Science.gov

Sample records for multicopper oxidase gene

  1. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  2. Multiple multi-copper oxidase gene families in basidiomycetes - what for?

    PubMed

    Kües, Ursula; Rühl, Martin

    2011-04-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  3. Evolution of Multicopper Oxidase Genes in Coprophilous and Non-Coprophilous Members of the Order Sordariales

    PubMed Central

    Pggeler, Stefanie

    2011-01-01

    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events. PMID:21966247

  4. The Aspergillus niger multicopper oxidase family: analysis and overexpression of laccase-like encoding genes

    PubMed Central

    2011-01-01

    Background Many filamentous fungal genomes contain complex groups of multicopper oxidase (MCO) coding genes that makes them a good source for new laccases with potential biotechnological interest. A bioinformatics analysis of the Aspergillus niger ATCC 1015 genome resulted in the identification of thirteen MCO genes. Ten of them were cloned and homologously overexpressed. Results A bioinformatic analysis of the A. niger ATCC 1015 genome revealed the presence of 13 MCO genes belonging to three different subfamilies on the basis of their phylogenetic relationships: ascomycete laccases, fungal pigment MCOs and fungal ferroxidases. According to in silico amino acid sequence analysis, the putative genes encoding for functional extracellular laccases (mcoA, mcoB, mcoC, mcoD, mcoE, mcoF, mcoG, mcoI, mcoJ and mcoM) were placed under the control of the glaA promoter and overexpressed in A. niger N593. Enzyme activity plate assays with several common laccase substrates showed that all genes are actually expressed and code for active MCOs. Interestingly, expressed enzymes show different substrate specificities. In addition, optimization of fungal pigment MCOs extracellular production was investigated. The performance of the widely used glucoamylase signal sequence (ssGlaA) in McoA secretion was studied. Results obtained suggest that ssGlaA do not yield higher levels of secreted McoA when compared to its native secretion signal. Also, McoB synthesis was investigated using different nitrogen sources in minimal medium liquid cultures. Higher yields of extracellular McoB were achieved with (NH4)2 tartrate. Conclusions Aspergillus niger is a good source of new laccases. The different substrate specificity observed in plate assays makes them interesting to be purified and biochemically compared. The homologous signal sequence of McoA has been shown to be a good choice for its extracellular overexpression. From the nitrogen sources tested (NH4)2 tartrate has been found to be the most appropriate for McoB production in A. niger. PMID:21981827

  5. Oxidation of Phenolate Siderophores by the Multicopper Oxidase Encoded by the Escherichia coli yacK Gene

    PubMed Central

    Kim, Chulhwan; Lorenz, W. Walter; Hoopes, J. Todd; Dean, Jeffrey F. D.

    2001-01-01

    A gene (yacK) encoding a putative multicopper oxidase (MCO) was cloned from Escherichia coli, and the expressed enzyme was demonstrated to exhibit phenoloxidase and ferroxidase activities. The purified protein contained six copper atoms per polypeptide chain and displayed optical and electron paramagnetic resonance (EPR) spectra consistent with the presence of type 1, type 2, and type 3 copper centers. The strong optical A610 (Ε610 = 10,890 M−1 cm−1) and copper stoichiometry were taken as evidence that, similar to ceruloplasmin, the enzyme likely contains multiple type 1 copper centers. The addition of copper led to immediate and reversible changes in the optical and EPR spectra of the protein, as well as decreased thermal stability of the enzyme. Copper addition also stimulated both the phenoloxidase and ferroxidase activities of the enzyme, but the other metals tested had no effect. In the presence of added copper, the enzyme displayed significant activity against two of the phenolate siderophores utilized by E. coli for iron uptake, 2,3-dihydroxybenzoate and enterobactin, as well as 3-hydroxyanthranilate, an iron siderophore utilized by Saccharomyces cerevisiae. Oxidation of enterobactin produced a colored precipitate suggestive of the polymerization reactions that characterize microbial melanization processes. As oxidation should render the phenolate siderophores incapable of binding iron, yacK MCO activity could influence levels of free iron in the periplasm in response to copper concentration. This mechanism may explain, in part, how yacK MCO moderates the sensitivity of E. coli to copper. PMID:11466290

  6. Exploring laccase-like multicopper oxidase genes from the ascomycete Trichoderma reesei: a functional, phylogenetic and evolutionary study

    PubMed Central

    2010-01-01

    Background The diversity and function of ligninolytic genes in soil-inhabiting ascomycetes has not yet been elucidated, despite their possible role in plant litter decay processes. Among ascomycetes, Trichoderma reesei is a model organism of cellulose and hemicellulose degradation, used for its unique secretion ability especially for cellulase production. T. reesei has only been reported as a cellulolytic and hemicellulolytic organism although genome annotation revealed 6 laccase-like multicopper oxidase (LMCO) genes. The purpose of this work was i) to validate the function of a candidate LMCO gene from T. reesei, and ii) to reconstruct LMCO phylogeny and perform evolutionary analysis testing for positive selection. Results After homologous overproduction of a candidate LMCO gene, extracellular laccase activity was detected when ABTS or SRG were used as substrates, and the recombinant protein was purified to homogeneity followed by biochemical characterization. The recombinant protein, called TrLAC1, has a molecular mass of 104 kDa. Optimal temperature and pH were respectively 40-45°C and 4, by using ABTS as substrate. TrLAC1 showed broad pH stability range of 3 to 7. Temperature stability revealed that TrLAC1 is not a thermostable enzyme, which was also confirmed by unfolding studies monitored by circular dichroism. Evolutionary studies were performed to shed light on the LMCO family, and the phylogenetic tree was reconstructed using maximum-likelihood method. LMCO and classical laccases were clearly divided into two distinct groups. Finally, Darwinian selection was tested, and the results showed that positive selection drove the evolution of sequences leading to well-known laccases involved in ligninolysis. Positively-selected sites were observed that could be used as targets for mutagenesis and functional studies between classical laccases and LMCO from T. reesei. Conclusions Homologous production and evolutionary studies of the first LMCO from the biomass-degrading fungus T. reesei gives new insights into the physicochemical parameters and biodiversity in this family. PMID:20735824

  7. [Ceruloplasmin, hephaestin and zyklopen: the three multicopper oxidases important for human iron metabolism].

    PubMed

    Wierzbicka, Diana; Gromadzka, Grazyna

    2014-01-01

    Multi-copper oxidases are a group of proteins which demonstrate enzymatic activity and are capable of oxidizing their substrates with the concomitant reduction of dioxygen to two water molecules. For some multi-copper oxidases there has been demonstrated ferroxidase activity which is related to their specific structure characterized by the presence of copper centres and iron-binding sites. Three multi-copper oxidases have been included in this group: ceruloplasmin, hephaestin and zyklopen. Multi-copper oxidases which are expressed in different tissues are capable of oxidizing a wide spectrum of substrates. Multi-copper oxidases are capable of oxidizing a wide spectrum of substrates. Ceruloplasmin exhibits antioxidant activity as well as being involved in many other biological processes. The observations of phenotypic effects of absence or low expression of multi-copper ferroxidase-coding genes suggest that the main role of these proteins is taking part in iron metabolism. The main role of ceruloplasmin in iron turnover is oxidizing Fe2+ into Fe3+, a process which is essential for iron binding to transferrin (the main iron-transporting protein), as well as to ferritin (the main iron-storage protein). The function of hephaestin as ferroxidase is essential for iron binding to apotransferrin in the lamina propria of the intestinal mucosa, a process that is important for further transport of iron to the liver by the portal vein. Available data indicate that zyklopen is responsible for the placental iron transport. The presence of three multi-copper oxidases with ferroxidase activity emphasizes the significance of oxidation for iron metabolism. The distribution of multi-copper ferroxidases in many tissues ensures the proper iron turnover in the body as well as preventing toxic effects related to the presence of Fe2+ ions. These ions contribute to generation of free radicals, including the highly reactive hydroxyl radical, through the Fenton and Haber-Weiss reactions. PMID:24988611

  8. Multi-Copper Oxidases and Human Iron Metabolism

    PubMed Central

    Vashchenko, Ganna; MacGillivray, Ross T. A.

    2013-01-01

    Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

  9. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  10. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed Central

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N

    1994-01-01

    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide product are proposed, indicating that the polypeptide of ORF1 might bind four copper ions: one type 1, one type 2, and two type 3. Images PMID:8282694

  11. The Involvement of a Multicopper Oxidase in Iron Uptake by the Green Algae Chlamydomonas reinhardtii1

    PubMed Central

    Herbik, Alexandra; Bölling, Christian; Buckhout, Thomas J.

    2002-01-01

    In the unicellular green algae Chlamydomonas reinhardtii, high-affinity uptake of iron (Fe) requires an Fe3+-chelate reductase and an Fe transporter. Neither of these proteins nor their corresponding genes have been isolated. We previously identified, by analysis of differentially expressed plasma membrane proteins, an approximately 150-kD protein whose synthesis was induced under conditions of Fe-deficient growth. Based on homology of internal peptide sequences to the multicopper oxidase hephaestin, this protein was proposed to be a ferroxidase. A nucleotide sequence to the full-length cDNA clone for this ferroxidase-like protein has been obtained. Analysis of the primary amino acid sequence revealed a putative transmembrane domain near the amino terminus of the protein and signature sequences for two multicopper oxidase I motifs and one multicopper oxidase II motif. The ferroxidase-like gene was transcribed under conditions of Fe deficiency. Consistent with the role of a copper (Cu)-containing protein in Fe homeostasis, growth of cells in Cu-depleted media eliminated high-affinity Fe uptake, and Cu-deficient cells that were grown in optimal Fe showed greatly reduced Fe accumulation compared with control, Cu-sufficient cells. Reapplication of Cu resulted in the recovery of Fe transport activity. Together, these results were consistent with the participation of a ferroxidase in high-affinity Fe uptake in C. reinhardtii. PMID:12481087

  12. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions. PMID:26384343

  13. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    PubMed Central

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  14. Multicopper manganese oxidase accessory proteins bind Cu and heme.

    PubMed

    Butterfield, Cristina N; Tao, Lizhi; Chacón, Kelly N; Spiro, Thomas G; Blackburn, Ninian J; Casey, William H; Britt, R David; Tebo, Bradley M

    2015-12-01

    Multicopper oxidases (MCOs) catalyze the oxidation of a diverse group of metal ions and organic substrates by successive single-electron transfers to O2 via four bound Cu ions. MnxG, which catalyzes MnO2 mineralization by oxidizing both Mn(II) and Mn(III), is unique among multicopper oxidases in that it carries out two energetically distinct electron transfers and is tightly bound to accessory proteins. There are two of these, MnxE and MnxF, both approximately 12kDa. Although their sequences are similar to those found in the genomes of several Mn-oxidizing Bacillus species, they are dissimilar to those of proteins with known function. Here, MnxE and MnxF are co-expressed independent of MnxG and are found to oligomerize into a higher order stoichiometry, likely a hexamer. They bind copper and heme, which have been characterized by electron paramagnetic resonance (EPR), X-ray absorption spectroscopy (XAS), and UV-visible (UV-vis) spectrophotometry. Cu is found in two distinct type 2 (T2) copper centers, one of which appears to be novel; heme is bound as a low-spin species, implying coordination by two axial ligands. MnxE and MnxF do not oxidize Mn in the absence of MnxG and are the first accessory proteins to be required by an MCO. This may indicate that Cu and heme play roles in electron transfer and/or Cu trafficking. PMID:26327317

  15. Functional studies of hephaestin in yeast: evidence for multicopper oxidase activity in the endocytic pathway.

    PubMed Central

    Li, Liangtao; Vulpe, Chris D; Kaplan, Jerry

    2003-01-01

    Hephaestin is a mammalian gene that encodes a predicted multicopper oxidase required for intestinal iron export. To examine if hephaestin can act as a ferroxidase, we studied yeast strains transformed with plasmids containing both a full-length hephaestin and a hephaestin lacking a transmembrane domain. Yeast with a deletion in FET3, which encodes a cell-surface multicopper oxidase, cannot grow on low-iron media. Expression of full-length hephaestin could complement the low-iron growth phenotype of a Delta fet3 strain. Complementation of Delta fet3 cells by hephaestin required genes that encode proteins necessary for the copper loading of Fet3p, including CCC2 and GEF1. Expression of hephaestin in Delta fet3 cells led to an increase in both iron transport and oxidase activity. These results demonstrate that hephaestin is a copper-dependent protein. In contrast with Fet3p, which is found on the cell surface, hephaestin was co-localized with Pep12p-containing vesicles. Inhibition of endocytosis or deletion of both the vacuolar iron transporters ( SMF3 and FET5 / FTH1 ) prevented hephaestin from complementing the low-iron growth phenotype of Delta fet3 cells, suggesting that hephaestin is functioning within the endocytic apparatus. PMID:12921533

  16. A Multicopper Oxidase Is Required for Copper Resistance in Mycobacterium tuberculosis

    PubMed Central

    Rowland, Jennifer L.

    2013-01-01

    Mycobacterium tuberculosis, the causative agent of tuberculosis, is one of the most important bacterial pathogens. Recent work has revealed that the natural bactericidal properties of copper are utilized by the host immune system to combat infections with bacteria, including M. tuberculosis. However, M. tuberculosis employs multiple mechanisms to reduce the internal copper amount by efflux and sequestration, which are required for virulence of M. tuberculosis. Here, we describe an alternative mechanism of copper resistance by M. tuberculosis. Deletion of the rv0846c gene increased the susceptibility of M. tuberculosis to copper at least 10-fold, establishing Rv0846c as a major component of copper resistance in M. tuberculosis. In vitro assays showed that Rv0846c oxidized organic substrates and Fe(II). Importantly, mutation of the predicted copper-coordinating cysteine 486 resulted in inactive Rv0846c protein which did not protect M. tuberculosis against copper stress. Hence, Rv0846c is a multicopper oxidase of M. tuberculosis and was renamed mycobacterial multicopper oxidase (MmcO). MmcO is membrane associated, probably by lipidation after export across the inner membrane by the twin-arginine translocation system. However, mutation of the lipidation site did not affect the oxidase activity or the copper protective function of MmcO. Our study revealed MmcO as an important copper resistance mechanism of M. tuberculosis, which possibly acts by oxidation of toxic Cu(I) in the periplasm. PMID:23772064

  17. A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

    PubMed

    Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

    2014-01-01

    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests. PMID:25330116

  18. Structural insights into the O2 reduction mechanism of multicopper oxidase.

    PubMed

    Komori, Hirofumi; Higuchi, Yoshiki

    2015-10-01

    Multicopper oxidases are ubiquitous enzymes that catalyse the oxidation of various substrates via the reduction of O2 to H2O. The enzymes contain a common active centre consisting of four copper ions. The key component for O2 reduction is the trinuclear copper centre comprising one type II and a pair of type III copper ions. Although the crystal structures of many multicopper oxidases have been determined by X-ray crystallography, the geometric parameters in the trinuclear copper centre are different for each study. Recent studies have revealed that the redox state of copper ions is altered by X-ray irradiation. The reported crystal structures may represent mixtures of different stages of the catalytic reactions. In this review, we discuss recent findings related to the structure of the active site in multicopper oxidases. PMID:26272825

  19. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.

    2015-01-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  20. A multicopper oxidase contributes to the copper tolerance of Brucella melitensis 16M.

    PubMed

    Wu, Tonglei; Wang, Shaohua; Wang, Zhen; Peng, Xiaowei; Lu, Yanli; Wu, Qingmin

    2015-06-01

    Copper is a potent antimicrobial agent. Multiple mechanisms of copper tolerance are utilized by some pathogenic bacteria. BMEII0580, which is significantly similar to the multicopper oxidase from Escherichia coli, was predicted to be the probable blue copper protein YacK precursor in Brucella melitensis 16M, and was designated as Brucella multicopper oxidase (BmcO). A bioinformatics analysis indicated that the typical motifs of multicopper oxidases are present in BmcO. BmcO, the expression of which was up-regulated by copper, could catalyze the oxidation of 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), dimethoxyphenol (DMP) and para-phenylenediamine (pPD), which are widely used as substrates for multicopper oxidase. Additionally, BmcO exhibited ferroxidase activity, which indicated that it might play an important role in the Fe(2+) uptake of B. melitensis. Importantly, the mutant strain 16MΔbmcO was more sensitive to copper than the wild-type strain B. melitensis 16M as well as its complementation strain 16MΔbmcO(bmcO). The infection assays of cells showed that similar bacterial numbers of B. melitensis 16M, 16MΔbmcO and 16MΔbmcO(bmcO) strains were recovered from the infected macrophages. This result indicated that BmcO was not essential for B. melitensis intracellular growth. In conclusion, our results confirm that BmcO is a multicopper oxidase and contributes to the copper tolerance of B. melitensis 16M. PMID:25956175

  1. A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity

    PubMed Central

    Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

    2003-01-01

    Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2′-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 μM. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088

  2. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    PubMed Central

    2012-01-01

    Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

  3. Evidence of a Multicopper Oxidase in Mn Oxidation by Gaeumannomyces graminis var. tritici.

    PubMed

    Thompson, Ian A; Huber, Don M; Schulze, Darrell G

    2006-02-01

    ABSTRACT Manganese (Mn) oxidation by the plant-pathogenic fungus Gaeumannomyces graminis var. tritici has been correlated with virulence in take-all disease. The mechanism of Mn oxidation has not, however, been investigated adequately. Research on bacteria and other fungi indicates that Mn oxidation is most often the result of the activity of multicopper oxidases. To determine if G. graminis var. tritici oxidizes Mn by similar means, the Mn oxidizing factor (MOF) produced by G. graminis var. tritici was characterized by cultural, spectrophotometric, and cellulose acetate electrophoresis methods. Based on our results, the MOF is an extracellular enzyme with an estimated molecular weight of 50 to 100 kDa. Electrophoresis and spectrophotometry indicate that the MOF is a multicopper oxidase with laccase activity. PMID:18943915

  4. Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub

    PubMed Central

    Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L

    2012-01-01

    Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

  5. Atmospheric N deposition increases bacterial laccase-like multicopper oxidases: implications for organic matter decay.

    PubMed

    Freedman, Zachary; Zak, Donald R

    2014-07-01

    Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize β-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

  6. Iodide Oxidation by a Novel Multicopper Oxidase from the Alphaproteobacterium Strain Q-1

    PubMed Central

    Suzuki, Mio; Eda, Yoshifumi; Ohsawa, Shiaki; Kanesaki, Yu; Yoshikawa, Hirofumi; Tanaka, Kan; Muramatsu, Yasuyuki; Yoshikawa, Jun; Sato, Ikuo; Fujii, Takaaki

    2012-01-01

    Alphaproteobacterium strain Q-1 is able to oxidize iodide (I−) to molecular iodine (I2) by an oxidase-like enzyme. One of the two isoforms of the iodide-oxidizing enzyme (IOE-II) produced by this strain was excised from a native polyacrylamide gel, eluted, and purified. IOE-II appeared as a single band (51 kDa) and showed significant in-gel iodide-oxidizing activity in sodium dodecyl sulfate-polyacrylamide gel electrophoresis without heat treatment. However, at least two bands with much higher molecular masses (150 and 230 kDa) were observed with heat treatment (95°C, 3 min). IOE-II was inhibited by NaN3, KCN, EDTA, and a copper chelator, o-phenanthroline. In addition to iodide, IOE-II showed significant activities toward phenolic compounds such as syringaldazine, 2,6-dimethoxy phenol, and p-phenylenediamine. IOE-II contained copper atoms as prosthetic groups and had UV/VIS absorption peaks at 320 and 590 nm. Comparison of several internal amino acid sequences obtained from trypsin-digested IOE-II with a draft genome sequence of strain Q-1 revealed that the products of two open reading frames (IoxA and IoxC), with predicted molecular masses of 62 and 71 kDa, are involved in iodide oxidation. Furthermore, subsequent tandem mass spectrometric analysis repeatedly detected peptides from IoxA and IoxC with high sequence coverage (32 to 40%). IoxA showed homology with the family of multicopper oxidases and included four copper-binding regions that are highly conserved among various multicopper oxidases. These results suggest that IOE-II is a multicopper oxidase and that it may occur as a multimeric complex in which at least two proteins (IoxA and IoxC) are associated. PMID:22447601

  7. Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra

    PubMed Central

    Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

    2013-01-01

    Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

  8. Catalytic Cycle of Multicopper Oxidases Studied by Combined Quantum- and Molecular-Mechanical Free-Energy Perturbation Methods.

    PubMed

    Li, Jilai; Farrokhnia, Maryam; Rulíšek, Lubomír; Ryde, Ulf

    2015-07-01

    We have used combined quantum mechanical and molecular mechanical free-energy perturbation methods in combination with explicit solvent simulations to study the reaction mechanism of the multicopper oxidases, in particular, the regeneration of the reduced state from the native intermediate. For 52 putative states of the trinuclear copper cluster, differing in the oxidation states of the copper ions and the protonation states of water- and O2-derived ligands, we have studied redox potentials, acidity constants, isomerization reactions, as well as water- and O2 binding reactions. Thereby, we can propose a full reaction mechanism of the multicopper oxidases with atomic detail. We also show that the two copper sites in the protein communicate so that redox potentials and acidity constants of one site are affected by up to 0.2 V or 3 pKa units by a change in the oxidation state of the other site. PMID:26039490

  9. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli

    PubMed Central

    Ihssen, Julian; Reiss, Renate; Luchsinger, Ronny; Thöny-Meyer, Linda; Richter, Michael

    2015-01-01

    Laccases are multi-copper oxidases that oxidize a broad range of substrates at the expense of molecular oxygen, without any need for co-factor regeneration. These enzymes bear high potential for the sustainable synthesis of fine chemicals and the modification of (bio)polymers. Here we describe cloning and expression of five novel bacterial laccase-like multi copper oxidases (LMCOs) of diverse origin which were identified by homology searches in online databases. Activity yields under different expression conditions and temperature stabilities were compared to three previously described enzymes from Bacillus subtilis, Bacillus pumilus and Bacillus clausii. In almost all cases, a switch to oxygen-limited growth conditions after induction increased volumetric activity considerably. For proteins with predicted signal peptides for secretion, recombinant expression with and without signal sequence was investigated. Bacillus CotA-type LMCOs outperformed enzymes from Streptomyces and Gram-negative bacteria with respect to activity yields in Escherichia coli and application relevant biochemical properties. The novel Bacillus coagulans LMCO combined high activity yields in E. coli with unprecedented activity at strong alkaline pH and high storage stability, making it a promising candidate for further development. PMID:26068013

  10. Multicopper oxidases: a workshop on copper coordination chemistry, electron transfer, and metallophysiology.

    PubMed

    Kosman, Daniel J

    2010-01-01

    Multicopper oxidases (MCOs) are unique among copper proteins in that they contain at least one each of the three types of biologic copper sites, type 1, type 2, and the binuclear type 3. MCOs are descended from the family of small blue copper proteins (cupredoxins) that likely arose as a complement to the heme-iron-based cytochromes involved in electron transport; this event corresponded to the aerobiosis of the biosphere that resulted in the conversion of Fe(II) to Fe(III) as the predominant redox state of this essential metal and the solubilization of copper from Cu(2)S to Cu(H(2)O)( n ) (2+). MCOs are encoded in genomes in all three kingdoms and play essential roles in the physiology of essentially all aerobes. With four redox-active copper centers, MCOs share with terminal copper-heme oxidases the ability to catalyze the four-electron reduction of O(2) to two molecules of water. The electron transfers associated with this reaction are both outer and inner sphere in nature and their mechanisms have been fairly well established. A subset of MCO proteins exhibit specificity for Fe(2+), Cu(+), and/or Mn(2+) as reducing substrates and have been designated as metallooxidases. These enzymes, in particular the ferroxidases found in all fungi and metazoans, play critical roles in the metal metabolism of the expressing organism. PMID:19816718

  11. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera.

    PubMed

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng

    2015-01-01

    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  12. Multireference Ab Initio Calculations of g tensors for Trinuclear Copper Clusters in Multicopper Oxidases

    PubMed Central

    Vancoillie, Steven; Chalupský, Jakub; Ryde, Ulf; Solomon, Edward I.; Pierloot, Kristine; Neese, Frank; Rulíšek, Lubomír

    2010-01-01

    EPR spectroscopy has proven to be an indispensable tool in elucidating the structure of metal sites in proteins. In recent years, experimental EPR data have been complemented by theoretical calculations, which have become a standard tool of many quantum chemical packages. However, there have only been a few attempts to calculate EPR g tensors for exchange-coupled systems with more than two spins. In this work, we present a quantum chemical study of structural, electronic, and magnetic properties of intermediates in the reaction cycle of multicopper oxidases and of their inorganic models. All these systems contain three copper(II) ions bridged by hydroxide or O2− anions and their ground states are antiferromagnetically coupled doublets. We demonstrate that only multireference methods, such as CASSCF/CASPT2 or MRCI can yield qualitatively correct results (compared to the experimental values) and consider the accuracy of the calculated EPR g tensors as the current benchmark of quantum chemical methods. By decomposing the calculated g tensors into terms arising from interactions of the ground state with the various excited states, the origin of the zero-field splitting is explained. The results of the study demonstrate that a truly quantitative prediction of the g tensors of exchange-coupled systems is a great challenge to contemporary theory. The predictions strongly depend on small energy differences that are difficult to predict with sufficient accuracy by any quantum chemical method that is applicable to systems of the size of our target systems. PMID:20469875

  13. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera

    PubMed Central

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng

    2015-01-01

    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  14. Magnetic Ganoderma lucidum spore microspheres: A novel material to immobilize CotA multicopper oxidase for dye decolorization.

    PubMed

    Fan, Lili; Wang, Yan; Zhao, Min; Song, Jinzhu; Wang, Jueyu; Jin, Zijing

    2016-08-01

    In this study, hollow microspheres were obtained from Ganoderma lucidum spores. Then the hollow microspheres were loaded with Fe3O4 nanoparticles to prepare novel magnetic spore microspheres. TEM images and X-ray diffractometry demonstrated that the Fe3O4 nanoparticles were incorporated throughout the spore microsphere. CotA multicopper oxidase was chosen as biomacromolecule to study the loading ability of the magnetic spore microspheres. The combination of the CotA enzyme with the microsphere was observed by laser scanning confocal microscope. The loaded amount of CotA on the microspheres was 75mg/g when the CotA concentration was 1.2mg/mL and the activity recovery of the immobilized CotA was 81%. The magnetic microspheres loaded with CotA, which can be easily and quickly recovered by an external magnetic field, were used for dye decolorization. After 1h decolorization, 99% of the indigo carmine has been removed by 10mg microspheres. In addition, the immobilized CotA retained 75% of activity after 10 consecutive cycles, which indicated that the magnetic spore microspheres are good support material for immobilization of the enzyme. PMID:27058768

  15. Effect of enzymatic orientation through the use of syringaldazine molecules on multiple multi-copper oxidase enzymes.

    PubMed

    Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen

    2014-07-14

    The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions. PMID:24875125

  16. Mn(II) Binding and Subsequent Oxidation by the Multicopper Oxidase MnxG Investigated by Electron Paramagnetic Resonance Spectroscopy.

    PubMed

    Tao, Lizhi; Stich, Troy A; Butterfield, Cristina N; Romano, Christine A; Spiro, Thomas G; Tebo, Bradley M; Casey, William H; Britt, R David

    2015-08-26

    The dynamics of manganese solid formation (as MnOx) by the multicopper oxidase (MCO)-containing Mnx protein complex were examined by electron paramagnetic resonance (EPR) spectroscopy. Continuous-wave (CW) EPR spectra of samples of Mnx, prepared in atmosphere and then reacted with Mn(II) for times ranging from 7 to 600 s, indicate rapid oxidation of the substrate manganese (with two-phase pseudo-first-order kinetics modeled using rate coefficients of: k(1obs) = 0.205 0.001 s(-1) and k(2obs) = 0.019 0.001 s(-1)). This process occurs on approximately the same time scale as in vitro solid MnOx formation when there is a large excess of Mn(II). We also found CW and pulse EPR spectroscopic evidence for at least three classes of Mn(II)-containing species in the reaction mixtures: (i) aqueous Mn(II), (ii) a specifically bound mononuclear Mn(II) ion coordinated to the Mnx complex by one nitrogenous ligand, and (iii) a weakly exchange-coupled dimeric Mn(II) species. These findings provide new insights into the molecular mechanism of manganese mineralization. PMID:26244911

  17. Mechanism of the reduction of the native intermediate in the multicopper oxidases: insights into rapid intramolecular electron transfer in turnover.

    PubMed

    Heppner, David E; Kjaergaard, Christian H; Solomon, Edward I

    2014-12-24

    The multicopper oxidases (MCOs) are the family of enzymes that catalyze the 4-electron reduction of O2 to H2O coupled to the four 1-electron oxidations of substrate. In the catalytic cycle electrons are transferred intramolecularly over ∼13 Å from a Type 1 (T1) Cu site that accepts electrons from substrate to a trinuclear Cu cluster (TNC) where O2 is reduced to H2O at rapid rates consistent with turnover (560 s(-1)). The oxygen reduction mechanism for the MCOs is well-characterized, whereas the rereduction is less understood. Our initial study of Rhus vernicifera Laccase (Heppner et al. J. Am. Chem. Soc. 2013, 135, 12212) experimentally established that the native intermediate (NI), the species formed upon O-O bond cleavage, is reduced with an IET rate >700 s(-1) and is the catalytically relevant fully oxidized form of the enzyme, rather than the resting state. In this report, we present kinetic and spectroscopic results coupled to DFT calculations that evaluate the mechanism of the 3 e(-)/3 H(+) reduction of NI, where all three catalytically relevant intramolecular electron transfer (IET) steps are rapid and involve three different structural changes. These three rapid IET processes reflect the sophisticated mechanistic control of the TNC to enable rapid turnover. All three IET processes are fast due to the associated protonation of the bridging oxo and hydroxo ligands, generated by O-O cleavage, to form water products that are extruded from the TNC upon full reduction, thereby defining a unifying mechanism for oxygen reduction and rapid IET by the TNC in the catalytic cycle of the MCOs. PMID:25490729

  18. Molecular dynamics of a thermostable multicopper oxidase from Thermus thermophilus HB27: structural differences between the apo and holo forms.

    PubMed

    Bello, Martiniano; Valderrama, Brenda; Serrano-Posada, Hugo; Rudiño-Piñera, Enrique

    2012-01-01

    Molecular dynamic (MD) simulations have been performed on Tth-MCO, a hyperthermophilic multicopper oxidase from thermus thermophilus HB27, in the apo as well as the holo form, with the aim of exploring the structural dynamic properties common to the two conformational states. According to structural comparison between this enzyme and other MCOs, the substrate in process to electron transfer in an outer-sphere event seems to transiently occupy a shallow and overall hydrophobic cavity near the Cu type 1 (T1Cu). The linker connecting the β-strands 21 and 24 of the second domain (loop (β21-β24)(D2)) has the same conformation in both states, forming a flexible lid at the entrance of the electron-transfer cavity. Loop (β21-β24)(D2) has been tentatively assigned a role occluding the access to the electron-transfer site. The dynamic of the loop (β21-β24)(D2) has been investigated by MD simulation, and results show that the structures of both species have the same secondary and tertiary structure during almost all the MD simulations. In the simulation, loop (β21-β24)(D2) of the holo form undergoes a higher mobility than in the apo form. In fact, loop (β21-β24)(D2) of the holo form experiences a conformational change which enables exposure to the electron-transfer site (open conformation), while in the apo form the opposite effect takes place (closed conformation). To confirm the hypothesis that the open conformation might facilitate the transient electron-donor molecule occupation of the site, the simulation was extended another 40 ns with the electron-donor molecule docked into the protein cavity. Upon electron-donor molecule stabilization, loops near the cavity reduce their mobility. These findings show that coordination between the copper and the protein might play an important role in the general mobility of the enzyme, and that the open conformation seems to be required for the electron transfer process to T1Cu. PMID:22808237

  19. Molecular Dynamics of a Thermostable Multicopper Oxidase from Thermus thermophilus HB27: Structural Differences between the Apo and Holo Forms

    PubMed Central

    Bello, Martiniano; Valderrama, Brenda; Serrano-Posada, Hugo; Rudiño-Piñera, Enrique

    2012-01-01

    Molecular dynamic (MD) simulations have been performed on Tth-MCO, a hyperthermophilic multicopper oxidase from thermus thermophilus HB27, in the apo as well as the holo form, with the aim of exploring the structural dynamic properties common to the two conformational states. According to structural comparison between this enzyme and other MCOs, the substrate in process to electron transfer in an outer-sphere event seems to transiently occupy a shallow and overall hydrophobic cavity near the Cu type 1 (T1Cu). The linker connecting the β-strands 21 and 24 of the second domain (loop (β21–β24)D2) has the same conformation in both states, forming a flexible lid at the entrance of the electron-transfer cavity. Loop (β21–β24)D2 has been tentatively assigned a role occluding the access to the electron-transfer site. The dynamic of the loop (β21–β24)D2 has been investigated by MD simulation, and results show that the structures of both species have the same secondary and tertiary structure during almost all the MD simulations. In the simulation, loop (β21–β24)D2 of the holo form undergoes a higher mobility than in the apo form. In fact, loop (β21–β24)D2 of the holo form experiences a conformational change which enables exposure to the electron-transfer site (open conformation), while in the apo form the opposite effect takes place (closed conformation). To confirm the hypothesis that the open conformation might facilitate the transient electron-donor molecule occupation of the site, the simulation was extended another 40 ns with the electron-donor molecule docked into the protein cavity. Upon electron-donor molecule stabilization, loops near the cavity reduce their mobility. These findings show that coordination between the copper and the protein might play an important role in the general mobility of the enzyme, and that the open conformation seems to be required for the electron transfer process to T1Cu. PMID:22808237

  20. Targeted suppression of the ferroxidase and iron trafficking activities of the multicopper oxidase Fet3p from Saccharomyces cerevisiae.

    PubMed

    Wang, Tzu-Pin; Quintanar, Liliana; Severance, Scott; Solomon, Edward I; Kosman, Daniel J

    2003-07-01

    The Fet3 protein in Saccharomyces cerevisiae is a multicopper oxidase tethered to the outer surface of the yeast plasma membrane. Fet3p catalyzes the oxidation of Fe(2+) to Fe(3+); this ferroxidation reaction is an obligatory first step in high-affinity iron uptake through the permease Ftr1p. Here, kinetic analyses of several Fet3p mutants identify residues that contribute to the specificity that Fet3p has for Fe(2+), one of which is essential also to the coupling of the ferroxidase and uptake processes. The spectral and kinetic properties of the D278A, E185D and A, Y354F and A, and E185A/Y354A mutants of a soluble form of Fet3p showed that all of the mutants exhibited the normal absorbance at 330 nm and 608 nm due to the type 3 and type 1 copper sites in Fet3p, respectively. The EPR spectra of the mutants were also equivalent to wild-type, showing that the type 1 and type 2 Cu(II) sites in the proteins were not perturbed. The only marked kinetic defects measured in vitro were increases in K(M) for Fe(2+) exhibited by the D278A, E185A, Y354A, and E185A/Y354A mutants. These results suggest that these three residues contribute to the ferroxidase specificity site in Fet3p. In vivo analysis of these mutant proteins in their membrane-bound form showed that only E185 mutants exhibited kinetic defects in (59)Fe uptake. For the Fet3p(E185D) mutant, K(M) for iron was 300-fold greater than the wild-type K(M), while Fet3p(E185A) was completely inactive in support of iron uptake. In situ fluorescence demonstrated that all of the mutant Fet3 proteins, in complex with an Ftr1p:YFP fusion protein, were trafficked normally to the plasma membrane. These results suggest that E185 contributes to Fe(2+ )binding to Fet3p and to the subsequent trafficking of the Fe(3+) produced to Ftr1p. PMID:12684851

  1. Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta

    PubMed Central

    Dittmer, Neal T.; Gorman, Maureen J.; Kanost, Michael R.

    2009-01-01

    Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect’s cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-β-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with Km values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent kcat values were 100 min−1, 80 min−1, and 290 min−1. The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with Km values of 1.9 mM and 0.47 mM, respectively, and apparent kcat values of 200 min−1 and 180 min−1. These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

  2. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals

    PubMed Central

    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin

    2015-01-01

    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV). PMID:26039669

  3. Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase

    PubMed Central

    De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

    2012-01-01

    X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UVVis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations ofthe metal centres, were observed at both acidic pH and highabsorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

  4. Crystal Structures of Multicopper Oxidase CueO Bound to Copper(I) and Silver(I): Functional Role of a Methonine-Rich Sequence

    SciTech Connect

    Singh, Satish K.; Roberts, Sue A.; McDevitt, Sylvia F.; Weichsel, Andrzej; Wildner, Guenter F.; Grass, Gregor B.; Rensing, Christopher; Montfort, William R.

    2011-10-24

    The multicopper oxidase CueO oxidizes toxic Cu(I) and is required for copper homeostasis in Escherichia coli. Like many proteins involved in copper homeostasis, CueO has a methionine-rich segment that is thought to be critical for copper handling. How such segments function is poorly understood. Here, we report the crystal structure of CueO at 1.1 {angstrom} with the 45-residue methionine-rich segment fully resolved, revealing an N-terminal helical segment with methionine residues juxtaposed for Cu(I) ligation and a C-terminal highly mobile segment rich in methionine and histidine residues. We also report structures of CueO with a C500S mutation, which leads to loss of the T1 copper, and CueO with six methionines changed to serine. Soaking C500S CueO crystals with Cu(I), or wild-type CueO crystals with Ag(I), leads to occupancy of three sites, the previously identified substrate-binding site and two new sites along the methionine-rich helix, involving methionines 358, 362, 368, and 376. Mutation of these residues leads to a {approx}4-fold reduction in kcat for Cu(I) oxidation. Ag(I), which often appears with copper in nature, strongly inhibits CueO oxidase activities in vitro and compromises copper tolerance in vivo, particularly in the absence of the complementary copper efflux cus system. Together, these studies demonstrate a role for the methionine-rich insert of CueO in the binding and oxidation of Cu(I) and highlight the interplay among cue and cus systems in copper and silver homeostasis.

  5. Direct electron-transfer conduits constructed at the interface between multicopper oxidase and nanocrystalline semiconductive Fe oxides

    NASA Astrophysics Data System (ADS)

    Nakamura, Ryuhei; Kamiya, Kazuhide; Hashimoto, Kazuhito

    2010-10-01

    Herein, the electron-transfer reactions occurring at the interface between bilirubin oxidase (BOD) and nanocrystalline hematite (α-Fe 2O 3) were characterized. Cyclic voltammograms indicated that BOD has an affinity for hematite surfaces and establishes a direct electron-transfer (DET) conduit between the primary electron acceptor T1 site and the conduction band of α-Fe 2O 3. DET was also confirmed photo-electrochemically, as cathodic photocurrents were generated when a nanocomposite of BOD and α-Fe 2O 3 was illuminated under oxygenated conditions. A proline residue displayed a high-binding affinity for hematite surfaces and is therefore likely part of an orientation-controlled motif which serves to locate BOD at the T1 site at a suitable distance for DET to α-Fe 2O 3.

  6. Systematic Perturbation of the Trinuclear Copper Cluster in the Multicopper Oxidases: The Role of Active Site Asymmetry in its Reduction of O2 to H2O

    PubMed Central

    Augustine, Anthony J.; Kjaergaard, Christian; Qayyum, Munzarin; Ziegler, Lynn; Kosman, Daniel J.; Hodgson, Keith O.; Hedman, Britt; Solomon, Edward I.

    2010-01-01

    The multicopper oxidase Fet3p catalyzes the four-electron reduction of dioxygen to water, coupled to the one-electron oxidation of four equivalents of substrate. To carry out this process the enzyme utilizes four Cu atoms: a type 1, a type 2, and a coupled binuclear, type 3 site. Substrates are oxidized at the T1 Cu, which rapidly transfers electrons, 13 Å away, to a trinuclear copper cluster composed of the T2 and T3 sites where dioxygen is reduced to water in two sequential 2e− steps. This study focuses on two variants of Fet3p, H126Q and H483Q, that perturb the two T3 Cu's, T3α and T3β, respectively. The variants have been isolated in both holo and type 1 depleted (T1D) forms, T1DT3αQ and T1DT3βQ, and their trinuclear copper clusters have been characterized in their oxidized and reduced states. While the variants are only mildly perturbed relative to T1D in the resting oxidized state, in contrast to T1D they are both found to have lost a ligand in their reduced states. Importantly, T1DT3αQ reacts with O2 but T1DT3βQ does not. Thus loss of a ligand at T3β, but not at T3α, turns off O2 reactivity, indicating that T3β and T2 are required for the 2e− reduction of O2 to form the peroxide intermediate (PI), whereas T3α remains reduced. This is supported by the spectroscopic features of PI in T1DT3αQ, which are identical to T1D PI. This selective redox activity of one edge of the trinuclear cluster demonstrates its asymmetry in O2 reactivity. The structural origin of this asymmetry between the T3α and T3β is discussed as is its contribution to reactivity. PMID:20377263

  7. ALTERNATIVE OXIDASE: From Gene to Function.

    PubMed

    Vanlerberghe, Greg C.; McIntosh, Lee

    1997-06-01

    Plants, some fungi, and protists contain a cyanide-resistant, alternative mitochondrial respiratory pathway. This pathway branches at the ubiquinone pool and consists of an alternative oxidase encoded by the nuclear gene Aox1. Alternative pathway respiration is only linked to proton translocation at Complex 1 (NADH dehydrogenase). Alternative oxidase expression is influenced by stress stimuli-cold, oxidative stress, pathogen attack-and by factors constricting electron flow through the cytochrome pathway of respiration. Control is exerted at the levels of gene expression and in response to the availability of carbon and reducing potential. Posttranslational control involves reversible covalent modification of the alternative oxidase and activation by specific carbon metabolites. This dynamic system of coarse and fine control may function to balance upstream respiratory carbon metabolism and downstream electron transport when these coupled processes become imbalanced as a result of changes in the supply of, or demand for, carbon, reducing power, and ATP. PMID:15012279

  8. Spectroscopic Studies of Perturbed T1 Cu Sites in the Multicopper Oxidases Saccharomyces Cerevisiae Fet3p And Rhus Vernicifera Laccase: Allosteric Coupling Between the T1 And Trinuclear Cu Sites

    SciTech Connect

    Augustine, A.J.; Kragh, M.E.; Sarangi, R.; Fujii, S.; Liboiron, B.D.; Stoj, C.S.; Kosman, D.J.; Hodgson, K.O.; Hedman, B.; Solomon, E.I.; /Stanford U., Chem. Dept. /Copenhagen U. /SLAC, SSRL /SUNY, Buffalo

    2009-04-30

    The multicopper oxidases catalyze the 4e{sup -} reduction of O{sub 2} to H{sub 2}O coupled to the 1e{sup -} oxidation of 4 equiv of substrate. This activity requires four Cu atoms, including T1, T2, and coupled binuclear T3 sites. The T2 and T3 sites form a trinuclear cluster (TNC) where O{sub 2} is reduced. The T1 is coupled to the TNC through a T1-Cys-His-T3 electron transfer (ET) pathway. In this study the two T3 Cu coordinating His residues which lie in this pathway in Fet3 have been mutated, H483Q, H483C, H485Q, and H485C, to study how perturbation at the TNC impacts the T1 Cu site. Spectroscopic methods, in particular resonance Raman (rR), show that the change from His to Gln to Cys increases the covalency of the T1 Cu?S Cys bond and decreases its redox potential. This study of T1?TNC interactions is then extended to Rhus vernicifera laccase where a number of well-defined species including the catalytically relevant native intermediate (NI) can be trapped for spectroscopic study. The T1 Cu?S covalency and potential do not change in these species relative to resting oxidized enzyme, but interestingly the differences in the structure of the TNC in these species do lead to changes in the T1 Cu rR spectrum. This helps to confirm that vibrations in the cysteine side chain of the T1 Cu site and the protein backbone couple to the Cu?S vibration. These changes in the side chain and backbone provide a possible mechanism for regulating intramolecular T1 to TNC ET in NI and partially reduced enzyme forms for efficient turnover.

  9. [Cloning and sequencing of ACC oxidase gene from sugarcane].

    PubMed

    Wang, Zi-Zhang; Li, Yang-Rui; Zhang, Shu-Zhen; Lin, Jun-Fang; Guo, Li-Qiong

    2003-01-01

    The plant hormone ethylene is not only responsible for the initiation of fruit ripening, senescence and dormancy but also for regulating many other plant developmental processes, such as seed germination, root initiation, growth, floral differentiation, sex differentiation and responding to environment stresses. One of the rate-limiting steps for ethylene biosynthesizing in plant is catalyzed by 1-aminocyclopropane-1-carboxylate (ACC) oxidase. Understanding of ethylene expressive pattern in plant is an entrance to understand the roles of ethylene on plant. In this paper, two degenerate oligonucleotide primers were designed, coding for two conservative amino acid regions in ACC oxidase protein family, the sequences of the two primers were TAGAGCTCGATGC[TA]TG [CT]GA[GA]AA[AC]TGGGG and CGTCTAGAGCTTC[GA]AATCTTGGCTCCTT respectively. A PCR amplification was performed on sugarcane (Saccharum L. Hybrid cv. ROC16) DNA template, and produced a fragment of 940 bp. By using the program of BLAST on NCBI GenBank database, the sequence presented a very high match with the ACC oxidase genes from other plants, 63 searched out sequences were all ACC oxidase genes. After alignment on PCgene program, the identities of the cloned fragment with ACC oxidase genes from rice and bamboo were both reaching about 88%. So we can concluded that the cloned sequence was a member of ACC oxidase genes fragment from sugarcane. The sequence has been submitted to the GenBank database, the accession number is AF442821. According to the ACC oxidase protein family, a 'intron' of 103 bp was excluded and the sequence coded 279 amino acids, which spanned 88% of the putative whole sequence in length. Alignment and phylogenetic analysis of the amino acid sequence deduced from this fragment and the ACC oxidase sequences of other plants retrieved from GenBank were carried out by using PCgene program. The putative amino acid sequence shared a homology of 86% with the ACC oxidases of bamboo and rice, 74.6% with banana, 70% with tomato and potato and 68% with melon and carnation, which showed that the homology of sugarcane ACC oxidase with monocot was higher than with dicot. The results of phylogenetic analysis showed that ACC oxidase from sugarcane and ACC oxidases from rice clustered together firstly, and then came those from banana, ACC oxidases of dicot from potato, tomato, petunia, melon, Arabidopsis thaliana and carnation came subsequently. It indicated that sugarcane ACC oxidase had a closer phylogenetic affinities to the monocot ACC oxidase sequences than to the dicot ACC oxidases sequences. The clustering results of ACC oxidase molecules accorded with morphological classification system. PMID:12812078

  10. Identification of Zyklopen, a New Member of the Vertebrate Multicopper Ferroxidase Family, and Characterization in Rodents and Human Cells123

    PubMed Central

    Chen, Huijun; Attieh, Zouhair K.; Syed, Basharut A.; Kuo, Yien‐Ming; Stevens, Valerie; Fuqua, Brie K.; Andersen, Henriette S.; Naylor, Claire E.; Evans, Robert W.; Gambling, Lorraine; Danzeisen, Ruth; Bacouri‐Haidar, Mhenia; Usta, Julnar; Vulpe, Chris D.; McArdle, Harry J.

    2010-01-01

    We previously detected a membrane-bound, copper-containing oxidase that may be involved in iron efflux in BeWo cells, a human placental cell line. We have now identified a gene encoding a predicted multicopper ferroxidase (MCF) with a putative C-terminal membrane-spanning sequence and high sequence identity to hephaestin (Heph) and ceruloplasmin (Cp), the other known vertebrate MCF. Molecular modeling revealed conservation of all type I, II, and III copper-binding sites as well as a putative iron-binding site. Protein expression was observed in multiple diverse mouse tissues, including placenta and mammary gland, and the expression pattern was distinct from that of Cp and Heph. The protein possessed ferroxidase activity, and protein levels decreased in cellular copper deficiency. Knockdown with small interfering RNA in BeWo cells indicates that this gene represents the previously detected oxidase. We propose calling this new member of the MCF family “zyklopen.” PMID:20685892

  11. Identification of zyklopen, a new member of the vertebrate multicopper ferroxidase family, and characterization in rodents and human cells.

    PubMed

    Chen, Huijun; Attieh, Zouhair K; Syed, Basharut A; Kuo, Yien-Ming; Stevens, Valerie; Fuqua, Brie K; Andersen, Henriette S; Naylor, Claire E; Evans, Robert W; Gambling, Lorraine; Danzeisen, Ruth; Bacouri-Haidar, Mhenia; Usta, Julnar; Vulpe, Chris D; McArdle, Harry J

    2010-10-01

    We previously detected a membrane-bound, copper-containing oxidase that may be involved in iron efflux in BeWo cells, a human placental cell line. We have now identified a gene encoding a predicted multicopper ferroxidase (MCF) with a putative C-terminal membrane-spanning sequence and high sequence identity to hephaestin (Heph) and ceruloplasmin (Cp), the other known vertebrate MCF. Molecular modeling revealed conservation of all type I, II, and III copper-binding sites as well as a putative iron-binding site. Protein expression was observed in multiple diverse mouse tissues, including placenta and mammary gland, and the expression pattern was distinct from that of Cp and Heph. The protein possessed ferroxidase activity, and protein levels decreased in cellular copper deficiency. Knockdown with small interfering RNA in BeWo cells indicates that this gene represents the previously detected oxidase. We propose calling this new member of the MCF family "zyklopen." PMID:20685892

  12. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  13. Four novel mutations of the coproporphyrinogen III oxidase gene.

    PubMed

    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

    2009-01-01

    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  14. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  15. Molecular evolution of the polyamine oxidase gene family in Metazoa

    PubMed Central

    2012-01-01

    Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS) mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO) and orthologous genes related by speciation events (PAOs, SMOs/APAOs). Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies. PMID:22716069

  16. Identification of new galactose oxidase genes in Fusarium spp.

    PubMed

    Aparecido Cordeiro, Fabio; Bertechini Faria, Carla; Parra Barbosa-Tessmann, Ione

    2010-12-01

    Galactose oxidase (GO) converts galactose to an aldehyde and has several biotechnological applications, including cancer diagnosis. It is mainly produced by Fusarium austroamericanum but is also produced by Fusarium acuminatum and by isolates of the Fusarium graminearum and Gibberella fujikuroi complexes. The F. austroamericanum GO gaoA gene has been cloned, but the GO genes from other secreting species have not been characterized. Problems associated with the F. austroamericanum GO such as high pI and low catalytic efficiency and thermostability, and the difficult purification process makes the search for homologous genes attractive. In this work, the GO genes from Fusarium verticillioides and Fusarium subglutinans, two species of the G. fujikuroi complex, were cloned, sequenced, and analyzed. New GO genes were found in databases and were used to construct a phylogenetic tree, which revealed the existence of three orthologous lineages of GO genes in Fusarium spp. In addition, RT-PCR analyses revealed that the new GO cloned gene may be endogenously expressed in F. subglutinans but not in F. verticillioides, in the used culture conditions. PMID:21077113

  17. Expression of the Aspergillus niger glucose oxidase gene in Penicillium nalgiovense.

    PubMed

    Geisen, R

    1995-05-01

    The glucose oxidase gene (god) from Aspergillus niger was expressed in Penicillium nalgiovense under control of the latter's homologous transcription signals. The GOD protein was synthesized in an active form, leading to increased glucose oxidase activity. The expression vector was introduced into P. nalgiovense along with a selectable plasmid carrying the dominant amdS marker gene of A. nidulans. PMID:24414658

  18. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation.

    PubMed

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D P

    2009-02-17

    Monoamine oxidase A gene (MAOA) has earned the nickname "warrior gene" because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as "altruistic" punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  19. The pea gene LH encodes ent-kaurene oxidase.

    PubMed

    Davidson, Sandra E; Smith, Jennifer J; Helliwell, Chris A; Poole, Andrew T; Reid, James B

    2004-03-01

    The pea (Pisum sativum) homolog, PsKO1, of the Arabidopsis GA3 gene was isolated. It codes for a cytochrome P450 from the CYP701A subfamily and has ent-kaurene oxidase (KO) activity, catalyzing the three step oxidation of ent-kaurene to ent-kaurenoic acid in the gibberellin (GA) biosynthetic pathway when expressed in yeast (Saccharomyces cerevisiae). PsKO1 is encoded by the LH gene because in three independent mutant alleles, lh-1, lh-2, and lh-3, PsKO1 has altered sequence, and the lh-1 allele, when expressed in yeast, failed to metabolize ent-kaurene. The lh mutants of pea are GA deficient and have reduced internode elongation and root growth. One mutant (lh-2) also causes a large increase in seed abortion. PsKO1 (LH) is expressed in all tissues examined, including stems, roots, and seeds, and appears to be a single-copy gene. Differences in sensitivity to the GA synthesis inhibitor, paclobutrazol, between the mutants appear to result from the distinct nature of the genetic lesions. These differences may also explain the tissue-specific differences between the mutants. PMID:14988475

  20. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation

    PubMed Central

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D. P.

    2009-01-01

    Monoamine oxidase A gene (MAOA) has earned the nickname “warrior gene” because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as “altruistic” punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  1. The pea gene NA encodes ent-kaurenoic acid oxidase.

    PubMed

    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B

    2003-01-01

    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants. PMID:12529541

  2. Two peanut germin-like genes and the potential superoxidase dismutase and oxalate oxidase activities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Germins and germin-like proteins (GLPs) genes are members of large multigene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity leadin...

  3. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

  4. Pistil-Specific and Ethylene-Regulated Expression of 1-Aminocyclopropane-1-Carboxylate Oxidase Genes in Petunia Flowers.

    PubMed Central

    Tang, X.; Gomes, AMTR.; Bhatia, A.; Woodson, W. R.

    1994-01-01

    The differential expression of the petunia 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene family during flower development and senescence was investigated. ACC oxidase catalyzes the conversion of ACC to ethylene. The increase in ethylene production by petunia corollas during senescence was preceded by increased ACC oxidase mRNA and enzyme activity. Treatment of flowers with ethylene led to an increase in ethylene production, ACC oxidase mRNA, and ACC oxidase activity in corollas. In contrast, leaves did not exhibit increased ethylene production or ACC oxidase expression in response to ethylene. Gene-specific probes revealed that the ACO1 gene was expressed specifically in senescing corollas and in other floral organs following exposure to ethylene. The ACO3 and ACO4 genes were specifically expressed in developing pistil tissue. In situ hybridization experiments revealed that ACC oxidase mRNAs were specifically localized to the secretory cells of the stigma and the connective tissue of the receptacle, including the nectaries. Treatment of flower buds with ethylene led to patterns of ACC oxidase gene expression spatially distinct from the patterns observed during development. The timing and tissue specificity of ACC oxidase expression during pistil development were paralleled by physiological processes associated with reproduction, including nectar secretion, accumulation of stigmatic exudate, and development of the self-incompatible response. PMID:12244270

  5. Phylogenetic Analysis of Six-Domain Multi-Copper Blue Proteins

    PubMed Central

    Vasin, Andrey; Klotchenko, Sergey; Puchkova, Ludmila

    2013-01-01

    Multicopper blue proteins, composed of several repetitive copper-binding domains similar to one-domain cupredoxin-like proteins, were found in almost all organisms. They are classified into the three different groups, based on their two-, three- or six-domain organization. We found orthologs of chordate six-domain copper-binding proteins in animals, plants, bacteria and archea. The phylogenetic analysis of 183 multicopper blue proteins and their copper-binding sites comparison make us think that all the modern six-domain blue proteins have originated from the common ancestral six-domain protein in the process of gene duplication and copper-binding sites loss as a result of amino acid substitutions. PMID:23516668

  6. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel

    1983-01-01

    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  7. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  8. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  9. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  10. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  11. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  12. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities.

    PubMed

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-06-15

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1-4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Po(lpo)) and aldehyde oxidase-1 (Aldox-1(n1)) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Po(lpo)-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Po(lpo) allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1(n1) phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  13. Submergence enhances expression of a gene encoding 1-aminocyclopropane-1-carboxylate oxidase in deepwater rice.

    PubMed

    Mekhedov, S I; Kende, H

    1996-06-01

    Partial submergence greatly stimulates internodal growth in deep water rice (Oryza sativa L.). Previous work has shown that the effect of submergence is, at least in part, mediated by ethylene, which accumulates in the air spaces of submerged internodes. To investigate the expression of the genes encoding ethylene biosynthetic enzymes during accelerated growth of deep water rice, we cloned a 1-aminocyclopropane-1-carboxylate (ACC) oxidase cDNA (OS-ACO1) from internodes of submerged plants and measured the activity of the enzyme in tissue extracts with an improved assay. We found an increase in ACC oxidase mRNA levels and enzyme activity after 4 to 24 h of submergence. Thus, it is likely that ethylene biosynthesis in internodes of deep water rice is controlled, at least in part, at the level of ACC oxidase. PMID:8759917

  14. Characterization of two peanut oxalate oxidase genes and development of peanut cultivars resistant to stem rot (Sclerotium rolfsii)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

  15. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  16. In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes

    PubMed Central

    Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.

    2014-01-01

    NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

  17. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  18. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-01-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  19. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.

    PubMed

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-12-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  20. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  1. Identification and analysis of the Shewanella oneidensis major oxygen-independent coproporphyrinogen III oxidase gene.

    PubMed

    Al-Sheboul, Suhaila; Saffarini, Daad

    2011-12-01

    Shewanella oneidenesis MR-1 is a facultative anaerobe that can use a large number of electron acceptors including metal oxides. During anaerobic respiration, S. oneidensis MR-1 synthesizes a large number of c cytochromes that give the organism its characteristic orange color. Using a modified mariner transposon, a number of S. oneidensis mutants deficient in anaerobic respiration were generated. One mutant, BG163, exhibited reduced pigmentation and was deficient in c cytochromes normally synthesized under anaerobic condition. The deficiencies in BG163 were due to insertional inactivation of hemN1, which exhibits a high degree of similarity to genes encoding anaerobic coproporphyrinogen III oxidases that are involved in heme biosynthesis. The ability of BG163 to synthesize c cytochromes under anaerobic conditions, and to grow anaerobically with different electron acceptors was restored by the introduction of hemN1 on a plasmid. Complementation of the mutant was also achieved by the addition of hemin to the growth medium. The genome sequence of S. oneidensis contains three putative anaerobic coproporphyrinogen III oxidase genes. The protein encoded by hemN1 appears to be the major enzyme that is involved in anaerobic heme synthesis of S. oneidensis. The other two putative anaerobic coproporphyrinogen III oxidase genes may play a minor role in this process. PMID:21726654

  2. Expression and signal regulation of the alternative oxidase genes under abiotic stresses.

    PubMed

    Feng, Hanqing; Guan, Dongdong; Sun, Kun; Wang, Yifeng; Zhang, Tengguo; Wang, Rongfang

    2013-12-01

    Plants in their natural environment frequently face various abiotic stresses, such as drought, high salinity, and chilling. Plant mitochondria contain an alternative oxidase (AOX), which is encoded by a small family of nuclear genes. AOX genes have been shown to be highly responsive to abiotic stresses. Using transgenic plants with varying levels of AOX expression, it has been confirmed that AOX genes are important for abiotic stress tolerance. Although the roles of AOX under abiotic stresses have been extensively studied and there are several excellent reviews on this topic, the differential expression patterns of the AOX gene family members and the signal regulation of AOX gene(s) under abiotic stresses have not been extensively summarized. Here, we review and discuss the current progress of these two important issues. PMID:24004533

  3. Molecular cloning and characterization of a novel 1-aminocyclopropane-1-carboxylate oxidase gene involved in ripening of banana fruits.

    PubMed

    Do, Yi-Yin; Thay, Te-Shih; Chang, Tang-Wei; Huang, Pung-Ling

    2005-10-19

    One novel banana fruit ripening related 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene quite different from ACC oxidase genes from other species was cloned. In contrast to other studies, the polypeptide encoded by this gene, named Mh-ACO1, lacks the putative leucine zipper motif which is conserved in all known ACC oxidases including the other previously reported banana ACC oxidase, Mh-ACO2. The locus consists of two nearly identical paralogous ACC oxidase genes arranged in opposite orientation and separated by a 3.1-kb intergenic region. The has only two introns, at positions identical to , which comprises a coding region interrupted by three introns. The predicted amino acid sequence of Mh-ACO1 shares less than 50% identity to those of ACC oxidase from other climacteric fruits, while that of Mh-ACO2 shows more than 65% homology. When expressed in Saccharomyces cerevisiae -encoded protein possessed the enzyme activity for ethylene conversion. The levels of mRNA corresponding to both and increased during fruit ripening and were induced by exogenous ethylene. We conclude that both and contribute to increased ethylene production in fruits and these two genes are differentially expressed in fruits and other organs in banana. PMID:16218670

  4. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  5. The human protoporphyrinogen oxidase gene (PPOX): Organization and location to chromosome 1

    SciTech Connect

    Taketani, Shigeru; Furukawa, Takako; Kohno, Hirao; Tokunaga, Rikio

    1995-10-10

    We determined the structure of the human protoporphyrinogen oxidase (PPOX) gene after isolation and characterization of lambda phage clones mapping discrete regions of the cDNA. Southern blotting of human genomic DNA showed that there is a single copy of the PPOX gene, and fluorescence in situ hybridization to metaphase chromosomes mapped the gene to region 1q22. The gene has 13 exons and about 8 kb. The exon intron boundary sequences conform to consensus acceptor (GTn) and donor (nAG) sequences, and exons in the gene appear to encode functional protein domains. Primer extension analysis revealed two major transcriptional initiation sites in a region with sequence motifs characteristic of a promoter. The promoter region contains multiple Sp1 elements, CCAAT boxes, and potential GATA-1 binding sites. Mapping of the 5{prime} end PPOX mRNA by polymerase chain reaction indicated that there are the same transcripts in erythroid and nonerythroid cells. 23 refs., 5 figs., 1 tab.

  6. Secretory and continuous expression of Aspergillus niger glucose oxidase gene in Pichia pastoris.

    PubMed

    Yamaguchi, Masaki; Tahara, Yusuke; Nakano, Atsunori; Taniyama, Tadayoshi

    2007-10-01

    We proposed a yeast transformant cell incorporating the Aspergillus niger glucose oxidase gene (GOX gene), which is capable of constitutively as well as secretory expression. The GOX gene has been cloned in this study. This conclusion is based on the following: first, the ligated DNA determined by electrophoresis, was a 1489-1882bp fragment, close to the size of glucose oxidase (GOD), which is 1818bp. Secondly, the single open reading frame encoded a protein of 605 amino acids. Thirdly, secreted GOD recombinant proteins in the culture supernatants of the GOX gene transformant migrated as a single band in SDS-PAGE with an apparent molecular mass of between 75,000 and 100,000 Da, which is glycosylated GOD by the Pichia pastoris X-33 host machinery during the secretion process. Finally, the clones were cultured and secreted a protein, which possessed the GOD activity of catalyzing beta-d-glucose oxidation. With regard to the pH characteristics, the activity was more than 80% of the maximum activity in the range between pH 5 and pH 7. As for the temperature characteristics, the activity was not less than 92% of the maximum in the temperature range between 10 and 45 degrees C. The GOX gene transformant was able to maintain the GOD enzyme activity and produce recombinant GOD continuously for at least 2 weeks. PMID:17590349

  7. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  8. Molecular cloning and expression characteristics of alternative oxidase gene of cotton (Gossypium hirsutum).

    PubMed

    Li, Fang; Zhang, Yi; Wang, Meimei; Zhang, Ying; Wu, Xiaoliang; Guo, Xingqi

    2008-06-01

    A novel alternative oxidase (AOX) gene derived from cotton (Gossypium hirsutum), designated as GhAOX1, was cloned with RACE-PCR. The full-length cDNA of GhAOX1was 1,298 bp in size, containing a 996 bp open reading frame (ORF) which corresponds to a precursor protein of 332 amino acid residues with a calculated molecular mass of 37.5 kDa. The predicted amino acid sequence exhibited 68.4%, 68.1%, 59.4%, and 69.8% homology to the alternative oxidases of Arabidopsis thaliana, Nicotiana tabacum, Solanum tuberosum and Glycine max, respectively. Interestingly, striking similarity in several coding regions, such as metal binding and hydrophobic alpha-helix regions was seen between GhAOX1 and other AOX1 proteins. Analysis of the exon/intron structure of the GhAOX1 gene showed that GhAOX1 consisted of four exons and three introns. Southern analysis indicated that the GhAOX1 was a single copy gene belonging to a multi-gene family. Expression analysis by Northern blot revealed that the GhAOX1 exhibited preferential expression in tissues, with the higher expression being found in cotyledons and petals. GhAOX1 was also found to be induced by a variety of stresses stimulation including cold, citrate, SA, KCN and antimycin A in cotton. PMID:17351819

  9. Analysis of reported SCO2 gene mutations affecting cytochrome c oxidase activity in various diseases

    PubMed Central

    Chadha, Radhika; Shah, Ritika; Mani, Shalini

    2014-01-01

    A large number of mutations have been reported in SCO2 (synthesis of cytochrome c oxidase) gene in association with COX deficiency reported in different diseases such as cardioencephalomyopathy, cardiomyopathy and Leigh syndrome. However, very few of these mutations have been functionally analyzed.SCO2 gene encodes for an essential assembly factor for the formation of cytochrome c oxidase (COX). It is a nuclear encoded protein that helps in transfer of copper ions to COX. This study is an attempt to understand the possible effect of these mutations on the structure and function of SCO2 protein, by using different in silico tools. As per Human Gene Mutation Database, total 11 non synonymous variations have been reported in SCO2 gene. Among these 11 variations, only E140K and R171W are functionally proven to cause COX deficiency. They have been used as controls in this study. The remaining variations were further analyzed using ClustalW, SIFT, PolyPhen-2, GOR4, MuPro and Panther softwares. As compared to the results of the controls, most of these variations were predicted to affect the structure of SCO2 protein and hence, may cause COX dysfunction. Thus, we hypothesize that these variations have the potential to result in a disease phenotype and should be investigated by subsequent functional analyses. This will help in an appropriate diagnosis and management of the wide spectrum of COX deficiency diseases. PMID:25097374

  10. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  11. NADPH oxidase-mediated oxidative stress: genetic studies of the p22(phox) gene in hypertension.

    PubMed

    Zalba, Guillermo; San Jos, Gorka; Moreno, Mara U; Fortuo, Ana; Dez, Javier

    2005-01-01

    Increased vascular production of reactive oxygen species, especially superoxide anion, significantly contributes to the oxidative stress associated with hypertension. An enhanced superoxide production causes an increased inactivation of nitric oxide that diminishes nitric oxide bioavailability, thus contributing to endothelial dysfunction and hypertrophy of vascular cells. It has been shown that NADPH oxidases play a major role as the most important sources of superoxide anion in phagocytic and vascular cells. Several experimental observations have described an enhanced superoxide generation as a result of NADPH oxidase activation in hypertension. Although these enzymes respond to stimuli such as vasoactive factors, growth factors, and cytokines, recent data suggest a significant role of the genetic background in the modulation of the expression of its different components. Several polymorphisms have been identified in the promoter and in the coding region of CYBA, the gene that encodes the essential subunit of the NADPH oxidase p22phox, some of which seem to influence significantly the activity of these enzymes in the context of cardiovascular diseases. Among CYBA polymorphisms, genetic investigations have provided a novel marker, the -930(A/G) polymorphism, which determines the genetic susceptibility of hypertensive patients to oxidative stress. PMID:16115038

  12. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  13. Enhancing Resistance to Sclerotinia minor in Peanut by Expressing a Barley Oxalate Oxidase Gene1

    PubMed Central

    Livingstone, D. Malcolm; Hampton, Jaime L.; Phipps, Patrick M.; Grabau, Elizabeth A.

    2005-01-01

    Sclerotinia minor Jagger is the causal agent of Sclerotinia blight, a highly destructive disease of peanut (Arachis hypogaea). Based on evidence that oxalic acid is involved in the pathogenicity of many Sclerotinia species, our objectives were to recover transgenic peanut plants expressing an oxalic acid-degrading oxalate oxidase and to evaluate them for increased resistance to S. minor. Transformed plants were regenerated from embryogenic cultures of three Virginia peanut cultivars (Wilson, Perry, and NC-7). A colorimetric enzyme assay was used to screen for oxalate oxidase activity in leaf tissue. Candidate plants with a range of expression levels were chosen for further analysis. Integration of the transgene was confirmed by Southern-blot analysis, and gene expression was demonstrated in transformants by northern-blot analysis. A sensitive fluorescent enzyme assay was used to quantify expression levels for comparison to the colorimetric protocol. A detached leaflet assay tested whether transgene expression could limit lesion size resulting from direct application of oxalic acid. Lesion size was significantly reduced in transgenic plants compared to nontransformed controls (65%89% reduction at high oxalic acid concentrations). A second bioassay examined lesion size after inoculation of leaflets with S. minor mycelia. Lesion size was reduced by 75% to 97% in transformed plants, providing evidence that oxalate oxidase can confer enhanced resistance to Sclerotinia blight in peanut. PMID:15778458

  14. Polymorphisms in NADPH oxidase CYBA gene modify the risk of ESRD in patients with chronic glomerulonephritis.

    PubMed

    Zhou, Hui; Chen, Min; Zhu, Ying; Wang, Bing; Liu, Xiao-Ning; Zuo, Zhi; Tang, Feng-Ying

    2016-03-01

    End-stage renal disease (ESRD) was defined as start of renal replacement therapy or death due to kidney disease. However, death due to acute kidney injury was not included. It typically occurs when chronic renal failure progresses to a point where the kidneys are permanently functioning at less than 10% of their capacity. Oxidative stress (OS) plays a crucial role in ESRD. Nicotinamide adenine dinucleotide phosphate (NADPH) is one of the most important enzymes during oxidative stress. Cytochrome b light chain (CYBA), encoded by a polymorphic gene, which is a critical component of the nicotinamide adenine dinucleotide (NADH)/NADPH oxidase system and plays an important role in electron transport and superoxide anion production, is located on chromosome band 16q24 and has six exons spanning almost 7.76kb of genomic DNA. CYBA gene polymorphisms can influence the activity of NADPH oxidase. To evaluate the association between CYBA gene polymorphisms and ESRD, we genotyped five CYBA polymorphisms using TaqMan allelic discrimination assay on DNA samples from 306 healthy controls and 332 patients with ESRD. Our results suggested that rs1049255 polymorphism of CYBA modified the risk of ESRD (p ?=??0.019; OR ?=??0.625; 95%CI ?=??0.424-0.921). GG genotype and G allele might be a protective factor against the risk of ESRD, especially in patients with chronic glomerulonephritis. PMID:26627442

  15. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.

    PubMed

    Pu, Xiao-jun; Lv, Xin; Lin, Hong-hui

    2015-11-01

    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors--WRKY, NAC, bZIP and MYB--are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  16. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.

    PubMed

    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S

    2003-01-21

    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  17. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M

    1998-01-01

    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  18. Exclusion of urate oxidase as a candidate gene for hyperuricosuria in the Dalmatian dog using an interbreed backcross.

    PubMed

    Safra, N; Ling, G V; Schaible, R H; Bannasch, D L

    2005-01-01

    Hyperuricosuria, an autosomal recessive disorder, is characterized by high levels of uric acid in the urine of Dalmatian dogs. Whereas high levels of uric acid are known to be caused by the silencing of the urate oxidase (uox) gene in humans and higher primates, the molecular basis for the Dalmatian defect is unknown. Transplantation studies show that the organ responsible for the Dalmatian phenotype is the liver, which is where urate oxidase is exclusively expressed and uric acid is converted into allantoin. We cloned and sequenced the canine uox cDNA and compared the sequence between a Dalmatian and non-Dalmatian dog. No change in cDNA sequence was identified. A Dalmatian x pointer backcross family was used to track the segregation of microsatellite markers surrounding the urate oxidase locus. The uox gene was excluded for Dalmatian hyperuricosuria based on the cDNA sequence identity and negative LOD scores. PMID:15958795

  19. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  20. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  1. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  2. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  3. Monoamine Oxidase A Gene Polymorphisms and Bipolar Disorder in Iranian Population

    PubMed Central

    Eslami Amirabadi, Mohammad Reza; Rajezi Esfahani, Sepideh; Davari-Ashtiani, Rozita; Khademi, Mojgan; Emamalizadeh, Babak; Movafagh, Abolfazl; Sadr, Said; Arabgol, Fariba; Darvish, Hossein; Razjoyan, Katayoon

    2015-01-01

    Background: Bipolar disorder (BPD) is a common and severe mood disorder. Although genetic factors have important rolesin the etiology of bipolar disorder, no specific gene has been identified in relation to this disorder. Monoamine oxidase gene is suggested to be associated with bipolar disorder in many studies. Objectives: This study aimed to investigatethe role of MAOA gene polymorphisms in the etiology of bipolar disorder in Iranian population. Patients and Methods: This study is a case-control study, with convenient sampling. Three common polymorphisms, a CA microsatellite, a VNTR, and a RFLP were typed in 156 bipolar patients and 173 healthy controls. Patients were chosen from Imam Hossein General Hospital, Psychiatry Ward (Tehran/Iran). Controlsamples for this study consisted of 173 healthy individuals recruitedby convenient sampling. Allelic distributions of these polymorphisms were analyzed in bipolar and control groups to investigate any association with MAOA gene. Results: Significant associations were observed regarding MAOA-CA (P = 0.016) and MAOA-VNTR (P = 0.004) polymorphisms in the bipolar females. There was no association between MAOA-RFLP and bipolar disorder. Conclusions: The obtained results confirm some previous studies regardinga gender specific association of MAOA gene with the bipolar disorder. PMID:25793118

  4. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on primary sequence data. The dynamic nature of this gene family differentiates PPO from other oxidative enzymes, and is consistent with a protein important for a diversity of functions relating to environmental adaptation. PMID:22897796

  5. Expression of NADPH oxidase homologues and accessory genes in human cancer cell lines, tumours and adjacent normal tissues

    PubMed Central

    JUHASZ, AGNES; GE, YUN; MARKEL, SUSAN; CHIU, ALICE; MATSUMOTO, LINDA; VAN BALGOOY, JOSEPHUS; ROY, KRISHNENDU; DOROSHOW, JAMES H

    2010-01-01

    The family of NADPH oxidase (NOX) genes produces reactive oxygen species (ROS) pivotal for both cell signalling and host defense. To investigate whether NOX and NOX accessory gene expression might be a factor common to specific human tumour types, this study measured the expression levels of NOX genes 1–5, dual oxidase 1 and 2, as well as those of NOX accessory genes NoxO1, NoxA1, p47phox, p67phox and p22phox in human cancer cell lines and in tumour and adjacent normal tissue pairs by quantitative, real-time RT-PCR. The results demonstrate tumour-specific patterns of NOX gene expression that will inform further studies of the role of NOX activity in tumour cell invasion, growth factor response and proliferative potential. PMID:19431059

  6. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene. PMID:26546307

  7. The terminal quinol oxidase of the hyperthermophilic archaeon Acidianus ambivalens exhibits a novel subunit structure and gene organization.

    PubMed Central

    Purschke, W G; Schmidt, C L; Petersen, A; Schäfer, G

    1997-01-01

    A terminal quinol oxidase has been isolated from the plasma membrane of the crenarchaeon Acidianus ambivalens (DSM 3772) (formerly Desulfurolobus ambivalens), cloned, and sequenced. The detergent-solubilized complex oxidizes caldariella quinol at high rates and is completely inhibited by cyanide and by quinolone analogs, potent inhibitors of quinol oxidases. It is composed of at least five different subunits of 64.9, 38, 20.4, 18.8, and 7.2 kDa; their genes are located in two different operons. doxB, the gene for subunit I, is located together with doxC and two additional small open reading frames (doxE and doxF) in an operon with a complex transcription pattern. Two other genes of the oxidase complex (doxD and doxA) are located in a different operon and are cotranscribed into a common 1.2-kb mRNA. Both operons exist in duplicate on the genome of A. ambivalens. Only subunit I exhibits clear homology to other members of the superfamily of respiratory heme-copper oxidases; however, it reveals 14 transmembrane helices. In contrast, the composition of the accessory proteins is highly unusual; none is homologous to any known accessory protein of cytochrome oxidases, nor do homologs exist in the databases. DoxA is classified as a subunit II equivalent only by analogy of molecular size and hydrophobicity pattern to corresponding polypeptides of other oxidases. Multiple alignments and phylogenetic analysis of the heme-bearing subunit I (DoxB) locate this oxidase at the bottom of the phylogenetic tree, in the branch of heme-copper oxidases recently suggested to be incapable of superstoichiometric proton pumping. This finding is corroborated by lack of the essential amino acid residues delineating the putative H+-pumping channel. It is therefore concluded that A. ambivalens copes with its strongly acidic environment simply by an extreme turnover of its terminal oxidase, generating a proton gradient only by chemical charge separation. PMID:9023221

  8. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  9. Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development.

    PubMed

    García-Martínez, J L; López-Diaz, I; Sánchez-Beltrán, M J; Phillips, A L; Ward, D A; Gaskin, P; Hedden, P

    1997-04-01

    PCR was used with degenerate primers based on conserved amino acid sequences in gibberellin (GA) 20-oxidases to isolate cDNA clones for these enzymes from young seeds of pea (Pisum sativum) and developing embryos of French bean (Phaseolus vulgaris). One GA 20-oxidase cDNA (Ps27-12) was obtained from pea and three (Pv 15-11, Pv73-1 and Pv85-26) from bean. Their identities were confirmed by demonstrating that fusion proteins expressed in Escherichia coli exhibited GA 20-oxidase activity, converting [14C]GA12 to [14C]GA9. The intermediates in this three-step reaction, GA15 and GA24, were also identified as products. The expression proteins from three of the clones (Ps27-12, Pv15-11 and Pv73-1) were also shown to convert GA53 to GA20, as effectively as they did GA12. On the basis of transcript levels measured by northern blot analysis, the pea GA 20-oxidase gene is most highly expressed in young leaves, fully expanded internodes, very young seeds (until 4 days after anthesis) and expanding pods (from 3 days after anthesis at least until day 6). Expression in pods from 3-day-old unpollinated ovaries is higher than in those from pollinated ovaries. Treatment of unpollinated ovaries with GA3 to induce parthenocarpic fruit-set severely reduced the amount of GA 20-oxidase mRNA, whereas treatment with 2,4-D, although inducing fruit-set, did not reduce the levels of these transcripts. Plant decapitation above an unpollinated ovary resulted in very high levels of GA 20-oxidase mRNA in the pod. The three GA 20-oxidase genes from French bean showed very different patterns of expression: Pv 15-1 was expressed in the roots, young leaves, and developing seeds, but most highly in immature cotyledons, while Pv73-1 has a similar expression pattern to Ps27-12, with transcripts found only in young seeds and young leaves, where it was particularly abundant. Transcripts corresponding to Pv85-26 were detected in developing seeds, and just traces in the young leaves. Southern blot analysis indicated that the bean GA 20-oxidases are each encoded by single-copy genes, whereas one more gene, homologous to Ps27-12, could also exist in pea. PMID:9154988

  10. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  11. Association between monoamine oxidase gene polymorphisms and smoking behaviour in Chinese males.

    PubMed

    Jin, Ying; Chen, Dafang; Hu, Yonghua; Guo, Song; Sun, Hongqiang; Lu, Aili; Zhang, Xiaoyan; Li, Lingsong

    2006-10-01

    Monoamine oxidase (MAO) is a critical metabolic enzyme of dopamine, which is a key neurotransmitter of the mesolimbic reward pathway in the human brain. Consequently, the gene encoding MAO is an important candidate gene in the genetics of smoking behaviour. We investigated the association between MAOA polymorphisms (a VNTR polymorphism and an EcoRV polymorphism) and smoking status. A community-based cross-sectional study was conducted with 203 current smoking subjects and 168 non-current smoking subjects in Beijing, China. Genotyping for these polymorphisms was performed using PCR and restriction fragment length polymorphism. Multiple logistic regression models were used to analyse the association of MAOA gene polymorphisms with smoking status. We found that individuals with the 1460T/O genotype had a significantly increased the risk of smoking compared to those with 1460C/O. The adjusted odds ratios (aORs) were 3.2 (95% CI 2.0-5.2) in current vs. non-current smokers group, 1.7 (95% CI 1.1-2.8) in ever vs. never smokers group, 2.5 (95% CI 1.4-4.3) in current vs. never smokers group, and 5.3 (95% CI 2.5-11.2) in current vs. former smokers group respectively. We also found that individuals with the 3-repeat genotype of the VNTR polymorphism had a significantly increased risk of smoking significantly compared to those with the 4-repeat genotype. The aORs were 2.0 (95% CI 1.0-4.1) in the current vs. former smokers group, and 1.9 (95% CI 1.0-3.6) in the nicotine dependent vs. non-nicotine dependent group respectively. Moreover, MAOA gene haplotypes were associated significantly with nicotine dependence in every group. In conclusion, there is an important association between MAOA polymorphisms and smoking status, suggesting a possible role of MAOA gene variants in nicotine dependence. PMID:16207390

  12. A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

    PubMed Central

    Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

    2014-01-01

    Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s?1) and nicotine (Km = 2.03 mM, kcat = 0.396 s?1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

  13. A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.

    PubMed

    Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping

    2014-09-01

    Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

  14. Molecular cloning, expression profiles, and characterization of a novel polyphenol oxidase (PPO) gene in Hevea brasiliensis.

    PubMed

    Li, Dejun; Deng, Zhi; Liu, Changren; Zhao, Manman; Guo, Huina; Xia, Zhihui; Liu, Hui

    2014-01-01

    The polyphenol oxidase (PPO) is involved in undesirable browning in many plant foods. Although the PPOs have been studied by several researchers, the isolation and expression profiles of PPO gene were not reported in rubber tree. In this study, a new PPO gene, HbPPO, was isolated from Hevea brasiliensis. The sequence alignment showed that HbPPO indicated high identities to plant PPOs and belonged to dicot branch. The cis-acting regulatory elements related to stress/hormone responses were predicted in the promoter region of HbPPO. Real-time RT-PCR analyses showed that HbPPO expression varied widely depending on different tissues and developmental stages of leaves. Besides being associated with tapping panel dryness, the HbPPO transcripts were regulated by ethrel, wounding, H2O2, and methyl jasmonate treatments. Moreover, the correlation between latex coagulation rate and PPO activity was further confirmed in this study. Our results lay the foundation for further analyzing the function of HbPPO in rubber tree. PMID:25051980

  15. Cloning and heterologous expression of glucose oxidase gene from Aspergillus niger Z-25 in Pichia pastoris.

    PubMed

    Guo, Yao; Lu, Fengxia; Zhao, Haizhen; Tang, Yanchong; Lu, Zhaoxin

    2010-09-01

    A gene of glucose oxidase (GOD) from Aspergillus niger Z-25 was cloned and sequenced. The entire open reading frame (ORF) consisted of 1,818 bp and encoded a putative peptide of 605 amino acids. The gene was fused to the pPICZalphaA plasmid and overexpressed in Pichia pastoris SMD1168. The recombinant GOD (rGOD) was secreted into the culture using MF-alpha factor signal peptide under the control of the AOX1 promoter. Sodium dodecyl sulfate polyacrylamide gel electrophoresis indicated that rGOD exhibited a single band at around 94 kDa. The maximal GOD activity of approximately 40 U/mL was achieved in shake flask by induction under optimal conditions after 7 days. rGOD was purified by ammonium sulfate precipitate leading to a final specific activity of 153.46 U/mg. The optimum temperature and pH of the purified enzyme were 40 degrees C and 6.0, respectively. Over 88% of maximum activity was maintained below 40 degrees C. And the recombinant enzyme displayed a favorable stability in the pH range from 4.0 to 8.0. The Lineweaver-Burk plotting revealed that rGOD exhibited a K (m) value of 16.95 mM and a K (cat) value of 484.26 s(-1). PMID:19784554

  16. The Pea Gene NA Encodes ent-Kaurenoic Acid Oxidase1

    PubMed Central

    Davidson, Sandra E.; Elliott, Robert C.; Helliwell, Chris A.; Poole, Andrew T.; Reid, James B.

    2003-01-01

    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA12 when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7α-hydroxykaurenoic acid and GA12-aldehyde, some additional products of the pea KAO activity were detected, including ent-6α,7α-dihydroxykaurenoic acid and 7β-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants. PMID:12529541

  17. Dominant Role of the cbb3 Oxidase in Regulation of Photosynthesis Gene Expression through the PrrBA System in Rhodobacter sphaeroides 2.4.1▿

    PubMed Central

    Kim, Yong-Jin; Ko, In-Jeong; Lee, Jin-Mok; Kang, Ho-Young; Kim, Young Min; Kaplan, Samuel; Oh, Jeong-Il

    2007-01-01

    In this study, the H303A mutant form of the cbb3 oxidase (H303A oxidase), which has the H303A mutation in its catalytic subunit (CcoN), was purified from Rhodobacter sphaeroides. The H303A oxidase showed the same catalytic activity as did the wild-type form of the oxidase (WT oxidase). The heme contents of the mutant and WT forms of the cbb3 oxidase were also comparable. However, the puf and puc operons, which are under the control of the PrrBA two-component system, were shown to be derepressed aerobically in the R. sphaeroides strain expressing the H303A oxidase. Since the strain harboring the H303A oxidase exhibited the same cytochrome c oxidase activity as the stain harboring the WT oxidase did, the aerobic derepression of photosynthesis gene expression observed in the H303A mutant appears to be the result of a defective signaling function of the H303A oxidase rather than reflecting any redox changes in the ubiquinone/ubiquinol pool. It was also demonstrated that ubiquinone inhibits not only the autokinase activity of full-length PrrB but also that of the truncated form of PrrB lacking its transmembrane domain, including the proposed quinone binding sequence. These results imply that the suggested ubiquinone binding site within the PrrB transmembrane domain is not necessary for the inhibition of PrrB kinase activity by ubiquinone. Instead, it is probable that signaling through H303 of the CcoN subunit of the cbb3 oxidase is part of the pathway through which the cbb3 oxidase affects the relative kinase/phosphatase activity of the membrane-bound PrrB. PMID:17557830

  18. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

    PubMed

    Gro, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

    2014-01-01

    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS. PMID:24173666

  19. ZFN-mediated gene targeting of the Arabidopsis protoporphyrinogen oxidase gene through Agrobacterium-mediated floral dip transformation

    PubMed Central

    Pater, Sylvia; Pinas, Johan E; Hooykaas, Paul J J; Zaal, Bert J

    2013-01-01

    Previously, we showed that ZFN-mediated induction of double-strand breaks (DSBs) at the intended recombination site enhanced the frequency of gene targeting (GT) at an artificial target locus using Agrobacterium-mediated floral dip transformation. Here, we designed zinc finger nucleases (ZFNs) for induction of DSBs in the natural protoporphyrinogen oxidase (PPO) gene, which can be conveniently utilized for GT experiments. Wild-type Arabidopsis plants and plants expressing the ZFNs were transformed via floral dip transformation with a repair T-DNA with an incomplete PPO gene, missing the 5′ coding region but containing two mutations rendering the enzyme insensitive to the herbicide butafenacil as well as an extra KpnI site for molecular analysis of GT events. Selection on butafenacil yielded 2 GT events for the wild type with a frequency of 0.8 × 10−3 per transformation event and 8 GT events for the ZFNs expressing plant line with a frequency of 3.1 × 10−3 per transformation event. Molecular analysis using PCR and Southern blot analysis showed that 9 of the GT events were so-called true GT events, repaired via homologous recombination (HR) at the 5′ and the 3′ end of the gene. One plant line contained a PPO gene repaired only at the 5′ end via HR. Most plant lines contained extra randomly integrated T-DNA copies. Two plant lines did not contain extra T-DNAs, and the repaired PPO genes in these lines were transmitted to the next generation in a Mendelian fashion. PMID:23279135

  20. ZFN-mediated gene targeting of the Arabidopsis protoporphyrinogen oxidase gene through Agrobacterium-mediated floral dip transformation.

    PubMed

    de Pater, Sylvia; Pinas, Johan E; Hooykaas, Paul J J; van der Zaal, Bert J

    2013-05-01

    Previously, we showed that ZFN-mediated induction of double-strand breaks (DSBs) at the intended recombination site enhanced the frequency of gene targeting (GT) at an artificial target locus using Agrobacterium-mediated floral dip transformation. Here, we designed zinc finger nucleases (ZFNs) for induction of DSBs in the natural protoporphyrinogen oxidase (PPO) gene, which can be conveniently utilized for GT experiments. Wild-type Arabidopsis plants and plants expressing the ZFNs were transformed via floral dip transformation with a repair T-DNA with an incomplete PPO gene, missing the 5' coding region but containing two mutations rendering the enzyme insensitive to the herbicide butafenacil as well as an extra KpnI site for molecular analysis of GT events. Selection on butafenacil yielded 2 GT events for the wild type with a frequency of 0.8 × 10⁻³ per transformation event and 8 GT events for the ZFNs expressing plant line with a frequency of 3.1 × 10⁻³ per transformation event. Molecular analysis using PCR and Southern blot analysis showed that 9 of the GT events were so-called true GT events, repaired via homologous recombination (HR) at the 5' and the 3' end of the gene. One plant line contained a PPO gene repaired only at the 5' end via HR. Most plant lines contained extra randomly integrated T-DNA copies. Two plant lines did not contain extra T-DNAs, and the repaired PPO genes in these lines were transmitted to the next generation in a Mendelian fashion. PMID:23279135

  1. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 μM/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 μM/min and Km (NADH) 51.3 μM, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  2. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  3. The ccoNOQP gene cluster codes for a cb-type cytochrome oxidase that functions in aerobic respiration of Rhodobacter capsulatus.

    PubMed

    Thöny-Meyer, L; Beck, C; Preisig, O; Hennecke, H

    1994-11-01

    The genes for a new type of a haem-copper cytochrome oxidase were cloned from Rhodobacter capsulatus strain 37b4, using the Bradyrhizobium japonicum fixNOQP gene region as a hybridizing probe. Four genes, probably organized in an operon (ccoNOQP), were identified; their products share extensive amino acid sequence similarity with the FixN, O, Q and P proteins that have recently been shown to be the subunits of a cb-type oxidase. CcoN is a b-type cytochrome, CcoO and CcoP are membrane-bound mono- and dihaem c-type cytochromes and CcoQ is a small membrane protein of unknown function. Genes for a similar oxidase are also present in other non-rhizobial bacterial species such as Azotobacter vinelandii, Agrobacterium tumefaciens and Pseudomonas aeruginosa, as revealed by polymerase chain reaction analysis. A ccoN mutant was constructed whose phenotype, in combination with the structural information on the gene products, provides evidence that the CcoNOQP oxidase is a cytochrome c oxidase of the cb type, which supports aerobic respiration in R. capsulatus and which is probably identical to the cbb3-type oxidase that was recently purified from a different strain of the same species. Mutant analysis also showed that this oxidase has no influence on photosynthetic growth and nitrogen-fixation activity. PMID:7891558

  4. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  5. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  6. A monoamine-regulated Klebsiella aerogenes operon containing the monoamine oxidase structural gene (maoA) and the maoC gene.

    PubMed Central

    Sugino, H; Sasaki, M; Azakami, H; Yamashita, M; Murooka, Y

    1992-01-01

    The Klebsiella aerogenes gene maoA, which is involved in the synthesis of monoamine oxidase, was induced by tyramine and the related compounds, subjected to catabolite and ammonium ion repression, and cloned. The nucleotide sequence of the region involved in monoamine oxidase synthesis was determined. Two open reading frames, the maoA gene and a hitherto unknown gene (maoC), were found. These are located between a potential promoter sequence and a transcriptional terminator sequence. A region of the Escherichia coli chromosome that was highly homologous to the Klebsiella maoA gene was found. The potential maoA gene is located at 30.9 min on the E. coli chromosome. Analysis of the amino acid sequences of the first 11 amino acids from the N terminus of the purified monoamine oxidase agrees with those deduced from the nucleotide sequence of the maoA gene. The leader peptide extends over 30 amino acids and has the characteristics of a signal sequence. Primer extension and S1 nuclease mapping of transcripts generated in vivo suggests that the tyramine-induced mRNA starts at a site 62 bases upstream from the ATG initiation codon of the maoC gene. In the putative promoter region, a high degree of similarity to the consensus sequence for the binding site of cyclic AMP receptor protein was found. Thus, the mao region is composed of two cistrons, and the mao operon is regulated by monoamine compounds, glucose, and ammonium ions. Images PMID:1556068

  7. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  8. [Cloning and bioinformatics analysis of ent-kaurene oxidase synthase gene in Salvia miltiorrhiza].

    PubMed

    Hu, Ya-ting; Gao, Wei; Liu, Yu-jia; Cheng, Qi-qing; Su, Ping; Liu, Yu-zhong; Chen, Min

    2014-11-01

    Based on the transcriptome database of Salvia miltiorrhiza, specific primers were designed to clone a full-length cDNA of ent-kaurene oxidase synthase (SmKOL) using the RACE strategy. ORF Finder was used to find the open reading frame of SmKOL cDNA, and ClustalW has been performed to analysis the multiple amino acid sequence alignment. Phylogenetic tree has been constructed using MEGA 5.1. The transcription level of SmKOL from the hairy roots induced by elicitor methyl jasmonate (MeJA) was qualifiedby real-time quantitative PCR. The full length of SmKOL cDNA was of 1 884 bp nucleotides encoding 519 amino acids. The molecular weight of the SmKOL protein was about 58.88 kDa with isoelectric point (pI) of 7.62. Results of real-time quantitative PCR analyses indicated that the level of SmKOL mRNA expression in hairy roots was increased by elicitor oMeJA, and reached maximum in 36 h. The full-length cDNA of SmKOL was cloned from S. miltiorrhiza hairy root, which provides a target gene for further studies of its function, gibberellin biosynthesis and regulation of secondary metabolites. PMID:25775789

  9. Mitochondrial Cytochrome Oxidase I Gene Sequence Analysis of Aedes Albopictus in Malaysia.

    PubMed

    Ismail, Nurul-Ain; Dom, Nazri Che; Ismail, Rodziah; Ahmad, Abu Hassan; Zaki, Afiq; Camalxaman, Siti Nazrina

    2015-12-01

    A study was conducted to establish polymorphic variation of the mitochondrial DNA encoding the cytochrome oxidase subunit 1 (CO1) gene in Aedes albopictus isolated from 2 hot spot dengue-infested areas in the Subang Jaya District, Malaysia. A phylogenetic analysis was performed with the use of sequences obtained from USJ6 and Taman Subang Mas (TSM). Comparison of the local CO1 sequences with a laboratory strain (USM), alongside reference strains derived from the GenBank database revealed low genetic variation in terms of nucleotide differences and haplotype diversity. Four methods were used to construct a phylogenetic tree and illustrate the genetic relationship of the 37 Ae. albopictus populations based on the CO1 sequences, namely neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian method, which revealed a distinct relationship between isolates from USJ6 and TSM. Our findings provide new information regarding the genetic diversity among morphologically similar Ae. albopictus, which has not been reported to date. PMID:26675451

  10. Brd1 gene in maize encodes a brassinosteroid C-6 oxidase.

    PubMed

    Makarevitch, Irina; Thompson, Addie; Muehlbauer, Gary J; Springer, Nathan M

    2012-01-01

    The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1-m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system. PMID:22292043

  11. Cortical Enlargement in Autism is Associated With a Functional VNTR in the Monoamine Oxidase A Gene

    PubMed Central

    Davis, Lea K.; Hazlett, Heather C.; Librant, Amy L.; Nopoulos, Peggy; Sheffield, Val C.; Piven, Joesph; Wassink, Thomas H.

    2009-01-01

    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that “low activity” alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the “low activity” allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2–3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the “low activity” allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the “low activity” allele in a separate sample of 114 affected sib pairfamilies. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the “low activity” genotype and the larger brain volumes in our sample. PMID:18361446

  12. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis.

    PubMed

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-05-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  13. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of the hypothesis Studies of the gau ORF will shed light on the origin of novel genes and their functions in organelles and could also have medical implications for human diseases that are caused by mitochondrial dysfunction. Moreover, this strengthens evidence for mitochondrial genes coded according to an overlapping genetic code. PMID:22024028

  14. Divergent biochemical and enzymatic properties of oxalate oxidase isoforms encoded by four similar genes in rice.

    PubMed

    Li, Xiao Chun; Liao, Yuan Yang; Leung, David W M; Wang, Hai Yan; Chen, Bai Ling; Peng, Xin Xiang; Liu, E E

    2015-10-01

    The biochemical and enzymatic properties of four highly similar rice oxalate oxidase proteins (OsOxO1-4) were compared after their purification from the leaves of transgenic plants each overexpressing the respective OsOxO1-4 genes. Although alignment of their amino acid sequences has revealed divergence mainly in the signal peptides and they catalyze the same enzymic (oxalate oxidase) reaction, divergence in apparent molecular mass, Km, optimum pH, stability and responses to inhibitors and activators was uncovered by biochemical characterization of the purified OsOxO1-4 proteins. The apparent molecular mass of oligomer OsOxO1 was found to be similar to that of OsOxO3 but lower than the other two. The molecular mass of the subunit of OsOxO1 was lower than that of OsOxO3. The Km value of OsOxO3 was higher than the other three which had similar Km. OsOxO1 and OsOxO4 possessed peak activity at pH 8.5 which was close to that at the optimum pH 4.0. The activity of OsOxO2 at pH 8.5 was only 65% of that at its optimum pH 3.5, while the activity of OsOxO3 did not vary much at pH 6-9 and was also much lower than that at its optimum pH 3. OsOxO2 and OsOxO3 still maintained all their activities after being heated at 70°C for 1h while OsOxO1 and OsOxO4 lost about 30% of their activities. Pyruvate and oxaloacetic acid inhibited the activity of OsOxO3 more strongly than the other three. Interestingly, glucose 6-phosphate, fructose 6-phosphate and fructose 1,6-biphosphate related to photosynthetic assimilation of triose phosphate greatly increased the activities of OsOxO3 and OsOxO4. In addition to the differences in the biochemical properties of the four OsOxO proteins, an intriguing finding is that the purified OsOxO1-4 exhibited substrate inhibition, which is a typical of the classical Michaelis-Menten enzyme kinetics exhibited by a majority of other enzymes. PMID:26347131

  15. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

    2008-01-01

    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  16. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  17. Transcriptional regulation of a pineapple polyphenol oxidase gene and its relationship to blackheart.

    PubMed

    Zhou, Yuchan; O'Hare, Tim J; Jobin-Decor, Marcelle; Underhill, Steven J R; Wills, Ron B H; Graham, Michael W

    2003-11-01

    Two genes encoding polyphenol oxidase (PPO) were isolated from pineapple (Ananas comosus[L.] Merr. cv. Smooth Cayenne). Sequence analyses showed that both contained a single intron and encoded typical chloroplast-localized PPO proteins, the sequences of which corresponded to two pineapple PPO cDNAs, PINPPO1 and PINPPO2, recently described by Stewart et al. (2001). Southern blot analyses suggested that pineapple contained only two PPO genes. Analysis of expression of PINPPO1 promoter GUS fusion constructs showed this promoter had a low basal activity and was cold- and wound-inducible, consistent with known mRNA expression profiles. Striking homologies to gibberellin response complexes (GARC) were observed in sequences of both the PINPPO1 and PINPPO2 promoters. Transient assays in mature pineapple fruit and stable expression in transgenic tobacco showed that PINPPO1 promoter-GUS fusions were indeed gibberellin (GA) responsive. A role for the element within the putative GARCs in mediating GA-responsiveness of the PINPPO1 promoter was confirmed by mutational analysis. PINPPO2 was also shown to be GA-responsive by RT-PCR analysis. Mutant PINPPO1 promoter-GUS fusion constructs, which were no longer GA-inducible, showed a delayed response to cold induction in pineapple fruit in transient assays, suggesting a role for GA in blackheart development. This was supported by observations that exogenous GA(3) treatment induced blackheart in the absence of chilling. Sequences showing homology to GARCs are also present in some PPO promoters in tomato, suggesting that GA regulates PPO expression in diverse species. PMID:17134404

  18. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  19. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  20. Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

    PubMed Central

    Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

    2014-01-01

    Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

  1. Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy.

    PubMed

    Bongers, Kale S; Fox, Daniel K; Kunkel, Steven D; Stebounova, Larissa V; Murry, Daryl J; Pufall, Miles A; Ebert, Scott M; Dyle, Michael C; Bullard, Steven A; Dierdorff, Jason M; Adams, Christopher M

    2015-01-15

    Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

  2. Overexpression of a Gene Encoding Hydrogen Peroxide-Generating Oxalate Oxidase Evokes Defense Responses in Sunflower1

    PubMed Central

    Hu, Xu; Bidney, Dennis L.; Yalpani, Nasser; Duvick, Jonathan P.; Crasta, Oswald; Folkerts, Otto; Lu, Guihua

    2003-01-01

    Oxalate oxidase (OXO) converts oxalic acid (OA) and O2 to CO2 and hydrogen peroxide (H2O2), and acts as a source of H2O2 in certain plant-pathogen interactions. To determine if the H2O2 produced by OXO can function as a messenger for activation of defense genes and if OXO can confer resistance against an OA-producing pathogen, we analyzed transgenic sunflower (Helianthus annuus cv SMF3) plants constitutively expressing a wheat (Triticum aestivum) OXO gene. The transgenic leaf tissues could degrade exogenous OA and generate H2O2. Hypersensitive response-like lesion mimicry was observed in the transgenic leaves expressing a high level of OXO, and lesion development was closely associated with elevated levels of H2O2, salicylic acid, and defense gene expression. Activation of defense genes was also observed in the transgenic leaves that had a low level of OXO expression and had no visible lesions, indicating that defense gene activation may not be dependent on hypersensitive response-like cell death. To further understand the pathways that were associated with defense activation, we used GeneCalling, an RNA-profiling technology, to analyze the alteration of gene expression in the transgenic plants. Among the differentially expressed genes, full-length cDNAs encoding homologs of a PR5, a sunflower carbohydrate oxidase, and a defensin were isolated. RNA-blot analysis confirmed that expression of these three genes was significantly induced in the OXO transgenic sunflower leaves. Furthermore, treatment of untransformed sunflower leaves with jasmonic acid, salicylic acid, or H2O2 increased the steady-state levels of these mRNAs. Notably, the transgenic sunflower plants exhibited enhanced resistance against the OA-generating fungus Sclerotinia sclerotiorum. PMID:12970484

  3. Cloning of a Novel Nicotine Oxidase Gene from Pseudomonas sp. Strain HZN6 Whose Product Nonenantioselectively Degrades Nicotine to Pseudooxynicotine

    PubMed Central

    Qiu, Jiguo; Ma, Yun; Zhang, Jing; Wen, Yuezhong

    2013-01-01

    Pseudomonas sp. strain HZN6 utilizes nicotine as its sole source of carbon, nitrogen, and energy. However, its catabolic mechanism has not been elucidated. In this study, self-formed adaptor PCR was performed to amplify the upstream sequence of the pseudooxynicotine amine oxidase gene. A 1,437-bp open reading frame (designated nox) was found to encode a nicotine oxidase (NOX) that shows 30% amino acid sequence identity with 6-hydroxy-l-nicotine oxidase from Arthrobacter nicotinovorans. The nox gene was cloned into a broad-host-range cloning vector and transferred into the non-nicotine-degrading bacteria Escherichia coli DH5α (DH-nox) and Pseudomonas putida KT2440 (KT-nox). The transconjugant KT-nox obtained nicotine degradation ability and yielded an equimolar amount of pseudooxynicotine, while DH-nox did not. Reverse transcription-PCR showed that the nox gene is expressed in both DH5α and KT2440, suggesting that additional factors required for nicotine degradation are present in a Pseudomonas strain(s), but not in E. coli. The mutant of strain HZN6 with nox disrupted lost the ability to degrade nicotine, but not pseudooxynicotine. These results suggested that the nox gene is responsible for the first step of nicotine degradation. The (RS)-nicotine degradation results showed that the two enantiomers were degraded at approximately the same rate, indicating that NOX does not show chiral selectivity. Site-directed mutagenesis revealed that both the conserved flavin adenine dinucleotide (FAD)-binding GXGXXG motif and His456 are essential for nicotine degradation activity. PMID:23335761

  4. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  5. DGGE analysis of the coproporphyrinogen oxidase gene: two new mutations in DNA from Danish patients with hereditary coproporphyria.

    PubMed

    Petersen, N E; Käehne, M; Christiansen, L; Brock, A; Hother-Nielsen, O; Rasmussen, K

    2000-11-01

    The knowledge of at least 21 different mutations and several polymorphisms in the coproporphyrinogen oxidase (CPO) gene demonstrates that the molecular basis of hereditary coproporphyria is heterogeneous. We developed a DGGE-based assay for the analysis of exons 2 to 7, including 14-96 nucleotides of the flanking intronic sequences of the CPO gene. To render it suitable for the clinical diagnostic laboratory, we designed the assay to allow use of identical PCR conditions and the same DGGE gel for analyses of all the regions. Using this assay, and subsequent sequencing of gene regions containing interallelic variations, two novel mutations in the CPO gene were identified: a missense mutation (607G-->A), leading to the substitution of an alanine with a threonine, and a nonsense mutation (1281G-->A), giving rise to a stop codon 28 codons upstream to the wild-type stop codon. PMID:11202054

  6. Changes in Cytokinin Content and Cytokinin Oxidase Activity in Response to Derepression of ipt Gene Transcription in Transgenic Tobacco Calli and Plants.

    PubMed Central

    Motyka, V.; Faiss, M.; Strand, M.; Kaminek, M.; Schmulling, T.

    1996-01-01

    Metabolic control of cytokinin oxidase by its substrate was investigated in planta using wild-type (WT) and conditionally ipt gene-expressing transgenic (IPT) tobacco (Nicotiana tabacum L.) callus cultures and plants. The derepression of the tetracycline (Tc)-dependent ipt gene transcription was followed by a progressive, more than 100-fold increase in total cytokinin content in IPT calli. The activity of cytokinin oxidase extracted from these calli began to increase 16 to 20 h after gene derepression, and after 13 d it was 10-fold higher than from Tc-treated WT calli. An increase in cytokinin oxidase activity, as a consequence of elevated cytokinin levels, was found in detached leaves (8-fold after 4 d) and in roots of intact plants (4-fold after 3 d). The partially purified cytokinin oxidase from WT, repressed IPT, and Tc-derepressed IPT tobacco calli exhibited similar characteristics. It had the same broad pH optimum (pH 6.5-8.5), its activity in vitro was enhanced 4-fold in the presence of copper-imidazole, and the apparent Km(N6-[[delta]2iso-pentenyl]adenine) values were in the range of 3.1 to 4.9 [mu]M. The increase in cytokinin oxidase activity in cytokinin-overproducing tissue was associated with the accumulation of a glycosylated form of the enzyme. The present data indicate the substrate induction of cytokinin oxidase activity in different tobacco tissues, which may contribute to hormone homeostasis. PMID:12226431

  7. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  8. Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

    PubMed

    Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

    2015-03-01

    Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. PMID:24947769

  9. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  10. Hereditary Coproporphyria Associated with the Q306X Mutation in the Coproporphyrin Oxidase Gene Presenting with Acute Ataxia

    PubMed Central

    Jiménez-Jiménez, Félix Javier; Agúndez, José A. G.; Martínez, Carmen; Navacerrada, Francisco; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Alonso-Navarro, Hortensia; García-Martín, Elena

    2013-01-01

    Background Hereditary coproporphyria (HCPO) is a low-penetrance, autosomal dominant, acute hepatic porphyria characterized by the overproduction and excretion of coproporphyrin. The most common neurological manifestations of this entity include peripheral, predominantly motor dysfunction, and central nervous system dysfunction. Ataxia associated with HCPO has not been reported previously. The aim of this article is to report a patient with HCPO presenting with acute ataxia. Case Report We describe a 44-year-old patient presenting clinically with acute ataxia who was diagnosed with HCPO; mutations were analyzed in the coproporphyrin-oxidase III (CPOX) gene in the patient and in six asymptomatic first-degree relatives. Discussion The patient was heterozygous for a mutation causing the amino acid exchange Q306X in the CPOX gene. No relatives carried the same or another mutation in the CPOX gene. HCPO should be considered in the differential diagnosis for patients presenting with ataxia. PMID:24156084

  11. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  12. maoB, a gene that encodes a positive regulator of the monoamine oxidase gene (maoA) in Escherichia coli.

    PubMed Central

    Yamashita, M; Azakami, H; Yokoro, N; Roh, J H; Suzuki, H; Kumagai, H; Murooka, Y

    1996-01-01

    The structural gene for copper- and topa quinone-containing monoamine oxidase (maoA) and an unknown amine oxidase gene have been located at 30.9 min on the Escherichia coli chromosome. Deletion analysis showed that the unknown gene was located within a 1.1-kb cloned fragment adjacent to the maoA gene. The nucleotide sequence of this fragment was determined, and a single open reading frame (maoB) consisting of 903 bp was found. The gene encoded a polypeptide with a predicted molecular mass of 34,619 Da which was correlated with the migration on a sodium dodecyl sulfate-polyacrylamide gel. The predicted amino acid sequence of the MaoB protein was identical to the NH2-terminal amino acid sequence derived by Edman degradation of the protein synthesized under the self-promoter. No homology of the nucleotide sequence of maoB to the sequences of any reported genes was found. However, the amino acid sequence of MaoB showed a high level of homology with respect to the helix-turn-helix motif of the AraC family in its C terminus. The homology search and disruption of maoA on the chromosome led to the conclusion that MaoB is a transcriptional activator of maoA but not an amine oxidase. The consensus sequence of the cyclic AMP-cyclic AMP receptor protein complex binding domain was adjacent to the putative promoter for the maoB gene. By use of lac gene fusions with the maoA and maoB genes, we showed that the maoA gene is regulated by tyramine and MaoB and that the expression of the maoB gene is subject to catabolite repression. Thus, it seems likely that tyramine and the MaoB protein activate the transcription of maoA by binding to the regulatory region of the maoA gene. PMID:8631685

  13. A newly identified fatty alcohol oxidase gene is mainly responsible for the oxidation of long-chain ω-hydroxy fatty acids in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Förster, André; Bär, Kati; Winter, Miriam; Otto, Christina; Petzsch, Patrick; Ježková, Michaela; Bahr, Katrin; Pfeiffer, Melanie; Matthäus, Falk; Barth, Gerold

    2014-09-01

    Nine potential (fatty) alcohol dehydrogenase genes and one alcohol oxidase gene were identified in Yarrowia lipolytica by comparative sequence analysis. All relevant genes were deleted in Y. lipolytica H222ΔP which is lacking β-oxidation. Resulting transformants were tested for their ability to accumulate ω-hydroxy fatty acids and dicarboxylic acids in the culture medium. The deletion of eight alcohol dehydrogenase genes (FADH, ADH1-7), which may be involved in ω-oxidation, led only to a slightly increased accumulation of ω-hydroxy fatty acids, whereas the deletion of the fatty alcohol oxidase gene (FAO1), which has not been described yet in Y. lipolytica, exhibited a considerably higher effect. The combined deletion of the eight (fatty) alcohol dehydrogenase genes and the alcohol oxidase gene further reduced the formation of dicarboxylic acids. These results indicate that both (fatty) alcohol dehydrogenases and an alcohol oxidase are involved in ω-oxidation of long-chain fatty acids whereby latter plays the major role. This insight marks the first step toward the biotechnological production of long-chain ω-hydroxy fatty acids with the help of the nonconventional yeast Y. lipolytica. The overexpression of FAO1 can be further used to improve existing strains for the production of dicarboxylic acids. PMID:24931727

  14. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  15. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  16. Diversity of laccase-coding genes in Fusarium oxysporum genomes.

    PubMed

    Kwiatos, Natalia; Ryngajłło, Małgorzata; Bielecki, Stanisław

    2015-01-01

    Multiple studies confirm laccase role in fungal pathogenicity and lignocellulose degradation. In spite of broad genomic research, laccases from plant wilt pathogen Fusarium oxysporum are still not characterized. The study aimed to identify F. oxysporum genes that may encode laccases sensu stricto and to characterize the proteins in silico in order to facilitate further research on their impact on the mentioned processes. Twelve sequenced F. oxysporum genomes available on Broad Institute of Harvard and MIT (2015) website were analyzed and three genes that may encode laccases sensu stricto were found. Their amino acid sequences possess all features essential for their catalytic activity, moreover, the homology models proved the characteristic 3D laccase structures. The study shades light on F. oxysporum as a new source of multicopper oxidases, enzymes with possible high redox potential and broad perspective in biotechnological applications. PMID:26441870

  17. High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

    PubMed

    Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

    2012-03-01

    The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry. PMID:22052258

  18. The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

    PubMed

    Nawathean, P; Maslov, D A

    2000-08-01

    By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs. PMID:10975258

  19. The copper-iron connection in biology: Structure of the metallo-oxidase Fet3p

    SciTech Connect

    Taylor, A. B.; Stoj, C. S.; Ziegler, L.; Kosman, D. J.; Hart, P. J.

    2005-10-17

    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O2 to H2O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase.

  20. The copper-iron connection in biology: Structure of the metallo-oxidase Fet3p

    PubMed Central

    Taylor, Alexander B.; Stoj, Christopher S.; Ziegler, Lynn; Kosman, Daniel J.; Hart, P. John

    2005-01-01

    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O2 to H2O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase. PMID:16230618

  1. The copper-iron connection in biology: structure of the metallo-oxidase Fet3p.

    PubMed

    Taylor, Alexander B; Stoj, Christopher S; Ziegler, Lynn; Kosman, Daniel J; Hart, P John

    2005-10-25

    Fet3p is a multicopper-containing glycoprotein localized to the yeast plasma membrane that catalyzes the oxidation of Fe(II) to Fe(III). This ferrous iron oxidation is coupled to the reduction of O(2) to H(2)O and is termed the ferroxidase reaction. Fet3p-produced Fe(III) is transferred to the permease Ftr1p for import into the cytosol. The posttranslational insertion of four copper ions into Fet3p is essential for its activity, thus linking copper and iron homeostasis. The mammalian ferroxidases ceruloplasmin and hephaestin are homologs of Fet3p. Loss of the Fe(II) oxidation catalyzed by these proteins results in a spectrum of pathological states, including death. Here, we present the structure of the Fet3p extracellular ferroxidase domain and compare it with that of human ceruloplasmin and other multicopper oxidases that are devoid of ferroxidase activity. The Fet3p structure delineates features that underlie the unique reactivity of this and homologous multicopper oxidases that support the essential trafficking of iron in diverse eukaryotic organisms. The findings are correlated with biochemical and physiological data to cross-validate the elements of Fet3p that define it as both a ferroxidase and cuprous oxidase. PMID:16230618

  2. Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission

    PubMed Central

    Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei

    2014-01-01

    Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

  3. Nitric oxide mediated amelioration of arsenic toxicity which alters the alternative oxidase (Aox1) gene expression in Hordeum vulgare L.

    PubMed

    Shukla, Pratiksha; Singh, Shalini; Dubey, Pragyan; Singh, Aradhana; Singh, A K

    2015-10-01

    The role of nitric oxide (NO) as a key molecule in the signal transduction pathway of a biotic stress response has already been described. Recent studies indicate that it also participate in the signaling of abiotic stresses. In the present study, we showed the altered expression of stress responsive gene alternative oxidase (Aox1) in seedlings of barley (Hordeum vulgare L.) in response to arsenic toxicity. Arsenic toxicity decreased the germination percentage, biomass, chlorophyll and carotenoid content whereas, arsenic toxicity enhanced the MDA content and proline content in a dose dependent manner. Other enzyme activities like catalase and superoxide dismutase increased with the increase in concentrations but it fell down at higher concentration of arsenic. Pretreatment of nitric oxide results in the enhanced expression of alternative oxidase which showed the adaptation of alternative pathway during the arsenic stress and it also enhances the growth ability and adaptability towards the arsenic stress. The results support the conclusion that nitric oxide ameliorates the arsenic toxicity not only at the level of antioxidant defense but also by affecting other mechanism of detoxification. PMID:26036416

  4. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  5. Missense Mutations in Cytochrome c Maturation Genes Provide New Insights into Rhodobacter capsulatus cbb3-Type Cytochrome c Oxidase Biogenesis

    PubMed Central

    Ekici, Seda; Jiang, Xinpei; Koch, Hans-Georg

    2013-01-01

    The Rhodobacter capsulatus cbb3-type cytochrome c oxidase (cbb3-Cox) belongs to the heme-copper oxidase superfamily, and its subunits are encoded by the ccoNOQP operon. Biosynthesis of this enzyme is complex and needs dedicated biogenesis genes (ccoGHIS). It also relies on the c-type cytochrome maturation (Ccm) process, which requires the ccmABCDEFGHI genes, because two of the cbb3-Cox subunits (CcoO and CcoP) are c-type cytochromes. Recently, we reported that mutants lacking CcoA, a major facilitator superfamily type transporter, produce very small amounts of cbb3-Cox unless the growth medium is supplemented with copper. In this work, we isolated “Cu-unresponsive” derivatives of a ccoA deletion strain that exhibited no cbb3-Cox activity even upon Cu supplementation. Molecular characterization of these mutants revealed missense mutations in the ccmA or ccmF gene, required for the Ccm process. As expected, Cu-unresponsive mutants lacked the CcoO and CcoP subunits due to Ccm defects, but remarkably, they contained the CcoN subunit of cbb3-Cox. Subsequent construction and examination of single ccm knockout mutants demonstrated that membrane insertion and stability of CcoN occurred in the absence of the Ccm process. Moreover, while the ccm knockout mutants were completely incompetent for photosynthesis, the Cu-unresponsive mutants grew photosynthetically at lower rates and produced smaller amounts of cytochromes c1 and c2 than did a wild-type strain due to their restricted Ccm capabilities. These findings demonstrate that different levels of Ccm efficiency are required for the production of various c-type cytochromes and reveal for the first time that maturation of the heme-Cu-containing subunit CcoN of R. capsulatus cbb3-Cox proceeds independently of that of the c-type cytochromes during the biogenesis of this enzyme. PMID:23123911

  6. Missense mutations in cytochrome c maturation genes provide new insights into Rhodobacter capsulatus cbb3-type cytochrome c oxidase biogenesis.

    PubMed

    Ekici, Seda; Jiang, Xinpei; Koch, Hans-Georg; Daldal, Fevzi

    2013-01-01

    The Rhodobacter capsulatus cbb(3)-type cytochrome c oxidase (cbb(3)-Cox) belongs to the heme-copper oxidase superfamily, and its subunits are encoded by the ccoNOQP operon. Biosynthesis of this enzyme is complex and needs dedicated biogenesis genes (ccoGHIS). It also relies on the c-type cytochrome maturation (Ccm) process, which requires the ccmABCDEFGHI genes, because two of the cbb(3)-Cox subunits (CcoO and CcoP) are c-type cytochromes. Recently, we reported that mutants lacking CcoA, a major facilitator superfamily type transporter, produce very small amounts of cbb(3)-Cox unless the growth medium is supplemented with copper. In this work, we isolated "Cu-unresponsive" derivatives of a ccoA deletion strain that exhibited no cbb(3)-Cox activity even upon Cu supplementation. Molecular characterization of these mutants revealed missense mutations in the ccmA or ccmF gene, required for the Ccm process. As expected, Cu-unresponsive mutants lacked the CcoO and CcoP subunits due to Ccm defects, but remarkably, they contained the CcoN subunit of cbb(3)-Cox. Subsequent construction and examination of single ccm knockout mutants demonstrated that membrane insertion and stability of CcoN occurred in the absence of the Ccm process. Moreover, while the ccm knockout mutants were completely incompetent for photosynthesis, the Cu-unresponsive mutants grew photosynthetically at lower rates and produced smaller amounts of cytochromes c(1) and c(2) than did a wild-type strain due to their restricted Ccm capabilities. These findings demonstrate that different levels of Ccm efficiency are required for the production of various c-type cytochromes and reveal for the first time that maturation of the heme-Cu-containing subunit CcoN of R. capsulatus cbb(3)-Cox proceeds independently of that of the c-type cytochromes during the biogenesis of this enzyme. PMID:23123911

  7. THE ISOAMYL OXIDASE GENE IN PENICILLIUM GRISEOFULVUM IS PART OF THE PATULIN BIOSYNTHETIC PATHWAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

  8. SURF1 gene mutations in three cases with Leigh syndrome and cytochrome c oxidase deficiency.

    PubMed

    Moslemi, A-R; Tulinius, M; Darin, N; Aman, P; Holme, E; Oldfors, A

    2003-10-14

    Leigh syndrome (LS) is one of the most frequent forms of mitochondrial disease in infancy and childhood. Mutations in SURF1 have been shown to be an important cause of LS with cytochrome c oxidase (COX) deficiency. The authors have identified four pathogenic mutations including a novel, in-frame, 15-bp tandem duplication (806-820) in exon 8 and a novel 751+1G>A splice site mutation in SURF1 in three cases of LS with COX deficiency. PMID:14557577

  9. Mislocalisation of hephaestin, a multicopper ferroxidase involved in basolateral intestinal iron transport, in the sex linked anaemia mouse

    PubMed Central

    Kuo, Y M; Su, T; Chen, H; Attieh, Z; Syed, B A; McKie, A T; Anderson, G J; Gitschier, J; Vulpe, C D

    2004-01-01

    Background: Hephaestin is a multicopper ferroxidase required for basolateral transport of iron from enterocytes. Sex linked anaemia (sla) mice have a defect in the release of iron from intestinal enterocytes into the circulation due to an interstitial deletion in the hephaestin gene (heph). Results: We have demonstrated that hephaestin is primarily localised to a supranuclear compartment in both intestinal enterocytes and in cultured cells. In normal intestinal enterocytes, hephaestin was also present on the basolateral surface. In sla mice, hephaestin was present only in the supranuclear compartment. In contrast, the iron permease Ireg1 localised to the basolateral membrane in both control and sla mice. Conclusion: We suggest that mislocalisation of hephaestin likely contributes to the functional defect in sla intestinal epithelium. PMID:14724150

  10. A restriction fragment length polymorphism results in a nonconservative amino acid substitution encoded within the first exon of the human lysyl oxidase gene

    SciTech Connect

    Csiszar, K.; Mariani, T.J.; Gosin, J.S.; Deak, S.B.; Boyd, C.D.

    1993-05-01

    A cDNA covering most of the coding sequence for human lysyl oxidase was used to screen, by Southern blot analysis, genomic DNA from circulating lymphocytes obtained from unrelated, apparently normal individuals. A heritable restriction fragment length polymorphism (RFLP) within a PstI restriction site was detected in 36% of individuals screened (a total of 72 chromosomes were analyzed). The major allele was represented as a 1.7-kb PstI restriction fragment. The minor allele was detected as 1.4 and 0.3kb restriction fragments. Lambda phage-DNA recombinants were isolated from a human lung fibroblast genomic DNA library using the human lysyl oxidase cDNA clone. DNA sequence analysis of several selected phage recombinants revealed that 83% of the coding sequence of lysyl oxidase was localized in four separate exons. Analysis of the coding sequence within exon 1, the most 5{prime} exon within the lysyl oxidase gene, revealed that the PstI RFLP was due to a G {r_arrow} A transition resulting in a nonconservative arginine to glutamine substitution proximal to a propeptide cleavage domain encoded by exon 1 of the lysyl oxidase gene. 33 refs., 5 figs., 1 tab.

  11. Identification of a gene essential for protoporphyrinogen IX oxidase activity in the cyanobacterium Synechocystis sp. PCC6803

    PubMed Central

    Kato, Kazushige; Tanaka, Ryouichi; Sano, Shinsuke; Tanaka, Ayumi; Hosaka, Hideo

    2010-01-01

    Protoporphyrinogen oxidase (Protox) catalyses the oxidation of protoporphyrinogen IX to protoporphyrin IX during the synthesis of tetrapyrrole molecules. Protox is encoded by the hemY gene in eukaryotes and by the hemG gene in many ?-proteobacteria, including Escherichia coli. It has been suggested that other bacteria possess a yet unidentified type of Protox. To identify a unique bacterial gene encoding Protox, we first introduced the Arabidopsis hemY gene into the genome of the cyanobacterium, Synechocystis sp. PCC6803. We subsequently mutagenized the cells by transposon tagging and screened the tagged lines for mutants that were sensitive to acifluorfen, which is a specific inhibitor of the hemY-type Protox. Several cell lines containing the tagged slr1790 locus exhibited acifluorfen sensitivity. The slr1790 gene encodes a putative membrane-spanning protein that is distantly related to the M subunit of NADH dehydrogenase complex I. We attempted to disrupt this gene in the wild-type background of Synechocystis, but we were only able to obtain heteroplasmic disruptants. These cells accumulated a substantial amount of protoporphyrin IX, suggesting that the slr1790 gene is essential for growth and Protox activity of cells. We found that most cyanobacteria and many other bacteria possess slr1790 homologs. We overexpressed an slr1790 homolog of Rhodobacter sphaeroides in Escherichia coli and found that this recombinant protein possesses Protox activity in vitro. These results collectively demonstrate that slr1790 encodes a unique Protox enzyme and we propose naming the slr1790 gene hemJ. PMID:20823222

  12. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  13. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  14. The role of the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of COX (cytochrome c oxidase) I and COX III mRNA.

    PubMed

    Xu, Fenghao; Morin, Charles; Mitchell, Grant; Ackerley, Cameron; Robinson, Brian H

    2004-08-15

    Leigh syndrome French Canadian (LSFC) is a variant of cytochrome oxidase deficiency found in Québec and caused by mutations in the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene. Northern blots showed that the LRPPRC mRNA levels seen in skeletal muscle>heart>placenta>kidney>liver>lung=brain were proportionally almost opposite in strength to the severity of the enzymic cytochrome oxidase defect. The levels of COX (cytochrome c oxidase) I and COX III mRNA visible on Northern blots were reduced in LSFC patients due to the common (A354V, Ala354-->Val) founder mutation. The amount of LRPPRC protein found in both fibroblast and liver mitochondria from LSFC patients was consistently reduced to <30% of control levels. Import of [(35)S]methionine LRPPRC into rat liver mitochondria was slower for the mutant (A354V) protein. A titre of LRPPRC protein was also found in nuclear fractions that could not be easily accounted for by mitochondrial contamination. [35S]Methionine labelling of mitochondrial translation products showed that the translation of COX I, and perhaps COX III, was specifically reduced in the presence of the mutation. These results suggest that the gene product of LRPPRC, like PET 309p, has a role in the translation or stability of the mRNA for mitochondrially encoded COX subunits. A more diffuse distribution of LRPPRC in LSFC cells compared with controls was evident when viewed by immunofluorescence microscopy, with less LRPPRC present in peripheral mitochondria. PMID:15139850

  15. Unusual clinical presentations in four cases of Leigh disease, cytochrome C oxidase deficiency, and SURF1 gene mutations.

    PubMed

    Tay, Stacey K H; Sacconi, Sabrina; Akman, H Ohran; Morales, Judith F; Morales, Augusto; De Vivo, Darryl C; Shanske, Sara; Bonilla, Eduardo; DiMauro, Salvatore

    2005-08-01

    Mutations in the SURF1 gene are the most frequent causes of Leigh disease with cytochrome c oxidase deficiency. We describe four children with novel SURF1 mutations and unusual features: three had prominent renal symptoms and one had ragged red fibers in the muscle biopsy. We identified five pathogenic mutations in SURF1: two mutations were novel, an in-frame nonsense mutation (834G-->A) and an out-of-frame duplication (820-824dupTACAT). Although renal manifestations have not been described in association with SURF1 mutations, they can be part of the clinical presentation. Likewise, mitochondrial proliferation in muscle (with ragged red fibers) is most unusual in Leigh disease but might be part of an emerging phenotype. PMID:16225813

  16. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  17. Molecular Characterization of Fire Ants, Solenopsis spp., from Brazil Based on Analysis of mtDNA Gene Cytochrome Oxidase I

    PubMed Central

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  18. Molecular characterization of fire ants, Solenopsis spp., from Brazil based on analysis of mtDNA gene cytochrome oxidase I.

    PubMed

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  19. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes contributed to browning reactions in tuber tissues but their effect was not equal. Different PPO genes may be regulated independently reflecting their diversified functions. Our results show that amiRNAs can be used to suppress closely related members of highly conserved multi-gene family. This approach also suggests a new strategy for breeding low-browning crops using small DNA inserts. PMID:24618103

  20. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muoz, Nama; Driss, Fathi; Sanchez, Manuel; Fumeron, Frdric; Roussel, Ronan; Hadjadj, Samy; Corra-Giannella, Maria Lcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with a role for NADPH oxidase in the pathophysiology of kidney complications of diabetes. PMID:25862415

  1. Expression of a Streptomyces 3-hydroxysteroid oxidase gene in oilseeds for converting phytosterols to phytostanols.

    PubMed

    Venkatramesh, Mylavarapu; Karunanandaa, Balasulojini; Sun, Bin; Gunter, Catharine A; Boddupalli, Sekhar; Kishore, Ganesh M

    2003-01-01

    Plant sterols and their hydrogenated forms, stanols, have attracted much attention because of their benefits to human health in reducing serum and LDL cholesterol levels, with vegetable oil processing being their major source in several food products currently sold. The predominant forms of plant sterol end products are sitosterol, stigmasterol, campesterol and brassicasterol (in brassica). In this study, 3-hydroxysteroid oxidase from Streptomyces hygroscopicus was utilized to engineer oilseeds from rapeseed (Brassica napus) and soybean (Glycine max), respectively, to modify the relative amounts of specific sterols to stanols. Each of the major phytosterols had its C-5 double bond selectively reduced to the corresponding phytostanol without affecting other functionalities, such as the C-22 double bond of stigmasterol in soybean seed and of brassicasterol in rapeseed. Additionally, several novel phytostanols were obtained that are not produced by chemical hydrogenation of phytosterols normally present in plants. PMID:12475617

  2. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  3. Activation tagging of a dominant gibberellin catabolism gene (GA 2-oxidase) from poplar that regulates tree stature.

    PubMed

    Busov, Victor B; Meilan, Richard; Pearce, David W; Ma, Caiping; Rood, Stewart B; Strauss, Steven H

    2003-07-01

    We identified a dwarf transgenic hybrid poplar (Populus tremula x Populus alba) after screening of 627 independent activation-tagged transgenic lines in tissue culture, greenhouse, and field environments. The cause of the phenotype was a hyperactivated gene encoding GA 2-oxidase (GA2ox), the major gibberellin (GA) catabolic enzyme in plants. The mutation resulted from insertion of a strong transcriptional enhancer near the transcription start site. Overexpression of the poplar GA2ox gene (PtaGA2ox1) caused hyperaccumulation of mRNA transcripts, quantitative shifts in the spectrum of GAs, and similarity in phenotype to transgenic poplars that overexpress a bean (Phaseolus coccineus) GA2ox gene. The poplar PtaGA2ox1 sequence was most closely related to PsGA2ox2 from pea (Pisum sativum) and two poorly known GA2oxs from Arabidopsis (AtGA2ox4 and AtGA2ox5). The dwarf phenotype was reversible through gibberellic acid application to the shoot apex. Transgenic approaches to producing semidwarf trees for use in arboriculture, horticulture, and forestry could have significant economic and environmental benefits, including altered fiber and fruit production, greater ease of management, and reduced risk of spread in wild populations. PMID:12857810

  4. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

    2013-01-01

    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  5. High-resolution melting analysis of 15 genes in 60 patients with cytochrome-c oxidase deficiency.

    PubMed

    Vondrackova, Alzbeta; Vesela, Katerina; Hansikova, Hana; Docekalova, Dagmar Zajicova; Rozsypalova, Eva; Zeman, Jiri; Tesarova, Marketa

    2012-07-01

    Cytochrome-c oxidase (COX) deficiency is one of the common childhood mitochondrial disorders. Mutations in genes for the assembly factors SURF1 and SCO2 are prevalent in children with COX deficiency in the Slavonic population. Molecular diagnosis is difficult because of the number of genes involved in COX biogenesis and assembly. The aim of this study was to screen for mutations in 15 nuclear genes that encode the 10 structural subunits, their isoforms and two assembly factors of COX in 60 unrelated Czech children with COX deficiency. Nine novel variants were identified in exons and adjacent intronic regions of COX4I2, COX6A1, COX6A2, COX7A1, COX7A2 and COX10 using high-resolution melting (HRM) analysis. Online bioinformatics servers were used to predict the importance of the newly identified amino-acid substitutions. The newly characterized variants updated the contemporary spectrum of known genetic sequence variations that are present in the Czech population, which will be important for further targeted mutation screening in Czech COX-deficient children. HRM and predictive bioinformatics methodologies are advantageous because they are low-cost screening tools that complement large-scale genomic studies and reduce the required time and effort. PMID:22592081

  6. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  7. Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in Saccharomyces cerevisiae.

    PubMed Central

    Bonnefoy, N; Kermorgant, M; Groudinsky, O; Minet, M; Slonimski, P P; Dujardin, G

    1994-01-01

    The yeast nuclear gene OXA1 is essential for cytochrome oxidase assembly, so that a null mutation in the OXA1 gene leads to complete respiratory deficiency. We have cloned by genetic selection a human OXA1 (OXA1Hs) cDNA that complements the respiratory defect of yeast oxa1 mutants. The deduced sequence of the human protein shares 33% identity with the yeast OXA1 protein. The OXA1Hs cDNA corresponds to a single and relatively highly expressed gene. Oxygen consumption measurements and cytochrome absorption spectra show that replacement of the yeast protein with the human homolog leads to the correct assembly of cytochrome oxidase, suggesting that the proteins play essentially the same role in both organisms. Images PMID:7991568

  8. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli. PMID:26369789

  9. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.

    2013-01-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  10. [Cloning and expression of Aspergillus niger glucose oxidase gene in methylotrophic yeast].

    PubMed

    Zhou, Y F; Zhang, X E; Liu, H; Zhang, C G; Cass, A E

    2001-07-01

    The DNA fragment encoding A. niger glucose oxidase was amplified by PCR using A. niger genomic DNA as template, and was cloned into vector of pPIC9 for expression in Pichia pastoris. When transformed into methylotrophic yeast Pichia pastoris GS115, The constructed plasmid pPICGOD1 directed the synthesis and secretion of functionally active GOD. After induction in MM medium for 4 days, the GOD activity in the medium reached 30-40 u/mL. SDS-PAGE revealed that recombinant yeast GOD was expressed up to 60%-70% of the total soluble protein, and the secreted GOD could be purified to electrophoretic homogeneity with one purification step using Q Sepharose Fast Flow ion exchange chromatography. The recombinant yeast GOD had very high catalytic activity, showed about 1.6-fold increase of specific activity over the commercial A. niger GOD. Kinetic analysis clearly demonstrated that recombinant yeast GOD showed similar substrate affinity for glucose to A. niger GOD, but the turnover number of the GOD from yeast was determined to be much higher than that of A. niger GOD. In addition, the linear range of glucose electrode made with recombinant yeast GOD was efficiently widened due to the high catalytic activity of yeast GOD. PMID:11702696

  11. Dual gene defects involving delta-aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient.

    PubMed

    Akagi, Reiko; Inoue, Rikako; Muranaka, Shikibu; Tahara, Tsuyoshi; Taketani, Shigeru; Anderson, Karl E; Phillips, John D; Sassa, Shigeru

    2006-01-01

    Summary A Caucasian male had symptoms of acute porphyria, with increases in urinary delta-aminolaevulinic acid (ALA), porphobilinogen (PBG) and coproporphyrin that were consistent with hereditary coproporphyria (HCP). However, a greater than expected increase in ALA, compared with PBG, and a substantial increase in erythrocyte zinc protoporphyrin, suggested additional ALA dehydratase (ALAD) deficiency. Nucleotide sequence analysis of coproporphyrinogen oxidase (CPO) cDNA of the patient, but not of the parents, revealed a novel nucleotide transition G835-->C, resulting in an amino acid change, G279R. The mutant CPO protein expressed in Escherichia coli was unstable, and produced about 5% of activity compared with the wild-type CPO. Erythrocyte ALAD activity was 32% of normal in the proband. Nucleotide sequence analysis of cloned ALAD cDNAs from the patient revealed a C36-->G base transition (F12L amino acid change). The F12L ALAD mutation, which was found in the mother and a brother, was previously described, and is known to lack any enzyme activity. This patient thus represents the first case of porphyria where both CPO and ALAD deficiencies were demonstrated at the molecular level. PMID:16398658

  12. The P450-4 gene of Gibberella fujikuroi encodes ent-kaurene oxidase in the gibberellin biosynthesis pathway.

    PubMed

    Tudzynski, B; Hedden, P; Carrera, E; Gaskin, P

    2001-08-01

    At least five genes of the gibberellin (GA) biosynthesis pathway are clustered on chromosome 4 of Gibberella fujikuroi; these genes encode the bifunctional ent-copalyl diphosphate synthase/ent-kaurene synthase, a GA-specific geranylgeranyl diphosphate synthase, and three cytochrome P450 monooxygenases. We now describe a fourth cytochrome P450 monooxygenase gene (P450-4). Gas chromatography-mass spectrometry analysis of extracts of mycelia and culture fluid of a P450-4 knockout mutant identified ent-kaurene as the only intermediate of the GA pathway. Incubations with radiolabeled precursors showed that the metabolism of ent-kaurene, ent-kaurenol, and ent-kaurenal was blocked in the transformants, whereas ent-kaurenoic acid was metabolized efficiently to GA(4). The GA-deficient mutant strain SG139, which lacks the 30-kb GA biosynthesis gene cluster, converted ent-kaurene to ent-kaurenoic acid after transformation with P450-4. The B1-41a mutant, described as blocked between ent-kaurenal and ent-kaurenoic acid, was fully complemented by P450-4. There is a single nucleotide difference between the sequence of the B1-41a and wild-type P450-4 alleles at the 3' consensus sequence of intron 2 in the mutant, resulting in reduced levels of active protein due to a splicing defect in the mutant. These data suggest that P450-4 encodes a multifunctional ent-kaurene oxidase catalyzing all three oxidation steps between ent-kaurene and ent-kaurenoic acid. PMID:11472927

  13. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits.

    PubMed

    Liu, Yu-Li; Wang, Sheng-Chang; Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V; Tsuang, Ming T; Chen, Wei J; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  14. Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity

    PubMed Central

    Shetty, Rohit; Sathyanarayanamoorthy, Arunapriya; Ramachandra, Reshma Airody; Arora, Vishal; Ghosh, Anuprita; Srivatsa, Purnima Raman; Pahuja, Natasha; Nuijts, Rudy M. M. A.; Sinha-Roy, Abhijit; Ghosh, Arkasubhra

    2015-01-01

    Purpose Keratoconus (KC) is characterized by progressive vision loss due to corneal thinning and structural abnormalities. It is hypothesized that KC is caused by deregulated collagen levels and collagen fibril-maturating enzyme lysyl oxidase (LOX). Further, it is currently not understood whether the gene expression deregulated by the corneal epithelium influences KC pathogenesis. We studied (i) the expressions of the LOX, collagen I (COL IA1), collagen IV (COL IVA1), MMP9, and IL6 genes in KC corneal epithelia, (ii) validated their expression levels in patient tissues, and (iii) correlated expression levels with KC disease severity. The primary goal of this study was to evaluate the importance of these genes in the progression of KC. Methods We analyzed the gene expression levels of the key proteins LOX, collagens (COL IA1 and COL IVA1), MMP9, and IL6 in debrided corneal epithelia from a large cohort of KC patients (90 eyes) and compared them to control patients (52 eyes) without KC. We measured the total LOX activity in the tears of KC patients compared to controls. We also correlated the protein expression levels of LOX and collagens by immunohistochemistry (IHC) in primary tissues from KC patients (27 eyes) undergoing keratoplasty compared to healthy donor corneas (15 eyes). Results We observed a significant reduction in LOX transcript levels in KC corneal epithelia, and LOX activity in KC tears correlated with disease severity. Collagen transcripts were also reduced in KC while MMP9 transcript levels were upregulated and correlated with disease severity. IL6 was moderately increased in KC patients. IHC demonstrated a reduction in the protein expression levels of LOX in the epithelium and collagen IV in the basement membrane of KC patients compared to healthy donor corneas. Conclusions The data demonstrates that the structural deformity of the KC cornea may be dependent on reduced expressions of collagens and LOX, as well as on MMP9 elevated by the corneal epithelium. PMID:25593510

  15. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  16. Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity

    PubMed Central

    Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan

    2013-01-01

    The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

  17. Characterization of the Regulatory and Expression Context of an Alternative Oxidase Gene Provides Insights into Cyanide-Insensitive Respiration during Growth and Development1[C][W][OA

    PubMed Central

    Ho, Lois H.M.; Giraud, Estelle; Lister, Ryan; Thirkettle-Watts, David; Low, Jasmine; Clifton, Rachel; Howell, Katharine A.; Carrie, Chris; Donald, Tamzin; Whelan, James

    2007-01-01

    Alternative oxidase (AOX) is encoded in small multigene families in plants. Functional analysis of the Arabidopsis (Arabidopsis thaliana) alternative oxidase 1c (AtAOX1c) promoter, an AOX gene not induced by oxidative stress, indicated that regulation of expression was complex, with the upstream promoter region containing positive and negative response regions. Comparison to the promoter region of soybean (Glycine max) alternative oxidase 2b (GmAOX2b), another AOX gene not induced by oxidative stress, revealed that they contained seven sequence elements in common. All elements were active in the promoter region of AtAOX1c in suspension cells and in leaf tissue from Columbia and mutant plants, where a mitochondrial protein import receptor was inactivated. Analysis of coexpressed and putatively coregulated genes, the latter defined as containing five or more sequence elements functional in AtAOX1c, indicated that AtAOX1c was coregulated with components involved with cell division and growth. Consistent with this analysis, we demonstrated that site II elements, previously shown to regulate the proliferating cell nuclear antigen, are present in the upstream promoter region of AtAOX1c and were strong negative regulators of AtAOX1c expression. It was demonstrated that NDB4, a gene encoding an external NAD(P)H dehydrogenase, displayed strong coexpression with AtAOX1c. Overall, these results indicate that AtAOX1c is regulated by growth and developmental signals. PMID:17322330

  18. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression.

    PubMed

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

    2013-07-01

    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573

  19. Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.

    PubMed

    Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K

    2014-08-01

    Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G. pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G. pecorum. High haplotype diversity was observed among G. pecorum populations from all host species, indicating that the G. pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G. pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G. pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures. PMID:25171609

  20. The choline oxidase gene codA confers salt tolerance to transgenic Eucalyptus globulus in a semi-confined condition.

    PubMed

    Yu, Xiang; Kikuchi, Akira; Matsunaga, Etsuko; Morishita, Yoshihiko; Nanto, Kazuya; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa; Watanabe, Kazuo N

    2013-06-01

    The performance of tree species is influenced by environmental factors and growth stages. To evaluate the practical performance of transgenic tree species, it is insufficient to grow small, young trees under controlled conditions, such as in a growth chamber. Three transgenic Eucalyptus globulus lines, carrying the choline oxidase gene, were investigated for their salt tolerance and expression of the transgene at the young plantlet stage in a special netted-house. To clarify the characteristics at the young as well during the later stages, salt tolerance and the properties of the transgenic lines at large juvenile and adult stages were evaluated in the special netted-house. All transgenic lines showed high glycinebetaine content, particularly in young leaves. Trees of the transgenic line 107-1 showed low damage because of salinity stress based on the results from the chlorophyll analysis and malondialdehyde content, and they survived the high-salt-shock treatment at the large juvenile and adult stages. Only this line showed salt tolerance at all stages in the special netted-house. In this evaluation in the special netted-house, the tolerant line among young plantlets might perform better at all stages. Since evaluation in these special netted-house mimics field evaluation, line 107-1 is a potential tolerant line. PMID:22752644

  1. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

    PubMed

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-01-01

    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma. PMID:21921941

  2. Finding New Enzymes from Bacterial Physiology: A Successful Approach Illustrated by the Detection of Novel Oxidases in Marinomonas mediterranea

    PubMed Central

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

    2010-01-01

    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid l-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for l-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  3. Finding new enzymes from bacterial physiology: a successful approach illustrated by the detection of novel oxidases in Marinomonas mediterranea.

    PubMed

    Sanchez-Amat, Antonio; Solano, Francisco; Lucas-Elío, Patricia

    2010-01-01

    The identification and study of marine microorganisms with unique physiological traits can be a very powerful tool discovering novel enzymes of possible biotechnological interest. This approach can complement the enormous amount of data concerning gene diversity in marine environments offered by metagenomic analysis, and can help to place the activities associated with those sequences in the context of microbial cellular metabolism and physiology. Accordingly, the detection and isolation of microorganisms that may be a good source of enzymes is of great importance. Marinomonas mediterranea, for example, has proven to be one such useful microorganism. This Gram-negative marine bacterium was first selected because of the unusually high amounts of melanins synthesized in media containing the amino acid L-tyrosine. The study of its molecular biology has allowed the cloning of several genes encoding oxidases of biotechnological interest, particularly in white and red biotechnology. Characterization of the operon encoding the tyrosinase responsible for melanin synthesis revealed that a second gene in that operon encodes a protein, PpoB2, which is involved in copper transfer to tyrosinase. This finding made PpoB2 the first protein in the COG5486 group to which a physiological role has been assigned. Another enzyme of interest described in M. mediterranea is a multicopper oxidase encoding a membrane-associated enzyme that shows oxidative activity on a wide range of substrates typical of both laccases and tyrosinases. Finally, an enzyme very specific for L-lysine, which oxidises this amino acid in epsilon position and that has received a new EC number (1.4.3.20), has also been described for M. mediterranea. Overall, the studies carried out on this bacterium illustrate the power of exploring the physiology of selected microorganisms to discover novel enzymes of biotechnological relevance. PMID:20411113

  4. Diversity of arsenite oxidase gene and arsenotrophic bacteria in arsenic affected Bangladesh soils.

    PubMed

    Sanyal, Santonu Kumar; Mou, Taslin Jahan; Chakrabarty, Ram Prosad; Hoque, Sirajul; Hossain, M Anwar; Sultana, Munawar

    2016-03-01

    Arsenic (As) contaminated soils are enriched with arsenotrophic bacteria. The present study analyzes the microbiome and arsenotrophic genes-from As affected soil samples of Bhanga, Charvadrason and Sadarpur of Faridpur district in Bangladesh in summer (SFDSL1, 2, 3) and in winter (WFDSL1, 2, 3). Total As content of the soils was within the range of 3.24-17.8 mg/kg as per atomic absorption spectroscopy. The aioA gene, conferring arsenite [As (III)] oxidation, was retrieved from the soil sample, WFDSL-2, reported with As concentration of 4.9 mg/kg. Phylogenetic analysis revealed that the aioA genes of soil WFDSL-2 were distributed among four major phylogenetic lineages comprised of α, β, γ Proteobacteria and Archaea with a dominance of β Proteobacteria (56.67 %). An attempt to enrich As (III) metabolizing bacteria resulted 53 isolates. ARDRA (amplified ribosomal DNA restriction analysis) followed by 16S rRNA gene sequencing of the 53 soil isolates revealed that they belong to six genera; Pseudomonas spp., Bacillus spp., Brevibacillus spp., Delftia spp., Wohlfahrtiimonas spp. and Dietzia spp. From five different genera, isolates Delftia sp. A2i, Pseudomonas sp. A3i, W. chitiniclastica H3f, Dietzia sp. H2f, Bacillus sp. H2k contained arsB gene and showed arsenite tolerance up-to 27 mM. Phenotypic As (III) oxidation potential was also confirmed with the isolates of each genus and isolate Brevibacillus sp. A1a showed significant As (III) transforming potential of 0.2425 mM per hour. The genetic information of bacterial arsenotrophy and arsenite oxidation added scientific information about the possible bioremediation potential of the soil isolates in Bangladesh. PMID:26980601

  5. Reconstructing Mammalian Phylogenies: A Detailed Comparison of the Cytochrome b and Cytochrome Oxidase Subunit I Mitochondrial Genes

    PubMed Central

    Tobe, Shanan S.; Kitchener, Andrew C.; Linacre, Adrian M. T.

    2010-01-01

    The phylogeny and taxonomy of mammalian species were originally based upon shared or derived morphological characteristics. However, genetic analyses have more recently played an increasingly important role in confirming existing or establishing often radically different mammalian groupings and phylogenies. The two most commonly used genetic loci in species identification are the cytochrome oxidase I gene (COI) and the cytochrome b gene (cyt b). For the first time this study provides a detailed comparison of the effectiveness of these two loci in reconstructing the phylogeny of mammals at different levels of the taxonomic hierarchy in order to provide a basis for standardizing methodologies in the future. Interspecific and intraspecific variation is assessed and for the first time, to our knowledge, statistical confidence is applied to sequence comparisons. Comparison of the DNA sequences of 217 mammalian species reveals that cyt b more accurately reconstructs their phylogeny and known relationships between species based on other molecular and morphological analyses at Super Order, Order, Family and generic levels. Cyt b correctly assigned 95.85% of mammal species to Super Order, 94.31% to Order and 98.16% to Family compared to 78.34%, 93.36% and 96.93% respectively for COI. Cyt b also gives better resolution when separating species based on sequence data. Using a Kimura 2-parameter p-distance (x100) threshold of 1.5–2.5, cyt b gives a better resolution for separating species with a lower false positive rate and higher positive predictive value than those of COI. PMID:21152400

  6. Secretory expression and purification of Aspergillus niger glucose oxidase in Saccharomyces cerevisiae mutant deficient in PMR1 gene.

    PubMed

    Ko, Ji-Hyun; Hahm, Moon Sun; Kang, Hyun Ah; Nam, Soo Wan; Chung, Bong Hyun

    2002-08-01

    The gene encoding glucose oxidase (GOD) from Aspergillus niger was expressed as a secretory product in the yeast Saccharomyces cerevisiae. Six consecutive histidine residues were fused to the C-terminus of GOD to facilitate purification. The recombinant GOD-His(6) secreted by S. cerevisiae migrated as a broad diffuse band on SDS-PAGE, with an apparent molecular weight higher than that in natural A. niger GOD. To investigate the effects of hyperglycosylation on the secretion efficiency and enzyme properties, GOD-His(6) was expressed and secreted in a S. cerevisiae mutant in which the PMR1 gene encoding Ca(++)-ATPase was disrupted. The pmr1 null mutant strain secreted an amount of GOD-His(6) per unit cell mass higher than that in the wild-type strain. In contrast to the hyperglycosylated GOD-His(6) secreted in the wild-type strain, the pmr1 mutant strain secreted GOD-His(6) in a homogeneous form with a protein band pattern similar to that in natural A. niger GOD, based on SDS-PAGE. The hyperglycosylated and pmr1Delta mutant-derived GOD-His(6) enzymes were purified to homogeneity by immobilized metal ion-affinity chromatography and their specific activities and stabilities were compared. The specific activity of the pmr1Delta mutant-derived GOD-His(6) on a protein basis was very similar to that of the hyperglycosylated GOD-His(6), although its pH and thermal stabilities were lower than those of the hyperglycosylated GOD-His(6). PMID:12182830

  7. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  8. Unravelling mitochondrial retrograde regulation in the abiotic stress induction of rice ALTERNATIVE OXIDASE 1 genes.

    PubMed

    Li, Chun-Rong; Liang, Dan-Dan; Li, Juan; Duan, Yong-Bo; Li, Hao; Yang, Ya-Chun; Qin, Rui-Ying; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo

    2013-04-01

    Mitochondrial retrograde regulation (MRR) is the transduction of mitochondrial signals to mediate nuclear gene expression. It is not clear whether MRR is a common regulation mechanism in plant abiotic stress response. In this study, we analysed the early abiotic stress response of the rice OsAOX1 genes, and the induction of OsAOX1a and OsAOX1b (OsAOX1a/b) was selected as a working model for the stress-induced MRR studies. We found that the induction mediated by the superoxide ion (O2·(-) )-generating chemical methyl viologen was stronger than that of hydrogen peroxide (H2 O2 ). The addition of reactive oxygen species (ROS) scavengers demonstrated that the stress induction was reduced by eliminating O2·(-) . Furthermore, the stress induction did not rely on chloroplast- or cytosol-derived O2·(-) . Next, we generated transgenic plants overexpressing the superoxide dismutase (SOD) gene at different subcellular locations. The results suggest that only the mitochondrial SOD, OsMSD, attenuated the stress induction of OsAOX1a/b specifically. Therefore, our findings demonstrate that abiotic stress initiates the MRR on OsAOX1a/b and that mitochondrial O2·(-) is involved in the process. PMID:22994594

  9. A novel heme a insertion factor gene cotranscribes with the Thermus thermophilus cytochrome ba3 oxidase locus.

    PubMed

    Werner, Carolin; Richter, Oliver-Matthias H; Ludwig, Bernd

    2010-09-01

    Studying the biogenesis of the Thermus thermophilus cytochrome ba(3) oxidase, we analyze heme a cofactor insertion into this membrane protein complex. Only three proteins linked to oxidase maturation have been described for this extreme thermophile, and in particular, no evidence for a canonical Surf1 homologue, required for heme a insertion, is available from genome sequence data. Here, we characterize the product of an open reading frame, cbaX, in the operon encoding subunits of the ba(3)-type cytochrome c oxidase. CbaX shares no sequence identity with any known oxidase biogenesis factor, and CbaX homologues are found only in the Thermaceae group. In a series of cbaX deletion and complementation experiments, we demonstrate that the resulting ba(3) oxidase complexes, affinity purified via an internally inserted His tag located in subunit I, are severely affected in their enzymatic activities and heme compositions in both the low- and high-spin sites. Thus, CbaX displays typical features of a generic Surf1 factor essential for binding and positioning the heme a moiety for correct assembly into the protein scaffold of oxidase subunit I. PMID:20622059

  10. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  11. Oxyphil cell metaplasia in the parathyroids is characterized by somatic mitochondrial DNA mutations in NADH dehydrogenase genes and cytochrome c oxidase activity-impairing genes.

    PubMed

    Müller-Höcker, Josef; Schäfer, Sabine; Krebs, Stefan; Blum, Helmut; Zsurka, Gábor; Kunz, Wolfram S; Prokisch, Holger; Seibel, Peter; Jung, Andreas

    2014-11-01

    Oxyphil cell transformation of epithelial cells due to the accumulation of mitochondria occurs often during cellular aging. To understand the pathogenic mechanisms, we studied mitochondrial DNA (mtDNA) alterations in the three cell types of the parathyroids using multiplex real-time PCR and next-generation sequencing. mtDNA was analyzed from cytochrome c oxidase (COX)-positive and COX-negative areas of 19 parathyroids. Mitochondria-rich pre-oxyphil/oxyphil cells were more prone to develop COX defects than the mitochondria-poor clear chief cells (P < 0.001). mtDNA increased approximately 2.5-fold from clear chief to oxyphil cells. In COX deficiency, the increase was even more pronounced, and COX-negative oxyphil cells had approximately two times more mtDNA than COX-positive oxyphil cells (P < 0.001), illustrating the influence of COX deficiency on mtDNA biosynthesis, probably as a consequence of insufficient ATP synthesis. Next-generation sequencing revealed a broad spectrum of putative pathogenic mtDNA point mutations affecting NADH dehydrogenase and COX genes as well as regulatory elements of mtDNA. NADH dehydrogenase gene mutations preferentially accumulated in COX-positive pre-oxyphil/oxyphil cells and, therefore, could be essential for inducing oxyphil cell transformation by increasing mtDNA/mitochondrial biogenesis. In contrast, COX-negative cells predominantly harbored mutations in the MT-CO1 and MT-CO3 genes and in regulatory mtDNA elements, but only rarely NADH dehydrogenase mutations. Thus, multiple hits in NADH dehydrogenase and COX activity-impairing genes represent the molecular basis of oxyphil cell transformation in the parathyroids. PMID:25418474

  12. The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase.

    PubMed

    Altamura, N; Capitanio, N; Bonnefoy, N; Papa, S; Dujardin, G

    1996-03-11

    The nuclear gene OXA1 was first isolated in Saccharomyces cerevisiae and found to be required at a post-translational step in cytochrome c oxidase biogenesis, probably at the level of assembly. Mutations in OXA1 lead to a complete respiratory deficiency. The protein Oxa1p is conserved through evolution and a human homolog has been isolated by functional complementation of a yeast oxa1- mutant. In order to further our understanding of the role of Oxa1p, we have constructed two yeast strains in which the OXA1 open reading frame was almost totally deleted. Cytochrome spectra and enzymatic activity measurements show the absence of heme aa3 and of a cytochrome c oxido-reductase activity and dramatic decrease of the oligomycin sensitive ATPase activity. Analysis of the respiratory complexes in non-denaturing gels reveals that Oxa1p is necessary for the correct assembly of the cytochrome c oxidase and the ATP synthase complex. PMID:8612730

  13. Functional expression of the Acanthamoeba castellanii alternative oxidase in Escherichia coli; regulation of the activity and evidence for Acaox gene function.

    PubMed

    Antos-Krzeminska, Nina; Jarmuszkiewicz, Wieslawa

    2014-06-01

    To evidence Acanthamoeba castellanii alternative oxidase (AcAOX) gene product function, we studied alterations in the levels of mRNA and protein and AcAOX activity during growth in amoeba batch culture. Moreover, heterologous expression of AcAOX in AOX-deficient Escherichia coli confirmed by the protein immunodetection and functional studies was performed. Despite the presence of native bo and bd quinol oxidases in E. coli membrane, from which the latter is known to be cyanide-resistant, functional expression of AcAOX in E. coli conferred cyanide-resistant benzohydroxamate-sensitive respiration on the bacteria. Moreover, AcAOX activity in transformed bacteria was stimulated by GMP and inhibited by ATP, indicating that AcAOX is regulated by mutual exclusion of purine nucleotides, which was previously demonstrated in the mitochondria of A. castellanii. PMID:24860925

  14. Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.

    PubMed

    Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P

    2013-10-01

    Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth. PMID:23979969

  15. Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations.

    PubMed

    Kovářová, Nikola; Cížková Vrbacká, Alena; Pecina, Petr; Stránecký, Viktor; Pronicka, Ewa; Kmoch, Stanislav; Houštěk, Josef

    2012-07-01

    The loss of Surf1 protein leads to a severe COX deficiency manifested as a fatal neurodegenerative disorder, the Leigh syndrome (LS(COX)). Surf1 appears to be involved in the early step of COX assembly but its function remains unknown. The aim of the study was to find out how SURF1 gene mutations influence expression of OXPHOS and other pro-mitochondrial genes and to further characterize the altered COX assembly. Analysis of fibroblast cell lines from 9 patients with SURF1 mutations revealed a 70% decrease of the COX complex content to be associated with 32-54% upregulation of respiratory chain complexes I, III and V and accumulation of Cox5a subunit. Whole genome expression profiling showed a general decrease of transcriptional activity in LS(COX) cells and indicated that the adaptive changes in OXPHOS complexes are due to a posttranscriptional compensatory mechanism. Electrophoretic and WB analysis showed that in mitochondria of LS(COX) cells compared to controls, the assembled COX is present entirely in a supercomplex form, as I-III₂-IV supercomplex but not as larger supercomplexes. The lack of COX also caused an accumulation of I-III₂ supercomplex. The accumulated Cox5a was mainly present as a free subunit. We have found out that the major COX assembly subcomplexes accumulated due to SURF1 mutations range in size between approximately 85-140kDa. In addition to the originally proposed S2 intermediate they might also represent Cox1-containing complexes lacking other COX subunits. Unlike the assembled COX, subcomplexes are unable to associate with complexes I and III. PMID:22465034

  16. Identification of a Novel Arsenite Oxidase Gene, arxA, in the Haloalkaliphilic, Arsenite-Oxidizing Bacterium Alkalilimnicola ehrlichii Strain MLHE-1 ▿

    PubMed Central

    Zargar, Kamrun; Hoeft, Shelley; Oremland, Ronald; Saltikov, Chad W.

    2010-01-01

    Although arsenic is highly toxic to most organisms, certain prokaryotes are known to grow on and respire toxic metalloids of arsenic (i.e., arsenate and arsenite). Two enzymes are known to be required for this arsenic-based metabolism: (i) the arsenate respiratory reductase (ArrA) and (ii) arsenite oxidase (AoxB). Both catalytic enzymes contain molybdopterin cofactors and form distinct phylogenetic clades (ArrA and AoxB) within the dimethyl sulfoxide (DMSO) reductase family of enzymes. Here we report on the genetic identification of a “new” type of arsenite oxidase that fills a phylogenetic gap between the ArrA and AoxB clades of arsenic metabolic enzymes. This “new” arsenite oxidase is referred to as ArxA and was identified in the genome sequence of the Mono Lake isolate Alkalilimnicola ehrlichii MLHE-1, a chemolithoautotroph that can couple arsenite oxidation to nitrate reduction. A genetic system was developed for MLHE-1 and used to show that arxA (gene locus ID mlg_0216) was required for chemoautotrophic arsenite oxidation. Transcription analysis also showed that mlg_0216 was only expressed under anaerobic conditions in the presence of arsenite. The mlg_0216 gene is referred to as arxA because of its greater homology to arrA relative to aoxB and previous reports that implicated Mlg_0216 (ArxA) of MLHE-1 in reversible arsenite oxidation and arsenate reduction in vitro. Our results and past observations support the position that ArxA is a distinct clade within the DMSO reductase family of proteins. These results raise further questions about the evolutionary relationships between arsenite oxidases (AoxB) and arsenate respiratory reductases (ArrA). PMID:20453090

  17. Sterol uptake induced by an impairment of pyridoxal phosphate synthesis in Saccharomyces cerevisiae: cloning and sequencing of the PDX3 gene encoding pyridoxine (pyridoxamine) phosphate oxidase.

    PubMed Central

    Loubbardi, A; Marcireau, C; Karst, F; Guilloton, M

    1995-01-01

    Exogenous sterols do not permeate wild-type Saccharomyces cerevisiae in aerobic conditions. However, mutant strain FKerg7, affected in lanosterol synthase, is a sterol auxotroph which is able to grow aerobically in the presence of ergosterol. Viability of this strain depends on the presence of an additional mutation, aux30, that leads to sterol permeability. Cells bearing the aux30 mutation fail to grow in standard yeast nitrogen base medium containing pyridoxine but grow normally if pyridoxine is replaced by either pyridoxal or pyridoxamine. These mutants are characterized by a lack in pyridoxine (pyridoxamine) phosphate oxidase [P(N/M)P oxidase] (EC 1.4.3.5) activity. The pleiotropic phenotype induced by the aux30 mutation includes a strong perturbation in amino acid biosynthesis. Strains bearing the aux30 mutation also display atypic fatty acid, sterol, and cytochrome patterns. Transformation of an aux30 strain with a replicative vector carrying the wild-type PDX3 gene encoding P(N/M)P oxidase restored wild-type fatty acid, sterol, and cytochrome patterns and suppressed exogenous sterol accumulation. It is proposed that sterol permeation of aux30 strains in mainly the consequence of their leaky Hem- character. The amino acid sequence of S. cerevisiae P(N/M)P oxidase inferred from the nucleotide sequence of PDX3 shows a high percentage of homology with the corresponding enzymes from Escherichia coli and Myxococcus xanthus. Several putative Gcn4p binding sequences are present in the PDX3 promoter region, leading to the assumption that transcription of this gene is under the general control of nitrogen metabolism. PMID:7896706

  18. Transcript levels of the nuclear-encoded respiratory genes in rice decrease by oxygen deprivation: evidence for involvement of calcium in expression of the alternative oxidase 1a gene.

    PubMed

    Tsuji, H; Nakazono, M; Saisho, D; Tsutsumi, N; Hirai, A

    2000-04-14

    We investigated the effect of oxygen on the expressions of respiratory genes encoded in the nuclear and mitochondrial genomes of rice (Oryza sativa L.). Hypoxic treatment decreased the transcript levels of nuclear-encoded, but not mitochondrial-encoded respiratory genes. The effects of ruthenium red (an inhibitor of Ca(2+) fluxes from organelles) and/or CaCl(2) on plants under hypoxic conditions suggested that Ca(2+) is a physiological transducer of a low-oxygen signaling pathway for expression of the alternative oxidase 1a gene (AOX1a), but not for expressions of genes involved in the cytochrome respiratory pathway, in rice. PMID:10767423

  19. Drosophila lysyl oxidases Dmloxl-1 and Dmloxl-2 are differentially expressed and the active DmLOXL-1 influences gene expression and development.

    PubMed

    Molnar, Janos; Ujfaludi, Zsuzsanna; Fong, Sheri F T; Bollinger, John A; Waro, Girma; Fogelgren, Ben; Dooley, David M; Mink, Matyas; Csiszar, Katalin

    2005-06-17

    Mammalian lysyl oxidase (LOX) is essential for the catalysis of lysyl-derived cross-links in fibrillar collagens and elastin in the extracellular matrix and has also been implicated in cell motility, differentiation, and tumor cell invasion. The active LOX has been shown to translocate to the nuclei of smooth muscle cells and regulate chromatin structure and transcription. It is difficult to interpret the role of the LOX protein as it is co-expressed with other members of the LOX amine oxidase family in most mammalian cells. To investigate the function of the LOX proteins, we have characterized the Drosophila lysyl oxidases Dmloxl-1 and Dmloxl-2. We present the gene, domain structure, and expression pattern of Dmloxl-1 and Dmloxl-2 during development. In early development, only Dmloxl-1 was expressed, which allowed functional studies. We have expressed Dmloxl-1 in S2 cells and determined that it is a catalytically active enzyme, inhibited by beta-amino-proprionitrile (BAPN), a specific LOX inhibitor. We localized DmLOXL-1 in the nuclei in embryos and in adult salivary gland cells in the nuclei, cytoplasm, and cell surface, using immunostaining and a DmLOXL-1 antibody. To address the biological function of Dmloxl-1, we raised larvae under BAPN inhibitory conditions and over-expressed Dmloxl-1 in transgenic Drosophila. DmLOXL-1 inhibition resulted in developmental delay and a shift in sex ratio; over-expression in the w(m4) variegating strain increased drosopterin production, demonstrating euchromatinization. Our previous data on the transcriptional down-regulation of seven ribosomal genes and the glue gene under inhibitory conditions and the current results collectively support a nuclear role for Dmloxl-1 in euchromatinization and gene regulation. PMID:15811848

  20. Variation in the Lysyl Oxidase (LOX) Gene Is Associated with Keratoconus in Family-Based and Case-Control Studies

    PubMed Central

    Bykhovskaya, Yelena; Li, Xiaohui; Epifantseva, Irina; Haritunians, Talin; Siscovick, David; Aldave, Anthony; Szczotka-Flynn, Loretta; Iyengar, Sudha K.; Taylor, Kent D.; Rotter, Jerome I.; Rabinowitz, Yaron S

    2012-01-01

    Purpose. Keratoconus is a bilateral noninflammatory progressive corneal disorder with complex genetic inheritance and a common cause for cornea transplantation in young adults. A genomewide linkage scan in keratoconus families identified a locus at 5q23.2, overlapping the gene coding for the lysyl oxidase (LOX). LOX encodes an enzyme responsible for collagen cross-linking in a variety of tissues including the cornea. Corneal collagen cross-linking with long-wave ultraviolet light and riboflavin is a promising new treatment for keratoconus. To determine whether LOX is a genetic determinant of the pathogenesis of keratoconus, we analyzed association results of LOX polymorphisms in two independent case-control samples and in keratoconus families. Methods. Association results were analyzed of single-nucleotide polymorphisms (SNPs) in the LOX gene from a Genome-Wide Association Study (GWAS) investigation in two independent panels of patients with keratoconus and controls and in keratoconus families. Results. Evidence of association was found at SNPs rs10519694 and rs2956540 located in intron 4 of LOX in the GWAS discovery case-control panel with P values of 2.3 × 10−3 and 7 × 10−3, respectively. The same two SNPs were found to be associated with keratoconus by family-based association testing with P values of 2.7 × 10−3 and 7.7 × 10−4, respectively. Meta P values of 4.0 × 10−5 and 4.0 × 10−7 were calculated for SNPs rs10519694 and rs2956540 by analyzing case-control and family samples simultaneously. Sequencing of LOX exons in a subset of keratoconus patients identified two polymorphisms, rs1800449 and rs2288393, located in LOX transcripts I and II, associated with keratoconus in case-control and family samples with a meta P value of 0.02. Conclusions. Results provided strong genetic evidence that LOX variants lead to increased susceptibility to developing of keratoconus. PMID:22661479

  1. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

    2010-01-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  2. High-resolution melting analysis for identifying sequence variations in nuclear genes for assembly factors and structural subunits of cytochrome c oxidase.

    PubMed

    Vondráčková, Alžběta; Veselá, Kateřina; Zeman, Jiří; Tesařová, Markéta

    2015-01-01

    High-resolution melting (HRM) analysis is a simple, sensitive, and cost-effective screening method. HRM enables the detection of homozygous or heterozygous point sequence variants and small deletions within specific PCR products by observing temperature and shape changes in melting curve profiles using fluorescent dyes. Herein, an updated protocol for routine variant screening of nuclear genes encoding assembly factors and structural subunits of cytochrome c oxidase (COX) is described. Nonetheless, the general recommendations given for HRM analysis can be applicable for examining any genetic region of interest. PMID:25631028

  3. The Menkes/Wilson disease gene homologue in yeast provides copper to a ceruloplasmin-like oxidase required for iron uptake.

    PubMed Central

    Yuan, D S; Stearman, R; Dancis, A; Dunn, T; Beeler, T; Klausner, R D

    1995-01-01

    The CCC2 gene of the yeast Saccharomyces cerevisiae is homologous to the human genes defective in Wilson disease and Menkes disease. A biochemical hallmark of these diseases is a deficiency of copper in ceruloplasmin and other copper proteins found in extracytosolic compartments. Here we demonstrate that disruption of the yeast CCC2 gene results in defects in respiration and iron uptake. These defects could be reversed by supplementing cells with copper, suggesting that CCC2 mutant cells were copper deficient. However, cytosolic copper levels and copper uptake were normal. Instead, CCC2 mutant cells lacked a copper-dependent oxidase activity associated with the extracytosolic domain of the FET3-encoded protein, a ceruloplasmin homologue previously shown to be necessary for high-affinity iron uptake in yeast. Copper restored oxidase activity both in vitro and in vivo, paralleling the ability of copper to restore respiration and iron uptake. These results suggest that the CCC2-encoded protein is required for the export of copper from the cytosol into an extracytosolic compartment, supporting the proposal that intracellular copper transport is impaired in Wilson disease and Menkes disease. Images Fig. 1 Fig. 3 PMID:7708696

  4. Cloning and expression in Escherichia coli of the D-aspartate oxidase gene from the yeast Cryptococcus humicola and characterization of the recombinant enzyme.

    PubMed

    Takahashi, Shouji; Takahashi, Toshiyuki; Kera, Yoshio; Matsunaga, Ryuji; Shibuya, Hiroo; Yamada, Ryo-hei

    2004-04-01

    The D-aspartate oxidase (DDO) from the yeast Cryptococcus humicola UJ1 (ChDDO) is highly specific to D-aspartate. The gene encoding ChDDO was cloned and expressed in Escherichia coli. Sequence analysis of the ChDDO gene showed that an open reading frame of 1,110 bp interrupted by two introns encodes a protein of 370 amino acids. The deduced amino acid sequence showed an FAD-binding motif and a peroxisomal targeting signal 1 in the N-terminal region and at the C-terminus, respectively, and also the presence of certain catalytically important amino acid residues corresponding to those catalytically important in D-amino acid oxidase (DAO). The sequence exhibited only a moderate identity to human (27.4%) and bovine (28.0%) DDOs, and a rather higher identity to yeast and fungal DAOs (30.4-33.2%). Similarly, phylogenetic analysis showed that ChDDO is more closely related to yeast and fungal DAOs than to mammalian DDOs. The gene expression was regulated at the transcriptional level and specifically induced by the presence of D-aspartate as the sole nitrogen source. ChDDO was expressed in an active form in E. coli to an approximately 5-fold greater extent than in yeast. The purified recombinant enzyme was identical to the native enzyme in physicochemical and catalytic properties. PMID:15115779

  5. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  6. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  7. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  8. A plant homolog of the neutrophil NADPH oxidase gp91phox subunit gene encodes a plasma membrane protein with Ca2+ binding motifs.

    PubMed Central

    Keller, T; Damude, H G; Werner, D; Doerner, P; Dixon, R A; Lamb, C

    1998-01-01

    Rapid generation of O2- and H2O2, which is reminiscent of the oxidative burst in neutrophils, is a central component of the resistance response of plants to pathogen challenge. Here, we report that the Arabidopsis rbohA (for respiratory burst oxidase homolog A) gene encodes a putative 108-kD protein, with a C-terminal region that shows pronounced similarity to the 69-kD apoprotein of the gp91phox subunit of the neutrophil respiratory burst NADPH oxidase. The RbohA protein has a large hydrophilic N-terminal domain that is not present in gp91phox. This domain contains two Ca2+ binding EF hand motifs and has extended similarity to the human RanGTPase-activating protein 1. rbohA, which is a member of a divergent gene family, generates transcripts of 3.6 and 4.0 kb that differ only in their polyadenylation sites. rbohA transcripts are most abundant in roots, with weaker expression in aerial organs and seedlings. Antibodies raised against a peptide near the RbohA C terminus detected a 105-kD protein that, unlike gp91phox, does not appear to be highly glycosylated. Cell fractionation, two-phase partitioning, and detergent extraction indicate that RbohA is an intrinsic plasma membrane protein. We propose that plants have a plasma membrane enzyme similar to the neutrophil NADPH oxidase but with novel potential regulatory mechanisms for Ca2+ and G protein stimulation of O2- and H2O2 production at the cell surface. PMID:9490748

  9. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  10. The sequence divergence in cytochrome C oxidase I gene of Culex quinquefasciatus mosquito and its comparison with four other Culex species.

    PubMed

    Tahir, Hafiz Muhammad; Kanwal, Naila; Mehwish

    2016-07-01

    The genetic diversity of Culex quinquefasciatus mosquito based on the standard barcode region of cytochrome C oxidase I (COI) gene fragment was studied in the present study. The COI gene sequences of Cx. quinquefasciatus were also compared with four other species of Genus Culex (i.e. Cx. tritaeniorhynchus, Cx. fuscocephala, Cx. pipiens, and Cx. theileri). Our data set included sequences of Culex mosquitoes from 16 different countries of world. The average intraspecific and interspecific divergences recorded were 0.67% and 8.27%, respectively. The clades for five species were clearly separated except Cx. quinquefasciatus and Cx. pipiens. It is concluded that the DNA barcoding is effective and reliable tool for the identification of selected Culex species but create little problem in case of sister species. PMID:26258502

  11. Oxygen Reactivity of Both Respiratory Oxidases in Campylobacter jejuni: the cydAB Genes Encode a Cyanide-Resistant, Low-Affinity Oxidase That Is Not of the Cytochrome bd Type▿

    PubMed Central

    Jackson, Rachel J.; Elvers, Karen T.; Lee, Lucy J.; Gidley, Mark D.; Wainwright, Laura M.; Lightfoot, James; Park, Simon F.; Poole, Robert K.

    2007-01-01

    The microaerophilic bacterium Campylobacter jejuni is a significant food-borne pathogen and is predicted to possess two terminal respiratory oxidases with unknown properties. Inspection of the genome reveals an operon (cydAB) apparently encoding a cytochrome bd-like oxidase homologous to oxidases in Escherichia coli and Azotobacter vinelandii. However, C. jejuni cells lacked all spectral signals characteristic of the high-spin hemes b and d of these oxidases. Mutation of the cydAB operon of C. jejuni did not have a significant effect on growth, but the mutation reduced formate respiration and the viability of cells cultured in 5% oxygen. Since cyanide resistance of respiration was diminished in the mutant, we propose that C. jejuni CydAB be renamed CioAB (cyanide-insensitive oxidase), as in Pseudomonas aeruginosa. We measured the oxygen affinity of each oxidase, using a highly sensitive assay that exploits globin deoxygenation during respiration-catalyzed oxygen uptake. The CioAB-type oxidase exhibited a relatively low affinity for oxygen (Km = 0.8 μM) and a Vmax of >20 nmol/mg/s. Expression of cioAB was elevated fivefold in cells grown at higher rates of oxygen provision. The alternative, ccoNOQP-encoded cyanide-sensitive oxidase, expected to encode a cytochrome cb′-type enzyme, plays a major role in the microaerobic respiration of C. jejuni, since it appeared to be essential for viability and exhibited a much higher oxygen affinity, with a Km value of 40 nM and a Vmax of 6 to 9 nmol/mg/s. Low-temperature photodissociation spectrophotometry revealed that neither oxidase has ligand-binding activity typical of the heme-copper oxidase family. These data are consistent with cytochrome oxidation during photolysis at low temperatures. PMID:17172349

  12. Study on dioxygen reduction by mutational modifications of the hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase

    SciTech Connect

    Morishita, Hirotoshi; Kurita, Daisuke; Kataoka, Kunishige; Sakurai, Takeshi

    2014-07-18

    Highlights: • Proton transport pathway in bilirubin oxidase was mutated. • Two intermediates in the dioxygen reduction steps were trapped and characterized. • A specific glutamate for dioxygen reduction by multicopper oxidases was identified. - Abstract: The hydrogen bond network leading from bulk water to the trinuclear copper center in bilirubin oxidase is constructed with Glu463 and water molecules to transport protons for the four-electron reduction of dioxygen. Substitutions of Glu463 with Gln or Ala were attributed to virtually complete loss or significant reduction in enzymatic activities due to an inhibition of the proton transfer steps to dioxygen. The single turnover reaction of the Glu463Gln mutant afforded the highly magnetically interacted intermediate II (native intermediate) with a broad g = 1.96 electron paramagnetic resonance signal detectable at cryogenic temperatures. Reactions of the double mutants, Cys457Ser/Glu463Gln and Cys457Ser/Glu463Ala afforded the intermediate I (peroxide intermediate) because the type I copper center to donate the fourth electron to dioxygen was vacant in addition to the interference of proton transport due to the mutation at Glu463. The intermediate I gave no electron paramagnetic resonance signal, but the type II copper signal became detectable with the decay of the intermediate I. Structural and functional similarities between multicopper oxidases are discussed based on the present mutation at Glu463 in bilirubin oxidase.

  13. A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

  14. Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae

    PubMed Central

    LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

    2006-01-01

    • Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60 kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

  15. Gene flow between Drosophila yakuba and Drosophila santomea in subunit V of cytochrome c oxidase: A potential case of cytonuclear cointrogression.

    PubMed

    Beck, Emily A; Thompson, Aaron C; Sharbrough, Joel; Brud, Evgeny; Llopart, Ana

    2015-08-01

    Introgression is the effective exchange of genetic information between species through natural hybridization. Previous genetic analyses of the Drosophila yakuba-D. santomea hybrid zone showed that the mitochondrial genome of D. yakuba had introgressed into D. santomea and completely replaced its native form. Since mitochondrial proteins work intimately with nuclear-encoded proteins in the oxidative phosphorylation (OXPHOS) pathway, we hypothesized that some nuclear genes in OXPHOS cointrogressed along with the mitochondrial genome. We analyzed nucleotide variation in the 12 nuclear genes that form cytochrome c oxidase (COX) in 33 Drosophila lines. COX is an OXPHOS enzyme composed of both nuclear- and mitochondrial-encoded proteins and shows evidence of cytonuclear coadaptation in some species. Using maximum-likelihood methods, we detected significant gene flow from D. yakuba to D. santomea for the entire COX complex. Interestingly, the signal of introgression is concentrated in the three nuclear genes composing subunit V, which shows population migration rates significantly greater than the background level of introgression in these species. The detection of introgression in three proteins that work together, interact directly with the mitochondrial-encoded core, and are critical for early COX assembly suggests this could be a case of cytonuclear cointrogression. PMID:26155926

  16. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  17. Characterization of two different genes (cDNA) for cytochrome c oxidase subunit VIa from heart and liver of the rat.

    PubMed Central

    Schlerf, A; Droste, M; Winter, M; Kadenbach, B

    1988-01-01

    By antibody screening of a rat liver and a rat heart cDNA library in lambda gt11 two clones coding for the liver- and heart-specific subunit VIa of rat cytochrome c oxidase were isolated. In the heart cDNA sequence a TAA stop codon was found in frame 18 bp 5' upstream of the first methionine codon, thus excluding a leader sequence for this protein. The two cDNAs contain the full-length coding region of two subunits. The amino acid sequences of the two subunits show only 50% homology, whereas 74% homology was found between rat heart and bovine heart subunit VIa. By Northern blot analysis it is shown that the gene for subunit VIa from heart is only expressed in heart and skeletal muscle, whereas that from liver is also expressed in kidney, brain, heart and weakly in muscle. Images PMID:2461293

  18. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

    PubMed

    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step. PMID:26287950

  19. [Genetic variation and differentiation of wood mice from the genus Sylvaemus inferred from sequencing of the cytochrome oxidase subunit 1 gene fragment].

    PubMed

    Bogdanov, A S; Stakheev, V V; Zykov, A E; Iakimenko, V V; Mal'kova, M G

    2012-02-01

    To ascertain intra- and interspecific differentiation patterns of some Sylvaemus wood mice species (S. uralensis, S. sylvaticus, S. ponticus, S. flavicollis, and S. fulvipectus), sequence variation of the mitochondrial cytochrome oxidase subunit I gene (COI) fragment (654 bp) was analyzed and the data obtained using several molecular genetic markers were compared. Distinct isolation of all Sylvaemus species (including closely related allopatric S. flavicollis and S. ponticus), as well as of the European and Asian races of pygmy wood mouse S. uralensis at the COI gene was demonstrated. However, genetic differences of the Sylvaemus species were 1.5 times and more higher than the distance (D) between the races of S. uralenciis. This finding provides no ample grounds to treat the latter as the independent species. The only specimen of Pamir-Alay subspecies S. uralensis pallipes examined showed closest relatedness to to the Asian race, although was rather distant from it (D = 0.038). No reliable isolation of the eastern European and southern European chromosomal forms, representing the European race of S. uralensis, as well as of their presumptive hybrids from the outskirts of the city of Sal'sk, Rostov region, at the COI gene was revealed. A hybrid origin of the populations of pygmy wood mouse from the outskirts of the Talapker railway station, Novovarshavsky district, Omsk region, was confirmed. In preliminary studies, based on karyotypic characters, these populations were diagnosed as distant hybrids of the eastern European chromosomal form and the Asian race. In yellow-necked wood mouse S. flavicollis from the territory of Russia and Ukraine, weak differentiation into northern and southern lineages (with mean genetic distance between them of 0.020) was observed. Considerably different relative genetic distances between the races of S. uralensis and the S. flavicollis--S. ponticus species pair, inferred from the mitochondrial cytochrome oxidase and cytochrome b gene data, indicated that the rates of evolution of different mitochondrial genome regions could be very different. It is suggested that transformations of the cytochrome b gene, or at least its part, were irregular in time and/or in different phyletic lineages (i.e., accelerated upon the formation of pygmy wood mouse races, and delayed upon the establishment of S. flavicollis and S. ponticus). PMID:22568000

  20. Gene Environment Interactions with a Novel Variable Monoamine Oxidase A Transcriptional Enhancer are Associated with Antisocial Personality Disorder

    PubMed Central

    Philibert, Robert A.; Wernett, Pamela; Plume, Jeff; Packer, Hans; Brody, Gene H.; Beach, Steven R.H.

    2011-01-01

    Monoamine Oxidase A (MAOA) is a critical enzyme in the catabolism of monoaminergic neurotransmitters. MAOA transcriptional activity is thought to be regulated by a well characterized 30 base pair (bp) variable nucleotide repeat (VNTR) that lies approximately ~1000 bp upstream of the transcriptional start site (TSS). However, clinical associations between this VNTR genotype and behavioral states have been inconsistent. Herein, we describe a second, 10 base pair VNTR that lies ~1500 bp upstream of the TSS. We provide in vitro and in silico evidence that this new VNTR region may be more influential in regulating MAOA transcription than the more proximal VNTR and that methylation of this CpG-rich VNTR is genotype dependent in females. Finally, we demonstrate that genotype at this new VNTR interacts significantly with history of child abuse to predict antisocial personality disorder (ASPD) in women and accounts for variance in addition to that explained by the prior VNTR. PMID:21554924

  1. Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.

    PubMed

    Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy

    2014-07-01

    Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded. PMID:24956508

  2. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

    PubMed

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

    2014-07-15

    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced ?-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in ?-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. PMID:24974333

  3. The origin of the Tibetan Mastiff and species identification of Canis based on mitochondrial cytochrome c oxidase subunit I (COI) gene and COI barcoding.

    PubMed

    Li, Y; Zhao, X; Pan, Z; Xie, Z; Liu, H; Xu, Y; Li, Q

    2011-12-01

    DNA barcoding is an effective technique to identify species and analyze phylogenesis and evolution. However, research on and application of DNA barcoding in Canis have not been carried out. In this study, we analyzed two species of Canis, Canis lupus (n = 115) and Canis latrans (n = 4), using the cytochrome c oxidase subunit I (COI) gene (1545 bp) and COI barcoding (648 bp DNA sequence of the COI gene). The results showed that the COI gene, as the moderate variant sequence, applied to the analysis of the phylogenesis of Canis members, and COI barcoding applied to species identification of Canis members. Phylogenetic trees and networks showed that domestic dogs had four maternal origins (A to D) and that the Tibetan Mastiff originated from Clade A; this result supports the theory of an East Asian origin of domestic dogs. Clustering analysis and networking revealed the presence of a closer relative between the Tibetan Mastiff and the Old English sheepdog, Newfoundland, Rottweiler and Saint Bernard, which confirms that many well-known large breed dogs in the world, such as the Old English sheepdog, may have the same blood lineage as that of the Tibetan Mastiff. PMID:22440462

  4. A stop-codon mutation in the human mtDNA cytochrome c oxidase I gene disrupts the functional structure of complex IV.

    PubMed Central

    Bruno, C; Martinuzzi, A; Tang, Y; Andreu, A L; Pallotti, F; Bonilla, E; Shanske, S; Fu, J; Sue, C M; Angelini, C; DiMauro, S; Manfredi, G

    1999-01-01

    We have identified a novel stop-codon mutation in the mtDNA of a young woman with a multisystem mitochondrial disorder. Histochemical analysis of a muscle-biopsy sample showed virtually absent cytochrome c oxidase (COX) stain, and biochemical studies confirmed an isolated reduction of COX activity. Sequence analysis of the mitochondrial-encoded COX-subunit genes identified a heteroplasmic G-->A transition at nucleotide position 6930 in the gene for subunit I (COX I). The mutation changes a glycine codon to a stop codon, resulting in a predicted loss of the last 170 amino acids (33%) of the polypeptide. The mutation was present in the patient's muscle, myoblasts, and blood and was not detected in normal or disease controls. It was not detected in mtDNA from leukocytes of the patient's mother, sister, and four maternal aunts. We studied the genetic, biochemical, and morphological characteristics of transmitochondrial cybrid cell lines, obtained by fusing of platelets from the patient with human cells lacking endogenous mtDNA (rho0 cells). There was a direct relationship between the proportion of mutant mtDNA and the biochemical defect. We also observed that the threshold for the phenotypic expression of this mutation was lower than that reported in mutations involving tRNA genes. We suggest that the G6930A mutation causes a disruption in the assembly of the respiratory-chain complex IV. PMID:10441567

  5. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity. PMID:26869262

  6. Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    PubMed Central

    2013-01-01

    Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

  7. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  8. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  9. Leigh syndrome with cytochrome-c oxidase deficiency and a single T insertion nt 5537 in the mitochondrial tRNATrp gene.

    PubMed

    Tulinius, M; Moslemi, A-R; Darin, N; Westerberg, B; Wiklund, L-M; Holme, E; Oldfors, A

    2003-04-01

    We report a nine-year-old boy with the features of Leigh syndrome (LS) and a severe cytochrome-c oxidase (COX) deficiency with a single thymidine insertion at nucleotide position 5537 (T 5537i) in the tRNA Trp gene of mitochondrial DNA. During infancy the boy was irritable and hypotonus was noticed. Early motor development was delayed, although mental development seemed normal until eight months of age. Early neurological signs were nystagmus, hypertonus and optic atrophy. Severe seizures and mental retardation developed subsequently. Major findings on neuroradiological investigation were from the brainstem, thalami and white matter compatible with LS. Spectrophotometric analysis of skeletal muscle mitochondria showed a profound COX deficiency and a marked complex I deficiency. Enzyme-histochemical analysis showed reduced COX activity in the majority of the muscle fibres. There were no ragged red fibres. The T 5537i mutation was found in a high proportion (> 95 %) in blood, liver and muscle tissue of the patient and in blood of the patient's mother (81 %). This mutation has previously been described in one family in which one child had a very high proportion of the T 5537i mutation and clinical features of LS. We conclude that, although mtDNA mutations are considered to be rare in LS with COX deficiency, the T 5537i mutation should be screened for in cases of LS with COX deficiency when SURF1 gene mutations have been excluded, especially when complex I activity is also decreased. PMID:12776230

  10. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  11. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants. PMID:22009051

  12. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  13. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  14. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  15. Microbial oxidation of arsenite in a subarctic environment: diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser

    PubMed Central

    2010-01-01

    Background Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10°C). Results Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25°C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. Conclusions The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10°C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates. PMID:20673331

  16. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

    PubMed

    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

    2015-07-01

    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP) that regulate MAOA gene expression in a coordinated manner. Aberrant MAOA expression under pathophysiological conditions including inflammation and ischemia is mediated by altered binding of GATA2/Sp1/TBP with MAOA proximal promoter. Thus, these findings provide new insights into pathogenesis of several common diseases. GATA2, GATA-binding protein 2; Sp1, specificity protein 1; TBP, TATA-binding protein. PMID:25810277

  17. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  18. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.

    PubMed

    Sagor, G H M; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  19. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  20. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.

    PubMed

    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov

    2012-06-01

    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum. PMID:22352719

  1. N-ethylmaleimide-resistant acyl-coenzyme A oxidase from Arthrobacter ureafaciens NBRC 12140: molecular cloning, gene expression and characterization of the recombinant enzyme.

    PubMed

    Bakke, Mikio; Setoyama, Chiaki; Miura, Retsu; Kajiyama, Naoki

    2007-01-01

    N-ethylmaleimide (NEM)-resistant acyl-coenzyme A oxidase (ACO) has been desired for the determination of free fatty acids (FFAs). In order to meet this demand, we prepared recombinant ACO from Arthrobacter ureafaciens NBRC 12140. The coding region of the gene was 2109, encoding a protein of 703 amino acids with a predicted molecular mass of 76.5 kDa. The heterologous expression level in Escherichia coli was 520-fold higher than that in the native strain. The purified enzyme retained more than 60% activity after incubation in the presence of 10 mM NEM at 37 degrees C for 4 h, while other commercially available ACOs showed only less than 10% activities after the same NEM treatment. We presume that this is due to the presence of only three cysteines in ACO from A. ureafaciens. Site-directed mutagenesis studies and close scrutiny of the three-dimensional structures of other related ACOs suggested that these cysteines were buried in the protein and unreactive to NEM. The recombinant enzyme was used for the colorimetric determination of free fatty acid, which gave a linear calibration. PMID:17141592

  2. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  3. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  4. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes.

    TOXLINE Toxicology Bibliographic Information

    Makouloutou P; Setsuda A; Yokoyama M; Tsuji T; Saita E; Torii H; Kaneshiro Y; Sasaki M; Maeda K; Une Y; Hasegawa H; Sato H

    2013-09-01

    The gullet worm (Gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. Due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. To investigate this notion, the ribosomal RNA gene (rDNA), mainly regions of the internal transcribed spacers (ITS) 1 and 2, and a cytochrome c oxidase subunit I (COI) region of mitochondrial DNA of G. pulchrum were characterized using parasites from the following hosts located in Japan: cattle, sika deer, wild boars, Japanese macaques, a feral Reeves's muntjac and captive squirrel monkeys. The rDNA nucleotide sequences of G. pulchrum were generally well conserved regardless of their host origin. However, a few insertions/deletions of nucleotides along with a few base substitutions in the ITS1 and ITS2 regions were observed in G. pulchrum from sika deer, wild boars and Japanese macaques, and those differed from G. pulchrum in cattle, the feral Reeves's muntjac and captive squirrel monkeys. The COI sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes, i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated. Our findings indicate that domestic and sylvatic transmission cycles of the gullet worm are currently present, at least in Japan.

  5. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  6. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  7. Neuron-specific specificity protein 4 (Sp4) bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons

    PubMed Central

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T. T.

    2013-01-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically-regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1, that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. PMID:24032355

  8. Amine Oxidase Copper-containing 1 (AOC1) Is a Downstream Target Gene of the Wilms Tumor Protein, WT1, during Kidney Development*

    PubMed Central

    Kirschner, Karin M.; Braun, Julian F.W.; Jacobi, Charlotte L.; Rudigier, Lucas J.; Persson, Anja Bondke; Scholz, Holger

    2014-01-01

    Amine oxidase copper-containing 1 (AOC1; formerly known as amiloride-binding protein 1) is a secreted glycoprotein that catalyzes the degradation of putrescine and histamine. Polyamines and their diamine precursor putrescine are ubiquitous to all organisms and fulfill pivotal functions in cell growth and proliferation. Despite the importance of AOC1 in regulating polyamine breakdown, very little is known about the molecular mechanisms that control its expression. We report here that the Wilms tumor protein, WT1, which is necessary for normal kidney development, activates transcription of the AOC1 gene. Expression of a firefly luciferase reporter under control of the proximal AOC1 promoter was significantly enhanced by co-transfection of a WT1 expression construct. Binding of WT1 protein to a cis-regulatory element in the AOC1 promoter was confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. Antisense inhibition of WT1 protein translation strongly reduced Aoc1 transcripts in cultured murine embryonic kidneys and gonads. Aoc1 mRNA levels correlated with WT1 protein in several cell lines. Double immunofluorescent staining revealed a co-expression of WT1 and AOC1 proteins in the developing genitourinary system of mice and rats. Strikingly, induced changes in polyamine homeostasis affected branching morphogenesis of cultured murine embryonic kidneys in a developmental stage-specific manner. These findings suggest that WT1-dependent control of polyamine breakdown, which is mediated by changes in AOC1 expression, has a role in kidney organogenesis. PMID:25037221

  9. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  10. Genetic Susceptibility for Individual Cooperation Preferences: The Role of Monoamine Oxidase A Gene (MAOA) in the Voluntary Provision of Public Goods

    PubMed Central

    Mertins, Vanessa; Schote, Andrea B.; Hoffeld, Wolfgang; Griessmair, Michele; Meyer, Jobst

    2011-01-01

    In the context of social dilemmas, previous research has shown that human cooperation is mainly based on the social norm of conditional cooperation. While in most cases individuals behave according to such a norm, deviant behavior is no exception. Recent research further suggests that heterogeneity in social behavior might be associated with varying genetic predispositions. In this study, we investigated the relationship between individuals' behavior in a public goods experiment and the promoter-region functional repeat polymorphism in the monoamine oxidase A gene (MAOA). In a dynamic setting of increasing information about others' contributions, we analyzed differences in two main components of conditional cooperation, namely the players' own contribution and their beliefs regarding the contribution of other players. We showed that there is a significant association between individuals' behavior in a repeated public goods game and MAOA. Our results suggest that male carriers of the low activity alleles cooperate significantly less than those carrying the high activity alleles given a situation where subjects had to rely on their innate beliefs about others' contributions. With increasing information about the others' cooperativeness, the genetic effect diminishes. Furthermore, significant opposing effects for female subjects carrying two low activity alleles were observed. PMID:21698196

  11. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  12. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  13. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  14. Identification, characterization and nutritional regulation of two isoforms of acyl-coenzyme A oxidase 1 gene in Nile tilapia (Oreochromis niloticus).

    PubMed

    He, An-Yuan; Liu, Cai-Zhi; Chen, Li-Qiao; Ning, Li-Jun; Zhang, Mei-Ling; Li, Er-Chao; Du, Zhen-Yu

    2014-07-15

    In peroxisome, acyl-coenzyme A oxidase 1 (ACOX1) is the first rate-limiting enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. Two isoforms of acyl-coenzyme A oxidase 1 were firstly identified in Nile tilapia (Oreochromis niloticus) in this study. ACOX1 isoform1 (ACOX1i1) and ACOX1 isoform2 (ACOX1i2) were encoded by the single gene with 661 amino acids in length. The coding region of both isoforms consisted of 14 exons. The residues from 89 to 193 in ACOX1i1 were encoded by exon 3b, while in ACOX1i2 they were encoded by exon 3a. Homologous alignment analysis indicated that the varied region (the residues from 89 to 193) of ACOX1i1 was more conserved than ACOX1i2 in vertebrates (Mammalia, Aves, Amphibia and Pisces). The mRNA expression level of ACOX1i1 and ACOX1i2 was detected separately in eleven tissues and the results indicated that ACOXi1 expression was the highest in liver followed by kidney and brain, while the expression of ACOXi2 was the highest in kidney followed by liver. The normalized levels of both transcript variants were comparable in most tissues, however the level of ACOX1i2 was significantly higher than that of ACOX1i1 in white muscle and kidney (5.1 fold and 3.1 fold), and ACOX1i1 was significantly higher than ACOX1i2 in gill and brain (4.8 fold and 1.9 fold). In different nutritional states, the expression levels of both isoforms in liver were comparable between fasting and most of post-feeding time points, except that the expression at 3h post-feeding was significantly lower than others. The expression of ACOX1i1 in the kidney also showed the similar pattern, indicating the lowest expression at 8h post-feeding, however, no significant change was seen in ACOX2i2 among all nutritional states. These results suggested that ACOX1i1 and i2 may play different roles in tissues, and their expression levels were differently modulated by nutritional stage. PMID:24802117

  15. Sequence analysis of the structural nuclear encoded subunits and assembly genes of cytochrome c oxidase in a cohort of 10 isolated complex IV-deficient patients revealed five mutations.

    PubMed

    Coenen, Marieke J H; Smeitink, Jan A M; Pots, Jeanette M; van Kaauwen, Edwin; Trijbels, Frans J M; Hol, Frans A; van den Heuvel, Lambert P

    2006-06-01

    The mitochondrial oxidative phosphorylation system is composed of five multiprotein complexes. The fourth complex of this system, cytochrome c oxidase (complex IV), consists of 13 subunits: 3 encoded by mitochondrial DNA and 10 encoded by the nuclear genome. Patients with an isolated complex IV deficiency frequently harbor mutations in nuclear genes encoding for proteins necessary for the assembly of the complex. Strikingly, until now, no mutations have been detected in the nuclear encoded structural subunits of complex IV in these patients. We report the results of a mutational analysis study in patients with isolated complex IV deficiency screened for mutations in all structural genes as well as assembly genes known to cause complex IV deficiency. Four patients carried mutations in the complex IV assembly gene SURF1. One patient harbored a mutation in the COX10 gene involved in heme A synthesis. Mutations in the 10 nuclear encoded structural genes were not present. PMID:16948936

  16. Bilirubin oxidase from Bacillus pumilus: a promising enzyme for the elaboration of efficient cathodes in biofuel cells.

    PubMed

    Durand, Fabien; Kjaergaard, Christian Hauge; Suraniti, Emmanuel; Gounel, Sébastien; Hadt, Ryan G; Solomon, Edward I; Mano, Nicolas

    2012-05-15

    A CotA multicopper oxidase (MCO) from Bacillus pumilus, previously identified as a laccase, has been studied and characterized as a new bacterial bilirubin oxidase (BOD). The 59 kDa protein containing four coppers, was successfully over-expressed in Escherichia coli and purified to homogeneity in one step. This 509 amino-acid enzyme, having 67% and 26% sequence identity with CotA from Bacillus subtilis and BOD from Myrothecium verrucaria, respectively, shows higher turnover activity towards bilirubin compared to other bacterial MCOs. The current density for O(2) reduction, when immobilized in a redox hydrogel, is only 12% smaller than the current obtained with Trachyderma tsunodae BOD. Under continuous electrocatalysis, an electrode modified with the new BOD is more stable, and has a higher tolerance towards NaCl, than a T. tsunodae BOD modified electrode. This makes BOD from B. pumilus an attractive new candidate for application in biofuel cells (BFCs) and biosensors. PMID:22410485

  17. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-05-01

    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  18. Deletion of genes encoding cytochrome oxidases and quinol monooxygenase blocks the aerobic-anaerobic shift in Escherichia coli K-12 MG1655.

    PubMed

    Portnoy, Vasiliy A; Scott, David A; Lewis, Nathan E; Tarasova, Yekaterina; Osterman, Andrei L; Palsson, Bernhard Ø

    2010-10-01

    The constitutive activation of the anoxic redox control transcriptional regulator (ArcA) in Escherichia coli during aerobic growth, with the consequent production of a strain that exhibits anaerobic physiology even in the presence of air, is reported in this work. Removal of three terminal cytochrome oxidase genes (cydAB, cyoABCD, and cbdAB) and a quinol monooxygenase gene (ygiN) from the E. coli K-12 MG1655 genome resulted in the activation of ArcA aerobically. These mutations resulted in reduction of the oxygen uptake rate by nearly 98% and production of d-lactate as a sole by-product under oxic and anoxic conditions. The knockout strain exhibited nearly identical physiological behaviors under both conditions, suggesting that the mutations resulted in significant metabolic and regulatory perturbations. In order to fully understand the physiology of this mutant and to identify underlying metabolic and regulatory reasons that prevent the transition from an aerobic to an anaerobic phenotype, we utilized whole-genome transcriptome analysis, (13)C tracing experiments, and physiological characterization. Our analysis showed that the deletions resulted in the activation of anaerobic respiration under oxic conditions and a consequential shift in the content of the quinone pool from ubiquinones to menaquinones. An increase in menaquinone concentration resulted in the activation of ArcA. The activation of the ArcB/ArcA regulatory system led to a major shift in the metabolic flux distribution through the central metabolism of the mutant strain. Flux analysis indicated that the mutant strain had undetectable fluxes around the tricarboxylic acid (TCA) cycle and elevated flux through glycolysis and anaplerotic input to oxaloacetate. Flux and transcriptomics data were highly correlated and showed similar patterns. PMID:20709841

  19. Potassium and the K+/H+ Exchanger Kha1p Promote Binding of Copper to ApoFet3p Multi-copper Ferroxidase.

    PubMed

    Wu, Xiaobin; Kim, Heejeong; Seravalli, Javier; Barycki, Joseph J; Hart, P John; Gohara, David W; Di Cera, Enrico; Jung, Won Hee; Kosman, Daniel J; Lee, Jaekwon

    2016-04-29

    Acquisition and distribution of metal ions support a number of biological processes. Here we show that respiratory growth of and iron acquisition by the yeast Saccharomyces cerevisiae relies on potassium (K(+)) compartmentalization to the trans-Golgi network via Kha1p, a K(+)/H(+) exchanger. K(+) in the trans-Golgi network facilitates binding of copper to the Fet3p multi-copper ferroxidase. The effect of K(+) is not dependent on stable binding with Fet3p or alteration of the characteristics of the secretory pathway. The data suggest that K(+) acts as a chemical factor in Fet3p maturation, a role similar to that of cations in folding of nucleic acids. Up-regulation of KHA1 gene in response to iron limitation via iron-specific transcription factors indicates that K(+) compartmentalization is linked to cellular iron homeostasis. Our study reveals a novel functional role of K(+) in the binding of copper to apoFet3p and identifies a K(+)/H(+) exchanger at the secretory pathway as a new molecular factor associated with iron uptake in yeast. PMID:26966178

  20. The Diamine Oxidase Gene Is Associated with Hypersensitivity Response to Non-Steroidal Anti-Inflammatory Drugs

    PubMed Central

    Agndez, Jos A. G.; Ayuso, Pedro; Cornejo-Garca, Jos A.; Blanca, Miguel; Torres, Mara J.; Doa, Inmaculada; Salas, Mara; Blanca-Lpez, Natalia; Canto, Gabriela; Rondon, Carmen; Campo, Paloma; Laguna, Jos J.; Fernndez, Javier; Martnez, Carmen; Garca-Martn, Elena

    2012-01-01

    Non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191), which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR ?=?1.7 (95% CI ?=?1.32.1; Pc ?=?0.0003) with a gene-dose effect (P?=?0.0001). The association was replicated in two populations from different geographic areas (Pc ?=?0.008 and Pc ?=?0.004, respectively). Conclusions and implications The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response. PMID:23152756

  1. Transcriptome Sequencing Identifies SPL7-Regulated Copper Acquisition Genes FRO4/FRO5 and the Copper Dependence of Iron Homeostasis in Arabidopsis[C][W

    PubMed Central

    Bernal, María; Casero, David; Singh, Vasantika; Wilson, Grandon T.; Grande, Arne; Yang, Huijun; Dodani, Sheel C.; Pellegrini, Matteo; Huijser, Peter; Connolly, Erin L.; Merchant, Sabeeha S.; Krämer, Ute

    2012-01-01

    The transition metal copper (Cu) is essential for all living organisms but is toxic when present in excess. To identify Cu deficiency responses comprehensively, we conducted genome-wide sequencing-based transcript profiling of Arabidopsis thaliana wild-type plants and of a mutant defective in the gene encoding SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 (SPL7), which acts as a transcriptional regulator of Cu deficiency responses. In response to Cu deficiency, FERRIC REDUCTASE OXIDASE5 (FRO5) and FRO4 transcript levels increased strongly, in an SPL7-dependent manner. Biochemical assays and confocal imaging of a Cu-specific fluorophore showed that high-affinity root Cu uptake requires prior FRO5/FRO4-dependent Cu(II)-specific reduction to Cu(I) and SPL7 function. Plant iron (Fe) deficiency markers were activated in Cu-deficient media, in which reduced growth of the spl7 mutant was partially rescued by Fe supplementation. Cultivation in Cu-deficient media caused a defect in root-to-shoot Fe translocation, which was exacerbated in spl7 and associated with a lack of ferroxidase activity. This is consistent with a possible role for a multicopper oxidase in Arabidopsis Fe homeostasis, as previously described in yeast, humans, and green algae. These insights into root Cu uptake and the interaction between Cu and Fe homeostasis will advance plant nutrition, crop breeding, and biogeochemical research. PMID:22374396

  2. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corra-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  3. Hormonal cross-talk between auxin and ethylene differentially regulates the expression of two members of the 1-aminocyclopropane-1-carboxylate oxidase gene family in rice (Oryza sativa L.).

    PubMed

    Chae, H S; Cho, Y G; Park, M Y; Lee, M C; Eun, M Y; Kang, B G; Kim, W T

    2000-03-01

    Two cDNA clones, pOS-ACO2 and pOS-ACO3, encoding 1-aminocyclopropane-1-carboxylate (ACC) oxidase were isolated from rice seedling cDNA library. pOS-ACO3 is a 1,299 bp full-length clone encoding 321 amino acids (Mr=35.9 kDa), while pOS-ACO2 is 1,072 bp long and is a partial cDNA clone encoding 314 amino acids. These two deduced amino acid sequences share 70% identity, and display a high degree of sequence identity (72-92%) with previously isolated pOS-ACO1 of deepwater rice. The chromosomal location studies show that OS-ACO2 is positioned on the long arm of chromosome 9, while OS-ACO3 on the long arm of chromosome 2 of rice genome. A marked increase in the level of OS-ACO2 transcript was observed in IAA-treated etiolated rice seedlings, whereas the OS-ACO3 mRNA was greatly accumulated by ethylene treatment. Results of ethylene inhibitor studies indicated that auxin promotion of the OS-ACO2 transcription was not mediated through the action of auxin-induced ethylene. Thus, it appears that there are two groups of ACC oxidase transcripts in rice plants, either auxin-induced or ethylene-induced. The auxin-induced OS-ACO2 expression was partially inhibited by ethylene, while ethylene induction of OS-ACO3 transcription was completely blocked by auxin. These results indicate that the expression of ACC oxidase genes is regulated by complex hormonal networks in a gene specific manner in rice seedlings. Okadaic acid, a potent inhibitor of protein phosphatase, effectively suppressed the IAA induction of OS-ACO2 expression, suggesting that protein dephosphorylation plays a role in the induction of ACC oxidase by auxin. A scheme of the multiple regulatory pathways for the expression of ACC oxidase gene family by auxin, ethylene and protein phosphatase is presented. PMID:10805599

  4. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-01-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  5. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  6. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.

    2015-01-01

    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  7. [Recombinant Aspergillus niger glucose oxidase expressed in Trichoderma reesei].

    PubMed

    Mu, Jing-Yui; Wang, Qiao; Yang, Daniel; Wang, En-Si; Wang, Qing; Huang, Yue

    2006-01-01

    It was expected that recombinant Aspergillus niger glucose oxidase could be expressed in Trichoderma reesei with stable activity. T. reesei CBHI promoter--CBHI ss. gene--A. niger glucose oxidase gene--T. reesei CBHI terminator--A. nidulans gpd promoter--E. coli Hygromycin B phosphotransferase gene--A. nidulans trpC terminator--pUC19 (pCBHGOD) vector was constructed in E. coli DH5alpha by PCR application and gene cloning methods. T. reesei QM9414 protoplast was transformed by T. reesei CBHI promoter-CBHI ss. Gene--A. niger glucose oxidase gene--T. reesei CBHI terminator-A. nidulans gpd promoter--E. coli Hygromycin B phosphotransferase gene--A. nidulans trpC terminator linear DNA fragment (CBHGOD fragment) that was made by digestion of pCBHGOD with Kpn I. T. reesei mutant clone with homologous recombinant A. niger glucose oxidase gene was selected by PCR method. Recombinant glucose oxidase was produced by mutant T. reesei strain under induction of wheat straw for 5 days. Recombinant glucose oxidase molecular mass was showed the same as native A. niger glucose oxidase standard from Sigma company by Western blot analysis. Recombinant glucose oxidase activity was 25u/mL in medium. The yield was 0.5 g/L in comparison with Sigma company glucose oxidase standard. There was no recombinant GOD degradation during Trichoderma reesei cultivation that was showed in Western blot analysis. Trichoderma reesei has capability to be a new recombinant host for Aspergillus niger GOD production. PMID:16572845

  8. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight and flag leaf chlorophyll content at 5~15 DAA than those in genotype-B and genotype-C, among 102 varieties under various environments. PMID:26714276

  9. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.

    PubMed

    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr

    2016-02-01

    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be characterised, which helps BR function to be understood. The knowledge can also be a good starting point for some breeding companies that are interested in introducing new semi-dwarf barley cultivars. PMID:26752435

  10. Development and evaluation of PCR methods based on cytochrome c oxidase subunit one (cox1) and NADH dehydrogenase subunit one gene (nad1) to detect Opisthorchis viverrini in human fecal samples.

    PubMed

    Buathong, Saiwasan; Leelayoova, Saovanee; Mungthin, Mathirut; Naaglor, Tawee; Taamasri, Paanjit; Suwannahitatorn, Picha; Tan-Ariya, Peerapan

    2015-09-01

    Opisthorchis viverrini is highly prevalent throughout Southeast Asia. Chronic infection of this parasite leads to cholangiocarcinoma (CCA), a fatal bile duct cancer. The early and accurate detection of this parasite is very important; therefore, new PCR methods targeting cytochrome c oxidase subunit one and NADH dehydrogenase subunit one gene to detect O. viverrini in fecal specimens have been developed. Ninety O. viverrini-positive human fecal samples were used in this study. The PCR sensitivity of both genes was compared with internal transcribe spacer 2 (ITS2)-PCR. The sensitivity of cox1-PCR and nad1-PCR was 66.7 and 50 %, respectively. The sensitivity of cox1-PCR and nad1-PCR achieved 89.1 and 71.7 % in specimens containing O. viverrini eggs of >100 eggs per gram (EPG). Additionally, these primers can be used to provide the information on genetic diversity from mitochondrial genes of O. viverrini. PMID:26239798

  11. Regulation and physiological role of cyanide-resistant oxidases in fungi and plants.

    PubMed

    Medentsev, A G; Arinbasarova, A Y; Akimenko, V K

    1999-11-01

    Data on the induction and regulation of cyanide-resistant oxidases in eucaryotic microorganisms and higher plants are reviewed. Expression of an alternative oxidase gene can be caused by a decrease in energy charge in cells. Some evidence exists suggesting that cAMP and Ca2+ act as intracellular signals inducing the expression of the alternative oxidase genes. Under certain conditions cells produce alternative oxidases which remain in an inactive state. Activation of the alternative pathway of cell respiration is usually observed when electron transport via cytochromes is inhibited. The physiological role of the alternative oxidase is discussed. PMID:10611527

  12. Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA

    PubMed Central

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.

    2011-01-01

    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

  13. [Preparation and identification of recombinant sarcosine oxidase].

    PubMed

    Pu, Jing; Wang, Rui; Yao, Mingdong; He, Zhongjie; Zhao, Ming; Meng, Yao

    2014-10-01

    An important index determination for clinical diagnosis of renal function is to assay the creatinine concentration in serum. In the analytical process applied with coupled-enzyme, the quality control of sarcosine oxidase (SOX) as a key enzyme is the first problem to be solved. In order to establish an efficient and laboratory-scale production of SOX, the recombinant sarcosine oxidase (r-SOX) gene was a high-level expression in E. coli induced with lactose on a large-scale fermentation in 300 L fermenter. The results suggested that the biomass concentration reached OD600 of 22 and the expression of recombinant sarcosine oxidase in E. coli accounted for about 25% of total soluble protein in culture after fermentation. The cell-free extract obtained from high pressure homogenizer was processed by selective thermal denaturation and then purified with Ni-Sepharose FF chromatography. The sarcosine oxidase with 97% purity, 25 U/mg specific activity and 92.4% activity recovery was obtained. The molecular weight with single peptide chain of 53 kD and 55 kD of recombinant sarcosine oxidase was assessed by SDS-PAGE in presence or absence of 2-mercaptoehanol and Sephacryl S-200 chromatography. This sarcosine oxidase was found to be a conjugated protein, yellow enzyme, which combined with FAD as prosthetic group by covalent linkage. The contaminant of catalase was not detected in the sample pool of this enzyme. In addition, a further test to the thermal stability of sarcosine oxidase was done. According to the above results, the development and utilization of this enzyme has been set up on a reliable foundation. PMID:25764728

  14. Mitochondrial cytochrome c oxidase deficiency.

    PubMed

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-03-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance of studying different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  15. Diversity and Evolutionary History of Iron Metabolism Genes in Diatoms

    PubMed Central

    Groussman, Ryan D.; Parker, Micaela S.; Armbrust, E. Virginia

    2015-01-01

    Ferroproteins arose early in Earth’s history, prior to the emergence of oxygenic photosynthesis and the subsequent reduction of bioavailable iron. Today, iron availability limits primary productivity in about 30% of the world’s oceans. Diatoms, responsible for nearly half of oceanic primary production, have evolved molecular strategies for coping with variable iron concentrations. Our understanding of the evolutionary breadth of these strategies has been restricted by the limited number of species for which molecular sequence data is available. To uncover the diversity of strategies marine diatoms employ to meet cellular iron demands, we analyzed 367 newly released marine microbial eukaryotic transcriptomes, which include 47 diatom species. We focused on genes encoding proteins previously identified as having a role in iron management: iron uptake (high-affinity ferric reductase, multi-copper oxidase, and Fe(III) permease); iron storage (ferritin); iron-induced protein substitutions (flavodoxin/ferredoxin, and plastocyanin/cytochrome c6) and defense against reactive oxygen species (superoxide dismutases). Homologs encoding the high-affinity iron uptake system components were detected across the four diatom Classes suggesting an ancient origin for this pathway. Ferritin transcripts were also detected in all Classes, revealing a more widespread utilization of ferritin throughout diatoms than previously recognized. Flavodoxin and plastocyanin transcripts indicate possible alternative redox metal strategies. Predicted localization signals for ferredoxin identify multiple examples of gene transfer from the plastid to the nuclear genome. Transcripts encoding four superoxide dismutase metalloforms were detected, including a putative nickel-coordinating isozyme. Taken together, our results suggest that the majority of iron metabolism genes in diatoms appear to be vertically inherited with functional diversity achieved via possible neofunctionalization of paralogs. This refined view of iron use strategies in diatoms elucidates the history of these adaptations, and provides potential molecular markers for determining the iron nutritional status of different diatom species in environmental samples. PMID:26052941

  16. Molybdenum trioxide nanoparticles with intrinsic sulfite oxidase activity.

    PubMed

    Ragg, Ruben; Natalio, Filipe; Tahir, Muhammad Nawaz; Janssen, Henning; Kashyap, Anubha; Strand, Dennis; Strand, Susanne; Tremel, Wolfgang

    2014-05-27

    Sulfite oxidase is a mitochondria-located molybdenum-containing enzyme catalyzing the oxidation of sulfite to sulfate in the amino acid and lipid metabolism. Therefore, it plays a major role in detoxification processes, where defects in the enzyme cause a severe infant disease leading to early death with no efficient or cost-effective therapy in sight. Here we report that molybdenum trioxide (MoO3) nanoparticles display an intrinsic biomimetic sulfite oxidase activity under physiological conditions, and, functionalized with a customized bifunctional ligand containing dopamine as anchor group and triphenylphosphonium ion as targeting agent, they selectively target the mitochondria while being highly dispersible in aqueous solutions. Chemically induced sulfite oxidase knockdown cells treated with MoO3 nanoparticles recovered their sulfite oxidase activity in vitro, which makes MoO3 nanoparticles a potential therapeutic for sulfite oxidase deficiency and opens new avenues for cost-effective therapies for gene-induced deficiencies. PMID:24702461

  17. Glucose oxidase--an overview.

    PubMed

    Bankar, Sandip B; Bule, Mahesh V; Singhal, Rekha S; Ananthanarayan, Laxmi

    2009-01-01

    Glucose oxidase (beta-D-glucose:oxygen 1-oxidoreductase; EC 1.1.2.3.4) catalyzes the oxidation of beta-D-glucose to gluconic acid, by utilizing molecular oxygen as an electron acceptor with simultaneous production of hydrogen peroxide. Microbial glucose oxidase is currently receiving much attention due to its wide applications in chemical, pharmaceutical, food, beverage, clinical chemistry, biotechnology and other industries. Novel applications of glucose oxidase in biosensors have increased the demand in recent years. Present review discusses the production, recovery, characterization, immobilization and applications of glucose oxidase. Production of glucose oxidase by fermentation is detailed, along with recombinant methods. Various purification techniques for higher recovery of glucose oxidase are described here. Issues of enzyme kinetics, stability studies and characterization are addressed. Immobilized preparations of glucose oxidase are also discussed. Applications of glucose oxidase in various industries and as analytical enzymes are having an increasing impact on bioprocessing. PMID:19374943

  18. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

    PubMed

    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

    2016-04-01

    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age  = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  19. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. PMID:25749303

  20. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.

    PubMed

    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon

    2015-06-10

    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade. PMID:25980806

  1. Two variants of the assembly factor Surf1 target specific terminal oxidases in Paracoccus denitrificans.

    PubMed

    Bundschuh, Freya A; Hoffmeier, Klaus; Ludwig, Bernd

    2008-10-01

    Biogenesis of cytochrome c oxidase (COX) relies on a large number of assembly proteins, one of them being Surf1. In humans, the loss of Surf1 function is associated with Leigh syndrome, a fatal neurodegenerative disorder. In the soil bacterium Paracoccus denitrificans, homologous genes specifying Surf1 have been identified and located in two operons of terminal oxidases: surf1q is the last gene of the qox operon (coding for a ba(3)-type ubiquinol oxidase), and surf1c is found at the end of the cta operon (encoding subunits of the aa(3)-type cytochrome c oxidase). We introduced chromosomal single and double deletions for both surf1 genes, leading to significantly reduced oxidase activities in membrane. Our experiments on P. denitrificans surf1 single deletion strains show that both Surf1c and Surf1q are functional and act independently for the aa(3)-type cytochrome c oxidase and the ba(3)-type quinol oxidase, respectively. This is the first direct experimental evidence for the involvement of a Surf1 protein in the assembly of a quinol oxidase. Analyzing the heme content of purified cytochrome c oxidase, we conclude that Surf1, though not indispensable for oxidase assembly, is involved in an early step of cofactor insertion into subunit I. PMID:18582433

  2. Ethylene Synthesis Regulated by Biphasic Induction of 1-Aminocyclopropane-1-Carboxylic Acid Synthase and 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Genes Is Required for Hydrogen Peroxide Accumulation and Cell Death in Ozone-Exposed Tomato1

    PubMed Central

    Moeder, Wolfgang; Barry, Cornelius S.; Tauriainen, Airi A.; Betz, Christian; Tuomainen, Jaana; Utriainen, Merja; Grierson, Donald; Sandermann, Heinrich; Langebartels, Christian; Kangasjärvi, Jaakko

    2002-01-01

    We show that above a certain threshold concentration, ozone leads to leaf injury in tomato (Lycopersicon esculentum). Ozone-induced leaf damage was preceded by a rapid increase in 1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity, ACC content, and ethylene emission. Changes in mRNA levels of specific ACC synthase, ACC oxidase, and ethylene receptor genes occurred within 1 to 5 h. Expression of the genes encoding components of ethylene biosynthesis and perception, and biochemistry of ethylene synthesis suggested that ozone-induced ethylene synthesis in tomato is under biphasic control. In transgenic plants containing an LE-ACO1 promoter-β-glucuronidase fusion construct, β-glucuronidase activity increased rapidly at the beginning of the O3 exposure and had a spatial distribution resembling the pattern of extracellular H2O2 production at 7 h, which coincided with the cell death pattern after 24 h. Ethylene synthesis and perception were required for active H2O2 production and cell death resulting in visible tissue damage. The results demonstrate a selective ozone response of ethylene biosynthetic genes and suggest a role for ethylene, in combination with the burst of H2O2 production, in regulating the spread of cell death. PMID:12481074

  3. Copper Deficiency Leads to Anemia, Duodenal Hypoxia, Upregulation of HIF-2α and Altered Expression of Iron Absorption Genes in Mice

    PubMed Central

    Matak, Pavle; Zumerle, Sara; Mastrogiannaki, Maria; El Balkhi, Souleiman; Delga, Stephanie; Mathieu, Jacques R. R.; Canonne-Hergaux, François; Poupon, Joel; Sharp, Paul A.; Vaulont, Sophie; Peyssonnaux, Carole

    2013-01-01

    Iron and copper are essential trace metals, actively absorbed from the proximal gut in a regulated fashion. Depletion of either metal can lead to anemia. In the gut, copper deficiency can affect iron absorption through modulating the activity of hephaestin - a multi-copper oxidase required for optimal iron export from enterocytes. How systemic copper status regulates iron absorption is unknown. Mice were subjected to a nutritional copper deficiency-induced anemia regime from birth and injected with copper sulphate intraperitoneally to correct the anemia. Copper deficiency resulted in anemia, increased duodenal hypoxia and Hypoxia inducible factor 2α (HIF-2α) levels, a regulator of iron absorption. HIF-2α upregulation in copper deficiency appeared to be independent of duodenal iron or copper levels and correlated with the expression of iron transporters (Ferroportin - Fpn, Divalent Metal transporter – Dmt1) and ferric reductase – Dcytb. Alleviation of copper-dependent anemia with intraperitoneal copper injection resulted in down regulation of HIF-2α-regulated iron absorption genes in the gut. Our work identifies HIF-2α as an important regulator of iron transport machinery in copper deficiency. PMID:23555700

  4. Exploiting algal NADPH oxidase for biophotovoltaic energy.

    PubMed

    Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K; Bombelli, Paolo; Howe, Christopher J; Merchant, Sabeeha S; Davies, Julia M; Smith, Alison G

    2016-01-01

    Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anion production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. The results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices. PMID:25641364

  5. Regulation of cyclooxygenase-2 and cytosolic phospholipase A2 gene expression by lipopolysaccharide through the RNA-binding protein HuR: involvement of NADPH oxidase, reactive oxygen species and mitogen-activated protein kinases

    PubMed Central

    Lin, Wei-Ning; Lin, Chih-Chung; Cheng, Hsin-Yi; Yang, Chuen-Mao

    2011-01-01

    BACKGROUND AND PURPOSE Lipopolysaccharide (LPS)-induced expression of cyclooxygenase-2 (COX-2) and cytosolic phospholipase A2 (cPLA2) has been implicated in several respiratory diseases. HuR is known to enhance the expression of genes by binding to 3′-untranslated region (3′-UTR) of mRNA and stabilizing mRNA. However, the exact mechanisms by which HuR affects the stability of mRNA and modulates LPS-induced COX-2 and cPLA2 expression in human tracheal smooth muscle cells (HTSMCs) are not known. EXPERIMENTAL APPROACH The expression of prostaglandin E2 (PGE2) was measured by ELISA, and pro-inflammatory proteins were determined by use of a promoter assay, PCR or Western blot analysis. Overexpression of siRNAs to knock down the target components was used to manipulate the expression of HuR. Release of reactive oxygen species (ROS) was detected by fluorescence dye. The activation of signalling components was assessed by comparing phosphorylation levels, localization of protein kinases or coimmunoprecipitation assay. KEY RESULTS LPS induced COX-2 and cPLA2 expression via post-translational regulation of mRNA stabilization, which were attenuated by transfection with HuR siRNA in HTSMCs. In addition, LPS-stimulated NADPH oxidase activation and ROS generation were attenuated by the NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and apocynin (APO). Generation of ROS induced phosphorylation of p42/p44 mitogen-activated protein kinase (MAPK), p38 MAPK and JNK1/2, which was attenuated by DPI and APO and the ROS scavenger N-acetylcysteine. CONCLUSIONS AND IMPLICATIONS These results suggested that in HTSMCs, LPS-induced COX-2 and cPLA2 expression is mediated through NADPH oxidase/ROS-dependent MAPKs associated with HuR accumulation in the cytoplasm. Activated MAPKs may regulate the nucleocytoplasmic shuttling of HuR, and thus induce the cytoplasmic accumulation of HuR. PMID:21391979

  6. De novo microdeletion of Xp11.3 exclusively encompassing the monoamine oxidase A and B genes in a male infant with episodic hypotonia: A genomics approach to personalized medicine

    PubMed Central

    O’Leary, Ryan E.; Shih, Jean C.; Hyland, Keith; Kramer, Nancy; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Monoamine oxidase A and B (MAOA and MAOB) play key roles in deaminating neurotransmitters and various other biogenic amines. Patients deficient in one or both enzymes have distinct metabolic and neurologic profiles. MAOB deficient patients exhibit normal clinical characteristics and behavior, while MAOA deficient patients have borderline intellectual deficiency and impaired impulse control. Patients who lack both MAOA and MAOB have the most extreme laboratory values (urine, blood, and CSF serotonin 4–6 times normal, with elevated O-methylated amine metabolites and reduced deaminated metabolites) in addition to severe intellectual deficiency and behavioral problems. Mice lacking maoa and moab exhibit decreased proliferation of neural stem cells beginning in late gestation and persisting into adulthood These mice show significantly increased monoamine levels, particularly serotonin, as well as anxiety-like behaviors as adults, suggesting that brain maturation in late embryonic development is adversely affected by elevated serotonin levels. We report the case of a male infant with a de novo Xp11.3 microdeletion exclusively encompassing the MAOA and MAOB genes. This newly recognized X-linked disorder is characterized by severe intellectual disability and unusual episodes of hypotonia, which resemble atonic seizures, but have no EEG correlate. A customized low dietary amine diet was implemented in an attempt to prevent the cardiovascular complications that can result from the excessive intake of these compounds. This is the second report of this deletion and the first attempt to maintain the patient’s cardiovascular health through dietary manipulation. Even though a diet low in tyramine, phenylethylamine, and dopa/dopamine is necessary for long-term management, it will not rescue the abnormal monoamine profile seen in combined MAOA and MAOB deficiency. Our patient displays markedly elevated levels of serotonin in blood, serum, urine, and CSF while on this diet. Serotonin biosynthesis inhibitors like para-chlorophenylalanine and p-ethynylphenylalanine may be needed to lower serotonin levels in patients with absent monoamine oxidase enzymes. PMID:22365943

  7. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  8. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.

    PubMed

    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  9. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.

    PubMed

    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio

    2015-11-01

    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487 bp fragment, including part of 5.8 S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma. PMID:26336248

  10. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya

    2008-10-24

    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  11. Two novel mutations and coexistence of the 991C>T and the 1339C>T mutation on a single allele in the coproporphyrinogen oxidase gene in Swedish patients with hereditary coproporphyria.

    PubMed

    Wiman, Asa; Floderus, Ylva; Harper, Pauline

    2002-01-01

    Hereditary coproporphyria (HCP) is an autosomal dominant disorder, resulting from a partial deficiency of the enzyme coproporphyrinogen oxidase (CPO). This enzyme catalyzes the sixth step of the heme biosynthetic pathway, and mutations in the CPO gene have been coupled to HCP. The present study was undertaken to identify disease-producing mutations in the CPOgene in nine Swedish families with HCP. Exon 1 of the CPO gene of the nine probands was analyzed directly by sequencing, and exons 2-7 were screened by denaturating gradient gel electrophoresis, followed by sequencing of exons showing abnormal band pattern. Mutations were detected in five of the nine families. In two of these families, the novel mutations 623C>T (S208F, exon 2) and 982C>T (R328C, exon 5) were identified, respectively. In the affected members of the other three families, the previously reported mutations 991C>T (R331W, exon 5) and 1339C>T (R447C, exon 7) were shown to coexist on one allele. The present study contributes 2 novel mutations to the 34 that have been previously reported to cause HCP. In addition, this is the first report on patients carrying two HCP-coupled mutations on one allele. PMID:12181641

  12. Rational design for building blocks of DNA-based conductive nanowires through multi-copper incorporation into mismatched base pairs.

    PubMed

    Zhao, Jing; Han, Li; Yang, Hongfang; Liu, Jinxiang; Bu, Yuxiang

    2012-10-01

    Metal-modified DNA base pairs, which possess potential electrical conductivity and can serve as conductive nanomaterials, have recently attracted much attention. Inspired by our recent finding that multicopper incorporation into natural DNA base pairs could improve the electronic properties of base pairs, herein, we designed two novel multi-copper-mediated mismatched base pairs (G(3Cu)T and A(2Cu)C), and examined their structural and electronic properties by means of density functional theory calculations. The results reveal that these multi-Cu-mediated mismatched base pairs still have planar geometries that are thermodynamically favorable to stability, and their binding energies are close to those of multi-Cu-mediated normal base pairs (G(3Cu)C and A(2Cu)T). Their HOMO-LUMO gaps and ionization potentials decrease significantly compared to the corresponding natural base pairs. As evidenced by the charge transfer excitation transitions, transverse electronic communication of G(3Cu)T and A(2Cu)C is remarkably enhanced, suggesting that they facilitate electron migration along the DNA wires upon incorporation. Further examinations also clarify the possibility to build promising DNA helices using the G(3Cu)T and/or A(2Cu) C base pairs. The calculated electronic properties of the three-layer-stacked multi-Cu-mediated mismatched base pairs illustrate that the Cu(m)-DNA have better conductivity. This work provides perspectives for the development and application of DNA nanowires. PMID:22807419

  13. Cytokinin oxidase regulates rice grain production.

    PubMed

    Ashikari, Motoyuki; Sakakibara, Hitoshi; Lin, Shaoyang; Yamamoto, Toshio; Takashi, Tomonori; Nishimura, Asuka; Angeles, Enrique R; Qian, Qian; Kitano, Hidemi; Matsuoka, Makoto

    2005-07-29

    Most agriculturally important traits are regulated by genes known as quantitative trait loci (QTLs) derived from natural allelic variations. We here show that a QTL that increases grain productivity in rice, Gn1a, is a gene for cytokinin oxidase/dehydrogenase (OsCKX2), an enzyme that degrades the phytohormone cytokinin. Reduced expression of OsCKX2 causes cytokinin accumulation in inflorescence meristems and increases the number of reproductive organs, resulting in enhanced grain yield. QTL pyramiding to combine loci for grain number and plant height in the same genetic background generated lines exhibiting both beneficial traits. These results provide a strategy for tailormade crop improvement. PMID:15976269

  14. Natural Compounds as Modulators of NADPH Oxidases

    PubMed Central

    2013-01-01

    Reactive oxygen species (ROS) are cellular signals generated ubiquitously by all mammalian cells, but their relative unbalance triggers also diseases through intracellular damage to DNA, RNA, proteins, and lipids. NADPH oxidases (NOX) are the only known enzyme family with the sole function to produce ROS. The NOX physiological functions concern host defence, cellular signaling, regulation of gene expression, and cell differentiation. On the other hand, increased NOX activity contributes to a wide range of pathological processes, including cardiovascular diseases, neurodegeneration, organ failure, and cancer. Therefore targeting these enzymatic ROS sources by natural compounds, without affecting the physiological redox state, may be an important tool. This review summarizes the current state of knowledge of the role of NOX enzymes in physiology and pathology and provides an overview of the currently available NADPH oxidase inhibitors derived from natural extracts such as polyphenols. PMID:24381714

  15. NADPH oxidases in the arbuscular mycorrhizal symbiosis.

    PubMed

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-04-01

    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  16. Purification of a cytochrome bd terminal oxidase encoded by the Escherichia coli app locus from a delta cyo delta cyd strain complemented by genes from Bacillus firmus OF4.

    PubMed Central

    Sturr, M G; Krulwich, T A; Hicks, D B

    1996-01-01

    Escherichia coli GK100, with deletions in the operons encoding its two terminal oxidases, cytochrome bo and ctyochrome bd, was complemented for growth on succinate by a recombinant plasmid (pMS100) containing a 3.4-kb region of DNA from alkaliphilic Bacillus firmus OF4. The complementing DNA was predicted to encode five proteins, but neither sequence analysis nor complementation experiments with subclones provided insight into the basis for the complementation. Cytochrome difference spectra of everted membrane vesicles from the transformed strain had characteristics of a cytochrome bd spectrum but with features different from those observed for alkaliphile membranes. To determine the bacterial source and identity of the structural genes for the cytochrome bd in the transformed mutant, the complex was extracted and partially purified. On sodium dodecyl sulfate-polyacrylamide gels, two polypeptides were resolved from the preparation, 43 (subunit I) and 27 (subunit II) kDa. An internal peptide from subunit I was sequenced, and it yielded the same primary sequence as is found in positions 496 to 510 of E. coli appC. Consistent with the microsequencing results pMS100 failed to complement a triple mutant of E. coli carrying a deletion in appB as well as in the cyo and cyd loci. The deduced sequence of AppBC had been predicted to be very similar to the sequence of CydAB (J. Dassa et al., Mol. Gen. Genet. 229:341-352, 1991) but this is the first demonstration that the former is indeed a cytochrome bd terminal oxidase. The enzyme catalyzed oxygen uptake coupled to quinol or N,N,N',N'-tetramethyl-p-phenylenediamine oxidation, and the activity was sensitive to cyanide. No cross-reactivity to subunit-specific polyclonal antibodies directed against the two individual subunits of cyd-encoded cytochrome bd was detected. Since this is the second cytochrome bd discovered in E. coli, it is proposed that the two complexes be designated cytochrome bd-I (cydAB-encoded enzyme) and cytochrome bd-II (appBC-encoded enzyme). In addition, cbdAB is suggested as a more appropriate gene designation for cytochrome bd than either appBC or cyxAB. PMID:8626304

  17. The cbb3-type cytochrome c oxidase from Rhodobacter sphaeroides, a proton-pumping heme-copper oxidase.

    PubMed

    Toledo-Cuevas, M; Barquera, B; Gennis, R B; Wikström, M; García-Horsman, J A

    1998-07-20

    Rhodobacter sphaeroides expresses a bb3-type quinol oxidase, and two cytochrome c oxidases: cytochrome aa3 and cytochrome cbb3. We report here the characterization of the genes encoding this latter oxidase. The ccoNOQP gene cluster of R. sphaeroides contains four open reading frames with high similarity to all ccoNOQP/fixNOQP gene clusters reported so far. CcoN has the six highly conserved histidines proposed to be involved in binding the low spin heme, and the binuclear center metals. ccoO and ccoP code for membrane bound mono- and diheme cytochromes c. ccoQ codes for a small hydrophobic protein of unknown function. Upstream from the cluster there is a conserved Fnr/FixK-like box which may regulate its expression. Analysis of a R. sphaeroides mutant in which the ccoNOQP gene cluster was inactivated confirms that this cluster encodes the cbb3-type oxidase previously purified. Analysis of proton translocation in several strains shows that cytochrome cbb3 is a proton pump. We also conclude that cytochromes cbb3 and aa3 are the only cytochrome c oxidases in the respiratory chain of R. sphaeroides. PMID:9711295

  18. Culture-Independent Identification of Manganese-Oxidizing Genes from Deep-Sea Hydrothermal Vent Chemoautotrophic Ferromanganese Microbial Communities Using a Metagenomic Approach

    NASA Astrophysics Data System (ADS)

    Davis, R.; Tebo, B. M.

    2013-12-01

    Microbial activity has long been recognized as being important to the fate of manganese (Mn) in hydrothermal systems, yet we know very little about the organisms that catalyze Mn oxidation, the mechanisms by which Mn is oxidized or the physiological function that Mn oxidation serves in these hydrothermal systems. Hydrothermal vents with thick ferromanganese microbial mats and Mn oxide-coated rocks observed throughout the Pacific Ring of Fire are ideal models to study the mechanisms of microbial Mn oxidation, as well as primary productivity in these metal-cycling ecosystems. We sampled ferromanganese microbial mats from Vai Lili Vent Field (Tmax=43°C) located on the Eastern Lau Spreading Center and Mn oxide-encrusted rhyolytic pumice (4°C) from Niua South Seamount on the Tonga Volcanic Arc. Metagenomic libraries were constructed and assembled from these samples and key genes known to be involved in Mn oxidation and carbon fixation pathways were identified in the reconstructed genomes. The Vai Lili metagenome assembled to form 121,157 contiguous sequences (contigs) greater than 1000bp in length, with an N50 of 8,261bp and a total metagenome size of 593 Mbp. Contigs were binned using an emergent self-organizing map of tetranucleotide frequencies. Putative homologs of the multicopper Mn-oxidase MnxG were found in the metagenome that were related to both the Pseudomonas-like and Bacillus-like forms of the enzyme. The bins containing the Pseudomonas-like mnxG genes are most closely related to uncultured Deltaproteobacteria and Chloroflexi. The Deltaproteobacteria bin appears to be an obligate anaerobe with possible chemoautotrophic metabolisms, while the Chloroflexi appears to be a heterotrophic organism. The metagenome from the Mn-stained pumice was assembled into 122,092 contigs greater than 1000bp in length with an N50 of 7635 and a metagenome size of 385 Mbp. Both forms of mnxG genes are present in this metagenome as well as the genes encoding the putative Mn oxidases McoA and MopA. The greater diversity of Mn oxidase pathways in this metagenome suggests a more diverse Mn oxidizing microbial community in the cold pumice sample. Key enzymes for four of the six known carbon fixation pathways (the Calvin Cycle, the reductive TCA cycle, the Wood-Ljungdahl pathway, and the 3-hydroxypropionate/4-hydroxybutyrate Cycle) were also identified in both samples indicating primary production occurs via a diverse community of carbon fixing organisms. Together, these samples contain active, diverse populations of Mn oxidizing bacteria living in association with microbial communities supported by chemoautotrophic carbon fixation.

  19. The first patient diagnosed with cytochrome c oxidase deficient Leigh syndrome: progress report.

    PubMed

    Coenen, M J H; Smeitink, J A M; Farhoud, M H; Nijtmans, L G J; Rodenburg, R; Janssen, A; van Kaauwen, E P M; Trijbels, F J M; van den Heuvel, L P

    2006-02-01

    Mutations in SURF1, an assembly gene for cytochrome c oxidase (COX), the fourth complex of the oxidative phosphorylation system, are most frequently encountered in patients with COX deficiency. We describe a patient with Leigh syndrome harbouring a mutation in SURF1 who was reported decades ago with a tissue-specific cytochrome c oxidase deficiency. PMID:16601896

  20. DEVELOPMENTAL REGULATION OF PEACH ACC OXIDASE-GUS FUSIONS IN TRANSGENIC TOMATO FRUITS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fruit ripening involves changes in the expression of a large number of genes including the well-characterized 1-Aminocyclopropane-1-caboxylic acid oxidase which catalyzes the conversion of 1-aminocyclopropane-1-caboxylate to ethylene. We isolated a genomic DNA sequence encoding ACC oxidase from pea...

  1. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 ? m in average length and 5 ? m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and ? =? 90 degrees, ? = 126 degrees.

  2. Overexpression of a GmCnx1 gene enhanced activity of nitrate reductase and aldehyde oxidase, and boosted mosaic virus resistance in soybean.

    PubMed

    Zhou, Zheng; He, Hongli; Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

    2015-01-01

    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g(-1) h(-1) and 30 pmol L(-1), respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  3. Overexpression of a GmCnx1 Gene Enhanced Activity of Nitrate Reductase and Aldehyde Oxidase, and Boosted Mosaic Virus Resistance in Soybean

    PubMed Central

    Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

    2015-01-01

    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g-1 h-1 and30 pmol L-1, respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  4. Cloning and expression pattern of peroxisomal beta-oxidation genes palmitoyl-CoA oxidase, multifunctional protein and 3-ketoacyl-CoA thiolase in mussel Mytilus galloprovincialis and thicklip grey mullet Chelon labrosus.

    PubMed

    Bilbao, Eider; Cajaraville, Miren P; Cancio, Ibon

    2009-08-15

    Due to the ability to respond after exposure to organic toxic compounds, peroxisome proliferation is used as biomarker of exposure to organic pollutants in mussels and in fish. Mussels are worldwide studied as sentinels of pollution in marine environments while mullets such as the thicklip grey mullet Chelon labrosus have been proposed as appropriate sentinel species since they inhabit highly polluted environments. In order to study genes of the inducible peroxisomal beta-oxidation pathway in mussels Mytilus galloprovincialis and in C. labrosus, genes coding for the three enzymes in the inducible peroxisomal beta-oxidation pathway, palmitoyl-CoA oxidase (AOX1), multifunctional protein (MFP1 in mullet and MFP2 in mussels), and 3-ketoacyl-CoA thiolase (THIO), were cloned. Additionally, a fragment of the peroxisomal Delta(2), Delta(4) dienoyl-CoA reductase 2 (DECR) necessary for the beta-oxidation of unsaturated fatty acids was cloned in mullets. The whole open reading frame of aox1 sequenced in both mussels and mullets revealed high homology with known aox1 sequences, with highly conserved important domains such as the FAD binding motif or the typical peroxisomal targeting signal (PTS1). A thorough in silico analysis of the gene and genome databases allowed to identify in fish and molluscs sequence homologs of all the enzymes necessary for 2 of the 3 different paralog peroxisomal beta-oxidation pathways described in metazoans (AOX1, AOX3, MFP1, MFP2, THIO and sterol carrier protein X). Only the enzyme necessary for the oxidation of branched chain fatty acids, AOX2, described in mammalian, avian and amphibian species, seems to be lacking from the genomes of fish and molluscs. In order to study the expression and regulation capacity of peroxisomal beta-oxidation genes, aox1 and thio expression was determined in different tissues of mature and immature mullets and mussels collected in January and June, both genes being expressed higher in the digestive gland of mussels collected in June compared to January. Finally, in silico studies of the promoter regions in the piscine genomes available in the Ensembl genome repository, allowed the identification of putative peroxisome proliferator response elements that could explain the possible cellular and molecular mechanisms leading to peroxisome proliferation in fish. Further studies are needed to decipher molecular mechanisms of peroxisome proliferation in aquatic organisms under exposure to peroxisome proliferator xenobiotics. PMID:19465092

  5. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  6. Fluorometric assays for coproporphyrinogen oxidase and protoporphyrinogen oxidase.

    PubMed

    Labbe, P; Camadro, J M; Chambon, H

    1985-08-15

    We describe fluorometric assays for two enzymes of the heme pathway, coproporphyrinogen oxidase and protoporphyrinogen oxidase. Both assays are based on measurement of protoporphyrin IX fluorescence generated from coproporphyrinogen III by the two consecutive reactions catalyzed by coproporphyrinogen oxidase and protoporphyrinogen oxidase. Both enzymatic activities are measured by recording protoporphyrin IX fluorescence increase in air-saturated buffer in the presence of EDTA (to inhibit ferrochelatase that can further metabolize protoporphyrin IX) and in the presence of dithiothreitol (that prevents nonenzymatic oxidation of porphyrinogens to porphyrins). Coproporphyrinogen oxidase (limiting) activity is measured in the presence of a large excess of protoporphyrinogen oxidase provided by yeast mitochondrial membranes isolated from commercial baker's yeast. These membranes are easy to prepare and are stable for at least 1 year when kept at -80 degrees C. Moreover they ensure maximum fluorescence of the generated protoporphyrin (solubilization effect), avoiding use of a detergent in the incubation medium. The fluorometric protoporphyrinogen oxidase two-step assay is closely related to that already described (J.-M. Camadro, D. Urban-Grimal, and P. Labbe, 1982, Biochem. Biophys. Res. Commun. 106, 724-730). Protoporphyrinogen is enzymatically generated from coproporphyrinogen by partially purified yeast coproporphyrinogen oxidase. The protoporphyrinogen oxidase reaction is then initiated by addition of the membrane fraction to be tested. However, when very low amounts of membrane are used, low amounts of Tween 80 (less than 1 mg/ml) have to be added to the incubation mixture to solubilize protoporphyrin IX in order to ensure optimal fluorescence intensity. This detergent has no effect on the rate of the enzymatic reaction when used at concentrations less than 2 mg/ml. Activities ranging from 0.1 to 4-5 nmol protoporphyrin formed per hour per assay are easily and reproducibly measured in less than 30 min. PMID:3907404

  7. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    PubMed Central

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

    2013-01-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  8. NADPH oxidase and neurodegeneration.

    PubMed

    Hernandes, Marina S; Britto, Luiz R G

    2012-12-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  9. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  10. [Identification of Ixodes persulcatus and Ixodes pavlovskyi occidentalis (Ixodidae) by the analysis of the gene fragment COXI (cytochrome oxidase subunit I)].

    PubMed

    Livanova, N N; Tikunova, N V; Livanov, S G; Fomenko, N V

    2012-01-01

    Ticks of the genus Ixodes were collected in 2010 in the lowland part of Toguchinsk district of Novosibirsk Province (Russia) and in the forest-park area of Novosibirsk Scientific Centre and its outskirts (Sovetskiy district of Novosibirsk), and identified as Ixodes persulcatus (Schulze, 1930) (18 females and 13 males) and Ixodes pavlovskyi (13 females and 10 males). Ten specimens of each sex from each collecting site were examined. The following nine characters were used: the length and width of the scutum (conscutum) and of the gnathosoma in ventral view; the length of palpal segments II-III; the width of the hypostome; the length of idiosoma with scapula, of leg I, of the medial spur on fore coxa (Taiga..., 1985; Filippova, Musatov, 1996; Filippova, Panova, 1998). According to morphometric characters, specimens of Ixodes pavlovskyi collected in the forest-park area of the Novosibirsk Scientific Centre were identified as the subspecies I. p. occidentalis Filippova et Panova, 1998. Nucleotide sequences of the COI mitochondrial gene fragment were determined for 56 ticks. Phylogenetic analysis of the COI gene fragment in representatives of the persulcatus-ricinus species-group dwelling in Asia demonstrated high degree of conservatism. Molecular-genetic methods allow reliable identification of morphologically similar species I. pavlovskyi and I. persulcatus, pathogenic for humans. PMID:23458013

  11. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    PubMed

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at frequencies of ca. 25-67 % and those with negative Phr were broadly found in Europe and Asia. The stop codon type was found in 285 accessions and was broadly distributed in Europe and Asia, whereas the TE-1 insertion type was found in 99 accessions from Europe and Asia but was not found in India. The 6-bp duplication type was found in only 8 accessions from Nansei Islands (Okinawa Prefecture) of Japan. We also analyzed Phr in the wild ancestor and concluded that the negative Phr type was likely to have originated after domestication of foxtail millet. It was also implied that negative Phr of foxtail millet arose by multiple independent loss of function of PPO gene through dispersal because of some advantages under some environmental conditions and human selection as in rice and barley. PMID:25740049

  12. Cloning of the cyo locus encoding the cytochrome o terminal oxidase complex of Escherichia coli.

    PubMed Central

    Au, D C; Gennis, R B

    1987-01-01

    The structural genes encoding the cytochrome o terminal oxidase complex (cyo) of Escherichia coli have been subcloned into the multicopy plasmid pBR322 after the Mu-mediated transposition of the gene locus from the bacterial chromosome onto the conjugative R plasmid RP4. Introduction of cyo plasmids into strains (cyo cyd) lacking both terminal oxidases restored the ability of the strains to grow aerobically on nonfermentable substrates. Strains carrying the cyo plasmids produced 5 to 10 times more cytochrome o oxidase than did control strains. The gene products encoded by the cyo plasmids could be immunoprecipitated with monospecific antibodies raised against cytochrome o. The cloned genes will be valuable for studying the structure, function, and regulation of the cytochrome o terminal oxidase complex. Images PMID:3036778

  13. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells

    PubMed Central

    Dassa, Emmanuel P; Dufour, Eric; Gonçalves, Sérgio; Paupe, Vincent; Hakkaart, Gertjan A J; Jacobs, Howard T; Rustin, Pierre

    2009-01-01

    Cytochrome c oxidase (COX) deficiency is associated with a wide spectrum of clinical conditions, ranging from early onset devastating encephalomyopathy and cardiomyopathy, to neurological diseases in adulthood and in the elderly. No method of compensating successfully for COX deficiency has been reported so far. In vitro, COX-deficient human cells require additional glucose, pyruvate and uridine for normal growth and are specifically sensitive to oxidative stress. Here, we have tested whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) from Ciona intestinalis could alleviate the metabolic abnormalities of COX-deficient human cells either from a patient harbouring a COX15 pathological mutation or rendered deficient by silencing the COX10 gene using shRNA. We demonstrate that the expression of the AOX, well-tolerated by the cells, compensates for both the growth defect and the pronounced oxidant-sensitivity of COX-deficient human cells. PMID:20049701

  14. The Escherichia coli CydX Protein Is a Member of the CydAB Cytochrome bd Oxidase Complex and Is Required for Cytochrome bd Oxidase Activity

    PubMed Central

    VanOrsdel, Caitlin E.; Bhatt, Shantanu; Allen, Rondine J.; Brenner, Evan P.; Hobson, Jessica J.; Jamil, Aqsa; Haynes, Brittany M.; Genson, Allyson M.

    2013-01-01

    Cytochrome bd oxidase operons from more than 50 species of bacteria contain a short gene encoding a small protein that ranges from ∼30 to 50 amino acids and is predicted to localize to the cell membrane. Although cytochrome bd oxidases have been studied for more than 70 years, little is known about the role of this small protein, denoted CydX, in oxidase activity. Here we report that Escherichia coli mutants lacking CydX exhibit phenotypes associated with reduced oxidase activity. In addition, cell membrane extracts from ΔcydX mutant strains have reduced oxidase activity in vitro. Consistent with data showing that CydX is required for cytochrome bd oxidase activity, copurification experiments indicate that CydX interacts with the CydAB cytochrome bd oxidase complex. Together, these data support the hypothesis that CydX is a subunit of the CydAB cytochrome bd oxidase complex that is required for complex activity. The results of mutation analysis of CydX suggest that few individual amino acids in the small protein are essential for function, at least in the context of protein overexpression. In addition, the results of analysis of the paralogous small transmembrane protein AppX show that the two proteins could have some overlapping functionality in the cell and that both have the potential to interact with the CydAB complex. PMID:23749980

  15. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  16. Novel genetic diversity within Anopheles punctimacula s.l.: Phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2)

    PubMed Central

    Loaiza, Jose R.; Scott, Marilyn E.; Bermingham, Eldredge; Sanjur, Oris I.; Rovira, Jose R.; Dutari, Larissa C.; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E.

    2013-01-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3´ COI), the Barcode region in the five prime end of the COI (5´ COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3´ COI depicted six highly supported molecular lineages (A–F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5´ COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3´ COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  17. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).

    PubMed

    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E

    2013-10-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  18. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun

    2016-09-01

    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (Fst<0.16965) and AMOVA analysis revealed that no significant genetic differentiation was observed among the seven different geographical populations. Neutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population. PMID:26394200

  19. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

    2014-01-01

    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  20. Draft Genome Sequence of Strain Q-1, an Iodide-Oxidizing Alphaproteobacterium Isolated from Natural Gas Brine Water

    PubMed Central

    Ehara, Ayaka; Suzuki, Haruo; Kanesaki, Yu; Yoshikawa, Hirofumi

    2014-01-01

    Here we report the draft genome sequence of strain Q-1, an iodide (I−)-oxidizing heterotrophic bacterium in the class Alphaproteobacteria isolated from natural gas brine water. The genome sequence contained a multicopper oxidase gene probably responsible for iodide oxidation. A photosynthetic gene cluster was found but genes for carbon-fixation were absent. PMID:24994802

  1. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-André; Alric, Jean; Johnson, Xenie

    2011-01-01

    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  2. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  3. Molecular cloning, sequencing, and functional expression of a cDNA encoding human coproporphyrinogen oxidase.

    PubMed Central

    Martasek, P; Camadro, J M; Delfau-Larue, M H; Dumas, J B; Montagne, J J; de Verneuil, H; Labbe, P; Grandchamp, B

    1994-01-01

    Coproporphyrinogen oxidase (EC 1.3.3.3) catalyzes the sixth step in the heme biosynthetic pathway, the oxidation of coproporphyrinogen III to protoporphyrinogen IX. The activity of this enzyme is deficient in the disease hereditary coproporphyria. The sequence of the cDNA and predicted amino acid sequence of the human coproporphyrinogen oxidase are presented. The human protein sequence contains a region completely homologous to that we obtained by sequencing an 11-amino acid peptide fragment from purified murine liver coproporphyrinogen oxidase. Results of Southern blotting were consistent with the presence of a single human coproporphyrinogen oxidase gene, and Northern blotting demonstrated one transcript of similar size in erythroid and nonerythroid cell lines. Expression of the cDNA coding for the putative mature human coproporphyrinogen oxidase in Escherichia coli resulted in a 17-fold increase in coproporphyrinogen activity over endogenous activity. Images PMID:8159699

  4. [Alternative oxidase in industrial fungi].

    PubMed

    Gu, Shuai; Liu, Qiang; He, Hao; Li, Shuang

    2015-01-01

    Filamentous fungi have been used in industrial fermentation extensively. Based on non-phosphorylating electron transport process, alternative respiration pathway (ARP) acts as an energy overflow, which can balance carbon metabolism and electron transport, allow the continuance of tricarboxylic acid cycle without the formation of ATP, and permit the turnover of carbon skeletons. Alternative respiration pathway also plays an important role in the stress response of fungi and the physiological function of conditioned pathogen. Alternative oxidase (AOX) is the terminal oxidase responsible for the activity of alternative respiration pathway, which exists widely in higher plants, parts of fungi and algae. Owing to the property that alternative oxidase (AOX) is sensitive to salicylhydroxamic acid (SHAM) and insensitive to conventional inhibitors of cytochrome respiration, alternative respiration pathway by AOX is also named as cyanide-resistant respiration (CRR). In recent years, the study of the alternative respiration pathway and alternative oxidase has been a hot topic in the area involving cellular respiration metabolism. In this review we summarized the latest research advances about the functions of alternative respiration pathway and alternative oxidase in industrial fungi. PMID:26021078

  5. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

    2016-01-01

    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  6. Cytochrome c Oxidase Dysfunction in Oxidative Stress

    PubMed Central

    Srinivasan, Satish; Avadhani, Narayan G.

    2012-01-01

    Cytochrome c Oxidase (CcO) is the terminal oxidase of the mitochondrial electron transport chain. This bigenomic enzyme in mammals contains 13 subunits, of which, three catalytic subunits are encoded by the mitochondrial genes. The remaining ten subunits with suspected roles in the regulation, and/or, assembly are coded by the nuclear genome. The enzyme contains two heme groups (heme a and a3) and two Cu2+ centers (Cu2+ A and Cu2+ B) as catalytic centers and handles more than 90% of molecular O2 respired by the mammalian cells and tissues. CcO is a highly regulated enzyme which is believed to be the pace setter for mitochondrial oxidative metabolism and ATP synthesis. The structure and function of the enzyme is affected in a wide variety of diseases including cancer, neurodegenerative diseases, myocardial ischemia/reperfusion, bone and skeletal diseases and diabetes. Despite handling a high O2 load the role of CcO in the production of reactive oxygen species still remains a subject of debate. However, a volume of evidence suggests that CcO dysfunction is invariably associated with increased mitochondrial reactive oxygen species production and cellular toxicity. In this article we review literature on mechanisms of multimodal regulation of CcO activity by a wide spectrum of physiological and pathological factors. We also review an array of literature on the direct or indirect roles of CcO in reactive oxygen species production. PMID:22841758

  7. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  8. Regulation of cytochrome c- and quinol oxidases, and piezotolerance of their activities in the deep-sea piezophile Shewanella violacea DSS12 in response to growth conditions.

    PubMed

    Ohke, Yoshie; Sakoda, Ayaka; Kato, Chiaki; Sambongi, Yoshihiro; Kawamoto, Jun; Kurihara, Tatsuo; Tamegai, Hideyuki

    2013-01-01

    The facultative piezophile Shewanella violacea DSS12 is known to have respiratory components that alter under the influence of hydrostatic pressure during growth, suggesting that its respiratory system is adapted to high pressure. We analyzed the expression of the genes encoding terminal oxidases and some respiratory components of DSS12 under various growth conditions. The expression of some of the genes during growth was regulated by both the O2 concentration and hydrostatic pressure. Additionally, the activities of cytochrome c oxidase and quinol oxidase of the membrane fraction of DSS12 grown under various conditions were measured under high pressure. The piezotolerance of cytochrome c oxidase activity was dependent on the O2 concentration during growth, while that of quinol oxidase was influenced by pressure during growth. The activity of quinol oxidase was more piezotolerant than that of cytochrome c oxidase under all growth conditions. Even in the membranes of the non-piezophile Shewanella amazonensis, quinol oxidase was more piezotolerant than cytochrome c oxidase, although both were highly piezosensitive as compared to the activities in DSS12. By phylogenetic analysis, piezophile-specific cytochrome c oxidase, which is also found in the genome of DSS12, was identified in piezophilic Shewanella and related genera. Our observations suggest that DSS12 constitutively expresses piezotolerant respiratory terminal oxidases, and that lower O2 concentrations and higher hydrostatic pressures induce higher piezotolerance in both types of terminal oxidases. Quinol oxidase might be the dominant terminal oxidase in high-pressure environments, while cytochrome c oxidase might also contribute. These features should contribute to adaptation of DSS12 in deep-sea environments. PMID:23832349

  9. Peroxisomal polyamine oxidase and NADPH-oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana.

    PubMed

    Andronis, Efthimios A; Moschou, Panagiotis N; Toumi, Imene; Roubelakis-Angelakis, Kalliopi A

    2014-01-01

    Homeostasis of reactive oxygen species (ROS) in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA) are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd) and spermine to putrescine and Spd, respectively, is catalyzed by two peroxisomal PA oxidases (AtPAO). However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI). Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions ([Formula: see text] ), but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX). On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and [Formula: see text] . These results suggest that the ratio of [Formula: see text] /H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of [Formula: see text] by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed. PMID:24765099

  10. Peroxisomal polyamine oxidase and NADPH-oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

    PubMed Central

    Andronis, Efthimios A.; Moschou, Panagiotis N.; Toumi, Imene; Roubelakis-Angelakis, Kalliopi A.

    2014-01-01

    Homeostasis of reactive oxygen species (ROS) in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA) are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd) and spermine to putrescine and Spd, respectively, is catalyzed by two peroxisomal PA oxidases (AtPAO). However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI). Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2•− ), but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX). On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2•− . These results suggest that the ratio of O2•− /H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2•− by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed. PMID:24765099

  11. Optimization of glucose oxidase production by Aspergillus niger using genetic- and process-engineering techniques.

    PubMed

    Hellmuth, K; Pluschkell, S; Jung, J K; Ruttkowski, E; Rinas, U

    1995-11-01

    Wild-type Aspergillus niger NRRL-3 was transformed with multiple copies of the glucose oxidase structural gene (god). The gene was placed under the control of the gpdA promoter of A. nidulans. For more efficient secretion the alpha-amylase signal peptide from A. oryzae was inserted in front of god. Compared to the wild type, the recombinant strain NRRL-3 (GOD3-18) produced up to four times more extracellular glucose oxidase under identical culture conditions. Addition of yeast extract (2 gl-1) to a mineral salts medium containing only glucose as carbon source increased volumetric and specific extracellular glucose oxidase activities by 130% and 50% respectively. With the same medium composition and inoculum size, volumetric and specific extracellular glucose oxidase activities increased more than ten times in bioreactor cultivations compared to shake-flask cultures. PMID:8590664

  12. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  13. Expression studies of gibberellin oxidases in developing pumpkin seeds.

    PubMed

    Frisse, Andrea; Pimenta, Maria João; Lange, Theo

    2003-03-01

    Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA(12)-aldehyde, GA(12), GA(15), GA(24), GA(25), and GA(9) to GA(14)-aldehyde, GA(14), GA(37), GA(36), GA(13), and GA(4), respectively. Recombinant 2-ox protein oxidized GA(9), GA(4), and GA(1) to GA(51), GA(34), and GA(8), respectively. Previously cloned GA 7-oxidase revealed additional 3beta-hydroxylation activity of GA(12). Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2beta,3beta-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

  14. Drugs related to monoamine oxidase activity.

    PubMed

    Fišar, Zdeněk

    2016-08-01

    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions. PMID:26944656

  15. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )

    1989-04-01

    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  16. Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity

    PubMed Central

    Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

    2013-01-01

    Abstract A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. PMID:23873697

  17. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.

    PubMed

    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

    2014-12-01

    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  18. Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.

    PubMed

    Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo

    2014-02-01

    A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag│AgCl│KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. PMID:24189123

  19. Different recombinant forms of polyphenol oxidase A, a laccase from Marinomonas mediterranea.

    PubMed

    Tonin, Fabio; Rosini, Elena; Piubelli, Luciano; Sanchez-Amat, Antonio; Pollegioni, Loredano

    2016-07-01

    Polyphenol oxidase from the marine bacterium Marinomonas mediterranea (MmPPOA) is a membrane-bound, blue, multi-copper laccase of 695 residues. It possesses peculiar properties that distinguish it from known laccases, such as a broad substrate specificity (common to tyrosinases) and a high redox potential. In order to push the biotechnological application of this laccase, the full-length enzyme was overexpressed in Escherichia coli cells with and without a C-terminal His-tag. The previous form, named rMmPPOA-695-His, was purified to homogeneity by HiTrap chelating chromatography following solubilization by 1% SDS in the lysis buffer with an overall yield of ≈1 mg/L fermentation broth and a specific activity of 1.34 U/mg protein on 2,6-dimethoxyphenol as substrate. A truncated enzyme form lacking 58 residues at the N-terminus encompassing the putative membrane binding region, namely rMmPPOA-637-His, was successfully expressed in E. coli as soluble protein and was purified by using the same procedure set-up as for the full-length enzyme. Elimination of the N-terminal sequence decreased the specific activity 15-fold (which was partially restored in the presence of 1 M NaCl) and altered the secondary and tertiary structures and the pH dependence of optimal stability. The recombinant rMmPPOA-695-His showed kinetic properties on catechol higher than for known laccases, a very high thermal stability, and a strong resistance to NaCl, DMSO, and Tween-80, all properties that are required for specific, targeted industrial applications. PMID:27050199

  20. Polyphenol oxidase (PPO) in wheat and wild relatives: Molecular evidence for a multigene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat polyphenol oxidase (PPO) is the major cause of browning reactions that discolor Asian noodles and other wheat products. It has been hypothesized that genes encoding wheat PPOs may have evolved by gene duplication into a multigene family. Here we characterized PPO genomic sequences from diploid...

  1. Cholesterol oxidase with high catalytic activity from Pseudomonas aeruginosa: Screening, molecular genetic analysis, expression and characterization.

    PubMed

    Doukyu, Noriyuki; Nihei, Shyou

    2015-07-01

    An extracellular cholesterol oxidase producer, Pseudomonas aeruginosa strain PA157, was isolated by a screening method to detect 6β-hydroperoxycholest-4-en-3-one-forming cholesterol oxidase. On the basis of a putative cholesterol oxidase gene sequence in the genome sequence data of P. aeruginosa strain PAO1, the cholesterol oxidase gene from strain PA157 was cloned. The mature form of the enzyme was overexpressed in Escherichia coli cells. The overexpressed enzyme formed inclusion bodies in recombinant E. coli cells grown at 20 °C and 30 °C. A soluble and active PA157 enzyme was obtained when the recombinant cells were grown at 10 °C. The purified enzyme was stable at pH 5.5 to 10 and was most active at pH 7.5-8.0, showing optimal activity at pH 7.0 and 70 °C. The enzyme retained about 90% of its activity after incubation for 30 min at 70 °C. The enzyme oxidized 3β-hydroxysteroids such as cholesterol, β-cholestanol, and β-sitosterol at high rates. The Km value and Vmax value for the cholesterol were 92.6 μM and 15.9 μmol/min/mg of protein, respectively. The Vmax value of the enzyme was higher than those of commercially available cholesterol oxidases. This is the first report to characterize a cholesterol oxidase from P. aeruginosa. PMID:25573142

  2. Genetic defects of cytochrome c oxidase assembly.

    PubMed

    Pecina, P; Houstková, H; Hansíková, H; Zeman, J; Houstek, J

    2004-01-01

    Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, is one of the key functional and regulatory sites of the mammalian energy metabolism. Owing to the importance of the enzyme, pathogenetic mutations affecting COX frequently result in severe, often fatal metabolic disorders. No satisfactory therapy is currently available so that the treatment remains largely symptomatic and does not improve the course of the disease. While only few genetic defects of COX are caused by mutations in mitochondrial genome, during the last five years a large number of pathogenetic mutations in nuclear genes have been discovered. All these mutations are located in genes encoding COX-specific assembly proteins including SURF1, SCO1, SCO2, COX10, and COX15. Despite the identification of increasing number of mutations, their precise etiopathogenetic mechanisms, which are necessary for the development of future therapeutic protocols, still remain to be elucidated. This review summarizes recent developments, including our efforts in elucidation of the molecular basis of human mitochondrial diseases due to specific defects of COX with special focus on SURF1 assembly protein. PMID:15119951

  3. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  4. Glucose oxidase activity of actinomycetes.

    PubMed

    St Vlahov, S

    1978-01-01

    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  5. Involvement of SenC in Assembly of Cytochrome c Oxidase in Rhodobacter capsulatus†

    PubMed Central

    Swem, Danielle L.; Swem, Lee R.; Setterdahl, Aaron; Bauer, Carl E.

    2005-01-01

    SenC, a Sco1 homolog found in the purple photosynthetic bacteria, has been implicated in affecting photosynthesis and respiratory gene expression, as well as assembly of cytochrome c oxidase. In this study, we show that SenC from Rhodobacter capsulatus is involved in the assembly of a fully functional cbb3-type cytochrome c oxidase, as revealed by decreased cytochrome c oxidase activity in a senC mutant. We also show that a putative copper-binding site in SenC is required for activity and that a SenC deletion phenotype can be rescued by the addition of exogenous copper to the growth medium. In addition, we demonstrate that a SenC mutation has an indirect effect on gene expression caused by a reduction in cytochrome c oxidase activity. A model is proposed whereby a reduction in cytochrome c oxidase activity impedes the flow of electrons through the respiratory pathway, thereby affecting the oxidation/reduction state of the ubiquinone pool, leading to alterations of photosystem and respiratory gene expression. PMID:16291681

  6. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  7. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  8. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  9. A Broad Distribution of the Alternative Oxidase in Microsporidian Parasites

    PubMed Central

    Williams, Bryony A. P.; Elliot, Catherine; Burri, Lena; Kido, Yasutoshi; Kita, Kiyoshi; Moore, Anthony L.; Keeling, Patrick J.

    2010-01-01

    Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX), a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1) as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes. PMID:20169184

  10. Structure and function of mammalian aldehyde oxidases.

    PubMed

    Terao, Mineko; Romão, Maria João; Leimkühler, Silke; Bolis, Marco; Fratelli, Maddalena; Coelho, Catarina; Santos-Silva, Teresa; Garattini, Enrico

    2016-04-01

    Mammalian aldehyde oxidases (AOXs; EC1.2.3.1) are a group of conserved proteins belonging to the family of molybdo-flavoenzymes along with the structurally related xanthine dehydrogenase enzyme. AOXs are characterized by broad substrate specificity, oxidizing not only aromatic and aliphatic aldehydes into the corresponding carboxylic acids, but also hydroxylating a series of heteroaromatic rings. The number of AOX isoenzymes expressed in different vertebrate species is variable. The two extremes are represented by humans, which express a single enzyme (AOX1) in many organs and mice or rats which are characterized by tissue-specific expression of four isoforms (AOX1, AOX2, AOX3, and AOX4). In vertebrates each AOX isoenzyme is the product of a distinct gene consisting of 35 highly conserved exons. The extant species-specific complement of AOX isoenzymes is the result of a complex evolutionary process consisting of a first phase characterized by a series of asynchronous gene duplications and a second phase where the pseudogenization and gene deletion events prevail. In the last few years remarkable advances in the elucidation of the structural characteristics and the catalytic mechanisms of mammalian AOXs have been made thanks to the successful crystallization of human AOX1 and mouse AOX3. Much less is known about the physiological function and physiological substrates of human AOX1 and other mammalian AOX isoenzymes, although the importance of these proteins in xenobiotic metabolism is fairly well established and their relevance in drug development is increasing. This review article provides an overview and a discussion of the current knowledge on mammalian AOX. PMID:26920149

  11. Identification of candidate aldehyde oxidases from the silkworm Bombyx mori potentially involved in antennal pheromone degradation.

    PubMed

    Pelletier, Julien; Bozzolan, Françoise; Solvar, Marthe; François, Marie-Christine; Jacquin-Joly, Emmanuelle; Maïbèche-Coisne, Martine

    2007-12-01

    Signal inactivation is a crucial step in the dynamic of olfactory process and involves various Odorant-Degrading Enzymes. In the silkworm Bombyx mori, one of the best models for studying olfaction in insects, the involvement of an antennal-specific aldehyde oxidase in the degradation of the sex pheromone component bombykal has been demonstrated over the three past decades by biochemical studies. However, the corresponding enzyme has never been characterized at the molecular level. Bioinformatic screening of B. mori genome and molecular approaches have been used to isolate several candidate sequences of aldehyde oxidases. Two interesting antennal-expressed genes have been further characterized and their putative functions are discussed in regard to their respective expression pattern and to our knowledge on aldehyde oxidase properties. Interestingly, one gene appeared as specifically expressed in the antennae of B. mori and associated in males with the bombykal-sensitive sensilla, strongly suggesting that it could encode for the previously biochemically characterized enzyme. PMID:17904312

  12. The cbb3 oxidases are an ancient innovation of the domain bacteria.

    PubMed

    Ducluzeau, Anne-Lise; Ouchane, Soufian; Nitschke, Wolfgang

    2008-06-01

    A survey of genomes for the presence of gene clusters related to cbb(3) oxidases detected bona fide members of the family in almost all phyla of the domain Bacteria. No archaeal representatives were found. The subunit composition was seen to vary substantially between clades observed on the phylogenetic tree of the catalytic subunit CcoN. The protein diade formed by CcoN and the monoheme cytochrome CcoO appears to constitute the functionally essential "core" of the enzyme conserved in all sampled cbb(3) gene clusters. The topology of the phylogenetic tree contradicts the scenario of a recent origin of cbb(3) oxidases and substantiates the status of this family as a phylogenetic entity on the same level as the other subgroups of the heme-copper superfamily (including nitric oxide reductase). This finding resuscitates and exacerbates the conundrum of the evolutionary origin of heme-copper oxidases. PMID:18353797

  13. Physiological roles of NOX/NADPH oxidase, the superoxide-generating enzyme

    PubMed Central

    Katsuyama, Masato; Matsuno, Kuniharu; Yabe-Nishimura, Chihiro

    2012-01-01

    NADPH oxidase is a superoxide (O2•−)-generating enzyme first identified in phagocytes, essential for their bactericidal activities. Later, in non-phagocytes, production of O2•− was also demonstrated in an NADPH-dependent manner. In the last decade, several non-phagocyte-type NADPH oxidases have been identified. The catalytic subunit of these oxidases, NOX, constitutes the NOX family. There are five homologs in the family, NOX1 to NOX5, and two related enzymes, DUOX1 and DUOX2. Transgenic or gene-disrupted mice of the NOX family have also been established. NOX/DUOX proteins possess distinct features in the dependency on other components for their enzymatic activities, tissue distributions, and physiological functions. This review summarized the characteristics of the NOX family proteins, especially focused on their functions clarified through studies using gene-modified mice. PMID:22247596

  14. Isolation and characterization of Rhodobacter capsulatus mutants affected in cytochrome cbb3 oxidase activity.

    PubMed

    Koch, H G; Hwang, O; Daldal, F

    1998-02-01

    The facultative phototrophic bacterium Rhodobacter capsulatus contains only one form of cytochrome (cyt) c oxidase, which has recently been identified as a cbb3-type cyt c oxidase. This is unlike other related species, such as Rhodobacter sphaeroides and Paracoccus denitrificans, which contain an additional mitochondrial-like aa3-type cyt c oxidase. An extensive search for mutants affected in cyt c oxidase activity in R. capsulatus led to the isolation of at least five classes of mutants. Plasmids complementing them to a wild-type phenotype were obtained for all but one of these classes from a chromosomal DNA library. The first class of mutants contained mutations within the structural genes (ccoNOQP) of the cyt cbb3 oxidase. Sequence analysis of these mutants and of the plasmids complementing them revealed that ccoNOQP in R. capsulatus is not flanked by the oxygen response regulator fnr, which is located upstream of these genes in other species. Genetic and biochemical characterizations of mutants belonging to this group indicated that the subunits CcoN, CcoO, and CcoP are required for the presence of an active cyt cbb3 oxidase, and unlike in Bradyrhizobium japonicum, no active CcoN-CcoO subcomplex was found in R. capsulatus. In addition, mutagenesis experiments indicated that the highly conserved open reading frame 277 located adjacent to ccoNOQP is required neither for cyt cbb3 oxidase activity or assembly nor for respiratory or photosynthetic energy transduction in R. capsulatus. The remaining cyt c oxidase-minus mutants mapped outside of ccoNOQP and formed four additional groups. In one of these groups, a fully assembled but inactive cyt cbb3 oxidase was found, while another group had only extremely small amounts of it. The next group was characterized by a pleiotropic effect on all membrane-bound c-type cytochromes, and the remaining mutants not complemented by the plasmids complementing the first four groups formed at least one additional group affecting the biogenesis of the cyt cbb3 oxidase of R. capsulatus. PMID:9473054

  15. Mice Deficient in Dual Oxidase Maturation Factors Are Severely Hypothyroid

    PubMed Central

    De Deken, Xavier; Mayo, Olga Barca; Raad, Houssam; Weiss, Mia; Liao, Xiao-Hui; Refetoff, Samuel

    2012-01-01

    Dual oxidases (DUOX1 and DUOX2) are evolutionary conserved reduced nicotinamide adenine dinucleotide phosphate oxidases responsible for regulated hydrogen peroxide (H2O2) release of epithelial cells. Specific maturation factors (DUOXA1 and DUOXA2) are required for targeting of functional DUOX enzymes to the cell surface. Mutations in the single-copy Duox and Duoxa genes of invertebrates cause developmental defects with reduced survival, whereas knockdown in later life impairs intestinal epithelial immune homeostasis. In humans, mutations in both DUOX2 and DUOXA2 can cause congenital hypothyroidism with partial iodide organification defects compatible with a role of DUOX2-generated H2O2 in driving thyroid peroxidase activity. The DUOX1/DUOXA1 system may account for residual iodide organification in patients with loss of DUOX2, but its physiological function is less clear. To provide a murine model recapitulating complete DUOX deficiency, we simultaneously targeted both Duoxa genes by homologous recombination. Knockout of Duoxa genes (Duoxa−/− mice) led to a maturation defect of DUOX proteins lacking Golgi processing of N-glycans and to loss of H2O2 release from thyroid tissue. Postnatally, Duoxa−/− mice developed severe goitreous congenital hypothyroidism with undetectable serum T4 and maximally disinhibited TSH levels. Heterozygous mice had normal thyroid function parameters. 125I uptake and discharge studies and probing of iodinated TG epitopes corroborated the iodide organification defect in Duoxa−/− mice. Duoxa−/− mice on continuous T4 replacement from P6 showed normal growth without an overt phenotype. Our results confirm in vivo the requirement of DUOXA for functional expression of DUOX-based reduced nicotinamide adenine dinucleotide phosphate oxidases and the role of DUOX isoenzymes as sole source of hormonogenic H2O2. PMID:22301785

  16. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.

    1999-01-01

    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  17. Polyamine Oxidase from Water Hyacinth

    PubMed Central

    Yanagisawa, Hiroshi; Kato, Akemi; Hoshiai, Sawa; Kamiya, Akiyoshi; Torii, Naohiro

    1987-01-01

    Polyamine oxidase was purified to homogeneity from leaves of water hyacinth by the criterion of sodium dodecyl sulfate gel electrophoresis (SDS disc PAGE). The enzyme showed a high specificity for spermidine and spermine (Km values 28 micromolar and 20 micromolar, respectively). The optimal pH of the enzyme for both spermidine and spermine was 6.5. The molecular weight of the enzyme estimated by Sephadex G-200 gel filtration was 87,000, while SDS disc PAGE gave a single band at the molecular weight of 60,000. Octamethylenediamine and quinacrine were strong inhibitors of the enzyme, but p-chloromercuribenzoate was without effect. A prosthetic group in the enzyme was identified as flavin adenine dinucleotide. Images Fig. 3 PMID:16665829

  18. RRM analysis of protoporphyrinogen oxidase.

    PubMed

    Sauren, M; Pirogova, E; Cosic, I

    2004-12-01

    Enzymes are crucial in accelerating metabolic reactions in living organisms. Protoporphyrinogen oxidase (PpOI) is an enzyme that catalyses the production of protoporphyrin IX (PpIX), a protein used in a cancer treatment known as photodynamic therapy (PDT). In this study, a structure-function analysis of PpOI was carried out using the Resonant Recognition Model (RRM), a physico-mathematical approach for analysis of proteins interactions. This method is based on the finding that the distribution of delocalised electron energies along the protein plays a crucial role in determining the protein's biological activity. Two digital signal processing (DSP) methods were used: Fourier Transform (FT) and Continuous Wavelet Transform (CWT). Here we have determined the characteristic frequencies and the "hot spot" amino acids, and predicted the location of proteins' active site(s). Several proteins that potentially belong to the PpOI functional group were also analysed to distinguish their viability in this role. PMID:15712584

  19. Cold-adapted arsenite oxidase from a psychrotolerant Polaromonas species.

    PubMed

    Osborne, Thomas H; Heath, Matthew D; Martin, Andrew C R; Pankowski, Jaroslaw A; Hudson-Edwards, Karen A; Santini, Joanne M

    2013-04-01

    Polaromonas sp. str. GM1 is an aerobic, psychrotolerant, heterotrophic member of the Betaproteobacteria and is the only isolate capable of oxidising arsenite at temperatures below 10 °C. Sequencing of the aio gene cluster in GM1 revealed the presence of the aioB and aioA genes, which encode the arsenite oxidase but the regulatory genes typically found upstream of aioB in other members of the Proteobacteria were absent. The GM1 Aio was purified to homogeneity and was found to be a heterodimer. The enzyme contained Mo and Fe as cofactors and had, using the artificial electron acceptor 2,6-dichlorophenolindophenol, a Km for arsenite of 111.70 ± 0.88 μM and a Vmax of 12.16 ± 0.30 U mg(-1), which is the highest reported specific activity for any known Aio. The temperature-activity profiles of the arsenite oxidases from GM1 and the mesophilic betaproteobacterium Alcaligenes faecalis were compared and showed that the GM1 Aio was more active at low temperatures than that of A. faecalis. A homology model of the GM1 Aio was made using the X-ray crystal structure of the Aio from A. faecalis as the template. Structural changes that account for cold adaptation were identified and it was found that these resulted in increased enzyme flexibility and a reduction in the hydrophobicity of the core. PMID:23150098

  20. Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

    PubMed Central

    Liu, Lei

    2012-01-01

    Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

  1. NADPH Oxidases and Angiotensin II Receptor Signaling

    PubMed Central

    Garrido, Abel Martin; Griendling, Kathy K.

    2010-01-01

    Over the last decade many studies have demonstrated the importance of reactive oxygen species (ROS) production by NADPH oxidases in angiotensin II (Ang II) signaling, as well as a role for ROS in the development of different diseases in which Ang II is a central component. In this review, we summarize the mechanism of activation of NADPH oxidases by Ang II and describe the molecular targets of ROS in Ang II signaling in the vasculature, kidney and brain. We also discuss the effects of genetic manipulation of NADPH oxidase function on the physiology and pathophysiology of the renin angiotensin system. PMID:19059306

  2. Monoamine oxidase and agitation in psychiatric patients.

    PubMed

    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela

    2016-08-01

    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. PMID:26851573

  3. HypC is the anthrone oxidase involved in aflatoxin biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

  4. EXPRESSION OF TURKEY TRANSCRIPTION FACTORS AND ACYL COA OXIDASE IN DIFFERENT TISSUES AND GENETIC POPULATIONS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several transcription factors are involved in regulating lipid metabolism in various animal tissues. Peroxisome proliferator activated receptor (PPAR) gamma and PPAR alpha regulate both lipogenesis and fatty acid oxidation. Gene fragments for PPAR gamma, PPAR alpha, and acyl CoA oxidase (ACO) have b...

  5. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.

    1973-01-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg−1 chlorophyll × hr−1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30 minutes. No single peptide from the digested trypsin was found to be the sole activating factor. About 0.25 μg of trypsin activated 50% the polyphenol oxidase activity in a standard chloroplast assay containing 2.1 μg of chlorophyll. Treatment of spinach chloroplasts with tris buffer or ethylenediamine tetraacetate extracted the ATPase activity, but the polyphenol oxidase activity remained with the broken plastids. However these treatments increased the latent polyphenol oxidase activity 50- to 100-fold. Chloroplasts from a second group of plants, including alfalfa, wheat, oats, peas, and sugarcane leaves, oxidized dihydroxyphenylalanine at a rate of 11 to 120 μmoles × mg−1 chlorophyll × hr−1. Polyphenol oxidase in these chloroplasts required a low intensity of red light for activity. Fifty or 75% activation of the oxidase in wheat chloroplasts required 4 to 6 foot candles of light and more light was required for alfalfa chloroplasts. Blue or far red light were ineffective. Trypsin was inhibitory. Upon aging chloroplasts from wheat leaves, but not alfalfa or peas, for 5 to 7 days at 4 C the total polyphenol oxidase activity did not increase, but the activation characteristics changed to those of chloroplasts from the spinach group. Chloroplasts from a third group of plants, including bean, tomato, and corn leaves, slowly oxidized dihydroxyphenylalanine in the dark and exhibited no latency. PMID:16658308

  6. Inhibition of xanthine oxidase by flavonoids.

    PubMed

    Nagao, A; Seki, M; Kobayashi, H

    1999-10-01

    Various dietary flavonoids were evaluated in vitro for their inhibitory effect on xanthine oxidase, which has been implicated in oxidative injury to tissue by ischemia-reperfusion. Xanthine oxidase activity was determined by directly measuring uric acid formation by HPLC. The structure-activity relationship revealed that the planar flavones and flavonols with a 7-hydroxyl group such as chrysin, luteolin, kaempferol, quercetin, myricetin, and isorhamnetin inhibited xanthine oxidase activity at low concentrations (IC50 values from 0.40 to 5.02 microM) in a mixed-type mode, while the nonplanar flavonoids, isoflavones and anthocyanidins were less inhibitory. These results suggest that certain flavonoids might suppress in vivo the formation of active oxygen species and urate by xanthine oxidase. PMID:10671036

  7. A description of an HPLC assay of coproporphyrinogen III oxidase activity in mononuclear cells.

    PubMed

    Gross, U; Gerlach, R; Kühnel, A; Seifert, V; Doss, M O

    2003-01-01

    Coproporphyrinogen III oxidase is deficient in hereditary coproporphyria. An activity assay for this enzyme in mononuclear cells, besides the preparation of the substrate, are presented. The separation conditions for the product of the test protoporphyrin IX by gradient, reversed-phase high-performance liquid chromatography are given. The normal value from mononuclear cells of healthy volunteers was 138 +/- 21 pkat/g total soluble protein (mean +/- SD). The enzyme activity of a family with hereditary coproporphyria was measured. The gene carriers exhibit a specific coproporphyrinogen III oxidase activity of 61-90 pkat/g total soluble protein. PMID:14605502

  8. The polyamine oxidase inactivator MDL 72527.

    PubMed

    Seiler, Nikolaus; Duranton, Benoit; Raul, Francis

    2002-01-01

    Polyamine oxidase is a FAD-dependent amine oxidase, which is constitutively expressed in nearly all tissues of the vertebrate organism. In 1985, N1,N4-bis(2,3-butadienyl)-1,4-butanediamine (MDL 72527) was designed as a selective enzyme-activated irreversible inhibitor of polyamine oxidase (EC 1.5.3.11). It inactivates, at micromolar concentration and time-dependently, the enzyme in cells, as well as in all organs of experimental animals, without inhibiting other enzymes of polyamine metabolism. MDL 72527 served during nearly two decades as a unique tool in the elucidation of the physiological roles of polyamine oxidase. The compound has anticancer and contragestational effects, and it improves the anticancer effect of the ornithine decarboxylase inactivator (D,L)-2-(difluoromethyl)ornithine (DFMO). Profound depletion of the polyamine pools of tumour cells and effects on different components of the immune defence system are responsible for the anticancer effects of MDL 72527/DFMO combinations. Recently a direct cytotoxic effect of MDL 72527 at concentrations above those required for polyamine oxidase inactivation was observed. The induction of apoptosis by MDL 72527 was ascribed to its lysosomotropic properties. Therapeutic potentials of the apoptotic effect of MDL 72527 need to be explored. Polyamine oxidase is the last enzyme of the polyamine interconversion pathway that awaits the detailed elucidation of its structure and regulation. MDL 72527 should be useful as a lead in the development of inactivators which are selective for the isoforms of polyamine oxidase. Isozyme-selective inhibitors will give more profound insights into and reveal a diversity of specific functions of polyamine oxidase. PMID:12458962

  9. Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

    PubMed

    Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

    2016-01-10

    Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. PMID:26367330

  10. Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes.

    PubMed

    Kersten, Phil; Cullen, Dan

    2014-11-01

    Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues are conserved, but five subfamilies are recognized. Glyoxal oxidase, the most intensively studied representative, has been shown physiologically connected to lignin peroxidase. Relatively little is known about structure-function relationships among more recently discovered copper radical oxidases. Nevertheless, differences in substrate preferences have been observed in one case and the proteins have been detected in filtrates of various wood-grown cultures. Such diversity may reflect adaptations to host cell wall composition and changing environmental conditions. PMID:24915038

  11. Deletion of glucose oxidase changes the pattern of organic acid production in Aspergillus carbonarius

    PubMed Central

    2014-01-01

    Aspergillus carbonarius has potential as a cell factory for the production of different organic acids. At pH 5.5, A.carbonarius accumulates high amounts of gluconic acid when it grows on glucose based medium whereas at low pH, it produces citric acid. The conversion of glucose to gluconic acid is carried out by secretion of the enzyme, glucose oxidase. In this work, the gene encoding glucose oxidase was identified and deleted from A. carbonarius with the aim of changing the carbon flux towards other organic acids. The effect of genetic engineering was examined by testing glucose oxidase deficient (Δgox) mutants for the production of different organic acids in a defined production medium. The results obtained showed that the gluconic acid accumulation was completely inhibited and increased amounts of citric acid, oxalic acid and malic acid were observed in the Δgox mutants. PMID:25401063

  12. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.

    1996-11-01

    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  13. Azide inhibition of urate oxidase.

    PubMed

    Gabison, Laure; Colloc'h, Nathalie; Prangé, Thierry

    2014-07-01

    The inhibition of urate oxidase (UOX) by azide was investigated by X-ray diffraction techniques and compared with cyanide inhibition. Two well characterized sites for reagents are present in the enzyme: the dioxygen site and the substrate-binding site. To examine the selectivity of these sites towards azide inhibition, several crystallization conditions were developed. UOX was co-crystallized with azide (N3) in the presence or absence of either uric acid (UA, the natural substrate) or 8-azaxanthine (8AZA, a competitive inhibitor). In a second set of experiments, previously grown orthorhombic crystals of the UOX-UA or UOX-8AZA complexes were soaked in sodium azide solutions. In a third set of experiments, orthorhombic crystals of UOX with the exchangeable ligand 8-nitroxanthine (8NXN) were soaked in a solution containing uric acid and azide simultaneously (competitive soaking). In all assays, the soaking periods were either short (a few hours) or long (one or two months). These different experimental conditions showed that one or other of the sites, or the two sites together, could be inhibited. This also demonstrated that azide not only competes with dioxygen as cyanide does but also competes with the substrate for its enzymatic site. A model in agreement with experimental data would be an azide in equilibrium between two sites, kinetically in favour of the dioxygen site and thermodynamically in favour of the substrate-binding site. PMID:25005084

  14. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa

    2013-01-01

    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  15. Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

    PubMed

    Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

    2013-06-01

    Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen. PMID:23620351

  16. Plant and animal glycolate oxidases have a common eukaryotic ancestor and convergently duplicated to evolve long-chain 2-hydroxy acid oxidases.

    PubMed

    Esser, Christian; Kuhn, Anke; Groth, Georg; Lercher, Martin J; Maurino, Veronica G

    2014-05-01

    Glycolate oxidase (GOX) is a crucial enzyme of plant photorespiration. The encoding gene is thought to have originated from endosymbiotic gene transfer between the eukaryotic host and the cyanobacterial endosymbiont at the base of plantae. However, animals also possess GOX activities. Plant and animal GOX belong to the gene family of (L)-2-hydroxyacid-oxidases ((L)-2-HAOX). We find that all (L)-2-HAOX proteins in animals and archaeplastida go back to one ancestral eukaryotic sequence; the sole exceptions are green algae of the chlorophyta lineage. Chlorophyta replaced the ancestral eukaryotic (L)-2-HAOX with a bacterial ortholog, a lactate oxidase that may have been obtained through the primary endosymbiosis at the base of plantae; independent losses of this gene may explain its absence in other algal lineages (glaucophyta, rhodophyta, and charophyta). We also show that in addition to GOX, plants possess (L)-2-HAOX proteins with different specificities for medium- and long-chain hydroxyacids (lHAOX), likely involved in fatty acid and protein catabolism. Vertebrates possess lHAOX proteins acting on similar substrates as plant lHAOX; however, the existence of GOX and lHAOX subfamilies in both plants and animals is not due to shared ancestry but is the result of convergent evolution in the two most complex eukaryotic lineages. On the basis of targeting sequences and predicted substrate specificities, we conclude that the biological role of plantae (L)-2-HAOX in photorespiration evolved by co-opting an existing peroxisomal protein. PMID:24408912

  17. Targeting NADPH oxidases in vascular pharmacology

    PubMed Central

    Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

    2012-01-01

    Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the selective inhibition of dysfunctional NADPH oxidase homologs. This appears to be the most reasonable approach, potentially much more efficient than non-selective scavenging of all ROS by the administration of antioxidants. PMID:22405985

  18. NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

    PubMed Central

    Peck, Ammon B.; Khan, Saeed R.

    2013-01-01

    A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

  19. Localization of NADPH Oxidase in Sympathetic and Sensory Ganglion Neurons and Perivascular Nerve Fibers

    PubMed Central

    Cao, Xian; Demel, Stacie L.; Quinn, Mark T.; Galligan, James J.; Kreulen, David L.

    2009-01-01

    Superoxide anion (O2−•) production was previously reported to be increased in celiac ganglia (CG) during DOCA-salt hypertension, possibly via activation of the reduced nicotinamide-adenine dinucleotide phosphate (NADPH) oxidase. This suggested a role for neuronal NADPH oxidase in autonomic neurovascular control. However, the expression and localization of NADPH oxidase in the peripheral neurons is not fully known. The purpose of this study was to examine the subcellular localization of NADPH oxidase in sympathetic and sensory ganglion neurons and perivascular nerve fibers. In rat CG, p22phox and neuropeptide Y (NPY) were colocalized in all neurons. P22phox was also localized to dorsal root ganglia (DRG) neurons that contain calcitonin gene related peptide (CGRP). In mesenteric arteries, p22phox and p47phox were colocalized with NPY or CGRP in perivascular nerve terminals. A similar pattern of nerve terminal staining of p22phox and p47phox was also found in cultured CG neurons and nerve growth factor (NGF)-differentiated PC12 cells. These data demonstrate a previously uncharacterized localization of NADPH oxidase in perivascular nerve fibers. The presence of a O2−• – generating enzyme in close vicinity to the sites of neurotransmitter handling in the nerve fibers suggests the possibility of novel redox-mediated mechanisms in peripheral neurovascular control. PMID:19716351

  20. Comparative characterization of three D-aspartate oxidases and one D-amino acid oxidase from Caenorhabditis elegans.

    PubMed

    Katane, Masumi; Saitoh, Yasuaki; Seida, Yousuke; Sekine, Masae; Furuchi, Takemitsu; Homma, Hiroshi

    2010-06-01

    Previously, we cloned cDNAs for four Caenorhabditis elegans genes (F20 Hp, C47Ap, F18Ep, and Y69Ap genes) that were annotated in the database as encoding D-amino acid oxidase (DAO) or D-aspartate oxidase (DDO) proteins. These genes were expressed in Escherichia coli, and the recombinant C47Ap and F18Ep were shown to have functional DDO activities, while Y69Ap had functional DAO activity. In this study, we improved the E. coli culture conditions for the production of recombinant F20 Hp and, following purification of the protein, revealed that it has functional DDO activity. The kinetic properties of recombinant C47Ap (DDO-1), F18Ep (DDO-2), F20 Hp (DDO-3), and Y69Ap (DAO) were also determined and compared with recombinant human DDO and DAO. In contrast to the low catalytic efficiency of human DDO for D-Glu, all three C. elegans DDOs showed higher catalytic efficiencies for D-Glu than D-Asp or N-methyl-D-Asp. The catalytic efficiency of C. elegans DAO for D-Ser was substantially lower than that of human DAO, while the C. elegans DAO was more efficient at deamination of basic D-amino acids (D-Arg and D-His) than human DAO. Collectively, our results indicate that C. elegans contains at least three genes that encode functional DDOs, and one gene encoding a functional DAO, and that these enzymes have different and distinctive properties. PMID:20564561

  1. Molecular, immunological, enzymatic and biochemical studies of coproporphyrinogen oxidase deficiency in a family with hereditary coproporphyria.

    PubMed

    Gross, U; Puy, H; Kühnel, A; Meissauer, U; Deybach, J C; Jacob, K; Martasek, P; Nordmann, Y; Doss, M O

    2002-02-01

    A 27-year-old woman who had recurrent pain in renal bed since 1998 with increasing character, was stationary admitted. The patient showed dark urine, complained of hair loss and took since 1994 a hormonal oral contraceptive. No photosensitivity was observed. Determinations of urinary porphyrin metabolites in 1998 revealed a porphyria cutanea tarda like excretion pattern with elevations of uro- (1767 nmol/24 hr, normal <29 nmol/24 hr) and heptacarboxyporphyrin (568 nmol/24 hr; normal <4 nmol/24 hr). Follow-up studies in feces showed the characteristics of a hereditary coproporphyria with dominance of coproporphyrin isomer III (total= 1470 nmol/g, isomer III= 93%), (normal: <37 nmol/g, isomer III = 25-35%). The excretion of porphyrin precursors (delta-aminolevulinic acid and porphobilinogen) was increased by taking an ethinylestradiol-cyproteronacetate-preparation, but acute and/or chronic manifestations were not observed. Coproporphyrinogen oxidase activity was decreased to 35% in the patient (normal=138+/-21 pkat/g protein; x+/-s), whereas the activity of red cell uroporphyrinogen decarboxylase was normal. Her mother and both sisters could be verified as heterozygous gene carriers of hereditary coproporphyria by their urinary and fecal excretion parameters and because of reduced coproporphyrinogen oxidase activity up to 50%. The father was normal with respect to his genotype. Molecular analysis revealed a hitherto unknown mutation with the transversion of a cytosine to thymine at nucleotide position 854 in exon 4 of the coproporphyrinogen oxidase gene. The gene defect was confirmed by DGGE in the mother and her three daughters. The investigation of the immunological nature of the defective coproporphyrinogen oxidase gene from the whole family revealed decreased concentrations of coproporphyrinogen oxidase protein in the patient, her mother and her two sisters. PMID:11929047

  2. Mutation screening in patients with isolated cytochrome c oxidase deficiency.

    PubMed

    Sacconi, Sabrina; Salviati, Leonardo; Sue, Carolyn M; Shanske, Sara; Davidson, Mercy M; Bonilla, Eduardo; Naini, Ali B; De Vivo, Darryl C; DiMauro, Salvatore

    2003-02-01

    Cytochrome c oxidase (COX) deficiency has been associated with a variety of clinical conditions and can be due to mutations in nuclear or mitochondrial genes. Despite recent progress in our understanding of the molecular bases of COX deficiency, the genetic defect remains elusive in many cases. We performed mutation screening in 30 patients with biochemical evidence of isolated COX deficiency and heterogeneous clinical phenotypes. Sixteen patients had various forms of encephalomyopathy, and six of these had the neuroradiological features of Leigh syndrome. Four patients had encephalohepatopathy, six had hypertrophic cardiomyopathy, and four had other phenotypes. We studied the three mtDNA genes encoding COX subunits, the 22 mtDNA tRNA genes, and seven COX assembly genes: SCO1, SCO2, SURF1, COX10, COX11, COX15, and COX17. We report two novel pathogenic SURF1 mutations in a patient with Leigh syndrome and one novel SCO2 mutation in a patient with hypertrophic cardiomyopathy. These data show that heterogeneous clinical phenotypes are associated with COX deficiency, that mutations in mtDNA COX genes are rare, and that mutations in additional genes remain to be identified. PMID:12538779

  3. The composition of milk xanthine oxidase

    PubMed Central

    Hart, L. I.; McGartoll, Mary A.; Chapman, Helen R.; Bray, R. C.

    1970-01-01

    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed `de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in `milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed `inactivated xanthine oxidase', causes variability in activity relative to E450 or to Mo content and formation of it decreases these ratios during storage of enzyme samples including samples free from demolybdo-xanthine oxidase. We conclude that even the best purified xanthine oxidase samples described here and by other workers are contaminated by significant amounts of the inactivated form. This may complicate the interpretation of changes in the enzyme taking place during the slow phase of reduction by substrates. Attempts to remove iron from the enzyme by published methods were not successful. ImagesFig. 2. PMID:5441374

  4. Involvement of Polyamine Oxidase in Wound Healing12[W

    PubMed Central

    Angelini, Riccardo; Tisi, Alessandra; Rea, Giuseppina; Chen, Martha M.; Botta, Maurizio; Federico, Rodolfo; Cona, Alessandra

    2008-01-01

    Hydrogen peroxide (H2O2) is involved in plant defense responses that follow mechanical damage, such as those that occur during herbivore or insect attacks, as well as pathogen attack. H2O2 accumulation is induced during wound healing processes as well as by treatment with the wound signal jasmonic acid. Plant polyamine oxidases (PAOs) are H2O2 producing enzymes supposedly involved in cell wall differentiation processes and defense responses. Maize (Zea mays) PAO (ZmPAO) is a developmentally regulated flavoprotein abundant in primary and secondary cell walls of several tissues. In this study, we investigated the effect of wounding on ZmPAO gene expression in the outer tissues of the maize mesocotyl and provide evidence that ZmPAO enzyme activity, protein, and mRNA levels increased in response to wounding as well as jasmonic acid treatment. Histochemically detected ZmPAO activity especially intensified in the epidermis and in the wound periderm, suggesting a tissue-specific involvement of ZmPAO in wound healing. The role played by ZmPAO-derived H2O2 production in peroxidase-mediated wall stiffening events was further investigated by exploiting the in vivo use of N-prenylagmatine (G3), a selective and powerful ZmPAO inhibitor, representing a reliable diagnostic tool in discriminating ZmPAO-mediated H2O2 production from that generated by peroxidase, oxalate oxidase, or by NADPH oxidase activity. Here, we demonstrate that G3 inhibits wound-induced H2O2 production and strongly reduces lignin and suberin polyphenolic domain deposition along the wound, while it is ineffective in inhibiting the deposition of suberin aliphatic domain. Moreover, ZmPAO ectopic expression in the cell wall of transgenic tobacco (Nicotiana tabacum) plants strongly enhanced lignosuberization along the wound periderm, providing evidence for a causal relationship between PAO and peroxidase-mediated events during wound healing. PMID:17993545

  5. Alternative oxidase: distribution, induction, properties, structure, regulation, and functions.

    PubMed

    Rogov, A G; Sukhanova, E I; Uralskaya, L A; Aliverdieva, D A; Zvyagilskaya, R A

    2014-12-01

    The respiratory chain in the majority of organisms with aerobic type metabolism features the concomitant existence of the phosphorylating cytochrome pathway and the cyanide- and antimycin A-insensitive oxidative route comprising a so-called alternative oxidase (AOX) as a terminal oxidase. In this review, the history of AOX discovery is described. Considerable evidence is presented that AOX occurs widely in organisms at various levels of organization and is not confined to the plant kingdom. This enzyme has not been found only in Archaea, mammals, some yeasts and protists. Bioinformatics research revealed the sequences characteristic of AOX in representatives of various taxonomic groups. Based on multiple alignments of these sequences, a phylogenetic tree was constructed to infer their possible evolution. The ways of AOX activation, as well as regulatory interactions between AOX and the main respiratory chain are described. Data are summarized concerning the properties of AOX and the AOX-encoding genes whose expression is either constitutive or induced by various factors. Information is presented on the structure of AOX, its active center, and the ubiquinone-binding site. The principal functions of AOX are analyzed, including the cases of cell survival, optimization of respiratory metabolism, protection against excess of reactive oxygen species, and adaptation to variable nutrition sources and to biotic and abiotic stress factors. It is emphasized that different AOX functions complement each other in many instances and are not mutually exclusive. Examples are given to demonstrate that AOX is an important tool to overcome the adverse aftereffects of restricted activity of the main respiratory chain in cells and whole animals. This is the first comprehensive review on alternative oxidases of various organisms ranging from yeasts and protists to vascular plants. PMID:25749168

  6. The impact of single nucleotide polymorphisms on human aldehyde oxidase.

    PubMed

    Hartmann, Tobias; Terao, Mineko; Garattini, Enrico; Teutloff, Christian; Alfaro, Joshua F; Jones, Jeffrey P; Leimkühler, Silke

    2012-05-01

    Aldehyde oxidase (AO) is a complex molybdo-flavoprotein that belongs to the xanthine oxidase family. AO is active as a homodimer, and each 150-kDa monomer binds two distinct [2Fe2S] clusters, FAD, and the molybdenum cofactor. AO has an important role in the metabolism of drugs based on its broad substrate specificity oxidizing aromatic aza-heterocycles, for example, N(1)-methylnicotinamide and N-methylphthalazinium, or aldehydes, such as benzaldehyde, retinal, and vanillin. Sequencing the 35 coding exons of the human AOX1 gene in a sample of 180 Italian individuals led to the identification of relatively frequent, synonymous, missense and nonsense single-nucleotide polymorphisms (SNPs). Human aldehyde oxidase (hAOX1) was purified after heterologous expression in Escherichia coli. The recombinant protein was obtained with a purity of 95% and a yield of 50 μg/l E. coli culture. Site-directed mutagenesis of the hAOX1 cDNA allowed the purification of protein variants bearing the amino acid changes R802C, R921H, N1135S, and H1297R, which correspond to some of the identified SNPs. The hAOX1 variants were purified and compared with the wild-type protein relative to activity, oligomerization state, and metal content. Our data show that the mutation of each amino acid residue has a variable impact on the ability of hAOX1 to metabolize selected substrates. Thus, the human population is characterized by the presence of functionally inactive hAOX1 allelic variants as well as variants encoding enzymes with different catalytic activities. Our results indicate that the presence of these allelic variants should be considered for the design of future drugs. PMID:22279051

  7. Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness

    ERIC Educational Resources Information Center

    Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen

    2013-01-01

    Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G × E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G × E occurs in infants. We therefore examined whether MAOA G × E predicts infant anger proneness, a temperamental…

  8. Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness

    ERIC Educational Resources Information Center

    Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen

    2013-01-01

    Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G E occurs in infants. We therefore examined whether MAOA G E predicts infant anger proneness, a temperamental

  9. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    SciTech Connect

    Xu, Yun-Ling; Li, Li; Wu, Keqiang

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.

  10. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

    PubMed

    Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

    1995-07-01

    The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway. PMID:7604047

  11. Identification, Purification, and Characterization of Iminodiacetate Oxidase from the EDTA-Degrading Bacterium BNC1

    PubMed Central

    Liu, Yong; Louie, Tai Man; Payne, Jason; Bohuslavek, Jan; Bolton, Harvey; Xun, Luying

    2001-01-01

    Microbial degradation of synthetic chelating agents, such as EDTA and nitrilotriacetate (NTA), may help immobilizing radionuclides and heavy metals in the environment. The EDTA- and NTA-degrading bacterium BNC1 uses EDTA monooxygenase to oxidize NTA to iminodiacetate (IDA) and EDTA to ethylenediaminediacetate (EDDA). IDA- and EDDA-degrading enzymes have not been purified and characterized to date. In this report, an IDA oxidase was purified to apparent homogeneity from strain BNC1 by using a combination of eight purification steps. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single protein band of 40 kDa, and by using size exclusion chromatography, we estimated the native enzyme to be a homodimer. Flavin adenine dinucleotide was determined as its prosthetic group. The purified enzyme oxidized IDA to glycine and glyoxylate with the consumption of O2. The temperature and pH optima for IDA oxidation were 35°C and 8, respectively. The apparent Km for IDA was 4.0 mM with a kcat of 5.3 s−1. When the N-terminal amino acid sequence was determined, it matched exactly with that encoded by a previously sequenced hypothetical oxidase gene of BNC1. The gene was expressed in Escherichia coli, and the gene product as a C-terminal fusion with a His tag was purified by a one-step nickel affinity chromatography. The purified fusion protein had essentially the same enzymatic activity and properties as the native IDA oxidase. IDA oxidase also oxidized EDDA to ethylenediamine and glyoxylate. Thus, IDA oxidase is likely the second enzyme in both NTA and EDTA degradation pathways in strain BNC1. PMID:11157233

  12. A codon deletion confers resistance to herbicides inhibiting protoporphyrinogen oxidase

    PubMed Central

    Patzoldt, William L.; Hager, Aaron G.; McCormick, Joel S.; Tranel, Patrick J.

    2006-01-01

    Herbicides that act by inhibiting protoporphyrinogen oxidase (PPO) are widely used to control weeds in a variety of crops. The first weed to evolve resistance to PPO-inhibiting herbicides was Amaranthus tuberculatus, a problematic weed in the midwestern United States that previously had evolved multiple resistances to herbicides inhibiting two other target sites. Evaluation of a PPO-inhibitor-resistant A. tuberculatus biotype revealed that resistance was a (incompletely) dominant trait conferred by a single, nuclear gene. Three genes predicted to encode PPO were identified in A. tuberculatus. One gene from the resistant biotype, designated PPX2L, contained a codon deletion that was shown to confer resistance by complementation of a hemG mutant strain of Escherichia coli grown in the presence and absence of the PPO inhibitor lactofen. PPX2L is predicted to encode both plastid- and mitochondria-targeted PPO isoforms, allowing a mutation in a single gene to confer resistance to two herbicide target sites. Unique aspects of the resistance mechanism include an amino acid deletion, rather than a substitution, and the dual-targeting nature of the gene, which may explain why resistance to PPO inhibitors has been rare. PMID:16894159

  13. Regulation of proline oxidase activity by lactate.

    PubMed

    Kowaloff, E M; Phang, J M; Granger, A S; Downing, S J

    1977-12-01

    We found that proline oxidase, the first enzyme of the proline degradative pathway, is inhibited by lactate. The Km of the enzyme for proline increases with increasing concentrations of lactate. Since proline can be a source for gluconeogenesis, regulation of proline degradation by lactate may serve as a mechanism for allocation of metabolic fuel sources. The marked inhibition of proline oxidase at levels of lactate that commonly occur in both genetic and acquired lactic acidosis may cause the previously unexplained hyperprolinemia seen in these metabolic disorders. PMID:271958

  14. A human SCO2 mutation helps define the role of Sco1p in the cytochrome oxidase assembly pathway.

    TOXLINE Toxicology Bibliographic Information

    Dickinson EK; Adams DL; Schon EA; Glerum DM

    2000-09-01

    Deficiencies in cytochrome oxidase, the terminal enzyme of the mitochondrial respiratory chain, are most often caused by an inability to complete assembly of the enzyme. Pathogenic mutations in SCO2, which encodes a cytochrome oxidase assembly factor, were recently described in several cases of fatal infantile cardioencephalomyopathy. To determine the molecular etiology of these disorders, we describe the generation and characterization of the parallel mutations in the homologous yeast SCO1 gene. We show that the E155K yeast sco1 mutant is respiration-competent, whereas the S240F mutant is not. Interestingly, the S240F mutation allows partial but incorrect assembly of cytochrome oxidase, as judged by an altered cytochrome aa(3) peak. Immunoblot analysis reveals a specific absence of subunit 2 from the cytochrome oxidase in this mutant. Taken together, our data suggest that Sco1p provides copper to the Cu(A) site on subunit 2 at a step occurring late in the assembly pathway. This is the first instance of a yeast cytochrome oxidase assembly mutant that is partially assembled. The S240F mutant also represents a powerful new tool with which to elucidate further steps in the cytochrome oxidase assembly pathway.

  15. Relationship of cytochrome caa sub 3 from Thermus thermophilus to other heme- and copper-containing terminal oxidases

    SciTech Connect

    Mather, M.W.; Springer, P.; Fee, J.A.

    1990-01-01

    Cytochrome oxidases are a key component of the energy metabolism of most aerobic organisms from mammals to bacteria. They are the final enzyme of the membrane associated respiratory chain responsible for converting the chemical energy of reduced substrates to a transmembrane electrochemical potential, which issused by the cell for a wide variety of energy-requiring processes. The most widely studied oxidase is the cytochrome c oxidase of the mammalian mitochondrion. This complex, integral membrane protein contains 13 subunits and four canonical metal centers: heme center a and a{sub 3}; copper centers CU{sub A} and CU{sub B}. It is responsible for electron transfer from reduced chytochrome c to dioxygen with the concomitant reduction of dioxygen to water and the coupled vectorial transfer of protons across the mitochondrial membrane. In this communication we will describe preliminary results of DNA sequencing experiments with the cytochrome caa{sub 3} oxidase, initially undertaken to determine the nature of the subunits of this oxidase and shed light on the distribution of the metal centers. We will speculate on oxidase gene and protein structures and evolutionary relationships in the light of these results and recent sequencing results from other groups. 47 refs., 4 figs., 1 tab.

  16. A diminution in ascorbate oxidase activity affects carbon allocation and improves yield in tomato under water deficit.

    PubMed

    Garchery, Cécile; Gest, Noé; Do, Phuc T; Alhagdow, Moftah; Baldet, Pierre; Menard, Guillaume; Rothan, Christophe; Massot, Capucine; Gautier, Hélène; Aarrouf, Jawad; Fernie, Alisdair R; Stevens, Rebecca

    2013-01-01

    The regulation of carbon allocation between photosynthetic source leaves and sink tissues in response to stress is an important factor controlling plant yield. Ascorbate oxidase is an apoplastic enzyme, which controls the redox state of the apoplastic ascorbate pool. RNA interference was used to decrease ascorbate oxidase activity in tomato (Solanum lycopersicum L.). Fruit yield was increased in these lines under three conditions where assimilate became limiting for wild-type plants: when fruit trusses were left unpruned, when leaves were removed or when water supply was limited. Several alterations in the transgenic lines could contribute to the improved yield and favour transport of assimilate from leaves to fruits in the ascorbate oxidase lines. Ascorbate oxidase plants showed increases in stomatal conductance and leaf and fruit sugar content, as well as an altered apoplastic hexose:sucrose ratio. Modifications in gene expression, enzyme activity and the fruit metabolome were coherent with the notion of the ascorbate oxidase RNAi lines showing altered sink strength. Ascorbate oxidase may therefore be a target for strategies aimed at improving water productivity in crop species. PMID:22725103

  17. Thermostable Xanthine Oxidase Activity from Bacillus pumilus RL-2d Isolated from Manikaran Thermal Spring: Production and Characterization.

    PubMed

    Sharma, Nirmal Kant; Thakur, Shikha; Thakur, Neerja; Savitri; Bhalla, Tek Chand

    2016-03-01

    Xanthine oxidase is an important enzyme of purine metabolism that catalyzes the hydroxylation of hypoxanthine to xanthine and then xanthine to uric acid. A thermostable xanthine oxidase is being reported from a thermophilic organism RL-2d isolated from the Manikaran (Kullu) hot spring of Himachal Pradesh (India). Based on the morphology, physiological tests, and 16S rDNA gene sequence, RL-2d was identified as Bacillus pumilus. Optimization of physiochemical parameters resulted into 4.1-fold increase in the xanthine oxidase activity from 0.051 U/mg dcw (dry cell weight) to 0.209 U/mg dcw. The xanthine oxidase of B. pumilus RL-2d has exhibited very good thermostability and its t1/2 at 70 and 80 °C were 5 and 1 h, respectively. Activity of this enzyme was strongly inhibited by Hg(2+), Ag(+) and allopurinol. The investigation showed that B. pumilus RL-2d exhibited highest xanthine oxidase activity and remarkable thermostability among the other xanthine oxidases reported so far. PMID:26843701

  18. Disparate Pathways for the Biogenesis of Cytochrome Oxidases in Bradyrhizobium japonicum*

    PubMed Central

    Bühler, Doris; Rossmann, Reinhild; Landolt, Sarah; Balsiger, Sylvia; Fischer, Hans-Martin; Hennecke, Hauke

    2010-01-01

    This work addresses the biogenesis of heme-copper terminal oxidases in Bradyrhizobium japonicum, the nitrogen-fixing root nodule symbiont of soybean. B. japonicum has four quinol oxidases and four cytochrome oxidases. The latter include the aa3- and cbb3-type oxidases. Although both have a CuB center in subunit I, the subunit II proteins differ in having either a CuA center (in aa3) or a covalently bound heme c (in cbb3). Two biogenesis factors were genetically studied here, the periplasmically exposed CoxG and ScoI proteins, which are the respective homologs of the mitochondrial copper-trafficking chaperones Cox11 and Sco1 for the formation of the CuB center in subunit I and the CuA center in subunit II of cytochrome aa3. We could demonstrate copper binding to ScoI in vitro, a process for which the thiols of cysteine residues 74 and 78 in the ScoI polypeptide were shown to be essential. Knock-out mutations in the B. japonicum coxG and scoI genes led to loss of cytochrome aa3 assembly and activity in the cytoplasmic membrane, whereas the cbb3-type cytochrome oxidase apparently remained unaffected. This suggests that subunit I of the cbb3-type oxidase obtains its copper cofactor via a different pathway than cytochrome aa3. In contrast to the coxG mutation, the scoI mutation caused a decreased symbiotic nitrogen fixation activity. We hypothesize that a periplasmic B. japonicum protein other than any of the identified CuA proteins depends on ScoI and is required for an effective symbiosis. PMID:20335176

  19. Complete genome sequence of the melanogenic marine bacterium Marinomonas mediterranea type strain (MMB-1T)

    SciTech Connect

    Lucas-Elio, Patricia; Goodwin, Lynne A.; Woyke, Tanja; Pitluck, Sam; Nolan, Matt; Kyrpides, Nikos C; Detter, J C; Copeland, A; Teshima, Hazuki; Bruce, David; Detter, J. Chris; Tapia, Roxanne; Han, Cliff; Land, Miriam L; Ivanova, N; Mikhailova, Natalia; Johnston, Andrew W. B.; Sanchez-Amat, Antonio

    2012-01-01

    Marinomonas mediterranea MMB-1 T Solano & Sanchez-Amat 1999 belongs to the family Oceanospirillaceae within the phylum Proteobacteria. This species is of interest because it is the only species described in the genus Marinomonas to date that can synthesize melanin pigments, which is mediated by the activity of a tyrosinase. M. mediterranea expresses other oxidases of biotechnological interest, such as a multicopper oxidase with laccase activity and a novel L-lysine-epsilon-oxidase. The 4,684,316 bp long genome harbors 4,228 proteincoding genes and 98 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  20. Cofactor engineering: a novel approach to metabolic engineering in Lactococcus lactis by controlled expression of NADH oxidase.

    PubMed

    Lopez de Felipe, F; Kleerebezem, M; de Vos, W M; Hugenholtz, J

    1998-08-01

    NADH oxidase-overproducing Lactococcus lactis strains were constructed by cloning the Streptococcus mutans nox-2 gene, which encodes the H2O-forming NADH oxidase, on the plasmid vector pNZ8020 under the control of the L. lactis nisA promoter. This engineered system allowed a nisin-controlled 150-fold overproduction of NADH oxidase at pH 7.0, resulting in decreased NADH/NAD ratios under aerobic conditions. Deliberate variations on NADH oxidase activity provoked a shift from homolactic to mixed-acid fermentation during aerobic glucose catabolism. The magnitude of this shift was directly dependent on the level of NADH oxidase overproduced. At an initial growth pH of 6.0, smaller amounts of nisin were required to optimize NADH oxidase overproduction, but maximum NADH oxidase activity was twofold lower than that found at pH 7.0. Nonetheless at the highest induction levels, levels of pyruvate flux redistribution were almost identical at both initial pH values. Pyruvate was mostly converted to acetoin or diacetyl via alpha-acetolactate synthase instead of lactate and was not converted to acetate due to flux limitation through pyruvate dehydrogenase. The activity of the overproduced NADH oxidase could be increased with exogenously added flavin adenine dinucleotide. Under these conditions, lactate production was completely absent. Lactate dehydrogenase remained active under all conditions, indicating that the observed metabolic effects were only due to removal of the reduced cofactor. These results indicate that the observed shift from homolactic to mixed-acid fermentation under aerobic conditions is mainly modulated by the level of NADH oxidation resulting in low NADH/NAD+ ratios in the cells. PMID:9683475

  1. A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury

    PubMed Central

    Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

    2013-01-01

    Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID:23840306

  2. Molecular Insights of p47phox Phosphorylation Dynamics in the Regulation of NADPH Oxidase Activation and Superoxide Production*

    PubMed Central

    Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei

    2014-01-01

    Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888

  3. The Elusive Third Subunit IIa of the Bacterial B-Type Oxidases: The Enzyme from the Hyperthermophile Aquifex aeolicus

    PubMed Central

    Prunetti, Laurence; Brugna, Myriam; Lebrun, Régine; Giudici-Orticoni, Marie-Thérèse; Guiral, Marianne

    2011-01-01

    The reduction of molecular oxygen to water is catalyzed by complicated membrane-bound metallo-enzymes containing variable numbers of subunits, called cytochrome c oxidases or quinol oxidases. We previously described the cytochrome c oxidase II from the hyperthermophilic bacterium Aquifex aeolicus as a ba3-type two-subunit (subunits I and II) enzyme and showed that it is included in a supercomplex involved in the sulfide-oxygen respiration pathway. It belongs to the B-family of the heme-copper oxidases, enzymes that are far less studied than the ones from family A. Here, we describe the presence in this enzyme of an additional transmembrane helix “subunit IIa”, which is composed of 41 amino acid residues with a measured molecular mass of 5105 Da. Moreover, we show that subunit II, as expected, is in fact longer than the originally annotated protein (from the genome) and contains a transmembrane domain. Using Aquifex aeolicus genomic sequence analyses, N-terminal sequencing, peptide mass fingerprinting and mass spectrometry analysis on entire subunits, we conclude that the B-type enzyme from this bacterium is a three-subunit complex. It is composed of subunit I (encoded by coxA2) of 59000 Da, subunit II (encoded by coxB2) of 16700 Da and subunit IIa which contain 12, 1 and 1 transmembrane helices respectively. A structural model indicates that the structural organization of the complex strongly resembles that of the ba3 cytochrome c oxidase from the bacterium Thermus thermophilus, the IIa helical subunit being structurally the lacking N-terminal transmembrane helix of subunit II present in the A-type oxidases. Analysis of the genomic context of genes encoding oxidases indicates that this third subunit is present in many of the bacterial oxidases from B-family, enzymes that have been described as two-subunit complexes. PMID:21738733

  4. Spatiotemporal localization of D-amino acid oxidase and D-aspartate oxidases during development in Caenorhabditis elegans.

    PubMed

    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito; Homma, Hiroshi

    2012-05-01

    Recent investigations have shown that a variety of D-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. D-Amino acid oxidase (DAO) and D-aspartate oxidase (DDO) are degradative enzymes stereospecific for D-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of D-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several D- and L-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and D-amino acids in multicellular organisms. PMID:22393259

  5. Spatiotemporal Localization of d-Amino Acid Oxidase and d-Aspartate Oxidases during Development in Caenorhabditis elegans

    PubMed Central

    Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito

    2012-01-01

    Recent investigations have shown that a variety of d-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. d-Amino acid oxidase (DAO) and d-aspartate oxidase (DDO) are degradative enzymes stereospecific for d-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of d-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several d- and l-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and d-amino acids in multicellular organisms. PMID:22393259

  6. A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio.

    PubMed

    Hernández-Romero, Diana; Sanchez-Amat, Antonio; Solano, Francisco

    2006-01-01

    The sequencing of the genome of Ralstonia solanacearum[Salanoubat M, Genin S, Artiguenave F, et al. (2002) Nature 415, 497-502] revealed several genes that putatively code for polyphenol oxidases (PPOs). This soil-borne pathogenic bacterium withers a wide range of plants. We detected the expression of two PPO genes (accession numbers NP_518458 and NP_519622) with high similarity to tyrosinases, both containing the six conserved histidines required to bind the pair of type-3 copper ions at the active site. Generation of null mutants in those genes by homologous recombination mutagenesis and protein purification allowed us to correlate each gene with its enzymatic activity. In contrast with all tyrosinases so far studied, the enzyme NP_518458 shows higher monophenolase than o-diphenolase activity and its initial activity does not depend on the presence of l-dopa cofactor. On the other hand, protein NP_519622 is an enzyme with a clear preference to oxidize o-diphenols and only residual monophenolase activity, behaving as a catechol oxidase. These catalytic characteristics are discussed in relation to two other characteristics apart from the six conserved histidines. One is the putative presence of a seventh histidine which interacts with the carboxy group on the substrate and controls the preference for carboxylated and decarboxylated substrates. The second is the size of the residue isosteric with the aromatic F261 reported in sweet potato catechol oxidase which acts as a gate to control accessibility to CuA at the active site. PMID:16403014

  7. Polyphenol oxidase activity in annual forage clovers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO)-mediated phenol reactions in red clover (Trifolium pratense L.) bind forage protein and reduce proteolysis, producing beneficial effects on forage protein degradability, silage fermentation, and soil-N cycling. We evaluated PPO activity in seven previously untested annual c...

  8. Oxidative stress, NADPH oxidases, and arteries.

    PubMed

    Sun, Qi-An; Runge, Marschall S; Madamanchi, Nageswara R

    2016-05-10

    Atherosclerosis and its major complications - myocardial infarction and stroke - remain major causes of death and disability in the United States and world-wide. Indeed, with dramatic increases in obesity and diabetes mellitus, the prevalence and public health impact of cardiovascular diseases (CVD) will likely remain high. Major advances have been made in development of new therapies to reduce the incidence of atherosclerosis and CVD, in particular for treatment of hypercholesterolemia and hypertension. Oxidative stress is the common mechanistic link for many CVD risk factors. However, only recently have the tools existed to study the interface between oxidative stress and CVD in animal models. The most important source of reactive oxygen species (and hence oxidative stress) in vascular cells are the multiple forms of enzymes nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Recently published and emerging studies now clearly establish that: 1) NADPH oxidases are of critical importance in atherosclerosis and hypertension in animal models; 2) given the tissue-specific expression of key components of NADPH oxidase, it may be possible to target vascular oxidative stress for prevention of CVD. PMID:25649240

  9. The substrate tolerance of alcohol oxidases.

    PubMed

    Pickl, Mathias; Fuchs, Michael; Glueck, Silvia M; Faber, Kurt

    2015-08-01

    Alcohols are a rich source of compounds from renewable sources, but they have to be activated in order to allow the modification of their carbon backbone. The latter can be achieved via oxidation to the corresponding aldehydes or ketones. As an alternative to (thermodynamically disfavoured) nicotinamide-dependent alcohol dehydrogenases, alcohol oxidases make use of molecular oxygen but their application is under-represented in synthetic biotransformations. In this review, the mechanism of copper-containing and flavoprotein alcohol oxidases is discussed in view of their ability to accept electronically activated or non-activated alcohols and their propensity towards over-oxidation of aldehydes yielding carboxylic acids. In order to facilitate the selection of the optimal enzyme for a given biocatalytic application, the substrate tolerance of alcohol oxidases is compiled and discussed: Substrates are classified into groups (non-activated prim- and sec-alcohols; activated allylic, cinnamic and benzylic alcohols; hydroxy acids; sugar alcohols; nucleotide alcohols; sterols) together with suitable alcohol oxidases, their microbial source, relative activities and (stereo)selectivities. PMID:26153139

  10. Inhibitory effects of phenolics on xanthine oxidase.

    PubMed

    Chang, W S; Chang, Y H; Lu, F J; Chiang, H C

    1994-01-01

    The stems of Bougainvillea spectabillis Wild (Nyctaginaceae) have been used in folk medicine against hepatitis. Spinasterol, 22, 23-dihydrospinasterol and caffeic acid were isolated from the plant stems and characterized. Caffeic acid has not been previously isolated from this plant but spinasterol has been isolated from the leaves. Caffeic acid was found to be the active principle exhibiting strong inhibition of xanthine oxidase in this study (IC50 = 39.21 microM). In order to study the structure-activity relationship of the phenolics as regards xanthine oxidase inhibition, twelve naturally occurring phenolics (esculetin, scopoletin, scoparone, barbaloin, berberine chloride, sinomenine, osthole, paeonol, honokiol, magnolol, methyleugenol and 6-gingerol) were tested for their inhibitory effects on xanthine oxidase. The results showed that esculetin displayed the strongest activity (IC50 = 28.4 microM), and induced competitive inhibition of the enzyme with respect to the substrate xanthine. The apparent inhibition constant (Ki) of esculetin was 2.369 x 10(-6) M. Since xanthine oxidase serum levels are increased in hepatic and brain tumors, caffeic acid and esculetin should be tested as anti-hepatitis or/and anticancer agents. PMID:8017853

  11. Characterization of Recombinant Lysyl Oxidase Propeptide

    PubMed Central

    Vora, Siddharth R.; Guo, Ying; Stephens, Danielle N.; Salih, Erdjan; Vu, Emile D.; Kirsch, Kathrin H.; Sonenshein, Gail E.; Trackman, Philip C.

    2010-01-01

    Lysyl oxidase enzyme activity is critical for the biosynthesis of mature and functional collagens and elastin. In addition, lysyl oxidase has tumor suppressor activity that has been shown to depend on the propeptide region (LOX-PP) derived from pro-lysyl oxidase (Pro-LOX), and not on lysyl oxidase enzyme activity. Pro-LOX is secreted as a 50 kDa proenzyme, and then undergoes biosynthetic proteolytic processing to active ~30 kDa LOX enzyme and LOX-PP. The present study reports the efficient recombinant expression and purification of rat LOX-PP. Moreover, using enzymatic deglycosylation and DTT derivatization combined with mass spectrometry technologies, it is shown for the first time that rLOX-PP and naturally occurring LOX-PP contain both N- and O-linked carbohydrates. Structure predictions furthermore suggest that LOX-PP is a mostly disordered protein, which was experimentally confirmed in circular dichroism studies. Due to its high isoelectric point and its disordered structure, we propose that LOX-PP can associate with extracellular and intracellular binding partners to affect its known biological activities as a tumor suppressor and inhibitor of cell proliferation. PMID:20192271

  12. Regulation of NADPH Oxidase Activity in Phagocytes

    PubMed Central

    Debeurme, Franck; Picciocchi, Antoine; Dagher, Marie-Claire; Grunwald, Didier; Beaumel, Sylvain; Fieschi, Franck; Stasia, Marie-Jos

    2010-01-01

    The X+-linked chronic granulomatous disease (X+-CGD) variants are natural mutants characterized by defective NADPH oxidase activity but with normal Nox2 expression. According to the three-dimensional model of the cytosolic Nox2 domain, most of the X+-CGD mutations are located in/or close to the FAD/NADPH binding regions. A structure/function study of this domain was conducted in X+-CGD PLB-985 cells exactly mimicking 10 human variants: T341K, C369R, G408E, G408R, P415H, P415L, ?507QKT509-HIWAinsert, C537R, L546P, and E568K. Diaphorase activity is defective in all these mutants. NADPH oxidase assembly is normal for P415H/P415L and T341K mutants where mutation occurs in the consensus sequences of NADPH- and FAD-binding sites, respectively. This is in accordance with their buried position in the three-dimensional model of the cytosolic Nox2 domain. FAD incorporation is abolished only in the T341K mutant explaining its absence of diaphorase activity. This demonstrates that NADPH oxidase assembly can occur without FAD incorporation. In addition, a defect of NADPH binding is a plausible explanation for the diaphorase activity inhibition in the P415H, P415L, and C537R mutants. In contrast, Cys-369, Gly-408, Leu-546, and Glu-568 are essential for NADPH oxidase complex assembly. However, according to their position in the three-dimensional model of the cytosolic domain of Nox2, only Cys-369 could be in direct contact with cytosolic factors during oxidase assembly. In addition, the defect in oxidase assembly observed in the C369R, G408E, G408R, and E568K mutants correlates with the lack of FAD incorporation. Thus, the NADPH oxidase assembly process and FAD incorporation are closely related events essential for the diaphorase activity of Nox2. PMID:20724480

  13. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.

    PubMed

    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  14. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  15. NADPH oxidases in lung biology and pathology: host defense enzymes, and more.

    PubMed

    van der Vliet, Albert

    2008-03-15

    The deliberate production of reactive oxygen species (ROS) by phagocyte NADPH oxidase is widely appreciated as a critical component of antimicrobial host defense. Recently, additional homologs of NADPH oxidase (NOX) have been discovered throughout the animal and plant kingdoms, which appear to possess diverse functions in addition to host defense, in cell proliferation, differentiation, and in regulation of gene expression. Several of these NOX homologs are also expressed within the respiratory tract, where they participate in innate host defense as well as in epithelial and inflammatory cell signaling and gene expression, and fibroblast and smooth muscle cell proliferation, in response to bacterial or viral infection and environmental stress. Inappropriate expression or activation of NOX/DUOX during various lung pathologies suggests their specific involvement in respiratory disease. This review summarizes the current state of knowledge regarding the general functional properties of mammalian NOX enzymes, and their specific importance in respiratory tract physiology and pathology. PMID:18164271

  16. NADPH OXIDASES IN LUNG BIOLOGY AND PATHOLOGY. HOST DEFENSE ENZYMES, AND MORE

    PubMed Central

    van der Vliet, Albert

    2008-01-01

    The deliberate production of reactive oxygen species (ROS) by phagocyte NADPH oxidase is widely appreciated as a critical component of antimicrobial host defense. Recently, additional homologs of NADPH oxidase (NOX) have been discovered throughout the animal and plant kingdoms, which appear to possess diverse functions in addition to host defense, including cell proliferation, differentiation, and regulation of gene expression. Several of these NOX homologs are also expressed within the respiratory tract, where they participate in innate host defense as well as in epithelial and inflammatory cell signaling and gene expression, and fibroblast and smooth muscle cell proliferation, in response to bacterial or viral infection and environmental stress. Inappropriate expression or activation of NOX/DUOX during various lung pathologies suggests their specific involvement in respiratory disease. This review summarizes the current state of knowledge regarding the general functional properties of mammalian NOX enzymes, and their specific importance in respiratory tract physiology and pathology. PMID:18164271

  17. Copper Starvation-inducible Protein for Cytochrome Oxidase Biogenesis in Bradyrhizobium japonicum*

    PubMed Central

    Serventi, Fabio; Youard, Zeb Andrew; Murset, Valérie; Huwiler, Simona; Bühler, Doris; Richter, Miriam; Luchsinger, Ronny; Fischer, Hans-Martin; Brogioli, Robert; Niederer, Martina; Hennecke, Hauke

    2012-01-01

    Microarray analysis of Bradyrhizobium japonicum grown under copper limitation uncovered five genes named pcuABCDE, which are co-transcribed and co-regulated as an operon. The predicted gene products are periplasmic proteins (PcuA, PcuC, and PcuD), a TonB-dependent outer membrane receptor (PcuB), and a cytoplasmic membrane-integral protein (PcuE). Homologs of PcuC and PcuE had been discovered in other bacteria, namely PCuAC and YcnJ, where they play a role in cytochrome oxidase biogenesis and copper transport, respectively. Deletion of the pcuABCDE operon led to a pleiotropic phenotype, including defects in the aa3-type cytochrome oxidase, symbiotic nitrogen fixation, and anoxic nitrate respiration. Complementation analyses revealed that, under our assay conditions, the tested functions depended only on the pcuC gene and not on pcuA, pcuB, pcuD, or pcuE. The B. japonicum genome harbors a second pcuC-like gene (blr7088), which, however, did not functionally replace the mutated pcuC. The PcuC protein was overexpressed in Escherichia coli, purified to homogeneity, and shown to bind Cu(I) with high affinity in a 1:1 stoichiometry. The replacement of His79, Met90, His113, and Met115 by alanine perturbed copper binding. This corroborates the previously purported role of this protein as a periplasmic copper chaperone for the formation of the CuA center on the aa3-type cytochrome oxidase. In addition, we provide evidence that PcuC and the copper chaperone ScoI are important for the symbiotically essential, CuA-free cbb3-type cytochrome oxidase specifically in endosymbiotic bacteroids of soybean root nodules, which could explain the symbiosis-defective phenotype of the pcuC and scoI mutants. PMID:23012364

  18. NADPH oxidases, reactive oxygen species, and the kidney: friend and foe.

    PubMed

    Sedeek, Mona; Nasrallah, Rania; Touyz, Rhian M; Hébert, Richard L

    2013-10-01

    Reactive oxygen species (ROS) play an important role in normal cellular physiology. They regulate different biologic processes such as cell defense, hormone synthesis and signaling, activation of G protein-coupled receptors, and ion channels and kinases/phosphatases. ROS are also important regulators of transcription factors and gene expression. On the other hand, in pathologic conditions, a surplus of ROS in tissue results in oxidative stress with various injurious consequences such as inflammation and fibrosis. NADPH oxidases are one of the many sources of ROS in biologic systems, and there are seven isoforms (Nox1-5, Duox1, Duox2). Nox4 is the predominant form in the kidney, although Nox2 is also expressed. Nox4 has been implicated in the basal production of ROS in the kidney and in pathologic conditions such as diabetic nephropathy and CKD; upregulation of Nox4 may be important in renal oxidative stress and kidney injury. Although there is growing evidence indicating the involvement of NADPH oxidase in renal pathology, there is a paucity of information on the role of NADPH oxidase in the regulation of normal renal function. Here we provide an update on the role of NADPH oxidases and ROS in renal physiology and pathology. PMID:23970124

  19. Roles for enteric d-type cytochrome oxidase in N2 fixation and microaerobiosis.

    PubMed Central

    Hill, S; Viollet, S; Smith, A T; Anthony, C

    1990-01-01

    Escherichia coli strains that lacked the d-type cytochrome oxidase, the terminal oxidase with a high affinity for O2, grew anaerobically as well as the wild type did and were not impaired in the ability to evolve H2 from either glucose or formate. The anaerobic synthesis and activity of nitrogenase in transconjugants of these strains carrying Klebsiella pneumoniae nif genes were also normal. However, the behavior towards O2 of anaerobically grown bacteria lacking the d-type oxidase differed from that of the wild type in the following ways: the potential O2 uptake was lower, H2 evolution and nitrogenase activity supported by fermentation were more strongly inhibited by O2, and microaerobic O2-dependent nitrogenase activity in the absence of a fermentable carbon source did not occur. These results show that the d-type oxidase serves two functions in enteric bacteria--to conserve energy under microaerobic conditions and to protect anaerobic processes from inhibition by O2. PMID:2156809

  20. Role of the NADPH Oxidases DUOX and NOX4 in Thyroid Oxidative Stress.

    PubMed

    Carvalho, Denise P; Dupuy, Corinne

    2013-09-01

    Somatic mutations are present at high levels in the rat thyroid gland, indicating that the thyrocyte is under oxidative stress, a state in which cellular oxidant levels are high. The most important class of free radicals, or reactive metabolites, is reactive oxygen species (ROS), such as superoxide anion (O2 (-)), hydroxyl radical (OH) and hydrogen peroxide (H2O2). The main source of ROS in every cell type seems to be mitochondrial respiration; however, recent data support the idea that NADPH:O(2) oxidoreductase flavoproteins or simply NADPH oxidases (NOX) are enzymes specialized in controlled ROS generation at the subcellular level. Several decades ago, high concentrations of H2O2 were detected at the apical surface of thyrocytes, where thyroid hormone biosynthesis takes place. Only in the last decade has the enzymatic source of H2O2 involved in thyroid hormone biosynthesis been well characterized. The cloning of two thyroid genes encoding NADPH oxidases dual oxidases 1 and 2 (DUOX1 and DUOX2) revealed that DUOX2 mutations lead to hereditary hypothyroidism in humans. Recent reports have also described the presence of NOX4 in the thyroid gland and have suggested a pathophysiological role of this member of the NOX family. In the present review, we describe the participation of NADPH oxidases not only in thyroid physiology but also in gland pathophysiology, particularly the involvement of these enzymes in the regulation of thyroid oxidative stress. PMID:24847449

  1. MECHANISM OF POLYPHENOL OXIDASE ACTION IN REDUCING LIPOLYSIS AND PROTEOLYSIS IN RED CLOVER DURING BATCH CULTURE INCUBATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

  2. BEHAVIORAL OUTCOMES OF MONOAMINE OXIDASE DEFICIENCY: PRECLINICAL AND CLINICAL EVIDENCE

    PubMed Central

    Bortolato, Marco; Shih, Jean C.

    2012-01-01

    Monoamine oxidase (MAO) isoenzymes A and B are mitochondrial-bound proteins, catalyzing the oxidative deamination of monoamine neurotransmitters as well as xenobiotic amines. Although they derive from a common ancestral progenitor gene, are located at X-chromosome and display 70% structural identity, their substrate preference, regional distribution, and physiological role are divergent. In fact, while MAO-A has high affinity for serotonin and norepinephrine, MAO-B primarily serves the catabolism of 2-phenylethylamine (PEA) and contributes to the degradation of other trace amines and dopamine. Convergent lines of preclinical and clinical evidence indicate that variations in MAO enzymatic activity—due to either genetic or environmental factors—can exert a profound influence on behavioral regulation and play a role in the pathophysiology of a large spectrum of mental and neurodegenerative disorders, ranging from antisocial personality disorder to Parkinson’s disease. Over the past few years, numerous advances have been made in our understanding of the phenotypical variations associated with genetic polymorphisms and mutations of the genes encoding for both isoenzymes. In particular, novel findings on the phenotypes of MAO-deficient mice are highlighting novel potential implications of both isoenzymes in a broad spectrum of mental disorders, ranging from autism and anxiety to impulse-control disorders and ADHD. These studies will lay the foundation for future research on the neurobiological and neurochemical bases of these pathological conditions, as well as the role of gene × environment interactions in the vulnerability to several mental disorders. PMID:21971001

  3. Differential effects of NADPH oxidase and xanthine oxidase inhibition on sympathetic reinnervation in postinfarct rat hearts.

    PubMed

    Lee, Tsung-Ming; Chen, Chien-Chang; Hsu, Yu-Jung

    2011-06-01

    Superoxide has been shown to play a major role in ventricular remodeling and arrhythmias after myocardial infarction. However, the source of increased myocardial superoxide production and the role of superoxide in sympathetic innervation remain to be further characterized. Male Wistar rats, after coronary artery ligation, were randomized to vehicle, allopurinol, or apocynin for 4weeks. To determine the role of peroxynitrite in sympathetic reinnervation, we also used 3-morpholinosydnonimine (a peroxynitrite generator). The postinfarction period was associated with increased oxidative stress, as measured by myocardial superoxide, nitrotyrosine, xanthine oxidase activity, NADPH oxidase activity, and dihydroethidium fluorescent staining. Measurement of myocardial norepinephrine levels revealed a significant elevation in vehicle-treated infarcted rats compared with sham. Sympathetic hyperinnervation was blunted after administration of allopurinol. Arrhythmic scores in the allopurinol-treated infarcted rats were significantly lower than those in vehicle. For similar levels of ventricular remodeling, apocynin had no beneficial effects on oxidative stress, sympathetic hyperinnervation, or arrhythmia vulnerability. Allopurinol-treated hearts had significantly decreased nerve growth factor expression, which was substantially increased after coadministration of 3-morpholinosydnonimine. These results indicate that xanthine oxidase but not NADPH oxidase largely mediates superoxide production after myocardial infarction. Xanthine oxidase inhibition ameliorates sympathetic innervation and arrhythmias possibly via inhibition of the peroxynitrite-mediated nerve growth factor pathway. PMID:21295134

  4. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-11-10

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  5. Ligand interactions with galactose oxidase: mechanistic insights.

    PubMed Central

    Whittaker, M M; Whittaker, J W

    1993-01-01

    Interactions between galactose oxidase and small molecules have been explored using a combination of optical absorption, circular dichroism, and electron paramagnetic resonance (EPR) spectroscopies to detect complex formation and characterize the products. Anions bind directly to the cupric center in both active and inactive galactose oxidase, converting to complexes with optical and EPR spectra that are distinctly different from those of the starting aquo enzyme. Azide binding is coupled to stoichiometric proton uptake by the enzyme, reflecting the generation of a strong base (pKa > 9) in the active site anion adduct. At low temperature, the aquo enzyme converts to a form that exhibits the characteristic optical and EPR spectra of an anion complex, apparently reflecting deprotonation of the coordinated water. Anion binding results in a loss of the optical transition arising from coordinated tyrosine, implying displacement of the axial tyrosine ligand on forming the adduct. Nitric oxide binds to galactose oxidase, forming a specific complex exhibiting an unusual EPR spectrum with all g values below 2. The absence of Cu splitting in this spectrum and the observation that the cupric EPR signal from the active site metal ion is not significantly decreased in the complex suggest a nonmetal interaction site for NO in galactose oxidase. These results have been interpreted in terms of a mechanistic scheme where substrate binding displaces a tyrosinate ligand from the active site cupric ion, generating a base that may serve to deprotonate the coordinated hydroxyl group of the substrate, activating it for oxidation. The protein-NO interactions may probe a nonmetal O2 binding site in this enzyme. PMID:8386015

  6. [Advances in the study of aldehyde oxidases].

    PubMed

    Mi, Jia-Qi; Li, Yan

    2014-05-01

    Aldehyde oxidase (AOX), a highly conserved molybdoflavoenzyme in mammal cytoplasm, has broad substrate specificity and ability to catalyze the oxidation of aldehydes and nitrogen, oxygen-containing heterocyclic rings. AOX was found to widely distribute with the individual differences in vivo and plays an important role in phase I metabolism of drugs and xenobiotics. The biological characteristics of AOX and its contributions in drug metabolism are introduced briefly in this review. PMID:25151725

  7. Inhibition of xanthine oxidase by pterins.

    PubMed

    Wede, I; Altindag, Z Z; Widner, B; Wachter, H; Fuchs, D

    1998-10-01

    The effect of a panel of pterins on xanthine oxidase was investigated by measuring formation of urate from xanthine as well as formazan production from nitroblue tetrazolium. The pterin derivatives, depending on their chemical structure, decreased urate as well as formazan generation: 200 microM neopterin and biopterin suppressed urate formation (90% from baseline) and formazan production (80% from baseline) as well. Their reduced forms, 7,8-dihydroneopterin and 5,6,7,8-tetrahydrobiopterin, showed a lesser but still strongly diminishing influence (40% from baseline). Another oxidized pterin namely leukopterin showed only a weak inhibitory effect. Xanthopterin, a known substrate of xanthine oxidase, had a strong effect on urate formation (80% inhibition), but a lesser effect on formazan production (30% reduction). When iron-(III)-EDTA complex was added to the reaction mixture all the effects were more pronounced. Superoxide dismutase, which removes superoxide anion by dismutation into oxygen, decreased formazan production in addition to pterin derivatives and had a small but enhancing effect on urate formation. Also the reductant N-acetylcysteine had an additive effect to pterins to diminish formazan production in a dose-dependent way. The results of our study suggest that depending on their chemical structure pterins reduce superoxide anion generation by xanthine oxidase. PMID:9860048

  8. Peroxiredoxin-6 and NADPH oxidase activity.

    PubMed

    Ambruso, Daniel R

    2013-01-01

    Peroxiredoxins (Prdxs) are a family of proteins which catalyze the reduction of H2O2 through the interaction of active site cysteine residues. Conserved within all plant and animal kingdoms, the function of these proteins is related to protection from oxidation or participation of signaling through degradation of H2O2. Peroxiredoxin 6 (Prdx6), a protein belonging to the class of 1-cys Prdxs, was identified in polymorphonuclear leukocytes or neutrophils, defined by amino acid sequence and activity, and found associated with a component of the NADPH oxidase (Nox2), p67(phox). Prdx6 plays an important role in neutrophil function and supports the optimal activity of Nox2. In this chapter, methods are described for determining the Prdx activity of Prdx6. In addition, the approach for assessing the effect of Prdx6 on Nox2 in the SDS-activated, cell-free system of NADPH oxidase activity is presented. Finally, the techniques for suppressing Prdx6 expression in phox-competent K562 cells and cultured myeloid cells with siRNA and shRNA methods are described. With these approaches, the role of Prdx6 in Nox2 activity can be explored with intact cells. The biochemical mechanisms of the Prdx6 effect on the NADPH oxidase can be investigated with the experimental strategies described. PMID:23830630

  9. D-Amino acid oxidase: new findings.

    PubMed

    Pilone, M S

    2000-11-01

    The most recent research on D-amino acid oxidases and D-amino acid metabolism has revealed new, intriguing properties of the flavoenzyme and enlighted novel biotechnological uses of this catalyst. Concerning the in vivo function of the enzyme, new findings on the physiological role of D-amino acid oxidase point to a detoxifying function of the enzyme in metabolizing exogenous D-amino acids in animals. A novel role in modulating the level of D-serine in brain has also been proposed for the enzyme. At the molecular level, site-directed mutagenesis studies on the pig kidney D-amino acid oxidase and, more recently, on the enzyme from the yeast Rhodotorula gracilis indicated that the few conserved residues of the active site do not play a role in acid-base catalysis but rather are involved in substrate interactions. The three-dimensional structure of the enzyme was recently determined from two different sources: at 2.5-3.0 A resolution for DAAO from pig kidney and at 1.2-1.8 A resolution for R. gracilis. The active site can be clearly depicted: the striking absence of essential residues acting in acid-base catalysis and the mode of substrate orientation into the active site, taken together with the results of free-energy correlation studies, clearly support a hydrid transfer type of mechanism in which the orbital steering between the substrate and the isoalloxazine atoms plays a crucial role during catalysis. PMID:11130179

  10. The NADH oxidase of Streptococcus pneumoniae: its involvement in competence and virulence.

    PubMed

    Auzat, I; Chapuy-Regaud, S; Le Bras, G; Dos Santos, D; Ogunniyi, A D; Le Thomas, I; Garel, J R; Paton, J C; Trombe, M C

    1999-12-01

    A soluble flavoprotein that reoxidizes NADH and reduces molecular oxygen to water was purified from the facultative anaerobic human pathogen Streptococcus pneumoniae. The nucleotide sequence of nox, the gene which encodes it, has been determined and was characterized at the functional and physiological level. Several nox mutants were obtained by insertion, nonsense or missense mutation. In extracts from these strains, no NADH oxidase activity could be measured, suggesting that a single enzyme encoded by nox, having a C44 in its active site, was utilizing O2 to oxidize NADH in S. pneumoniae. The growth rate and yield of the NADH oxidase-deficient strains were not changed under aerobic or anaerobic conditions, but the efficiency of development of competence for genetic transformation during growth was markedly altered. Conditions that triggered competence induction did not affect the amount of Nox, as measured using Western blotting, indicating that nox does not belong to the competence-regulated genetic network. The decrease in competence efficiency due to the nox mutations was similar to that due to the absence of oxygen in the nox+ strain, suggesting that input of oxygen into the metabolism via NADH oxidase was important for controlling competence development throughout growth. This was not related to regulation of nox expression by O2. Interestingly, the virulence and persistence in mice of a blood isolate was attenuated by a nox insertion mutation. Global cellular responses of S. pneumoniae, such as competence for genetic exchange or virulence in a mammalian host, could thus be modulated by oxygen via the NADH oxidase activity of the bacteria, although the bacterial energetic metabolism is essentially anaerobic. The enzymatic activity of the NADH oxidase coded by nox was probably involved in transducing the external signal, corresponding to O2 availability, to the cell metabolism and physiology; thus, this enzyme may function as an oxygen sensor. This work establishes, for the first time, the role of O2 in the regulation of pneumococcal transformability and virulence. PMID:10594826

  11. A novel superoxide-producing NAD(P)H oxidase in kidney.

    PubMed

    Shiose, A; Kuroda, J; Tsuruya, K; Hirai, M; Hirakata, H; Naito, S; Hattori, M; Sakaki, Y; Sumimoto, H

    2001-01-12

    During phagocytosis, gp91(phox), the catalytic subunit of the phagocyte NADPH oxidase, becomes activated to produce superoxide, a precursor of microbicidal oxidants. Currently increasing evidence suggests that nonphagocytic cells contain similar superoxide-producing oxidases, which are proposed to play crucial roles in various events such as cell proliferation and oxygen sensing for erythropoiesis. Here we describe the cloning of human cDNA that encodes a novel NAD(P)H oxidase, designated NOX4. The NOX4 protein of 578 amino acids exhibits 39% identity to gp91(phox) with special conservation in membrane-spanning regions and binding sites for heme, FAD, and NAD(P)H, indicative of its function as a superoxide-producing NAD(P)H oxidase. The membrane fraction of kidney-derived human embryonic kidney (HEK) 293 cells, expressing NOX4, exhibits NADH- and NADPH-dependent superoxide-producing activities, both of which are inhibited by diphenylene iodonium, an agent known to block oxygen sensing, and decreased in cells expressing antisense NOX4 mRNA. The human NOX4 gene, comprising 18 exons, is located on chromosome 11q14.2-q21, and its expression is almost exclusively restricted to adult and fetal kidneys. In human renal cortex, high amounts of the NOX4 protein are present in distal tubular cells, which reside near erythropoietin-producing cells. In addition, overexpression of NOX4 in cultured cells leads to increased superoxide production and decreased rate of growth. The present findings thus suggest that the novel NAD(P)H oxidase NOX4 may serve as an oxygen sensor and/or a regulator of cell growth in kidney. PMID:11032835

  12. Reactive Oxygen Species and Angiogenesis: NADPH Oxidase as Target for Cancer Therapy

    PubMed Central

    Ushio-Fukai, Masuko; Nakamura, Yoshimasa

    2009-01-01

    Angiogenesis is essential for tumor growth, metastasis, arteriosclerosis as well as embryonic development and wound healing. Its process is dependent on cell proliferation, migration and capillary tube formation in endothelia cells (ECs). High levels of reactive oxygen species (ROS) such as superoxide and H2O2 are observed in various cancer cells. Accumulating evidence suggests that ROS function as signaling molecules to mediate various growth-related responses including angiogenesis. ROS-dependent angiogenesis can be regulated by endogenous antioxidant enzymes such as SOD and thioredoxin. Vascular endothelial growth factor (VEGF), one of the major angiogenesis factor, is induced in growing tumors and stimulates EC proliferation and migration primarily through the VEGF receptor type2 (VEGFR2, Flk1/KDR). Major source of ROS in ECs is a NADPH oxidase which consists of Nox1, Nox2, Nox4, Nox5, p22phox, p47phox and the small G protein Rac1. NADPH oxidase is activated by various growth factors including VEGF and angiopoietin-1 as well as hypoxia and ischemia, and ROS derived from this oxidase are involved in VEGFR2 autophosphorylation, and diverse redox signaling pathways leading to induction of transcription factors and genes involved in angiogenesis. Dietary antioxidants appear to be effective for treatment of tumor angiogenesis. The aim of this review is to provide an overview of the recent progress on role of ROS derived from NADPH oxidase and redox signaling events involved in angiogenesis. Understanding these mechanisms may provide insight into the NADPH oxidase and redox signaling components as potential therapeutic targets for tumor angiogenesis. PMID:18406051

  13. Kinetic Results for Mutations of Conserved Residues H304 and R309 of Human Sulfite Oxidase Point to Mechanistic Complexities

    PubMed Central

    Davis, Amanda C.; Johnson-Winters, Kayunta; Arnold, Anna R.; Tollin, Gordon; Enemark, John H.

    2014-01-01

    Several point mutations in the gene of human sulfite oxidase (hSO) result in isolated sulfite oxidase deficiency, an inherited metabolic disorder. Three conserved residues (H304, R309, K322) are hydrogen bonded to the phosphate group of the molybdenum cofactor, and the R309H and K322R mutations are responsible for isolated sulfite oxidase deficiency. The kinetic effects of the K322R mutation have been previously reported (Rajapakshe et al. 2012, Chem. Biodiversity 9, 1621-1634); here we investigate several mutants of H304 and R309 by steady-state kinetics, laser flash photolysis studies of intramolecular electron transfer (IET), and spectroelectrochemistry. An unexpected result is that all of the mutants show decreased rates of IET but increased steady-state rates of catalysis. However, in all cases the rate of IET is greater than the overall turnover rate, showing that IET is not the rate determining step for any of the mutations. PMID:24968320

  14. Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

    PubMed

    Cil, M; Bykbayram, A E; Kiralp, S; Toppare, L; Ya?ci, Y

    2007-06-01

    In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively. PMID:17291580

  15. NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

    SciTech Connect

    Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong

    2008-12-19

    Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91{sup phox} was dose-dependent. Meanwhile, the cytoplasmic subunit p47{sup phox} was translocated to the cell membrane and localized with p22{sup phox} and gp91{sup phox} to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

  16. The gibberellin 20-oxidase of Gibberella fujikuroi is a multifunctional monooxygenase.

    PubMed

    Tudzynski, Bettina; Rojas, Mara Cecilia; Gaskin, Paul; Hedden, Peter

    2002-06-14

    The genes for gibberellin (GA) biosynthesis are clustered in the fungus Gibberella fujikuroi. In addition to genes encoding a GA-specific geranylgeranyl diphosphate synthase and a bifunctional ent-copalyl diphosphate/ent-kaurene synthase, the cluster contains four cytochrome P450 monooxygenase genes (P450-1, -2, -3, -4). Recently it was shown that P450-4 and P450-1 encode multifunctional enzymes catalyzing the three oxidation steps from ent-kaurene to ent-kaurenoic acid and the four oxidation steps from ent-kaurenoic acid to GA14, respectively. Here we describe the functional analysis of the P450-2 gene by gene disruption and by expressing the gene in a mutant that lacks the entire GA biosynthesis gene cluster. Mutants in which P450-2 is inactivated by the insertion of a large piece of DNA accumulated GA14 and lacked biosynthetically more advanced metabolites, indicating that the gene encodes a 20-oxidase. This was confirmed by incubating lines containing P450-2 in the absence of the other GA biosynthesis genes with isotopically labeled substrates. The P450-2 gene product oxidized the 3beta-hydroxylated intermediate, GA14, and its non-hydroxylated analogue GA12 to GA4 and GA9, respectively. Expression of P450-2 is repressed by high amounts of nitrogen in the culture medium but is not affected by the presence of biosynthetically advanced GAs, i.e. there is no evidence for feedback regulation. The fact that the GA 20-oxidase is a cytochrome P450 monooxygenase in G. fujikuroi and not a 2-oxoglutarate-dependent dioxygenase as in plants, together with the significant differences in regulation of gene expression, are further evidence for independent evolution of the GA biosynthetic pathways in plants and fungi. PMID:11943776

  17. [The history of renalase from amine oxidase to a a-NAD(P)H-oxidase/anomerase].

    PubMed

    Severina, I S; Fedchenko, V I; Veselovsky, A V; Medvedev, A E

    2015-01-01

    Renalase is a recently discovered secretory protein, which plays a certain (still poorly understood) role in regulation of blood pressure. The review summarizes own and literature data accumulated since the first publication on relanase (2005). Initial reports on FAD-dependent amine oxidase activity of this protein were not confirmed in independent experiments performed in different laboratories. In addition, proposed amine oxidase activity of circulating extracellular renalase requires the presence of FAD, which has not been detected either in blood or urinary renalase. Moreover, renalase excreted into urine lacks its N-terminal peptide, which is ultimately needed for accommodation of the FAD cofactor. Results of the Aliverti's group on NAD(P)H binding by renalase and weak diaphorase activity of this protein stimulated further studies of renalase as NAD(P)H oxidase catalyzing reaction of catecholamine co-oxidation. However, physiological importance of such extracellular catecholamine-metabolizing activity (demonstrated in one laboratory and not detected in another laboratory) remains unclear due to existence of much more active enzymatic systems (e.g. neutrophil NAD(P)H oxidase, xanthine oxidase/xanthine) in circulation, which can perform such co-oxidation reactions. Recently a-NAD(P)H oxidase/anomerase activity of renalase, which also pomotes oxidative conversion of b-NADH isomers inhibiting activity of NAD-dependent dehydrogenases, has been described. However, its possible contribution to the antihypertensive effect of renalase remains unclear. Thus, the antihypertensive effect of renalase still remains a phenomenon with unclear biochemical mechanim(s) and functions of intracellular and extracellular (circulating) renalases obviously differ. PMID:26716738

  18. Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).

    PubMed

    Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

    2015-01-01

    Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other advanced nanosystem based on directed nucleic acid assemblies, polyamine-induced DNA condensation, and bovine serum amine oxidase may be proposed for futuristic anticancer therapy utilizing nucleic acids, polyamines and BSAO. BSAO based nanoparticles can be employed for the generation of cytotoxic polyamine metabolites. PMID:25333509

  19. Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

    PubMed Central

    Dijkman, Willem P.

    2014-01-01

    In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

  20. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)

    2002-01-01

    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  1. Redox signaling: globalization of gene expression

    PubMed Central

    Oh, Jeong-Il; Kaplan, Samuel

    2000-01-01

    Here we show that the extent of electron flow through the cbb3 oxidase of Rhodobacter sphaeroides is inversely related to the expression levels of those photosynthesis genes that are under control of the PrrBA two-component activation system: the greater the electron flow, the stronger the inhibitory signal generated by the cbb3 oxidase to repress photosynthesis gene expression. Using site-directed mutagenesis, we show that intramolecular electron transfer within the cbb3 oxidase is involved in signal generation and transduction and this signal does not directly involve the intervention of molecular oxygen. In addition to the cbb3 oxidase, the redox state of the quinone pool controls the transcription rate of the puc operon via the AppA–PpsR antirepressor–repressor system. Together, these interacting regulatory circuits are depicted in a model that permits us to understand the regulation by oxygen and light of photosynthesis gene expression in R.sphaeroides. PMID:10944106

  2. Targeting NADPH Oxidases for the Treatment of Cancer and Inflammation

    PubMed Central

    Bonner, Michael Y.; Arbiser, Jack L

    2015-01-01

    NADPH oxidases are a family of oxidases that utilize molecular oxygen to generate hydrogen peroxide and superoxide, thus indicating physiological functions of these Highly reactive and short lived species. The regulation of these NADPH oxidases (nox) enzymes is complex, with many members of this family exhibiting complexity in subunit composition, cellular location, and tissue specific expression. While the complexity of the nox family (Nox1–5, Duox1,2) is daunting, the complexity also allows for targeting of NADPH oxidases in disease states. This review will discuss which inflammatory and malignant disorders can be targeted by nox inhibitors, as well as clinical experience in the use of nox inhibitors. PMID:22581366

  3. Reduced cytochrome oxidase activity in the retrosplenial cortex after lesions to the anterior thalamic nuclei.

    PubMed

    Mendez-Lopez, Magdalena; Arias, Jorge L; Bontempi, Bruno; Wolff, Mathieu

    2013-08-01

    The anterior thalamic nuclei (ATN) make a critical contribution to hippocampal system functions. Growing experimental work shows that the effects of ATN lesions often resemble those of hippocampal lesions and both markedly reduce the expression of immediate-early gene markers in the retrosplenial cortex, which still appears normal by standard histological means. This study shows that moderate ATN damage was sufficient to produce severe spatial memory impairment as measured in a radial-arm maze. Furthermore, ATN rats exhibited reduced cytochrome oxidase activity in the most superficial cortical layers of the granular retrosplenial cortex, and, to a lesser extent, in the anterior cingulate cortex. By contrast, no change in cytochrome oxidase activity was observed in other limbic cortical regions or in the hippocampal formation. Altogether our results indicate that endogenous long-term brain metabolic capacity within the granular retrosplenial cortex is compromised by even limited ATN damage. PMID:23660649

  4. Identification and characterization of an alternative oxidase in the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    Uribe, Daniel; Khachatourians, George G

    2008-02-01

    Mitochondria of Metarhizium anisopliae contain an alternative oxidase (AOX), which reduces oxygen to water by accepting electrons directly from ubiquinol. AOX activity is demonstrated in situ as a constitutive enzyme. Greatest activity of AOX appears at the beginning and at the end of the fungal developmental cycle, germination of aerial conidia and the formation of submerged conidia, respectively. Changes in nutritional conditions, e.g., the presence of h