradient, reversed-phase high-performance liquid chromatography are given. The normal value from mononuclear cells of healthy volunteers was 138 +/- 21 pkat/g total soluble protein (mean +/- SD). The enzyme activity of a family with hereditary coproporphyria was measured. The gene carriers exhibit a specific coproporphyrinogen III oxidase activity of 61-90 pkat/g total soluble protein. PMID:14605502

  12. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.

    1996-11-01

    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  13. Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

    PubMed

    Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

    2016-01-10

    Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. PMID:26367330

  14. Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes.

    PubMed

    Kersten, Phil; Cullen, Dan

    2014-11-01

    Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues are conserved, but five subfamilies are recognized. Glyoxal oxidase, the most intensively studied representative, has been shown physiologically connected to lignin peroxidase. Relatively little is known about structure-function relationships among more recently discovered copper radical oxidases. Nevertheless, differences in substrate preferences have been observed in one case and the proteins have been detected in filtrates of various wood-grown cultures. Such diversity may reflect adaptations to host cell wall composition and changing environmental conditions. PMID:24915038

  15. Alcohol oxidase is a novel pathogenicity factor for Cladosporium fulvum, but aldehyde dehydrogenase is dispensable.

    PubMed

    Segers, G; Bradshaw, N; Archer, D; Blissett, K; Oliver, R P

    2001-03-01

    Cladosporiumfulvum is a mitosporic ascomycete pathogen of tomato. A study of fungal genes expressed during carbon starvation in vitro identified several genes that were up regulated during growth in planta. These included genes predicted to encode acetaldehyde dehydrogenase (Aldh1) and alcohol oxidase (Aox1). An Aldh1 deletion mutant was constructed. This mutant lacked all detectable ALDH activity, had lost the ability to grow with ethanol as a carbon source, but was unaffected in pathogenicity. Aox1 expression was induced by carbon starvation and during the later stages of infection. The alcohol oxidase enzyme activity has broadly similar properties (Km values, substrate specificity, pH, and heat stability) to yeast enzymes. Antibodies raised to Hansenula polymorpha alcohol oxidase (AOX) detected antigens in Western blots of starved C. fulvum mycelium and infected plant material. Antigen reacting with the antibodies was localized to organelles resembling peroxisomes in starved mycelium and infected plants. Disruption mutants of Aox1 lacked detectable AOX activity and had markedly reduced pathogenicity as assayed by two different measures of fungal growth. These results identify alcohol oxidase as a novel pathogenicity factor and are discussed in relation to peroxisomal metabolism of fungal pathogens during growth in planta. PMID:11277434

  16. Plant and animal glycolate oxidases have a common eukaryotic ancestor and convergently duplicated to evolve long-chain 2-hydroxy acid oxidases.

    PubMed

    Esser, Christian; Kuhn, Anke; Groth, Georg; Lercher, Martin J; Maurino, Veronica G

    2014-05-01

    Glycolate oxidase (GOX) is a crucial enzyme of plant photorespiration. The encoding gene is thought to have originated from endosymbiotic gene transfer between the eukaryotic host and the cyanobacterial endosymbiont at the base of plantae. However, animals also possess GOX activities. Plant and animal GOX belong to the gene family of (L)-2-hydroxyacid-oxidases ((L)-2-HAOX). We find that all (L)-2-HAOX proteins in animals and archaeplastida go back to one ancestral eukaryotic sequence; the sole exceptions are green algae of the chlorophyta lineage. Chlorophyta replaced the ancestral eukaryotic (L)-2-HAOX with a bacterial ortholog, a lactate oxidase that may have been obtained through the primary endosymbiosis at the base of plantae; independent losses of this gene may explain its absence in other algal lineages (glaucophyta, rhodophyta, and charophyta). We also show that in addition to GOX, plants possess (L)-2-HAOX proteins with different specificities for medium- and long-chain hydroxyacids (lHAOX), likely involved in fatty acid and protein catabolism. Vertebrates possess lHAOX proteins acting on similar substrates as plant lHAOX; however, the existence of GOX and lHAOX subfamilies in both plants and animals is not due to shared ancestry but is the result of convergent evolution in the two most complex eukaryotic lineages. On the basis of targeting sequences and predicted substrate specificities, we conclude that the biological role of plantae (L)-2-HAOX in photorespiration evolved by co-opting an existing peroxisomal protein. PMID:24408912

  17. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases.

    PubMed

    Giacomelli, Lisa; Rota-Stabelli, Omar; Masuero, Domenico; Acheampong, Atiako Kwame; Moretto, Marco; Caputi, Lorenzo; Vrhovsek, Urska; Moser, Claudio

    2013-11-01

    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  18. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa

    2013-01-01

    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  19. NADPH Oxidase Biology and the Regulation of Tyrosine Kinase Receptor Signaling and Cancer Drug Cytotoxicity

    PubMed Central

    Paletta-Silva, Rafael; Rocco-Machado, Nathália; Meyer-Fernandes, José Roberto

    2013-01-01

    The outdated idea that reactive oxygen species (ROS) are only dangerous products of cellular metabolism, causing toxic and mutagenic effects on cellular components, is being replaced by the view that ROS have several important functions in cell signaling. In aerobic organisms, ROS can be generated from different sources, including the mitochondrial electron transport chain, xanthine oxidase, myeloperoxidase, and lipoxygenase, but the only enzyme family that produces ROS as its main product is the NADPH oxidase family (NOX enzymes). These transfer electrons from NADPH (converting it to NADP−) to oxygen to make O2•−. Due to their stability, the products of NADPH oxidase, hydrogen peroxide, and superoxide are considered the most favorable ROS to act as signaling molecules. Transcription factors that regulate gene expression involved in carcinogenesis are modulated by NADPH oxidase, and it has emerged as a promising target for cancer therapies. The present review discusses the mechanisms by which NADPH oxidase regulates signal transduction pathways in view of tyrosine kinase receptors, which are pivotal to regulating the hallmarks of cancer, and how ROS mediate the cytotoxicity of several cancer drugs employed in clinical practice. PMID:23434665

  20. Localization of NADPH Oxidase in Sympathetic and Sensory Ganglion Neurons and Perivascular Nerve Fibers

    PubMed Central

    Cao, Xian; Demel, Stacie L.; Quinn, Mark T.; Galligan, James J.; Kreulen, David L.

    2009-01-01

    Superoxide anion (O2−•) production was previously reported to be increased in celiac ganglia (CG) during DOCA-salt hypertension, possibly via activation of the reduced nicotinamide-adenine dinucleotide phosphate (NADPH) oxidase. This suggested a role for neuronal NADPH oxidase in autonomic neurovascular control. However, the expression and localization of NADPH oxidase in the peripheral neurons is not fully known. The purpose of this study was to examine the subcellular localization of NADPH oxidase in sympathetic and sensory ganglion neurons and perivascular nerve fibers. In rat CG, p22phox and neuropeptide Y (NPY) were colocalized in all neurons. P22phox was also localized to dorsal root ganglia (DRG) neurons that contain calcitonin gene related peptide (CGRP). In mesenteric arteries, p22phox and p47phox were colocalized with NPY or CGRP in perivascular nerve terminals. A similar pattern of nerve terminal staining of p22phox and p47phox was also found in cultured CG neurons and nerve growth factor (NGF)-differentiated PC12 cells. These data demonstrate a previously uncharacterized localization of NADPH oxidase in perivascular nerve fibers. The presence of a O2−• – generating enzyme in close vicinity to the sites of neurotransmitter handling in the nerve fibers suggests the possibility of novel redox-mediated mechanisms in peripheral neurovascular control. PMID:19716351

  1. Involvement of NADPH oxidases in suppression of cyclooxygenase-2 promoter-dependent transcriptional activities by sesamol

    PubMed Central

    Shimizu, Satomi; Ishigamori, Rikako; Fujii, Gen; Takahashi, Mami; Onuma, Wakana; Terasaki, Masaru; Yano, Tomohiro; Mutoh, Michihiro

    2015-01-01

    Cyclooxygenase-2 (COX-2) has been shown to play an important role in colon carcinogenesis. Moreover, one of the components of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, NADPH oxidase 1 (NOX1), dominantly expressed in the colon, is implicated in the pathogenesis of colon cancer. We have reported that sesamol, one of the lignans in sesame seeds, suppressed COX-2 gene transcriptional activity in human colon cancer cells, and also suppressed intestinal polyp formation in Apc-mutant mice. In the present study, we investigated the involvement of NADPH oxidase in the inhibition of COX-2 transcriptional activity by sesamol. We found that several NADPH oxidase inhibitors, such as apocynin, showed suppressive effects on COX-2 transcriptional activity. Moreover, sesamol significantly suppressed NOX1 mRNA levels in a dose-dependent manner. In addition, we demonstrated that knockdown of NOX1 successfully suppressed COX-2 transcriptional activity. These results suggest that inhibition of NADPH oxidase, especially NOX1, may be involved in the mechanism of the suppression of COX-2 transcriptional activity by sesamol. PMID:25759517

  2. Comparative characterization of three D-aspartate oxidases and one D-amino acid oxidase from Caenorhabditis elegans.

    PubMed

    Katane, Masumi; Saitoh, Yasuaki; Seida, Yousuke; Sekine, Masae; Furuchi, Takemitsu; Homma, Hiroshi

    2010-06-01

    Previously, we cloned cDNAs for four Caenorhabditis elegans genes (F20 Hp, C47Ap, F18Ep, and Y69Ap genes) that were annotated in the database as encoding D-amino acid oxidase (DAO) or D-aspartate oxidase (DDO) proteins. These genes were expressed in Escherichia coli, and the recombinant C47Ap and F18Ep were shown to have functional DDO activities, while Y69Ap had functional DAO activity. In this study, we improved the E. coli culture conditions for the production of recombinant F20 Hp and, following purification of the protein, revealed that it has functional DDO activity. The kinetic properties of recombinant C47Ap (DDO-1), F18Ep (DDO-2), F20 Hp (DDO-3), and Y69Ap (DAO) were also determined and compared with recombinant human DDO and DAO. In contrast to the low catalytic efficiency of human DDO for D-Glu, all three C. elegans DDOs showed higher catalytic efficiencies for D-Glu than D-Asp or N-methyl-D-Asp. The catalytic efficiency of C. elegans DAO for D-Ser was substantially lower than that of human DAO, while the C. elegans DAO was more efficient at deamination of basic D-amino acids (D-Arg and D-His) than human DAO. Collectively, our results indicate that C. elegans contains at least three genes that encode functional DDOs, and one gene encoding a functional DAO, and that these enzymes have different and distinctive properties. PMID:20564561

  3. Expression studies on the ba3 quinol oxidase from Paracoccus denitrificans. A bb3 variant is enzymatically inactive.

    PubMed

    Zickermann, I; Tautu, O S; Link, T A; Korn, M; Ludwig, B; Richter, O M

    1997-06-15

    Expression of the quinol oxidase from Paracoccus denitrificans has been examined using a polyclonal antibody directed against subunit II and a promoter probe vector carrying the promoter region of the qox operon. Under aerobic conditions nitrate and nitrite act as specific inducers of the expression. To obtain an enzymatically competent quinol oxidase complex, an intact ctaB gene is required, which constitutes part of the cta operon coding for the aa3 cytochrome c oxidase of P. denitrificans. Deletion of ctaB leads to a change in heme composition of the quinol oxidase with heme b replacing the high-spin heme a of the binuclear center, causing loss of electron transport activity. PMID:9219517

  4. Proline dehydrogenase (oxidase) in cancer.

    PubMed

    Liu, Wei; Phang, James M

    2012-01-01

    Proline dehydrogenase (oxidase, PRODH/POX), the first enzyme in the proline degradative pathway, plays a special role in tumorigenesis and tumor development. Proline metabolism catalyzed by PRODH/POX is closely linked with the tricarboxylic acid (TCA) cycle and urea cycle. The proline cycle formed by the interconversion of proline and Δ(1) -pyrroline-5-carboxylate (P5C) between mitochondria and cytosol interlocks with pentose phosphate pathway. Importantly, by catalyzing proline to P5C, PRODH/POX donates electrons into the electron transport chain to generate ROS or ATP. In earlier studies, we found that PRODH/POX functions as a tumor suppressor to initiate apoptosis, inhibit tumor growth, and block the cell cycle, all by ROS signaling. It also suppresses hypoxia inducible factor signaling by increasing α-ketoglutarate. During tumor progression, PRODH/POX is under the control of various tumor-associated factors, such as tumor suppressor p53, inflammatory factor peroxisome proliferator-activated receptor gamma (PPARγ), onco-miRNA miR-23b*, and oncogenic transcription factor c-MYC. Recent studies revealed the two-sided features of PRODH/POX-mediated regulation. Under metabolic stress such as oxygen and glucose deprivation, PRODH/POX can be induced to serve as a tumor survival factor through ATP production or ROS-induced autophagy. The paradoxical roles of PRODH/POX can be understood considering the temporal and spatial context of the tumor. Further studies will provide additional insights into this protein and on its metabolic effects in tumors, which may lead to new therapeutic strategies. PMID:22886911

  5. Molecular, immunological, enzymatic and biochemical studies of coproporphyrinogen oxidase deficiency in a family with hereditary coproporphyria.

    PubMed

    Gross, U; Puy, H; Kühnel, A; Meissauer, U; Deybach, J C; Jacob, K; Martasek, P; Nordmann, Y; Doss, M O

    2002-02-01

    A 27-year-old woman who had recurrent pain in renal bed since 1998 with increasing character, was stationary admitted. The patient showed dark urine, complained of hair loss and took since 1994 a hormonal oral contraceptive. No photosensitivity was observed. Determinations of urinary porphyrin metabolites in 1998 revealed a porphyria cutanea tarda like excretion pattern with elevations of uro- (1767 nmol/24 hr, normal <29 nmol/24 hr) and heptacarboxyporphyrin (568 nmol/24 hr; normal <4 nmol/24 hr). Follow-up studies in feces showed the characteristics of a hereditary coproporphyria with dominance of coproporphyrin isomer III (total= 1470 nmol/g, isomer III= 93%), (normal: <37 nmol/g, isomer III = 25-35%). The excretion of porphyrin precursors (delta-aminolevulinic acid and porphobilinogen) was increased by taking an ethinylestradiol-cyproteronacetate-preparation, but acute and/or chronic manifestations were not observed. Coproporphyrinogen oxidase activity was decreased to 35% in the patient (normal=138+/-21 pkat/g protein; x+/-s), whereas the activity of red cell uroporphyrinogen decarboxylase was normal. Her mother and both sisters could be verified as heterozygous gene carriers of hereditary coproporphyria by their urinary and fecal excretion parameters and because of reduced coproporphyrinogen oxidase activity up to 50%. The father was normal with respect to his genotype. Molecular analysis revealed a hitherto unknown mutation with the transversion of a cytosine to thymine at nucleotide position 854 in exon 4 of the coproporphyrinogen oxidase gene. The gene defect was confirmed by DGGE in the mother and her three daughters. The investigation of the immunological nature of the defective coproporphyrinogen oxidase gene from the whole family revealed decreased concentrations of coproporphyrinogen oxidase protein in the patient, her mother and her two sisters. PMID:11929047

  6. The composition of milk xanthine oxidase

    PubMed Central

    Hart, L. I.; McGartoll, Mary A.; Chapman, Helen R.; Bray, R. C.

    1970-01-01

    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed `de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in `milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed `inactivated xanthine oxidase', causes variability in activity relative to E450 or to Mo content and formation of it decreases these ratios

  7. NADPH oxidases: new actors in thyroid cancer?

    PubMed

    Ameziane-El-Hassani, Rabii; Schlumberger, Martin; Dupuy, Corinne

    2016-08-01

    Hydrogen peroxide (H2O2) is a crucial substrate for thyroid peroxidase, a key enzyme involved in thyroid hormone synthesis. However, as a potent oxidant, H2O2 might also be responsible for the high level of oxidative DNA damage observed in thyroid tissues, such as DNA base lesions and strand breakages, which promote chromosomal instability and contribute to the development of tumours. Although the role of H2O2 in thyroid hormone synthesis is well established, its precise mechanisms of action in pathological processes are still under investigation. The NADPH oxidase/dual oxidase family are the only oxidoreductases whose primary function is to produce reactive oxygen species. As such, the function and expression of these enzymes are tightly regulated. Thyrocytes express dual oxidase 2, which produces most of the H2O2 for thyroid hormone synthesis. Thyrocytes also express dual oxidase 1 and NADPH oxidase 4, but the roles of these enzymes are still unknown. Here, we review the structure, expression, localization and function of these enzymes. We focus on their potential role in thyroid cancer, which is characterized by increased expression of these enzymes. PMID:27174022

  8. Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness

    ERIC Educational Resources Information Center

    Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen

    2013-01-01

    Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G × E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G × E occurs in infants. We therefore examined whether MAOA G × E predicts infant anger proneness, a temperamental…

  9. Differential Expression and Internal Feedback Regulation of 1-Aminocyclopropane-1-Carboxylate Synthase, 1-Aminocyclopropane-1-Carboxylate Oxidase, and Ethylene Receptor Genes in Tomato Fruit during Development and Ripening1

    PubMed Central

    Nakatsuka, Akira; Murachi, Shiho; Okunishi, Hironori; Shiomi, Shinjiro; Nakano, Ryohei; Kubo, Yasutaka; Inaba, Akitsugu

    1998-01-01

    We investigated the feedback regulation of ethylene biosynthesis in tomato (Lycopersicon esculentum) fruit with respect to the transition from system 1 to system 2 ethylene production. The abundance of LE-ACS2, LE-ACS4, and NR mRNAs increased in the ripening fruit concomitant with a burst in ethylene production. These increases in mRNAs with ripening were prevented to a large extent by treatment with 1-methylcyclopropene (MCP), an ethylene action inhibitor. Transcripts for the LE-ACS6 gene, which accumulated in preclimacteric fruit but not in untreated ripening fruit, did accumulate in ripening fruit treated with MCP. Treatment of young fruit with propylene prevented the accumulation of transcripts for this gene. LE-ACS1A, LE-ACS3, and TAE1 genes were expressed constitutively in the fruit throughout development and ripening irrespective of whether the fruit was treated with MCP or propylene. The transcripts for LE-ACO1 and LE-ACO4 genes already existed in preclimacteric fruit and increased greatly when ripening commenced. These increases in LE-ACO mRNA with ripening were also prevented by treatment with MCP. The results suggest that in tomato fruit the preclimacteric system 1 ethylene is possibly mediated via constitutively expressed LE-ACS1A and LE-ACS3 and negatively feedback-regulated LE-ACS6 genes with preexisting LE-ACO1 and LE-ACO4 mRNAs. At the onset of the climacteric stage, it shifts to system 2 ethylene, with a large accumulation of LE-ACS2, LE-ACS4, LE-ACO1, and LE-ACO4 mRNAs as a result of a positive feedback regulation. This transition from system 1 to system 2 ethylene production might be related to the accumulated level of NR mRNA. PMID:9847103

  10. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    SciTech Connect

    Xu, Yun-Ling; Li, Li; Wu, Keqiang

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.

  11. Choline oxidase, a catabolic enzyme in Arthrobacter pascens, facilitates adaptation to osmotic stress in Escherichia coli.

    PubMed Central

    Rozwadowski, K L; Khachatourians, G G; Selvaraj, G

    1991-01-01

    Choline oxidase (EC 1.1.3.17) is a bifunctional enzyme that is capable of catalyzing glycine betaine biosynthesis from choline via betaine aldehyde. A gene (cox) encoding this enzyme in the gram-positive soil bacterium Arthrobacter pascens was isolated and characterized. This gene is contained within a 1.9-kb fragment that encodes a polypeptide of approximately 66 kDa. Transfer of this gene to an Escherichia coli mutant that is defective in betaine biosynthesis resulted in an osmotolerant phenotype. This phenotype was associated with the ability of the host to synthesize and assemble an enzymatically active choline oxidase that could catalyze biosynthesis of glycine betaine from an exogenous supply of choline. Although glycine betaine functions as an osmolyte in several different organisms, it was not found to have this role in A. pascens. Instead, both choline and glycine betaine were utilized as carbon sources. In A. pascens synthesis and activity of choline oxidase were modulated by carbon sources and were susceptible to catabolite repression. Thus, cox, a gene concerned with carbon utilization in A. pascens, was found to play a role in adaptation to an environmental stress in a heterologous organism. In addition to providing a possible means of manipulating osmotolerance in other organisms, the cox gene offers a model system for the study of choline oxidation, an important metabolic process in both procaryotes and eucaryotes. Images PMID:1987142

  12. CYTOCHROME OXIDASE IN NORMAL AND REGENERATING NEURONS

    PubMed Central

    Howe, Howard A.; Mellors, Robert C.

    1945-01-01

    Manometric determinations of cytochrome oxidase activity were carried out on grey matter from the thalamus and anterior horn of cats and monkeys under various experimental conditions. The thalamus of the cat was studied following the degeneration of virtually all the thalamic neurons secondary to decortication. In comparing the deneuronated thalamus with the normal one, it was found that approximately 34 per cent of the cytochrome oxidase activity was contributed by the neurons and the balance by neuroglia and mesodermal tissues which on the operated side remained comparable to that of the normal side. Total activity of the normal thalamus averaged 5.52 units per mg. of dry weight where I unit is defined as the amount of cytochrome oxidase required to produce a net oxygen consumption of 10 c.mm. per hour under the specified conditions of the experiment. The grey matter of the anterior horns of the spinal cord was isolated by a special technique and its cytochrome oxidase activity was compared with anterior horns in which motoneurons had been stimulated to regenerative activity by section of peripheral nerves. Each animal was studied in relation to an anterior horn which was normal and one in which only the functional state of the motoneurons had been changed. Average normal levels of 2.23 units were found for cat anterior horn and 0.69 units for the monkey. Reductions of cytochrome oxidase activity in the range of 22 to 23 per cent were observed for both cat and monkey following nerve section. In the latter the time sequence was carefully studied in relation to the cytological cycle known as chromatolysis and a virus refractory state previously described by us. It was found that maximal reduction of cytochrome oxidase activity coincided with maximal refractoriness of the cells to poliomyelitis virus (30 to 70 days following nerve section). Neither of these states could be correlated in time with maximal chromatolysis (10 to 15 days). PMID:19871471

  13. Relationship of cytochrome caa sub 3 from Thermus thermophilus to other heme- and copper-containing terminal oxidases

    SciTech Connect

    Mather, M.W.; Springer, P.; Fee, J.A.

    1990-01-01

    Cytochrome oxidases are a key component of the energy metabolism of most aerobic organisms from mammals to bacteria. They are the final enzyme of the membrane associated respiratory chain responsible for converting the chemical energy of reduced substrates to a transmembrane electrochemical potential, which issused by the cell for a wide variety of energy-requiring processes. The most widely studied oxidase is the cytochrome c oxidase of the mammalian mitochondrion. This complex, integral membrane protein contains 13 subunits and four canonical metal centers: heme center a and a{sub 3}; copper centers CU{sub A} and CU{sub B}. It is responsible for electron transfer from reduced chytochrome c to dioxygen with the concomitant reduction of dioxygen to water and the coupled vectorial transfer of protons across the mitochondrial membrane. In this communication we will describe preliminary results of DNA sequencing experiments with the cytochrome caa{sub 3} oxidase, initially undertaken to determine the nature of the subunits of this oxidase and shed light on the distribution of the metal centers. We will speculate on oxidase gene and protein structures and evolutionary relationships in the light of these results and recent sequencing results from other groups. 47 refs., 4 figs., 1 tab.

  14. A diminution in ascorbate oxidase activity affects carbon allocation and improves yield in tomato under water deficit.

    PubMed

    Garchery, Cécile; Gest, Noé; Do, Phuc T; Alhagdow, Moftah; Baldet, Pierre; Menard, Guillaume; Rothan, Christophe; Massot, Capucine; Gautier, Hélène; Aarrouf, Jawad; Fernie, Alisdair R; Stevens, Rebecca

    2013-01-01

    The regulation of carbon allocation between photosynthetic source leaves and sink tissues in response to stress is an important factor controlling plant yield. Ascorbate oxidase is an apoplastic enzyme, which controls the redox state of the apoplastic ascorbate pool. RNA interference was used to decrease ascorbate oxidase activity in tomato (Solanum lycopersicum L.). Fruit yield was increased in these lines under three conditions where assimilate became limiting for wild-type plants: when fruit trusses were left unpruned, when leaves were removed or when water supply was limited. Several alterations in the transgenic lines could contribute to the improved yield and favour transport of assimilate from leaves to fruits in the ascorbate oxidase lines. Ascorbate oxidase plants showed increases in stomatal conductance and leaf and fruit sugar content, as well as an altered apoplastic hexose:sucrose ratio. Modifications in gene expression, enzyme activity and the fruit metabolome were coherent with the notion of the ascorbate oxidase RNAi lines showing altered sink strength. Ascorbate oxidase may therefore be a target for strategies aimed at improving water productivity in crop species. PMID:22725103

  15. Spatiotemporal Localization of d-Amino Acid Oxidase and d-Aspartate Oxidases during Development in Caenorhabditis elegans

    PubMed Central

    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito

    2012-01-01

    Recent investigations have shown that a variety of d-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. d-Amino acid oxidase (DAO) and d-aspartate oxidase (DDO) are degradative enzymes stereospecific for d-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of d-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several d- and l-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and d-amino acids in multicellular organisms. PMID:22393259

  16. Spatiotemporal localization of D-amino acid oxidase and D-aspartate oxidases during development in Caenorhabditis elegans.

    PubMed

    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito; Homma, Hiroshi

    2012-05-01

    Recent investigations have shown that a variety of D-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. D-Amino acid oxidase (DAO) and D-aspartate oxidase (DDO) are degradative enzymes stereospecific for D-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of D-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several D- and L-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and D-amino acids in multicellular organisms. PMID:22393259

  17. Cyanobacterial lactate oxidases serve as essential partners in N2 fixation and evolved into photorespiratory glycolate oxidases in plants.

    PubMed

    Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

    2011-08-01

    Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N(2)-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high L-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N(2)-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N(2) fixation was more sensitive to O(2) in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O(2)-scavenging enzyme to protect nitrogenase in extant N(2)-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

  18. A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio.

    PubMed

    Hernández-Romero, Diana; Sanchez-Amat, Antonio; Solano, Francisco

    2006-01-01

    The sequencing of the genome of Ralstonia solanacearum[Salanoubat M, Genin S, Artiguenave F, et al. (2002) Nature 415, 497-502] revealed several genes that putatively code for polyphenol oxidases (PPOs). This soil-borne pathogenic bacterium withers a wide range of plants. We detected the expression of two PPO genes (accession numbers NP_518458 and NP_519622) with high similarity to tyrosinases, both containing the six conserved histidines required to bind the pair of type-3 copper ions at the active site. Generation of null mutants in those genes by homologous recombination mutagenesis and protein purification allowed us to correlate each gene with its enzymatic activity. In contrast with all tyrosinases so far studied, the enzyme NP_518458 shows higher monophenolase than o-diphenolase activity and its initial activity does not depend on the presence of l-dopa cofactor. On the other hand, protein NP_519622 is an enzyme with a clear preference to oxidize o-diphenols and only residual monophenolase activity, behaving as a catechol oxidase. These catalytic characteristics are discussed in relation to two other characteristics apart from the six conserved histidines. One is the putative presence of a seventh histidine which interacts with the carboxy group on the substrate and controls the preference for carboxylated and decarboxylated substrates. The second is the size of the residue isosteric with the aromatic F261 reported in sweet potato catechol oxidase which acts as a gate to control accessibility to CuA at the active site. PMID:16403014

  19. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

    2012-01-01

    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  20. Oxidative stress, NADPH oxidases, and arteries.

    PubMed

    Sun, Qi-An; Runge, Marschall S; Madamanchi, Nageswara R

    2016-05-10

    Atherosclerosis and its major complications - myocardial infarction and stroke - remain major causes of death and disability in the United States and world-wide. Indeed, with dramatic increases in obesity and diabetes mellitus, the prevalence and public health impact of cardiovascular diseases (CVD) will likely remain high. Major advances have been made in development of new therapies to reduce the incidence of atherosclerosis and CVD, in particular for treatment of hypercholesterolemia and hypertension. Oxidative stress is the common mechanistic link for many CVD risk factors. However, only recently have the tools existed to study the interface between oxidative stress and CVD in animal models. The most important source of reactive oxygen species (and hence oxidative stress) in vascular cells are the multiple forms of enzymes nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Recently published and emerging studies now clearly establish that: 1) NADPH oxidases are of critical importance in atherosclerosis and hypertension in animal models; 2) given the tissue-specific expression of key components of NADPH oxidase, it may be possible to target vascular oxidative stress for prevention of CVD. PMID:25649240

  1. The substrate tolerance of alcohol oxidases.

    PubMed

    Pickl, Mathias; Fuchs, Michael; Glueck, Silvia M; Faber, Kurt

    2015-08-01

    Alcohols are a rich source of compounds from renewable sources, but they have to be activated in order to allow the modification of their carbon backbone. The latter can be achieved via oxidation to the corresponding aldehydes or ketones. As an alternative to (thermodynamically disfavoured) nicotinamide-dependent alcohol dehydrogenases, alcohol oxidases make use of molecular oxygen but their application is under-represented in synthetic biotransformations. In this review, the mechanism of copper-containing and flavoprotein alcohol oxidases is discussed in view of their ability to accept electronically activated or non-activated alcohols and their propensity towards over-oxidation of aldehydes yielding carboxylic acids. In order to facilitate the selection of the optimal enzyme for a given biocatalytic application, the substrate tolerance of alcohol oxidases is compiled and discussed: Substrates are classified into groups (non-activated prim- and sec-alcohols; activated allylic, cinnamic and benzylic alcohols; hydroxy acids; sugar alcohols; nucleotide alcohols; sterols) together with suitable alcohol oxidases, their microbial source, relative activities and (stereo)selectivities. PMID:26153139

  2. Complete genome sequence of the melanogenic marine bacterium Marinomonas mediterranea type strain (MMB-1T)

    SciTech Connect

    Lucas-Elio, Patricia; Goodwin, Lynne A.; Woyke, Tanja; Pitluck, Sam; Nolan, Matt; Kyrpides, Nikos C; Detter, J C; Copeland, A; Teshima, Hazuki; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Land, Miriam L; Ivanova, N; Mikhailova, Natalia; Johnston, Andrew W. B.; Sanchez-Amat, Antonio

    2012-01-01

    Marinomonas mediterranea MMB-1 T Solano & Sanchez-Amat 1999 belongs to the family Oceanospirillaceae within the phylum Proteobacteria. This species is of interest because it is the only species described in the genus Marinomonas to date that can synthesize melanin pigments, which is mediated by the activity of a tyrosinase. M. mediterranea expresses other oxidases of biotechnological interest, such as a multicopper oxidase with laccase activity and a novel L-lysine-epsilon-oxidase. The 4,684,316 bp long genome harbors 4,228 proteincoding genes and 98 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.

    PubMed

    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  4. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  5. Copper distributed by Atx1 is available to copper amine oxidase 1 in Schizosaccharomyces pombe.

    PubMed

    Peter, Chardeen; Laliberté, Julie; Beaudoin, Jude; Labbé, Simon

    2008-10-01

    Copper amine oxidases (CAOs) have been proposed to be involved in the metabolism of xenobiotic and biogenic amines. The requirement for copper is absolute for their activity. In the fission yeast Schizosaccharomyces pombe, cao1(+) and cao2(+) genes are predicted to encode members of the CAO family. While both genes are expressed in wild-type cells, we determined that the expression of only cao1(+) but not cao2(+) results in the production of an active enzyme. Site-directed mutagenesis identified three histidine residues within the C-terminal region of Cao1 that are necessary for amine oxidase activity. By use of a cao1(+)-GFP allele that retained wild-type function, Cao1-GFP was localized in the cytosol (GFP is green fluorescent protein). Under copper-limiting conditions, disruption of ctr4(+), ctr5(+), and cuf1(+) produced a defect in amine oxidase activity, indicating that a functionally active Cao1 requires Ctr4/5-mediated copper transport and the transcription factor Cuf1. Likewise, atx1 null cells exhibited substantially decreased levels of amine oxidase activity. In contrast, deletion of ccc2, cox17, and pccs had no significant effect on Cao1 activity. Residual amine oxidase activity in cells lacking atx1(+) can be restored to normal levels by returning an atx1(+) allele, underscoring the critical importance of the presence of Atx1 in cells. Using two-hybrid analysis, we demonstrated that Cao1 physically interacts with Atx1 and that this association is comparable to that of Atx1 with the N-terminal region of Ccc2. Collectively, these results describe the first example of the ability of Atx1 to act as a copper carrier for a molecule other than Ccc2 and its critical role in delivering copper to Cao1. PMID:18723604

  6. Monoclonal antibodies to the alternative oxidase of higher plant mitochondria

    SciTech Connect

    Elthon, T.E.; Nickels, R.L.; McIntosh, L. )

    1989-04-01

    The higher plant mitochondrial electron transport chain contains, in addition to the cytochrome chain which terminates with cytochrome oxidase, an alternative pathway that terminates with an alternative oxidase. The alternative oxidase of Sauromatum guttatum Schott has recently been identified as a cluster of proteins with apparent M{sub r} of 37, 36, and 35 kilodaltons (kD). Monoclonal antibodies have now been prepared to these proteins and designated as AOA (binding all three proteins of the alternative oxidase cluster), AOU (binding the upper or 37 kD protein), and AOL (binding the lower or 36 and 35 kD proteins). All three antibodies bind to their respective alternative oxidase proteins whether the proteins are in their native or denatured states. AOA and AOU inhibit alternative oxidase activity around 49%, whereas AOL inhibits activity only 14%. When coupled individually to Sepharose 4B, all three monoclonal resins were capable of retaining the entire cluster of alternative oxidase proteins, suggesting that these proteins are physically associated in some manner. The monoclonals were capable of binding similar mitochondrial proteins in a number of thermogenic and nonthermogenic species, indicating that they will be useful in characterizing and purifying the alternative oxidase of different systems. The ability of the monoclonal-Sepharose 4B resins to retain the cluster of previously identified alternative oxidase proteins, along with the inhibition of alternative oxidase activity by these monoclonals, supports the role of these proteins in constituting the alternative oxidase.

  7. Copper Starvation-inducible Protein for Cytochrome Oxidase Biogenesis in Bradyrhizobium japonicum*

    PubMed Central

    Serventi, Fabio; Youard, Zeb Andrew; Murset, Valérie; Huwiler, Simona; Bühler, Doris; Richter, Miriam; Luchsinger, Ronny; Fischer, Hans-Martin; Brogioli, Robert; Niederer, Martina; Hennecke, Hauke

    2012-01-01

    Microarray analysis of Bradyrhizobium japonicum grown under copper limitation uncovered five genes named pcuABCDE, which are co-transcribed and co-regulated as an operon. The predicted gene products are periplasmic proteins (PcuA, PcuC, and PcuD), a TonB-dependent outer membrane receptor (PcuB), and a cytoplasmic membrane-integral protein (PcuE). Homologs of PcuC and PcuE had been discovered in other bacteria, namely PCuAC and YcnJ, where they play a role in cytochrome oxidase biogenesis and copper transport, respectively. Deletion of the pcuABCDE operon led to a pleiotropic phenotype, including defects in the aa3-type cytochrome oxidase, symbiotic nitrogen fixation, and anoxic nitrate respiration. Complementation analyses revealed that, under our assay conditions, the tested functions depended only on the pcuC gene and not on pcuA, pcuB, pcuD, or pcuE. The B. japonicum genome harbors a second pcuC-like gene (blr7088), which, however, did not functionally replace the mutated pcuC. The PcuC protein was overexpressed in Escherichia coli, purified to homogeneity, and shown to bind Cu(I) with high affinity in a 1:1 stoichiometry. The replacement of His79, Met90, His113, and Met115 by alanine perturbed copper binding. This corroborates the previously purported role of this protein as a periplasmic copper chaperone for the formation of the CuA center on the aa3-type cytochrome oxidase. In addition, we provide evidence that PcuC and the copper chaperone ScoI are important for the symbiotically essential, CuA-free cbb3-type cytochrome oxidase specifically in endosymbiotic bacteroids of soybean root nodules, which could explain the symbiosis-defective phenotype of the pcuC and scoI mutants. PMID:23012364

  8. MECHANISM OF POLYPHENOL OXIDASE ACTION IN REDUCING LIPOLYSIS AND PROTEOLYSIS IN RED CLOVER DURING BATCH CULTURE INCUBATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

  9. Brain monoamine oxidase A activity predicts trait aggression.

    PubMed

    Alia-Klein, Nelly; Goldstein, Rita Z; Kriplani, Aarti; Logan, Jean; Tomasi, Dardo; Williams, Benjamin; Telang, Frank; Shumay, Elena; Biegon, Anat; Craig, Ian W; Henn, Fritz; Wang, Gene-Jack; Volkow, Nora D; Fowler, Joanna S

    2008-05-01

    The genetic deletion of monoamine oxidase A (MAO A), an enzyme that breaks down the monoamine neurotransmitters norepinephrine, serotonin, and dopamine, produces aggressive phenotypes across species. Therefore, a common polymorphism in the MAO A gene (MAOA, Mendelian Inheritance in Men database number 309850, referred to as high or low based on transcription in non-neuronal cells) has been investigated in a number of externalizing behavioral and clinical phenotypes. These studies provide evidence linking the low MAOA genotype and violent behavior but only through interaction with severe environmental stressors during childhood. Here, we hypothesized that in healthy adult males the gene product of MAO A in the brain, rather than the gene per se, would be associated with regulating the concentration of brain amines involved in trait aggression. Brain MAO A activity was measured in vivo in healthy nonsmoking men with positron emission tomography using a radioligand specific for MAO A (clorgyline labeled with carbon 11). Trait aggression was measured with the multidimensional personality questionnaire (MPQ). Here we report for the first time that brain MAO A correlates inversely with the MPQ trait measure of aggression (but not with other personality traits) such that the lower the MAO A activity in cortical and subcortical brain regions, the higher the self-reported aggression (in both MAOA genotype groups) contributing to more than one-third of the variability. Because trait aggression is a measure used to predict antisocial behavior, these results underscore the relevance of MAO A as a neurochemical substrate of aberrant aggression. PMID:18463263

  10. Brain Monoamine Oxidase-A Activity Predicts Trait Aggression

    PubMed Central

    Alia-Klein, Nelly; Goldstein, Rita Z.; Kriplani, Aarti; Logan, Jean; Tomasi, Dardo; Williams, Benjamin; Telang, Frank; Shumay, Elena; Biegon, Anat; Craig, Ian W.; Henn, Fritz; Wang, Gene-Jack; Volkow, Nora D.; Fowler, Joanna S.

    2008-01-01

    The genetic deletion of monoamine oxidase A (MAO A, an enzyme which breaks down the monoamine neurotransmitters norepinephrine, serotonin and dopamine) produces aggressive phenotypes across species. Therefore, a common polymorphism in the MAO A gene (MAOA, MIM 309850, referred to as high or low based on transcription in non-neuronal cells) has been investigated in a number of externalizing behavioral and clinical phenotypes. These studies provide evidence linking the low MAOA genotype and violent behavior but only through interaction with severe environmental stressors during childhood. Here, we hypothesized that in healthy adult males the gene product of MAO A in the brain, rather than the gene per se, would be associated with regulating the concentration of brain amines involved in trait aggression. Brain MAO A activity was measured in-vivo in healthy non-smoking men with positron emission tomography using a radioligand specific for MAO A (clorgyline labeled with carbon 11). Trait aggression was measured with the Multidimensional Personality Questionnaire (MPQ). Here we report for the first time that brain MAO A correlates inversely with the MPQ trait measure of aggression (but not with other personality traits) such that the lower the MAO A activity in cortical and subcortical brain regions the higher the self-reported aggression (in both MAOA genotype groups) contributing to more than a third of the variability. Since trait aggression is a measure used to predict antisocial behavior, these results underscore the relevance of MAO A as a neurochemical substrate of aberrant aggression. PMID:18463263

  11. BEHAVIORAL OUTCOMES OF MONOAMINE OXIDASE DEFICIENCY: PRECLINICAL AND CLINICAL EVIDENCE

    PubMed Central

    Bortolato, Marco; Shih, Jean C.

    2012-01-01

    Monoamine oxidase (MAO) isoenzymes A and B are mitochondrial-bound proteins, catalyzing the oxidative deamination of monoamine neurotransmitters as well as xenobiotic amines. Although they derive from a common ancestral progenitor gene, are located at X-chromosome and display 70% structural identity, their substrate preference, regional distribution, and physiological role are divergent. In fact, while MAO-A has high affinity for serotonin and norepinephrine, MAO-B primarily serves the catabolism of 2-phenylethylamine (PEA) and contributes to the degradation of other trace amines and dopamine. Convergent lines of preclinical and clinical evidence indicate that variations in MAO enzymatic activity—due to either genetic or environmental factors—can exert a profound influence on behavioral regulation and play a role in the pathophysiology of a large spectrum of mental and neurodegenerative disorders, ranging from antisocial personality disorder to Parkinson’s disease. Over the past few years, numerous advances have been made in our understanding of the phenotypical variations associated with genetic polymorphisms and mutations of the genes encoding for both isoenzymes. In particular, novel findings on the phenotypes of MAO-deficient mice are highlighting novel potential implications of both isoenzymes in a broad spectrum of mental disorders, ranging from autism and anxiety to impulse-control disorders and ADHD. These studies will lay the foundation for future research on the neurobiological and neurochemical bases of these pathological conditions, as well as the role of gene × environment interactions in the vulnerability to several mental disorders. PMID:21971001

  12. Human copper-dependent amine oxidases.

    PubMed

    Finney, Joel; Moon, Hee-Jung; Ronnebaum, Trey; Lantz, Mason; Mure, Minae

    2014-03-15

    Copper amine oxidases (CAOs) are a class of enzymes that contain Cu(2+) and a tyrosine-derived quinone cofactor, catalyze the conversion of a primary amine functional group to an aldehyde, and generate hydrogen peroxide and ammonia as byproducts. These enzymes can be classified into two non-homologous families: 2,4,5-trihydroxyphenylalanine quinone (TPQ)-dependent CAOs and the lysine tyrosylquinone (LTQ)-dependent lysyl oxidase (LOX) family of proteins. In this review, we will focus on recent developments in the field of research concerning human CAOs and the LOX family of proteins. The aberrant expression of these enzymes is linked to inflammation, fibrosis, tumor metastasis/invasion and other diseases. Consequently, there is a critical need to understand the functions of these proteins at the molecular level, so that strategies targeting these enzymes can be developed to combat human diseases. PMID:24407025

  13. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-11-10

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  14. INCREASED XANTHINE OXIDASE IN THE SKIN OF PREECLAMPTIC WOMEN

    PubMed Central

    Bainbridge, Shannon A.; Deng, Jau-Shyong; Roberts, James M.

    2010-01-01

    Xanthine oxioreductase is the holoenzyme responsible for terminal purine catabolism. Under conditions of metabolic stress or heightened pro-inflammatory cytokine production this enzyme is preferentially in it’s oxidized form, xanthine oxidase, with catalytic action that generates uric acid and the free radical superoxide. As preeclampsia is characterized by heightened inflammation, oxidative stress and hyperuricemia it has been proposed that xanthine oxidase plays a pivotal role in this hypertensive disorder of pregnancy. We sought to determine whether xanthine oxidase protein content was higher in maternal tissue of preeclamptic mothers, compared to healthy pregnant controls, using immunohistochemical analysis of skin biopsies. We further compared xanthine oxidase immunoreactivity in skin biopsies from preeclamptic women and patients with several inflammatory conditions. In preeclamptic women, intense xanthine oxidase immunoreactivity was present within the epidermis. By contrast, only very faint xanthine oxidase staining was observed in skin biopsies from healthy pregnant controls. Further, a role for inflammation in the increase of xanthine oxidase was suggested by similar findings of heightened xanthine oxidase immunoreactivity in the skin biopsies from non-pregnant individuals diagnosed with conditions of systemic inflammation. The finding of increased xanthine oxidase in maternal tissue, most likely as the result of heightened maternal inflammation, suggest maternal xanthine oxidase as a source of free radical and uric acid generation in preeclampsia. PMID:19196876

  15. Data on cytochrome c oxidase assembly in mice and human fibroblasts or tissues induced by SURF1 defect.

    PubMed

    Kovářová, Nikola; Pecina, Petr; Nůsková, Hana; Vrbacký, Marek; Zeviani, Massimo; Mráček, Tomáš; Viscomi, Carlo; Houštěk, Josef

    2016-06-01

    This paper describes data related to a research article entitled "Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects" [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1 (-/-) ) and control (SURF1 (+/+) ) mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX), to reversible inhibition of mitochondrial translation in SURF1 (-/-) mouse and SURF1 patient fibroblast cell lines. PMID:27408912

  16. CtaM Is Required for Menaquinol Oxidase aa3 Function in Staphylococcus aureus

    PubMed Central

    Schurig-Briccio, Lici A.; Gerdes, Svetlana Y.; Gennis, Robert B.

    2016-01-01

    ABSTRACT Staphylococcus aureus is the leading cause of skin and soft tissue infections, bacteremia, osteomyelitis, and endocarditis in the developed world. The ability of S. aureus to cause substantial disease in distinct host environments is supported by a flexible metabolism that allows this pathogen to overcome challenges unique to each host organ. One feature of staphylococcal metabolic flexibility is a branched aerobic respiratory chain composed of multiple terminal oxidases. Whereas previous biochemical and spectroscopic studies reported the presence of three different respiratory oxygen reductases (o type, bd type, and aa3 type), the genome contains genes encoding only two respiratory oxygen reductases, cydAB and qoxABCD. Previous investigation showed that cydAB and qoxABCD are required to colonize specific host organs, the murine heart and liver, respectively. This work seeks to clarify the relationship between the genetic studies showing the unique roles of the cydAB and qoxABCD in virulence and the respiratory reductases reported in the literature. We establish that QoxABCD is an aa3-type menaquinol oxidase but that this enzyme is promiscuous in that it can assemble as a bo3-type menaquinol oxidase. However, the bo3 form of QoxABCD restricts the carbon sources that can support the growth of S. aureus. In addition, QoxABCD function is supported by a previously uncharacterized protein, which we have named CtaM, that is conserved in aerobically respiring Firmicutes. In total, these studies establish the heme A biosynthesis pathway in S. aureus, determine that QoxABCD is a type aa3 menaquinol oxidase, and reveal CtaM as a new protein required for type aa3 menaquinol oxidase function in multiple bacterial genera. PMID:27406563

  17. Reactive Oxygen Species and Angiogenesis: NADPH Oxidase as Target for Cancer Therapy

    PubMed Central

    Ushio-Fukai, Masuko; Nakamura, Yoshimasa

    2009-01-01

    Angiogenesis is essential for tumor growth, metastasis, arteriosclerosis as well as embryonic development and wound healing. Its process is dependent on cell proliferation, migration and capillary tube formation in endothelia cells (ECs). High levels of reactive oxygen species (ROS) such as superoxide and H2O2 are observed in various cancer cells. Accumulating evidence suggests that ROS function as signaling molecules to mediate various growth-related responses including angiogenesis. ROS-dependent angiogenesis can be regulated by endogenous antioxidant enzymes such as SOD and thioredoxin. Vascular endothelial growth factor (VEGF), one of the major angiogenesis factor, is induced in growing tumors and stimulates EC proliferation and migration primarily through the VEGF receptor type2 (VEGFR2, Flk1/KDR). Major source of ROS in ECs is a NADPH oxidase which consists of Nox1, Nox2, Nox4, Nox5, p22phox, p47phox and the small G protein Rac1. NADPH oxidase is activated by various growth factors including VEGF and angiopoietin-1 as well as hypoxia and ischemia, and ROS derived from this oxidase are involved in VEGFR2 autophosphorylation, and diverse redox signaling pathways leading to induction of transcription factors and genes involved in angiogenesis. Dietary antioxidants appear to be effective for treatment of tumor angiogenesis. The aim of this review is to provide an overview of the recent progress on role of ROS derived from NADPH oxidase and redox signaling events involved in angiogenesis. Understanding these mechanisms may provide insight into the NADPH oxidase and redox signaling components as potential therapeutic targets for tumor angiogenesis. PMID:18406051

  18. Comparison of kinetic properties of amine oxidases from sainfoin and lentil and immunochemical characterization of copper/quinoprotein amine oxidases.

    PubMed

    Zajoncová, L; Frébort, I; Luhová, L; Sebela, M; Galuszka, P; Pec, P

    1999-01-01

    Kinetic properties of novel amine oxidase isolated from sainfoin (Onobrychis viciifolia) were compared to those of typical plant amine oxidase (EC 1.4.3.6) from lentil (Lens culinaris). The amine oxidase from sainfoin was active toward substrates, such as 1,5-diaminopentane (cadaverine) with K(m) of 0.09 mM and 1,4-diaminobutane (putrescine) with K(m) of 0.24 mM. The maximum rate of oxidation for cadaverine at saturating concentration was 2.7 fold higher than that of putrescine. The amine oxidase from lentil had the maximum rate for putrescine comparable to the rate of sainfoin amine oxidase with the same substrate. Both amine oxidases, like other plant Cu-amine oxidases, were inhibited by substrate analogs (1,5-diamino-3-pentanone, 1,4-diamino-2-butanone and aminoguanidine), Cu2+ chelating agents (diethyltriamine, 1,10-phenanthroline, 8-hydroxyquinoline, 2,2'-bipyridyl, imidazole, sodium cyanide and sodium azide), some alkaloids (L-lobeline and cinchonine), some lathyrogens (beta-aminopropionitrile and aminoacetonitrile) and other inhibitors (benzamide oxime, acetone oxime, hydroxylamine and pargyline). Tested by Ouchterlony's double diffusion in agarose gel, polyclonal antibodies against the amine oxidase from sainfoin, pea and grass pea cross-reacted with amine oxidases from several other Fabaceae and from barley (Hordeum vulgare) of Poaceae, while amine oxidase from the filamentous fungus Aspergillus niger did not cross-react at all. However, using Western blotting after SDS-PAGE with rabbit polyclonal antibodies against the amine oxidase from Aspergillus niger, some degree of similarity of plant amine oxidases from sainfoin, pea, field pea, grass pea, fenugreek, common melilot, white sweetclover and Vicia panonica with the A. niger amine oxidase was confirmed. PMID:10092944

  19. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia

    1993-01-01

    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  20. Involvement of Pyruvate Oxidase Activity and Acetate Production in the Survival of Lactobacillus plantarum during the Stationary Phase of Aerobic Growth▿ †

    PubMed Central

    Goffin, Philippe; Muscariello, Lidia; Lorquet, Frederique; Stukkens, Aline; Prozzi, Deborah; Sacco, Margherita; Kleerebezem, Michiel; Hols, Pascal

    2006-01-01

    In addition to the previously characterized pyruvate oxidase PoxB, the Lactobacillus plantarum genome encodes four predicted pyruvate oxidases (PoxC, PoxD, PoxE, and PoxF). Each pyruvate oxidase gene was individually inactivated, and only the knockout of poxF resulted in a decrease in pyruvate oxidase activity under the tested conditions. We show here that L. plantarum has two major pyruvate oxidases: PoxB and PoxF. Both are involved in lactate-to-acetate conversion in the early stationary phase of aerobic growth and are regulated by carbon catabolite repression. A strain devoid of pyruvate oxidase activity was constructed by knocking out the poxB and poxF genes. In this mutant, acetate production was strongly affected, with lactate remaining the major end product of either glucose or maltose fermentation. Notably, survival during the stationary phase appeared to be dramatically improved in the poxB poxF double mutant. PMID:17012588

  1. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)

    2002-01-01

    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  2. NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

    SciTech Connect

    Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong

    2008-12-19

    Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91{sup phox} was dose-dependent. Meanwhile, the cytoplasmic subunit p47{sup phox} was translocated to the cell membrane and localized with p22{sup phox} and gp91{sup phox} to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

  3. Lack of GLYCOLATE OXIDASE1, but Not GLYCOLATE OXIDASE2, Attenuates the Photorespiratory Phenotype of CATALASE2-Deficient Arabidopsis.

    PubMed

    Kerchev, Pavel; Waszczak, Cezary; Lewandowska, Aleksandra; Willems, Patrick; Shapiguzov, Alexey; Li, Zhen; Alseekh, Saleh; Mühlenbock, Per; Hoeberichts, Frank A; Huang, Jingjing; Van Der Kelen, Katrien; Kangasjärvi, Jaakko; Fernie, Alisdair R; De Smet, Riet; Van de Peer, Yves; Messens, Joris; Van Breusegem, Frank

    2016-07-01

    The genes coding for the core metabolic enzymes of the photorespiratory pathway that allows plants with C3-type photosynthesis to survive in an oxygen-rich atmosphere, have been largely discovered in genetic screens aimed to isolate mutants that are unviable under ambient air. As an exception, glycolate oxidase (GOX) mutants with a photorespiratory phenotype have not been described yet in C3 species. Using Arabidopsis (Arabidopsis thaliana) mutants lacking the peroxisomal CATALASE2 (cat2-2) that display stunted growth and cell death lesions under ambient air, we isolated a second-site loss-of-function mutation in GLYCOLATE OXIDASE1 (GOX1) that attenuated the photorespiratory phenotype of cat2-2 Interestingly, knocking out the nearly identical GOX2 in the cat2-2 background did not affect the photorespiratory phenotype, indicating that GOX1 and GOX2 play distinct metabolic roles. We further investigated their individual functions in single gox1-1 and gox2-1 mutants and revealed that their phenotypes can be modulated by environmental conditions that increase the metabolic flux through the photorespiratory pathway. High light negatively affected the photosynthetic performance and growth of both gox1-1 and gox2-1 mutants, but the negative consequences of severe photorespiration were more pronounced in the absence of GOX1, which was accompanied with lesser ability to process glycolate. Taken together, our results point toward divergent functions of the two photorespiratory GOX isoforms in Arabidopsis and contribute to a better understanding of the photorespiratory pathway. PMID:27225899

  4. An overview on alcohol oxidases and their potential applications.

    PubMed

    Goswami, Pranab; Chinnadayyala, Soma Sekhar R; Chakraborty, Mitun; Kumar, Adepu Kiran; Kakoti, Ankana

    2013-05-01

    Alcohol oxidases (Alcohol: O₂ Oxidoreductase; EC 1.1.3.x) are flavoenzymes that catalyze the oxidation of alcohols to the corresponding carbonyl compounds with a concomitant release of hydrogen peroxide. Based on substrate specificity, alcohol oxidases may be categorized broadly into four different groups namely, (a) short chain alcohol oxidase (SCAO), (b) long chain alcohol oxidase (LCAO), (c) aromatic alcohol oxidase (AAO), and (d) secondary alcohol oxidase (SAO). The sources reported for these enzymes are mostly limited to bacteria, yeast, fungi, plant, insect, and mollusks. However, the quantum of reports for each category of enzymes considerably varies across these sources. The enzymes belonging to SCAO and LCAO are intracellular in nature, whereas AAO and SAO are mostly secreted to the medium. SCAO and LCAO are invariably reported as multimeric proteins with very high holoenzyme molecular masses, but the molecular characteristics of these enzymes are yet to be clearly elucidated. One of the striking features of the alcohol oxidases that make them distinct from the widely known alcohol dehydrogenase is the avidly bound cofactor to the redox center of these enzymes that obviate the need to supplement cofactor during the catalytic reaction. These flavin-based redox enzymes have gained enormous importance in the development of various industrial processes and products primarily for developing biosensors and production of various industrially useful carbonyl compounds. The present review provides an overview on alcohol oxidases from different categories focusing research on these oxidases during the last decade along with their potential industrial applications. PMID:23525937

  5. Xanthine oxidase status in ethanol-intoxicated rat liver.

    PubMed

    Abbondanza, A; Battelli, M G; Soffritti, M; Cessi, C

    1989-12-01

    The status of xanthine oxidase in ethanol-induced liver injury has been investigated in the rat, by acute and chronic ethanol treatments. A 38% increase of the enzyme O-form was observed after repeated ethanol administration. Chronic intoxication caused a significant decrease of total xanthine oxidase activity after both prolonged ethanol feeding and life span ethanol ingestion. The intermediate D/O-form of xanthine oxidase (that can act either as an oxidase or as a dehydrogenase, being able to react with O2 as well as with NAD+ as electron acceptor) increased 5.5-fold after prolonged ethanol feeding. PMID:2690670

  6. Reduced cytochrome oxidase activity in the retrosplenial cortex after lesions to the anterior thalamic nuclei.

    PubMed

    Mendez-Lopez, Magdalena; Arias, Jorge L; Bontempi, Bruno; Wolff, Mathieu

    2013-08-01

    The anterior thalamic nuclei (ATN) make a critical contribution to hippocampal system functions. Growing experimental work shows that the effects of ATN lesions often resemble those of hippocampal lesions and both markedly reduce the expression of immediate-early gene markers in the retrosplenial cortex, which still appears normal by standard histological means. This study shows that moderate ATN damage was sufficient to produce severe spatial memory impairment as measured in a radial-arm maze. Furthermore, ATN rats exhibited reduced cytochrome oxidase activity in the most superficial cortical layers of the granular retrosplenial cortex, and, to a lesser extent, in the anterior cingulate cortex. By contrast, no change in cytochrome oxidase activity was observed in other limbic cortical regions or in the hippocampal formation. Altogether our results indicate that endogenous long-term brain metabolic capacity within the granular retrosplenial cortex is compromised by even limited ATN damage. PMID:23660649

  7. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd

    2016-01-01

    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

  8. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

    PubMed

    Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-05-01

    Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704

  9. Mouse aldehyde-oxidase-4 controls diurnal rhythms, fat deposition and locomotor activity

    PubMed Central

    Terao, Mineko; Barzago, Maria Monica; Kurosaki, Mami; Fratelli, Maddalena; Bolis, Marco; Borsotti, Andrea; Bigini, Paolo; Micotti, Edoardo; Carli, Mirjana; Invernizzi, Roberto William; Bagnati, Renzo; Passoni, Alice; Pastorelli, Roberta; Brunelli, Laura; Toschi, Ivan; Cesari, Valentina; Sanoh, Seigo; Garattini, Enrico

    2016-01-01

    Aldehyde-oxidase-4 (AOX4) is one of the mouse aldehyde oxidase isoenzymes and its physiological function is unknown. The major source of AOX4 is the Harderian-gland, where the enzyme is characterized by daily rhythmic fluctuations. Deletion of the Aox4 gene causes perturbations in the expression of the circadian-rhythms gene pathway, as indicated by transcriptomic analysis. AOX4 inactivation alters the diurnal oscillations in the expression of master clock-genes. Similar effects are observed in other organs devoid of AOX4, such as white adipose tissue, liver and hypothalamus indicating a systemic action. While perturbations of clock-genes is sex-independent in the Harderian-gland and hypothalamus, sex influences this trait in liver and white-adipose-tissue which are characterized by the presence of AOX isoforms other than AOX4. In knock-out animals, perturbations in clock-gene expression are accompanied by reduced locomotor activity, resistance to diet induced obesity and to hepatic steatosis. All these effects are observed in female and male animals. Resistance to obesity is due to diminished fat accumulation resulting from increased energy dissipation, as white-adipocytes undergo trans-differentiation towards brown-adipocytes. Metabolomics and enzymatic data indicate that 5-hydroxyindolacetic acid and tryptophan are novel endogenous AOX4 substrates, potentially involved in AOX4 systemic actions. PMID:27456060

  10. Mouse aldehyde-oxidase-4 controls diurnal rhythms, fat deposition and locomotor activity.

    PubMed

    Terao, Mineko; Barzago, Maria Monica; Kurosaki, Mami; Fratelli, Maddalena; Bolis, Marco; Borsotti, Andrea; Bigini, Paolo; Micotti, Edoardo; Carli, Mirjana; Invernizzi, Roberto William; Bagnati, Renzo; Passoni, Alice; Pastorelli, Roberta; Brunelli, Laura; Toschi, Ivan; Cesari, Valentina; Sanoh, Seigo; Garattini, Enrico

    2016-01-01

    Aldehyde-oxidase-4 (AOX4) is one of the mouse aldehyde oxidase isoenzymes and its physiological function is unknown. The major source of AOX4 is the Harderian-gland, where the enzyme is characterized by daily rhythmic fluctuations. Deletion of the Aox4 gene causes perturbations in the expression of the circadian-rhythms gene pathway, as indicated by transcriptomic analysis. AOX4 inactivation alters the diurnal oscillations in the expression of master clock-genes. Similar effects are observed in other organs devoid of AOX4, such as white adipose tissue, liver and hypothalamus indicating a systemic action. While perturbations of clock-genes is sex-independent in the Harderian-gland and hypothalamus, sex influences this trait in liver and white-adipose-tissue which are characterized by the presence of AOX isoforms other than AOX4. In knock-out animals, perturbations in clock-gene expression are accompanied by reduced locomotor activity, resistance to diet induced obesity and to hepatic steatosis. All these effects are observed in female and male animals. Resistance to obesity is due to diminished fat accumulation resulting from increased energy dissipation, as white-adipocytes undergo trans-differentiation towards brown-adipocytes. Metabolomics and enzymatic data indicate that 5-hydroxyindolacetic acid and tryptophan are novel endogenous AOX4 substrates, potentially involved in AOX4 systemic actions. PMID:27456060

  11. Redox signaling: globalization of gene expression

    PubMed Central

    Oh, Jeong-Il; Kaplan, Samuel

    2000-01-01

    Here we show that the extent of electron flow through the cbb3 oxidase of Rhodobacter sphaeroides is inversely related to the expression levels of those photosynthesis genes that are under control of the PrrBA two-component activation system: the greater the electron flow, the stronger the inhibitory signal generated by the cbb3 oxidase to repress photosynthesis gene expression. Using site-directed mutagenesis, we show that intramolecular electron transfer within the cbb3 oxidase is involved in signal generation and transduction and this signal does not directly involve the intervention of molecular oxygen. In addition to the cbb3 oxidase, the redox state of the quinone pool controls the transcription rate of the puc operon via the AppA–PpsR antirepressor–repressor system. Together, these interacting regulatory circuits are depicted in a model that permits us to understand the regulation by oxygen and light of photosynthesis gene expression in R.sphaeroides. PMID:10944106

  12. Nox NADPH Oxidases and the Endoplasmic Reticulum

    PubMed Central

    Araujo, Thaís L.S.; Abrahão, Thalita B.

    2014-01-01

    Abstract Significance: Understanding isoform- and context-specific subcellular Nox reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase compartmentalization allows relevant functional inferences. This review addresses the interplay between Nox NADPH oxidases and the endoplasmic reticulum (ER), an increasingly evident player in redox pathophysiology given its role in redox protein folding and stress responses. Recent Advances: Catalytic/regulatory transmembrane subunits are synthesized in the ER and their processing includes folding, N-glycosylation, heme insertion, p22phox heterodimerization, as shown for phagocyte Nox2. Dual oxidase (Duox) maturation also involves the regulation by ER-resident Duoxa2. The ER is the activation site for some isoforms, typically Nox4, but potentially other isoforms. Such location influences redox/Nox-mediated calcium signaling regulation via ER targets, such as sarcoendoplasmic reticulum calcium ATPase (SERCA). Growing evidence suggests that Noxes are integral signaling elements of the unfolded protein response during ER stress, with Nox4 playing a dual prosurvival/proapoptotic role in this setting, whereas Nox2 enhances proapoptotic signaling. ER chaperones such as protein disulfide isomerase (PDI) closely interact with Noxes. PDI supports growth factor-dependent Nox1 activation and mRNA expression, as well as migration in smooth muscle cells, and PDI overexpression induces acute spontaneous Nox activation. Critical Issues: Mechanisms of PDI effects include possible support of complex formation and RhoGTPase activation. In phagocytes, PDI supports phagocytosis, Nox activation, and redox-dependent interactions with p47phox. Together, the results implicate PDI as possible Nox organizer. Future Directions: We propose that convergence between Noxes and ER may have evolutive roots given ER-related functional contexts, which paved Nox evolution, namely calcium signaling and pathogen killing. Overall, the interplay between

  13. NADPH oxidase promotes neutrophil extracellular trap formation in pulmonary aspergillosis.

    PubMed

    Röhm, Marc; Grimm, Melissa J; D'Auria, Anthony C; Almyroudis, Nikolaos G; Segal, Brahm H; Urban, Constantin F

    2014-05-01

    NADPH oxidase is a crucial enzyme in antimicrobial host defense and in regulating inflammation. Chronic granulomatous disease (CGD) is an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates. Aspergillus species are ubiquitous, filamentous fungi, which can cause invasive aspergillosis, a major cause of morbidity and mortality in CGD, reflecting the critical role for NADPH oxidase in antifungal host defense. Activation of NADPH oxidase in neutrophils can be coupled to the release of proteins and chromatin that comingle in neutrophil extracellular traps (NETs), which can augment extracellular antimicrobial host defense. NETosis can be driven by NADPH oxidase-dependent and -independent pathways. We therefore undertook an analysis of whether NADPH oxidase was required for NETosis in Aspergillus fumigatus pneumonia. Oropharyngeal instillation of live Aspergillus hyphae induced neutrophilic pneumonitis in both wild-type and NADPH oxidase-deficient (p47(phox-/-)) mice which had resolved in wild-type mice by day 5 but progressed in p47(phox-/-) mice. NETs, identified by immunostaining, were observed in lungs of wild-type mice but were absent in p47(phox-/-) mice. Using bona fide NETs and nuclear chromatin decondensation as an early NETosis marker, we found that NETosis required a functional NADPH oxidase in vivo and ex vivo. In addition, NADPH oxidase increased the proportion of apoptotic neutrophils. Together, our results show that NADPH oxidase is required for pulmonary clearance of Aspergillus hyphae and generation of NETs in vivo. We speculate that dual modulation of NETosis and apoptosis by NADPH oxidase enhances antifungal host defense and promotes resolution of inflammation upon infection clearance. PMID:24549323

  14. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

    2012-01-01

    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  15. The Arabidopsis NADPH oxidases RbohD and RbohF display differential expression patterns and contributions during plant immunity.

    PubMed

    Morales, Jorge; Kadota, Yasuhiro; Zipfel, Cyril; Molina, Antonio; Torres, Miguel-Angel

    2016-03-01

    Plant NADPH oxidases, also known as respiratory burst oxidase homologues (RBOHs), produce reactive oxygen species (ROS) that perform a wide range of functions. RbohD and RbohF, two of the 10 Rboh genes present in Arabidopsis, are pleiotropic and mediate diverse physiological processes including the response to pathogens. We hypothesized that the spatio-temporal control of RbohD and RbohF gene expression might be critical in determining their multiplicity of functions. Transgenic Arabidopsis plants with RbohD and RbohF promoter fusions to β-glucuronidase and Luciferase reporter genes were generated. Analysis of these plants revealed a differential expression pattern for RbohD and RbohF throughout plant development and during immune responses. RbohD and RbohF gene expression was differentially modulated by pathogen-associated molecular patterns. Histochemical stains and in vivo expression analysis showed a correlation between the level of RbohD and RbohF promoter activity, H2O2 accumulation and the amount of cell death in response to the pathogenic bacterium Pseudomonas syringae pv. tomato DC3000 and the necrotrophic fungus Plectosphaerella cucumerina. A promoter-swap strategy revealed that the promoter region of RbohD was required to drive production of ROS by this gene in response to pathogens. Moreover, RbohD promoter was activated during Arabidopsis interaction with a non-virulent P. cucumerina isolate, and susceptibility tests with the double mutant rbohD rbohF uncovered a new function for these oxidases in basal resistance. Altogether, our results suggest that differential spatio-temporal expression of the Rboh genes contributes to fine-tune RBOH/NADPH oxidase-dependent ROS production and signaling in Arabidopsis immunity. PMID:26798024

  16. Effect of contraceptive steroids on monoamine oxidase activity

    PubMed Central

    Southgate, Jennifer; Collins, G. G. S.; Pryse-Davies, J.; Sandler, M.

    1969-01-01

    Cyclical variations in monoamine oxidase activity during the human menstrual cycle, specific to the endometrium and modified in women undergoing contraceptive steroid treatment, may reflect changes in hormonal environment. Treatment of rats with individual constituents of the contraceptive pill causes analogous changes: oestrogens inhibit and progestogens potentiate uterine monoamine oxidase activity. ImagesFig. 2Fig. 3

  17. Xanthine oxidase inhibitors from Garcinia esculenta twigs.

    PubMed

    Zhu, Lun-Lun; Fu, Wen-Wei; Watanabe, Shimpei; Shao, Yi-Nuo; Tan, Hong-Sheng; Zhang, Hong; Tan, Chang-Heng; Xiu, Yan-Feng; Norimoto, Hisayoshi; Xu, Hong-Xi

    2014-12-01

    The EtOAc-soluble portion of the 80 % (v/v) EtOH extract from the twigs of Garcinia esculenta exhibited strong xanthine oxidase inhibition in vitro. Bioassay-guided purification led to the isolation of 1,3,6,7-tetrahydroxyxanthone (3) and griffipavixanthone (8) as the main xanthine oxidase inhibitors, along with six additional compounds (1, 2, 4-7), including two new compounds (1 and 2). This enzyme inhibition was dose dependent with an IC50 value of approximately 1.2 µM for 3 and 6.3 µM for 8. The inhibitory activity of 3 was stronger than the control allopurinol (IC50 value: 5.3 µM). To our knowledge, compound 8 is the first bixanthone that demonstrated potent XO inhibitory activity in vitro. The structures of the new compounds were established by spectroscopic analysis, and the optical properties and absolute stereochemistry of racemic (±) esculentin A (2) were further determined by the calculation of the DP4 probability and analysis of its MTPA ester derivatives. PMID:25340468

  18. Activation of antibacterial autophagy by NADPH oxidases

    PubMed Central

    Huang, Ju; Canadien, Veronica; Lam, Grace Y.; Steinberg, Benjamin E.; Dinauer, Mary C.; Magalhaes, Marco A. O.; Glogauer, Michael; Grinstein, Sergio; Brumell, John H.

    2009-01-01

    Autophagy plays an important role in immunity to microbial pathogens. The autophagy system can target bacteria in phagosomes, promoting phagosome maturation and preventing pathogen escape into the cytosol. Recently, Toll-like receptor (TLR) signaling from phagosomes was found to initiate their targeting by the autophagy system, but the mechanism by which TLR signaling activates autophagy is unclear. Here we show that autophagy targeting of phagosomes is not exclusive to those containing TLR ligands. Engagement of either TLRs or the Fcγ receptors (FcγRs) during phagocytosis induced recruitment of the autophagy protein LC3 to phagosomes with similar kinetics. Both receptors are known to activate the NOX2 NADPH oxidase, which plays a central role in microbial killing by phagocytes through the generation of reactive oxygen species (ROS). We found that NOX2-generated ROS are necessary for LC3 recruitment to phagosomes. Antibacterial autophagy in human epithelial cells, which do not express NOX2, was also dependent on ROS generation. These data reveal a coupling of oxidative and nonoxidative killing activities of the NOX2 NADPH oxidase in phagocytes through autophagy. Furthermore, our results suggest a general role for members of the NOX family in regulating autophagy. PMID:19339495

  19. The complex roles of NADPH oxidases in fungal infection

    PubMed Central

    Hogan, Deborah; Wheeler, Robert T.

    2014-01-01

    Summary NADPH oxidases play key roles in immunity and inflammation that go beyond the production of microbicidal reactive oxygen species (ROS). The past decade has brought a new appreciation for the diversity of roles played by ROS in signaling associated with inflammation and immunity. NADPH oxidase activity affects disease outcome during infections by human pathogenic fungi, an important group of emerging and opportunistic pathogens that includes Candida, Aspergillus and Cryptococcus species. Here we review how alternative roles of NADPH oxidase activity impact fungal infection and how ROS signaling affects fungal physiology. Particular attention is paid to roles for NADPH oxidase in immune migration, immunoregulation in pulmonary infection, neutrophil extracellular trap formation, autophagy and inflammasome activity. These recent advances highlight the power and versatility of spatiotemporally controlled redox regulation in the context of infection, and point to a need to understand the molecular consequences of NADPH oxidase activity in the cell. PMID:24905433

  20. Ascorbic acid and L-gulonolactone oxidase in lagomorphs.

    PubMed

    Jenness, R; Birney, E C; Ayaz, K L

    1978-01-01

    1. The activity of L-gulonolactone oxidase (EC 1.1.3.8) in the liver of eastern cottontail rabbits (Sylvilagus floridanus) is about 10-fold greater in winter than in summer. 2. L-gulonolactone oxidase activity is low and tissue ascorbate high during all seasons in snowshoe hares (Lepus americanus). 3. Liver contents of ascorbate fall to low levels in L. americanus fed on rabbit chow in the laboratory. 4. The activity of L-gulonolactone oxidase in liver of Sylvilagus and Oryctolagus is depressed by feeding high levels of L-ascorbic acid. 5. The New Zealand White breed of domestic rabbit (Oryctolagus cuniculus) has considerably higher levels of L-gulonolactone oxidase and liver ascorbate than does the Dutch breed. 6. In a wild population of Oryctolagus sampled in Australia L-gulonolactone oxidase levels were intermediate between those of the two domestic breeds and more variable than either. PMID:318384

  1. Expression dynamics of NADPH oxidases during early zebrafish development.

    PubMed

    Weaver, Cory J; Leung, Yuk Fai; Suter, Daniel M

    2016-07-01

    Nicotinamide dinucleotide phosphate oxidases (NOX) control various cellular signaling cascades. In the nervous system, there is recent evidence that NOX-derived reactive oxygen species (ROS) regulate neurite outgrowth, regeneration, and stem cell proliferation; however, a comprehensive NOX gene expression analysis is missing for all major model systems. Zebrafish embryos provide an excellent model system to study neurodevelopment and regeneration because they develop quickly and are well suited for in vivo imaging and molecular approaches. Although the sequences of five NOX genes (nox1, nox2/cybb, nox4, nox5, and duox) have been identified in the zebrafish genome, nothing is known about their expression pattern. Here, we used quantitative polymerase chain reaction combined with in situ hybridization to develop a catalog of nox1, nox2/cybb, nox5, and duox expression in zebrafish during early nervous system development from 12 to 48 hours post fertilization. We found that expression levels of nox1, nox5, and duox are dynamic during the first 2 days of development, whereas nox2/cybb levels remain remarkably stable. By sectioning in situ hybridized embryos, we found a pattern of broad and overlapping NOX isoform expression at 1 and 1.5 days post fertilization. After 2 days of development, a few brain regions displayed increased NOX expression levels. Collectively, these results represent the first comprehensive analysis of NOX gene expression in the zebrafish and will provide a basis for future studies aimed at determining the functions of NOX enzymes in neurodevelopment and regeneration. J. Comp. Neurol. 524:2130-2141, 2016. © 2015 Wiley Periodicals, Inc. PMID:26662995

  2. Expression of 1-aminocyclopropane-1-carboxylate oxidase during leaf ontogeny in white clover.

    PubMed

    Hunter, D A; Yoo, S D; Butcher, S M; McManus, M T

    1999-05-01

    We examined the expression of three distinct 1-aminocyclopropane-1-carboxylic acid oxidase genes during leaf ontogeny in white clover (Trifolium repens). Significant production of ethylene occurs at the apex, in newly initiated leaves, and in senescent leaf tissue. We used a combination of reverse transcriptase-polymerase chain reaction and 3'-rapid amplification of cDNA ends to identify three distinct DNA sequences designated TRACO1, TRACO2, and TRACO3, each with homology to 1-aminocyclopropane-1-carboxylic acid oxidase. Southern analysis confirmed that these sequences represent three distinct genes. Northern analysis revealed that TRACO1 is expressed specifically in the apex and TRACO2 is expressed in the apex and in developing and mature green leaves, with maximum expression in developing leaf tissue. The third gene, TRACO3, is expressed in senescent leaf tissue. Antibodies were raised to each gene product expressed in Escherichia coli, and western analysis showed that the TRACO1 antibody recognizes a protein of approximately 205 kD (as determined by gradient sodium dodecyl sulfate-polyacylamide gel electrophoresis) that is expressed preferentially in apical tissue. The TRACO2 antibody recognizes a protein of approximately 36.4 kD (as determined by gradient sodium dodecyl sulfate-polyacylamide gel electrophoresis) that is expressed in the apex and in developing and mature green leaves, with maximum expression in mature green tissue. No protein recognition by the TRACO3 antibody could be detected in senescent tissue or at any other stage of leaf development. PMID:10318691

  3. A putative novel nuclear-encoded subunit of the cytochrome c oxidase complex in trypanosomatids.

    PubMed

    Maslov, Dmitri A; Zíková, Alena; Kyselová, Iveta; Lukes, Julius

    2002-01-01

    A relatively large nuclear-encoded polypeptide, designated trCOIV, is found in the cytochrome c oxidase (CO) complex of trypanosomatids. In order to determine if this polypeptide represents a bona fide subunit of the complex, we have characterized the cDNA and the gene for this polypeptide in Leishmania tarentolae. Its nuclear gene has no sequence similarity to mammalian COIV. The trCOIV preprotein has a long mitochondrial targeting sequence of 31 residues. The mature polypeptide cofractionates with kinetoplast-mitochondria and its preferential mitochondrial localization was confirmed by immunofluorescence and immunoelectron microscopy. Based on the hydropathy plot analysis, the protein lacks pronounced transmembrane domains and likely occupies a peripheral position within the CO complex. The corresponding genes are also present in the sequenced portions of the Trypanosoma cruzi, Trypanosoma brucei and Leishmania major genomes, and the same polypeptide is found in cytochrome oxidase isolated from procyclic T. brucei and promastigote Leishmania mexicana amazonensis. However, the trCOIV gene, the mRNA and the polypeptide could not be detected in a respiration-deficient trypanosomatid Phytomonas serpens. PMID:12467979

  4. Loss of lysyl oxidase-like 3 causes cleft palate and spinal deformity in mice

    PubMed Central

    Zhang, Jian; Yang, Rui; Liu, Ziyi; Hou, Congzhe; Zong, Wen; Zhang, Aizhen; Sun, Xiaoyang; Gao, Jiangang

    2015-01-01

    In mammals, embryonic development are highly regulated morphogenetic processes that are tightly controlled by genetic elements. Failure of any one of these processes can result in embryonic malformation. The lysyl oxidase (LOX) family genes are closely related to human diseases. In this study, we investigated the essential role of lysyl oxidase-like 3 (LOXL3), a member of the LOX family, in embryonic development. Mice lacking LOXL3 exhibited perinatal lethality, and the deletion of the Loxl3 gene led to impaired development of the palate shelves, abnormalities in the cartilage primordia of the thoracic vertebrae and mild alveolar shrinkage. We found that the obvious decrease of collagen cross-links in palate and spine that was induced by the lack of LOXL3 resulted in cleft palate and spinal deformity. Thus, we provide critical in vivo evidence that LOXL3 is indispensable for mouse palatogenesis and vertebral column development. The Loxl3 gene may be a candidate disease gene resulting in cleft palate and spinal deformity. PMID:26307084

  5. Apocyanin, a Microglial NADPH Oxidase Inhibitor Prevents Dopaminergic Neuronal Degeneration in Lipopolysaccharide-Induced Parkinson's Disease Model.

    PubMed

    Sharma, Neha; Nehru, Bimla

    2016-07-01

    Microglia-associated inflammatory processes have been strongly implicated in the development and progression of Parkinson's disease (PD). Specifically, microglia are activated in response to lipopolysaccharide (LPS) and become chronic source of cytokines and reactive oxygen species (ROS) production. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase complex is responsible for extracellular as well as intracellular production of ROS by microglia and its expression is upregulated in PD. Therefore, targeting NADPH oxidase complex activation using an NADPH oxidase inhibitor, i.e., apocyanin seems to be an effective approach. The aim of present study was to investigate the neuroprotective effects of apocyanin in a LPS-induced PD model. LPS (5 μg) was injected intranigral and apocyanin was administered daily at a dose of 10 mg/kg b.wt (i.p.) during the experiment. LPS when injected into the substantia nigra (SN) reproduced the characteristic hallmark features of PD in rats. It elicited an inflammatory response characterized by glial cell activation (Iba-1, GFAP). Furthermore, LPS upregulated the gene expression of nuclear factor-κB (NFκB), iNOS, and gp91PHOX and resulted in an elevated total ROS production as well as NADPH oxidase activity. Subsequently, this resulted in dopaminergic loss as depicted by decreased tyrosine hydroxylase (TH) expression with substantial loss in neurotransmitter dopamine and its metabolites, whereas treatment with apocyanin significantly reduced the number of glial fibrillary acidic protein (GFAP) and Iba-1-positive cells in LPS-treated animals. It also mitigated microglial activation-induced inflammatory response and elevation in NADPH oxidase activity, thus reducing the extracellular as well as intracellular ROS production. The present study indicated that targeting NADPH oxidase can inhibit microglial activation and reduce a broad spectrum of toxic factors generation (i.e., cytokines, ROS, and reactive nitrogen species [RNS

  6. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  7. Role of cytochrome bd oxidase from Corynebacterium glutamicum in growth and lysine production.

    PubMed

    Kabus, Armin; Niebisch, Axel; Bott, Michael

    2007-02-01

    Corynebacterium glutamicum possesses two terminal oxidases, cytochrome aa3 and cytochrome bd. Cytochrome aa3 forms a supercomplex with the cytochrome bc1 complex, which contains an unusual diheme cytochrome c1. Both the bc1 -aa3 supercomplex and cytochrome bd transfer reducing equivalents from menaquinol to oxygen; however, they differ in their proton translocation efficiency by a factor of three. Here, we analyzed the role of cytochrome bd for growth and lysine production. When cultivated in glucose minimal medium, a cydAB deletion mutant of C. glutamicum ATCC 13032 grew like the wild type in the exponential phase, but growth thereafter was inhibited, leading to a biomass formation 40% less than that of the wild type. Constitutive overproduction of functional cytochrome bd oxidase in ATCC 13032 led to a reduction of the growth rate by approximately 45% and of the maximal biomass by approximately 35%, presumably as a consequence of increased electron flow through the inefficient cytochrome bd oxidase. In the L-lysine-producing C. glutamicum strain MH20-22B, deletion of the cydAB genes had only minor effects on growth rate and biomass formation, but lysine production was increased by approximately 12%. Thus, the respiratory chain was shown to be a target for improving amino acid production by C. glutamicum. PMID:17142369

  8. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  9. Genetic and genomic analysis of Rhizoctonia solani interactions with Arabidopsis; evidence of resistance mediated through NADPH oxidases.

    PubMed

    Foley, Rhonda C; Gleason, Cynthia A; Anderson, Jonathan P; Hamann, Thorsten; Singh, Karam B

    2013-01-01

    Rhizoctonia solani is an important soil-borne necrotrophic fungal pathogen, with a broad host range and little effective resistance in crop plants. Arabidopsis is resistant to R. solani AG8 but susceptible to R. solani AG2-1. A screen of 36 Arabidopsis ecotypes and mutants affected in the auxin, camalexin, salicylic acid, abscisic acid and ethylene/jasmonic acid pathways did not reveal any variation in response to R. solani and demonstrated that resistance to AG8 was independent of these defense pathways. The Arabidopsis Affymetrix ATH1 Genome array was used to assess global gene expression changes in plants infected with AG8 and AG2-1 at seven days post-infection. While there was considerable overlap in the response, some gene families were differentially affected by AG8 or AG2-1 and included those involved in oxidative stress, cell wall associated proteins, transcription factors and heat shock protein genes. Since a substantial proportion of the gene expression changes were associated with oxidative stress responses, we analysed the role of NADPH oxidases in resistance. While single NADPH oxidase mutants had no effect, a NADPH oxidase double mutant atrbohf atrbohd resulted in an almost complete loss of resistance to AG8, suggesting that reactive oxidative species play an important role in Arabidopsis's resistance to R. solani. PMID:23451091

  10. Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

    PubMed Central

    Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

    2013-01-01

    Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

  11. The Function of Ascorbate Oxidase in Tobacco1

    PubMed Central

    Pignocchi, Cristina; Fletcher, John M.; Wilkinson, Joy E.; Barnes, Jeremy D.; Foyer, Christine H.

    2003-01-01

    The function of the apoplastic enzyme ascorbate oxidase (AO) was investigated in tobacco (Nicotiana tabacum). The abundance of AO mRNA was up-regulated by light. Cytosolic ascorbate peroxidase (APX1) transcripts were also highest in the light. In contrast, l-galactono-γ-lactone dehydrogenase, stromal APX, and thylakoid APX transcripts remained constant over the day/night cycle. Salicylic acid inhibited growth, increased expression of the pathogenesis-related protein (PR) 1a, and decreased AO transcript abundance. In contrast, the application of auxin enhanced growth and increased AO and PR 1a gene expression. Therefore, AO transcript abundance varied in a manner similar to hormone-mediated changes in plant growth. To study the effects of modified AO expression on growth, transformed tobacco plants expressing AO in the sense and antisense orientations were generated. The resultant large changes in apoplastic AO activity in the transformed tobacco plants had little effect on whole leaf ascorbate (AA) content, but they had dramatic effects on apoplastic AA levels. Enhanced AO activity oxidized the apoplastic AA pool, whereas decreased AO activity increased the amount of AA compared with dehydroascorbate. A relationship was observed between AO activity and plant height and biomass. Native AO transcript levels were no longer subject to light/dark regulation in AO sense and antisense plants. Taken together, these data show that there is an interaction between hormone, redox, and light signals at the level of the apoplast via modulation of ion of AA content. PMID:12857842

  12. Evolution of histamine oxidase activity for biotechnological applications.

    PubMed

    Rosini, Elena; Tonin, Fabio; Vasylieva, Natalia; Marinesco, Stephane; Pollegioni, Loredano

    2014-01-01

    Histamine is present to various degrees in many foods, and concentrations in fish samples are considered a good indicator of freshness and hygienic food quality. Seeking for innovative methods to quantify histamine in foods, we used a synthetic gene designed on the sequence of histamine oxidase from Arthrobacter crystallopoietes (HOD) as the starting point in this study to develop a biosensor. HOD was expressed in Escherichia coli cells with a yield of ∼7 mg protein/L of fermentation broth. Recombinant wild-type HOD oxidized histamine and tyramine whereas it was inactive toward putrescine and cadaverine (two amines present in fish samples). The putative residues involved in substrate binding were identified by an in silico docking procedure based on a model of the structure of HOD: site-saturation mutagenesis was performed on 8 positions. The most significant changes in kinetic properties were observed for the P143M HOD: this variant showed higher histamine affinity and lower substrate inhibition by tyramine than wild-type enzyme. Biosensor prototypes were produced using both the wild-type and the P143M variant HOD. These biosensors showed a good sensitivity and selectivity with respect to biogenic amines present in food specimens. Accordingly, the HOD-based biosensor was successfully used to assess histamine in fish samples, yielding values in good agreement with those obtained by HPLC analyses but in a few seconds and at a significantly lower cost per analysis. PMID:23995223

  13. Coenzyme-like ligands for affinity isolation of cholesterol oxidase.

    PubMed

    Xin, Yu; Lu, Liushen; Wang, Qing; Zhang, Ling; Tong, Yanjun; Wang, Wu

    2016-05-15

    Two coenzyme-like chemical ligands were designed and synthesized for affinity isolation of cholesterol oxidase (COD). To simulate the structure of natural coenzyme of COD (flavin adenine dinucleotide (FAD)), on Sepharose beads, 5-aminouracil, cyanuric chloride and 1, 4-butanediamine were composed and then modified. The COD gene from Brevibacterium sp. (DQ345780) was expressed in Escherichia coli BL21 (DE3), and then the sorbents were applied to adsorption analysis with the pure enzyme. Subsequently, the captured enzyme was applied to SDS-PAGE and activity analysis. As calculated, the theoretical maximum adsorption (Qmax) of the two affinity sorbents (RL-1 and RL-2) were ∼83.5 and 46.3mg/g wet gel; and the desorption constant Kd of the two sorbents were ∼6.02×10(-4) and 1.19×10(-4)μM. The proteins after cell lysis were applied to affinity isolation, and then after one step of affinity binding on the two sorbents, the protein recoveries of RL-1 and RL-2 were 9.2% and 9.7%; the bioactivity recoveries were 92.7% and 91.3%, respectively. SDS-PAGE analysis revealed that the purities of COD isolated with the two affinity sorbents were approximately 95%. PMID:26856529

  14. Cataplexy and monoamine oxidase deficiency in Norrie disease.

    PubMed

    Vossler, D G; Wyler, A R; Wilkus, R J; Gardner-Walker, G; Vlcek, B W

    1996-05-01

    Norrie disease (ND) is an X-linked recessive disorder causing ocular atrophy, mental retardation, deafness, and dysmorphic features. Virtually absent monoamine oxidase (MAO) type-A and -B activity has been found in some boys with chromosome deletions. We report the coexistence of cataplexy and abnormal REM sleep organization with ND. Three related boys, referred for treatment of medically refractory atonic spells and apneas, underwent extended EEG-video-polysomnographic monitoring. They demonstrated attacks of cataplexy and inappropriate periods of REM sleep during which they were unarousable. One boy also had generalized tonic-clonic seizures. Previous testing revealed that all three have complete ND gene deletions. In all subjects, platelet MAO-B activity was absent, serum serotonin levels were markedly increased, and plasma catecholamine levels were normal. Data from the canine narcolepsy syndrome model implicate abnormal catecholaminergic and cholinergic activities in the pathogenesis of cataplexy. Our findings suggest that abnormal MAO activity or an imbalance between serotonin and other neurotransmitter levels may be involved in the pathogenesis of human cataplexy. PMID:8628463

  15. In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

    PubMed

    Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

    2016-01-01

    In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors. PMID:27409598

  16. Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus

    PubMed Central

    Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric

    2016-01-01

    ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these

  17. NADPH Oxidases in Chronic Liver Diseases

    PubMed Central

    Jiang, Joy X.; Török, Natalie J.

    2015-01-01

    Oxidative stress is a common feature observed in a wide spectrum of chronic liver diseases including viral hepatitis, alcoholic, and nonalcoholic steatohepatitis. The nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOXs) are emerging as major sources of reactive oxygen species (ROS). Several major isoforms are expressed in the liver, including NOX1, NOX2, and NOX4. While the phagocytic NOX2 has been known to play an important role in Kupffer cell and neutrophil phagocytic activity and inflammation, the nonphagocytic NOX homologues are increasingly recognized as key enzymes in oxidative injury and wound healing. In this review, we will summarize the current advances in knowledge on the regulatory pathways of NOX activation, their cellular distribution, and their role in the modulation of redox signaling in liver diseases. PMID:26436133

  18. Degradation of pentachlorophenol by potato polyphenol oxidase.

    PubMed

    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

    2011-11-01

    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  19. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.

    1996-12-31

    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  20. NADPH Oxidases in Lung Health and Disease

    PubMed Central

    Bernard, Karen; Hecker, Louise; Luckhardt, Tracy R.; Cheng, Guangjie

    2014-01-01

    Abstract Significance: The evolution of the lungs and circulatory systems in vertebrates ensured the availability of molecular oxygen (O2; dioxygen) for aerobic cellular metabolism of internal organs in large animals. O2 serves as the physiologic terminal acceptor of mitochondrial electron transfer and of the NADPH oxidase (Nox) family of oxidoreductases to generate primarily water and reactive oxygen species (ROS), respectively. Recent advances: The purposeful generation of ROS by Nox family enzymes suggests important roles in normal physiology and adaptation, most notably in host defense against invading pathogens and in cellular signaling. Critical issues: However, there is emerging evidence that, in the context of chronic stress and/or aging, Nox enzymes contribute to the pathogenesis of a number of lung diseases. Future Directions: Here, we review evolving functions of Nox enzymes in normal lung physiology and emerging pathophysiologic roles in lung disease. Antioxid. Redox Signal. 20, 2838–2853. PMID:24093231

  1. Lysyl oxidase binds transforming growth factor-beta and regulates its signaling via amine oxidase activity.

    PubMed

    Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Kaku, Masaru; Fong, Keith S K; Csiszar, Katalin; Yamauchi, Mitsuo

    2008-12-01

    Lysyl oxidase (LOX), an amine oxidase critical for the initiation of collagen and elastin cross-linking, has recently been shown to regulate cellular activities possibly by modulating the functions of growth factors. In this study, we investigated the interaction between LOX and transforming growth factor-beta1 (TGF-beta1), a potent growth factor abundant in bone, the effect of LOX on TGF-beta1 signaling, and its potential mechanism. The specific binding between mature LOX and mature TGF-beta1 was demonstrated by immunoprecipitation and glutathione S-transferase pulldown assay in vitro. Both proteins were colocalized in the extracellular matrix in an osteoblastic cell culture system, and the binding complex was identified in the mineral-associated fraction of bone matrix. Furthermore, LOX suppressed TGF-beta1-induced Smad3 phosphorylation likely through its amine oxidase activity. The data indicate that LOX binds to mature TGF-beta1 and enzymatically regulates its signaling in bone and thus may play an important role in bone maintenance and remodeling. PMID:18835815

  2. Phagocyte NADPH oxidase and specific immunity.

    PubMed

    Cachat, Julien; Deffert, Christine; Hugues, Stephanie; Krause, Karl-Heinz

    2015-05-01

    The phagocyte NADPH oxidase NOX2 produces reactive oxygen species (ROS) and is a well-known player in host defence. However, there is also increasing evidence for a regulatory role of NOX2 in adaptive immunity. Deficiency in phagocyte NADPH oxidase causes chronic granulomatous disease (CGD) in humans, a condition that can also be studied in CGD mice. Clinical observations in CGD patients suggest a higher susceptibility to autoimmune diseases, in particular lupus, idiopathic thrombocytopenic purpura and rheumatoid arthritis. In mice, a strong correlation exists between a polymorphism in a NOX2 subunit and the development of autoimmune arthritis. NOX2 deficiency in mice also favours lupus development. Both CGD patients and CGD mice exhibit increased levels of immunoglobulins, including autoantibodies. Despite these phenotypes suggesting a role for NOX2 in specific immunity, mechanistic explanations for the typical increase of CGD in autoimmune disease and antibody levels are still preliminary. NOX2-dependent ROS generation is well documented for dendritic cells and B-lymphocytes. It is unclear whether T-lymphocytes produce ROS themselves or whether they are exposed to ROS derived from dendritic cells during the process of antigen presentation. ROS are signalling molecules in virtually any cell type, including T- and B-lymphocytes. However, knowledge about the impact of ROS-dependent signalling on T- and B-lymphocyte phenotype and response is still limited. ROS might contribute to Th1/Th2/Th17 cell fate decisions during T-lymphocyte activation and might enhance immunoglobulin production by B-lymphocytes. In dendritic cells, NOX2-derived ROS might be important for antigen processing and cell activation. PMID:25760962

  3. Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

    PubMed

    Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

    2010-05-01

    Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching. PMID:19763895

  4. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

    1984-01-01

    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  5. Characterization of gibberellin 20-oxidases in the citrus hybrid Carrizo citrange.

    PubMed

    Huerta, Laura; Garcia-Lor, Andres; Garcia-Martinez, Jose L

    2009-04-01

    CcGA20ox1 is a gene encoding a GA 20-oxidase, a gibberellin (GA) biosynthetic enzyme, previously isolated from the citrus hybrid Carrizo citrange (Citrus sinensis (L.) Osbeck x Poncirus trifoliata (L.) Raf.). Southern blot analysis of genomic DNA of Carrizo citrange with CcGA20ox1 suggested the presence in the hybrid of another gene encoding another GA 20-oxidase. A cDNA clone from this new gene (CcGA20ox2) was isolated using RNA from the other parent C. sinensis. CcGA20ox2 encoded a protein of 372 amino acids that showed 67.1% identity with CcGA20ox1, and its expression product catalyzed the in vitro conversion of GA12 to GA9, confirming that it corresponds to another active GA20ox. Amplification of genomic DNA and isolation of genomic clones of CcGA20ox1 and CcGA20ox2 revealed that the parental sources of these genes in the hybrid were P. trifoliata and C. sinensis, respectively. The sequences of CcGA20ox1 and CcGA20ox2 showed that both genes contained two introns, which are also conserved in GA20ox genes of other species like Arabidopsis thaliana L., Pisum sativum L. and Solanum lycopersicum L. Determination of transcript levels in the Carrizo citrange hybrid by quantitative real-time polymerase chain reaction showed that CcGA20ox1 was expressed mainly in internodes, leaves and seeds, and CcGA20ox2 in flower buds and flowers at anthesis, with the genes having similar transcript levels in young developing fruits. PMID:19203975

  6. The cytochrome c oxidase biogenesis factor AtCOX17 modulates stress responses in Arabidopsis.

    PubMed

    Garcia, Lucila; Welchen, Elina; Gey, Uta; Arce, Agustín L; Steinebrunner, Iris; Gonzalez, Daniel H

    2016-03-01

    COX17 is a soluble protein from the mitochondrial intermembrane space that participates in the transfer of copper for cytochrome c oxidase (COX) assembly in eukaryotic organisms. In this work, we studied the function of both Arabidopsis thaliana AtCOX17 genes using plants with altered expression levels of these genes. Silencing of AtCOX17-1 in a cox17-2 knockout background generates plants with smaller rosettes and decreased expression of genes involved in the response of plants to different stress conditions, including several genes that are induced by mitochondrial dysfunctions. Silencing of either of the AtCOX17 genes does not affect plant development or COX activity but causes a decrease in the response of genes to salt stress. In addition, these plants contain higher reactive oxygen and lipid peroxidation levels after irrigation with high NaCl concentrations and are less sensitive to abscisic acid. In agreement with a role of AtCOX17 in stress and abscisic acid responses, both AtCOX17 genes are induced by several stress conditions, abscisic acid and mutation of the transcription factor ABI4. The results indicate that AtCOX17 is required for optimal expression of a group of stress-responsive genes, probably as a component of signalling pathways that link stress conditions to gene expression responses. PMID:26436309

  7. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  8. hCOA3 Stabilizes Cytochrome c Oxidase 1 (COX1) and Promotes Cytochrome c Oxidase Assembly in Human Mitochondria*

    PubMed Central

    Clemente, Paula; Peralta, Susana; Cruz-Bermudez, Alberto; Echevarría, Lucía; Fontanesi, Flavia; Barrientos, Antoni; Fernandez-Moreno, Miguel A.; Garesse, Rafael

    2013-01-01

    Cytochrome c oxidase (COX) or complex IV of the mitochondrial respiratory chain plays a fundamental role in energy production of aerobic cells. In humans, COX deficiency is the most frequent cause of mitochondrial encephalomyopathies. Human COX is composed of 13 subunits of dual genetic origin, whose assembly requires an increasing number of nuclear-encoded accessory proteins known as assembly factors. Here, we have identified and characterized human CCDC56, an 11.7-kDa mitochondrial transmembrane protein, as a new factor essential for COX biogenesis. CCDC56 shares sequence similarity with the yeast COX assembly factor Coa3 and was termed hCOA3. hCOA3-silenced cells display a severe COX functional alteration owing to a decreased stability of newly synthesized COX1 and an impairment in the holoenzyme assembly process. We show that hCOA3 physically interacts with both the mitochondrial translation machinery and COX structural subunits. We conclude that hCOA3 stabilizes COX1 co-translationally and promotes its assembly with COX partner subunits. Finally, our results identify hCOA3 as a new candidate when screening for genes responsible for mitochondrial diseases associated with COX deficiency. PMID:23362268

  9. Leishmania major possesses a unique HemG-type protoporphyrinogen IX oxidase

    PubMed Central

    Zwerschke, Dagmar; Karrie, Simone; Jahn, Dieter; Jahn, Martina

    2014-01-01

    Leishmania major was proposed to either utilize haem from its host or partially synthesize the tetrapyrrole from host provided precursors. However, only indirect evidence was available for this partial late haem biosynthetic pathway. Here, we demonstrate that the LMJF_06_1280 gene of L. major encodes a HemG-type PPO (protoporphyrinogen IX oxidase) catalysing the oxidation of protoporphyrinogen IX to protoporphyrin IX. Interestingly, trypanosomatids are currently the only known eukaryotes possessing HemG-type enzymes. The LMJF_06_1280 gene forms a potential transcriptional unit with LMJF_06_1270 encoding CPO (coproporphyrinogen III oxidase) and with LMJF_06_1290 for a cytochrome b5. In vivo function of the L. major hemG gene was shown by the functional complementation of the Escherichia coli ΔhemG strain LG285. Restored haem formation in E. coli was observed using HPLC analyses. Purified recombinant L. major HemG revealed PPO activity in vitro using different ubiquinones and triphenyltetrazolium as electron acceptors. FMN was identified as the L. major HemG cofactor. Active site residues were found to be essential for HemG catalysis. These data in combination with the solved crystal structures of L. major CPO and the physiological proof of a ferrochelatase activity provide clear-cut evidence for a partial haem biosynthetic pathway in L. major. PMID:24962471

  10. The terminal oxidase in the marine bacterium Pseudomonas nautica 617.

    PubMed

    Simpson, H; Denis, M; Malatesta, F

    1997-06-01

    The molecular properties of a novel membrane quinol oxidase from the marine bacterium Pseudomonas nautica 617 are presented. The protein contains 2b hemes/mole which may be distinguished by EPR spectroscopy but not by optical spectroscopy and electrochemistry. Respiration, though being cyanide insensitive, is not inhibited by carbon monoxide and oxygen reduction is carried out only half-way with production of hydrogen peroxide. The terminal oxidase represents, therefore, a unique example in the large family of terminal oxidases known up to date. PMID:9337488

  11. Identification of yeasts from clinical specimens by oxidase test.

    PubMed

    Kumar, S; Arora, B S; Mathur, M D

    2000-10-01

    A total of 100 yeasts and yeast like fungi isolates from clinical specimens were negative for oxidase production on Sabouraud dextrose agar. When grown on Columbia agar, chocolate agar, tryptose agar, Mueller-Hinton agar, brain heart infusion and a medium resembling Sabouraud's dextrose agar but with starch instead of dextrose, all the isolate of Candida albicans (55), C. guilliermondii (6), C. parapsilosis (14), C. tropicalis (6), C. pseudotropicalis (6) and Crytococcus neoformans (2) were positive for oxidase producation. Torulopsis glabrata (2), Saccharomyces cervisiae (2) and two out of seven isolates of C. krusei were negative for oxidase test. PMID:11344606

  12. Aiding and abetting roles of NOX oxidases in cellular transformation

    PubMed Central

    Block, Karen; Gorin, Yves

    2013-01-01

    NADPH oxidases of the NADPH oxidase (NOX) family are dedicated reactive oxygen species-generating enzymes that broadly and specifically regulate redox-sensitive signalling pathways that are involved in cancer development and progression. They act at specific cellular membranes and microdomains through the activation of oncogenes and the inactivation of tumour suppressor proteins. In this Review, we discuss primary targets and redox-linked signalling systems that are influenced by NOX-derived ROS, and the biological role of NOX oxidases in the aetiology of cancer. PMID:22918415

  13. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

    2014-01-01

    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  14. Alternative oxidase involvement in Daucus carota somatic embryogenesis.

    PubMed

    Frederico, António Miguel; Campos, Maria Doroteia; Cardoso, Hélia Guerra; Imani, Jafargholi; Arnholdt-Schmitt, Birgit

    2009-12-01

    Plant alternative oxidase (AOX) is a mitochondrial inner membrane enzyme involved in alternative respiration. The critical importance of the enzyme during acclimation upon stress of plant cells is not fully understood and is still an issue of intensive research and discussion. Recently, a role of AOX was suggested for the ability of plant cells to change easily its fate upon stress. In order to get new insights about AOX involvement in cell reprogramming, quantitative real-time polymerase chain reaction (PCR) and inhibitor studies were performed during cell redifferentiation and developmental stages of Daucus carota L. somatic embryogenesis. Transcript level analysis shows that D. carota AOX genes (DcAOX1a and DcAOX2a) are differentially expressed during somatic embryogenesis. DcAOX1a shows lower expression levels, being mainly down-regulated, whereas DcAOX2a presented a large up-regulation during initiation of the realization phase of somatic embryogenesis. However, when globular embryos start to develop, both genes are down-regulated, being this state transient for DcAOX2a. In addition, parallel studies were performed using salicylhydroxamic acid (SHAM) in order to inhibit AOX activity during the realization phase of somatic embryogenesis. Embryogenic cells growing in the presence of the inhibitor were unable to develop embryogenic structures and its growth rate was diminished. This effect was reversible and concentration dependent. The results obtained contribute to the hypothesis that AOX activity supports metabolic reorganization as an essential part of cell reprogramming and, thus, enables restructuring and de novo cell differentiation. PMID:19863756

  15. Genetic characterization and expression analysis of wheat (Triticum aestivum) line 07OR1074 exhibiting very low polyphenol oxidase (PPO) activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat (Triticum aestivum) polyphenol oxidase (PPO) contributes to the time dependent discoloration of Asian noodles. Wheat contains multiple paralogous and orthologous PPO genes , Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2, expressed in wheat kernels, Ppo-A1, Ppo-D1, Ppo-A2, Ppo-D2, and Ppo-B2. To d...

  16. A transgenic apple callus showing reduced polyphenol oxidase activity and lower browning potential.

    PubMed

    Murata, M; Nishimura, M; Murai, N; Haruta, M; Homma, S; Itoh, Y

    2001-02-01

    Polyphenol oxidase (PPO) is responsible for enzymatic browning of apples. Apples lacking PPO activity might be useful not only for the food industry but also for studies of the metabolism of polyphenols and the function of PPO. Transgenic apple calli were prepared by using Agrobacterium tumefaciens carrying the kanamycin (KM) resistant gene and antisense PPO gene. Four KM-resistant callus lines were obtained from 356 leaf explants. Among these transgenic calli, three calli grew on the medium containing KM at the same rate as non-transgenic callus on the medium without KM. One callus line had an antisense PPO gene, in which the amount and activity of PPO were reduced to half the amount and activity in non-transgenic callus. The browning potential of this line, which was estimated by adding chlorogenic acid, was also half the browning potential of non-transgenic callus. PMID:11302173

  17. ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

    USGS Publications Warehouse

    Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

    2012-01-01

    Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

  18. Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

    PubMed Central

    Lermontova, Inna; Grimm, Bernhard

    2000-01-01

    The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251

  19. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.

    2015-01-01

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  20. Inhibition of plant and mammalian diamine oxidase by substrate analogues.

    PubMed

    Biegański, T; Osińska, Z; Masliński, C

    1982-04-01

    Imidazoles, aliphatic substrate analogues and the natural dipeptides, carnosine and anserine, were investigated as inhibitors of diamine oxidase from the pig kidney, human pregnancy plasma and pea seedlings. Imidazole, methylimidazoles, N-acetylimidazole, histamine and N tau-methylhistamine are relatively potent inhibitors of mammalian diamine oxidase showing no influence on plant enzymes. Anserine and carnosine are inhibitors of pig kidney and pea seedling enzymes. Ki values are 2 microM and 10 microM respectively. Investigated natural derivatives of putrescine and cadaverine have no influence on diamine oxidase of different origin. In conclusion, we present some evidence to suggest that mammalian diamine oxidase, despite a high reaction rate with putrescine, is better adapted to histamine oxidation, whereas for plant enzymes the diamines are preferred substrates. PMID:6805264

  1. [Heterogeneity of molecular forms of phenol oxidase from grape leaves].

    PubMed

    Pruidze, G N; Zaprometov, M N; Durmishidze, S V; Kintsurashvili, D F

    1983-07-01

    The substrate specificity and some kinetic properties of the monomeric (Mr = 26 000--35 000) and dimeric (Mr = 55 000--70 000) forms of phenol oxidase from vine leaves were studied. These forms possess different hydroxylating and o-diphenol oxidase activities. A kinetic analysis demonstrated that the monomeric form of the enzyme possesses a higher affinity for monophenols and can more effectively accomplish the hydroxylation reaction as compared to the dimeric one. During vine vegetation the ratio of molecular forms of phenol oxidase is altered manifesting itself in quantitative and qualitative changes of enzymatic activity. During plant maturation the dimeric fraction is predominant. The maturation process is associated with a sharp rise of the o-phenol oxidase activity, a disappearance of the hydroxylating activity and a substantial deceleration of phenol compounds production. PMID:6412775

  2. Confirmation of a blocked amino terminus of sulfhydryl oxidase

    SciTech Connect

    Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E. )

    1990-09-01

    The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with ({sup 14}C)iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 ({plus minus} 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked.

  3. Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis.

    PubMed

    Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

    2013-01-01

    Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

  4. Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

    PubMed

    Sytykiewicz, Hubert

    2016-07-22

    Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. PMID:27178208

  5. Molecular aspects of monoamine oxidase B.

    PubMed

    Ramsay, Rona R

    2016-08-01

    Monoamine oxidases (MAO) influence the monoamine levels in brain by virtue of their role in neurotransmitter breakdown. MAO B is the predominant form in glial cells and in platelets. MAO B structure, function and kinetics are described as a background for the effect of alterations in its activity on behavior. The need to inhibit MAO B to combat decreased brain amines continues to drive the search for new drugs. Reversible and irreversible inhibitors are now designed using data-mining, computational screening, docking and molecular dynamics. Multi-target ligands designed to combat the elevated activity of MAO B in Alzheimer's and Parkinson's Diseases incorporate MAO inhibition (usually irreversible) as well as iron chelation, antioxidant or neuroprotective properties. The main focus of drug design is the catalytic activity of MAO, but the imidazoline I2 site in the entrance cavity of MAO B is also a pharmacological target. Endogenous regulation of MAO B expression is discussed briefly in light of new studies measuring mRNA, protein, or activity in healthy and degenerative samples, including the effect of DNA methylation on the expression. Overall, this review focuses on examples of recent research on the molecular aspects of the expression, activity, and inhibition of MAO B. PMID:26891670

  6. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).

    PubMed

    Neves, Valdir Augusto; da Silva, Maraiza Aparecida

    2007-03-21

    Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  7. MONOAMINE OXIDASE: RADIOTRACER DEVELOPMENT AND HUMAN STUDIES.

    SciTech Connect

    FOWLER,J.S.; LOGAN,J.; VOLKOW,N.D.; WANG,G.J.; MACGREGOR,R.R.; DING,Y.S.

    2000-09-28

    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  8. Photodynamic therapy using a protoporphyrinogen oxidase inhibitor.

    PubMed

    Fingar, V H; Wieman, T J; McMahon, K S; Haydon, P S; Halling, B P; Yuhas, D A; Winkelman, J W

    1997-10-15

    The use of endogenously created porphyrins as an alternative to photosensitizer injection for photodynamic therapy is a rapidly evolving area of study. One common method to induce porphyrin synthesis and accumulation in cells is the topical, oral, or parenteral administration of 5-aminolevulinic acid, a precursor for heme biosynthesis. Porphyrin accumulation may also be elicited by the use of enzyme inhibitors of the heme biosynthetic pathway. Groups of DBA/2 mice bearing SMT-F mammary tumors were placed on a diet containing 0-4000 ppm of a protoporphyrinogen oxidase inhibitor, FP-846. This agent blocks a critical step in porphyrin metabolism and results in elevated intracellular levels of protoporphyrin IX. Light treatment of tumors produced both initial and long-term regression that was dependent on the amount of inhibitor, the duration of inhibitor exposure to animals, and the amount of light used in PDT. Tumor regression occurred without significant destruction of normal tissues in the treatment field and without initial vascular constriction or blood flow stasis. Tumor cure in animals given 4000 ppm FP-846 in feed for 3 days and 300 J/cm2 602-670 nm light (23% cure) was similar to the response in animals given 10 mg/kg Photofrin and the same light dose (20%). PMID:9377568

  9. Analyzing the electrogenicity of cytochrome c oxidase.

    PubMed

    Kim, Ilsoo; Warshel, Arieh

    2016-07-12

    Measurements of voltage changes in response to charge separation within membrane proteins can offer fundamental information on spectroscopically "invisible" steps. For example, results from studies of voltage changes associated with electron and proton transfer in cytochrome c oxidase could, in principle, be used to discriminate between different theoretical models describing the molecular mechanism of proton pumping. Earlier analyses of data from these measurements have been based on macroscopic considerations that may not allow for exploring the actual molecular mechanisms. Here, we have used a coarse-grained model describing the relation between observed voltage changes and specific charge-transfer reactions, which includes an explicit description of the membrane, the electrolytes, and the electrodes. The results from these calculations offer mechanistic insights at the molecular level. Our main conclusion is that previously assumed mechanistic evidence that was based on electrogenic measurements is not unique. However, the ability of our calculations to obtain reliable voltage changes means that we have a tool that can be used to describe a wide range of electrogenic charge transfers in channels and transporters, by combining voltage measurements with other experiments and simulations to analyze new mechanistic proposals. PMID:27357681

  10. Molecularly "wired" cholesterol oxidase for biosensing.

    PubMed

    Leonida, Mihaela D; Aurian-Blajeni, Benedict

    2015-02-01

    The influence of several factors on the activity of cholesterol oxidase (ChOx) transiently exposed to a room temperature ionic liquid (RTIL) was studied. Presence of flavin adenine dinucleotide (FAD, prosthetic group of ChOx) during exposure to RTIL makes the procedure enzyme-friendly, while the use of RTIL (green reagent) makes it environmentally-friendly. Following exposure to RTIL and its subsequent removal, FAD becomes part of the molecular structure of the refolded protein (a molecular "wire"). This makes the procedure used here a molecular one. The factors studied were: FAD presence in RTIL during modification, water presence during exposure to RTIL, and ratio FAD:RTIL during "wiring". Performance parameters monitored were: enzyme activity before and after "wiring" (expressed as (dA/dt)/mg enzyme, and measured spectrophotometrically), peak current in an amperometric biosensor for cholesterol detection, and linearity of the biosensor response depending on cholesterol concentration. After RTIL removal, the modified enzyme (ME) retained a high percentage of the added FAD, which supplemented that of the native enzyme (functioning as a "wire" and enhancing electron transfer kinetics), and a fraction of the initial activity. Used in an amperometric biosensor, ME showed catalytic activity, linear behavior as a function of cholesterol concentration, and stability. PMID:25579496

  11. Crystallization of carbohydrate oxidase from Microdochium nivale.

    PubMed

    Dusková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Stepánková, Andrea; Hasek, Jindrich

    2009-06-01

    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 A resolution, with unit-cell parameters a = b = 55.7, c = 610.4 A and apparent space group P6(2)22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 A, beta = 95.7 degrees . Data sets were collected to a resolution of 2.4 A. The structure was solved by the molecular-replacement method. Model refinement is currently in progress. PMID:19478452

  12. Crystallization of carbohydrate oxidase from Microdochium nivale

    PubMed Central

    Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich

    2009-01-01

    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The en