These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Characterization of the multicopper oxidase gene family in Anopheles gambiae.  

PubMed

The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He, N., Botelho, J.M.C., McNall, R.J., Belozerov, V., Dunn, W.A., Mize, T., Orlando, R., Willis, J.H., 2007. Proteomic analysis of cast cuticles from Anopheles gambiae by tandem mass spectrometry. Insect Biochem. Mol. Biol. 37, 135-146). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

Gorman, Maureen J; Dittmer, Neal T; Marshall, Jeremy L; Kanost, Michael R

2008-09-01

2

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?  

PubMed Central

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

Kües, Ursula; Rühl, Martin

2011-01-01

3

Insect multicopper oxidases: diversity, properties, and physiological roles.  

PubMed

Multicopper oxidases (MCOs) are a group of related proteins that are ubiquitous in nature. They perform a wide variety of functions including pigmentation, lignin synthesis and degradation, iron homeostasis, and morphogenesis. The laccases of fungi are intensely studied for their biotechnological potential as a more environmentally friendly alternative to harsh or toxic chemicals used for certain industrial applications. Research into insect MCOs has recently attracted renewed interest as it is evident that they have diverse roles in insect physiology. MCO mRNA or enzymatic activity has been detected in extracts from epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Genome sequencing has allowed for the identification of MCO genes and revealed that the number of genes can vary between species. The function of one of the genes, MCO2, has been demonstrated to be a laccase-type phenoloxidase critical for cuticle sclerotization. However, the enzymatic properties and physiological functions of the remaining MCOs remain to be elucidated. A better understanding of the roles MCOs play in insect biology may help to develop new control measures of pest species. PMID:20219675

Dittmer, Neal T; Kanost, Michael R

2010-03-01

4

Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.  

PubMed Central

Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide product are proposed, indicating that the polypeptide of ORF1 might bind four copper ions: one type 1, one type 2, and two type 3. Images PMID:8282694

Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N

1994-01-01

5

Diversity of two-domain laccase-like multicopper oxidase genes in Streptomyces spp.: identification of genes potentially involved in extracellular activities and lignocellulose degradation during composting of agricultural waste.  

PubMed

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Lu, Lunhui; Zeng, Guangming; Fan, Changzheng; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-06-01

6

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste  

PubMed Central

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

7

Multicopper oxidase-1 is a ferroxidase essential for iron homeostasis in Drosophila melanogaster  

PubMed Central

Multicopper ferroxidases catalyze the oxidation of ferrous iron to ferric iron. In yeast and algae, they participate in cellular uptake of iron; in mammals, they facilitate cellular efflux. The mechanisms of iron metabolism in insects are still poorly understood, and insect multicopper ferroxidases have not been identified. In this paper, we present evidence that Drosophila melanogaster multicopper oxidase-1 (MCO1) is a functional ferroxidase. We identified candidate iron-binding residues in the MCO1 sequence and found that purified recombinant MCO1 oxidizes ferrous iron. An association between MCO1 function and iron homeostasis was confirmed by two observations: RNAi-mediated knockdown of MCO1 resulted in decreased iron accumulation in midguts and whole insects, and weak knockdown increased the longevity of flies fed a toxic concentration of iron. Strong knockdown of MCO1 resulted in pupal lethality, indicating that MCO1 is an essential gene. Immunohistochemistry experiments demonstrated that MCO1 is located on the basal surfaces of the digestive system and Malpighian tubules. We propose that MCO1 oxidizes ferrous iron in the hemolymph and that the resulting ferric iron is bound by transferrin or melanotransferrin, leading to iron storage, iron withholding from pathogens, regulation of oxidative stress, and/or epithelial maturation. These proposed functions are distinct from those of other known ferroxidases. Given that MCO1 orthologues are present in all insect genomes analyzed to date, this discovery is an important step toward understanding iron metabolism in insects. PMID:22847425

Lang, Minglin; Braun, Caroline L.; Kanost, Michael R.; Gorman, Maureen J.

2012-01-01

8

A Multicopper Oxidase-Related Protein Is Essential for Insect Viability, Longevity and Ovary Development  

PubMed Central

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests. PMID:25330116

Peng, Zeyu; Green, Peter G.; Arakane, Yasuyuki; Kanost, Michael R.; Gorman, Maureen J.

2014-01-01

9

Functional analysis of the multi-copper oxidase from Legionella pneumophila.  

PubMed

Multicopper oxidases have been described to have functions in copper tolerance, manganese oxidation, and iron oxidation in a range of bacteria. The putative cytoplasmic membrane multicopper oxidase from Legionella pneumophila was investigated. The mcoL gene was found to be critical for aerobic extracellular growth under either iron-limiting conditions or in the presence of ferrous Fe(II) iron, as a sole source of this essential metal. The mcoL mutants showed minor growth defects when grown in the presence of Fe(III) as the iron source. In contrast, intracellular growth and survival was not affected by the absence of the mcoL gene regardless of available iron concentration. The evidence presented here could indicate a possible role for mcoL in prevention of the toxic effects of ferrous iron during aerobic conditions. However, a function in high-affinity acquisition of iron could also be possible given the inability of the McoL mutants to grow aerobically under iron-limiting conditions. PMID:18403241

Huston, Wilhelmina M; Naylor, Jennifer; Cianciotto, Nicholas P; Jennings, Michael P; McEwan, Alastair G

2008-04-01

10

Molecular cloning and characterization of a novel metagenome-derived multicopper oxidase with alkaline laccase activity and highly soluble expression  

Microsoft Academic Search

Lac591, a gene encoding a novel multicopper oxidase with laccase activity, was identified through activity-based functional screening\\u000a of a metagenomic library from mangrove soil. Sequence analysis revealed that lac591 encodes a protein of 500 amino acids with a predicted molecular mass of 57.4 kDa. Lac591 was overexpressed heterologously\\u000a as soluble active enzyme in Escherichia coli and purified, giving rise to 380 mg

Mao Ye; Gang Li; Wei Qu Liang; Yu Huan Liu

2010-01-01

11

Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.  

PubMed

Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J

2015-04-01

12

Multicopper Oxidase-3 Is a Laccase Associated with the Peritrophic Matrix of Anopheles gambiae  

PubMed Central

The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including polyphenols and phenylendiamines; ferroxidases, which oxidize ferrous iron; and several other oxidases with specific substrates such as ascorbate, bilirubin or copper. The genome of Anopheles gambiae, a species of mosquito, encodes five putative multicopper oxidases. Of these five, only AgMCO2 has known enzymatic and physiological functions: it is a highly conserved laccase that functions in cuticle pigmentation and tanning by oxidizing dopamine and dopamine derivatives. AgMCO3 is a mosquito-specific gene that is expressed predominantly in adult midguts and Malpighian tubules. To determine its enzymatic function, we purified recombinant AgMCO3 and analyzed its activity. AgMCO3 oxidized hydroquinone (a p-diphenol), the five o-diphenols tested, 2,2?-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and p-phenylenediamine, but not ferrous iron. The catalytic efficiencies of AgMCO3 were similar to those of cuticular laccases (MCO2 orthologs), except that AgMCO3 oxidized all of the phenolic substrates with similar efficiencies whereas the MCO2 isoforms were less efficient at oxidizing catechol or dopa. These results demonstrate that AgMCO3 can be classified as a laccase and suggest that AgMCO3 has a somewhat broader substrate specificity than MCO2 orthologs. In addition, we observed AgMCO3 immunoreactivity in the peritrophic matrix, which functions as a selective barrier between the blood meal and midgut epithelial cells, protecting the midgut from mechanical damage, pathogens, and toxic molecules. We propose that AgMCO3 may oxidize toxic molecules in the blood meal leading to detoxification or to cross-linking of the molecules to the peritrophic matrix, thus targeting them for excretion. PMID:22479493

Lang, Minglin; Kanost, Michael R.; Gorman, Maureen J.

2012-01-01

13

A Novel Extracellular Multicopper Oxidase from Phanerochaete chrysosporium with Ferroxidase Activity  

PubMed Central

Lignin degradation by the white rot basidiomycete Phanerochaete chrysosporium involves various extracellular oxidative enzymes, including lignin peroxidase, manganese peroxidase, and a peroxide-generating enzyme, glyoxal oxidase. Recent studies have suggested that laccases also may be produced by this fungus, but these conclusions have been controversial. We identified four sequences related to laccases and ferroxidases (Fet3) in a search of the publicly available P. chrysosporium database. One gene, designated mco1, has a typical eukaryotic secretion signal and is transcribed in defined media and in colonized wood. Structural analysis and multiple alignments identified residues common to laccase and Fet3 sequences. A recombinant MCO1 (rMCO1) protein expressed in Aspergillus nidulans had a molecular mass of 78 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the copper I-type center was confirmed by the UV-visible spectrum. rMCO1 oxidized various compounds, including 2,2?-azino(bis-3-ethylbenzthiazoline-6-sulfonate) (ABTS) and aromatic amines, although phenolic compounds were poor substrates. The best substrate was Fe2+, with a Km close to 2 ?M. Collectively, these results suggest that the P. chrysosporium genome does not encode a typical laccase but rather encodes a unique extracellular multicopper oxidase with strong ferroxidase activity. PMID:14532088

Larrondo, Luis F.; Salas, Loreto; Melo, Francisco; Vicuña, Rafael; Cullen, Daniel

2003-01-01

14

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger  

PubMed Central

Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA) and 2,2-azino-di(3-ethylbenzthiazoline) sulfonic acid (ABTS), and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst. PMID:23270588

2012-01-01

15

Ericoid mycorrhizal root fungi and their multicopper oxidases from a temperate forest shrub  

PubMed Central

Ericoid mycorrhizal fungi (ERM) may specialize in capturing nutrients from their host's litter as a strategy for regulating nutrient cycles in terrestrial ecosystems. In spite of their potential significance, we know little about the structure of ERM fungal communities and the genetic basis of their saprotrophic traits (e.g., genes encoding extracellular enzymes). Rhododendron maximum is a model ERM understory shrub that influences the nutrient cycles of montane hardwood forests in the southern Appalachians (North Carolina, USA). We sampled ERM roots of R. maximum from organic and mineral soil horizons and identified root fungi by amplifying and sequencing internal transcribed spacer (ITS) ribosomal DNA (rDNA) collected from cultures and clones. We observed 71 fungal taxa on ERM roots, including known symbionts Rhizoscyphus ericae and Oidiodendron maius, putative symbionts from the Helotiales, Chaetothyriales, and Sebacinales, ectomycorrhizal symbionts, and saprotrophs. Supporting the idea that ERM fungi are adept saprotrophs, richness of root-fungi was greater in organic than in mineral soil horizons. To study the genetic diversity of oxidative enzymes that contribute to decomposition, we amplified and sequenced a portion of genes encoding multicopper oxidases (MCOs) from ERM ascomycetes. Most fungi possessed multiple copies of MCO sequences with strong similarities to known ferroxidases and laccases. Our findings indicate that R. maximum associates with a taxonomically and ecologically diverse fungal community. The study of MCO gene diversity and expression may be useful for understanding how ERM root fungi regulate the cycling of nutrients between the host plant and the soil environment. PMID:22408727

Wurzburger, Nina; Higgins, Brian P; Hendrick, Ronald L

2012-01-01

16

Linkage between Catecholate Siderophores and the Multicopper Oxidase CueO in Escherichia coli  

Microsoft Academic Search

The multicopper oxidase CueO had previously been demonstrated to exhibit phenoloxidase activity and was implicated in intrinsic copper resistance in Escherichia coli. Catecholates can potentially reduce Cu(II) to the prooxidant Cu(I). In this report we provide evidence that CueO protects E. coli cells by oxidizing enterobactin, the catechol iron siderophore of E. coli, in the presence of copper. In vitro,

Gregor Grass; Keshari Thakali; Phillip E. Klebba; Daniel Thieme; Axel Muller; Gunter F. Wildner; Christopher Rensing

2004-01-01

17

Determining the Role of Multicopper Oxidases in Manganese(II) Oxidation by Marine Bacillus Spores  

NASA Astrophysics Data System (ADS)

Bacteria play an important role in the environmental cycling of Mn by oxidizing soluble Mn(II) and forming insoluble Mn(III/IV) oxides. These biogenic Mn oxides are renowned for their strong sorptive and oxidative properties, which control the speciation and availability of many metals and organic compounds. A wide variety of bacteria are known to catalyze the oxidation of Mn(II); one of the most frequently isolated types are Bacillus species that oxidize Mn(II) only as metabolically dormant spores. We are using genetic and biochemical methods to study the molecular mechanisms of this process in these organisms. mnxG, a gene related to the multicopper oxidase (MCO) family of enzymes, is required for Mn(II) oxidation in the model organism, Bacillus sp. strain SG-1. Mn(II)-oxidizing activity can be detected in crude protein extracts of the exosporium and as a discrete band in SDS-PAGE gels, however previous attempts to purify or identify this Mn(II)-oxidizing enzyme have failed. A direct link between the Mn(II)-oxidizing enzyme and the MCO gene suspected to encode it has never been made. We used genetic and biochemical methods to investigate the role of the MCO in the mechanism of Mn(II) oxidation. Comparative analysis of the mnx operon from several diverse Mn(II)-oxidizing Bacillus spores revealed that mnxG is the most highly conserved gene in the operon, and that copper binding sites are highly conserved. As with Mn(II) oxidases from other organisms, heterologous expression of the Bacillus mnxG in E. coli did not yield an active Mn(II) oxidase. Purifying sufficient quantities of the native Mn(II) oxidase from Bacillus species for biochemical characterization has proven difficult because the enzyme does not appear to be abundant, and it is highly insoluble. We were able to partially purify the Mn(II) oxidase, and to analyze the active band by in-gel trypsin digestion followed by tandem mass spectrometry (MS/MS). MS/MS spectra provided a conclusive match to mnxG, suggesting that this MCO directly catalyzes the oxidation of Mn(II) and the precipitation of Mn(IV) oxide, which represents a novel reaction for a MCO. MS/MS analysis of bands identified by in-gel activity assays is a powerful method of identifying novel enzymes responsible for geochemical processes.

Dick, G. J.; Tebo, B. M.

2005-12-01

18

A Multicopper Oxidase (Cj1516) and a CopA Homologue (Cj1161) Are Major Components of the Copper Homeostasis System of Campylobacter jejuni  

Microsoft Academic Search

Metal ion homeostasis mechanisms in the food-borne human pathogen Campylobacter jejuni are poorly understood. The Cj1516 gene product is homologous to the multicopper oxidase CueO, which is known to contribute to copper tolerance in Escherichia coli. Here we show, by optical absorbance and electron paramag- netic resonance spectroscopy, that purified recombinant Cj1516 contains both T1 and trinuclear copper centers, which

Stephen J. Hall; Andrew Hitchcock; Clive S. Butler; David J. Kelly

2009-01-01

19

Atmospheric N Deposition Increases Bacterial Laccase-Like Multicopper Oxidases: Implications for Organic Matter Decay  

PubMed Central

Anthropogenic release of biologically available nitrogen (N) has increased dramatically over the last 150 years, which can alter the processes controlling carbon (C) storage in terrestrial ecosystems. In a northern hardwood forest ecosystem located in Michigan in the United States, nearly 20 years of experimentally increased atmospheric N deposition has reduced forest floor decay and increased soil C storage. This change occurred concomitantly with compositional changes in Basidiomycete fungi and in Actinobacteria, as well as the downregulation of fungal lignocelluloytic genes. Recently, laccase-like multicopper oxidases (LMCOs) have been discovered among bacteria which can oxidize ?-O-4 linkages in phenolic compounds (e.g., lignin and humic compounds), resulting in the production of dissolved organic carbon (DOC). Here, we examined how nearly 2 decades of experimental N deposition has affected the abundance and composition of saprotrophic bacteria possessing LMCO genes. In our experiment, LMCO genes were more abundant in the forest floor under experimental N deposition whereas the abundances of bacteria and fungi were unchanged. Experimental N deposition also led to less-diverse, significantly altered bacterial and LMCO gene assemblages, with taxa implicated in organic matter decay (i.e., Actinobacteria, Proteobacteria) accounting for the majority of compositional changes. These results suggest that experimental N deposition favors bacteria in the forest floor that harbor the LMCO gene and represents a plausible mechanism by which anthropogenic N deposition has reduced decomposition, increased soil C storage, and accelerated phenolic DOC production in our field experiment. Our observations suggest that future rates of atmospheric N deposition could fundamentally alter the physiological potential of soil microbial communities. PMID:24837374

Zak, Donald R.

2014-01-01

20

Laccase versus Laccase-Like Multi-Copper Oxidase: A Comparative Study of Similar Enzymes with Diverse Substrate Spectra  

PubMed Central

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term “laccase-like multi-copper oxidase” (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

21

Laccase versus laccase-like multi-copper oxidase: a comparative study of similar enzymes with diverse substrate spectra.  

PubMed

Laccases (EC 1.10.3.2) are multi-copper oxidases that catalyse the one-electron oxidation of a broad range of compounds including substituted phenols, arylamines and aromatic thiols to the corresponding radicals. Owing to their broad substrate range, copper-containing laccases are versatile biocatalysts, capable of oxidizing numerous natural and non-natural industry-relevant compounds, with water as the sole by-product. In the present study, 10 of the 11 multi-copper oxidases, hitherto considered to be laccases, from fungi, plant and bacterial origin were compared. A substrate screen of 91 natural and non-natural compounds was recorded and revealed a fairly broad but distinctive substrate spectrum amongst the enzymes. Even though the enzymes share conserved active site residues we found that the substrate ranges of the individual enzymes varied considerably. The EC classification is based on the type of chemical reaction performed and the actual name of the enzyme often refers to the physiological substrate. However, for the enzymes studied in this work such classification is not feasible, even more so as their prime substrates or natural functions are mainly unknown. The classification of multi-copper oxidases assigned as laccases remains a challenge. For the sake of simplicity we propose to introduce the term "laccase-like multi-copper oxidase" (LMCO) in addition to the term laccase that we use exclusively for the enzyme originally identified from the sap of the lacquer tree Rhus vernicifera. PMID:23755261

Reiss, Renate; Ihssen, Julian; Richter, Michael; Eichhorn, Eric; Schilling, Boris; Thöny-Meyer, Linda

2013-01-01

22

Surfactant-assisted direct electron transfer between multi-copper oxidases and carbon nanotube-based porous electrodes.  

PubMed

The effects of pre-treatment with surfactants on the electrocatalytic reaction of multi-copper oxidases were quantitatively evaluated using a well-structured carbon nanotube forest electrode. It was found that both the charge polarity of the head group and the aromatics in the tail part of the surfactants affect the efficiency of enzymatic electrocatalysis. PMID:24871387

Ogawa, Yudai; Yoshino, Syuhei; Miyake, Takeo; Nishizawa, Matsuhiko

2014-07-14

23

A Multicopper Oxidase (Cj1516) and a CopA Homologue (Cj1161) Are Major Components of the Copper Homeostasis System of Campylobacter jejuni?  

PubMed Central

Metal ion homeostasis mechanisms in the food-borne human pathogen Campylobacter jejuni are poorly understood. The Cj1516 gene product is homologous to the multicopper oxidase CueO, which is known to contribute to copper tolerance in Escherichia coli. Here we show, by optical absorbance and electron paramagnetic resonance spectroscopy, that purified recombinant Cj1516 contains both T1 and trinuclear copper centers, which are characteristic of multicopper oxidases. Inductively coupled plasma mass spectrometry revealed that the protein contained approximately six copper atoms per polypeptide. The presence of an N-terminal “twin arginine” signal sequence suggested a periplasmic location for Cj1516, which was confirmed by the presence of p-phenylenediamine (p-PD) oxidase activity in periplasmic fractions of wild-type but not Cj1516 mutant cells. Kinetic studies showed that the pure protein exhibited p-PD, ferroxidase, and cuprous oxidase activities and was able to oxidize an analogue of the bacterial siderophore anthrachelin (3,4-dihydroxybenzoate), although no iron uptake impairment was observed in a Cj1516 mutant. However, this mutant was very sensitive to increased copper levels in minimal media, suggesting a role in copper tolerance. This was supported by increased expression of the Cj1516 gene in copper-rich media. A mutation in a second gene, the Cj1161c gene, encoding a putative CopA homologue, was also found to result in copper hypersensitivity, and a Cj1516 Cj1161c double mutant was found to be more copper sensitive than either single mutant. These observations and the apparent lack of alternative copper tolerance systems suggest that Cj1516 (CueO) and Cj1161 (CopA) are major proteins involved in copper homeostasis in C. jejuni. PMID:18931123

Hall, Stephen J.; Hitchcock, Andrew; Butler, Clive S.; Kelly, David J.

2008-01-01

24

New insights into the catalytic active-site structure of multicopper oxidases.  

PubMed

Structural models determined by X-ray crystallography play a central role in understanding the catalytic mechanism of enzymes. However, X-ray radiation generates hydrated electrons that can cause significant damage to the active sites of metalloenzymes. In the present study, crystal structures of the multicopper oxidases (MCOs) CueO from Escherichia coli and laccase from a metagenome were determined. Diffraction data were obtained from a single crystal under low to high X-ray dose conditions. At low levels of X-ray exposure, unambiguous electron density for an O atom was observed inside the trinuclear copper centre (TNC) in both MCOs. The gradual reduction of copper by hydrated electrons monitored by measurement of the Cu?K-edge X-ray absorption spectra led to the disappearance of the electron density for the O atom. In addition, the size of the copper triangle was enlarged by a two-step shift in the location of the type III coppers owing to reduction. Further, binding of O2 to the TNC after its full reduction was observed in the case of the laccase. Based on these novel structural findings, the diverse resting structures of the MCOs and their four-electron O2-reduction process are discussed. PMID:24598746

Komori, Hirofumi; Sugiyama, Ryosuke; Kataoka, Kunishige; Miyazaki, Kentaro; Higuchi, Yoshiki; Sakurai, Takeshi

2014-03-01

25

Multireference Ab Initio Calculations of g tensors for Trinuclear Copper Clusters in Multicopper Oxidases  

PubMed Central

EPR spectroscopy has proven to be an indispensable tool in elucidating the structure of metal sites in proteins. In recent years, experimental EPR data have been complemented by theoretical calculations, which have become a standard tool of many quantum chemical packages. However, there have only been a few attempts to calculate EPR g tensors for exchange-coupled systems with more than two spins. In this work, we present a quantum chemical study of structural, electronic, and magnetic properties of intermediates in the reaction cycle of multicopper oxidases and of their inorganic models. All these systems contain three copper(II) ions bridged by hydroxide or O2? anions and their ground states are antiferromagnetically coupled doublets. We demonstrate that only multireference methods, such as CASSCF/CASPT2 or MRCI can yield qualitatively correct results (compared to the experimental values) and consider the accuracy of the calculated EPR g tensors as the current benchmark of quantum chemical methods. By decomposing the calculated g tensors into terms arising from interactions of the ground state with the various excited states, the origin of the zero-field splitting is explained. The results of the study demonstrate that a truly quantitative prediction of the g tensors of exchange-coupled systems is a great challenge to contemporary theory. The predictions strongly depend on small energy differences that are difficult to predict with sufficient accuracy by any quantum chemical method that is applicable to systems of the size of our target systems. PMID:20469875

Vancoillie, Steven; Chalupský, Jakub; Ryde, Ulf; Solomon, Edward I.; Pierloot, Kristine; Neese, Frank; Rulíšek, Lubomír

2010-01-01

26

Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase  

PubMed Central

Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.

2013-01-01

27

The Fox1 Ferroxidase of Chlamydomonas reinhardtii: A New Multicopper Oxidase Structural Paradigm  

PubMed Central

Multicopper oxidases (MCO) contain at least four copper atoms arrayed in three distinct ligand fields supported by two canonical structural features: 1) multiples of the cupredoxin fold; and 2) four unique sequence elements that include the 10 histidine and one cysteine ligands to the four copper atoms. Ferroxidases are a sub-family of MCO proteins that contain residues supporting a specific reactivity towards ferrous iron; these MCOs play a vital role in iron metabolism in bacteria, algae, fungi and mammals. In contrast to the fungal ferroxidases, e.g. Fet3p from Saccharomyces cerevisiae, the mammalian ceruloplasmin (Cp) is twice as large (six versus three cupredoxin domains) and contains three type 1, or “blue” copper sites. Chlamydomonas reinhardtii expresses a putative ferroxidase, Fox1, which has sequence similarity to human Cp (hCp). Eschewing the standard sequence-based modeling paradigm, a function-based model of the Fox1 protein has been constructed which replicates hCp's six Cu-site ligand arrays with an overall root mean square deviation of 1.4 Å. Analysis of this model has led also to assignment of motifs in Fox1 that are unique to ferroxidases, the strongest evidence to date that the well-characterized fungal high-affinity iron uptake system is essential to iron homeostasis in green algae. The model of Fox1 also establishes a sub-family of MCO proteins with a non-canonical Cu-ligand organization. These diverse structures suggest alternate mechanisms for intramolecular electron transfer and require a new trajectory for the evolution of the MCO superfamily. PMID:19023602

Terzulli, Alaina J.; Kosman, Daniel J.

2009-01-01

28

Multicopper Oxidase Involvement in Both Mn(II) and Mn(III) Oxidation during Bacterial Formation of MnO2  

PubMed Central

Global cycling of environmental manganese requires catalysis by bacteria and fungi for MnO2 formation, since abiotic Mn(II) oxidation is slow under ambient conditions. Genetic evidence from several bacteria implicates multicopper oxidases (MCOs) as being required for MnO2 formation. However, MCOs catalyze one-electron oxidations, whereas conversion of Mn(II) to MnO2 is a two-electron process. Trapping experiments with pyrophosphate (PP), a Mn(III) chelator, have demonstrated that Mn(III) is an intermediate in Mn(II) oxidation when mediated by exosporium from the Mn-oxidizing bacterium Bacillus SG-1. The reaction of Mn(II) depends on O2 and is inhibited by azide, consistent with MCO catalysis. We show that the subsequent conversion of Mn(III) to MnO2 also depends on O2 and is inhibited by azide. Thus, both oxidation steps appear to be MCO-mediated, likely by the same enzyme, indicated by genetic evidence to be the MnxG gene product. We propose a model of how the manganese oxidase active site may be organized to couple successive electron transfers to the formation of polynuclear Mn(IV) complexes as precursors to MnO2 formation. PMID:22892957

Soldatova, Alexandra V.; Butterfield, Cristina; Oyerinde, Oyeyemi F.; Tebo, Bradley M.; Spiro, Thomas G.

2013-01-01

29

Molecular origin of rapid versus slow intramolecular electron transfer in the catalytic cycle of the multicopper oxidases.  

PubMed

Kinetic measurements on single-turnover processes in laccase established fast type-1 Cu to trinuclear Cu cluster (TNC) intramolecular electron transfer (IET) in the reduction of the native intermediate (NI), the fully oxidized form of the enzyme formed immediately after O-O bond cleavage in the mechanism of O2 reduction. Alternatively, slow IET kinetics was observed in the reduction of the resting enzyme, which involves proton-coupled electron transfer on the basis of isotope measurements. The >10(3) difference between the IET rates for these two processes confirms that the NI, rather than the resting enzyme that has been defined by crystallography, is the fully oxidized form of the TNC in catalytic turnover. Computational modeling showed that reduction of NI is fast because of the larger driving force associated with a more favorable proton affinity of its ?3-oxo moiety generated by reductive cleavage of the O-O bond. This defines a unifying mechanism in which reductive cleavage of the O-O bond is coupled to rapid IET in the multicopper oxidases. PMID:23902255

Heppner, David E; Kjaergaard, Christian H; Solomon, Edward I

2013-08-21

30

Using planktonic microorganisms to supply the unpurified multi-copper oxidases laccase and copper efflux oxidases at a biofuel cell cathode.  

PubMed

The feasibility to apply crude culture supernatants that contain the multicopper oxidases laccase or copper efflux oxidase (CueO) as oxygen reducing catalysts in a biofuel cell cathode is shown. As enzyme-secreting recombinant planktonic microorganisms, the yeast Yarrowia lipolytica and the bacterium Escherichia coli were investigated. The cultivation and operation conditions (choice of medium, pH) had distinct effects on the electro-catalytic performance. The highest current density of 119 ± 23 ?A cm(-2) at 0.400 V vs. NHE was obtained with the crude culture supernatant of E. coli cells overexpressing CueO and tested at pH 5.0. In comparison, at pH 7.4 the electrode potential at 100 ?A cm(-2) is 0.25 V lower. Laccase-containing supernatants of Y. lipolytica yielded a maximum current density of 6.7 ± 0.4 ?Acm(-2) at 0.644 V vs. NHE. These results open future possibilities to circumvent elaborate enzyme purification procedures and realize cost effective and easy-to-operate enzymatic biofuel cells. PMID:24607459

Sané, Sabine; Richter, Katrin; Rubenwolf, Stefanie; Matschke, Nina Joan; Jolivalt, Claude; Madzak, Catherine; Zengerle, Roland; Gescher, Johannes; Kerzenmacher, Sven

2014-04-01

31

Geometric and electronic structure differences between the type 3 copper sites of the multicopper oxidases and hemocyanin/tyrosinase  

PubMed Central

The coupled binuclear “type 3” Cu sites are found in hemocyanin (Hc), tyrosinase (Tyr), and the multicopper oxidases (MCOs), such as laccase (Lc), and play vital roles in O2 respiration. Although all type 3 Cu sites share the same ground state features, those of Hc/Tyr have very different ligand-binding properties relative to those of the MCOs. In particular, the type 3 Cu site in the MCOs (LcT3) is a part of the trinuclear Cu cluster, and if the third (i.e., type 2) Cu is removed, the LcT3 site does not react with O2. Density functional theory calculations indicate that O2 binding in Hc is ?9 kcal mol?1 more favorable than for LcT3. The difference is mostly found in the total energy difference of the deoxy states (?7 kcal mol?1), where the stabilization of deoxy LcT3 derives from its long equilibrium Cu–Cu distance of ?5.5–6.5 ?, relative to ?4.2 ? in deoxy Hc/Tyr. The O2 binding in Hc is driven by the electrostatic destabilization of the deoxy Hc site, in which the two Cu(I) centers are kept close together by the protein for facile 2-electron reduction of O2. Alternatively, the lack of O2 reactivity in LcT3 reflects the flexibility of the active site, capable of minimizing the electrostatic repulsion of the 2 Cu(I)s. Thus, the O2 reactivity of the MCOs is intrinsic to the trinuclear Cu cluster, leading to different O2 intermediates as required by its function of irreversible reduction of O2 to H2O. PMID:19346471

Yoon, Jungjoo; Fujii, Satoshi; Solomon, Edward I.

2009-01-01

32

Characterization of endogenous and recombinant forms of laccase-2, a multicopper oxidase from the tobacco hornworm, Manduca sexta.  

PubMed

Laccases belong to the group of multicopper oxidases that exhibit wide substrate specificity for polyphenols and aromatic amines. They are found in plants, fungi, bacteria, and insects. In insects the only known role for laccase is in cuticle sclerotization. However, extracting laccase from the insect's cuticle requires proteolysis, resulting in an enzyme that is missing its amino-terminus. To circumvent this problem, we expressed and purified full-length and amino-terminally truncated recombinant forms of laccase-2 from the tobacco hornworm, Manduca sexta. We also purified the endogenous enzyme from the pharate pupal cuticle and used peptide mass fingerprinting analysis to confirm that it is laccase-2. All three enzymes had pH optima between 5 and 5.5 when using N-acetyldopamine (NADA) or N-beta-alanyldopamine-alanyldopamine (NBAD) as substrates. The laccases exhibited typical Michaelis-Menten kinetics when NADA was used as a substrate, with K(m) values of 0.46 mM, 0.43 mM, and 0.63 mM, respectively, for the full-length recombinant, truncated recombinant, and cuticular laccases; the apparent k(cat) values were 100 min(-1), 80 min(-1), and 290 min(-1). The similarity in activity of the two recombinant laccases suggests that laccase-2 is expressed in an active form rather than as a zymogen, as had been previously proposed. This conclusion is consistent with the detection of activity in untanned pupal wing cuticle using the laccase substrate 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). Immunoblot analysis of proteins extracted from both tanned and untanned cuticle detected only a single protein of 84 kDa, consistent with the full-length enzyme. With NBAD as substrate, the full-length recombinant and cuticular laccases showed kinetics indicative of substrate inhibition, with K(m) values of 1.9 mM and 0.47 mM, respectively, and apparent k(cat) values of 200 min(-1) and 180 min(-1). These results enhance our understanding of cuticle sclerotization, and may aid in the design of insecticides targeting insect laccases. PMID:19576986

Dittmer, Neal T; Gorman, Maureen J; Kanost, Michael R

2009-09-01

33

Melon ascorbate oxidase: cloning of a multigene family, induction during fruit development and repression by wounding  

Microsoft Academic Search

A small family of at least four genes encoding melon ascorbate oxidase (AO) has been identified and three members of it have been cloned. Preliminary DNA sequence determination suggested that melon AO genes code for enzymes homologous to ascorbate oxidases from other plants and similar to other multicopper oxidases. We describe detailed molecular studies addressing melon AO expression during organ

George Diallinas; Irene Pateraki; Maite Sanmartin; Angela Scossa; Eugenia Stilianou; Nickolas J. Panopoulos; Angelos K. Kanellis

1997-01-01

34

Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase  

PubMed Central

X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O2. In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV–Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-­ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O2 reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

De la Mora, Eugenio; Lovett, Janet E.; Blanford, Christopher F.; Garman, Elspeth F.; Valderrama, Brenda; Rudino-Pinera, Enrique

2012-01-01

35

Structural changes caused by radiation-induced reduction and radiolysis: the effect of X-ray absorbed dose in a fungal multicopper oxidase.  

PubMed

X-ray radiation induces two main effects at metal centres contained in protein crystals: radiation-induced reduction and radiolysis and a resulting decrease in metal occupancy. In blue multicopper oxidases (BMCOs), the geometry of the active centres and the metal-to-ligand distances change depending on the oxidation states of the Cu atoms, suggesting that these alterations are catalytically relevant to the binding, activation and reduction of O(2). In this work, the X-ray-determined three-dimensional structure of laccase from the basidiomycete Coriolopsis gallica (Cg L), a high catalytic potential BMCO, is described. By combining spectroscopic techniques (UV-Vis, EPR and XAS) and X-ray crystallography, structural changes at and around the active copper centres were related to pH and absorbed X-ray dose (energy deposited per unit mass). Depletion of two of the four active Cu atoms as well as low occupancies of the remaining Cu atoms, together with different conformations of the metal centres, were observed at both acidic pH and high absorbed dose, correlating with more reduced states of the active coppers. These observations provide additional evidence to support the role of flexibility of copper sites during O(2) reduction. This study supports previous observations indicating that interpretations regarding redox state and metal coordination need to take radiation effects explicitly into account. PMID:22525754

De la Mora, Eugenio; Lovett, Janet E; Blanford, Christopher F; Garman, Elspeth F; Valderrama, Brenda; Rudino-Pinera, Enrique

2012-05-01

36

Characterization of cDNAs encoding putative laccase-like multicopper oxidases and developmental expression in the tobacco hornworm, Manduca sexta, and the malaria mosquito, Anopheles gambiae.  

PubMed

Laccase (EC 1.10.3.2) is an enzyme with p-diphenol oxidase activity that is a member of a group of proteins collectively known as multicopper, or blue copper, oxidases. Laccase is hypothesized to play an important role in insect cuticle sclerotization by oxidizing catechols in the cuticle to their corresponding quinones, which then catalyze protein cross-linking reactions. To facilitate studies of the structure, function and regulation of insect laccases, we have cloned two cDNAs for laccases from the tobacco hornworm, Manduca sexta (MsLac1 and 2), and one from the malaria mosquito, Anopheles gambiae (AgLac1). The MsLac1 and 2 cDNAs encode proteins of 801 amino acids (aa) and 760 aa, respectively, while the AgLac1 cDNA encodes a protein of 1009 aa. All three cDNAs contain putative secretion signal sequences, and the 10 histidines and one cysteine that form the copper-binding centers, as well as a methionine in the T1 copper center. Novel to the insect laccases, relative to both fungal and plant laccases, is a longer amino-terminal sequence characterized by a unique domain consisting of several conserved cysteine, aromatic, and charged residues. Northern blot analyses identified single transcripts of approximately 3.6, 3.5, and 4.4 kb for MsLac1, MsLac2, and AgLac1, respectively, and also showed that AgLac1 was expressed in all life stages of the mosquito. RT-PCR revealed that the MsLac1 transcript was most abundant in the midgut, Malpighian tubules, and epidermis, whereas the MsLac2 transcript was most abundant in the epidermis. MsLac2 showed strong expression in the pharate pupal and reduced expression in the early pupal epidermis, consistent with the laccases' presumed role in cuticle sclerotization. PMID:14723895

Dittmer, Neal T; Suderman, Richard J; Jiang, Haobo; Zhu, Yu-Cheng; Gorman, Maureen J; Kramer, Karl J; Kanost, Michael R

2004-01-01

37

Crystal Structures of Multicopper Oxidase CueO Bound to Copper(I) and Silver(I): Functional Role of a Methonine-Rich Sequence  

SciTech Connect

The multicopper oxidase CueO oxidizes toxic Cu(I) and is required for copper homeostasis in Escherichia coli. Like many proteins involved in copper homeostasis, CueO has a methionine-rich segment that is thought to be critical for copper handling. How such segments function is poorly understood. Here, we report the crystal structure of CueO at 1.1 {angstrom} with the 45-residue methionine-rich segment fully resolved, revealing an N-terminal helical segment with methionine residues juxtaposed for Cu(I) ligation and a C-terminal highly mobile segment rich in methionine and histidine residues. We also report structures of CueO with a C500S mutation, which leads to loss of the T1 copper, and CueO with six methionines changed to serine. Soaking C500S CueO crystals with Cu(I), or wild-type CueO crystals with Ag(I), leads to occupancy of three sites, the previously identified substrate-binding site and two new sites along the methionine-rich helix, involving methionines 358, 362, 368, and 376. Mutation of these residues leads to a {approx}4-fold reduction in kcat for Cu(I) oxidation. Ag(I), which often appears with copper in nature, strongly inhibits CueO oxidase activities in vitro and compromises copper tolerance in vivo, particularly in the absence of the complementary copper efflux cus system. Together, these studies demonstrate a role for the methionine-rich insert of CueO in the binding and oxidation of Cu(I) and highlight the interplay among cue and cus systems in copper and silver homeostasis.

Singh, Satish K.; Roberts, Sue A.; McDevitt, Sylvia F.; Weichsel, Andrzej; Wildner, Guenter F.; Grass, Gregor B.; Rensing, Christopher; Montfort, William R. (Skidmore); (Bundeswehr); (Ariz)

2011-10-24

38

The Two Oxidized Forms of the Trinuclear Cu Cluster in the Multicopper Oxidases And Mechanism for the Decay of the Native Intermediate  

SciTech Connect

Multicopper oxidases (MCOs) catalyze the 4e{sup -} reduction of O2 to H2O. The reaction of the fully reduced enzyme with O2 generates the native intermediate (NI), which undergoes a slow decay to the resting enzyme in the absence of substrate. NI is a fully oxidized form, but its spectral features are very different from those of the resting form (also fully oxidized), because the type 2 and the coupled-binuclear type 3 Cu centers in the O2-reducing trinuclear Cu cluster site are isolated in the resting enzyme, whereas these are all bridged by a {mu}3-oxo ligand in NI. Notably, the one azide-bound NI (NI{sub Az}) exhibits spectral features very similar to those of NI, in which the {mu}3-oxo ligand in NI has been replaced by a {mu}3-bridged azide. Comparison of the spectral features of NI and NIAz, combined with density functional theory (DFT) calculations, allows refinement of the NI structure. The decay of NI to the resting enzyme proceeds via successive proton-assisted steps, whereas the rate-limiting step involves structural rearrangement of the {mu}3-oxo-bridge from inside to outside the cluster. This phenomenon is consistent with the slow rate of NI decay that uncouples the resting enzyme from the catalytic cycle, leaving NI as the catalytically relevant fully oxidized form of the MCO active site. The all-bridged structure of NI would facilitate electron transfer to all three Cu centers of the trinuclear cluster for rapid proton-coupled reduction of NI to the fully reduced form for catalytic turnover.

Yoon, J.; Liboiron, B.D.; Sarangi, R.; Hodgson, K.O.; Hedman, B.; Solomona, E.I.; /Stanford U., Chem. Dept. /SLAC, SSRL

2007-10-10

39

Ground State Electronic and Magnetic Properties of a ?3-Oxo Bridged Trinuclear Cu(II) Complex: Correlation to the Native Intermediate of the Multicopper Oxidases  

PubMed Central

The ground state electronic and magnetic properties of one of the possible structures of the trinuclear CuII site in the native intermediate (NI) of the multicopper oxidases, the ?3-oxo bridged structure, are evaluated using the C3-symmetric Cu3II complex, ?3O. ?3O is unique in that no ligand, other than the oxo, contributes to the exchange coupling. However, ?3O has a ferromagnetic ground state, inconsistent with that of NI. Therefore, two perturbations have been considered: protonation of the ?3-oxo ligand and relaxation of the ?3-oxo ligand into the Cu3 plane. Notably, when the oxo-ligand is sufficiently close to the Cu3 plane (< 0.3 Å), the ground state of ?3O becomes antiferromagnetic and can be correlated to that of NI. In addition, the ferromagnetic 4A ground state of ?3O is found from variable-temperature EPR to undergo a zero-field splitting (ZFS) of 2D = -5.0 cm-1, which derives from the second-order anisotropic exchange. This allows evaluation of the ?-to-? excited state exchange pathways and provides experimental evidence that the orbitally-degenerate 2E ground state of the antiferromagnetic ?3O would also undergo a ZFS by the first-order antisymmetric exchange that has the same physical origin as the anisotropic exchange. The important contribution of the ?3-oxo bridge to the ground-to-ground and ground-to-excited state superexchange pathways that are responsible for the isotropic, antisymmetric and anisotropic exchange are discussed. PMID:16241158

Yoon, Jungjoo; Solomon, Edward I.

2008-01-01

40

Direct electron-transfer conduits constructed at the interface between multicopper oxidase and nanocrystalline semiconductive Fe oxides  

NASA Astrophysics Data System (ADS)

Herein, the electron-transfer reactions occurring at the interface between bilirubin oxidase (BOD) and nanocrystalline hematite (?-Fe 2O 3) were characterized. Cyclic voltammograms indicated that BOD has an affinity for hematite surfaces and establishes a direct electron-transfer (DET) conduit between the primary electron acceptor T1 site and the conduction band of ?-Fe 2O 3. DET was also confirmed photo-electrochemically, as cathodic photocurrents were generated when a nanocomposite of BOD and ?-Fe 2O 3 was illuminated under oxygenated conditions. A proline residue displayed a high-binding affinity for hematite surfaces and is therefore likely part of an orientation-controlled motif which serves to locate BOD at the T1 site at a suitable distance for DET to ?-Fe 2O 3.

Nakamura, Ryuhei; Kamiya, Kazuhide; Hashimoto, Kazuhito

2010-10-01

41

The mammalian aldehyde oxidase gene family  

PubMed Central

Aldehyde oxidases (EC 1.2.3.1) are a small group of structurally conserved cytosolic proteins represented in both the animal and plant kingdoms. In vertebrates, aldehyde oxidases constitute the small sub-family of molybdo-flavoenzymes, along with the evolutionarily and structurally related protein, xanthine oxidoreductase. These enzymes require a molybdo-pterin cofactor (molybdenum cofactor, MoCo) and flavin adenine dinucleotide for their catalytic activity. Aldehyde oxidases have broad substrate specificity and catalyse the hydroxylation of N-heterocycles and the oxidation of aldehydes to the corresponding acid. In humans, a single aldehyde oxidase gene (AOX1) and two pseudogenes clustering on a short stretch of chromosome 2q are known. In other mammals, a variable number of structurally conserved aldehyde oxidase genes has been described. Four genes (Aox1, Aox3, Aox4 and Aox3l1), coding for an equivalent number of catalytically active enzymes, are present in the mouse and rat genomes. Although human AOX1 and its homologous proteins are best known as drug metabolising enzymes, the physiological substrate(s) and function(s) are as yet unknown. The present paper provides an update of the available information on the evolutionary history, tissue- and cell-specific distribution and function of mammalian aldehyde oxidases. PMID:20038499

2009-01-01

42

Terminal Oxidase Diversity and Function in “Metallosphaera yellowstonensis”: Gene Expression and Protein Modeling Suggest Mechanisms of Fe(II) Oxidation in the Sulfolobales? †  

PubMed Central

“Metallosphaera yellowstonensis” is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b558/566, several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores. PMID:21239558

Kozubal, M. A.; Dlaki?, M.; Macur, R. E.; Inskeep, W. P.

2011-01-01

43

A putative multicopper protein secreted by an atypical type II secretion system involved in the  

E-print Network

of a variety of sedimentary environments (Lovley, 2000). Micro-organisms growing via Fe(III) reduc- tion(III)-reducing micro- organisms in a diversity of sedimentary environments in which Fe(III) reduction is an important for a multicopper oxidase-like protein in an anaerobic organism. These results further emphasize the importance

Lovley, Derek

44

A tobacco flower-specific gene encodes a polyphenol oxidase  

Microsoft Academic Search

Identification of pistil-expressed genes is an important step in understanding pistil development and function in plant reproduction. A tobacco stigma\\/style cDNA library was differentially screened and several cDNA clones were isolated. One of these tobacco genes, designated tobP1, is characterized here. TobP1 encodes a protein highly homologous to plant polyphenol oxidases. Northern blot analysis of total RNA extracted from different

Maria Helena S. Goldman; Jef Seurinck; Mozart Marins; Gustavo H. Goldman; Celestina Mariani

1998-01-01

45

Lysyl Oxidase ( Lox ) Gene Deficiency Affects Osteoblastic Phenotype  

Microsoft Academic Search

Lysyl oxidase (LOX) catalyzes cross-linking of elastin and collagen, which is essential for the structural integrity and function\\u000a of bone tissue. The present study examined the role of Lox gene deficiency for the osteoblast phenotype in primary calvarial osteoblasts from E18.5 Lox knockout (Lox\\u000a \\u000a ?\\/?\\u000a ) and wild type (wt) (C57BL\\/6) mice. Next to Lox gene depletion, mRNA expression of

N. Pischon; J. M. Mäki; P. Weisshaupt; N. Heng; A. H. Palamakumbura; P. N’Guessan; A. Ding; R. Radlanski; H. Renz; T. A. L. J. J. Bronckers; J. Myllyharju; A. M. Kielbassa; B. M. Kleber; J.-P. Bernimoulin; P. C. Trackman

2009-01-01

46

Cloning and sequencing of rabbit leukocyte NADPH oxidase genes reveals a unique p67phox homolog  

Microsoft Academic Search

The NADPH oxidase plays an impor- tant role in immune and nonimmune cell functions. Because rabbits represent an established model for studying a number of important disease processes that involve NADPH oxidase activity, we carried out studies to clone and sequence all five rabbit leukocyte NADPH oxidase genes. Comparison of the rabbit sequences with those of other species showed that,

Katherine A. Gauss; Patrice L. Mascolo; Daniel W. Siemsen; Laura K. Nelson; Peggy L. Bunger; Patrick J. Pagano; Mark T. Quinn

47

Molecular evolution of the polyamine oxidase gene family in Metazoa  

PubMed Central

Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS) mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO) and orthologous genes related by speciation events (PAOs, SMOs/APAOs). Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies. PMID:22716069

2012-01-01

48

Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20Oxidase Gene  

Microsoft Academic Search

We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2-35S-V). The transgenic plants in which the pumpkin gene

Tomoya Niki; Takaaki Nishijima; Masayoshi Nakayama; Tamotsu Hisamatsu; Naomi Oyama-Okubo; Hiroko Yamazaki; Peter Hedden; Theo Lange; Lewis N. Mander; Masaji Koshioka

2001-01-01

49

Characterization of a laccase gene from the white-rot fungus Trametes versicolor and structural features of basidiomycete laccases  

Microsoft Academic Search

A gene coding for the multi-copper phenol oxidase laccase has been isolated from the white-rot basidiomycete Trametes oersicolor. The gene, which is preceded by a TATA box and a pyrimidine-rich region, is predicted to contain ten introns. The mature translation product, preceded by a 22-residue signal peptide, should consist of 498 residues. Comparisons with Edman degradation data of peptides from

Leif Jönsson; Kjell Sjöström; Ingrid Häggström; Per Olof Nyman

1995-01-01

50

Molecular cloning and expression analysis of a cytokinin oxidase (DhCKX) gene in Dendrobium huoshanense  

Microsoft Academic Search

Cytokinin oxidase plays an important role in the cytokinins regulatory processes. A putative cytokinin oxidase gene, D\\u000a endrobium\\u000a h\\u000a uoshanense\\u000a cytokinin oxidase (DhCKX), was cloned by reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) of total\\u000a RNA isolated from shoot apices of D. huoshanense plantlets in the presence of 20 ?mol l?1 6-benzylamino-purine (BAP). The full-length cDNA contains

Ying Wang; Jian-Ping Luo; Zhao-Jun Wei; Jing-Cheng Zhang

2009-01-01

51

Common polymorphisms in human lysyl oxidase genes are not associated with the adolescent idiopathic scoliosis phenotype  

Microsoft Academic Search

Background  Although adolescent idiopathic scoliosis affects approximately 3% of adolescents, the genetic contributions have proven difficult\\u000a to identify. Work in model organisms, including zebrafish, chickens, and mice, has implicated the lysyl oxidase family of\\u000a enzymes in the development of scoliosis. We hypothesized that common polymorphisms in the five human lysyl oxidase genes (LOX, LOXL1, LOXL2, LOXL3, and LOXL4) may be associated

Tracy L McGregor; Christina A Gurnett; Matthew B Dobbs; Carol A Wise; Jose A Morcuende; Thomas M Morgan; Ramkumar Menon; Louis J Muglia

2011-01-01

52

Increased Septoria musiva resistance in transgenic hybrid poplar leaves expressing a wheat oxalate oxidase gene  

Microsoft Academic Search

A cDNA clone of a wheat germin-like oxalate oxidase (OxO) gene regulated by the constitutive CaMV 35S promoter was expressed in a hybrid poplar clone, Populus × euramericana (`Ogy'). Previous studies showed that OxO is likely to play an important role in several aspects of plant development, stress response, and defense against pathogens. In order to study this wheat oxalate oxidase

Haiying Liang; Charles A. Maynard; Randy D. Allen; William A. Powell

2001-01-01

53

Two peanut germin-like genes and the potential superoxidase dismutase and oxalate oxidase activities  

Technology Transfer Automated Retrieval System (TEKTRAN)

Germins and germin-like proteins (GLPs) genes are members of large multigene families. These genes have been reported to play a role directly or indirectly in plant defense response. A number of GLPs have been demonstrated to have superoxidase dismutase (SOD) or oxalate oxidase (OxO) activity leadin...

54

The expression of lysyl-oxidase gene family members in myeloproliferative neoplasms.  

PubMed

Myeloproliferative neoplasms (MPNs) are malignant disorders originating from clonal expansion of a single neoplastic stem cell and characteristically show an increase in bone marrow reticulin fibers. Lysyl oxidases (LOXs) are copper-dependent amine oxidases that play a critical role in the biogenesis of connective tissue by crosslinking extracellular matrix proteins, collagen and elastin. Expression of LOX gene family members is increased in disorders associated with increased fibrosis. To evaluate involvement of LOX gene family in various MPNs. In-situ hybridization was used to detect Lysyl-Oxidase family members in bone marrow biopsies from patients with different MPNs. We compared normal bone marrows and those from patients with polycythemia vera, essential thrombocythemia, chronic myeloid leukemia, and primary myelofibrosis (PMF). Serum levels of lysyl-oxidase from patients with PMF and healthy controls were also examined. LOX gene family was not detected in normal bone marrows. All members of the LOX gene family were over expressed in PMF. In other MPNs a differential pattern of expression was observed. Differences in gene expression were statistically significant (P < 0.010). The medianserum LOX levels in normal controls was 28.4 ± 2.5 ng\\ml and 44.6 ± 9.44 ng\\ml in PMF (P = 0.02). The varying pattern of expression of LOX genes may reflect differences in the pathophysiology of bone marrow fibrosis in these MPNs. These observations could be used as the basis for future targeted therapy directed against bone marrow fibrosis. PMID:23494965

Tadmor, T; Bejar, J; Attias, D; Mischenko, E; Sabo, E; Neufeld, G; Vadasz, Z

2013-05-01

55

Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species  

Technology Transfer Automated Retrieval System (TEKTRAN)

Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

56

Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

57

Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

58

Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities  

ERIC Educational Resources Information Center

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

59

Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings  

Microsoft Academic Search

The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript

Simon Barak; Ali Nejidat; Yair Heimer; Micha Volokita

2001-01-01

60

Molecular Phylogeny of the Chipmunks Inferred from Mitochondrial Cytochrome b and Cytochrome Oxidase II Gene Sequences  

Microsoft Academic Search

There are currently 25 recognized species of the chipmunk genus Tamias. In this study we sequenced the complete mitochondrial cytochrome b (cyt b) gene of 23 Tamias species. We analyzed the cyt b sequence and then analyzed a combined data set of cyt b along with a previous data set of cytochrome oxidase subunit II (COII) sequence. Maximum-likelihood was used

Antoinette J. Piaggio; Greg S. Spicer

2001-01-01

61

Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression  

Technology Transfer Automated Retrieval System (TEKTRAN)

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

62

Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene  

PubMed Central

We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-?). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

2001-01-01

63

Characterization of two peanut oxalate oxidase genes and development of peanut cultivars resistant to stem rot (Sclerotium rolfsii)  

Technology Transfer Automated Retrieval System (TEKTRAN)

In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

64

NADPH oxidase activity and cytochrome b558 content of human Epstein-Barr-virus-transformed B lymphocytes correlate with expression of genes encoding components of the oxidase system.  

PubMed

We investigated the NADPH oxidase activity, cytochrome b558 content, and gene expression of gp91-phox and p47-phox in normal Epstein-Barr-virus (EBV)-transformed B lymphocytes, compared to EBV-transformed B lymphocytes from patients with X-linked chronic granulomatous disease (CGD), normal peripheral blood neutrophils or mononuclear cells, and the A301 or C8166 lymphoblastoid cell lines. CGD phenotypes included both "classic" disease with no detectable gp91-phox protein (termed X91(0)) and "variant" phenotype with reduced but detectable gp91-phox protein (X91(-)). Normal EBV-transformed B lymphocytes show a dose-dependent PMA-induced superoxide release. Culturing these cells with IFN-gamma (100 U/ml) and TNF-alpha (1000 U/ml), alone or in combination for 7 days, caused a modest increase in their NADPH oxidase activity (P > 0.05 in all situations). Normal EBV-transformed B lymphocytes have lower NADPH oxidase activity and cytochrome b558 content than peripheral blood neutrophils or mononuclear cells (P < 0.05 in all situations). In contrast, they have higher NADPH oxidase activity and cytochrome b558 content than X91(-) CGD EBV-transformed B lymphocytes (P < 0.05 in all situations). A301 or C8166 lymphoblastoid cell lines and X91(0) CGD EBV-transformed B lymphocytes have barely detectable NADPH oxidase activity or cytochrome b558 content (P < 0.05 in all situations). Gene expression studies also show a modest increase in expression and transcription rates of gp91-phox and p47-phox genes in normal EBV-transformed B cells cultured with IFN-gamma (100 U/ml) and TNF-alpha (1000 U/ml), alone or in combination for 7 days. We conclude that NADPH oxidase activity and cytochrome b558 content correlate with gp91-phox and p47-phox gene expression in EBV-transformed B lymphocytes. PMID:9851826

Condino-Neto, A; Newburger, P E

1998-12-15

65

In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes  

PubMed Central

NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.

2014-01-01

66

The SLENDER Gene of Pea Encodes a Gibberellin 2Oxidase1  

Microsoft Academic Search

The amount of active gibberellin (GA) in plant tissues is deter- mined in part by its rate of catabolism through oxidation at C-2. In pea (Pisum sativum L.) seeds, GA 2-oxidation is controlled by the SLN (SLENDER) gene, a mutation of which produces seedlings characterized by a slender or hyper-elongated phenotype. We cloned a GA 2-oxidase cDNA from immature pea

David N. Martin; William M. Proebsting; Peter Hedden

1999-01-01

67

Cloning and in situ expression studies of the Hydrogenobaculum arsenite oxidase genes.  

PubMed

Novel arsenite [As(III)] oxidase structural genes (aoxAB) were cloned from Hydrogenobaculum bacteria isolated from an acidic geothermal spring. Reverse transcriptase PCR demonstrated expression throughout the outflow channel, and the aoxB cDNA clones exhibited distribution patterns relative to the physicochemical gradients in the spring. Microelectrode analyses provided evidence of quantitative As(III) transformation within the microbial mat. PMID:19304831

Clingenpeel, Scott R; D'Imperio, Seth; Oduro, Harry; Druschel, Greg K; McDermott, Timothy R

2009-05-01

68

PapilioPhylogeny Based on Mitochondrial Cytochrome Oxidase I and II Genes  

Microsoft Academic Search

Butterflies of the genusPapiliohave served as the basis for numerous studies in insect physiology, genetics, and ecology. However, phylogenetic work on relationships among major lineages in the genus has been limited and inconclusive. We have sequenced 2.3 kb of DNA from the mitochondrial cytochrome oxidase I and II genes (COI and COII) for 23Papiliotaxa and two outgroups,Pachliopta neptunusandEurytides marcellus,in order

Michael S. Caterino; Felix A. H. Sperling

1999-01-01

69

Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

70

Expression of Phanerochaete chrysosporium genes encoding lignin peroxidases, manganese peroxidases, and glyoxal oxidase in wood  

SciTech Connect

Lignin depolymerization is catalyzed by extracellular enzymes of white rot basidiomycetes such as Phanerochaete chrysosporium. Major components of this system include lignin peroxidases, manganese-dependent lignin peroxidases, and a peroxide-generating enzyme, glyoxal oxidase. Expression of Phanerochaete chrysosporium genes encoding ligninolytic enzymes was assessed in wood. Poly(A) RNA was extracted from colonized wood chips by magnetic capture, and specific transcripts were quantified by competitive reverse transcriptase PCR. mRNA levels varied substantially among lignin peroxidase genes, and transcript patterns were dramatically different from those in previous studies with defined media.

Janse, B.J.H. [Univ. of Stellenbosch (South Africa). Dept. of Microbiology; Gaskell, J.; Cullen, D. [Forest Products Lab., Madison, WI (United States). Inst. of Microbial and Biochemical Technology; Akhtar, M. [Forest Products Lab., Madison, WI (United States). Inst. of Microbial and Biochemical Technology]|[Univ of Wisconsin, Madison, WI (United States). Biotechnology Center

1998-09-01

71

Semidwarf (sd-1), “green revolution” rice, contains a defective gibberellin 20-oxidase gene  

PubMed Central

The introduction of semidwarf rice (Oryza sativa L.) led to record yield increases throughout Asia in the 1960s. The major semidwarfing allele, sd-1, is still extensively used in modern rice cultivars. The phenotype of sd-1 is consistent with dwarfism that results from a deficiency in gibberellin (GA) plant growth hormones. We propose that the semidwarf (sd-1) phenotype is the result of a deficiency of active GAs in the elongating stem arising from a defective 20-oxidase GA biosynthetic enzyme. Sequence data from the rice genome was combined with previous mapping studies to locate a putative GA 20-oxidase gene (Os20ox2) at the predicted map location of sd-1 on chromosome 1. Two independent sd-1 alleles contained alterations within Os20ox2: a deletion of 280 bp within the coding region of Os20ox2 was predicted to encode a nonfunctional protein in an indica type semidwarf (Doongara), whereas a substitution in an amino acid residue (Leu-266) that is highly conserved among dioxygenases could explain loss of function of Os20ox2 in a japonica semidwarf (Calrose76). The quantification of GAs in elongating stems by GC-MS showed that the initial substrate of GA 20-oxidase activity (GA53) accumulated, whereas the content of the major product (GA20) and of bioactive GA1 was lower in semidwarf compared with tall lines. We propose that the Os20ox2 gene corresponds to the sd-1 locus. PMID:12077303

Spielmeyer, Wolfgang; Ellis, Marc H.; Chandler, Peter M.

2002-01-01

72

The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.  

PubMed Central

Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

Szuplewski, S; Terracol, R

2001-01-01

73

The human protoporphyrinogen oxidase gene (PPOX): Organization and location to chromosome 1  

SciTech Connect

We determined the structure of the human protoporphyrinogen oxidase (PPOX) gene after isolation and characterization of lambda phage clones mapping discrete regions of the cDNA. Southern blotting of human genomic DNA showed that there is a single copy of the PPOX gene, and fluorescence in situ hybridization to metaphase chromosomes mapped the gene to region 1q22. The gene has 13 exons and about 8 kb. The exon intron boundary sequences conform to consensus acceptor (GTn) and donor (nAG) sequences, and exons in the gene appear to encode functional protein domains. Primer extension analysis revealed two major transcriptional initiation sites in a region with sequence motifs characteristic of a promoter. The promoter region contains multiple Sp1 elements, CCAAT boxes, and potential GATA-1 binding sites. Mapping of the 5{prime} end PPOX mRNA by polymerase chain reaction indicated that there are the same transcripts in erythroid and nonerythroid cells. 23 refs., 5 figs., 1 tab.

Taketani, Shigeru; Furukawa, Takako; Kohno, Hirao; Tokunaga, Rikio [Kansai Medical Univ., Osaka (Japan)] [and others

1995-10-10

74

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)  

PubMed Central

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

75

The LOXL2 Gene Encodes a New Lysyl Oxidase-like Protein and Is Expressed at High Levels in Reproductive Tissues*  

E-print Network

The LOXL2 Gene Encodes a New Lysyl Oxidase-like Protein and Is Expressed at High Levels the complete cDNA sequence, gene structure, and tissue-specific expression of LOXL2, a new amine oxidase, and LOXL2 genes that also maintained exon-intron structure con- servation. In contrast, six exons encoding

Bryant-Greenwood, Gillian D.

76

Enhancing resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene.  

PubMed

Sclerotinia minor Jagger is the causal agent of Sclerotinia blight, a highly destructive disease of peanut (Arachis hypogaea). Based on evidence that oxalic acid is involved in the pathogenicity of many Sclerotinia species, our objectives were to recover transgenic peanut plants expressing an oxalic acid-degrading oxalate oxidase and to evaluate them for increased resistance to S. minor. Transformed plants were regenerated from embryogenic cultures of three Virginia peanut cultivars (Wilson, Perry, and NC-7). A colorimetric enzyme assay was used to screen for oxalate oxidase activity in leaf tissue. Candidate plants with a range of expression levels were chosen for further analysis. Integration of the transgene was confirmed by Southern-blot analysis, and gene expression was demonstrated in transformants by northern-blot analysis. A sensitive fluorescent enzyme assay was used to quantify expression levels for comparison to the colorimetric protocol. A detached leaflet assay tested whether transgene expression could limit lesion size resulting from direct application of oxalic acid. Lesion size was significantly reduced in transgenic plants compared to nontransformed controls (65%-89% reduction at high oxalic acid concentrations). A second bioassay examined lesion size after inoculation of leaflets with S. minor mycelia. Lesion size was reduced by 75% to 97% in transformed plants, providing evidence that oxalate oxidase can confer enhanced resistance to Sclerotinia blight in peanut. PMID:15778458

Livingstone, D Malcolm; Hampton, Jaime L; Phipps, Patrick M; Grabau, Elizabeth A

2005-04-01

77

Identification and isolation of the cytochrome oxidase subunit II gene in mitochondria of the yeast Hansenula saturnus  

Microsoft Academic Search

Mitochondrial DNA from the petite negative yeast Hansenula saturnus has been isolated and sized by digestion with restriction enzymes. The size of the mitochondrial genome is approximately 47 kb. The gene for subunit II of cytochrome oxidase was localized in the genome by Southern blotting using a [32P]-labeled probe containing the subunit II gene of the yeast Saccharomyces cerevisiae. The

Janet E. Lawson; Donald W. Deters

1985-01-01

78

Characterization of Rice NADPH Oxidase Genes and Their Expression under Various Environmental Conditions  

PubMed Central

Plasma membrane NADPH oxidases (Noxs) are key producers of reactive oxygen species under both normal and stress conditions in plants. We demonstrate that at least eleven genes in the genome of rice (Oryza sativa L.) were predicted to encode Nox proteins, including nine genes (OsNox1–9) that encode typical Noxs and two that encode ancient Nox forms (ferric reduction oxidase 1 and 7, OsFRO1 and OsFRO7). Phylogenetic analysis divided the Noxs from nine plant species into six subfamilies, with rice Nox genes distributed among subfamilies I to V. Gene expression analysis using semi-quantitative RT-PCR and real-time qRT-PCR indicated that the expression of rice Nox genes depends on organs and environmental conditions. Exogenous calcium strongly stimulated the expression of OsNox3, OsNox5, OsNox7, and OsNox8, but depressed the expression of OsFRO1. Drought stress substantially upregulated the expression of OsNox1–3, OsNox5, OsNox9, and OsFRO1, but downregulated OsNox6. High temperature upregulated OsNox5–9, but significantly downregulated OsNox1–3 and OsFRO1. NaCl treatment increased the expression of OsNox2, OsNox8, OsFRO1, and OsFRO7, but decreased that of OsNox1, OsNox3, OsNox5, and OsNox6. These results suggest that the expression profiles of rice Nox genes have unique stress-response characteristics, reflecting their related but distinct functions in response to different environmental stresses. PMID:23629674

Wang, Gang-Feng; Li, Wen-Qiang; Li, Wen-Yan; Wu, Guo-Li; Zhou, Cong-Yi; Chen, Kun-Ming

2013-01-01

79

Identification of forensically important Sarcophagidae (Diptera) based on partial mitochondrial cytochrome oxidase I and II genes.  

PubMed

Entomological evidence is of great importance in forensic cases for postmortem interval calculation. The use of Sarcophagidae (Diptera) for postmortem interval estimation is limited because morphological determination is often hampered because of similar characteristics in the larval, pupal, and even adult stage. To make the species identification more accurate and reliable, DNA-based identification is considered. In this study, we assessed the use of partial mitochondrial cytochrome oxidase I and II genes for discrimination of forensically important Sarcophagidae from Egypt and China [Sarcophaga argyrostoma (Robineau-Desvoidy), Sarcophaga dux (Thomson), Sarcophaga albiceps (Meigen), and Wohlfahrtia nuba (Wiedemann)]. This region was amplified using polymerase chain reaction followed by direct sequencing of the amplification products and using restriction enzymes HinfI and MfeI. Nucleotide sequence divergences were calculated using the Kimura 2-parameter distance model, and a neighbor-joining phylogenetic tree was generated. All examined specimens were assigned to the correct species. Combinations of the restriction enzymes HinfI and MfeI provide different restriction fragment length polymorphism profiles even among 3 sympatric species that belong to the Sarcophaga genus. Therefore, this study demonstrates that the studied partial mitochondrial cytochrome oxidase I and II genes were found to be instrumental for the molecular identification of these forensically important flesh fly species. PMID:23629402

Aly, Sanaa Mohamed; Wen, Jifang; Wang, Xiang

2013-06-01

80

Differential activation of two ACC oxidase gene promoters from melon during plant development and in response to pathogen attack  

Microsoft Academic Search

ACC (1-aminocyclopropane-1-carboxylate) oxidase genes are differentially expressed in melon during development and in response\\u000a to various stresses. We investigated the molecular basis of their transcription by analyzing the 5? untranslated regions of\\u000a the ACC oxidase genes CM-ACO1 and CM-ACO3. In order to determine how their temporal and spatial expression patterns were established, we fused the promoter regions\\u000a of CM-ACO1 (726?bp)

E. Lasserre; F. Godard; T. Bouquin; J. A. Hernandez; J.-C. Pech; D. Roby; C. Balagué

1997-01-01

81

Bd oxidase homologue of photosynthetic purple sulfur bacterium Allochromatium vinosum is co-transcribed with a nitrogen fixation related gene.  

PubMed

Purple sulfur bacteria, which are known to be the most ancient among anoxygenic phototrophs, play an important role in the global sulfur cycle. Allochromatium vinosum oxidizes reduced sulfur compounds such as hydrogen sulfide, elemental sulfur and thiosulfide. At low oxygen concentrations, A. vinosum can grow chemotrophically using oxygen as the terminal electron acceptor. Being also a nitrogen fixer, A. vinosum is faced with the paradox of co-existence of aerobic metabolism and nitrogen fixation. Due to growth difficulties, only a few studies have dealt with the aerobic metabolism of the organism and, until now, there has been no information about the genes involved in the respiratory metabolism of purple sulfur bacteria. In this article we show the first terminal oxidase gene for A. vinosum. The presence of a Bd type of quinol oxidase is necessary to protect nitrogenases against the inhibitory effects of oxygen. In this case, a nitrogen fixation related gene is part of the cyd operon and this gene is co-transcribed with cydAB genes. Bd oxidase of A. vinosum may be the earliest form of oxidase where the function of the enzyme is to scavenge the contaminant oxygen during nitrogen fixation. This may be an important clue about the early evolution of oxygenic photosynthesis, perhaps as a protective mechanism for nitrogen fixation. PMID:20577808

Dincturk, H Benan; Demir, Volkan; Aykanat, Tutku

2011-02-01

82

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings  

PubMed Central

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-?1, -?2, -?1, and -?, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-?1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-? 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

Jakubowicz, Ma?gorzata; Ga?ga?ska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

83

Identification of a p53-response element in the promoter of the proline oxidase gene  

SciTech Connect

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

Maxwell, Steve A. [Department of Molecular and Cellular Medicine, Room 252, College of Medicine, Texas A and M Health Science Center, College Station, TX 77843-1114 (United States)], E-mail: smaxwell@medicine.tamhsc.edu; Kochevar, Gerald J. [Department of Pathology and Laboratory Medicine, College of Medicine, Texas A and M Health Science Center, College Station, TX 77843-1114 (United States)

2008-05-02

84

Monoamine Oxidase A Gene Polymorphisms and Bipolar Disorder in Iranian Population  

PubMed Central

Background: Bipolar disorder (BPD) is a common and severe mood disorder. Although genetic factors have important rolesin the etiology of bipolar disorder, no specific gene has been identified in relation to this disorder. Monoamine oxidase gene is suggested to be associated with bipolar disorder in many studies. Objectives: This study aimed to investigatethe role of MAOA gene polymorphisms in the etiology of bipolar disorder in Iranian population. Patients and Methods: This study is a case-control study, with convenient sampling. Three common polymorphisms, a CA microsatellite, a VNTR, and a RFLP were typed in 156 bipolar patients and 173 healthy controls. Patients were chosen from Imam Hossein General Hospital, Psychiatry Ward (Tehran/Iran). Controlsamples for this study consisted of 173 healthy individuals recruitedby convenient sampling. Allelic distributions of these polymorphisms were analyzed in bipolar and control groups to investigate any association with MAOA gene. Results: Significant associations were observed regarding MAOA-CA (P = 0.016) and MAOA-VNTR (P = 0.004) polymorphisms in the bipolar females. There was no association between MAOA-RFLP and bipolar disorder. Conclusions: The obtained results confirm some previous studies regardinga gender specific association of MAOA gene with the bipolar disorder.

Eslami Amirabadi, Mohammad Reza; Rajezi Esfahani, Sepideh; Davari-Ashtiani, Rozita; Khademi, Mojgan; Emamalizadeh, Babak; Movafagh, Abolfazl; Sadr, Said; Arabgol, Fariba; Darvish, Hossein; Razjoyan, Katayoon

2015-01-01

85

Chromosome conformation capture of transcriptional interactions between cytochrome c oxidase genes and genes of glutamatergic synaptic transmission in neurons.  

PubMed

Neuronal activity and energy metabolism are tightly coupled processes. Recently, we found that nuclear respiratory factor 1 co-regulates all subunits of cytochrome c oxidase (COX, representing oxidative energy metabolism) and glutamatergic neurochemicals, including NR1 (Grin1) and NR2B (Grin2b) of NMDA receptors, GluR2 (Gria2) of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, and neuronal nitric oxide synthase (Nos1). Moreover, all 10 nuclear-encoded COX subunit genes and three transcription factor genes for the three mitochondrial-encoded COX subunits are transcribed in the same transcription factory. The goal of the present study was to test our hypothesis that genomic loci for Grin1, Grin2b, Gria2, and Nos1 interact with those for COX at the transcriptional level. By means of chromosome conformation capture, interactions were found among all of these genes in neurons, but not in C2C12 muscle cells. COX subunit genes also did not interact with neurochemical genes not regulated by nuclear respiratory factor 1, nor with genes for calreticulin, a non-mitochondrial protein. Depolarizing stimulation up-regulated interaction frequencies between COX and neurochemical genes, whereas impulse blockade with tetrodotoxin or inhibition of COX with KCN down-regulated them in neurons. Thus, an efficient mechanism is in place for coordinating the transcriptional coupling of energy metabolism and glutamatergic neurotransmission at the molecular level in neurons. PMID:21064266

Dhar, Shilpa S; Wong-Riley, Margaret T T

2010-11-01

86

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion  

PubMed Central

Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on primary sequence data. The dynamic nature of this gene family differentiates PPO from other oxidative enzymes, and is consistent with a protein important for a diversity of functions relating to environmental adaptation. PMID:22897796

2012-01-01

87

Association Study of a Monoamine Oxidase A Gene Promoter Polymorphism with Major Depressive Disorder and Antidepressant Response  

Microsoft Academic Search

Monoamine oxidase A (MAOA), a mitochondrial enzyme involved in the degradation of biogenic amines, may be implicated in the pathogenesis of major depressive disorder (MDD) and be related to the therapeutic effects of antidepressants. To elucidate a genetic predisposition of MDD, we studied a variable-number-tandem-repeat (VNTR) polymorphism in the promoter region of the MAOA gene in a Chinese population of

Younger W-Y Yu; Shih-Jen Tsai; Chen-Jee Hong; Tai-Jui Chen; Ming-Chao Chen; Chih-Wei Yang; T-J Chen

2005-01-01

88

Regulated expression of a wheat germin gene in tobacco: oxalate oxidase activity and apoplastic localization of the heterologous protein  

Microsoft Academic Search

Wheat (Triticum aestivum) germin is a homopentameric glycoprotein whose synthesis is allied with seed germination. Germin pentamers show an unusual resistance to dissociation and possess an oxalate oxidase (OxO) activity. In order to increase our knowledge of germin gene expression, the function(s) of germin during development and possible uses in plant genetic engineering, an in vivo expression system is required.

Anne Berna; François Bernier

1997-01-01

89

Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A  

SciTech Connect

Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

Brunner, H.G. (Univ. Hospital, Nijmegan (Netherlands)); Nelen, M.; Ropers, H.H.; van Oost, B.A. (Univ. Hospital Nijmegen (Netherlands))

1993-10-22

90

Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover ( Trifolium pratense L.).  

PubMed

Polyphenol oxidase (PPO) genes and their corresponding enzyme activities occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activities in Arabidopsis and five legumes were compared with those of high-PPO red clover ( Trifolium pratense L.). Red clover PPO enzyme activity decreased leaves > stem > nodules > peduncle = petiole > embryo; PPO1 and PPO4 genes were expressed early in leaf emergence, whereas PPO4 and PPO5 predominated in mature leaves. PPO1 was expressed in embryos and nodules. PPO substrates, phaselic acid and clovamide, were detected in leaves, and clovamide was detected in nodules. Phaselic acid and clovamide, along with caffeic and chlorogenic acids, were suitable substrates for PPO1, PPO4, and PPO5 genes expressed in alfalfa ( Medicago sativa L.) leaves. PPO enzyme presence and activity were colocalized in leaves and nodules by cytochemistry. Substrates and PPO activity were localized in developing squashed cell layer of nodules, suggesting PPO may have a developmental role in nodules. PMID:23790148

Webb, K Judith; Cookson, Alan; Allison, Gordon; Sullivan, Michael L; Winters, Ana L

2013-08-01

91

A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7  

PubMed Central

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s?1) and nicotine (Km = 2.03 mM, kcat = 0.396 s?1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

2014-01-01

92

Cytokinin Oxidase Gene Expression in Maize Is Localized to the Vasculature, and Is Induced by Cytokinins, Abscisic Acid, and Abiotic Stress  

PubMed Central

Cytokinins are hormones that play an essential role in plant growth and development. The irreversible degradation of cytokinins, catalyzed by cytokinin oxidase, is an important mechanism by which plants modulate their cytokinin levels. Cytokinin oxidase has been well characterized biochemically, but its regulation at the molecular level is not well understood. We isolated a cytokinin oxidase open reading frame from maize (Zea mays), called Ckx1, and we used it as a probe in northern and in situ hybridization experiments. We found that the gene is expressed in a developmental manner in the kernel, which correlates with cytokinin levels and cytokinin oxidase activity. In situ hybridization with Ckx1 and transgenic expression of a transcriptional fusion of the Ckx1 promoter to the Escherichia coli ?-glucuronidase reporter gene revealed that the gene is expressed in the vascular bundles of kernels, seedling roots, and coleoptiles. We show that Ckx1 gene expression is inducible in various organs by synthetic and natural cytokinins. Ckx1 is also induced by abscisic acid, which may control cytokinin oxidase expression in the kernel under abiotic stress. We hypothesize that under non-stress conditions, cytokinin oxidase in maize plays a role in controlling growth and development via regulation of cytokinin levels transiting in the xylem. In addition, we suggest that under environmental stress conditions, cytokinin oxidase gene induction by abscisic acid results in aberrant degradation of cytokinins therefore impairing normal development. PMID:12857805

Brugière, Norbert; Jiao, Shuping; Hantke, Sabine; Zinselmeier, Chris; Roessler, Jeffrey A.; Niu, Xiaomu; Jones, Robert J.; Habben, Jeffrey E.

2003-01-01

93

Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.  

PubMed

In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions. PMID:20840600

Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

2010-11-01

94

Engineering gibberellin metabolism in Solanum nigrum L. by ectopic expression of gibberellin oxidase genes.  

PubMed

Gibberellins (GAs) control many aspects of plant development, including seed germination, shoot growth, flower induction and growth and fruit expansion. Leaf explants of Solanum nigrum (Black Nightshade; Solanaceae) were used for Agrobacterium-mediated delivery of GA-biosynthetic genes to determine the influence of their encoded enzymes on the production of bioactive GAs and plant stature in this species. Constructs were prepared containing the neomycin phosphotransferase (nptII) gene for kanamycin resistance as a selectable marker, and the GA-biosynthetic genes, their expression under the control of the CaMV 35S promoter. The GA-biosynthetic genes comprised AtGA20ox1, isolated from Arabidopsis thaliana, the product from which catalyses the formation of C(19)-GAs, and MmGA3ox1 and MmGA3ox2, isolated from Marah macrocarpus, which encode functionally different GA 3-oxidases that convert C(19)-GAs to biologically active forms. Increase in stature was observed in plants transformed with AtGA20ox1, MmGA3ox2 and MmGA3ox1 + MmGA3ox2, their presence and expression being confirmed by PCR and RT-PCR, respectively, accompanied by an increase in GA(1) content. Interestingly, MmGA3ox1 alone did not induce a sustained increase in plant height, probably because of only a marginal increase in bioactive GA(1) content in the transformed plants. The results are discussed in the context of regulating plant stature, since this strategy would decrease the use of chemicals to promote plant growth. PMID:22238061

Bhattacharya, A; Ward, D A; Hedden, P; Phillips, A L; Power, J B; Davey, M R

2012-05-01

95

The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene.  

PubMed

The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

Clem, Stian A; Wu, Wenbi; Passarelli, A Lorena

2014-07-01

96

Genetic modification of the Streptomyces cholesterol oxidase gene for expression in Escherichia coli and development of promoter-probe vectors for use in enteric bacteria  

Microsoft Academic Search

Streptomyces cholesterol oxidase was produced in Escherichia coli by a modification of the cholesterol oxidase gene (choA?) in which the native codons for the precursor NH2-terminal region and the ribosome binding site were substituted for those favored by E. coli. The choA? gene was expressed under the control of the lac or tac promoter in a multiple copy plasmid vector,

Nobuhiko Nomura; Kwang-Pil Choi; Mitsuo Yamashita; Hiroko Yamamoto; Yoshikatsu Murooka

1995-01-01

97

Decreased shoot stature and grain  -amylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat  

Microsoft Academic Search

Ectopic expression of a gibberellin 2-oxidase gene (PcGA2ox1) decreased the content of bioactive gibber- ellins (GAs) in transgenic wheat, producing a range of dwarf plants with different degrees of severity. In at least one case, a single transformation event gave rise to T1 plants with different degrees of dwarfism, the pheno- types being stably inherited over at least four genera-

Nigel E. J. Appleford; Mark D. Wilkinson; Qian Ma; Daniel J. Evans; Marlon C. Stone; Stephen P. Pearce; Stephen J. Powers; Stephen G. Thomas; Huw D. Jones; Andrew L. Phillips; Peter Hedden; John R. Lenton

2007-01-01

98

Mitochondrial DNA from a spider mite: isolation, restriction map and partial sequence of the cytochrome oxidase subunit I gene  

Microsoft Academic Search

Mitochondrial (mt) DNA of the phytophagous miteTetranychus urticae was purified and a restriction map was constructed. The 12.5 kb long genome is the shortest animal mtDNA known. A 564 bp clone comprising part of the gene for cytochrome oxidase subunit I was sequenced. As has been found in insects, the mitochondrial sequences of mites are extremely A+T rich (75% on

Didier Fournier; Jean Marc Bride; Maria Navajas

1994-01-01

99

Current issues in species identification for forensic science and the validity of using the cytochrome oxidase I (COI) gene  

Microsoft Academic Search

Species identification techniques commonly utilized in Australian Forensic Science laboratories are gel immunodifussion antigen\\u000a antibody reactions and hair comparison analysis. Both of these techniques have significant limitations and should be considered\\u000a indicative opinion based tests. The Barcode of Life Initiative aims to sequence a section of DNA (~648 base pairs) for the\\u000a Cytochrome Oxidase I mitochondrial gene (COI) in all

Linzi Wilson-Wilde; Janette Norman; James Robertson; Stephen Sarre; Arthur Georges

2010-01-01

100

Activation Tagging of a Dominant Gibberellin Catabolism Gene (GA 2-oxidase) from Poplar That Regulates Tree Stature  

Microsoft Academic Search

We identified a dwarf transgenic hybrid poplar (Populus tremula Populus alba) after screening of 627 independent activation-tagged transgenic lines in tissue culture, greenhouse, and field environments. The cause of the phenotype was a hyperactivated gene encoding GA 2-oxidase (GA2ox), the major gibberellin (GA) catabolic enzyme in plants. The mutation resulted from insertion of a strong transcriptional enhancer near the transcription

Victor B. Busov; Richard Meilan; David W. Pearce; Caiping Ma; Stewart B. Rood; Steven H. Strauss

2003-01-01

101

Three-dimensional organization of three-domain copper oxidases: A review  

NASA Astrophysics Data System (ADS)

“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Za?tsev, V. N.; Mikha?lov, A. M.

2008-01-01

102

Three-dimensional organization of three-domain copper oxidases: A review  

SciTech Connect

'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Zaitsev, V. N. [University of St. Andrews, Centre for Biomolecular Sciences (United Kingdom); Mikhailov, A. M. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

2008-01-15

103

Brd1 Gene in Maize Encodes a Brassinosteroid C-6 Oxidase  

PubMed Central

The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1–m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system. PMID:22292043

Makarevitch, Irina; Thompson, Addie; Muehlbauer, Gary J.; Springer, Nathan M.

2012-01-01

104

Restricted expression of NADPH oxidase/peroxidase gene (Duox) in zone VII of the ascidian endostyle.  

PubMed

The ascidian Ciona intestinalis, a marine invertebrate chordate, is an emerging model system for developmental and evolutionary studies. The endostyle, one of the characteristic organs of ascidians, is a pharyngeal structure with iodine-concentrating and peroxidase activities and is therefore considered to be homologous to the follicular thyroid of higher vertebrates. We have previously reported that a limited part of the endostyle (zone VII) is marked by the expression of orthologs of the thyroid peroxidase (TPO) and thyroid transcription factor-2 (TTF-2/FoxE) genes. In this study, we have identified the Ciona homolog of NADPH oxidase/peroxidase (Duox), which provides hydrogen peroxide (H(2)O(2)) for iodine metabolism by TPO in the vertebrate thyroid. Expression patterns assessed by in situ hybridization have revealed that Ciona Duox (Ci-Duox) is predominantly expressed in the dorsal part of zone VII of the endostyle. Furthermore, two-color fluorescent in situ hybridization with Ci-Duox and Ciona TPO (CiTPO) has revealed that the ventral boundary of the Ci-Duox domain of expression is more dorsal than that of CiTPO. We have also characterized several genes, such as Ci-Fgf8/17/18, 5HT7, and Ci-NK4, which are predominantly expressed in the ventral part of zone VII, in a region complementary to the Ci-Duox expression domain. These observations suggest that, at the molecular level, zone VII has a complex organization that might have some impact on the specification of cell types and functions in this thyroid-equivalent element of the ascidian endostyle. PMID:16823546

Hiruta, Jin; Mazet, Francoise; Ogasawara, Michio

2006-12-01

105

Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy.  

PubMed

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

Bongers, Kale S; Fox, Daniel K; Kunkel, Steven D; Stebounova, Larissa V; Murry, Daryl J; Pufall, Miles A; Ebert, Scott M; Dyle, Michael C; Bullard, Steven A; Dierdorff, Jason M; Adams, Christopher M

2015-01-15

106

Isolation and partial nucleotide sequence of the laccase gene from Neurospora crassa: amino acid sequence homology of the protein to human ceruloplasmin.  

PubMed

The laccase (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) gene from Neurospora crassa was cloned and part of its nucleotide sequence corresponding to the carboxyl-terminal region of the protein has been determined. The gene was cloned by cDNA synthesis with a laccase-specific synthetic deoxyundecanucleotide as primer and poly(A) RNA isolated from cycloheximide-treated N. crassa cultures as template. Based on the nucleotide sequence of the cDNA obtained, a unique 21-mer was synthesized and used to screen a genomic DNA library from N. crassa. Five different positive clones were isolated and shown to share an overlapping DNA region with the same pattern of restriction sites. Sequence analysis of the common 1.36-kilobase Sal I fragment revealed an open reading frame of 726 nucleotides. The amino acid sequence deduced is in complete agreement with the primary structures of several tryptic peptides isolated previously from N. crassa laccase. The analyzed carboxyl-terminal region of laccase exhibits a striking sequence homology to the carboxyl-terminal part of the third homology unit of the multicopper oxidase ceruloplasmin and to a smaller extent, to the low molecular weight blue copper proteins plastocyanin and azurin. Based on amino acid sequence comparison between these proteins, putative copper ligands of N. crassa laccase are proposed. Moreover, these data further support the hypothesis that the small blue copper proteins and the multicopper oxidases have evolved from the same ancestral gene. PMID:2947240

Germann, U A; Lerch, K

1986-12-01

107

Coordination of cytochrome c oxidase gene expression in the remodelling of skeletal muscle.  

PubMed

Many fish species respond to low temperature by inducing mitochondrial biogenesis, reflected in an increase in activity of the mitochondrial enzyme cytochrome c oxidase (COX). COX is composed of 13 subunits, three encoded by mitochondrial (mt)DNA and 10 encoded by nuclear genes. We used real-time PCR to measure mRNA levels for the 10 nuclear-encoded genes that are highly expressed in muscle. We measured mRNA levels in white muscle of three minnow species, each at two temperatures: zebrafish (Danio rerio) acclimated to 11 and 30°C, goldfish (Carassius auratus) acclimated to 4 and 35°C, and northern redbelly dace (Chrosomus eos) collected in winter and summer. We hypothesized that temperature-induced changes in COX activity would be paralleled by COX nuclear-encoded subunit transcript abundance. However, we found mRNA for COX subunits showed pronounced differences in thermal responses. Though zebrafish COX activity did not change in the cold, the transcript levels of four subunits decreased significantly (COX5A1, 60% decrease; COX6A2, 70% decrease; COX6C, 50% decrease; COX7B, 55% decrease). Treatments induced changes in COX activity in both dace (2.9 times in winter fish) and goldfish (2.5 times in cold fish), but the response in transcript levels was highly variable. Some subunits failed to increase in one (goldfish COX7A2, dace COX6A2) or both (COX7B, COX6B2) species. Other transcripts increased 1.7-100 times. The most cold-responsive subunits were COX4-1 (7 and 21.3 times higher in dace and goldfish, respectively), COX5A1 (13.9 and 5 times higher), COX6B1 (6 and 10 times higher), COX6C (11 and 4 times higher) and COX7C (13.3 and 100 times higher). The subunits that most closely paralleled COX increases in the cold were COX5B2 (dace 2.5 times, goldfish 1.7 times) and COX6A2 (dace 4.1 times, goldfish 1.7 times). Collectively, these studies suggest that COX gene expression is not tightly coordinated during cold-induced mitochondrial remodelling in fish muscle. Further, they caution against arguments about the importance of transcriptional regulation based on measurement of mRNA levels of select subunits of multimeric proteins. PMID:21562175

Duggan, Ana T; Kocha, Katrinka M; Monk, Christopher T; Bremer, Katharina; Moyes, Christopher D

2011-06-01

108

Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.  

PubMed Central

In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship between expression of thiC and production of the cbb3 terminal oxidase. This is consistent with the proposition that a purine-related metabolite, 5-aminoimidazole-4-carboxamide ribonucleotide, is a negative effector of the production of the symbiotic terminal oxidase cbb3 in R. etli. PMID:9371431

Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M

1997-01-01

109

The Multicopper Ferroxidase Hephaestin Enhances Intestinal Iron Absorption in Mice  

PubMed Central

Hephaestin is a vertebrate multicopper ferroxidase important for the transfer of dietary iron from intestinal cells to the blood. Hephaestin is mutated in the sex-linked anemia mouse, resulting in iron deficiency. However, sex-linked anemia mice still retain some hephaestin ferroxidase activity. They survive, breed, and their anemia improves with age. To gain a better understanding of the role of hephaestin in iron homeostasis, we used the Cre-lox system to generate knockout mouse models with whole body or intestine-specific (Villin promoter) ablation of hephaestin. Both types of mice were viable, indicating that hephaestin is not essential and that other mechanisms, multicopper ferroxidase-dependent or not, must compensate for hephaestin deficiency. The knockout strains, however, both developed a microcytic, hypochromic anemia, suggesting severe iron deficiency and confirming that hephaestin plays an important role in body iron acquisition. Consistent with this, the knockout mice accumulated iron in duodenal enterocytes and had reduced intestinal iron absorption. In addition, the similarities of the phenotypes of the whole body and intestine-specific hephaestin knockout mice clarify the important role of hephaestin specifically in intestinal enterocytes in maintaining whole body iron homeostasis. These mouse models will serve as valuable tools to study the role of hephaestin and associated proteins in iron transport in the small intestine and other tissues. PMID:24896847

Fuqua, Brie K.; Lu, Yan; Darshan, Deepak; Frazer, David M.; Wilkins, Sarah J.; Wolkow, Natalie; Bell, Austin G.; Hsu, JoAnn; Yu, Catherine C.; Chen, Huijun; Dunaief, Joshua L.; Anderson, Gregory J.; Vulpe, Chris D.

2014-01-01

110

The LOXL2 Gene Encodes a New Lysyl Oxidase-like Protein and Is Expressed at High Levels in Reproductive Tissues  

Microsoft Academic Search

We have reported in this paper the complete cDNA sequence, gene structure, and tissue-specific expression of LOXL2, a new amine oxidase and a member of an emerging family of human lysyl oxidases. The predicted amino acid sequence, from several overlapping cDNA clones isolated from placenta and spleen cDNA libraries, shared extensive sequence homology with the con- served copper-binding and catalytic

Claude Jourdan-Le Saux; Heike Tronecker; Ljubica Bogic; Gillian D. Bryant-Greenwood; Charles D. Boyd; Katalin Csiszar

1999-01-01

111

Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population  

SciTech Connect

The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko [Ehime Univ. School of Medicine, Tokyo (Japan)] [and others

1995-12-18

112

Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.  

PubMed Central

The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

1989-01-01

113

Systematic screening of lysyl oxidase-like (LOXL) family genes demonstrates that LOXL2 is a susceptibility gene to intracranial aneurysms  

Microsoft Academic Search

Four lysyl oxidase family genes (LOXL1, LOXL2, LOXL3, and LOXL4), which catalyze cross-linking of collagen and elastin, were considered to be functional candidates for intracranial aneurysms\\u000a (IA) and were extensively screened for genetic susceptibility in Japanese IA patients. Total RNA was isolated from four paired\\u000a ruptured IA and superficial temporal artery (STA) tissue and examined by real-time RT-PCR. The expression

Hiroyuki Akagawa; Akira Narita; Haruhiko Yamada; Atsushi Tajima; Boris Krischek; Hidetoshi Kasuya; Tomokatsu Hori; Motoo Kubota; Naokatsu Saeki; Akira Hata; Tohru Mizutani; Ituro Inoue

2007-01-01

114

Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.  

PubMed

Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(?) and bod2(?) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(?) bod2(?) double mutant was changed. The bod1(?) and bod2(?) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(?) and bod2(?) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. PMID:24947769

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

2015-03-01

115

Drosophila melanogaster diphenol oxidase A2: gene structure and homology with the mouse mast-cell tum- transplantation antigen, P91A.  

PubMed

The Drosophila melanogaster diphenol oxidase (DOX) A2-encoding gene (Dox-A2) is involved in catecholamine metabolism, melanin formation and sclerotization of the cuticle. Insect phenol oxidases (POX) are well studied biochemically, but not genetically and molecularly. The Dox-A2 (2-53.9) gene is the first insect POX-encoding gene to be cloned and sequenced. It encodes a protein product unique among currently known POX. The deduced protein, however, exhibits extensive similarity (58-81%) to the mouse mast cell tum- antigen, P91A [Lurquin et al., Cell 58 (1989) 293-303] and may identify the normal mouse protein as a DOX. PMID:1909680

Pentz, E S; Wright, T R

1991-07-22

116

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review  

PubMed Central

Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

Buades-Rotger, Macià; Gallardo-Pujol, David

2014-01-01

117

Transcriptome analysis of PPAR? target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.  

PubMed

Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor ? (PPAR?) plays a major role in placental development, and activation of PPAR? by its agonists results in inhibition of EVCT invasion in vitro. To identify PPAR? target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPAR? agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPAR?. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by ?-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPAR? targets and that LOX activity is a negative regulator of trophoblastic cell invasion. PMID:24265769

Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

2013-01-01

118

Transcriptome Analysis of PPAR? Target Genes Reveals the Involvement of Lysyl Oxidase in Human Placental Cytotrophoblast Invasion  

PubMed Central

Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor ? (PPAR?) plays a major role in placental development, and activation of PPAR? by its agonists results in inhibition of EVCT invasion in vitro. To identify PPAR? target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPAR? agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPAR?. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by ?-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPAR? targets and that LOX activity is a negative regulator of trophoblastic cell invasion. PMID:24265769

Segond, Nadine; Degrelle, Séverine A.; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S. K.; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

2013-01-01

119

The urate oxidase gene of Drosophila pseudoobscura and Drosophila melanogaster : Evolutionary changes of sequence and regulation  

Microsoft Academic Search

The urate oxidase (UO) transcription unit of Drosophila pseudoobscura was cloned, sequenced, and compared to the UO transcription unit from Drosophila melanogaster. In both species the UO coding region is divided into two exons of approximately equal size. The deduced D. pseudoobscura and D. melanogaster UO peptides have 346 and 352 amino acid residues, respectively. The nucleotide sequences of the

Thomas B. Friedman; Jean B. Burnett; Susan Lootens; Robin Steinman; Lori L. Wallrathl

1992-01-01

120

Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

121

[Expression of paternal genes controlling cytochrome oxidase activity in hybrid fish].  

PubMed

The heat resistance of the oxygen consumption by the mitochondria, temperature dependence of the Michaelis' constant (CM) and heat resistance of cytochrome oxidase were studied in the embryos and larvae of fish hybrids (Misgurnus X Brachydanio). The oxygen consumption by the mitochondria from the larvae of Misgurnus ceased (following the 10 min heating) at 50 degrees, from Brachydanio at 54 degrees and from the hybrids at 52 degress suggesting control of the respiratory function. CM of cytochrome oxidase has the same minimum in the larvae of Misgurnus and Brachydanio, therefore this criterion was not used to study the genetic control in their hybrids. The heat resistance of cytochrome oxidase (T50) differed in Misgurnus and Brachydanio and was of intermediate value in their hybrids. At the early stages of hybrid development T50 was of maternal type (Misgurnus) but beginning from the mid-gastrula stage T50 increased and attained the maximum prior to the hatching. Chloramphenicol did not affect the increase of T50 in hybrids, but actinomycin decreased it almost down to the level characteristic of Misgurnus. The data obtained suggest that the genetic control of cytochrome oxidase activity begins earlier than that of other studied enzymes. PMID:209380

Abramova, N B; Kliachko, O S; Ne?fakh, A A

1978-01-01

122

Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1  

PubMed Central

Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

Wang, Ju; Lin, Jianxun; Zhao, Minyan

2015-01-01

123

Species differences in the temporal pattern of Drosophila urate oxidase gene expression are attributed to trans-acting regulatory changes.  

PubMed Central

The Drosophila melanogaster urate oxidase (UO)-encoding gene is expressed in the third-instar larva and adult. In contrast, the Drosophila pseudoobscura UO gene is only expressed in the adult, whereas the Drosophila virilis UO gene is expressed only in the third-instar larva. UO activity in these three Drosophila species is detected exclusively within the Malpighian tubules. By using P-element mediated germ-line transformation, UO genes from D. pseudoobscura and D. virilis were integrated into the D. melanogaster genome. The D. virilis and D. pseudoobscura UO transgenes were expressed in the third-instar larva and adult Malpighian tubules, which is the D. melanogaster temporal pattern of UO gene expression. These observations indicate that differences in the temporal patterns of regulation of UO genes among these three Drosophila species are not likely to be due to evolutionary changes in the sequence or complement of UO cis-acting regulatory elements. The species differences in UO regulation are probably the result of changes in one or more trans-acting factors required for UO gene expression in the third-instar larval and adult stages. Images PMID:2062830

Wallrath, L L; Friedman, T B

1991-01-01

124

Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and developmental delay.  

PubMed

Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors ? and ?(LXR? and LXR?), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510

He, Miao; Kratz, Lisa E; Michel, Joshua J; Vallejo, Abbe N; Ferris, Laura; Kelley, Richard I; Hoover, Jacqueline J; Jukic, Drazen; Gibson, K Michael; Wolfe, Lynne A; Ramachandran, Dhanya; Zwick, Michael E; Vockley, Jerry

2011-03-01

125

Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder  

SciTech Connect

We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

Lim, L.C.C.; Sham, P.; Castle, D. [Institute of Psychiatry, London (United Kingdom)] [and others

1995-08-14

126

Intragenic deletion in the gene encoding L-gulonolactone oxidase causes vitamin C deficiency in pigs  

Microsoft Academic Search

The absence of L-ascorbic acid (L-AA, or AA) synthesis in scurvy-prone organisms, including humans, other primates, guinea pigs, and flying mammals, was traced to the lack of L-gulonolactone oxidase (GULO) activity. GULO is a microsomal enzyme that catalyzes the terminal step in the biosynthesis of L-AA. Clinical cases of scurvy were described in a family of Danish pigs. This trait

Lara Hasan; Peter Vögeli; Peter Stoll; Špela Špilar Gerald KramerStranzinger; Stefan Neuenschwander

2004-01-01

127

Expression of ACC oxidase genes differs among sex genotypes and sex phases in cucumber  

Microsoft Academic Search

Ethylene has been implicated as a sex-determining hormone in cucumber: its exogenous application increases femaleness, and gynoecious genotypes were reported to produce more ethylene. In this study, three full-length ACC oxidase cDNAs were isolated from cucumber floral buds. RFLP analysis of a population that segregates for the F (femaleness) locus indicated that CS-ACO2 is linked to F at a distance

Anat Kahana; Leah Silberstein; Naama Kessler; Ronald S. Goldstein; Rafael Perl-Treves

1999-01-01

128

Mitochondrial cytochrome C oxidase subunit I of Manduca sexta and a comparison with other invertebrate genes.  

PubMed

A cDNA encoding mitochondrial cytochrome c oxidase subunit I (mt COI) from Manduca sexta (Lepidoptera: Sphingidae) was cloned and sequenced. AT (adenine-thymine) content is high and codon usage is biased and likely reflects the role of mt COI in electron transport. The encoded protein is 514 amino acids long, contains seven invariant His residues observed in COIs in all organisms and would be predicted to be composed of 12 transmembrane regions. PMID:8925445

Frohlich, D R; Stevenson, B A; Peterson, A M; Wells, M A

1996-04-01

129

A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)  

PubMed Central

The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID:25018760

Clouse, Ronald M.; Carraro, Nicola

2014-01-01

130

A diphenol oxidase gene is part of a cluster of genes involved in catecholamine metabolism and sclerotization in drosophila. I. Identification of the biochemical defect in Dox-A2 [l(2)37Bf] mutants.  

PubMed

Phenol oxidase, a complex enzyme, plays a major role in the processes of sclerotization and melanization of cuticle in insects. Several loci have been reported to affect levels of phenol oxidase activity, but to date only one structural locus has been identified [Dox-3F (2-53.1+)]. Recently isolated Dox-A2 mutations (2-53.9) are recessive, early larval lethals, which as heterozygotes reduce phenol oxidase activity. A homozygous mutant escaper had weak, completely unpigmented cuticle and unpigmented bristles. Enzyme assays show that Dox-A2 heterozygotes have diphenol oxidase activity reduced to 47-79% of wild type, whereas monophenol oxidase activity, at 94-106% of wild type, is normal. Elevated pool sizes of the diphenol oxidase substrates DOPA, dopamine, and N-acetyldopamine are observed in the mutant, confirming the enzyme assay results. Separation of the three phenol oxidase A component activities on polyacrylamide gels shows that Dox-A2 mutations reduce the activity of only the A2 component. Dox-A2 may identify a structural locus for the A2 component of the diphenol oxidase enzyme system. The Dox-A2 locus is one of 18 loci in the dopa decarboxylase, Df (2L)TW130 region of the second chromosome, at least 14 of which affect the formation, melanization or sclerotization of cuticle in some way. These loci form an apparent cluster of functionally related genes. PMID:3082714

Pentz, E S; Black, B C; Wright, T R

1986-04-01

131

Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission  

PubMed Central

Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei

2014-01-01

132

A restriction fragment length polymorphism results in a nonconservative amino acid substitution encoded within the first exon of the human lysyl oxidase gene  

SciTech Connect

A cDNA covering most of the coding sequence for human lysyl oxidase was used to screen, by Southern blot analysis, genomic DNA from circulating lymphocytes obtained from unrelated, apparently normal individuals. A heritable restriction fragment length polymorphism (RFLP) within a PstI restriction site was detected in 36% of individuals screened (a total of 72 chromosomes were analyzed). The major allele was represented as a 1.7-kb PstI restriction fragment. The minor allele was detected as 1.4 and 0.3kb restriction fragments. Lambda phage-DNA recombinants were isolated from a human lung fibroblast genomic DNA library using the human lysyl oxidase cDNA clone. DNA sequence analysis of several selected phage recombinants revealed that 83% of the coding sequence of lysyl oxidase was localized in four separate exons. Analysis of the coding sequence within exon 1, the most 5{prime} exon within the lysyl oxidase gene, revealed that the PstI RFLP was due to a G {r_arrow} A transition resulting in a nonconservative arginine to glutamine substitution proximal to a propeptide cleavage domain encoded by exon 1 of the lysyl oxidase gene. 33 refs., 5 figs., 1 tab.

Csiszar, K.; Mariani, T.J.; Gosin, J.S.; Deak, S.B.; Boyd, C.D. [Robert Wood Johnson Medical School, New Brunswick, NJ (United States)] [Robert Wood Johnson Medical School, New Brunswick, NJ (United States)

1993-05-01

133

Kinetics of arsenite oxidation by Variovorax sp. MM-1 isolated from a soil and identification of arsenite oxidase gene.  

PubMed

A Gram-negative, arsenite-oxidizing bacterial strain, MM-1 tolerant to 20mM arsenite and 200 mM arsenate was isolated from a heavy metal contaminated soil which contained only 8.8 mg kg(-1) of arsenic. Based on 16S rRNA analysis, the strain was closely related to the genus Variovorax. This strain completely oxidized 500 ?M of arsenite to arsenate within 3h of incubation in minimal salts medium. Kinetic studies of arsenite oxidation by the cells showed one of the lowest Km (17 ?M) and highest Vmax (1.23 × 10(-7) ?M min(-1) cell(-1)) values reported to date for whole cell suspension. PCR analysis using degenerate primers confirmed the presence of arsenite oxidase gene and its amino acid sequence was 70-91% identical to the large subunit of most reported arsenite oxidases. The significant arsenite oxidation capacity shown by the strain opens the way to its potential application in arsenic remediation process. PMID:23290483

Bahar, Md Mezbaul; Megharaj, Mallavarapu; Naidu, Ravi

2013-11-15

134

THE ISOAMYL OXIDASE GENE IN PENICILLIUM GRISEOFULVUM IS PART OF THE PATULIN BIOSYNTHETIC PATHWAY  

Technology Transfer Automated Retrieval System (TEKTRAN)

Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

135

Phylogenetic comparison and classification of laccase and related multicopper oxidase protein sequences  

E-print Network

sequences Patrik J. Hoegger1 , Sreedhar Kilaru1 , Timothy Y. James2 , Jason R. Thacker2 and Ursula Ku¨ es1 1 Georg-August-University Go¨ttingen, Institute of Forest Botany, Go¨ttingen, Germany 2 Duke University, Buesgenweg 2, 37077 Go¨ttingen, Germany Fax: +49 551392705 Tel: +49 5513914086 E-mail: phoegge

James, Timothy

136

Identification of a gene essential for protoporphyrinogen IX oxidase activity in the cyanobacterium Synechocystis sp. PCC6803  

PubMed Central

Protoporphyrinogen oxidase (Protox) catalyses the oxidation of protoporphyrinogen IX to protoporphyrin IX during the synthesis of tetrapyrrole molecules. Protox is encoded by the hemY gene in eukaryotes and by the hemG gene in many ?-proteobacteria, including Escherichia coli. It has been suggested that other bacteria possess a yet unidentified type of Protox. To identify a unique bacterial gene encoding Protox, we first introduced the Arabidopsis hemY gene into the genome of the cyanobacterium, Synechocystis sp. PCC6803. We subsequently mutagenized the cells by transposon tagging and screened the tagged lines for mutants that were sensitive to acifluorfen, which is a specific inhibitor of the hemY-type Protox. Several cell lines containing the tagged slr1790 locus exhibited acifluorfen sensitivity. The slr1790 gene encodes a putative membrane-spanning protein that is distantly related to the M subunit of NADH dehydrogenase complex I. We attempted to disrupt this gene in the wild-type background of Synechocystis, but we were only able to obtain heteroplasmic disruptants. These cells accumulated a substantial amount of protoporphyrin IX, suggesting that the slr1790 gene is essential for growth and Protox activity of cells. We found that most cyanobacteria and many other bacteria possess slr1790 homologs. We overexpressed an slr1790 homolog of Rhodobacter sphaeroides in Escherichia coli and found that this recombinant protein possesses Protox activity in vitro. These results collectively demonstrate that slr1790 encodes a unique Protox enzyme and we propose naming the slr1790 gene “hemJ.” PMID:20823222

Kato, Kazushige; Tanaka, Ryouichi; Sano, Shinsuke; Tanaka, Ayumi; Hosaka, Hideo

2010-01-01

137

AROMA VOLATILE EMISSION AND EXPRESSION OF 1-AMINOCYCLOPROPANE-1-CARBOXYLATE (ACC) SYNTHASE AND ACC OXIDASE GENES IN PEARS TREATED WITH 2,4-DP  

Technology Transfer Automated Retrieval System (TEKTRAN)

Effects of the synthetic auxin 2,4-dichlorophenoxy-propionic acid (2,4-DP) on 1-aminocyclopropane-1-carboxylate (ACC) synthase and oxidase gene expression by ‘La France’ and aroma production by ‘Bartlett’ pears (Pyrus communis L.) were investigated. In non-stored, non-treated ‘LaFrance’ fruit, the ...

138

Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).  

PubMed

Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

Wang, Wei; Liu, Ji-Hong

2015-01-25

139

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs  

PubMed Central

Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes contributed to browning reactions in tuber tissues but their effect was not equal. Different PPO genes may be regulated independently reflecting their diversified functions. Our results show that amiRNAs can be used to suppress closely related members of highly conserved multi-gene family. This approach also suggests a new strategy for breeding low-browning crops using small DNA inserts. PMID:24618103

2014-01-01

140

Molecular Characterization of Fire Ants, Solenopsis spp., from Brazil Based on Analysis of mtDNA Gene Cytochrome Oxidase I  

PubMed Central

Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

2014-01-01

141

Over-expression of a gibberellin 2-oxidase gene from Phaseolus coccineus L. enhances gibberellin inactivation and induces dwarfism in Solanum species  

Microsoft Academic Search

Gibberellins (GAs) are endogenous hormones that play a predominant role in regulating plant stature by increasing cell division\\u000a and elongation in stem internodes. The product of the GA 2-oxidase gene from Phaseolus coccineus (PcGA2ox1) inactivates C19-GAs, including the bioactive GAs GA1 and GA4, by 2?-hydroxylation, reducing the availability of these GAs in plants. The PcGA2ox1 gene was introduced into Solanum

C. Dijkstra; E. Adams; A. Bhattacharya; A. F. Page; P. Anthony; S. Kourmpetli; J. B. Power; K. C. Lowe; S. G. Thomas; P. Hedden; A. L. Phillips; M. R. Davey

2008-01-01

142

Molecular identification and phylogenetic relationships of seven Indian Sciaenids (Pisces: Perciformes, Sciaenidae) based on 16S rRNA and cytochrome c oxidase subunit I mitochondrial genes  

Microsoft Academic Search

The partial sequences of 16S rRNA and cytochrome c oxidase subunit I (COI) mitochondrial genes were analyzed for species identification\\u000a and phylogenetic relationships among the commercially important Indian sciaenids (Otolithes cuvieri, Otolithes ruber, Johnius dussumieri, Johnius elongatus, Johnieops vogleri, Otolithoides biauritus and Protonibea diacanthus). Sequence analysis of both genes revealed that the seven species fell into three distinct groups, which

Wazir S. Lakra; M. Goswami; A. Gopalakrishnan

2009-01-01

143

Activation tagging of a dominant gibberellin catabolism gene (GA 2-oxidase) from poplar that regulates tree stature.  

PubMed

We identified a dwarf transgenic hybrid poplar (Populus tremula x Populus alba) after screening of 627 independent activation-tagged transgenic lines in tissue culture, greenhouse, and field environments. The cause of the phenotype was a hyperactivated gene encoding GA 2-oxidase (GA2ox), the major gibberellin (GA) catabolic enzyme in plants. The mutation resulted from insertion of a strong transcriptional enhancer near the transcription start site. Overexpression of the poplar GA2ox gene (PtaGA2ox1) caused hyperaccumulation of mRNA transcripts, quantitative shifts in the spectrum of GAs, and similarity in phenotype to transgenic poplars that overexpress a bean (Phaseolus coccineus) GA2ox gene. The poplar PtaGA2ox1 sequence was most closely related to PsGA2ox2 from pea (Pisum sativum) and two poorly known GA2oxs from Arabidopsis (AtGA2ox4 and AtGA2ox5). The dwarf phenotype was reversible through gibberellic acid application to the shoot apex. Transgenic approaches to producing semidwarf trees for use in arboriculture, horticulture, and forestry could have significant economic and environmental benefits, including altered fiber and fruit production, greater ease of management, and reduced risk of spread in wild populations. PMID:12857810

Busov, Victor B; Meilan, Richard; Pearce, David W; Ma, Caiping; Rood, Stewart B; Strauss, Steven H

2003-07-01

144

Activation Tagging of a Dominant Gibberellin Catabolism Gene (GA 2-oxidase) from Poplar That Regulates Tree Stature1  

PubMed Central

We identified a dwarf transgenic hybrid poplar (Populus tremula × Populus alba) after screening of 627 independent activation-tagged transgenic lines in tissue culture, greenhouse, and field environments. The cause of the phenotype was a hyperactivated gene encoding GA 2-oxidase (GA2ox), the major gibberellin (GA) catabolic enzyme in plants. The mutation resulted from insertion of a strong transcriptional enhancer near the transcription start site. Overexpression of the poplar GA2ox gene (PtaGA2ox1) caused hyperaccumulation of mRNA transcripts, quantitative shifts in the spectrum of GAs, and similarity in phenotype to transgenic poplars that overexpress a bean (Phaseolus coccineus) GA2ox gene. The poplar PtaGA2ox1 sequence was most closely related to PsGA2ox2 from pea (Pisum sativum) and two poorly known GA2oxs from Arabidopsis (AtGA2ox4 and AtGA2ox5). The dwarf phenotype was reversible through gibberellic acid application to the shoot apex. Transgenic approaches to producing semidwarf trees for use in arboriculture, horticulture, and forestry could have significant economic and environmental benefits, including altered fiber and fruit production, greater ease of management, and reduced risk of spread in wild populations. PMID:12857810

Busov, Victor B.; Meilan, Richard; Pearce, David W.; Ma, Caiping; Rood, Stewart B.; Strauss, Steven H.

2003-01-01

145

A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor  

PubMed Central

Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

2013-01-01

146

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.  

PubMed

Background Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. Aims To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Method Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. Conclusions These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. PMID:25497297

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

147

[Polymorphisms of catechol-O-methyltransferase and monoamine oxidase B genes among Chinese patients with Parkinson's disease].  

PubMed

OBJECTIVE To study polymorphisms of catechol-O-methyltransferase (COMT) and monoamine oxidase B (MAO-B) genes among Chinese patients with Parkinson's disease. METHODS Genotypes of the COMT and MAO-B genes of 1408 patients with Parkinson's disease was sequenced using Sanger method. And these patients were recruited by Chinese Parkinson Study Group from 29 research centers throughout the country. RESULTS The genotypic frequencies of COMT rs4680 AA, AG, GG were 8.9%, 42.0% and 49.1%. Those of rs4818 CC, CG, GG were 42.5%, 45.6% and 11.9%, respectively. The genotype frequencies of MAO-B rs1799836 A/AA, AG, G/GG were 74.4%, 14.1% and 11.5%, respectively. The haplotype formed by COMT rs4680 (GG) and MAO-B rs1799836 (A/AA) genotype has a frequency of 36.86%. CONCLUSION Polymorphisms of COMT and MAO-B genes has a unique characteristics among Chinese patients with Parkinson's disease. They may be related with differences in drug response in such patients. PMID:25636089

Hao, Hongying; Shao, Ming; An, Jing; Chen, Chushuang; Feng, Xiuli; Xie, Shu; Gu, Zhuqin; Chen, Biao

2015-02-10

148

Involvement of the NADH oxidase-encoding noxA gene in oxidative stress responses in Corynebacterium glutamicum.  

PubMed

Corynebacterium glutamicum ORF NCgl0328, designated noxA, encodes an NADH oxidase enzyme. The noxA gene, which was preferentially expressed in the log growth phase, was found to be under the control of the whcA, whcB, and whcE genes, which play regulatory roles in cells under oxidative stress. While noxA transcription was minimal in whcE-deleted mutant cells (?whcE) during growth, its transcription was maximal even in the stationary phase in ?whcA cells. The transcription levels of noxA in ?whcB and whcB-overexpressing cells were comparable to the levels only in the log growth phase in ?whcA and whcA-overexpressing cells, respectively. Direct binding of purified WhcA to the promoter region of noxA was observed in vitro. The DNA-protein interaction was only possible in the presence of the reducing agent dithiothreitol. A noxA-deleted mutant strain and a strain overexpressing the noxA gene (P180-noxA) were established, and these strains were found to exhibit defective cell growth. The ?noxA and P180-noxA strains were sensitive to the redox-cycling oxidant menadione, suggesting a role of noxA in redox balancing. Accordingly, the purified NoxA enzyme exhibited NADH-oxidizing activity. Taken together, these data show that noxA plays a role in oxidative stress responses and also that the gene is under direct control of the WhcA protein, which was shown to be a regulatory DNA-binding protein. Furthermore, the involvement and roles of the whcA, whcB, and whcE genes in regulating the expression of noxA were demonstrated. PMID:25549620

Park, Jung Chul; Kim, Younhee; Lee, Heung-Shick

2015-02-01

149

Association between the nicotinamide adenine dinucleotide phosphate oxidase p22phox gene ?A930G polymorphism and intracerebral hemorrhage.  

PubMed

The present study aimed to evaluate whether the ?A930G polymorphism of the nicotinamide adenine dinucleotide phosphate [NAD(P)H] oxidase p22phox gene is involved in intracerebral hemorrhage (ICH) in the Chinese Han population. In the present case?control investigation, the subjects included 118 patients with ICH and 147 healthy controls. The ?A930G polymorphism was determined using polymerase chain reaction and restriction fragment length polymorphism. Furthermore, the correlation between the ?A930G gene polymorphism and ICH was evaluated using statistical analyses. The distribution of p22phox ?A930G genotypes differed significantly between the two groups (P=0.003), with the AA, AG and GG genotype frequencies being 61.9, 29.3 and 8.8% in the control group and 40.7, 45.8 and 13.6% in the ICH group, respectively. The G allele frequency was significantly higher in patients with ICH compared with healthy controls (36.4 vs. 23.5%; P<0.05), however, the opposite was observed in the frequency of the A allele (63.6 vs. 76.5%; P<0.05). Binary logistic regression analysis revealed that genetic mutations of the p22phox ?A930G gene were independent risk factors of ICH (odds ratio, 2.196; 95% confidence interval, 1.003?4.586; P=0.009). In addition, certain conventional factors were associated with increased risk of ICH, including elevated blood pressure, increased levels of glucose and triglycerides in the blood, a history of hypertension and smoking. The ?A930G polymorphism of the p22phox gene may affect the susceptibility to ICH and certain haplotypes of the gene may be associated with a higher susceptibility to ICH. PMID:25572489

Zhou, Yuan; Zhao, Ying-Chun

2015-05-01

150

[Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].  

PubMed

This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A

2014-10-01

151

Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity  

PubMed Central

Purpose Keratoconus (KC) is characterized by progressive vision loss due to corneal thinning and structural abnormalities. It is hypothesized that KC is caused by deregulated collagen levels and collagen fibril-maturating enzyme lysyl oxidase (LOX). Further, it is currently not understood whether the gene expression deregulated by the corneal epithelium influences KC pathogenesis. We studied (i) the expressions of the LOX, collagen I (COL IA1), collagen IV (COL IVA1), MMP9, and IL6 genes in KC corneal epithelia, (ii) validated their expression levels in patient tissues, and (iii) correlated expression levels with KC disease severity. The primary goal of this study was to evaluate the importance of these genes in the progression of KC. Methods We analyzed the gene expression levels of the key proteins LOX, collagens (COL IA1 and COL IVA1), MMP9, and IL6 in debrided corneal epithelia from a large cohort of KC patients (90 eyes) and compared them to control patients (52 eyes) without KC. We measured the total LOX activity in the tears of KC patients compared to controls. We also correlated the protein expression levels of LOX and collagens by immunohistochemistry (IHC) in primary tissues from KC patients (27 eyes) undergoing keratoplasty compared to healthy donor corneas (15 eyes). Results We observed a significant reduction in LOX transcript levels in KC corneal epithelia, and LOX activity in KC tears correlated with disease severity. Collagen transcripts were also reduced in KC while MMP9 transcript levels were upregulated and correlated with disease severity. IL6 was moderately increased in KC patients. IHC demonstrated a reduction in the protein expression levels of LOX in the epithelium and collagen IV in the basement membrane of KC patients compared to healthy donor corneas. Conclusions The data demonstrates that the structural deformity of the KC cornea may be dependent on reduced expressions of collagens and LOX, as well as on MMP9 elevated by the corneal epithelium. PMID:25593510

Shetty, Rohit; Sathyanarayanamoorthy, Arunapriya; Ramachandra, Reshma Airody; Arora, Vishal; Ghosh, Anuprita; Srivatsa, Purnima Raman; Pahuja, Natasha; Nuijts, Rudy M. M. A.; Sinha-Roy, Abhijit; Ghosh, Arkasubhra

2015-01-01

152

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.  

PubMed

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 ?g/L) in neutral or alkaline springs than in acidic springs (on average 30.88 ?g/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

153

Expression of Phanerochaete chrysosporium Genes Encoding Lignin Peroxidases, Manganese Peroxidases, and Glyoxal Oxidase in Wood  

PubMed Central

Expression of Phanerochaete chrysosporium genes encoding ligninolytic enzymes was assessed in wood. Poly(A) RNA was extracted from colonized wood chips by magnetic capture, and specific transcripts were quantified by competitive reverse transcriptase PCR. mRNA levels varied substantially among lignin peroxidase genes, and transcript patterns were dramatically different from those in previous studies with defined media. PMID:9726913

Janse, Bernard J. H.; Gaskell, Jill; Akhtar, Masood; Cullen, Daniel

1998-01-01

154

Bilirubin oxidases in bioelectrochemistry: features and recent findings.  

PubMed

Bilirubin oxidases, a sub class of the Multicopper oxidases family, were discovered in 1981 by Tanaka and Murao (Murao and Tanaka, 1981) and first used for the detection of bilirubin. Since 2001 and the pioneering work of Tsujimura, these BODs have attracted a lot of attention for the reduction of O2. Unlike laccases, these BODs are stable in physiological conditions (20mM phosphate buffer, pH 7.4, 0.14 M NaCl, 37 °C) and more than 120 papers have been published in the last 7 years. Here, we will first briefly describe some general features of BODs and then review the use of BODs for bilirubin biosensors and the recent achievements and progress toward the elaboration of efficient O2 reducing cathodes. PMID:23911663

Mano, Nicolas; Edembe, Lise

2013-12-15

155

The monoamine oxidase A (MAO-A) gene, family function and maltreatment as predictors of destructive behaviour during male adolescent alcohol consumption  

Microsoft Academic Search

Aim To investigate possible interactions between a polymorphism in the monoamine oxidase A (MAO-A) gene promoter, family relations and maltreatment\\/sexual abuse on adolescent alcohol-related problem behaviour among male adolescents. Design, setting and participants A cross-sectional study of a randomized sample of 66 male individuals from a total population of 16- and 19-year adolescents from a Swedish county. Boys, who volunteered

Kent W. Nilsson; Rickard L. Sjöberg; Hanna-Linn Wargelius; Jerzy Leppert; Leif Lindström; Lars Oreland

2007-01-01

156

A novel human lysyl oxidase-like gene (LOXL4) on chromosome 10q24 has an altered scavenger receptor cysteine rich domain  

Microsoft Academic Search

We have identified a novel 14-exon human lysyl oxidase-like gene, LOXL4, on chromosome 10q24. The cDNA and derived amino acid sequence of LOXL4 demonstrates a conserved C-terminal region including the characteristic copper-binding site, lysyl and tyrosyl residues and a cytokine receptor-like domain. One of the four N-terminal SRCR domains contains a 13 amino acid insertion encoded by a short exon

L. Asuncion; B. Fogelgren; K. S. K. Fong; S. F. T. Fong; Y. Kim; K. Csiszar

2001-01-01

157

The mouse lysyl oxidase-like 2 gene ( mLOXL2) maps to chromosome 14 and is highly expressed in skin, lung and thymus  

Microsoft Academic Search

The predicted amino acid sequence derived from a mouse expressed sequence tag (EST) contig contained two domains that are highly conserved among members of the lysyl oxidase gene family: a copper binding-site with four histidines and a catalytic domain that includes a tryptophan residue. This new cDNA sequence showed the highest level of sequence homology with the human loxl2 cDNA

Claude Jourdan-Le Saux; Olivier Le Saux; Claudine Gleyzal; Pascal Sommer; Katalin Csiszar

2000-01-01

158

Association of A\\/G Polymorphism in Intron 13 of the Monoamine Oxidase B Gene with Schizophrenia in a Spanish Population  

Microsoft Academic Search

Background: Monoamine oxidase B (MAO-B) enzyme is involved in the oxidative metabolism of dopamine. We studied whether the A644G polymorphism in intron 13 of the MAO-B gene is a risk factor for schizophrenia. Methods: 242 subjects diagnosed with schizophrenia and related disorders and 290 hospital-based controls participated in the study. Genomic DNA was isolated from whole blood and genotyped with

Patricia Gassó; Miquel Bernardo; Sergi Mas; Anna Crescenti; Clemente Garcia; Eduard Parellada; Amalia Lafuente

2008-01-01

159

Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.  

PubMed

Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G.?pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G.?pecorum. High haplotype diversity was observed among G.?pecorum populations from all host species, indicating that the G.?pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G.?pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G.?pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures. PMID:25171609

Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K

2014-08-01

160

The choline oxidase gene codA confers salt tolerance to transgenic Eucalyptus globulus in a semi-confined condition.  

PubMed

The performance of tree species is influenced by environmental factors and growth stages. To evaluate the practical performance of transgenic tree species, it is insufficient to grow small, young trees under controlled conditions, such as in a growth chamber. Three transgenic Eucalyptus globulus lines, carrying the choline oxidase gene, were investigated for their salt tolerance and expression of the transgene at the young plantlet stage in a special netted-house. To clarify the characteristics at the young as well during the later stages, salt tolerance and the properties of the transgenic lines at large juvenile and adult stages were evaluated in the special netted-house. All transgenic lines showed high glycinebetaine content, particularly in young leaves. Trees of the transgenic line 107-1 showed low damage because of salinity stress based on the results from the chlorophyll analysis and malondialdehyde content, and they survived the high-salt-shock treatment at the large juvenile and adult stages. Only this line showed salt tolerance at all stages in the special netted-house. In this evaluation in the special netted-house, the tolerant line among young plantlets might perform better at all stages. Since evaluation in these special netted-house mimics field evaluation, line 107-1 is a potential tolerant line. PMID:22752644

Yu, Xiang; Kikuchi, Akira; Matsunaga, Etsuko; Morishita, Yoshihiko; Nanto, Kazuya; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa; Watanabe, Kazuo N

2013-06-01

161

Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences.  

PubMed

Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus. PMID:23778610

Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R

2013-07-01

162

Dual oxidases  

PubMed Central

Reactive oxygen species (ROS) have an important role in various physiological processes including host defence, mitogenesis, hormone biosynthesis, apoptosis and fertilization. Currently, the most characterized ROS-producing system operates in phagocytic cells, where ROS generated during phagocytosis act in host defence. Recently, several novel homologues of the phagocytic oxidase have been discovered and this protein family is now designated as the NOX/DUOX family of NADPH oxidases. NOX/DUOX enzymes function in a variety of tissues, including colon, kidney, thyroid gland, testis, salivary glands, airways and lymphoid organs. Importantly, members of the enzyme family are also found in non-mammalian species, including Caenorhabditis elegans and sea urchin. The physiological functions of novel NADPH oxidase enzymes are currently largely unknown. This review focuses on our current knowledge about dual oxidases. PMID:16321800

Donkó, Ágnes; Péterfi, Zalán; Sum, Adrienn; Leto, Thomas; Geiszt, Miklós

2005-01-01

163

Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.  

PubMed

Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

2012-09-14

164

Reconstructing Mammalian Phylogenies: A Detailed Comparison of the Cytochrome b and Cytochrome Oxidase Subunit I Mitochondrial Genes  

PubMed Central

The phylogeny and taxonomy of mammalian species were originally based upon shared or derived morphological characteristics. However, genetic analyses have more recently played an increasingly important role in confirming existing or establishing often radically different mammalian groupings and phylogenies. The two most commonly used genetic loci in species identification are the cytochrome oxidase I gene (COI) and the cytochrome b gene (cyt b). For the first time this study provides a detailed comparison of the effectiveness of these two loci in reconstructing the phylogeny of mammals at different levels of the taxonomic hierarchy in order to provide a basis for standardizing methodologies in the future. Interspecific and intraspecific variation is assessed and for the first time, to our knowledge, statistical confidence is applied to sequence comparisons. Comparison of the DNA sequences of 217 mammalian species reveals that cyt b more accurately reconstructs their phylogeny and known relationships between species based on other molecular and morphological analyses at Super Order, Order, Family and generic levels. Cyt b correctly assigned 95.85% of mammal species to Super Order, 94.31% to Order and 98.16% to Family compared to 78.34%, 93.36% and 96.93% respectively for COI. Cyt b also gives better resolution when separating species based on sequence data. Using a Kimura 2-parameter p-distance (x100) threshold of 1.5–2.5, cyt b gives a better resolution for separating species with a lower false positive rate and higher positive predictive value than those of COI. PMID:21152400

Tobe, Shanan S.; Kitchener, Andrew C.; Linacre, Adrian M. T.

2010-01-01

165

Molecular cloning, sequencing, and heterologous expression of the vaoA gene from Penicillium simplicissimum CBS 170.90 encoding vanillyl-alcohol oxidase.  

PubMed

The cDNA encoding vanillyl-alcohol oxidase (EC 1.1.3.7) was selected from a cDNA library constructed from mRNA isolated from Penicillium simplicissimum CBS 170.90 grown on veratryl alcohol by immunochemical screening. The vaoA-cDNA nucleotide sequence revealed an open reading frame of 1680 base pairs encoding a 560-amino acid protein with a deduced mass of 62,915 Da excluding the covalently bound FAD. The deduced primary structure shares 31% sequence identity with the 8alpha-(O-tyrosyl)-FAD containing subunit of the bacterial flavocytochrome p-cresol methyl hydroxylase. The vaoA gene was isolated from a P. simplicissimum genomic library constructed in lambdaEMBL3 using the vaoA-cDNA as a probe. Comparison of the nucleotide sequence of the vaoA gene with the cDNA nucleotide sequence demonstrated that the gene is interrupted by five short introns. Aspergillus niger NW156 prtF pyrA leuA cspA transformed with the pyrA containing plasmid and a plasmid harboring the complete vaoA gene including the promoter and terminator was able to produce vaoA mRNA and active vanillyl-alcohol oxidase when grown on veratryl alcohol and anisyl alcohol. A similar induction of the vaoA gene was found for P. simplicissimum, indicating that similar regulatory systems are involved in the induction of the vaoA gene in these fungi. Introduction of a consensus ribosome binding site, AGAAGGAG, in the vaoA-cDNA resulted in elevated expression levels of active vanillyl-alcohol oxidase from the lac promoter in Escherichia coli TG2. The catalytic and spectral properties of the purified recombinant enzyme were indistinguishable from the native enzyme. PMID:9525880

Benen, J A; Sánchez-Torres, P; Wagemaker, M J; Fraaije, M W; van Berkel, W J; Visser, J

1998-04-01

166

No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms  

SciTech Connect

We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

Craddock, N.; Daniels, J.; Roberts, E. [Univ. of Wales, College of Medicine, Cardiff (United Kingdom)] [and others

1995-08-14

167

Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development  

Microsoft Academic Search

PCR was used with degenerate primers based on conserved amino acid sequences in gibberellin (GA) 20-oxidases to isolate cDNA clones for these enzymes from young seeds of pea (Pisum sativum) and developing embryos of French bean (Phaseolus vulgaris). One GA 20-oxidase cDNA (Ps27-12) was obtained from pea and three (Pv15-11, Pv73-1 and Pv85-26) from bean. Their identities were confirmed by

Isabel López-Diaz; María J. Sánchez-Beltrán; Andrew L. Phillips; Dennis A. Ward; Paul Gaskin; Peter Hedden

1997-01-01

168

Immunologic Evidence that the Gene for L-Gulono-gamma Lactone Oxidase is not Expressed in Animals Subject to Scurvy  

Microsoft Academic Search

L-Gulono-gamma -lactone oxidase (L-Gulono-gamma -lactone:oxygen 2-oxidoreductase, EC 1.1.3.8) is the enzyme that catalyzes the terminal step of L-ascorbic acid biosynthesis in mammalian liver. The absence of the oxidase activity in primates and guinea pigs is the reason why these animals are subject to scurvy, which must be considered an inborn error of metabolism. Attempts were made to determine if a

Morimitsu Nishikimi; Sidney Udenfriend

1976-01-01

169

Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.  

PubMed

Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3?-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth. PMID:23979969

Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P

2013-10-01

170

Oxidase Test Protocol  

NSDL National Science Digital Library

The oxidase test is used to detect the presence of the enzyme cytochrome oxidase in microorganisms.  While used as a taxonomic tool for many microorganisms, the test was established initially to differentiate Neisseria spp. (oxidase positive) from Acinetobacter (oxidase negative) and Pseudomonas spp. (oxidase positive) from the Enterobacteriaceae (oxidase negative).

American Society For Microbiology

2010-11-11

171

Polyphenol Oxidase Activity Expression in Ralstonia solanacearum  

Microsoft Academic Search

Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for poly- phenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this micro- organism. The conditions for the PPO assays were optimized for the

Diana Hernandez-Romero; Francisco Solano; Antonio Sanchez-Amat

2005-01-01

172

Systematic position and relationships of Paracreptotrematina limi, based on partial sequences of 28S rRNA and cytochrome c oxidase subunit 1 genes.  

PubMed

Paracreptotrematina limi Amin and Myer, 1982 (Trematoda), an intestinal fluke specific to the mudminnow, Umbra limi, is conventionally classified within the papillose Allocreadiidae. Its unusual morphology (lack of identifiable vitellaria, large fully embryonated terminal eggs), assumptions of homology of its 2 atypical muscular oral 'papillae' (lobes) with those of the Bunoderinae, and its unknown life cycle make this classification tenuous. Previous phylogenetic analyses of the papillose allocreadiids, based on morphology, placed P. limi as a basal papillose allocreadiid. We tested this hypothesis with a phylogenetic analysis by using partial sequences of the 28S ribosomal RNA gene and the cytochrome c oxidase subunit I gene from several plagiorchiiform taxa, including reportedly related allocreadiids as well as selected species of Plagiorchiidae, Haematoloechidae, and Macroderoididae. Results of phylogenetic analyses of the 28S rRNA gene fragments by using parsimony criteria support the classification of P. limi as an allocreadiid and place it as a sister taxon to a clade with Allocreadium lobatum Wallin, 1909, Bunodera luciopercae (Müller, 1876) and Crepidostomum cooperi Hopkins, 1931, with Polylekithum ictaluri (Pearse, 1924) basal to all of them. Analysis of the cytochrome c oxidase subunit I gene sequence data from fewer taxa supports the placement of P. limi relative to 3 (A. lobatum, C. cooperi, and P. ictaluri) of the 4 allocreadiid taxa. These results also suggest that the previous conception of the papillose allocreadiids as a monophyletic assemblage that includes P. limi may require a reappraisal. PMID:16729708

Platta, Christopher S; Choudhury, Anindo

2006-04-01

173

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.  

PubMed

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants. PMID:24950439

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-01-01

174

[Variability of the mitochondrial gene for cytochrome oxidase I within the Adalia bipunctata species and within species of ladybird beetles (Coleoptera: Coccinellidae)].  

PubMed

Intergeneric, interspecific, and intraspecific genetic variation of the 310-bp 3'-end region of the mitochondrial gene of cytochrome oxidase I (COI) has been assessed in ladybirds (Coleoptera: Coccinnellidae). The phylogenetic distances between eight species of ladybirds have been determined. Mitochondrial DNA (mtDNA) nucleotide sequences have been compared in Adalia bipunctata L. differing in the elytron and pronotum colors that have been sampled from several geographically remote populations. The taxonomic statuses of two morphs from the genus Adalia, A. bipunctata bipunctata and A. bipunctata fasciatopunctata, have been identified. PMID:15065427

Palenko, M V; Mukha, D V; Zakharov, I A

2004-02-01

175

Lack of Population Genetic Structure in the Bat Fly (Trichobius major) in Kansas, Oklahoma, and Texas based on DNA Sequence Data for the Cytochrome Oxidase I (COI) and NADH Dehydrogenase 4 (ND4) Genes  

Microsoft Academic Search

The bat fly, Trichobius major, is an ectoparasite which resides for most of its life on the cave myotis, Myotis velifer. We used portions of the cytochrome oxidase I (COI) and NADH dehydrogenase 4 (ND4) genes of the mitochondrial genome (mtDNA) to infer population genetic structure and gene flow of T. major in Kansas, Oklahoma, and Texas. DNA sequence data

Gregory M. Wilson; Kendra S. Byrd; William Caire; Ronald A. Van Den Bussche

176

Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.  

PubMed

Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-?m plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

2014-01-01

177

Effect of ascorbate oxidase over-expression on ascorbate recycling gene expression in response to agents imposing oxidative stress  

Microsoft Academic Search

Ascorbate oxidase (AO) is a cell wall-localized enzyme that uses oxygen to catalyse the oxidation of ascorbate (AA) to the unstable radical monodehydroascorbate (MDHA) which rapidly disproportionates to yield dehy- droascorbate (DHA) and AA, and thus contributes to the regulation of the AA redox state. Here, it is reported that in vivo lowering of the apoplast AA redox state, through

Vasileios Fotopoulos; Maite Sanmartin; Angelos K. Kanellis

2006-01-01

178

Investigation of the C242T polymorphism of NAD(P)H oxidase p22 phox gene and ischaemic heart disease using family-based association methods.  

PubMed

Ischaemic heart disease is a complex phenotype arising from the interaction of genetic and environmental factors. Excessive production of reactive oxygen species leading to endothelial dysfunction is believed to be important in the pathogenesis of ischaemic heart disease. The NAD(P)H oxidase system generates superoxide anions in vascular cells; however, the role of the C242T polymorphism of the NAD(P)H oxidase p22 phox gene in ischaemic heart disease is unclear due to contradictory results from case-control studies. Consequently, we applied family-based association tests to investigate the role of this polymorphism in ischaemic heart disease in a well-defined Irish population. A total of 1023 individuals from 388 families (discordant sibships and parent/child trios) were recruited. Linkage disequilibrium between the polymorphism and ischaemic heart disease was tested using the combined transmission disequilibrium test (TDT)/sib-TDT (cTDT) and pedigree disequilibrium test (PDT). Both cTDT and PDT analyses found no statistically significant excess transmission of either allele to affected individuals (P =0.30 and P =0.28, respectively). Using robust family-based association tests specifically designed for the study of complex diseases, we found no evidence that the C242T polymorphism of the p22 phox gene has a significant role in the development of ischaemic heart disease in our population. PMID:12877653

Spence, M S; McGlinchey, P G; Patterson, C C; Allen, A R; Murphy, G; Bayraktutan, U; Fogarty, D G; Evans, A E; McKeown, P P

2003-12-01

179

Overexpression of a Maize Sulfite Oxidase Gene in Tobacco Enhances Tolerance to Sulfite Stress via Sulfite Oxidation and CAT-Mediated H2O2 Scavenging  

PubMed Central

Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO2/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E.coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H2O2 accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

2012-01-01

180

Functional analysis reveals effects of tobacco alternative oxidase gene (NtAOX1a) on regulation of defence responses against abiotic and biotic stresses.  

PubMed

Mitochondrial AOX (alternative oxidase) is the terminal oxidase of the CN (cyanide)-resistant alternative respiratory pathway in plants. To investigate the role of the tobacco AOX gene (NtAOX1a) (where Nt is Nicotiana tabacum) under deleterious conditions which could induce ROS (reactive oxygen species) accumulation, we generated and characterized a number of independent transgenic tobacco (N. tabacum) lines with altered NtAOX1a gene expression and AP (alternative pathway) capacity. AOX efficiently inhibited the production of low-temperature-induced H2O2 and might be a major enzyme for scavenging H2O2 at low temperature. Furthermore, NtAOX1a may act as a regulator of KCN-induced resistance to TMV (tobacco mosaic virus) through the regulation of H2O2. Notably, a moderate accumulation of H2O2 under the control of NtAOX1a was crucial in viral resistance. Analysis of seed germination indicated an important role for NtAOX1a in germination under H2O2-induced oxidative stress when the CP (cytochrome pathway) was inhibited. These results demonstrate that NtAOX1a is necessary for plants to survive low temperature, pathogen attack and oxidative stress by scavenging ROS under these adverse conditions when the CP is restricted. PMID:19125696

Zhang, Yi; Xi, Dongmei; Wang, Jian; Zhu, Dongfang; Guo, Xingqi

2009-12-01

181

Alternative oxidase and plastoquinol terminal oxidase in marine prokaryotes of the Sargasso Sea  

Microsoft Academic Search

Alternative oxidase (AOX) represents a non-energy conserving branch in mitochondrial electron transport while plastoquinol terminal oxidase (PTOX) represents a potential branch in photosynthetic electron transport. Using a metagenomics dataset, we have uncovered numerous and diverse AOX and PTOX genes from the Sargasso Sea. Sequence similarity, synteny and phylogenetic analyses indicate that the large majority of these genes are from prokaryotes.

Allison E. McDonald; Greg C. VanlerbergheT

2005-01-01

182

Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.  

PubMed

To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS. PMID:24422758

Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

2015-02-01

183

Phylogeographic analysis of the firefly, Luciola lateralis, in Japan and Korea based on mitochondrial cytochrome oxidase II gene sequences (Coleoptera: Lampyridae).  

PubMed

Luciola lateralis is widely distributed throughout the Korean Peninsula, northeast China, Sakhalin, and Japan. Two ecological types are recognized in Japan based on flash and hatching time characteristics. The mitochondrial cytochrome oxidase II gene was surveyed by restriction fragment length polymorphism analysis for Japan (46 populations) and Korea (two populations). Eleven haplotypes were detected. Gene trees revealed that haplotypes between Japan and Korea are much more differentiated in nucleotide sequences (8.1%) than those within Japan (0.3-1.4%) and Korea (0.7%). Haplotypes between Honshu and Hokkaido are not separated as clades, and the two ecological types cannot be segregated from each other phylogenetically. We suggest that the Japanese populations of this species may have dispersed within one million years ago and that ecological differences may be the result of physiological adaptation to cold climates. PMID:15524308

Suzuki, Hirobumi; Sato, Yasushi; Ohba, Nobuyoshi; Bae, Jin-Sik; Jin, Byung-Rae; Sohn, Hung-Dae; Kim, Sam-Eun

2004-10-01

184

Isolation and characterization of a mutant protoporphyrinogen oxidase gene from Chlamydomonas reinhardtii conferring resistance to porphyric herbicides  

Microsoft Academic Search

In plant and algal cells, inhibition of the enzyme protoporphyrinogen oxidase (Protox) by the N-phenyl heterocyclic herbicide S-23142 causes massive protoporphyrin IX accumulation, resulting in membrane deterioration and cell lethality in the light. We have identified a 40.4 kb genomic fragment encoding S-23142 resistance by using transformation to screen an indexed cosmid library made from nuclear DNA of the dominant

Barbara L. Randolph-Anderson; Ryo Sato; Anita M. Johnson; Elizabeth H. Harris; Charles R. Hauser; Kenji Oeda; Fumiharu Ishige; Shoichi Nishio; Nicholas W. Gillham; John E. Boynton

1998-01-01

185

Molecular Systematics of Mahseers (Cyprinidae) in Malaysia Inferred from Sequencing of a Mitochondrial Cytochrome C Oxidase I (COI) Gene  

Microsoft Academic Search

This study examined the molecular systematics among three Mahseers (Tor douronensis, Tor tambroides and Neolissochilus stracheyi) using partial sequencing of a Cytochrome C Oxidase I (COI) mitochondrial DNA segment (466bp). The phylogenetic results using the Neighbour-Joining (NJ) method supported the monophyletic status (hence the taxonomic status) among the three putative Mahseer species. The close genetic relationships (0.1- 0.4%) found between

Yuzine B. Esa; Siti Shapor Siraj; Siti Khalijah Daud; Japning Jeffrine Rovie Ryan

2008-01-01

186

The polyphenol oxidase gene family in poplar: phylogeny, differential expression and identification of a novel, vacuolar isoform  

Microsoft Academic Search

Polyphenol oxidases (PPOs) are oxidative enzymes that convert monophenols and o-diphenols to o-quinones using molecular oxygen. The quinone products are highly reactive following tissue damage and can interact with cellular\\u000a constituents and cause oxidative browning and cross-linking. The induction of PPO in some plants as a result of wounding,\\u000a herbivore attack, or pathogen infection has implicated them in defense. However,

Lan T. Tran; C. Peter Constabel

187

Additive effect of polymorphisms in the ?2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.  

PubMed

Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the ?2 -adrenoceptor (ADRB2) gene, Trp64Arg in the ?3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function. PMID:24890187

Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing

2014-09-01

188

A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum  

Technology Transfer Automated Retrieval System (TEKTRAN)

The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

189

Co-occurrence of the Multicopper Oxidases Tyrosinase and Laccase in Lichens in Sub-order Peltigerineae  

PubMed Central

• Background and Aims Following previous findings of high extracellular redox activity in lichens and the presence of laccases in lichen cell walls, the work presented here additionally demonstrates the presence of tyrosinases. Tests were made for the presence of tyrosinases in 40 species of lichens, and from selected species their cellular location and molecular weights were determined. The effects of stress and inhibitors on enzyme activity were also studied. • Methods Tyrosinase and laccase activities were assayed spectrophotometrically using a variety of substrates. The molecular mass of the enzymes was estimated using polyacrylamide gel electrophoresis. • Key Results Extracellular tyrosinase and laccase activity was measured in 40 species of lichens from different taxonomic groupings and contrasting habitats. Out of 20 species tested from the sub-order Peltigerineae, all displayed significant tyrosinase and laccase activity, while activity was low or absent in other species tested. Representatives from both groups of lichens displayed low peroxidase activities. Identification of the enzymes as tyrosinases was confirmed by the ability of lichen thalli or leachates derived by shaking lichens in distilled water to metabolize substrates such as l-dihydroxyphenylalanine (DOPA), tyrosine and epinephrine readily in the absence of hydrogen peroxide, the sensitivity of the enzymes to the inhibitors cyanide, azide and hexylresorcinol, activation by SDS and having typical tyrosinase molecular masses of approx. 60?kDa. Comparing different species within the Peltigerineae showed that the activities of tyrosinases and laccase were correlated to each other. Desiccation and wounding stimulated laccase activity, while only wounding stimulated tyrosinase activity. • Conclusions Cell walls of lichens in sub-order Peltigerineae have much higher activities and a greater diversity of cell wall redox enzymes compared with other lichens. Possible roles of tyrosinases include melanization, removal of toxic phenols or quinones, and production of herbivore deterrents. PMID:16950829

LAUFER, ZSANETT; BECKETT, RICHARD P.; MINIBAYEVA, FARIDA V.

2006-01-01

190

Structural Insights into Sulfite Oxidase Deficiency  

SciTech Connect

Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

2005-01-01

191

Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria  

PubMed Central

Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

2013-01-01

192

The origin of the Tibetan Mastiff and species identification of Canis based on mitochondrial cytochrome c oxidase subunit I (COI) gene and COI barcoding.  

PubMed

DNA barcoding is an effective technique to identify species and analyze phylogenesis and evolution. However, research on and application of DNA barcoding in Canis have not been carried out. In this study, we analyzed two species of Canis, Canis lupus (n = 115) and Canis latrans (n = 4), using the cytochrome c oxidase subunit I (COI) gene (1545 bp) and COI barcoding (648 bp DNA sequence of the COI gene). The results showed that the COI gene, as the moderate variant sequence, applied to the analysis of the phylogenesis of Canis members, and COI barcoding applied to species identification of Canis members. Phylogenetic trees and networks showed that domestic dogs had four maternal origins (A to D) and that the Tibetan Mastiff originated from Clade A; this result supports the theory of an East Asian origin of domestic dogs. Clustering analysis and networking revealed the presence of a closer relative between the Tibetan Mastiff and the Old English sheepdog, Newfoundland, Rottweiler and Saint Bernard, which confirms that many well-known large breed dogs in the world, such as the Old English sheepdog, may have the same blood lineage as that of the Tibetan Mastiff. PMID:22440462

Li, Y; Zhao, X; Pan, Z; Xie, Z; Liu, H; Xu, Y; Li, Q

2011-12-01

193

The Core Promoter and Redox-sensitive Cis-elements as Key Targets for Inactivation of the Lysyl Oxidase Gene by Cadmium  

PubMed Central

Exposure of humans to cadmium (Cd) either from environmental contamination or from cigarette smoke, often induces lung emphysema and cancers. Lysyl oxidase (LOX), a copper-dependent enzyme essential for crosslinking of the extracellular matrix, displays antagonistic effects on emphysema and cancer pathogenesis. Our previous studies showed down-regulation of LOX in Cd-resistant (CdR) rat fetal lung fibroblasts (RFL6) derived from parental cells via long-term Cd exposure. The cloned rat LOX gene promoter ?804/?1 (relative to ATG) with the maximal promoter activity contains the Inr-DPE core promoter, putative NFI binding sites, metal response elements (MRE) and antioxidant response elements (ARE). ChIP assays reported here further characterize the rat LOX gene promoter in response to Cd. CdR cells exhibited enhanced methylation of CpG at the LOX core promoter region and reduced activities of the NFI binding sites and MRE, but increased activity of the ARE in a dose-dependent manner. The collective effect of Cd on the LOX promoter is trans-inhibition of the LOX gene as shown by suppression of histone H3 acetylation in the LOX core promoter region. Thus, the LOX core promoter and redox-sensitive cis-elements are key Cd targets for down-regulation of LOX relevant to mechanisms for Cd-induced emphysema and lung cancers. PMID:25741534

Li, Jianmin; Cheng, Guang; Zheng, Maoguen; Zhao, Yinzhi; Zhou, Jing; Li, Wande

2015-01-01

194

Alternative oxidase 1 (Aox1) gene expression in roots of Medicago truncatula is a genotype-specific component of salt stress tolerance.  

PubMed

Alternative oxidase (AOX) is the central component of the non-phosphorylating alternative respiratory pathway in plants and may be important for mitochondrial function during environmental stresses. Recently it has been proposed that Aox can be used as a functional marker for breeding stress tolerant plant varieties. This requires characterization of Aox alleles in plants with different degree of tolerance in a certain stress, affecting plant phenotype in a recognizable way. In this study we examined Aox1 gene expression levels in Medicago truncatula genotypes differing in salt stress tolerance, in order to uncover any correlation between Aox expression and tolerance to salt stress. Results demonstrated a specific induction of Aox1 gene expression in roots of the tolerant genotype that presented the lowest modulation in phenotypic and biochemical stress indices such as morphologic changes, protein level, lipid peroxidation and ROS generation. Similarly, in a previous study we reported that induction of antioxidant gene expression in the tolerant genotype contributed to the support of the antioxidant cellular machinery and stress tolerance. Correlation between expression patterns of the two groups of genes was revealed mainly in 48 h treated roots. Taken together, results from both experiments suggest that M. truncatula tolerance to salt stress may in part due to an efficient control of oxidative balance thanks to (i) induction of antioxidant systems and (ii) involvement of the AOX pathway. This reinforces the conclusion that differences in antioxidant mechanisms can be essential for salt stress tolerance in M. truncatula and possibly the corresponding genes, especially Aox, could be utilized as functional marker. PMID:23079242

Mhadhbi, Haythem; Fotopoulos, Vasileios; Mylona, Photini V; Jebara, Moez; Aouani, Mohamed Elarbi; Polidoros, Alexios N

2013-01-01

195

Molecular characterization of the Escherichia coli htrD gene: cloning, sequence, regulation, and involvement with cytochrome d oxidase.  

PubMed Central

The Escherichia coli htrD gene was originally isolated during a search for new genes required for growth at high temperature. Insertional inactivation of htrD leads to a pleiotropic phenotype characterized by temperature-sensitive growth in rich medium, H2O2 sensitivity, and sensitivity to cysteine. The htrD gene was cloned and sequenced, and an htrD::mini-Tn10 insertion mutation was mapped within this gene. The htrD gene was shown to encode a protein of approximately 17.5 kDa. Expression of the htrD gene was examined by using an phi (htrD-lacZ) operon fusion. It was found that htrD is not temperature regulated and therefore is not a heat shock gene. Further study revealed that htrD expression is increased under aerobic growth conditions. Conversely, under anaerobic growth conditions, htrD expression is decreased. In addition, a mutation within the nearby cydD gene was found to drastically reduce htrD expression under all conditions tested. These results indicate that htrD is somehow involved in aerobic respiration and that the cydD gene product is necessary for htrD gene expression. In agreement with this conclusion, htrD mutant bacteria are unable to oxidize the cytochrome d-specific electron donor N,N,N',N'-tetramethyl-p-phenylenediamine. Images PMID:8380150

Delaney, J M; Wall, D; Georgopoulos, C

1993-01-01

196

Subunit 1 of cytochrome oxidase from Neurospora crassa: nucleotide sequence of the coding gene and partial amino acid sequence of the protein.  

PubMed Central

A partial protein sequence (223 residues) of cytochrome oxidase subunit 1 from Neurospora crassa has been established. The nucleotide sequence of a cloned mitochondrial DNA segment, including the structural gene coding for the mature subunit 1 (CO I locus) was determined. In contrast to the situation in yeast, the CO I locus in N. crassa is not interrupted by long intervening sequences. A polypeptide of 555 residues with a mol. wt. of 61 000 has been deduced from the reading frame established by protein sequencing. With the exception of the C-terminal part of the polypeptide, the proposed sequences for subunit 1 of N. crassa, yeast, and man are largely homologous. Protein sequencing reveals that a region of low homology close to the C-terminal portion belongs to the structural gene in N. crassa. The DNA sequence coding for the prepiece , which characterizes the polypeptide precursor of the N. crassa subunit 1, has not yet been localized. A RNA species of approximately 6.8 kb has been identified as the CO I transcript. There is no indication of splicing of this large transcript. Images Fig. 6. PMID:6327266

Burger, G; Scriven, C; Machleidt, W; Werner, S

1982-01-01

197

The P450-4 Gene of Gibberella fujikuroi Encodes ent-Kaurene Oxidase in the Gibberellin Biosynthesis Pathway  

Microsoft Academic Search

At least five genes of the gibberellin (GA) biosynthesis pathway are clustered on chromosome 4 of Gibberella fujikuroi; these genes encode the bifunctional ent-copalyl diphosphate synthase\\/ent-kaurene synthase, a GA- specific geranylgeranyl diphosphate synthase, and three cytochrome P450 monooxygenases. We now describe a fourth cytochrome P450 monooxygenase gene (P450-4). Gas chromatography-mass spectrometry analysis of extracts of mycelia and culture fluid of

BETTINA TUDZYNSKI; PETER HEDDEN; ESTHER CARRERA; PAUL GASKIN

2001-01-01

198

Potentially novel copper resistance genes in copper-enriched activated sludge revealed by metagenomic analysis.  

PubMed

In this study, we utilized the Illumina high-throughput metagenomic approach to investigate diversity and abundance of both microbial community and copper resistance genes (CuRGs) in activated sludge (AS) which was enriched under copper selective stress up to 800 mg/L. The raw datasets (~3.5 Gb for each sample, i.e., the copper-enriched AS and the control AS) were merged and normalized for the BLAST analyses against the SILVA SSU rRNA gene database and self-constructed copper resistance protein database (CuRD). Also, the raw metagenomic sequences were assembled into contigs and analyzed based on Open Reading Frames (ORFs) to identify potentially novel copper resistance genes. Among the different resistance systems for copper detoxification under the high copper stress condition, the Cus system was the most enriched system. The results also indicated that genes encoding multi-copper oxidase played a more important role than those encoding efflux proteins. More significantly, several potentially novel copper resistance ORFs were identified by Pfam search and phylogenic analysis. This study demonstrated a new understanding of microbial-mediated copper resistance under high copper stress using high-throughput shotgun sequencing technique. PMID:25081552

Li, Li-Guan; Cai, Lin; Zhang, Xu-Xiang; Zhang, Tong

2014-12-01

199

Population genetic structure of malaria vector Anopheles stephensi using mitochondrial cytochrome oxidase II gene in Indian populations.  

PubMed

The genetic differentiation in A. stephensi based on haplotype diversity using Restriction Fragment Length Polymorphism and bysequencing of CO II gene across different localities in India has been analyzed. The presence of only one DraI restriction site in CO II gene conferred to haplotype B indicating that the gene is very much conserved and the gene flow is not affected even by a major geographical distance barrier. The sequencing and analysisof various population parameters revealed seven haplotypes in all populations. The West Bengal population was found to be more genetically diverse than others. The geographic distance between populations was found to be contributing to the genetic differentiation. The sign of demographic expansion were found in three of the five populations. The local geographic barriers were found to be ineffective in prevention of gene flow. PMID:25345249

Sharma, Arvind; Deshmukh, Arunaditya; Sharma, Richa; Kumar, Ashwani; Mukherjee, Sayantan; Chandra, G C; Gakhar, S K

2014-10-01

200

Association study between monoamine oxidase A (MAOA) gene polymorphisms and schizophrenia: lack of association with schizophrenia and possible association with affective disturbances of schizophrenia.  

PubMed

Monoamine oxidase A (MAOA) catalyzes monoamine neurotransmitters including dopamine, 5-hydroxytryptamine (5-HT, serotonin), and norepinephrine. MAOA also plays a key role in emotional regulation. The aim of this study was to investigate the associations between the exonic single nucleotide polymorphisms (SNPs) of the MAOA gene located on the X chromosome and schizophrenia. We also analyzed the relationships between these SNPs and the common clinical symptoms of schizophrenia such as persecutory delusion, auditory hallucinations, affective disturbances, and poor concentration. Two hundred seventy five Korean schizophrenia patients and 289 control subjects were recruited. Three SNPs [rs6323 (Arg294Arg), rs1137070 (Asp470Asp), and rs3027407 (3'-untranslated region)] of the MAOA gene were selected and genotyped by direct sequencing. The common clinical symptoms of schizophrenia according to the Operation Criteria Checklist were analyzed. Three examined SNPs showed no associations with male and female schizophrenia, respectively (p>0.05). In the analysis of the common clinical symptoms of schizophrenia patients, three examined SNPs were associated with affective disturbances, especially restricted affect and blunted affect in male schizophrenia, respectively (restricted affect, p=0.002, OR=2.71, 95% CI 1.45-5.00; blunted affect, p=0.009, OR 2.25, 95% CI 1.22-4.12). The SNPs were not associated with other clinical symptoms of schizophrenia (persecutory delusion, auditory hallucinations, and poor concentration). These results suggest that exonic SNPs (rs6323, rs1137070, and rs3027407) of the MAOA gene may be contributed to affective disturbances of Korean males schizophrenia, especially restricted affect and blunted affect. PMID:24510409

Kim, Su Kang; Park, Hae Jeong; Seok, Hosik; Jeon, Hye Sook; Chung, Joo-Ho; Kang, Won Sub; Kim, Jong Woo; Yu, Gyeong Im; Shin, Dong Hoon

2014-05-01

201

Silencing of hypoxia-inducible tumor suppressor lysyl oxidase gene by promoter methylation activates carbonic anhydrase IX in nasopharyngeal carcinoma  

PubMed Central

Lysyl oxidase (LOX) is an oxidative enzyme known to initiate the cross-linking of collagens and elastin, and suggested recently as a tumor suppressor for several tumor types including lung, pancreatic and gastric cancers. Previously we showed that LOX is strongly induced upon hypoxia in nasopharyngeal carcinoma (NPC) cell lines CNE2 and HONE1 but only slightly in HK1 and not in C666-1. Here, we further studied the regulatory mechanism and functions of LOX in NPC. LOX is widely expressed in human normal tissues with variations in expression levels. LOX was expressed in most NPC cell lines except for C666-1, while HK1 and FaDu (laryngeal cancer) only expressed low level of LOX. Methylation analysis showed that the LOX promoter was methylated in C666-1 and partially methylated in HK1. After demethylation with 5-aza-2’-deoxycytidine, LOX expression was reactivated along with increased unmethylated alleles. LOX promoter methylation was detected in 42/49 (85.7%) of NPC primary tumors but only 3/16 (18.75%) of nose swab samples from NPC patients. LOX overexpression reduced the clonogenicity and cell growth of NPC cells, and also inhibited the migration and invasion of the NPC cells. Carbonic anhydrase IX (CA9) mRNA level was obviously decreased in HK1 cells after transfection with LOX. The elevation of CA9 protein upon hypoxia was inhibited in LOX-transfected HK1 cells. The protein levels of an apoptosis marker cPARP were increased in LOX-transfected HK1 cells upon hypoxia treatment. Our data showed that silencing or down-regulation of LOX in NPC was due to its promoter methylation and LOX acts as a tumor suppressor in NPC. LOX silencing would facilitate NPC cells to escape from hypoxia-induced apoptosis and maintains a malignant and metastatic phenotype. PMID:25520868

Sung, Fion L; Cui, Yan; Hui, Edwin P; Li, Lili; Loh, Thomas KS; Tao, Qian; Chan, Anthony TC

2014-01-01

202

Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser  

SciTech Connect

Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

2010-01-01

203

Microbial oxidation of arsenite in a subarctic environment: diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser  

PubMed Central

Background Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10°C). Results Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25°C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. Conclusions The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10°C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates. PMID:20673331

2010-01-01

204

A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.  

PubMed

A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

2014-10-01

205

Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata).  

PubMed

Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

2010-10-01

206

Himantura tutul sp. nov. (Myliobatoidei: Dasyatidae), a new ocellated whipray from the tropical Indo-West Pacific, described from its cytochrome-oxidase I gene sequence.  

PubMed

It has been previously established that the Leopard Whipray, Himantura leoparda, consists of two genetically isolated, cryptic species, provisionally designated as 'Cluster 1' and 'Cluster 4' (Arlyza et al., Mol. Phylogenet. Evol. 65 (2013) [1]). Here, we show that the two cryptic species differ by the spotting patterns on the dorsal surface of adults: Cluster-4 individuals tend to have larger-ocellated spots, which also more often have a continuous contour than Cluster-1 individuals. We show that H. leoparda's holotype has the typical larger-ocellated spot pattern, designating Cluster 4 as the actual H. leoparda. The other species (Cluster 1) is described as Himantura tutul sp. nov. on the basis of the nucleotide sequence of a 655-base pair fragment of its cytochrome-oxidase I gene (GenBank accession No. JX263335). Nucleotide synapomorphies at this locus clearly distinguish H. tutul sp. nov. from all three other valid species in the H. uarnak species complex, namely H. leoparda, H. uarnak, and H. undulata. H. tutul sp. nov. has a wide distribution in the Indo-West Pacific, from the shores of eastern Africa to the Indo-Malay archipelago. H. leoparda under its new definition has a similarly wide Indo-West Pacific distribution. PMID:23608177

Borsa, Philippe; Durand, Jean-Dominique; Shen, Kang-Ning; Arlyza, Irma S; Solihin, Dedy D; Berrebi, Patrick

2013-02-01

207

Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder  

ERIC Educational Resources Information Center

The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

2009-01-01

208

Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls  

SciTech Connect

It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

Noethen, M.M.; Eggermann, K.; Propping, P. [Univ. of Bonn (Germany)] [and others

1995-10-01

209

Investigation of the population structure of the tick vector of Lyme disease Ixodes scapularis (Acari: Ixodidae) in Canada using mitochondrial cytochrome C oxidase subunit I gene sequences.  

PubMed

Genotyping of Ixodes scapularis Say (Acari: Ixodidae) ticks could enhance understanding of the occurrence and genotypes of I. scapularis-borne pathogens. We investigated the utility of mitochondrial (mt) Cytochrome C Oxidase subunit I gene (cox1) sequences as a tool for understanding the population structure of I. scapularis collected in Canada, where we also investigated the geographic occurrence of different cox1 haplotypes. Sequences obtained from 414 ticks were one of 55 unique haplotypes, most of which grouped into one of six clades. Demographic analysis suggested that cox1 sequences have haplotype and nucleotide diversity comparable to other mt genes. All haplotypes were connected in a single minimum spanning network tree. Despite low fixation index values there were significant differences in the frequency of occurrence of haplotypes of different clades among four geographic regions: 1) Alberta to western Ontario, 2) eastern Ontario, 3) Quebec, and 4) Atlantic Provinces; suggesting that cox1 sequences could reveal population structure differences between I. scapularis in geographically separated populations of northeastern and midwestern North America. Spatial clusters of ticks of the same haplotype identified in regions of southern Quebec and southern Ontario where I. scapularis is invading were consistent with population bottlenecks associated with founder events. These findings suggest that cox1 sequences are useful for the study of I. scapularis population structure, are of sufficient diversity that spatial analyses of haplotypes can be used to identify where I. scapularis is emerging in southern Canada, and may be useful for exploring differences between northeastern and midwestern populations of I. scapularis. PMID:23802450

Mechai, S; Feil, E J; Gariepy, T D; Gregory, T R; Lindsay, L R; Millien, V; Ogden, N H

2013-05-01

210

Lysyl Oxidases: Expression in the Fetal Membranes and Placenta  

Microsoft Academic Search

The cross-linking of the connective tissues in the fetal membranes and placenta is important for their tensile strength and elasticity. We have studied the expression of lysyl oxidase (LOX) because it is the classical enzyme responsible for the cross-linking of collagen and elastin. We have also studied the two recently described, genetically distinct lysyl oxidase-like genes and proteins, lysyl oxidase-like

S. Hein; S. Y. Yamamoto; K. Okazaki; C. Jourdan-Lesaux; K. Csiszar; G. D. Bryant-Greenwood

2001-01-01

211

Association of a Monoamine Oxidase-A Gene Promoter Polymorphism With ADHD and Anxiety in Boys With Autism Spectrum Disorder  

PubMed Central

The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned comparisons indicated that children with the 4- versus 3-repeat allele had significantly (p < 05) more severe parent-rated ADHD inattention and impulsivity, and more severe teacher-rated symptoms of generalized anxiety. Our results support a growing body of research indicating that concomitant behavioral disturbances in children with ASD warrant consideration as clinical phenotypes, but replication with independent samples is necessary to confirm this preliminary finding. PMID:18566880

Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli

2015-01-01

212

Gibberellin 3-oxidase Gene Expression Patterns Influence Gibberellin Biosynthesis, Growth, and Development in Pea1[W][OPEN  

PubMed Central

Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3?-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth. PMID:23979969

Reinecke, Dennis M.; Wickramarathna, Aruna D.; Ozga, Jocelyn A.; Kurepin, Leonid V.; Jin, Alena L.; Good, Allen G.; Pharis, Richard P.

2013-01-01

213

PPAR? and Proline Oxidase in Cancer  

PubMed Central

Proline is metabolized by its own specialized enzymes with their own tissue and subcellular localizations and mechanisms of regulation. The central enzyme in this metabolic system is proline oxidase, a flavin adenine dinucleotide-containing enzyme which is tightly bound to mitochondrial inner membranes. The electrons from proline can be used to generate ATP or can directly reduce oxygen to form superoxide. Although proline may be derived from the diet and biosynthesized endogenously, an important source in the microenvironment is from degradation of extracellular matrix by matrix metalloproteinases. Previous studies showed that proline oxidase is a p53-induced gene and its overexpression can initiate proline-dependent apoptosis by both intrinsic and extrinsic pathways. Another important factor regulating proline oxidase is peroxisome proliferator activated receptor gamma (PPAR?). Importantly, in several cancer cells, proline oxidase may be an important mediator of the PPAR?-stimulated generation of ROS and induction of apoptosis. Knockdown of proline oxidase expression by antisense RNA markedly decreased these PPAR?-stimulated effects. These findings suggest an important role in the proposed antitumor effects of PPAR?. Moreover, it is possible that proline oxidase may contribute to the other metabolic effects of PPAR?. PMID:18670615

Phang, James M.; Pandhare, Jui; Zabirnyk, Olga; Liu, Yongmin

2008-01-01

214

Molecular relationships and classification of several tufted capuchin lineages (Cebus apella, Cebus xanthosternos and Cebus nigritus, Cebidae), by means of mitochondrial cytochrome oxidase II gene sequences.  

PubMed

The morphological systematics of the tufted capuchins is confusing. In an attempt to clarify the complex systematics and phylogeography of this taxon, we provide a first molecular analysis. We obtained mitochondrial cytochrome oxidase II (mtCOII) gene sequences from 49 tufted capuchins that had exact geographic origins from diverse lineages in Colombia, Peru, Bolivia, French Guyana, Brazil, Argentina and Paraguay and that belonged to clearly recognized morphological taxa. This project had 4 main findings: (1) we determined 2 established and related taxa in the northern Amazon River area, which we named C. a. apella and C. a. fatuellus. C. a. apella is distributed from French Guyana until, at least, the Negro River in the northern Brazilian Amazon, whereas C. a. fatuellus is distributed throughout the Colombian Eastern Llanos and the northern Colombian Amazon. We also determined 2 other southern C. apella taxa, which we named C. a. macrodon and C. a. cay. C. a. macrodon has a western and southern Amazon distribution, while C. a. cay has a more southern distribution outside the Amazon basin. (2) In the upper Amazon basin, there is a unique lineage (C. a. macrocephalus) with 1 widely distributed haplotype. The 4 morphological subspecies (C. a. maranonis, C. a. macrocephalus, C. a. peruanus, C. a. pallidus), and maybe a fifth unknown subspecies, described in this area were molecularly undifferentiated at least for the mitochondrial gene analyzed. (3) Our molecular analysis determined that 1 individual of C. robustus fell into the lineage of C. a. macrocephalus. Therefore, this form does not receive any specific name. (4) The animals classified a priori as C. nigritus and C. xanthosternos (because of their morphological phenotypes and by their geographical origins) were clearly differentiated from the other specimens analyzed with the molecular marker employed. Therefore, we consider that these 2 lineages could be assigned the status of full species following the biological species definition. (5) In 2001, Groves described 4 tufted capuchin species (C. apella, C. libidinosus, C. nigritus and C. xanthosternos), while Silva Jr. determined 7 species (C. apella, C. macrocephalus, C. libidinosus, C. cay, C. nigritus, C. robustus and C. xanthosternos). The tests of Swofford-Olsen-Waddell-Hillis, of Shimodaira and Hasegawa and of Templeton did not fit with either of these two classificatory schemes, although Groves' scheme was better with regard to our data than that of Silva Jr. (6) All the temporal splits among the tufted capuchin taxa studied were estimated to have occurred during the last phase of the Pleistocene by using the ? statistic applied to the median joining haplotype network. PMID:23128150

Ruiz-García, Manuel; Castillo, Maria Ignacia; Lichilín-Ortiz, Nicolás; Pinedo-Castro, Myreya

2012-01-01

215

Expression of Pisum sativum PsAO3 gene, which encodes an aldehyde oxidase utilizing abscisic aldehyde, is induced under progressively but not rapidly imposed drought stress.  

PubMed

Aldehyde oxidase (AO; EC 1.2.3.1) catalyzes the final step of abscisic acid (ABA) biosynthesis, which is the oxidation of abscisic aldehyde (ABAld) to ABA. Gene expression analyses indicate that the stress-induced Pisum sativum PsAO? isoform, which effectively uses ABAld as a substrate, is encoded by the PsAO3 gene. PsAO3 was heterologously expressed in Pichia pastoris and the recombinant PsAO3 protein revealed substrate preferences highly similar to the native PsAO? protein present in the pea leaves and roots. Both proteins prefer indole-3-aldehyde and naphthaldehyde as substrates, although high activities against abscisic aldehyde and citral were also observed. The Km values of PsAO3 for naphthaldehyde and abscisic aldehyde (4.6 and 5.1 ?M, respectively) were the lowest among the substrates tested. PsAO3 activity was almost completely inhibited by potassium cyanide, diphenyleneiodonium, and methanol. Rapidly imposed drought stress did not increase the level of PsAO3 mRNA or activity of any AO isoform, although an enhanced ABA accumulation and induction of PsNCED2 and -3 (9-cis-epoxycarotenoid dioxygenase; EC 1.13.11.51) expression, both in the pea roots and leaves, was observed. During a progressively induced drought, the level of PsAO3 transcript and PsAO? activity increased significantly in the roots and leaves, whereas ABA accumulation occurred only in the leaves where it was accompanied by induction of the PsNCED3 expression. Therefore, we suppose that next to NCED, also AO (mainly PsAO?) might be involved in regulation of the drought-induced ABA synthesis. However, while the "constitutive activity" of PsAO? is sufficient for the fast generation of ABA under rapid drought stress, the enhanced PsAO? activity is required for the progressive and long-term ABA accumulation in the leaves under progressive drought stress. PMID:23876699

Zdunek-Zastocka, Edyta; Sobczak, Miros?aw

2013-10-01

216

Arsenite oxidase also functions as an antimonite oxidase.  

PubMed

Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

Wang, Qian; Warelow, Thomas P; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H; Lehr, Corinne R; Bothner, Brian; McDermott, Timothy R; Santini, Joanne M; Wang, Gejiao

2015-03-15

217

Localizing NADPH Oxidase-Derived ROS  

NSDL National Science Digital Library

Reactive oxygen species (ROS) function as signaling molecules to mediate various biological responses, including cell migration, growth, and gene expression. ROS are diffusible and short-lived molecules. Thus, localizing the ROS signal at the specific subcellular compartment is essential for activating redox signaling events after receptor activation. NADPH (nicotinamide adenine dinucleotide phosphate) oxidase is one of the major sources of ROS in vasculature; it consists of a catalytic subunit (Nox1, Nox2, Nox3, Nox4, or Nox5), p22phox, p47phox, p67phox, and the small guanosine triphosphatase Rac1. Targeting of NADPH oxidase to focal complexes in lamellipodia and membrane ruffles through the interaction of p47phox with the scaffold proteins TRAF4 and WAVE1 provides a mechanism for achieving localized ROS production, which is required for directed cell migration. ROS are believed to inactivate protein tyrosine phosphatases, which concentrate in specific subcellular compartments, thereby establishing a positive feedback system that activates redox signaling pathways to promote cell movement. Additionally, ROS production may be localized through interactions of NADPH oxidase with signaling platforms associated with lipid rafts and caveolae, as well as with endosomes. There is also evidence that NADPH oxidase is found in the nucleus, indicating its involvement in redox-responsive gene expression. This review focuses on targeting of NADPH oxidase to discrete subcellular compartments as a mechanism of localizing ROS and activation of downstream redox signaling events that mediate various cell functions.

Masuko Ushio-Fukai (IL; University of Illinois College of Medicine, Chicago REV)

2006-08-22

218

Cholesterol oxidase: physiological functions  

PubMed Central

An important aspect of catalysis by cholesterol oxidase (3?-hydroxysteroid oxidase) is the nature of its association with the lipid bilayer that contains the sterol substrate. Efficient catalytic turnover is affected by the association of the protein with the membrane as well as the solubility of the substrate in the lipid bilayer. In this review, the binding of cholesterol oxidase to the lipid bilayer, its turnover of substrates presented in different physical environments, and how these conditions affect substrate specificity are discussed. The physiological functions of the enzyme in bacterial metabolism, pathogenesis, and macrolide biosynthesis are reviewed in this context. PMID:19843168

Kreit, Joseph; Sampson, Nicole S.

2009-01-01

219

Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA  

PubMed Central

Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.

2011-01-01

220

Regulation by biotic and abiotic stress of a wheat germin gene encoding oxalate oxidase, a H2O2-producing enzyme  

Microsoft Academic Search

Germins and germin-like proteins (GLPs) constitute a ubiquitous family of plant proteins that seem to be involved in many developmental and stress-related processes. Wheat germin has been extensively studied at the biochemical level: it is found in the apoplast and the cytoplasm of germinating embryo cells and it has oxalate oxidase activity (EC 1.2.3.4). Germin synthesis can also be induced

Anne Berna; François Bernier

1999-01-01

221

Copper Deficiency Leads to Anemia, Duodenal Hypoxia, Upregulation of HIF-2? and Altered Expression of Iron Absorption Genes in Mice  

PubMed Central

Iron and copper are essential trace metals, actively absorbed from the proximal gut in a regulated fashion. Depletion of either metal can lead to anemia. In the gut, copper deficiency can affect iron absorption through modulating the activity of hephaestin - a multi-copper oxidase required for optimal iron export from enterocytes. How systemic copper status regulates iron absorption is unknown. Mice were subjected to a nutritional copper deficiency-induced anemia regime from birth and injected with copper sulphate intraperitoneally to correct the anemia. Copper deficiency resulted in anemia, increased duodenal hypoxia and Hypoxia inducible factor 2? (HIF-2?) levels, a regulator of iron absorption. HIF-2? upregulation in copper deficiency appeared to be independent of duodenal iron or copper levels and correlated with the expression of iron transporters (Ferroportin - Fpn, Divalent Metal transporter – Dmt1) and ferric reductase – Dcytb. Alleviation of copper-dependent anemia with intraperitoneal copper injection resulted in down regulation of HIF-2?-regulated iron absorption genes in the gut. Our work identifies HIF-2? as an important regulator of iron transport machinery in copper deficiency. PMID:23555700

Matak, Pavle; Zumerle, Sara; Mastrogiannaki, Maria; El Balkhi, Souleiman; Delga, Stephanie; Mathieu, Jacques R. R.; Canonne-Hergaux, François; Poupon, Joel; Sharp, Paul A.; Vaulont, Sophie; Peyssonnaux, Carole

2013-01-01

222

Electrochemical identification of artificial oligonucleotides related to bovine species. Potential for identification of species based on mismatches in the mitochondrial cytochrome C1 oxidase gene.  

PubMed

Our studies show that electrochemical impedance spectroscopy (EIS) and scanning electrochemical microscopy (SECM) of films of ds-DNA on gold allow us to distinguish between mitochondrial DNA fragments of the cytochrome c(1) oxidase (mt-Cox1) of three related species of the subfamily 'Bovinae' (Bos taurus, Bison bison, and Bison bonasus). In EIS, a perfectly matched DNA gives rise to a considerably larger charge transfer resistance R(ct) compared to mismatched pairings. Differences in charge transfer resistance, ?R(ct), before and after the addition of Zn(2+) ions provide an additional tool for identification. In addition, all ds-DNA films were studied by SECM and their kinetic parameters were determined. Perfectly matched ds-DNAs are readily distinguished from mismatched duplexes by their lower rate constants. Our system can be used multiple times by dehybridization and rehybridization of capture strands up to the 250 pmole level. PMID:21847503

Shamsi, Mohtashim Hassan; Kraatz, Heinz-Bernhard

2011-11-21

223

NADPH Oxidase 4 Regulates Cardiomyocyte Differentiation via Redox Activation of c-Jun Protein and the cis-Regulation of GATA-4 Gene Transcription*  

PubMed Central

NADPH oxidase 4 (Nox4) generates reactive oxygen species (ROS) that can modulate cellular phenotype and function in part through the redox modulation of the activity of transcription factors. We demonstrate here the potential of Nox4 to drive cardiomyocyte differentiation in pluripotent embryonal carcinoma cells, and we show that this involves the redox activation of c-Jun. This in turn acts to up-regulate GATA-4 expression, one of the earliest markers of cardiotypic differentiation, through a defined and highly conserved cis-acting motif within the GATA-4 promoter. These data therefore suggest a mechanism whereby ROS act in pluripotential cells in vivo to regulate the initial transcription of critical tissue-restricted determinant(s) of the cardiomyocyte phenotype, including GATA-4. The ROS-dependent activation, mediated by Nox4, of widely expressed redox-regulated transcription factors, such as c-Jun, is fundamental to this process. PMID:23589292

Murray, Thomas V. A.; Smyrnias, Ioannis; Shah, Ajay M.; Brewer, Alison C.

2013-01-01

224

NADPH oxidases are involved in differentiation and pathogenicity in Botrytis cinerea  

Microsoft Academic Search

Nicotinamide adenine dinucleotide (NADPH) oxidases have been shown to be involved in various differentiation processes in fungi. We investigated the role of two NADPH oxidases in the necrotrophic phytopathogenic fungus, Botrytis cinerea. The genes bcnoxA and bcnoxB were cloned and characterized; their deduced amino acid sequences show high homology to fungal NADPH oxidases. Analyses of single and double knock-out mutants

Nadja Segmüller; Leonie Kokkelink; Sabine Giesbert; Daniela Odinius; Jan van Kan; Paul Tudzynski

2008-01-01

225

Rac GTPase and the Regulation of NADPH Oxidase in Rice Innate Immunity Response  

Microsoft Academic Search

Reactive oxygen species (ROS) produced by NADPH oxidase play critical roles in various plant growth, development and defense\\u000a against pathogens. Plant NADPH oxidases are called regulatory burst oxidase homolog or Rboh. Although Rboh has been isolated\\u000a from numerous plant species, the molecular mechanism of the regulation of its enzymatic activity remains unclear. All rboh genes identified to date possess a

Hann Ling Wong; Tsutomu Kawasaki; Ko Shimamoto

226

Exploiting algal NADPH oxidase for biophotovoltaic energy  

E-print Network

synthetic gene construct containing the complete RBO1 gene model (Table 1). Three independently transformed strains were selected by antibiotic resistance and confirmed for RBO1 by PCR (Figure 5a). These were compared for light-dependent O#1;#3;2 production... the electron transport proteins that contribute power output in the devices remains a fundamental goal in the development of these biological solar cells. Plasma membrane NADPH oxidases (NOX) are found in animals, plants and algae. They are encoded in animals...

Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; Bombelli, Paolo; Howe, Christopher J.; Merchant, Sabeeha S.; Davies, Julia M.; Smith, Alison G.

2015-01-29

227

NADPH oxidases and cancer.  

PubMed

The mechanism by which reactive oxygen species (ROS) are produced by tumour cells remained incompletely understood until the discovery over the last 15 years of the family of NADPH oxidases (NOXs 1-5 and dual oxidases DUOX1/2) which are structural homologues of gp91phox, the major membrane-bound component of the respiratory burst oxidase of leucocytes. Knowledge of the roles of the NOX isoforms in cancer is rapidly expanding. Recent evidence suggests that both NOX1 and DUOX2 species produce ROS in the gastrointestinal tract as a result of chronic inflammatory stress; cytokine induction (by interferon-?, tumour necrosis factor ?, and interleukins IL-4 and IL-13) of NOX1 and DUOX2 may contribute to the development of colorectal and pancreatic carcinomas in patients with inflammatory bowel disease and chronic pancreatitis, respectively. NOX4 expression is increased in pre-malignant fibrotic states which may lead to carcinomas of the lung and liver. NOX5 is highly expressed in malignant melanomas, prostate cancer and Barrett's oesophagus-associated adenocarcinomas, and in the last it is related to chronic gastro-oesophageal reflux and inflammation. Over-expression of functional NOX proteins in many tissues helps to explain tissue injury and DNA damage from ROS that accompany pre-malignant conditions, as well as elucidating the potential mechanisms of NOX-related damage that contribute to both the initiation and the progression of a wide range of solid and haematopoietic malignancies. PMID:25818486

Roy, Krishnendu; Wu, Yongzhong; Meitzler, Jennifer L; Juhasz, Agnes; Liu, Han; Jiang, Guojian; Lu, Jiamo; Antony, Smitha; Doroshow, James H

2015-06-01

228

Reduced renal responses to nitric oxide synthase inhibition in mice lacking the gene for gp91phox subunit of NAD(P)H oxidase.  

PubMed

Both short-term and long-term nitric oxide (NO) blockade were shown to cause an increase in O(2)(-) activity. To assess the contribution of such enhanced O(2)(-) activity in the kidney, responses to administration of the NO synthase inhibitor nitro-L-arginine methyl ester (L-NAME; 200 microg.min(-1).kg body wt(-1)) were assessed in knockout mice the lacking NAD(P)H oxidase subunit gp91(phox) (KO; n = 10) and in wild-type (WT; n = 10) mice. Renal blood flow (RBF) and glomerular filtration rate (GFR) were determined by PAH and inulin clearances, respectively. Baseline RBF was higher in KO compared with WT mice (5.8 +/- 0.5 vs. 4.5 +/- 0.3 ml.min(-1).g(-1); P < 0.04) without significant differences in GFR (0.62 +/- 0.04 vs. 0.73 +/- 0.05 ml.min(-1).g(-1)) and in mean arterial pressure (MAP; 91 +/- 6 vs. 88 +/- 4 mmHg). L-NAME infusion for 60 min caused similar increases in MAP (114 +/- 6 vs. 113 +/- 3 mmHg) in both groups but resulted in a lesser degree of reduction in RBF in KO compared with WT mice (-7 +/- 3 vs. -17 +/- 3%; P < 0.02), although GFR remained unchanged in both groups. The natriuretic response to systemic L-NAME infusion was attenuated in KO compared with WT mice (Delta: 3.1 +/- 0.7 vs. 5.2 +/- 0.6 micromol.min(-1).g(-1)). L-NAME increased urinary 8-isoprostane excretion rate in WT (5.9 +/- 1 to 7.7 +/- 1 pg.min(-1).g(-1); P < 0.02) but not in KO mice (5.6 +/- 1 to 4.9 +/- 0.3 pg.min(-1).g(-1)). In contrast, responses to another vasoconstrictor, norepinephrine, were similar in both strains of mice. These data indicate that activation of NAD(P)H oxidase results in the enhancement of O(2)(-) activity that influences renal hemodynamics and excretory function in the condition of NO deficiency. PMID:18596078

Haque, Mohammed Z; Majid, Dewan S A

2008-09-01

229

Improved detection of malaria cases in island settings of Vanuatu and Kenya by PCR that targets the Plasmodium mitochondrial cytochrome c oxidase III (cox3) gene.  

PubMed

Detection of sub-microscopic parasitemia is crucial for all malaria elimination programs. PCR-based methods have proven to be sensitive, but two rounds of amplification (nested PCR) are often needed to detect the presence of Plasmodium DNA. To simplify the detection process, we designed a nested PCR method whereby only the primary PCR is required for the detection of the four major human Plasmodium species. Primers designed for the detection of the fifth species, Plasmodium knowlesi, were not included in this study due to the absence of appropriate field samples. Compared to the standard 18S rDNA PCR method, our cytochrome c oxidase III (cox3) method detected 10-50% more cases while maintaining high sensitivities (1.00) for all four Plasmodium species in our samples from Vanuatu (n=77) and Kenya (n=76). Improvement in detection efficiency was more substantial for samples with sub-microscopic parasitemia (54%) than those with observable parasitemia (10-16%). Our method will contribute to improved malaria surveillance in low endemicity settings. PMID:25256904

Isozumi, Rie; Fukui, Mayumi; Kaneko, Akira; Chan, Chim W; Kawamoto, Fumihiko; Kimura, Masatsugu

2015-06-01

230

TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4  

SciTech Connect

Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D. [Department of Biochemistry, Whitaker Cardiovascular Institute, Boston University School of Medicine, 715 Albany Street, Boston, MA 02118 (United States); Ravid, Katya [Department of Biochemistry, Whitaker Cardiovascular Institute, Boston University School of Medicine, 715 Albany Street, Boston, MA 02118 (United States)], E-mail: ravid@biochem.bumc.bu.edu

2008-10-24

231

Modifications of laccase activities of copper efflux oxidase, CueO by synergistic mutations in the first and second coordination spheres of the type I copper center.  

PubMed

The redox potential of type I copper in the Escherichia coli multicopper oxidase CueO was shifted in the positive or negative direction as a result of the single, double, and triple mutations in the first and second coordination spheres: the formation of the NH···S(-)(Cys500 ligand) hydrogen bond, the breakdown of the NH(His443 ligand)···O(-)(Asp439) hydrogen bond, and the substitution of the Met510 ligand for the non-coordinating Leu or coordinating Gln. Laccase activities of CueO were maximally enhanced 140-fold by virtue of the synergistic effect of mild mutations at and at around the ligand groups to type I copper. PMID:23337502

Kataoka, Kunishige; Kogi, Hiroki; Tsujimura, Seiya; Sakurai, Takeshi

2013-02-15

232

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis  

Microsoft Academic Search

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference

BAVESH D. KANA; EDWARD A. WEINSTEIN; DAVID AVARBOCK; STEPHANIE S. DAWES; HARVEY RUBIN; VALERIE MIZRAHI

2001-01-01

233

Hydrogen peroxide-producing NADH oxidase (nox-1) from Lactococcus lactis  

E-print Network

Hydrogen peroxide-producing NADH oxidase (nox-1) from Lactococcus lactis Rongrong Jiang and Andreas applied the sequence comparison-based approach to develop a novel hydrogen peroxide-forming NADH oxidase (nox-1) from Lactococcus lactis (L. lactis) that reduces oxygen to hydrogen peroxide. The nox-1 gene

234

Alternative oxidase and plastoquinol terminal oxidase in marine prokaryotes of the Sargasso Sea.  

PubMed

Alternative oxidase (AOX) represents a non-energy conserving branch in mitochondrial electron transport while plastoquinol terminal oxidase (PTOX) represents a potential branch in photosynthetic electron transport. Using a metagenomics dataset, we have uncovered numerous and diverse AOX and PTOX genes from the Sargasso Sea. Sequence similarity, synteny and phylogenetic analyses indicate that the large majority of these genes are from prokaryotes. AOX appears to be widely distributed among marine Eubacteria while PTOX is widespread among strains of cyanobacteria closely related to the high-light adapted Prochlorococcus marinus MED4, as well as Synechococcus. The wide distribution of AOX and PTOX in marine prokaryotes may have important implications for productivity in the world's oceans. PMID:15777727

McDonald, Allison E; Vanlerberghe, Greg C

2005-04-11

235

Cloning and characterization of a fifth human lysyl oxidase isoenzyme: the third member of the lysyl oxidase-related subfamily with four scavenger receptor cysteine-rich domains  

Microsoft Academic Search

We report the complete cDNA sequence of the human lysyl oxidase-like 4 (LOXL4) gene, a new member of the lysyl oxidase (LO) gene family. The predicted polypeptide is 756 amino acids long, including a 24-residue signal peptide. The C-terminal region contains a LO domain similar to those of LOX, LOXL, LOXL2 and LOXL3. The N-terminal region has four subregions similar

Joni M. Mäki; Hilkka Tikkanen; Kari I. Kivirikko

2001-01-01

236

Long term liver specific glucokinase gene defect induced diabetic cardiomyopathy by up regulating NADPH oxidase and down regulating insulin receptor and p-AMPK  

PubMed Central

Background The liver-specific glucokinase knockout (gckw/–) mouse experiences long-term hyperglycemia and insulin resistance. This study was designed to evaluate the functional and structural changes in the myocardium of 60 week-old gckw/– mice, and to investigate the effect of rosiglitazone on the myocardium in this model. Methods 60 week-old gckw/– mice were randomly divided into 3 groups: gckw/–, gckw/– mice treated with insulin (1 U/kg) and gckw/– mice treated with rosiglitazone (18 mg/kg). Insulin or rosiglitazone treatment was for 4 weeks. Gckw/w litermates were used as controls. Echocardiography, electrocardiogram, biochemical, histopathological, ultrastructural, real time PCR and Western blot studies were performed to examine for structural and functional changes. Results Long-term liver-specific gck knockout in mice elicits hyperglycaemia and insulin resistance. Compared to age matched gckw/w mice, 60 week-old gckw/– mice showed decreased LV internal dimension, increased posterior wall thickness, lengthened PR and QRS intervals, up-regulated MLC2 protein expression, decreased SOD activity, increased MDA levels and up-regulated Cyba mRNA. Morphological studies revealed that there was an increase in the amount of PAS and Masson positively stained material, as did the number and proportion of the cell occupied by mitochondria in the gckw/– mice. Western blot analysis revealed that the levels of the insulin receptor, Akt, phosphorylated AMPK beta and phosphorylated ACC were reduced in gckw/– mice. These effects were partly attenuated or ablated by treatment with rosiglitazone. Conclusions Our results indicate that changes in the myocardium occur in the liver-specific glucokinase knockout mouse and suggest that reduced glucokinase expression in the liver may induce diabetic cardiomyopathy by up regulating NADPH oxidase and down regulating insulin receptor and p-AMPK protein levels. Rosiglitazone treatment may protect against diabetic cardiomyopathy by altering the levels of a set of proteins involved in cardiac damage. PMID:24447392

2014-01-01

237

Molecular cloning and characterization of the NADPH oxidase from the kuruma shrimp, Marsupenaeus japonicus: early gene up-regulation after Vibrio penaeicida and poly(I:C) stimulations in vitro.  

PubMed

Free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) are involved in many physiological processes. In humans, there are 5 homologs of nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (Noxes) that generate superoxide (O(2)(-)), which can dismute to produce ROS, and play significant roles in innate immunity and cell proliferation. Though Noxes have been identified in vertebrates (humans and fishes) and some insects, there are very few reports investigating Noxes in crustaceans. In the present study, we describe the entire cDNA sequence (4216 bp) of Marsupenaeus japonicus (kuruma shrimp) Nox (MjNox) generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjNox encodes a protein of 1280 amino acids with an estimated mass of 146 kDa that has 46.8% sequence homology with the Nox gene of the fruit fly, Drosophila melanogaster. Highly conserved amino acid sequences were observed in the NADPH binding domain. Transcriptional analysis revealed that MjNox mRNA is highly expressed in the lymphoid organ, hepatopancreas and hemocytes of the healthy kuruma shrimp. In the hemocytes, MjNox expression reached its peak 4 h after stimulation with either Vibrio penaeicida or poly(I:C) and decreased to its normal level after 12 h.This study is the first to identify and clone a Nox family member (MjNox) from a crustacean species. PMID:22133377

Inada, Mari; Sudhakaran, Raja; Kihara, Keisuke; Nishi, Junichi; Yoshimine, Maki; Mekata, Tohru; Kono, Tomoya; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2012-02-01

238

Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.  

PubMed

The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa

2015-04-01

239

Exploring the utility of phylogenetic analysis of cytochrome oxidase gene subunit I as a complementary tool to classical taxonomical identification of phlebotomine sand fly species (Diptera, Psychodidae) from southern Europe.  

PubMed

Phlebotomine sand flies (Diptera, Psychodidae) are known to be vectors of several pathogens such as Leishmania and Phlebovirus genera. The identification of phlebotomine sand fly species is currently based on morphological characters, and requires considerable taxonomic expertise and skilfulness, but may be complemented by DNA-based analyses for (i) accurate species identification and (ii) for estimating sand fly diversity. The aim of this study was to evaluate the utility of mitochondrial cytochrome oxidase gene subunit I (cox1) sequence analysis as a complementary tool to classical taxonomical for the identification of the most prevalent phlebotomine sand fly species from southern Europe (i.e. Phlebotomus ariasi, P. perniciosus, P. sergenti and Sergentomyia minuta). Phylogenetic analyses of cox1 sequences allowed conclusive assignment of most of the sand flies into individual species, and revealed the genetic heterogeneity that characterizes some of the identified genetic clusters. Nevertheless, it showed some limitations, as it failed to (i) allocate correctly all of all species of a given subgenus to a single lineage, or (ii) conclusively identify sequences amplified from individuals classified morphologically as P. ariasi. A more extensive analysis of cox1 sequences together with morphometric characterization of specimens from different geographic areas/regions might be useful for the correct assessment of the phylogenetic relationship within the P. ariasi/P. chadlii cluster and/or help to ascertain the usefulness of cox1 for molecular taxonomy of sand flies. PMID:25617635

Maia, Carla; Parreira, Ricardo; Cristóvão, José Manuel; Afonso, Maria Odete; Campino, Lenea

2015-04-01

240

After-ripening alters the gene expression pattern of oxidases involved in the ethylene and gibberellin pathways during early imbibition of Sisymbrium officinale L. seeds  

Microsoft Academic Search

After-ripening (AR) in Sisymbrium officinale seeds altered SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 gene expression. Except for SoGA20ox2 expression, which sharply diminished, the expression of the other genes rose during development, particularly that of SoACS7. In contrast, only the SoACO2 and SoGA2ox6 transcripts increased with seed desiccation; the others decreased. AR increased the SoGA3ox2 transcript in dry seed, but dramatically

Raquel Iglesias-Fernandez; Angel Matilla

2009-01-01

241

Down-regulation of acyl-CoA oxidase gene expression and increased NF-kappaB activity in etomoxir-induced cardiac hypertrophy  

Microsoft Academic Search

Activation of nuclear factor- ? B (NF- ? B) is required for hypertrophic growth of cardiomyocytes. Etomoxir is an irreversible inhibitor of carnitine palmitoyltransferase I (CPT-I) that activates peroxisome proliferator-activated re- ceptor ? (PPAR ? ) and induces cardiac hypertrophy through an unknown mechanism. We studied the mRNA expression of genes involved in fatty acid oxidation in the heart of

A. Cabrero; Manuel Merlos; Juan C. Laguna; Manuel Vázquez Carrera

2003-01-01

242

Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells  

SciTech Connect

Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

Kim, Dong Joon [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of); College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of); Kang, Dong Chul [Ilsong Institute of Life Science, Hallym University, Anyang 431-060 (Korea, Republic of); Sang, Byung Chan [College of Agricultural Life and Sciences, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Myung, Pyung Keun [College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Park, Kyung Chan [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of)], E-mail: kpark@kribb.re.kr; Yeom, Young Il [Medical Genomics Research Center, KRIBB, P.O. Box 115, Yusong, Daejeon 305-806 (Korea, Republic of)], E-mail: yeomyi@kribb.re.kr

2008-09-05

243

Cloning and mutagenesis of genes encoding the cytochrome bd terminal oxidase complex in Azotobacter vinelandii: mutants deficient in the cytochrome d complex are unable to fix nitrogen in air.  

PubMed Central

The genome of Azotobacter vinelandii contains DNA sequences homologous to the structural genes for the Escherichia coli cytochrome bd terminal oxidase complex. Two recombinant clones bearing cydA- and cydB-like sequence were isolated from an A. vinelandii gene library and subcloned into the plasmid vector pACYC184. Physical mapping demonstrated that the cydA- and cydB-like regions in A. vinelandii are contiguous. The cydAB and flanking DNA was mutagenized by the insertion of Tn5-B20. Mutations in the cydB-hybridizing region resulted in the loss of spectral features associated with cytochromes b595 and d. A new locus, cydB, encoding cytochromes b595 and d in A. vinelandii is proposed. A second region adjacent to cydB was also involved in expression of the cytochrome bd complex in A. vinelandii, since mutations in this region resulted in an increase in the levels of both cytochrome b595 and cytochrome d. The regions involved in expression of the cytochrome bd complex and cydB are transcribed in the same direction. Mutants deficient in cytochromes b595 and d were unable to grow on N-deficient medium when incubated in air but could fix nitrogen when the environmental O2 concentration was reduced to 1.5% (vol/vol). It is proposed that the branch of the respiratory chain terminated by the cytochrome bd complex supports the high respiration rates required for the respiratory protection of nitrogenase. Images PMID:2170336

Kelly, M J; Poole, R K; Yates, M G; Kennedy, C

1990-01-01

244

Overexpression of a GmCnx1 Gene Enhanced Activity of Nitrate Reductase and Aldehyde Oxidase, and Boosted Mosaic Virus Resistance in Soybean  

PubMed Central

Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 ?g g-1 h-1 and30 pmol L-1, respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

2015-01-01

245

The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes  

PubMed Central

Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

2013-01-01

246

Isopentenyl Transferase and Cytokinin Oxidase\\/Dehydrogenase Gene Family Members are Differentially Expressed During Pod and Seed Development in Rapid-cycling Brassica  

Microsoft Academic Search

The plant hormone group, the cytokinins, regulates many stages of plant growth and development. Regulation includes that of\\u000a cell division and enhancement of sink strength, both of which are important processes in seed development and embryonic growth.\\u000a Two gene families play a key role in maintaining cytokinin homeostasis: isopentenyl transferase (IPT), which catalyzes the\\u000a rate-limiting step in the formation of

David O'KeefeJiancheng; Jiancheng Song; Paula E. Jameson

2011-01-01

247

The Escherichia coli CydX Protein Is a Member of the CydAB Cytochrome bd Oxidase Complex and Is Required for Cytochrome bd Oxidase Activity  

PubMed Central

Cytochrome bd oxidase operons from more than 50 species of bacteria contain a short gene encoding a small protein that ranges from ?30 to 50 amino acids and is predicted to localize to the cell membrane. Although cytochrome bd oxidases have been studied for more than 70 years, little is known about the role of this small protein, denoted CydX, in oxidase activity. Here we report that Escherichia coli mutants lacking CydX exhibit phenotypes associated with reduced oxidase activity. In addition, cell membrane extracts from ?cydX mutant strains have reduced oxidase activity in vitro. Consistent with data showing that CydX is required for cytochrome bd oxidase activity, copurification experiments indicate that CydX interacts with the CydAB cytochrome bd oxidase complex. Together, these data support the hypothesis that CydX is a subunit of the CydAB cytochrome bd oxidase complex that is required for complex activity. The results of mutation analysis of CydX suggest that few individual amino acids in the small protein are essential for function, at least in the context of protein overexpression. In addition, the results of analysis of the paralogous small transmembrane protein AppX show that the two proteins could have some overlapping functionality in the cell and that both have the potential to interact with the CydAB complex. PMID:23749980

VanOrsdel, Caitlin E.; Bhatt, Shantanu; Allen, Rondine J.; Brenner, Evan P.; Hobson, Jessica J.; Jamil, Aqsa; Haynes, Brittany M.; Genson, Allyson M.

2013-01-01

248

Characterisation of full-length mitochondrial copies and partial nuclear copies (numts) of the cytochrome b and cytochrome c oxidase subunit I genes of Toxoplasma gondii, Neospora caninum, Hammondia heydorni and Hammondia triffittae (Apicomplexa: Sarcocystidae).  

PubMed

Genomic DNA was extracted from three oocyst isolates of Hammondia triffittae from foxes and two oocyst isolates of Hammondia heydorni from dogs, as well as from cell culture-derived tachyzoites of Toxoplasma gondii (RH strain) and Neospora caninum (NC-Liverpool strain), and examined by PCR with primers targeting the cytochrome b (cytb) and the cytochrome c oxidase subunit I (cox1) genes in order to characterise both genes and, if possible, the remainder of the mitochondrial genome of these species. Several primers were designed and used in various combinations to amplify regions within and between both genes and to determine gene order. When certain forward primers targeting cytb were used in combination with certain reverse primers targeting cox1, two overlapping sequences were obtained for each species and isolate studied, which showed that a full-length copy of cytb was followed 36-37 bp downstream by a full-length copy of cox1, and these sequences are believed to represent the true mitochondrial genes and the gene order in the mitochondrial genome of the four species examined. The cytb of T. gondii, N. caninum, H. heydorni and H. triffittae comprised a total of 1,080 bp (359 amino acids) and used ATG and TAA as start and stop codon, respectively. The cox1 of these species also used TAA as stop codon, whereas the most likely start codon was ATG, resulting in a gene comprising 1,491 bp (496 amino acids). Pair-wise sequence comparisons based on either cytb or cox1 clearly separated T. gondii from N. caninum and both of these species from the two Hammondia species, whereas the latter two species were 100 % identical at cytb and shared 99.3 % identity at cox1. Phylogenetic analyses using the maximum-likelihood method confirmed these findings and placed T. gondii in a clade separate from the three other species and all four Toxoplasmatinae in a sister clade to Eimeria spp. PCR with other primers and/or primer pairs than those used to obtain the full-length mitochondrial genes yielded several types of about 1-1.5 kb long sequences, which comprised stretches of the primer-targeted genes at both ends and an intervening non-coding sequence of various length and composition. Thus, portions of cytb could be found both upstream and downstream from portions of cox1 and portions of the same gene could be found adjacent to each other (cytb?cox1; cox1?cytb; cytb?cytb; cox1?cox1). Sequence comparisons revealed that some of these gene fragments were truncated genes, whereas others included the putative start or stop codon of the full-length mitochondrial genes. From the nature of the gene fragments and/or their flanking sequences, they are assumed to be located on the chromosomes of the nuclear genome and to represent nuclear mitochondrial DNA segments (numts) or pseudogenes. In the four species examined, there were no nucleotide differences between the full-length mitochondrial copies of cytb and cox1 and their various incomplete nuclear counterparts. With a few exceptions, identical numt types and closely similar flanking sequences were obtained for all four species, which would indicate that the original transfer of these mitochondrial genes to the nuclear genome and/or the majority of any subsequent rearrangements of these gene fragments within the nuclear genome happened before the four species diverged. Yet, there were species-specific differences in the nucleotide composition of the nuclear gene fragments, identical to the differences in the mitochondrial genes, which would indicate that the incomplete nuclear copies of cytb and cox1 have been continuously updated during evolution to conform to their mitochondrial parent genes. The PCR-based findings of numts were further supported by Basic Local Alignment Search Tool (BLAST) searches against genome sequences of T. gondii and N. caninum using the concatenated mitochondrial cytb/cox1 sequences as queries. These searches revealed the presence of numerous numts of eighth distinct types in both species, with each one having a fixed starting and end point with respect t

Gjerde, Bjørn

2013-04-01

249

Heterologous expression and characterization of Choline Oxidase from the soil bacterium Arthrobacter nicotianae  

Microsoft Academic Search

In the course of a microbial screening of soil samples for new oxidases, different enrichment strategies were carried out.\\u000a With choline as the only carbon source, a microorganism was isolated and identified as Arthrobacter nicotianae. From this strain, a gene coding for a choline oxidase was isolated from chromosomal DNA. This gene named codA was cloned in Escherichia coli BL21-Gold

D. Ribitsch; W. Karl; E. Wehrschütz-Sigl; S. Tutz; P. Remler; H. J. Weber; K. Gruber; R. Stehr; C. Bessler; N. Hoven; K. Sauter; K. H. Maurer; H. Schwab

2009-01-01

250

Interfacial behavior and activity of laccase and bilirubin oxidase on bare gold surfaces.  

PubMed

Two blue multicopper oxidases (MCOs) (viz. Trametes hirsuta laccase (ThLc) and Myrothecium verrucaria bilirubin oxidase (MvBOx)) were immobilized on bare polycrystalline gold (Au) surfaces by direct adsorption from both dilute and concentrated enzyme solutions. The adsorption was studied in situ by means of null ellipsometry. Moreover, both enzyme-modified and bare Au electrodes were investigated in detail by atomic force microscopy (AFM) as well as electrochemically. When adsorbed from dilute solutions (0.125 and 0.25 mg mL?¹ in the cases of ThLc and MvBOx, respectively), the amounts of enzyme per unit area were determined to be ca. 1.7 and 4.8 pmol cm?², whereas the protein film thicknesses were determined to be 29 and 30 Å for ThLc and MvBOx, respectively. A well-pronounced bioelectrocatalytic reduction of molecular oxygen (O?) was observed on MvBOx/Au biocathodes, whereas this was not the case for ThLc-modified Au electrodes (i.e., adsorbed ThLc was catalytically inactive). The initially observed apparent k(cat)(app) values for adsorbed MvBOx and the enzyme in solution were found to be very close to each other (viz. 54 and 58 s?¹, respectively (pH 7.4, 25 °C)). However, after 3 h of operation of MvBOx/Au biocathodes, kcatapp dropped to 23 s?¹. On the basis of the experimental results, conformational changes of the enzymes (in all likelihood, their flattening on the Au surface) were suggested to explain the deactivation of MCOs on the bare Au electrodes. PMID:24564218

Pankratov, Dmitry; Sotres, Javier; Barrantes, Alejandro; Arnebrant, Thomas; Shleev, Sergey

2014-03-18

251

[Identification of Ixodes persulcatus and Ixodes pavlovskyi occidentalis (Ixodidae) by the analysis of the gene fragment COXI (cytochrome oxidase subunit I)].  

PubMed

Ticks of the genus Ixodes were collected in 2010 in the lowland part of Toguchinsk district of Novosibirsk Province (Russia) and in the forest-park area of Novosibirsk Scientific Centre and its outskirts (Sovetskiy district of Novosibirsk), and identified as Ixodes persulcatus (Schulze, 1930) (18 females and 13 males) and Ixodes pavlovskyi (13 females and 10 males). Ten specimens of each sex from each collecting site were examined. The following nine characters were used: the length and width of the scutum (conscutum) and of the gnathosoma in ventral view; the length of palpal segments II-III; the width of the hypostome; the length of idiosoma with scapula, of leg I, of the medial spur on fore coxa (Taiga..., 1985; Filippova, Musatov, 1996; Filippova, Panova, 1998). According to morphometric characters, specimens of Ixodes pavlovskyi collected in the forest-park area of the Novosibirsk Scientific Centre were identified as the subspecies I. p. occidentalis Filippova et Panova, 1998. Nucleotide sequences of the COI mitochondrial gene fragment were determined for 56 ticks. Phylogenetic analysis of the COI gene fragment in representatives of the persulcatus-ricinus species-group dwelling in Asia demonstrated high degree of conservatism. Molecular-genetic methods allow reliable identification of morphologically similar species I. pavlovskyi and I. persulcatus, pathogenic for humans. PMID:23458013

Livanova, N N; Tikunova, N V; Livanov, S G; Fomenko, N V

2012-01-01

252

Spermine oxidase: ten years after  

Microsoft Academic Search

Spermine oxidase (SMO) was discovered much more recently than other enzymes involved in polyamine metabolism; this review\\u000a summarizes 10 years of researches on this enzyme. Spermine oxidase (SMO) is a FAD-dependent enzyme that specifically oxidizes\\u000a spermine (Spm) and plays a dominant role in the highly regulated mammalian polyamines catabolism. SMO participates in drug\\u000a response, apoptosis, response to stressful stimuli and etiology

Manuela Cervelli; Roberto Amendola; Fabio Polticelli; Paolo Mariottini

253

NADPH oxidase CYBA polymorphisms, oxidative stress and cardiovascular diseases.  

PubMed

Oxidative stress plays a key role in the pathophysiology of several major cardiovascular diseases, including atherosclerosis, hypertension, heart failure, stroke and diabetes. ROS (reactive oxygen species) affect multiple tissues either directly or through NO depletion. ROS induce cardiovascular dysfunction by modulating cell contraction/dilation, migration, growth/apoptosis and extracellular matrix protein turnover, which contribute to vascular and cardiac remodelling. Of the several sources of ROS within the cardiovascular system, a family of multisubunit NADPH oxidases appears to be a predominant contributor of superoxide anion. Recent findings suggest a significant role of the genetic background in NADPH oxidase regulation. Common genetic polymorphisms within the promoter and exonic sequences of CYBA, the gene that encodes the p22(phox) subunit of NADPH oxidase, have been characterized in the context of cardiovascular diseases. This review aims to present the current state of research into these polymorphisms in their relationship to cardiovascular diseases. PMID:18184111

San José, Gorka; Fortuño, Ana; Beloqui, Oscar; Díez, Javier; Zalba, Guillermo

2008-02-01

254

Novel genetic diversity within Anopheles punctimacula s.l.: Phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2)  

PubMed Central

Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3´ COI), the Barcode region in the five prime end of the COI (5´ COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3´ COI depicted six highly supported molecular lineages (A–F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5´ COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3´ COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

Loaiza, Jose R.; Scott, Marilyn E.; Bermingham, Eldredge; Sanjur, Oris I.; Rovira, Jose R.; Dutari, Larissa C.; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E.

2013-01-01

255

Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene.  

PubMed

The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

2015-01-01

256

Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene  

PubMed Central

The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

2015-01-01

257

Lysyl Oxidase-Like and Lysyl Oxidase Are Present in the Dermis and Epidermis of a Skin Equivalent and in Human Skin and Are Associated to Elastic Fibers  

Microsoft Academic Search

Elastic fiber formation involves the secretion of tropoelastin which is converted to insoluble elastin by cross-linking, initiated by the oxidative deamination of lysine residues by lysyl oxidase. Five lysyl oxidase genes have been discovered. This study deals with the expression of two isoforms, LOX and LOX-like (LOXL), in human foreskin and in a human skin-equivalent (SE) model that allows the

Emmanuelle Noblesse; Valérie Cenizo; Charbel Bouez; Agnès Borel; Claudine Gleyzal; Simone Peyrol; Marie-Paule Jacob; Pascal Sommer; Odile Damour

2004-01-01

258

Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1  

PubMed Central

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

259

After-ripening alters the gene expression pattern of oxidases involved in the ethylene and gibberellin pathways during early imbibition of Sisymbrium officinale L. seeds  

PubMed Central

After-ripening (AR) in Sisymbrium officinale seeds altered SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 gene expression. Except for SoGA20ox2 expression, which sharply diminished, the expression of the other genes rose during development, particularly that of SoACS7. In contrast, only the SoACO2 and SoGA2ox6 transcripts increased with seed desiccation; the others decreased. AR increased the SoGA3ox2 transcript in dry seed, but dramatically decreased the SoACS7 transcript. At the onset of imbibition, AR inhibited SoACS7 and SoACO2 expression and stimulated that of SoGA20ox2, SoGA3ox2, and SoGA2ox6, demonstrating that the participation of ethylene (ET) and gibberellins (GAs) differs in after-ripened and non-after-ripened seeds. The inhibition of SoACO2 expression in the presence of GA4+7, paclobutrazol (PB), inhibitors of ET synthesis and signalling (IESS), and notably ET+GA4+7 indicated ET–GA cross-talk in non-after-ripened seeds. A positive effect of AR in reversing this inhibition was found. The idea of ET–GA cross-talk is also supported by the effect of ET on SoGA3ox2 expression, notably induced by the AR process. In contrast, SoGA20ox2 expression did not appear to be susceptible to AR. SoGA2ox6 expression, poorly known in seeds, suggests that AR prompted an up-regulation under all treatments studied, whereas in non-after-ripened seeds expression was down-regulated. On the other hand, the ?-mannanase (MAN) activity dramatically increased in dry after-ripened seed, being significantly boosted by ET. The absence of MAN inhibition by IESS suggests that although ET seems to be one of the factors controlling MAN, its presence did not appear to be essential. GA4+7 only increased MAN in seeds wich were after-ripened. Here, it is proposed that ET and GAs participate actively in establishing the AR process. PMID:19246594

Iglesias-Fernández, Raquel; Matilla, Angel

2009-01-01

260

Genetic differentiation of octopuses from different habitats near the Korean Peninsula and eastern China based on analysis of the mDNA cytochrome C oxidase 1 gene.  

PubMed

Distributed along the coastal waters of Korea and China, Octopus minor is found in various habitats, including the mud flats in the southern and western coasts of the Korean Peninsula and the rocky areas around Jeju Island; however, the genetic relationships among the different populations are unknown and have not been studied. We compared 630-nucleotide sequences of the CO1 gene from O. minor specimens collected from five regions around the Korean Peninsula and three regions from eastern China in order to determine population structure and genetic relationships. Based on the sequences at 12 polymorphic sites in this region, 11 haplotypes were identified from 85 specimens. Individuals from Jeju Island had unique haplotypes, including two haplotypes not found in the other populations. Nucleotide and haplotype diversity for all populations ranged from 0.03-0.37 and 0.20-0.64, respectively. Pairwise F(ST) values indicated significant genetic differences in populations from Korea and China. An UPGMA dendrogram showed separation of the eight populations into three clusters; one included only the Jeju population, another included the rest of the Korean populations and some from Dalian, China; a third cluster consisted of two other populations from China. We conclude that there are discrete genetic differences in O. minor from the different habitats, suggesting that the populations should be considered as management units in the ongoing recovery program. PMID:23212336

Kang, J-H; Park, J-Y; Choi, T-J

2012-01-01

261

Regulation of the Marinomonas mediterranea Antimicrobial Protein Lysine Oxidase by l-Lysine and the Sensor Histidine Kinase PpoS? †  

PubMed Central

Some Gram-negative bacteria express a novel enzyme with lysine-?-oxidase (LOD) activity (EC 1.4.3.20). The oxidation of l-Lys generates, among other products, hydrogen peroxide, which confers antimicrobial properties to this kind of enzyme and has been shown to be involved in cell death during biofilm development and differentiation. In addition to LOD, the melanogenic marine bacterium Marinomonas mediterranea, which forms part of the microbiota of the marine plant Posidonia oceanica, expresses two other oxidases of biotechnological interest, a multicopper oxidase, PpoA, with laccase activity and a tyrosinase named PpoB, which is responsible for melanin synthesis. By using both lacZ fusions with the lodAB promoter and quantitative reverse transcription-PCR (qRT-PCR), this study shows that the hybrid sensor histidine kinase PpoS regulates LOD activity at the transcriptional level. Although PpoS also regulates PpoA and PpoB, in this case, the regulatory effect cannot be attributed only to a transcriptional regulation. Further studies indicate that LOD activity is induced at the posttranscriptional level by l-Lys as well as by two structurally similar compounds, l-Arg and meso-2,6-diaminopimelic acid (DAP), neither of which is a substrate of the enzyme. The inducing effect of these compounds is specific for LOD activity since PpoA and PpoB are not affected by them. This study offers, for the first time, insights into the mechanisms regulating the synthesis of the antimicrobial protein lysine-?-oxidase in M. mediterranea, which could be important in the microbial colonization of the seagrass P. oceanica. PMID:20656878

Molina-Quintero, Luisa R.; Lucas-Elío, Patricia; Sanchez-Amat, Antonio

2010-01-01

262

Hordeum vulgare Seedlings Amine Oxidase  

PubMed Central

Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni

1990-01-01

263

Lysyl Oxidase-related Protein1 Promotes Tumor Fibrosis and Tumor Progression in Vivo1  

Microsoft Academic Search

The lysyl oxidase gene family members function as extracellular matrix modulating enzymes. We have found that another member of this family, lysyl oxidase related protein-1 (LOR-1), is highly expressed in metastatic breast cancer-derived cell lines but not in the nonmetastatic estrogen- dependent MCF-7 cells. Furthermore, LOR-1 expression in periductal tumor cells of breast carcinomas is significantly correlated with increased tumor

Gal Akiri; Edmond Sabo; Hagit Dafni; Zehava Vadasz; Yelena Kartvelishvily; Noga Gan; Ofra Kessler; Tzafra Cohen; Murray Resnick; Michal Neeman; Gera Neufeld

2003-01-01

264

Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity  

PubMed Central

Abstract A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. PMID:23873697

Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

2013-01-01

265

Catecholamines oxidation by xanthine oxidase  

Microsoft Academic Search

Dopamine and structurally related catecholamines in the presence of hydrogen peroxide are oxidized in vitro by xanthine oxidase producing the corresponding melanin pigments. The kinetic parameters of the reaction, measured as aminochrome formation, have been calculated. The rate of peroxidation depends on enzyme and hydrogen peroxide concentration. The optimum pH for the peroxidative activity of the enzyme is around 8.5.

Cesira Foppoli; Raffaella Coccia; Chiara Cini; Maria Anna Rosei

1997-01-01

266

Antifungal Tradecraft by Cholesterol Oxidase  

PubMed Central

Summary In this issue of Chemistry & Biology, Aparicio and coworkers report that secreted bacterial cholesterol oxidase is required for the biosynthesis of the antifungal polyene pimaricin by Streptomyces natalensis [1]. Their discovery expands the inventory of tasks this biotechnologically important enzyme performs. PMID:17379137

Nesbitt, Natasha M.; Sampson, Nicole S.

2013-01-01

267

Polyphenol oxidase and photosynthesis research  

Microsoft Academic Search

Very briefly, the present state of knowledge on the latent, lumen oriented polyphenol oxidase (PPO) of the chloroplast is reviewed. The location of PPO in the thylakoid membrane was described by D. Arnon 46 years ago. The N-terminus sequence of the spinach enzyme is reported. A historical sketch is given of the discovery of photophosphorylation and Arnon's visit to the

Achim Trebst; Brigitte Depka

1995-01-01

268

Chromate reduction by rabbit liver aldehyde oxidase  

SciTech Connect

Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

Banks, R.B.; Cooke, R.T. Jr.

1986-05-29

269

Androgen receptor and monoamine oxidase polymorphism in wild bonobos  

PubMed Central

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

270

A Mutation in C2orf64 Causes Impaired Cytochrome c Oxidase Assembly and Mitochondrial Cardiomyopathy  

Microsoft Academic Search

The assembly of mitochondrial respiratory chain complex IV (cytochrome c oxidase) involves the coordinated action of several assembly chaperones. In Saccharomyces cerevisiae, at least 30 different assembly chaperones have been identified. To date, pathogenic mutations leading to a mitochondrial disorder have been identified in only seven of the corresponding human genes. One of the genes for which the relevance to

Merei Huigsloot; Radek Szklarczyk

2011-01-01

271

Direct electrochemistry and intramolecular electron transfer of ascorbate oxidase confined on L-cysteine self-assembled gold electrode.  

PubMed

A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag?AgCl?KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. PMID:24189123

Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo

2014-02-01

272

L-amino acid oxidases with specificity for basic L-amino acids in cyanobacteria.  

PubMed

The two closely related fresh water cyanobacteria Synechococcus elongatus PCC 6301 and Synechococcus elongatus PCC 7942 have previously been shown to constitutively express a FAD-containing L-amino acid oxidase with high specificity for basic L-amino acids (L-arginine being the best substrate). In this paper we show that such an enzyme is also present in the fresh water cyanobacterium Synechococcus cedrorum PCC 6908. In addition, an improved evaluation of the nucleotide/amino acid sequence of the L-amino acid oxidase of Synechococcus elongatus PCC 6301 (encoded by the aoxA gene) with respect to the FAD-binding site and a translocation pathway signal sequence will be given. Moreover, the genome sequences of 24 cyanobacteria will be evaluated for the occurrence of an aoxA-similar gene. In the evaluated cyanobacteria 15 genes encoding an L-amino acid oxidase-similar protein will be found. PMID:17542496

Gau, Achim E; Heindl, Achim; Nodop, Anke; Kahmann, Uwe; Pistorius, Elfriede K

2007-01-01

273

Gibberellin oxidase activities in Bradyrhizobium japonicum bacteroids.  

PubMed

Bradyrhizobium japonicum bacteroids isolated from root nodules of soybean (Glycine max.) plants converted the gibberellin (GA) precursor [(14)C1]GA12 into several products identified by combined gas chromatography-mass spectrometry as [(14)C1]GA24, [(14)C1]GA9, [(14)C1]GA15, GA9 17-nor-16-one and unidentified products. The oxidation of GA12, catalyzed by the GA 20-oxidase, was present in symbiotic bacteroids from plants around flowering, but not in bacteroids from plants at either an early vegetative stage or at late growth stages. Expression of cps and ks genes, involved in ent-kaurene biosynthesis, was also demonstrated in bacteroids from soybean plants around flowering. Earlier precursors of the GA pathway, ent-[(14)C1]kaurenoic acid or [(14)C4]GA12-aldehyde, were efficiently utilized by B. japonicum bacteroids to give labelled GA9 plus intermediates partially oxidized at C-20, as well as GA9 17-nor-16-one and an unidentified product. No 3? or 13-hydroxylated [(14)C]GAs were detected in any of the incubations. Moreover the C19-GAs [(14)C1]GA4 or [(14)C1]GA20 were recovered unconverted upon incubation with the bacteroids which supports the absence of GA 3?-hydroxylase activity in B. japonicum. The bacterial 20-oxidase utilized the 13-hydroxylated substrates [(14)C1]GA53, [(14)C1]GA44 or [(14)C1]GA19, although with less efficiency than [(14)C1]GA12 to give [(14)C1]GA20 as final product, while the 3?-hydroxylated substrate [(14)C1]GA14 was converted to [(14)C1]GA4 to a very small extent. Endogenous GA9 and GA24 were identified by GC-MS in methanolic nodule extracts. These results suggest that B. japonicum bacteroids would synthesize GA9 under the symbiotic conditions present in soybean root nodules. PMID:24378220

Méndez, Constanza; Baginsky, Cecilia; Hedden, Peter; Gong, Fan; Carú, Margarita; Rojas, María Cecilia

2014-02-01

274

Molecular cloning of human liver sulfite oxidase.  

PubMed

A 2.4 kilobase cDNA clone of human sulfite oxidase was isolated from a human liver cDNA library in lambda gt10. Comparison of three sulfite oxidase sequences to several plant and fungal nitrate reductase sequences reveals a single conserved cysteine with highly conserved flanking sequences. The conserved cysteine is postulated to be a ligand of molybdenum in sulfite oxidase and nitrate reductase. PMID:7599189

Garrett, R M; Bellissimo, D B; Rajagopalan, K V

1995-06-01

275

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*  

PubMed Central

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ?8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

276

Effects of Transgenic Hybrid Aspen Overexpressing Polyphenol Oxidase on Rhizosphere Diversity  

Microsoft Academic Search

This study assessed the potential effects of transgenic aspen overexpressing a polyphenol oxidase gene on diversity in rhizosphere communities. Cultivation-independent methods were used to better delineate bacterial and fungal populations associated with transgenic and nontransgenic trees. Gene libraries for the bacterial component of the rhizosphere were established using 16S rRNA and chaperonin-60 (CPN-60) gene sequences, while the fungal community was

Kathryn L. Oliver; Richard C. Hamelin; William E. Hintz

2008-01-01

277

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris  

PubMed Central

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

278

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.  

PubMed

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

279

Cloning, expression and biochemical characterization of the cholesterol oxidase CgChoA from Chryseobacterium gleum  

PubMed Central

Background Cholesterol oxidases are important enzymes for applications such as the analysis of cholesterol in clinical samples, the synthesis of steroid derived drugs, and are considered as potential antibacterial drug targets. Results The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector and heterologously expressed in Escherichia coli JM109 co-transformed with pRARE2. The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion chromatography, showed a temperature optimum of 35°C, and a pH optimum at 6.75 using 0.011 M MOPS buffer under the tested conditions. The purified protein showed a maximum activity of 15.5 U/mg. CgChoA showed a Michaelis-Menten like kinetic behavior only when the substrate was dissolved in water and taurocholate (apparent Km?=?0.5 mM). In addition, the conversion of cholesterol by CgChoA was studied via biocatalytic batches at analytical scale, and cholest-4-en-3-one was confirmed as product by HPLC-MS. Conclusion CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other organisms. Thus, the enzyme broadens the available toolbox of cholesterol oxidases for e.g. synthetic and biosensing applications. PMID:24885249

2014-01-01

280

Oxidative innate immune defenses by Nox/Duox family NADPH Oxidases  

PubMed Central

The importance of reactive oxygen species (ROS) in innate immunity was first recognized in professional phagocytes undergoing a “respiratory burst” upon activation. This robust oxygen consumption is related to a superoxide-generating enzyme, the phagocytic NADPH oxidase (Nox2 or phox). The oxidase is essential for microbial killing, since patients lacking a functional oxidase suffer from enhanced susceptibility to microbial infections. ROS derived from superoxide attack bacteria in the isolated niche of the neutrophil phagosome. The oxidase is electrogenic, alters ion currents across membranes, induces apoptosis, regulates cytokine production, influences gene expression, and promotes formation of extracellular traps. Recently, new homologues of Nox2 were discovered establishing the Nox family of NADPH oxidases that encompasses seven members. Nox1 is highly expressed in the colon epithelium, and can be induced by LPS or IFN-?. Nox4 was implicated in innate immunity since LPS induces Nox4-dependent ROS generation. Duox1 and Duox2 localize to the apical plasma membrane of epithelial cells in major airways, salivary glands, and the gastrointestinal tract, and provide extracellular hydrogen peroxide to lactoperoxidase to produce antimicrobial hypothiocyanite ions. Th1 and Th2 cytokines regulate expression of Dual oxidases in human airways and may thereby act in host defense or in proinflammatory responses. PMID:18511861

Rada, Balázs; Leto, Thomas L.

2009-01-01

281

Oxidative innate immune defenses by Nox/Duox family NADPH oxidases.  

PubMed

The importance of reactive oxygen species (ROS) in innate immunity was first recognized in professional phagocytes undergoing a 'respiratory burst'upon activation. This robust oxygen consumption is related to a superoxide-generating enzyme, the phagocytic NADPH oxidase (Nox2-based or phox). The oxidase is essential for microbial killing, since patients lacking a functional oxidase suffer from enhanced susceptibility to microbial infections. ROS derived from superoxide attack bacteria in the isolated niche of the neutrophil phagosome. The oxidase is electrogenic, alters ion currents across membranes, induces apoptosis, regulates cytokine production, influences gene expression, and promotes formation of extracellular traps. Recently, new homologues of Nox2 were discovered establishing the Nox family of NADPH oxidases that encompasses seven members. Nox1 is highly expressed in the colon epithelium, and can be induced by LPS or IFN- gamma. Nox4 was implicated in innate immunity since LPS induces Nox4-dependent ROS generation. Duox1 and Duox2 localize to the apical plasma membrane of epithelial cells in major airways, salivary glands, and the gastrointestinal tract, and provide extracellular hydrogen peroxide to lactoperoxidase to produce antimicrobial hypothiocyanite ions. Th1 and Th2 cytokines regulate expression of dual oxidases in human airways and may thereby act in host defense or in proinflammatory responses. PMID:18511861

Rada, Balázs; Leto, Thomas L

2008-01-01

282

Ectopic Expression of Pumpkin Gibberellin Oxidases Alters Gibberellin Biosynthesis and Development of Transgenic Arabidopsis Plants1  

PubMed Central

Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902

Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta

2006-01-01

283

Modification of plasma membrane NADPH oxidase activity in cucumber seedling roots in response to cadmium stress.  

PubMed

The aim of this study was to investigate the effect of cadmium on plasma membrane (PM) NADPH oxidase activity in cucumber roots. Plants were treated with cadmium for 1, 3 or 6 days. Some of the plants after 3-day exposure to cadmium were transferred to a medium without the heavy metal for the next 3 days. Treatment of plants with cadmium for 6 days stimulated the activity of NADPH oxidase. The highest stimulation of O2(•-) production by NADPH oxidase was observed in post-stressed plants, which was correlated with the stimulation of activity of PM H(+)-ATPase in the same conditions. In order to examine the effects of cadmium stresses on the expression level of genes encoding NADPH oxidase, putative cucumber homologs encoding RBOH proteins were selected and a real-time PCR assay was performed. NADPH is a substrate for oxidase; thus alterations in the activity of glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrogenase, NADP-isocitrate dehydrogenase and NADP-malic enzyme under cadmium stress were studied. The activity of NADPH dehydrogenases was increased under cadmium stress. The results indicate that PM NADPH oxidase could be involved in plants' response to cadmium stress by affecting the activity of PM H(+)-ATPase, and NADPH-generating enzymes could play important roles in this process. PMID:25804809

Jakubowska, Dagmara; Janicka-Russak, Ma?gorzata; Kaba?a, Katarzyna; Migocka, Magdalena; Reda, Ma?gorzata

2015-05-01

284

The therapeutic potential of monoamine oxidase inhibitors  

Microsoft Academic Search

Monoamine oxidase inhibitors were among the first antidepressants to be discovered and have long been used as such. It now seems that many of these agents might have therapeutic value in several common neurodegenerative conditions, independently of their inhibition of monoamine oxidase activity. However, many claims and some counter-claims have been made about the physiological importance of these enzymes and

Dale Edmondson; Keith F. Tipton; Moussa B. H. Youdim

2006-01-01

285

Factors Affecting Reaction Kinetics of Glucose Oxidase  

Microsoft Academic Search

Basic principles of enzyme kinetics are demonstrated using the enzyme glucose oxidase. The glucose oxidase enzymatic reaction is coupled to horseradish peroxidase, which in turn catalyzes the oxidation of a dye to a bright blue-green color. The appearance of the blue-green dye is used to monitor the course of the reaction and is quite visible in a classroom setting. A

Kristin A. Johnson

2002-01-01

286

Immunological comparison of sulfite oxidase  

SciTech Connect

Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

Pollock, V.; Barber, M.J. (Univ. South Florida College, Tampa (United States))

1991-03-11

287

The C-terminal region controls correct folding of genus Trametes pyranose 2-oxidases.  

PubMed

The pyranose 2-oxidases from Trametes ochracea and Trametes pubescens share markedly similar amino acid sequences with identity of 93.4%. When expressed from the recombinant plasmids based on the same vector in the Escherichia coli host strain BL21(DE3) at higher growth temperatures, they differ strikingly in the formation of the inclusion bodies. Upon overexpression in the cultures performed at 28 degrees C, the specific activity of pyranose 2-oxidase from T. pubescens was eight times higher than that from T. ochracea: 93% of pyranose 2-oxidase from T. ochracea and only 15% of that from T. pubescens was present in the form of inclusion bodies. To ascertain the cause of this difference, both cloned genes were shuffled. Site-directed recombination of p2o cDNAs revealed that DNA constructs ending with 3' end of p2o cDNA from T. pubescens code for proteins that are folded into an active form to the greater extent, regardless of the gene expression level. "In silicio" analysis of physico-chemical properties of the protein sequences of pyranose 2-oxidases revealed that the sequence of amino acid residues 368-430, constituting the small, head domain of pyranose 2-oxidase from T. pubescens, affects positively the enzyme folding at higher cultivation temperatures. The domain differs in six amino acid residues from that of T. ochracea. PMID:17566580

Maresová, Helena; Palyzová, Andrea; Kyslík, Pavel

2007-06-30

288

Modular assembly of yeast cytochrome oxidase  

PubMed Central

Previous studies of yeast cytochrome oxidase (COX) biogenesis identified Cox1p, one of the three mitochondrially encoded core subunits, in two high–molecular weight complexes combined with regulatory/assembly factors essential for expression of this subunit. In the present study we use pulse-chase labeling experiments in conjunction with isolated mitochondria to identify new Cox1p intermediates and place them in an ordered pathway. Our results indicate that before its assimilation into COX, Cox1p transitions through five intermediates that are differentiated by their compositions of accessory factors and of two of the eight imported subunits. We propose a model of COX biogenesis in which Cox1p and the two other mitochondrial gene products, Cox2p and Cox3p, constitute independent assembly modules, each with its own complement of subunits. Unlike their bacterial counterparts, which are composed only of the individual core subunits, the final sequence in which the mitochondrial modules associate to form the holoenzyme may have been conserved during evolution. PMID:23266989

McStay, Gavin P.; Su, Chen Hsien; Tzagoloff, Alexander

2013-01-01

289

EXPRESSION OF TURKEY TRANSCRIPTION FACTORS AND ACYL-COENZYME OXIDASE IN DIFFERENT TISSUES AND GENETIC POPULATIONS  

Technology Transfer Automated Retrieval System (TEKTRAN)

Several transcription factors are involved in regulating lipid metabolism in various animal tissues. Peroxisome proliferator-activated receptor (PPAR) gamma and PPARalpha regulate lipogenesis and fatty acid oxidation. Gene fragments for PPARgamma, PPARalpha, and acyl-coenzyme A oxidase (ACO) have be...

290

HypC is the anthrone oxidase involved in aflatoxin biosynthesis  

Technology Transfer Automated Retrieval System (TEKTRAN)

Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

291

Dietary inhibitors of monoamine oxidase A.  

PubMed

Inhibition of monoamine oxidase is one way to treat depression and anxiety. The information now available on the pharmacokinetics of flavonoids and of the components of tobacco prompted an exploration of whether a healthy diet (with or without smoking) provides active compounds in amounts sufficient to partially inhibit monoamine oxidase. A literature search was used to identify dietary monoamine oxidase inhibitors, the levels of these compounds in foods, the pharmacokinetics of the absorption and distribution, and tissue levels observed. An estimated daily intake and the expected tissue concentrations were compared with the measured efficacies of the compounds as inhibitors of monoamine oxidases. Norharman, harman and quercetin dietary presence, pharmacokinetics, and tissue levels were consistent with significant levels reaching neuronal monoamine oxidase from the diet or smoking; 1,2,3,4-tetrahydroisoquinoline, eugenol, 1-piperoylpiperidine, and coumarin were not. Quercetin was equipotent with norharman as a monoamine oxidase A inhibitor and its metabolite, isorhamnetin, also inhibits. Total quercetin was the highest of the compounds in the sample diet. Although bioavailability was variable depending on the source, a healthy diet contains amounts of quercetin that might give sufficient amounts in brain to induce, by monoamine oxidase A inhibition, a small decrease in neurotransmitter breakdown. PMID:21190052

Dixon Clarke, Sarah E; Ramsay, Rona R

2011-07-01

292

Monoamine oxidase inhibitors and neuroprotection: a review.  

PubMed

Monoamine oxidase inhibitors have been available for more than 50 years, initially developed as antidepressants but currently used in a variety of psychiatric and neurological conditions. There has been a recent surge of interest in monoamine oxidase inhibitors because of their reported neuroprotective and/or neurorescue properties. Interestingly, it seems that often these properties are independent of their ability to inhibit monoamine oxidase. This review article presents an overview of the neuroprotective/neurorescue properties of these multifaceted drugs and focuses on phenelzine, (-)-deprenyl, rasagiline, ladostigil, tranylcypromine, moclobemide, and clorgyline and their possible neuroprotective mechanisms. PMID:22960850

Al-Nuaimi, Saleem K; Mackenzie, Erin M; Baker, Glen B

2012-11-01

293

Human lysyl oxidase-like 2.  

PubMed

Lysyl oxidase like-2 (LOXL2) belongs to the lysyl oxidase (LOX) family, which comprises Cu(2+)- and lysine tyrosylquinone (LTQ)-dependent amine oxidases. LOXL2 is proposed to function similarly to LOX in the extracellular matrix (ECM) by promoting crosslinking of collagen and elastin. LOXL2 has also been proposed to regulate extracellular and intracellular cell signaling pathways. Dysregulation of LOXL2 has been linked to many diseases, including cancer, pro-oncogenic angiogenesis, fibrosis and heart diseases. In this review, we will give an overview of the current understandings and hypotheses regarding the molecular functions of LOXL2. PMID:25146937

Moon, Hee-Jung; Finney, Joel; Ronnebaum, Trey; Mure, Minae

2014-12-01

294

Patterns of evolution of mitochondrial cytochrome c oxidase I and II DNA and implications for DNA barcoding  

Microsoft Academic Search

DNA barcoding has focused increasing attention on the use of specific regions of mitochondrial cytochrome c oxidase I and II genes (COI–COII) to diagnose and delimit species. However, our understanding of patterns of molecular evolution within these genes is limited. Here we examine patterns of nucleotide divergence in COI–COII within species and between species pairs of Lepidoptera and Diptera using

Amanda D. Roe; Felix A. H. Sperling

2007-01-01

295

Protonmotive Mechanism of Heme-Copper Oxidases  

Microsoft Academic Search

The mechanism of coupling of proton and electron transfer in oxidases is reviewed and related to the structural information that is now available. A “glutamate trap” mechanism for proton\\/electron coupling is described.

P. R. Rich; S. Jünemann; B. Meunier

1998-01-01

296

The Purification of Polyphenol Oxidase from Tobacco  

Microsoft Academic Search

A new polyphenol oxidase (PPO) named PPO II was purified from tobacco (Nicotiana tobacum) by using acetone powder, ammonium sulfate precipitation, and column chromatography on DEAE-Sephadex A-50, Sephadex G-75, and CM-Sephadex C-50. It has an active site of a pair of type 3 coppers bridged to phenolate oxygen, which represents a new catalytic mechanism for polyphenol oxidase. PAGE, SDS-PAGE, and

Chunhua Shi; Ya Dai; Xiaolong Xu; Yongshu Xie; Qingliang Liu

2002-01-01

297

NADPH oxidases are involved in differentiation and pathogenicity in Botrytis cinerea.  

PubMed

Nicotinamide adenine dinucleotide (NADPH) oxidases have been shown to be involved in various differentiation processes in fungi. We investigated the role of two NADPH oxidases in the necrotrophic phytopathogenic fungus, Botrytis cinerea. The genes bcnoxA and bcnoxB were cloned and characterized; their deduced amino acid sequences show high homology to fungal NADPH oxidases. Analyses of single and double knock-out mutants of both NADPH oxidase genes showed that both bcnoxA and bcnoxB are involved in formation of sclerotia. Both genes have a great impact on pathogenicity: whereas bcnoxB mutants showed a retarded formation of primary lesions, probably due to an impaired formation of penetration structures, bcnoxA mutants were able to penetrate host tissue in the same way as the wild type but were much slower in colonizing the host tissue. Double mutants showed an additive effect: they were aberrant in penetration and colonization of plant tissue and, therefore, almost nonpathogenic. To study the structure of the fungal Nox complex in more detail, bcnoxR (encoding a homolog of the mammalian p67(phox), a regulatory subunit of the Nox complex) was functionally characterized. The phenotype of DeltabcnoxR mutants is identical to that of DeltabcnoxAB double mutants, providing evidence that BcnoxR is involved in activation of both Bcnox enzymes. PMID:18624644

Segmüller, Nadja; Kokkelink, Leonie; Giesbert, Sabine; Odinius, Daniela; van Kan, Jan; Tudzynski, Paul

2008-06-01

298

Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases  

PubMed Central

Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

Giacomelli, Lisa

2013-01-01

299

NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys  

PubMed Central

A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

Peck, Ammon B.; Khan, Saeed R.

2013-01-01

300

NADPH Oxidase Biology and the Regulation of Tyrosine Kinase Receptor Signaling and Cancer Drug Cytotoxicity  

PubMed Central

The outdated idea that reactive oxygen species (ROS) are only dangerous products of cellular metabolism, causing toxic and mutagenic effects on cellular components, is being replaced by the view that ROS have several important functions in cell signaling. In aerobic organisms, ROS can be generated from different sources, including the mitochondrial electron transport chain, xanthine oxidase, myeloperoxidase, and lipoxygenase, but the only enzyme family that produces ROS as its main product is the NADPH oxidase family (NOX enzymes). These transfer electrons from NADPH (converting it to NADP?) to oxygen to make O2•?. Due to their stability, the products of NADPH oxidase, hydrogen peroxide, and superoxide are considered the most favorable ROS to act as signaling molecules. Transcription factors that regulate gene expression involved in carcinogenesis are modulated by NADPH oxidase, and it has emerged as a promising target for cancer therapies. The present review discusses the mechanisms by which NADPH oxidase regulates signal transduction pathways in view of tyrosine kinase receptors, which are pivotal to regulating the hallmarks of cancer, and how ROS mediate the cytotoxicity of several cancer drugs employed in clinical practice. PMID:23434665

Paletta-Silva, Rafael; Rocco-Machado, Nathália; Meyer-Fernandes, José Roberto

2013-01-01

301

Involvement of NADPH oxidases in suppression of cyclooxygenase-2 promoter-dependent transcriptional activities by sesamol  

PubMed Central

Cyclooxygenase-2 (COX-2) has been shown to play an important role in colon carcinogenesis. Moreover, one of the components of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, NADPH oxidase 1 (NOX1), dominantly expressed in the colon, is implicated in the pathogenesis of colon cancer. We have reported that sesamol, one of the lignans in sesame seeds, suppressed COX-2 gene transcriptional activity in human colon cancer cells, and also suppressed intestinal polyp formation in Apc-mutant mice. In the present study, we investigated the involvement of NADPH oxidase in the inhibition of COX-2 transcriptional activity by sesamol. We found that several NADPH oxidase inhibitors, such as apocynin, showed suppressive effects on COX-2 transcriptional activity. Moreover, sesamol significantly suppressed NOX1 mRNA levels in a dose-dependent manner. In addition, we demonstrated that knockdown of NOX1 successfully suppressed COX-2 transcriptional activity. These results suggest that inhibition of NADPH oxidase, especially NOX1, may be involved in the mechanism of the suppression of COX-2 transcriptional activity by sesamol. PMID:25759517

Shimizu, Satomi; Ishigamori, Rikako; Fujii, Gen; Takahashi, Mami; Onuma, Wakana; Terasaki, Masaru; Yano, Tomohiro; Mutoh, Michihiro

2015-01-01

302

Involvement of NADPH oxidases in suppression of cyclooxygenase-2 promoter-dependent transcriptional activities by sesamol.  

PubMed

Cyclooxygenase-2 (COX-2) has been shown to play an important role in colon carcinogenesis. Moreover, one of the components of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, NADPH oxidase 1 (NOX1), dominantly expressed in the colon, is implicated in the pathogenesis of colon cancer. We have reported that sesamol, one of the lignans in sesame seeds, suppressed COX-2 gene transcriptional activity in human colon cancer cells, and also suppressed intestinal polyp formation in Apc-mutant mice. In the present study, we investigated the involvement of NADPH oxidase in the inhibition of COX-2 transcriptional activity by sesamol. We found that several NADPH oxidase inhibitors, such as apocynin, showed suppressive effects on COX-2 transcriptional activity. Moreover, sesamol significantly suppressed NOX1 mRNA levels in a dose-dependent manner. In addition, we demonstrated that knockdown of NOX1 successfully suppressed COX-2 transcriptional activity. These results suggest that inhibition of NADPH oxidase, especially NOX1, may be involved in the mechanism of the suppression of COX-2 transcriptional activity by sesamol. PMID:25759517

Shimizu, Satomi; Ishigamori, Rikako; Fujii, Gen; Takahashi, Mami; Onuma, Wakana; Terasaki, Masaru; Yano, Tomohiro; Mutoh, Michihiro

2015-03-01

303

Molecular differences in the mitochondrial cytochrome oxidase I (mtCOI) gene and development of a species-specific marker for onion thrips, Thrips tabaci Lindeman, and melon thrips, T. palmi Karny (Thysanoptera: Thripidae), vectors of tospoviruses (Bunyaviridae).  

PubMed

A quick and developmental-stage non-limiting method of the identification of vectors of tospoviruses, such as Thrips tabaci and T. palmi, is important in the study of vector transmission, insecticide resistance, biological control, etc. Morphological identification of these thrips vectors is often a stumbling block in the absence of a specialist and limited by polymorphism, sex, stage of development, etc. Molecular identification, on the other hand, is not hampered by the above factors and can easily be followed by a non-specialist with a little training. The mitochondrial cytochrome oxidase I (mtCOI) exhibits reliable inter-species variations as compared to the other markers. In this communication, we present the differences in the mtCOI partial sequence of morphologically identified specimens of T. tabaci and T. palmi collected from onion and watermelon, respectively. Species-specific markers, identified in this study, could successfully determine T. tabaci and T. palmi, which corroborated the morphological identification. Phylogenetic analyses showed that both T. tabaci and T. palmi formed different clades as compared to the other NCBI accessions. The implication of these variations in vector efficiency has to be investigated further. The result of this investigation is useful in the quick identification of T. tabaci and T. palmi, a critical factor in understanding the epidemiology of the tospoviruses, their management and also in quarantine. PMID:17916265

Asokan, R; Krishna Kumar, N K; Kumar, Vikas; Ranganath, H R

2007-10-01

304

Targeting NADPH oxidases in vascular pharmacology  

PubMed Central

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the selective inhibition of dysfunctional NADPH oxidase homologs. This appears to be the most reasonable approach, potentially much more efficient than non-selective scavenging of all ROS by the administration of antioxidants. PMID:22405985

Schramm, Agata; Matusik, Pawe?; Osmenda, Grzegorz; Guzik, Tomasz J

2012-01-01

305

Heme/copper terminal oxidases  

SciTech Connect

Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

Ferguson-Miller, S.; Babcock, G.T. [Michigan State Univ., East Lansing, MI (United States)] [Michigan State Univ., East Lansing, MI (United States)

1996-11-01

306

Thrombin and NAD(P)H oxidase-mediated regulation of CD44 and BMP4-Id pathway in VSMC, restenosis, and atherosclerosis.  

PubMed

To characterize novel signaling pathways that underlie NAD(P)H oxidase-mediated signaling in atherosclerosis, we first examined differences in thrombin-induced gene expression between wild-type and p47phox(-/-) (NAD[P]H oxidase-deficient) VSMC. Of the 9000 genes analyzed by cDNA microarray method at the G1/S transition point, 76 genes were similarly and significantly modulated in both the cell types, whereas another 22 genes that encompass various functional groups were regulated in NAD(P)H oxidase-dependent manner. Among these 22 genes, thrombin-induced NAD(P)H oxidase-mediated regulation of Klf15, Igbp1, Ak4, Adamts5, Ech1, Serp1, Sec61a2, Aox1, Aoh1, Fxyd5, Rai14, and Serpinh1 was shown for the first time in VSMC. The role of NAD(P)H oxidase in the regulation of a subset of these genes (CD44, BMP4, Id1, and Id3) was confirmed using modulators of reactive oxygen species (ROS) generation, a ROS scavenger and in gain-of-function experiments. We then characterized regulation of these genes in restenosis and atherosclerosis. In both apoE(-/-) mice and in a mouse vascular injury model, these genes are regulated in NAD(P)H oxidase-dependent manner during vascular lesion formation. Based on these findings, we propose that NAD(P)H oxidase-dependent gene expression in general, and the CD44 and BMP4-Id signaling pathway in particular, is important in restenosis and atherosclerosis. PMID:16601225

Vendrov, Aleksandr E; Madamanchi, Nageswara R; Hakim, Zeenat S; Rojas, Mauricio; Runge, Marschall S

2006-05-26

307

Identification, Purification, and Characterization of Iminodiacetate Oxidase from the EDTA-Degrading Bacterium BNC1  

PubMed Central

Microbial degradation of synthetic chelating agents, such as EDTA and nitrilotriacetate (NTA), may help immobilizing radionuclides and heavy metals in the environment. The EDTA- and NTA-degrading bacterium BNC1 uses EDTA monooxygenase to oxidize NTA to iminodiacetate (IDA) and EDTA to ethylenediaminediacetate (EDDA). IDA- and EDDA-degrading enzymes have not been purified and characterized to date. In this report, an IDA oxidase was purified to apparent homogeneity from strain BNC1 by using a combination of eight purification steps. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single protein band of 40 kDa, and by using size exclusion chromatography, we estimated the native enzyme to be a homodimer. Flavin adenine dinucleotide was determined as its prosthetic group. The purified enzyme oxidized IDA to glycine and glyoxylate with the consumption of O2. The temperature and pH optima for IDA oxidation were 35°C and 8, respectively. The apparent Km for IDA was 4.0 mM with a kcat of 5.3 s?1. When the N-terminal amino acid sequence was determined, it matched exactly with that encoded by a previously sequenced hypothetical oxidase gene of BNC1. The gene was expressed in Escherichia coli, and the gene product as a C-terminal fusion with a His tag was purified by a one-step nickel affinity chromatography. The purified fusion protein had essentially the same enzymatic activity and properties as the native IDA oxidase. IDA oxidase also oxidized EDDA to ethylenediamine and glyoxylate. Thus, IDA oxidase is likely the second enzyme in both NTA and EDTA degradation pathways in strain BNC1. PMID:11157233

Liu, Yong; Louie, Tai Man; Payne, Jason; Bohuslavek, Jan; Bolton, Harvey; Xun, Luying

2001-01-01

308

Relationship of cytochrome caa sub 3 from Thermus thermophilus to other heme- and copper-containing terminal oxidases  

SciTech Connect

Cytochrome oxidases are a key component of the energy metabolism of most aerobic organisms from mammals to bacteria. They are the final enzyme of the membrane associated respiratory chain responsible for converting the chemical energy of reduced substrates to a transmembrane electrochemical potential, which issused by the cell for a wide variety of energy-requiring processes. The most widely studied oxidase is the cytochrome c oxidase of the mammalian mitochondrion. This complex, integral membrane protein contains 13 subunits and four canonical metal centers: heme center a and a{sub 3}; copper centers CU{sub A} and CU{sub B}. It is responsible for electron transfer from reduced chytochrome c to dioxygen with the concomitant reduction of dioxygen to water and the coupled vectorial transfer of protons across the mitochondrial membrane. In this communication we will describe preliminary results of DNA sequencing experiments with the cytochrome caa{sub 3} oxidase, initially undertaken to determine the nature of the subunits of this oxidase and shed light on the distribution of the metal centers. We will speculate on oxidase gene and protein structures and evolutionary relationships in the light of these results and recent sequencing results from other groups. 47 refs., 4 figs., 1 tab.

Mather, M.W.; Springer, P.; Fee, J.A.

1990-01-01

309

Mechanistic and structural studies of nitroalkane oxidase from Fusarium oxysporum  

E-print Network

This thesis describes the purification and the initial mechanistic studies of nitroalkane oxidase from Fusarium oxysponim. Nitroalkane oxidase catalyzes the oxidative denitrification of a nitroalkane to the corresponding aidehyde or ketone...

Heasley, Carl J

1995-01-01

310

Complete genome sequence of the melanogenic marine bacterium Marinomonas mediterranea type strain (MMB-1T)  

SciTech Connect

Marinomonas mediterranea MMB-1 T Solano & Sanchez-Amat 1999 belongs to the family Oceanospirillaceae within the phylum Proteobacteria. This species is of interest because it is the only species described in the genus Marinomonas to date that can synthesize melanin pigments, which is mediated by the activity of a tyrosinase. M. mediterranea expresses other oxidases of biotechnological interest, such as a multicopper oxidase with laccase activity and a novel L-lysine-epsilon-oxidase. The 4,684,316 bp long genome harbors 4,228 proteincoding genes and 98 RNA genes and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

Lucas-Elio, Patricia [University of Murcia, Murcia, Spain; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Detter, J C [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Bruce, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Johnston, Andrew W. B. [University of East Anglia, Norwich, United Kingdom; Sanchez-Amat, Antonio [University of Murcia, Murcia, Spain

2012-01-01

311

A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury  

PubMed Central

Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID:23840306

Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

2013-01-01

312

Molecular Insights of p47phox Phosphorylation Dynamics in the Regulation of NADPH Oxidase Activation and Superoxide Production*  

PubMed Central

Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox?/? coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2? production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888

Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei

2014-01-01

313

The Elusive Third Subunit IIa of the Bacterial B-Type Oxidases: The Enzyme from the Hyperthermophile Aquifex aeolicus  

PubMed Central

The reduction of molecular oxygen to water is catalyzed by complicated membrane-bound metallo-enzymes containing variable numbers of subunits, called cytochrome c oxidases or quinol oxidases. We previously described the cytochrome c oxidase II from the hyperthermophilic bacterium Aquifex aeolicus as a ba3-type two-subunit (subunits I and II) enzyme and showed that it is included in a supercomplex involved in the sulfide-oxygen respiration pathway. It belongs to the B-family of the heme-copper oxidases, enzymes that are far less studied than the ones from family A. Here, we describe the presence in this enzyme of an additional transmembrane helix “subunit IIa”, which is composed of 41 amino acid residues with a measured molecular mass of 5105 Da. Moreover, we show that subunit II, as expected, is in fact longer than the originally annotated protein (from the genome) and contains a transmembrane domain. Using Aquifex aeolicus genomic sequence analyses, N-terminal sequencing, peptide mass fingerprinting and mass spectrometry analysis on entire subunits, we conclude that the B-type enzyme from this bacterium is a three-subunit complex. It is composed of subunit I (encoded by coxA2) of 59000 Da, subunit II (encoded by coxB2) of 16700 Da and subunit IIa which contain 12, 1 and 1 transmembrane helices respectively. A structural model indicates that the structural organization of the complex strongly resembles that of the ba3 cytochrome c oxidase from the bacterium Thermus thermophilus, the IIa helical subunit being structurally the lacking N-terminal transmembrane helix of subunit II present in the A-type oxidases. Analysis of the genomic context of genes encoding oxidases indicates that this third subunit is present in many of the bacterial oxidases from B-family, enzymes that have been described as two-subunit complexes. PMID:21738733

Prunetti, Laurence; Brugna, Myriam; Lebrun, Régine; Giudici-Orticoni, Marie-Thérèse; Guiral, Marianne

2011-01-01

314

Evidence for Interplay between Genes and Parenting on Infant Temperament in the First Year of Life: Monoamine Oxidase a Polymorphism Moderates Effects of Maternal Sensitivity on Infant Anger Proneness  

ERIC Educational Resources Information Center

Background: The low expression polymorphism of the MAOA gene in interaction with adverse environments (G × E) is associated with antisocial behaviour disorders. These have their origins in early life, but it is not known whether MAOA G × E occurs in infants. We therefore examined whether MAOA G × E predicts infant anger proneness, a temperamental…

Pickles, Andrew; Hill, Jonathan; Breen, Gerome; Quinn, John; Abbott, Kate; Jones, Helen; Sharp, Helen

2013-01-01

315

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1  

PubMed Central

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ?-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

316

Spatiotemporal Localization of d-Amino Acid Oxidase and d-Aspartate Oxidases during Development in Caenorhabditis elegans  

PubMed Central

Recent investigations have shown that a variety of d-amino acids are present in living organisms and that they possibly play important roles in physiological functions in the body. d-Amino acid oxidase (DAO) and d-aspartate oxidase (DDO) are degradative enzymes stereospecific for d-amino acids. They have been identified in various organisms, including mammals and the nematode Caenorhabditis elegans, although the significance of these enzymes and the relevant functions of d-amino acids remain to be elucidated. In this study, we investigated the spatiotemporal localization of C. elegans DAO and DDOs (DDO-1, DDO-2, and DDO-3) and measured the levels of several d- and l-amino acids in wild-type C. elegans and four mutants in which each gene for DAO and the DDOs was partially deleted and thereby inactivated. Furthermore, several phenotypes of these mutant strains were characterized. The results reported in this study indicate that C. elegans DAO and DDOs are involved in egg-laying events and the early development of C. elegans. In particular, DDOs appear to play important roles in the development and maturation of germ cells. This work provides novel and useful insights into the physiological functions of these enzymes and d-amino acids in multicellular organisms. PMID:22393259

Saitoh, Yasuaki; Katane, Masumi; Kawata, Tomonori; Maeda, Kazuhiro; Sekine, Masae; Furuchi, Takemitsu; Kobuna, Hiroyuki; Sakamoto, Taro; Inoue, Takao; Arai, Hiroyuki; Nakagawa, Yasuhito

2012-01-01

317

Kinetics and specificity of guinea pig liver aldehyde oxidase and bovine milk xanthine oxidase towards substituted benzaldehydes  

Microsoft Academic Search

Molybdenum-containing enzymes, aldehyde oxidase and xanthine oxidase, are im- portant in the oxidation of N-heterocyclic xenobiotics. However, the role of these en- zymes in the oxidation of drug-derived aldehydes has not been established. The present investigation describes the interaction of eleven structurally related benzaldehydes with guinea pig liver aldehyde oxidase and bovine milk xanthine oxidase, since they have similar substrate

Georgios I. Panoutsopoulos; Christine Beedham

2004-01-01

318

Arxula adeninivorans recombinant urate oxidase and its application in the production of food with low uric acid content.  

PubMed

Hyperuricemia and its symptoms are becoming increasingly common worldwide. Elevated serum uric acid levels are caused by increased uric acid synthesis from food constituents and reduced renal excretion. Treatment in most cases involves reducing alcohol intake and consumption of meat and fish or treatment with pharmaceuticals. Another approach could be to reduce uric acid level in food, either during production or consumption. This work reports the production of recombinant urate oxidase by Arxula adeninivorans and its application to reduce uric acid in a food product. The A. adeninivorans urate oxidase amino acid sequence was found to be similar to urate oxidases from other fungi (61-65% identity). In media supplemented with adenine, hypoxanthine or uric acid, induction of the urate oxidase (AUOX) gene and intracellular accumulation of urate oxidase (Auoxp) was observed. The enzyme characteristics were analyzed from isolates of the wild-type strain A. adeninivorans LS3, as well as from those of transgenic strains expressing the AUOX gene under control of the strong constitutive TEF1 promoter or the inducible AYNI1 promoter. The enzyme showed high substrate specificity for uric acid, a broad temperature and pH range, high thermostability and the ability to reduce uric acid content in food. PMID:24022585

Trautwein-Schult, Anke; Jankowska, Dagmara; Cordes, Arno; Hoferichter, Petra; Klein, Christina; Matros, Andrea; Mock, Hans-Peter; Baronian, Keith; Bode, Rüdiger; Kunze, Gotthard

2013-01-01

319

Polyphenol oxidase activity in annual forage clovers  

Technology Transfer Automated Retrieval System (TEKTRAN)

Polyphenol oxidase (PPO)-mediated phenol reactions in red clover (Trifolium pratense L.) bind forage protein and reduce proteolysis, producing beneficial effects on forage protein degradability, silage fermentation, and soil-N cycling. We evaluated PPO activity in seven previously untested annual c...

320

Studies on the mechanism of alcohol oxidase  

E-print Network

advanced than carbon hydrogen bond cleavage. With methanol, ethanol, and trifluoroethanol as substrates for alcohol oxidase, a single ionizable group with a pKa value of 8.3 must be deprotonated for binding and catalysis. This residue is proposed...

Menon, Vipin

1994-01-01

321

Kinetic design of the respiratory oxidases.  

PubMed

Energy conservation in all kingdoms of life involves electron transfer, through a number of membrane-bound proteins, associated with proton transfer across the membrane. In aerobic organisms, the last component of this electron-transfer chain is a respiratory heme-copper oxidase that catalyzes reduction of O(2) to H(2)O, linking this process to transmembrane proton pumping. So far, the molecular mechanism of proton pumping is not known for any system that is driven by electron transfer. Here, we show that this problem can be addressed and elucidated in a unique cytochrome c oxidase (cytochrome ba(3)) from a thermophilic bacterium, Thermus thermophilus. The results show that in this oxidase the electron- and proton-transfer reactions are orchestrated in time such that previously unresolved proton-transfer reactions could be directly observed. On the basis of these data we propose that loading of the proton pump occurs upon electron transfer, but before substrate proton transfer, to the catalytic site. Furthermore, the results suggest that the pump site alternates between a protonated and deprotonated state for every second electron transferred to the catalytic site, which would explain the noninteger pumping stoichiometry (0.5 H(+)/e(-)) of the ba(3) oxidase. Our studies of this variant of Nature's palette of mechanistic solutions to a basic problem offer a route toward understanding energy conservation in biological systems. PMID:21690359

von Ballmoos, Christoph; Gennis, Robert B; Ädelroth, Pia; Brzezinski, Peter

2011-07-01

322

Regulation of NADPH Oxidase Activity in Phagocytes  

PubMed Central

The X+-linked chronic granulomatous disease (X+-CGD) variants are natural mutants characterized by defective NADPH oxidase activity but with normal Nox2 expression. According to the three-dimensional model of the cytosolic Nox2 domain, most of the X+-CGD mutations are located in/or close to the FAD/NADPH binding regions. A structure/function study of this domain was conducted in X+-CGD PLB-985 cells exactly mimicking 10 human variants: T341K, C369R, G408E, G408R, P415H, P415L, ?507QKT509-HIWAinsert, C537R, L546P, and E568K. Diaphorase activity is defective in all these mutants. NADPH oxidase assembly is normal for P415H/P415L and T341K mutants where mutation occurs in the consensus sequences of NADPH- and FAD-binding sites, respectively. This is in accordance with their buried position in the three-dimensional model of the cytosolic Nox2 domain. FAD incorporation is abolished only in the T341K mutant explaining its absence of diaphorase activity. This demonstrates that NADPH oxidase assembly can occur without FAD incorporation. In addition, a defect of NADPH binding is a plausible explanation for the diaphorase activity inhibition in the P415H, P415L, and C537R mutants. In contrast, Cys-369, Gly-408, Leu-546, and Glu-568 are essential for NADPH oxidase complex assembly. However, according to their position in the three-dimensional model of the cytosolic domain of Nox2, only Cys-369 could be in direct contact with cytosolic factors during oxidase assembly. In addition, the defect in oxidase assembly observed in the C369R, G408E, G408R, and E568K mutants correlates with the lack of FAD incorporation. Thus, the NADPH oxidase assembly process and FAD incorporation are closely related events essential for the diaphorase activity of Nox2. PMID:20724480

Debeurme, Franck; Picciocchi, Antoine; Dagher, Marie-Claire; Grunwald, Didier; Beaumel, Sylvain; Fieschi, Franck; Stasia, Marie-José

2010-01-01

323

A comparative summary of expression systems for the recombinant production of galactose oxidase  

Microsoft Academic Search

BACKGROUND: The microbes Escherichia coli and Pichia pastoris are convenient prokaryotic and eukaryotic hosts, respectively, for the recombinant production of proteins at laboratory scales. A comparative study was performed to evaluate a range of constructs and process parameters for the heterologous intra- and extracellular expression of genes encoding the industrially relevant enzyme galactose 6-oxidase (EC 1.1.3.9) from the fungus Fusarium

Oliver Spadiut; Lisbeth Olsson; Harry Brumer

2010-01-01

324

The Plant NADPH Oxidase RBOHD Mediates Rapid Systemic Signaling in Response to Diverse Stimuli  

Microsoft Academic Search

Cell-to-cell communication and long-distance signaling play a key role in the response of plants to pests, mechanical wounding, and extreme environmental conditions. Here, we report on a rapid systemic signal in Arabidopsis thaliana that traveled at a rate of 8.4 centimeters per minute and was dependent on the respiratory burst oxidase homolog D (RbohD) gene. Signal propagation was accompanied by

Gad Miller; Karen Schlauch; Rachel Tam; Diego Cortes; Miguel A. Torres; Vladimir Shulaev; Jeffery L. Dangl; Ron Mittler

2009-01-01

325

Pyruvate oxidase contributes to the aerobic growth efficiency of Escherichia coli  

Microsoft Academic Search

The metabolic importance of pyruvate oxidase (PoxB), which converts pyruvate directly to acetate and CO2, was assessed using an isogenic set of genetically engineered strains of Escherichia coli. In a strain lacking the pyruvate dehydrogenase complex (PDHC), PoxB supported acetate-independent aerobic growth when the poxB gene was expressed constitutively or from the IPTG- inducible tac promoter. Using aerobic glucose-limited chemostat

Ahmed M. Abdel-Hamid; Margaret M. Attwood; John R. Guest

2001-01-01

326

Lysyl Oxidase-Like 2 as a New Poor Prognosis Marker of Squamous Cell Carcinomas  

Microsoft Academic Search

Lysyl oxidase-like 2 (Loxl2) interacts with and stabilizes Snai1 transcription factor, promoting epithelial-mesenchymal tran- sition.Either Loxl2 or Snai1 knock-down blocks tumor growth and induces differentiation, but the specific role of each factor in tumor progression is still unknown.Comparison of the gene expression profiles of the squamous cell carcinoma cell line HaCa4 after knocking-down Loxl2 or Snai1 revealed that a subset

Hector Peinado; David Hardisson; Vanesa Santos; Marta Mendiola; Juan Ignacio de Diego; Manuel Nistal; Miguel Quintanilla; Francisco Portillo; Amparo Cano

2008-01-01

327

Polyphenol oxidase overexpression in transgenic Populus enhances resistance to herbivory by forest tent caterpillar ( Malacosoma disstria )  

Microsoft Academic Search

In order to functionally analyze the predicted defensive role of leaf polyphenol oxidase (PPO; EC 1.10.3.1) in Populus, transgenic hybrid aspen ( Populus tremula × P. alba) plants overexpressing a hybrid poplar ( Populus trichocarpa × P. deltoides) PtdPPO1 gene were constructed. Regenerated transgenic plants showed high PPO enzyme activity, PtdPPO1 mRNA levels and PPO protein accumulation. In leaf disk bioassays,

Jiehua Wang; C. Peter Constabel

2004-01-01

328

MECHANISM OF POLYPHENOL OXIDASE ACTION IN REDUCING LIPOLYSIS AND PROTEOLYSIS IN RED CLOVER DURING BATCH CULTURE INCUBATION  

Technology Transfer Automated Retrieval System (TEKTRAN)

Introduction: We previously showed that red clover, with the PPO1 gene silenced (Sullivan and Hatfield, 2006), exhibited higher levels of lipolysis than the wild type in the presence of rumen micro-organisms. This questioned the hypothetical mode of action of polyphenol oxidase (PPO) being solely th...

329

Identification of Renox, an NAD(P)H oxidase in kidney  

PubMed Central

Oxygen sensing is essential for homeostasis in all aerobic organisms, but its mechanism is poorly understood. Data suggest that a phagocytic-like NAD(P)H oxidase producing reactive oxygen species serves as a primary sensor for oxygen. We have characterized a source of superoxide anions in the kidney that we refer to as a renal NAD(P)H oxidase or Renox. Renox is homologous to gp91phox (91-kDa subunit of the phagocyte oxidase), the electron-transporting subunit of phagocytic NADPH oxidase, and contains all of the structural motifs considered essential for binding of heme, flavin, and nucleotide. In situ RNA hybridization revealed that renox is highly expressed at the site of erythropoietin production in the renal cortex, showing the greatest accumulation of renox mRNA in proximal convoluted tubule epithelial cells. NIH 3T3 fibroblasts overexpressing transfected Renox show increased production of superoxide and develop signs of cellular senescence. Our data suggest that Renox, as a renal source of reactive oxygen species, is a likely candidate for the oxygen sensor function regulating oxygen-dependent gene expression and may also have a role in the development of inflammatory processes in the kidney. PMID:10869423

Geiszt, Miklós; Kopp, Jeffrey B.; Várnai, Péter; Leto, Thomas L.

2000-01-01

330

Role of the NADPH Oxidases DUOX and NOX4 in Thyroid Oxidative Stress.  

PubMed

Somatic mutations are present at high levels in the rat thyroid gland, indicating that the thyrocyte is under oxidative stress, a state in which cellular oxidant levels are high. The most important class of free radicals, or reactive metabolites, is reactive oxygen species (ROS), such as superoxide anion (O2 (-)), hydroxyl radical (OH) and hydrogen peroxide (H2O2). The main source of ROS in every cell type seems to be mitochondrial respiration; however, recent data support the idea that NADPH:O(2) oxidoreductase flavoproteins or simply NADPH oxidases (NOX) are enzymes specialized in controlled ROS generation at the subcellular level. Several decades ago, high concentrations of H2O2 were detected at the apical surface of thyrocytes, where thyroid hormone biosynthesis takes place. Only in the last decade has the enzymatic source of H2O2 involved in thyroid hormone biosynthesis been well characterized. The cloning of two thyroid genes encoding NADPH oxidases dual oxidases 1 and 2 (DUOX1 and DUOX2) revealed that DUOX2 mutations lead to hereditary hypothyroidism in humans. Recent reports have also described the presence of NOX4 in the thyroid gland and have suggested a pathophysiological role of this member of the NOX family. In the present review, we describe the participation of NADPH oxidases not only in thyroid physiology but also in gland pathophysiology, particularly the involvement of these enzymes in the regulation of thyroid oxidative stress. PMID:24847449

Carvalho, Denise P; Dupuy, Corinne

2013-09-01

331

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping  

SciTech Connect

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissues revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin [Keio Univ. School of Medicine, Tokyo (Japan)] [and others] [Keio Univ. School of Medicine, Tokyo (Japan); and others

1997-03-01

332

Immune cascade of Spodoptera litura: cloning, expression, and characterization of inducible prophenol oxidase.  

PubMed

Haemolymph associated phenol oxidase is a critical component of invertebrate immune reaction and cuticle sclerotization. Phenol oxidase catalyses the conversion of mono-phenols to diphenols and quinones which finally leads to melanin formation. We have cloned the c-DNA encoding phenol oxidase from the haemocytes of Spodoptera litura and expressed it in Escherichia coli. The encoding gene is 2452bp with an open reading frame of 2091 bp translating into a 697 amino acid protein. Multiple alignment analysis of the predicted protein sequence shows close homology to other lepidopeteran PPOII type genes. The transcription of the gene is induced upon microbial challenge of 6th instar larvae with E. coli and is unresponsive to injury. Cloning of the ORF of SLPPO in-frame in the E. coli expression vector pQE30 resulted in its expression. Enzymatic analysis of the recombinant protein reveals that the recombinant protein is catalytically active on 4-methyl pyrocatechol upon activation by cetyl pyridinium chloride. PMID:16185666

Rajagopal, R; Thamilarasi, K; Venkatesh, G Raja; Srinivas, P; Bhatnagar, Raj K

2005-11-11

333

Purine-induced expression of urate oxidase and enzyme activity in Atlantic salmon (Salmo salar). Cloning of urate oxidase liver cDNA from three teleost species and the African lungfish Protopterus annectens.  

PubMed

The peroxisomal enzyme urate oxidase plays a pivotal role in the degradation of purines in both prokaryotes and eukaryotes. However, knowledge about the purine-induced expression of the encoding gene is lacking in vertebrates. These are the first published sequences of fish urate oxidase, which were predicted from PCR amplified liver cDNAs of Atlantic salmon (Salmo salar), Atlantic cod (Gadus morhua), Atlantic halibut (Hippoglossus hippoglossus) and African lungfish (Protopterus annectens). Sequence alignment of different vertebrate urate oxidases revealed amino acid substitutions of putative functional importance in the enzyme of chicken and lungfish. In the adult salmon, expression of urate oxidase mRNA predominated in liver, but was also identified in several nonhepatic organs including brain, but not in skeletal muscle and kidney. Juvenile salmon fed diets containing bacterial protein meal (BPM) rich in nucleic acids showed a significant increase in liver urate oxidase enzyme activity, and urea concentrations in plasma, muscle and liver were elevated. Whereas salmon fed the 18% BPM diet showed a nonsignificant increase in liver mRNA levels of urate oxidase compared with the 0% BPM-fed fish, no further increase in mRNA levels was found in fish receiving 36% BPM. The discrepancy between urate oxidase mRNA and enzyme activity was explained by rapid mRNA degradation or alternatively, post-translational control of the activity. Although variable plasma and liver levels of urate were detected, the substrate increased only slightly in 36% BPM-fed fish, indicating that the uricolytic pathway of Atlantic salmon is intimately regulated to handle high dietary purine levels. PMID:16759232

Andersen, Øivind; Aas, Turid S; Skugor, Stanko; Takle, Harald; van Nes, Solveig; Grisdale-Helland, Barbara; Helland, Ståle J; Terjesen, Bendik F

2006-07-01

334

BEHAVIORAL OUTCOMES OF MONOAMINE OXIDASE DEFICIENCY: PRECLINICAL AND CLINICAL EVIDENCE  

PubMed Central

Monoamine oxidase (MAO) isoenzymes A and B are mitochondrial-bound proteins, catalyzing the oxidative deamination of monoamine neurotransmitters as well as xenobiotic amines. Although they derive from a common ancestral progenitor gene, are located at X-chromosome and display 70% structural identity, their substrate preference, regional distribution, and physiological role are divergent. In fact, while MAO-A has high affinity for serotonin and norepinephrine, MAO-B primarily serves the catabolism of 2-phenylethylamine (PEA) and contributes to the degradation of other trace amines and dopamine. Convergent lines of preclinical and clinical evidence indicate that variations in MAO enzymatic activity—due to either genetic or environmental factors—can exert a profound influence on behavioral regulation and play a role in the pathophysiology of a large spectrum of mental and neurodegenerative disorders, ranging from antisocial personality disorder to Parkinson’s disease. Over the past few years, numerous advances have been made in our understanding of the phenotypical variations associated with genetic polymorphisms and mutations of the genes encoding for both isoenzymes. In particular, novel findings on the phenotypes of MAO-deficient mice are highlighting novel potential implications of both isoenzymes in a broad spectrum of mental disorders, ranging from autism and anxiety to impulse-control disorders and ADHD. These studies will lay the foundation for future research on the neurobiological and neurochemical bases of these pathological conditions, as well as the role of gene × environment interactions in the vulnerability to several mental disorders. PMID:21971001

Bortolato, Marco; Shih, Jean C.

2012-01-01

335

Characterization of an Operon Encoding Two cType Cytochromes, an aa3Type Cytochrome Oxidase, and Rusticyanin in Thiobacillus ferrooxidans ATCC 33020  

Microsoft Academic Search

Despite the importance of Thiobacillus ferrooxidans in bioremediation and bioleaching, little is known about the genes encoding electron transfer proteins implicated in its energetic metabolism. This paper reports the sequences of the four cox genes encoding the subunits of an aa3-type cytochrome c oxidase. These genes are in a locus containing four other genes: cyc2, which encodes a high-molecular-weight cytochrome

CORINNE APPIA-AYME; NICOLAS GUILIANI; JEANINE RATOUCHNIAK; VIOLAINE BONNEFOY

1999-01-01

336

Genes  

NSDL National Science Digital Library

Illustration of the placement of genes in a chromosome. A gene can be defined as a region of DNA that controls a hereditary characteristic. It usually corresponds to a sequence used in the production of a specific protein or RNA. A gene carries biological information in a form that must be copied and transmitted from each cell to all its progeny. This includes the entire functional unit: coding DNA sequences, non-coding regulatory DNA sequences, and introns. Genes can be as short as 1000 base pairs or as long as several hundred thousand base pairs. It can even be carried by more than one chromosome. The estimate for the number of genes in humans has decreased as our knowledge has increased. As of 2001, humans are thought to have between 30,000 and 40,000 genes.

BEGIN:VCARD VERSION:2.1 FN:Access Excellence N:Excellence; Access REV:2005-03-12 END:VCARD

2005-03-12

337

Lysyl oxidase expression and inhibition in uveal melanoma.  

PubMed

Lysyl oxidase is a marker of poor prognosis in several malignancies and is hypothesized to promote a migratory phenotype in hypoxic breast carcinomas. This study aims to characterize the expression of the lysyl oxidase and lysyl oxidase-like proteins in human uveal melanoma cell lines and archival choroidal melanomas using immunohistochemistry. The transcriptional control of lysyl oxidase will also be investigated under simulated hypoxic conditions using cobalt chloride. Lastly, changes in cellular proliferation and invasion will be assessed after the treatment of cell lines with beta-aminopropionitrile, a lysyl oxidase catalytic inhibitor. Retrospective analysis of lysyl oxidase expression in primary human uveal melanoma showed 82% (27 of 33) of tumors being stained positive. High lysyl oxidase expression correlated with the aggressive epithelioid cell type and was associated with shorter metastasis-free survival. Simulated hypoxia resulted in a significant increase in lysyl oxidase mRNA expression. Inhibiting lysyl oxidase's catalytic activity significantly reduced cellular invasion but had no effect on cell proliferation. Our study is the first to show lysyl oxidase expression in primary choroidal melanomas. This protein may represent a potential therapeutic target that warrants further study in this malignancy. PMID:20179655

Abourbih, Daniel A; Di Cesare, Sebastian; Orellana, Maria E; Antecka, Emilia; Martins, Claudia; Petruccelli, Luca A; Burnier, Miguel N

2010-04-01

338

A novel superoxide-producing NAD(P)H oxidase in kidney.  

PubMed

During phagocytosis, gp91(phox), the catalytic subunit of the phagocyte NADPH oxidase, becomes activated to produce superoxide, a precursor of microbicidal oxidants. Currently increasing evidence suggests that nonphagocytic cells contain similar superoxide-producing oxidases, which are proposed to play crucial roles in various events such as cell proliferation and oxygen sensing for erythropoiesis. Here we describe the cloning of human cDNA that encodes a novel NAD(P)H oxidase, designated NOX4. The NOX4 protein of 578 amino acids exhibits 39% identity to gp91(phox) with special conservation in membrane-spanning regions and binding sites for heme, FAD, and NAD(P)H, indicative of its function as a superoxide-producing NAD(P)H oxidase. The membrane fraction of kidney-derived human embryonic kidney (HEK) 293 cells, expressing NOX4, exhibits NADH- and NADPH-dependent superoxide-producing activities, both of which are inhibited by diphenylene iodonium, an agent known to block oxygen sensing, and decreased in cells expressing antisense NOX4 mRNA. The human NOX4 gene, comprising 18 exons, is located on chromosome 11q14.2-q21, and its expression is almost exclusively restricted to adult and fetal kidneys. In human renal cortex, high amounts of the NOX4 protein are present in distal tubular cells, which reside near erythropoietin-producing cells. In addition, overexpression of NOX4 in cultured cells leads to increased superoxide production and decreased rate of growth. The present findings thus suggest that the novel NAD(P)H oxidase NOX4 may serve as an oxygen sensor and/or a regulator of cell growth in kidney. PMID:11032835

Shiose, A; Kuroda, J; Tsuruya, K; Hirai, M; Hirakata, H; Naito, S; Hattori, M; Sakaki, Y; Sumimoto, H

2001-01-12

339

The NADH oxidase of Streptococcus pneumoniae: its involvement in competence and virulence.  

PubMed

A soluble flavoprotein that reoxidizes NADH and reduces molecular oxygen to water was purified from the facultative anaerobic human pathogen Streptococcus pneumoniae. The nucleotide sequence of nox, the gene which encodes it, has been determined and was characterized at the functional and physiological level. Several nox mutants were obtained by insertion, nonsense or missense mutation. In extracts from these strains, no NADH oxidase activity could be measured, suggesting that a single enzyme encoded by nox, having a C44 in its active site, was utilizing O2 to oxidize NADH in S. pneumoniae. The growth rate and yield of the NADH oxidase-deficient strains were not changed under aerobic or anaerobic conditions, but the efficiency of development of competence for genetic transformation during growth was markedly altered. Conditions that triggered competence induction did not affect the amount of Nox, as measured using Western blotting, indicating that nox does not belong to the competence-regulated genetic network. The decrease in competence efficiency due to the nox mutations was similar to that due to the absence of oxygen in the nox+ strain, suggesting that input of oxygen into the metabolism via NADH oxidase was important for controlling competence development throughout growth. This was not related to regulation of nox expression by O2. Interestingly, the virulence and persistence in mice of a blood isolate was attenuated by a nox insertion mutation. Global cellular responses of S. pneumoniae, such as competence for genetic exchange or virulence in a mammalian host, could thus be modulated by oxygen via the NADH oxidase activity of the bacteria, although the bacterial energetic metabolism is essentially anaerobic. The enzymatic activity of the NADH oxidase coded by nox was probably involved in transducing the external signal, corresponding to O2 availability, to the cell metabolism and physiology; thus, this enzyme may function as an oxygen sensor. This work establishes, for the first time, the role of O2 in the regulation of pneumococcal transformability and virulence. PMID:10594826

Auzat, I; Chapuy-Regaud, S; Le Bras, G; Dos Santos, D; Ogunniyi, A D; Le Thomas, I; Garel, J R; Paton, J C; Trombe, M C

1999-12-01

340

NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death  

SciTech Connect

Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91{sup phox} was dose-dependent. Meanwhile, the cytoplasmic subunit p47{sup phox} was translocated to the cell membrane and localized with p22{sup phox} and gp91{sup phox} to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

Liu Qing [Department of Radiobiology, Institute of Modern Physics, Chinese Academy of Sciences, 509 Nanchang Rd., Lanzhou 730000 (China); Key Laboratory of Heavy Ion Radiation Medicine of Gansu Province, 509 Nanchang Rd., Lanzhou 730000 (China); He Xiaoqing [First Affiliated Hospital of Lanzhou University, 1 Donggang West Rd., Lanzhou 730000 (China); Liu Yongsheng [Key Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural, 1 Xujiaping Rd., Lanzhou 730046 (China); Du Bingbing; Wang Xiaoyan [College of Medicine, Lanzhou University, 222, South Tianshui Rd., Lanzhou 730000 (China); Zhang Weisheng [Gansu Province People's Hospital, 160 Donggang West Rd., Lanzhou 730000 (China); Jia Pengfei [Institute of Cell Biology, School of Life Science, Lanzhou University, 222, South Tianshui Rd., Lanzhou 730000 (China); Dong Jingmei [Institute of Sports Medicine, Lanzhou City University, Jiefang Rd., Lanzhou 730070 (China); Ma Jianxiu [College of Medicine, Northwest University for Nationalities, 1 Northwest New Village, Lanzhou 730030 (China); Wang Xiaohu [Department of Radiology, Gansu Province Cancer Hospital, 2 Xiaoxihu East Rd., Lanzhou 730050 (China); Li Sha [Department of Radiology, Lanzhou General Hospital of PLA, 98 Xiaoxihu West Rd., 730050 (China); Zhang Hong [Department of Radiobiology, Institute of Modern Physics, Chinese Academy of Sciences, 509 Nanchang Rd., Lanzhou 730000 (China); Key Laboratory of Heavy Ion Radiation Medicine of Gansu Province, 509 Nanchang Rd., Lanzhou 730000 (China)], E-mail: zhangh@impcas.ac.cn

2008-12-19

341

Xanthine oxidase biosensor for monitoring meat spoilage  

NASA Astrophysics Data System (ADS)

In this study, we have designed an electrochemical biosensor for real-time detection of specific biomarkers of bacterial metabolism related to meat spoilage (hypoxanthine and xanthine). The selective biosensor was developed by assembling a `sandwich' of nanomaterials and enzymes on a platinum-iridium electrode (1.6 mm tip diameter). The materials deposited on the sensor tip include amorphous platinum nanoclusters (i.e. Pt black), reduced graphene oxide, nanoceria, and xanthine oxidase. Xanthine oxidase was encapsulated in laponite hydrogel and used for the biorecognition of hypoxanthine and xanthine (two molecules involved in the rotting of meat by spoilage microorganisms). The developed biosensor demonstrated good electrochemical performance toward xanthine with sensitivity of 2.14 +/- 1.48 ?A/mM, response time of 5.2 +/- 1.5 sec, lower detection limit of 150 +/- 39 nM, and retained at least 88% of its activity after 7 days of continuous use.

Vanegas, D. C.; Gomes, C.; McLamore, E. S.

2014-05-01

342

Imaging Monoamine Oxidase in the Human Brain  

SciTech Connect

Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

1999-11-10

343

Defensive Roles of Polyphenol Oxidase in Plants  

Microsoft Academic Search

Plant polyphenol oxidases (PPOs) are widely distributed and well-studied oxidative enzymes, and their effects on discoloration in damaged and diseased plant tissues have been known for many years. The discovery in C.A. Ryan's laboratory in the mid-1990s that tomato PPO is induced by the herbivore defense signals systemin and jasmonate, together with seminal work on PPO's possible effects on herbiv-

C. Peter Constabel; Raymond Barbehenn

344

Nanoparticle strategies for cancer therapeutics: Nucleic acids, polyamines, bovine serum amine oxidase and iron oxide nanoparticles (Review).  

PubMed

Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other advanced nanosystem based on directed nucleic acid assemblies, polyamine-induced DNA condensation, and bovine serum amine oxidase may be proposed for futuristic anticancer therapy utilizing nucleic acids, polyamines and BSAO. BSAO based nanoparticles can be employed for the generation of cytotoxic polyamine metabolites. PMID:25333509

Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J

2015-01-01

345

Comparison of kinetic properties of amine oxidases from sainfoin and lentil and immunochemical characterization of copper/quinoprotein amine oxidases.  

PubMed

Kinetic properties of novel amine oxidase isolated from sainfoin (Onobrychis viciifolia) were compared to those of typical plant amine oxidase (EC 1.4.3.6) from lentil (Lens culinaris). The amine oxidase from sainfoin was active toward substrates, such as 1,5-diaminopentane (cadaverine) with K(m) of 0.09 mM and 1,4-diaminobutane (putrescine) with K(m) of 0.24 mM. The maximum rate of oxidation for cadaverine at saturating concentration was 2.7 fold higher than that of putrescine. The amine oxidase from lentil had the maximum rate for putrescine comparable to the rate of sainfoin amine oxidase with the same substrate. Both amine oxidases, like other plant Cu-amine oxidases, were inhibited by substrate analogs (1,5-diamino-3-pentanone, 1,4-diamino-2-butanone and aminoguanidine), Cu2+ chelating agents (diethyltriamine, 1,10-phenanthroline, 8-hydroxyquinoline, 2,2'-bipyridyl, imidazole, sodium cyanide and sodium azide), some alkaloids (L-lobeline and cinchonine), some lathyrogens (beta-aminopropionitrile and aminoacetonitrile) and other inhibitors (benzamide oxime, acetone oxime, hydroxylamine and pargyline). Tested by Ouchterlony's double diffusion in agarose gel, polyclonal antibodies against the amine oxidase from sainfoin, pea and grass pea cross-reacted with amine oxidases from several other Fabaceae and from barley (Hordeum vulgare) of Poaceae, while amine oxidase from the filamentous fungus Aspergillus niger did not cross-react at all. However, using Western blotting after SDS-PAGE with rabbit polyclonal antibodies against the amine oxidase from Aspergillus niger, some degree of similarity of plant amine oxidases from sainfoin, pea, field pea, grass pea, fenugreek, common melilot, white sweetclover and Vicia panonica with the A. niger amine oxidase was confirmed. PMID:10092944

Zajoncová, L; Frébort, I; Luhová, L; Sebela, M; Galuszka, P; Pec, P

1999-01-01

346

Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688  

PubMed Central

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

Dijkman, Willem P.

2014-01-01

347

Identification and characterization of an alternative oxidase in the entomopathogenic fungus Metarhizium anisopliae.  

PubMed

Mitochondria of Metarhizium anisopliae contain an alternative oxidase (AOX), which reduces oxygen to water by accepting electrons directly from ubiquinol. AOX activity is demonstrated in situ as a constitutive enzyme. Greatest activity of AOX appears at the beginning and at the end of the fungal developmental cycle, germination of aerial conidia and the formation of submerged conidia, respectively. Changes in nutritional conditions, e.g., the presence of host insect cuticle or nutrient starvation had no effect on the induction of AOX activity. Antimycin A, an electron transport chain inhibitor, induced AOX activity. Cloning of the AOX DNA and the alignment of the deduced amino acid sequence of a segment of the AOX gene from M. anisopliae shows structural similarities with other AOX sequences with differing levels of variation when compared with homologous sequences from plants, yeasts, and filamentous fungi. Alternative oxidase in entomopathogenic fungi may have a positive contribution to ecological fitness. PMID:18388981

Uribe, Daniel; Khachatourians, George G

2008-02-01

348

Purification and characterization of extracellular cholesterol oxidase from Enterobacter sp  

Microsoft Academic Search

The objective of this work is to obtain an abundant source of cholesterol oxidases for industrial and medicinal needs. Thirteen\\u000a bacterial strains that express high level of inducible extracellular cholesterol oxidase (COX) were isolated from carnivore\\u000a feces. One of these strains, named COX8-9, belonging to the genus Enterobacter, was found to produce the highest level of cholesterol oxidase. COX from

Deping Ye; Jiahong Lei; Wei Li; Fanglan Ge; Ke Wu; Wenliu Xu; Bin Yong

2008-01-01

349

Development of irreversible inactivators of spermine oxidase and N1-acetylpolyamine oxidase.  

PubMed

Three functional groups (2-propenyl, 2-propynyl, and 2,3-butadienyl) were introduced onto one of the terminal amino groups of spermidine. Of the six compounds synthesized, N-(3-aminopropyl)-N'-2,3-butadienyl-1,4-butanediamine (N(8)-butadienyl Spd) and N-[3-(2,3-butadienylamino)propyl]-1,4-butanediamine (N(1)-butadienyl Spd) irreversibly inactivated human spermine oxidase (SMO) and N(1)-acetylpolyamine oxidase (APAO). Interestingly, N(8)-butadienyl Spd inactivated SMO far more potently than N,N'-di-2,3-butadienyl-1,4-butanediamine (MDL 72527). PMID:24583866

Moriya, Shun-suke; Miura, Toshiyuki; Takao, Koichi; Sugita, Yoshiaki; Samejima, Keijiro; Hiramatsu, Kyoko; Kawakita, Masao

2014-01-01

350

Targeting NADPH Oxidases for the Treatment of Cancer and Inflammation  

PubMed Central

NADPH oxidases are a family of oxidases that utilize molecular oxygen to generate hydrogen peroxide and superoxide, thus indicating physiological functions of these Highly reactive and short lived species. The regulation of these NADPH oxidases (nox) enzymes is complex, with many members of this family exhibiting complexity in subunit composition, cellular location, and tissue specific expression. While the complexity of the nox family (Nox1–5, Duox1,2) is daunting, the complexity also allows for targeting of NADPH oxidases in disease states. This review will discuss which inflammatory and malignant disorders can be targeted by nox inhibitors, as well as clinical experience in the use of nox inhibitors. PMID:22581366

Bonner, Michael Y.; Arbiser, Jack L

2015-01-01

351

21 CFR 866.2420 - Oxidase screening test for gonorrhea.  

Code of Federal Regulations, 2013 CFR

...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

2013-04-01

352

21 CFR 866.2420 - Oxidase screening test for gonorrhea.  

Code of Federal Regulations, 2012 CFR

...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

2012-04-01

353

21 CFR 866.2420 - Oxidase screening test for gonorrhea.  

Code of Federal Regulations, 2014 CFR

...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase screening test for gonorrhea. (a) Identification. An...

2014-04-01

354

Impact of myeloperoxidase and NADPH-oxidase polymorphisms in drug-induced agranulocytosis.  

PubMed

Therapy of the atypical antipsychotic drug clozapine is limited by a comparatively high incidence of agranulocytosis in 0.8% of patients. This severe side effect is possibly based on the clozapine-mediated stimulation of cytokines and soluble cytokine receptors release, followed by induction of granulocyte proliferation and induction of myeloperoxidase (MPO) and NADPH-oxidase. Because NADPH-oxidase/MPO may oxidize clozapine to highly reactive nitrenium ions, we investigated the role of hereditary polymorphisms in the NADPH oxidase/myeloperoxidase system in agranulocytosis patients who received clozapine (n = 49), ticlopidine (n = 11), and other drugs prior to the event. The low active MPO -436A allelic variant frequency was 22.2% in cases and 19.9% in controls, but AA carriers were overrepresented among cases compared with the sum of AG and GG-carriers (odds ratio 4.16, 95% confidence limits 0.86-20.3, P = 0.056). Particularly in clozapine-induced agranulocytosis, this finding was most pronounced (P = 0.04). In the CYBA gene, encoding the p22phox subunit of the NADPH-oxidase, 2 polymorphisms were investigated. C242T (His72Tyr) had an allele frequency of 31.9% and 32.2% (P = NS) and A640G in the 3'-UTR was less frequent in cases (48.7%) than controls (60.0%), odds ratio 0.63 (0.39-1.02), P = 0.048. CYBA 640GG-carriers were marginally less frequent in cases compared with controls (28.2% vs. 38.7%, P = 0.062). Sequencing the entire coding region of the NADPH subunit CYBB (gpS1phase) disclosed that CYBB is a highly conserved gene, which does not represent a risk factor for clozapine-induced agranulocytosis. The impact of the polymorphic myeloperoxidase, however, needs further verification to predict a patient's risk to develop drug-induced agranulocytosis. PMID:15538122

Mosyagin, Igor; Dettling, Michael; Roots, Ivar; Mueller-Oerlinghausen, Bruno; Cascorbi, Ingolf

2004-12-01

355

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis  

PubMed Central

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

356

Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.  

PubMed

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 ?m for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J

2012-12-14

357

The human lysyl oxidase-like 2 protein functions as an amine oxidase toward collagen and elastin  

Microsoft Academic Search

The lysyl oxidase-like 2 (LOXL2) protein is a human paralogue of lysyl oxidase (LOX) that functions as an amine oxidase for\\u000a formation of lysine-derived cross-links found in collagen and elastin. In addition to the C-terminal domains characteristic\\u000a to the LOX family members, LOXL2 contains four scavenger receptor cysteine-rich (SRCR) domains in the N-terminus. In order\\u000a to assess the amine oxidase

Young-Mi Kim; Eun-Cheol Kim; Youngho Kim

2011-01-01

358

1-Aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein  

PubMed Central

1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal ?-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in ?-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837

Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe

2013-01-01

359

Bilirubin oxidase bioelectrocatalytic cathodes: the impact of hydrogen peroxide.  

PubMed

Mediator-less, direct electro-catalytic reduction of oxygen to water by bilirubin oxidase (Myrothecium sp.) was obtained on anthracene-modified, multi-walled carbon nanotubes. H2O2 was found to significantly and irreversibly affect the electro-catalytic activity of bilirubin oxidase, whereas similar electrodes comprised of laccase (Trametes versicolor) were reversibly inhibited. PMID:24185735

Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

2014-01-01

360

Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa  

NASA Technical Reports Server (NTRS)

In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

1995-01-01

361

Ascorbic acid and L-gulonolactone oxidase in lagomorphs.  

PubMed

1. The activity of L-gulonolactone oxidase (EC 1.1.3.8) in the liver of eastern cottontail rabbits (Sylvilagus floridanus) is about 10-fold greater in winter than in summer. 2. L-gulonolactone oxidase activity is low and tissue ascorbate high during all seasons in snowshoe hares (Lepus americanus). 3. Liver contents of ascorbate fall to low levels in L. americanus fed on rabbit chow in the laboratory. 4. The activity of L-gulonolactone oxidase in liver of Sylvilagus and Oryctolagus is depressed by feeding high levels of L-ascorbic acid. 5. The New Zealand White breed of domestic rabbit (Oryctolagus cuniculus) has considerably higher levels of L-gulonolactone oxidase and liver ascorbate than does the Dutch breed. 6. In a wild population of Oryctolagus sampled in Australia L-gulonolactone oxidase levels were intermediate between those of the two domestic breeds and more variable than either. PMID:318384

Jenness, R; Birney, E C; Ayaz, K L

1978-01-01

362

Primary structure of a novel subunit in ba3-cytochrome oxidase from Thermus thermophilus.  

PubMed Central

The bax-type cytochrome c oxidase from Thermus thermophilus is known as a two subunit enzyme. Deduced from the crystal structure of this enzyme, we discovered the presence of an additional transmembrane helix "subunit IIa" spanning the membrane. The hydrophobic N-terminally blocked protein was isolated in high yield using high-performance liquid chromatography. Its complete amino acid sequence was determined by a combination of automated Edman degradation of both the deformylated and the cyanogen bromide cleaved protein and automated C-terminal sequencing of the native protein. The molecular mass of 3,794 Da as determined by MALDI-MS and by ESI requires the N-terminal methionine to be formylated and is in good agreement with the value calculated from the formylmethionine containing sequence (3,766.5 Da + 28 Da = 3,794.5 Da). This subunit consits of 34 residues forming one helix across the membrane (Lys5-Ala34), which corresponds in space to the first transmembrane helix of subunit II of the cytochrome c oxidases from Paracoccus denitrificans and bovine heart, however, with opposite polarity. It is 35% identical to subunit IV of the ba3-cytochrome oxidase from Natronobacterium pharaonis. The open reading frame encoding this new subunit IIa (cbaD) is located upstream of cbaB in the same operon as the genes for subunit I (cbaA) and subunit II (cbaB). PMID:11152118

Soulimane, T.; Than, M. E.; Dewor, M.; Huber, R.; Buse, G.

2000-01-01

363

Xanthine oxidase inhibitors from Garcinia esculenta twigs.  

PubMed

The EtOAc-soluble portion of the 80?% (v/v) EtOH extract from the twigs of Garcinia esculenta exhibited strong xanthine oxidase inhibition in vitro. Bioassay-guided purification led to the isolation of 1,3,6,7-tetrahydroxyxanthone (3) and griffipavixanthone (8) as the main xanthine oxidase inhibitors, along with six additional compounds (1, 2, 4-7), including two new compounds (1 and 2). This enzyme inhibition was dose dependent with an IC50 value of approximately 1.2?µM for 3 and 6.3?µM for 8. The inhibitory activity of 3 was stronger than the control allopurinol (IC50 value: 5.3?µM). To our knowledge, compound 8 is the first bixanthone that demonstrated potent XO inhibitory activity in vitro. The structures of the new compounds were established by spectroscopic analysis, and the optical properties and absolute stereochemistry of racemic (±) esculentin A (2) were further determined by the calculation of the DP4 probability and analysis of its MTPA ester derivatives. PMID:25340468

Zhu, Lun-Lun; Fu, Wen-Wei; Watanabe, Shimpei; Shao, Yi-Nuo; Tan, Hong-Sheng; Zhang, Hong; Tan, Chang-Heng; Xiu, Yan-Feng; Norimoto, Hisayoshi; Xu, Hong-Xi

2014-12-01

364

The human lysyl oxidase-like 2 protein functions as an amine oxidase toward collagen and elastin.  

PubMed

The lysyl oxidase-like 2 (LOXL2) protein is a human paralogue of lysyl oxidase (LOX) that functions as an amine oxidase for formation of lysine-derived cross-links found in collagen and elastin. In addition to the C-terminal domains characteristic to the LOX family members, LOXL2 contains four scavenger receptor cysteine-rich (SRCR) domains in the N-terminus. In order to assess the amine oxidase activity of LOXL2, we expressed a series of recombinant LOXL2 proteins with deletions in the SRCR domains, using an Escherichia coli expression system. All of the purified recombinant LOXL2 proteins, with or without the SRCR domains in the N-terminus, showed significant amine oxidase activity toward several different types of collagen and elastin in in vitro amine oxidase assays, indicating deletion of the SRCR domains does not interfere with amine oxidase activity of LOXL2. Further, amine oxidase activity of LOXL2 was not susceptible to inhibition by ?-aminopropionitrile, an irreversible inhibitor of LOX, suggesting a different enzymatic mechanism between these two paralogues. PMID:20306300

Kim, Young-Mi; Kim, Eun-Cheol; Kim, Youngho

2011-01-01

365

Acyl-CoA oxidase complexes control the chemical message produced by Caenorhabditis elegans.  

PubMed

Caenorhabditis elegans uses ascaroside pheromones to induce development of the stress-resistant dauer larval stage and to coordinate various behaviors. Peroxisomal ?-oxidation cycles are required for the biosynthesis of the fatty acid-derived side chains of the ascarosides. Here we show that three acyl-CoA oxidases, which catalyze the first step in these ?-oxidation cycles, form different protein homo- and heterodimers with distinct substrate preferences. Mutations in the acyl-CoA oxidase genes acox-1, -2, and -3 led to specific defects in ascaroside production. When the acyl-CoA oxidases were expressed alone or in pairs and purified, the resulting acyl-CoA oxidase homo- and heterodimers displayed different side-chain length preferences in an in vitro activity assay. Specifically, an ACOX-1 homodimer controls the production of ascarosides with side chains with nine or fewer carbons, an ACOX-1/ACOX-3 heterodimer controls the production of those with side chains with seven or fewer carbons, and an ACOX-2 homodimer controls the production of those with ?-side chains with less than five carbons. Our results support a biosynthetic model in which ?-oxidation enzymes act directly on the CoA-thioesters of ascaroside biosynthetic precursors. Furthermore, we identify environmental conditions, including high temperature and low food availability, that induce the expression of acox-2 and/or acox-3 and lead to corresponding changes in ascaroside production. Thus, our work uncovers an important mechanism by which C. elegans increases the production of the most potent dauer pheromones, those with the shortest side chains, under specific environmental conditions. PMID:25775534

Zhang, Xinxing; Feng, Likui; Chinta, Satya; Singh, Prashant; Wang, Yuting; Nunnery, Joshawna K; Butcher, Rebecca A

2015-03-31

366

Aminoacetone oxidase from Streptococcus oligofermentans belongs to a new three-domain family of bacterial flavoproteins.  

PubMed

The aaoSo gene from Streptococcus oligofermentans encodes a 43 kDa flavoprotein, aminoacetone oxidase (SoAAO), which was reported to possess a low catalytic activity against several different L-amino acids; accordingly, it was classified as an L-amino acid oxidase. Subsequently, SoAAO was demonstrated to oxidize aminoacetone (a pro-oxidant metabolite), with an activity ~25-fold higher than the activity displayed on L-lysine, thus lending support to the assumption of aminoacetone as the preferred substrate. In the present study, we have characterized the SoAAO structure-function relationship. SoAAO is an FAD-containing enzyme that does not possess the classical properties of the oxidase/dehydrogenase class of flavoproteins (i.e. no flavin semiquinone formation is observed during anaerobic photoreduction as well as no reaction with sulfite) and does not show a true L-amino acid oxidase activity. From a structural point of view, SoAAO belongs to a novel protein family composed of three domains: an ?/? domain corresponding to the FAD-binding domain, a ?-domain partially modulating accessibility to the coenzyme, and an additional ?-domain. Analysis of the reaction products of SoAAO on aminoacetone showed 2,5-dimethylpyrazine as the main product; we propose that condensation of two aminoacetone molecules yields 3,6-dimethyl-2,5-dihydropyrazine that is subsequently oxidized to 2,5-dimethylpyrazine. The ability of SoAAO to bind two molecules of the substrate analogue O-methylglycine ligand is thought to facilitate the condensation reaction. A specialized role for SoAAO in the microbial defence mechanism related to aminoacetone catabolism through a pathway yielding dimethylpyrazine derivatives instead of methylglyoxal can be proposed. PMID:25269103

Molla, Gianluca; Nardini, Marco; Motta, Paolo; D'Arrigo, Paola; Panzeri, Walter; Pollegioni, Loredano

2014-12-15

367

Gene transfer from mitochondrion to nucleus: novel mechanisms for gene activation from Cox2  

E-print Network

Gene transfer from mitochondrion to nucleus: novel mechanisms for gene activation from Cox2 Daniel The evolutionarily recent transfer of the gene for cytochrome c oxidase subunit 2 (cox2) from the mitochondrion this presequence post-import, are considered to be essential adaptations for targeting of Cox2 to the mitochondrion

Palmer, Jeffrey

368

Epigenetic Silencing of Lysyl Oxidase-Like-1 through DNA Hypermethylation in an Autosomal Recessive Cutis Laxa Case  

Microsoft Academic Search

We have recently reported a case of cutis laxa caused by a fibulin-5 missense mutation (p.C217R). Skin fibroblasts from this individual showed an abnormal pattern of expression of several genes coding for elastic fiber-related proteins, including lysyl oxidase-like-1 (LOXL1). In this study we intended to elucidate the mechanism responsible for LOXL1 downregulation in these fibulin-5-mutant cells. We identified a proximal

Romain Debret; Valérie Cenizo; Géraldine Aimond; Valérie André; Martine Devillers; Isabelle Rouvet; André Mégarbané; Odile Damour; Pascal Sommer

2010-01-01

369

Cloning and characterization of multiple human polyamine oxidase splice variants that code for isoenzymes with different biochemical characteristics.  

PubMed Central

The recently cloned and characterized human polyamine oxidase (PAOh1) potentially represents a new class of catabolic enzymes in the mammalian polyamine metabolic pathway capable of the efficient oxidation of polyamines. Here the discovery of three additional human PAO splice variants is reported, and the data support the fact that the human PAO gene codes for at least four isoenzymes, each of which exhibit distinctive biochemical characteristics, suggesting the existence of additional levels of complexity in polyamine catabolism. PMID:12398765

Murray-Stewart, Tracy; Wang, Yanlin; Devereux, Wendy; Casero, Robert A

2002-01-01

370

Leishmania major possesses a unique HemG-type protoporphyrinogen IX oxidase  

PubMed Central

Leishmania major was proposed to either utilize haem from its host or partially synthesize the tetrapyrrole from host provided precursors. However, only indirect evidence was available for this partial late haem biosynthetic pathway. Here, we demonstrate that the LMJF_06_1280 gene of L. major encodes a HemG-type PPO (protoporphyrinogen IX oxidase) catalysing the oxidation of protoporphyrinogen IX to protoporphyrin IX. Interestingly, trypanosomatids are currently the only known eukaryotes possessing HemG-type enzymes. The LMJF_06_1280 gene forms a potential transcriptional unit with LMJF_06_1270 encoding CPO (coproporphyrinogen III oxidase) and with LMJF_06_1290 for a cytochrome b5. In vivo function of the L. major hemG gene was shown by the functional complementation of the Escherichia coli ?hemG strain LG285. Restored haem formation in E. coli was observed using HPLC analyses. Purified recombinant L. major HemG revealed PPO activity in vitro using different ubiquinones and triphenyltetrazolium as electron acceptors. FMN was identified as the L. major HemG cofactor. Active site residues were found to be essential for HemG catalysis. These data in combination with the solved crystal structures of L. major CPO and the physiological proof of a ferrochelatase activity provide clear-cut evidence for a partial haem biosynthetic pathway in L. major. PMID:24962471

Zwerschke, Dagmar; Karrie, Simone; Jahn, Dieter; Jahn, Martina

2014-01-01

371

Characterization of two amine oxidases from Aspergillus carbonarius AIU 205.  

PubMed

We have reported that Aspergillus carbonarius AIU 205, which was isolated by our group, produced three enzymes exhibiting oxidase activity for 4-aminobutanamide (4-ABAD) (J. Biosci. Bioeng., 117, 263-268 (2014)). Among three enzymes, characteristics of enzyme I have been revealed, but those of the other two enzymes have not. In this study, we purified enzymes II and III, and compared their characteristics with those of enzyme I. Enzymes II and III also oxidized aliphatic monoamines, aromatic amines, and aliphatic aminoalcohols. In addition, the oxidase activity of both enzymes was strongly inhibited by carbonyl reagents and specific inhibitors for copper-containing amine oxidases. Thus, enzymes II and III were also classified into the copper-containing amine oxidase group (EC 1.4.3.6) along with enzyme I. However, these three enzymes differed from each other in their enzymatic, kinetic, and physicochemical properties. The N-terminal amino acid sequences also differed from each other; that of enzyme I was modified, that of enzyme II was similar to those of peroxisomal copper-containing amine oxidases, and that of enzyme III was similar to those of copper-containing amine oxidases from the genus Aspergillus. Therefore, we concluded that A. carbonarius AIU 205 produced three different types of amine oxidase in the mycelia. PMID:25468423

Sugawara, Asami; Matsui, Daisuke; Yamada, Miwa; Asano, Yasuhisa; Isobe, Kimiyasu

2014-11-22

372

ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases  

USGS Publications Warehouse

Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

2012-01-01

373

Direct Regulation of Cytochrome c Oxidase by Calcium Ions  

PubMed Central

Cytochrome c oxidase from bovine heart binds Ca2+ reversibly at a specific Cation Binding Site located near the outer face of the mitochondrial membrane. Ca2+ shifts the absorption spectrum of heme a, which allowed previously to determine the kinetics and equilibrium characteristics of the binding. However, no effect of Ca2+ on the functional characteristics of cytochrome oxidase was revealed earlier. Here we report that Ca2+ inhibits cytochrome oxidase activity of isolated bovine heart enzyme by 50–60% with Ki of ?1 µM, close to Kd of calcium binding with the oxidase determined spectrophotometrically. The inhibition is observed only at low, but physiologically relevant, turnover rates of the enzyme (?10 s?1 or less). No inhibitory effect of Ca2+ is observed under conventional conditions of cytochrome c oxidase activity assays (turnover number >100 s?1 at pH 8), which may explain why the effect was not noticed earlier. The inhibition is specific for Ca2+ and is reversed by EGTA. Na+ ions that compete with Ca2+ for binding with the Cation Binding Site, do not affect significantly activity of the enzyme but counteract the inhibitory effect of Ca2+. The Ca2+-induced inhibition of cytochrome c oxidase is observed also with the uncoupled mitochondria from several rat tissues. At the same time, calcium ions do not inhibit activity of the homologous bacterial cytochrome oxidases. Possible mechanisms of the inhibition are discussed as well as potential physiological role of Ca2+ binding with cytochrome oxidase. Ca2+- binding at the Cation Binding Site is proposed to inhibit proton-transfer through the exit part of the proton conducting pathway H in the mammalian oxidases. PMID:24058566

Vygodina, Tatiana; Kirichenko, Anna; Konstantinov, Alexander A.

2013-01-01

374

Visualization of monoamine oxidase in human brain  

SciTech Connect

Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.

1996-12-31

375

NADPH OXIDASE IN STROKE AND CEREBROVASCULAR DISEASE  

PubMed Central

NADPH oxidase (NOX) was originally identified in immune cells as playing an important microbicidal role. In stroke and cerebrovascular disease, inflammation is increasingly being recognized as contributing negatively to neurological outcome, with NOX as an important source of superoxide. Several labs have now shown that blocking or deleting NOX in the experimental stroke models protects from brain ischemic. Recent work has implicated glucose as an important NOX substrate leading to reperfusion injury, and that NOX inhibition can improve the detrimental effects of hyperglycemia on stroke. NOX inhibition also appears to ameliorate complications of thrombolytic therapy by reducing blood brain barrier disruption, edema formation and hemorrhage. Further, NOX from circulating inflammatory cells seems to contribute more to ischemic injury more than NOX generated from endogenous brain residential cells. Several pharmacological inhibitors of NOX are now available. Thus, blocking NOX activation may prove to be a promising treatment for stroke as well as an adjunctive agent to prevent its secondary complications. PMID:22643077

Tang, Xian Nan; Cairns, Belinda; Kim, Jong Youl; Yenari, Midori A.

2013-01-01

376

Degradation of pentachlorophenol by potato polyphenol oxidase.  

PubMed

In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

2011-11-01

377

Alternative oxidase involvement in Daucus carota somatic embryogenesis.  

PubMed

Plant alternative oxidase (AOX) is a mitochondrial inner membrane enzyme involved in alternative respiration. The critical importance of the enzyme during acclimation upon stress of plant cells is not fully understood and is still an issue of intensive research and discussion. Recently, a role of AOX was suggested for the ability of plant cells to change easily its fate upon stress. In order to get new insights about AOX involvement in cell reprogramming, quantitative real-time polymerase chain reaction (PCR) and inhibitor studies were performed during cell redifferentiation and developmental stages of Daucus carota L. somatic embryogenesis. Transcript level analysis shows that D. carota AOX genes (DcAOX1a and DcAOX2a) are differentially expressed during somatic embryogenesis. DcAOX1a shows lower expression levels, being mainly down-regulated, whereas DcAOX2a presented a large up-regulation during initiation of the realization phase of somatic embryogenesis. However, when globular embryos start to develop, both genes are down-regulated, being this state transient for DcAOX2a. In addition, parallel studies were performed using salicylhydroxamic acid (SHAM) in order to inhibit AOX activity during the realization phase of somatic embryogenesis. Embryogenic cells growing in the presence of the inhibitor were unable to develop embryogenic structures and its growth rate was diminished. This effect was reversible and concentration dependent. The results obtained contribute to the hypothesis that AOX activity supports metabolic reorganization as an essential part of cell reprogramming and, thus, enables restructuring and de novo cell differentiation. PMID:19863756

Frederico, António Miguel; Campos, Maria Doroteia; Cardoso, Hélia Guerra; Imani, Jafargholi; Arnholdt-Schmitt, Birgit

2009-12-01

378

Why Orange Guaymas Basin Beggiatoa spp. Are Orange: Single-Filament-Genome-Enabled Identification of an Abundant Octaheme Cytochrome with Hydroxylamine Oxidase, Hydrazine Oxidase, and Nitrite Reductase Activities  

PubMed Central

Orange, white, and yellow vacuolated Beggiatoaceae filaments are visually dominant members of microbial mats found near sea floor hydrothermal vents and cold seeps, with orange filaments typically concentrated toward the mat centers. No marine vacuolate Beggiatoaceae are yet in pure culture, but evidence to date suggests they are nitrate-reducing, sulfide-oxidizing bacteria. The nearly complete genome sequence of a single orange Beggiatoa (“Candidatus Maribeggiatoa”) filament from a microbial mat sample collected in 2008 at a hydrothermal site in Guaymas Basin (Gulf of California, Mexico) was recently obtained. From this sequence, the gene encoding an abundant soluble orange-pigmented protein in Guaymas Basin mat samples (collected in 2009) was identified by microcapillary reverse-phase high-performance liquid chromatography (HPLC) nano-electrospray tandem mass spectrometry (?LC–MS-MS) of a pigmented band excised from a denaturing polyacrylamide gel. The predicted protein sequence is related to a large group of octaheme cytochromes whose few characterized representatives are hydroxylamine or hydrazine oxidases. The protein was partially purified and shown by in vitro assays to have hydroxylamine oxidase, hydrazine oxidase, and nitrite reductase activities. From what is known of Beggiatoaceae physiology, nitrite reduction is the most likely in vivo role of the octaheme protein, but future experiments are required to confirm this tentative conclusion. Thus, while present-day genomic and proteomic techniques have allowed precise identification of an abundant mat protein, and its potential activities could be assayed, proof of its physiological role remains elusive in the absence of a pure culture that can be genetically manipulated. PMID:23220958

Biddle, Jennifer F.; Siebert, Jason R.; Staunton, Eric; Hegg, Eric L.; Matthysse, Ann G.; Teske, Andreas

2013-01-01

379

Phagocyte NADPH oxidase and specific immunity.  

PubMed

The phagocyte NADPH oxidase NOX2 produces reactive oxygen species (ROS) and is a well-known player in host defence. However, there is also increasing evidence for a regulatory role of NOX2 in adaptive immunity. Deficiency in phagocyte NADPH oxidase causes chronic granulomatous disease (CGD) in humans, a condition that can also be studied in CGD mice. Clinical observations in CGD patients suggest a higher susceptibility to autoimmune diseases, in particular lupus, idiopathic thrombocytopenic purpura and rheumatoid arthritis. In mice, a strong correlation exists between a polymorphism in a NOX2 subunit and the development of autoimmune arthritis. NOX2 deficiency in mice also favours lupus development. Both CGD patients and CGD mice exhibit increased levels of immunoglobulins, including autoantibodies. Despite these phenotypes suggesting a role for NOX2 in specific immunity, mechanistic explanations for the typical increase of CGD in autoimmune disease and antibody levels are still preliminary. NOX2-dependent ROS generation is well documented for dendritic cells and B-lymphocytes. It is unclear whether T-lymphocytes produce ROS themselves or whether they are exposed to ROS derived from dendritic cells during the process of antigen presentation. ROS are signalling molecules in virtually any cell type, including T- and B-lymphocytes. However, knowledge about the impact of ROS-dependent signalling on T- and B-lymphocyte phenotype and response is still limited. ROS might contribute to Th1/Th2/Th17 cell fate decisions during T-lymphocyte activation and might enhance immunoglobulin production by B-lymphocytes. In dendritic cells, NOX2-derived ROS might be important for antigen processing and cell activation. PMID:25760962

Cachat, Julien; Deffert, Christine; Hugues, Stephanie; Krause, Karl-Heinz

2015-05-01

380

The terminal oxidase in the marine bacterium Pseudomonas nautica 617.  

PubMed

The molecular properties of a novel membrane quinol oxidase from the marine bacterium Pseudomonas nautica 617 are presented. The protein contains 2b hemes/mole which may be distinguished by EPR spectroscopy but not by optical spectroscopy and electrochemistry. Respiration, though being cyanide insensitive, is not inhibited by carbon monoxide and oxygen reduction is carried out only half-way with production of hydrogen peroxide. The terminal oxidase represents, therefore, a unique example in the large family of terminal oxidases known up to date. PMID:9337488

Simpson, H; Denis, M; Malatesta, F

1997-06-01

381

Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase  

PubMed Central

Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

2014-01-01

382

Sequence variation in the cytochrome oxidase I, internal transcribed spacer 1, and Ts14 diagnostic antigen sequences of Taenia solium isolates from South and Central America, India, and Asia  

Microsoft Academic Search

We examined the genetic variability in the pig–human tapeworm, Taenia solium, by sequencing the genes for cytochrome oxidase I, internal transcribed spacer 1, and a diagnostic antigen, Ts14, from individual cysts isolated from Peru, Colombia, Mexico, India, China, and the Philippines. For these genes, the rate of nucleotide variation was minimal. Isolates from these countries can be distinguished based on

K Hancock; D. E Broughel; I. N. S Moura; A Khan; N. J Pieniazek; A. E Gonzalez; H. H Garcia; R. H Gilman; V. C. W Tsang

2001-01-01

383

Aldehyde oxidase compartmentalization in Drosophila melanogaster wing imaginal disks.  

PubMed

Distribution of the enzyme aldehyde oxidase in mature Drosophilia melanogaster wing disks may allow visualization of known developmental compartments comprising (i) presumptive dorsal and ventral wing surfaces, and (ii) the presumptive anterior wing and the presumptive posterior wing. PMID:404707

Kuhn, D T; Cunningham, G N

1977-05-20

384

Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism  

PubMed Central

Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

Sullivan, Michael L.

2015-01-01

385

21 CFR 866.2420 - Oxidase screening test for gonorrhea.  

Code of Federal Regulations, 2011 CFR

...articles intended to identify by chemical reaction, cytochrome oxidase, an oxidizing enzyme that is associated with certain bacteria including Neisseria gonorrhoeae. A sample of a male's urethral discharge is obtained on a swab which is placed...

2011-04-01

386

Polyphenol Contents and Polyphenol Oxidase Activities of Some Nigerian Kolanuts  

Microsoft Academic Search

The levels of polyphenol and activities of polyphenol oxidases in some Nigerian kolanuts were investigated. Garcina cola had the least polyphenol content of 15.60±1.70 (mg\\/g), while Cola nitida (red) recorded the highest value of 33.50±2.51mg\\/g. Polyphenol oxidase from Garcina cola had its optimum pH of activity in t he acidic region (pH 3), but the white and red species of

T. P. Prohp; K. E. Ekpo; E. V. Osagie; A. Osagie; H. Obi

2009-01-01

387

POLYPHENOL OXIDASE ACTIVITY IN BANANA CHIPS DURING OSMOTIC DEHYDRATION  

Microsoft Academic Search

Various treatments were used to determine polyphenol oxidase activity changes during osmotic dehydration of banana slices. A temperature of 35 °C and 5.0 pH were used as the most adequate conditions for polyphenol oxidase activity determination when 4-methyl catechol was used as a substrate. Enzyme activity change was determined in the central and edge region of fruit. The central part

K. N. Waliszewski; R. H. Garcia; M. Ramirez; M. A. Garcia

2000-01-01

388

Properties of Polyphenol Oxidase Extracted from Zhonghuashoutao Peach Flesh  

Microsoft Academic Search

Objective)Properties of polyphenol oxidase extracted and purified from Zhonghuashoutao peach (Prunus persica L. var. densa Makino cv. Zhonghuashoutao) flesh were studied to investigate the theory of browning. (Method)Polyphenol oxidase activities of peach flesh were spectrophotometrically determined at 420 nm with catechol as substrate at different pH, temperatures and substrate concentrations and so on. (Result) The enzyme showed a single protein

DUAN Yu-quan; DONG Wei; ZHANG Ming-jing; FENG Shuang-qing; ZHAO Yu-mei

389

Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris  

Microsoft Academic Search

High-level secretory expression of wheat (Triticum aestivum) germin\\/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an ?-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1g (4×104U) of purified,

Heng-Yen Pan; Mei M. Whittaker; Romaric Bouveret; Anne Berna; François Bernier; James W.. Whittaker

2007-01-01

390

Genome-Wide Analysis of Respiratory Burst Oxidase Homologs in Grape (Vitis vinifera L.)  

PubMed Central

Plant respiratory burst oxidase homolog (rboh) genes appear to play crucial roles in plant development, defense reactions and hormone signaling. In this study, a total of seven rboh genes from grape were identified and characterized. Genomic structure and predicted protein sequence analysis indicated that the sequences of plant rboh genes are highly conserved. Synteny analysis demonstrated that several Vvrboh genes were found in corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of the respective lineages. The expression pattern of Vvrboh genes in different tissues was assessed by qRT-PCR and two were constitutively expressed in all tissues tested. The expression profiles were similarly analyzed following exposure to various stresses and hormone treatments. It was shown that the expression levels of VvrbohA, VvrbohB and VvrbohC1 were significantly increased by salt and drought treatments. VvrbohB, VvrbohC2, and VvrbohD exhibited a dramatic up-regulation after powdery mildew (Uncinula necator (Schw.) Burr.) inoculation, while VvrbohH was down-regulated. Finally, salicylic acid treatment strongly stimulated the expression of VvrbohD and VvrbohH, while abscisic acid treatment induced the expression of VvrbohB and VvrbohH. These results demonstrate that the expression patterns of grape rboh genes exhibit diverse and complex stress-response expression signatures. PMID:24351809

Cheng, Chenxia; Xu, Xiaozhao; Gao, Min; Li, Jun; Guo, Chunlei; Song, Junyang; Wang, Xiping

2013-01-01

391

Identification and characterization of peanut oxalate genes and development of peanut cultivars resistant to stem rot  

Technology Transfer Automated Retrieval System (TEKTRAN)

In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

392

A new superoxide-generating oxidase in murine osteoclasts.  

PubMed

Superoxide production contributes to osteoclastic bone resorption. Evidence strongly indicates that NADPH oxidase is an enzyme system responsible for superoxide generation in osteoclasts. A membrane-bound subunit, p91, is the catalytic domain of NADPH oxidase. However, osteoclasts from p91 knockout mice still produce superoxide at a rate similar to that observed in wild type mice. This unexpected phenomenon prompted us to examine the osteoclasts for an alternative to the p91-containing oxidase. In this study, the cloning of a NADPH oxidase subunit (Nox 4) with 578 amino acids is reported. Nox 4 has 58% similarity in amino acids with the known p91 subunit of NADPH oxidase. Nox 4 is present and active in osteoclasts. Antisense oligonucleotides of Nox 4 reduced osteoclastic superoxide generation as well as resorption pit formation by osteoclasts. This new oxidase complex was present and functional in osteoclasts from p91 knockout mice, explaining the normal resorptive activity seen in the osteoclasts where no p91 is present. PMID:11098048

Yang, S; Madyastha, P; Bingel, S; Ries, W; Key, L

2001-02-23

393

Confirmation of a blocked amino terminus of sulfhydryl oxidase  

SciTech Connect

The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with ({sup 14}C)iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 ({plus minus} 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked.

Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E. (North Carolina State Univ., Raleigh (USA))

1990-09-01

394

Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis.  

PubMed

Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

2013-01-01

395

Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis  

PubMed Central

Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

2013-01-01

396

The 5,6-dihydroxyindole-2-carboxylic acid (DHICA) oxidase activity of human tyrosinase.  

PubMed Central

Melanin synthesis in mammals is catalysed by at least three enzymic proteins, tyrosinase (monophenol dihydroxyphenylalanine:oxygen oxidoreductase, EC 1.14.18.1) and tyrosinase-related proteins (tyrps) 1 and 2, whose genes map to the albino, brown and slaty loci in mice, respectively. Tyrosinase catalyses the rate-limiting generation of L-dopaquinone from L-tyrosine and is also able to oxidize L-dopa to L-dopaquinone. Conversely, mouse tyrp1, but not tyrosinase, catalyses the oxidation of the indolic intermediate 5,6-dihydroxyindole-2-carboxylic acid (DHICA) into the corresponding 5,6-indolequinone-2-carboxylic acid, thus promoting the incorporation of DHICA units into eumelanin. The catalytic activities of the human melanogenic enzymes are still debated. TYRP1 has been reported to lack DHICA oxidase activity, whereas tyrosinase appears to accelerate DHICA consumption, thus raising the question of DHICA metabolism in human melanocytes. Here we have used two different approaches, comparison of the catalytic activities of human melanocytic cell lines expressing the full set of melanogenic enzymes or deficient in TYRP1, and transient expression of TYR and tyr genes in COS7 cells, to demonstrate that human tyrosinase actually functions as a DHICA oxidase, as opposed to the mouse enzyme. Therefore, human tyrosinase displays a broader substrate specificity than its mouse counterpart, and might be at least partially responsible for the incorporation of DHICA units into human eumelanins. PMID:11171088

Olivares, C; Jiménez-Cervantes, C; Lozano, J A; Solano, F; García-Borrón, J C

2001-01-01

397

NADPH OXIDASE 4 MEDIATES TGF-?-INDUCED SMOOTH MUSCLE ?-ACTIN VIA p38MAPK AND SRF  

PubMed Central

In contrast to other cell types, vascular smooth muscle cells modify their phenotype in response to external signals. NADPH oxidase 4 (Nox4) is critical for maintenance of smooth muscle gene expression; however, the underlying mechanisms are incompletely characterized. Using smooth muscle ?-actin (SMA) as a prototypical smooth muscle gene and transforming growth factor-? (TGF-?) as a differentiating agent, we examined Nox4-dependent signaling. TGF-? increases Nox4 expression and activity in human aortic smooth muscle cells (HASMC). Transfection of HASMC with siRNA against Nox4 (siNox4) abolishes TGF-?-induced SMA expression and stress fiber formation. siNox4 also significantly inhibits TGF-?-stimulated p38MAPK phosphorylation, as well as that of its substrate, mitogen-activated protein kinase-activated protein kinase-2 (MK-2). Moreover, the p38MAPK inhibitor SB-203580 nearly completely blocks the SMA increase induced by TGF-?. Inhibition of either p38MAPK or NADPH oxidase-derived reactive oxygen species impairs the TGF-?-induced phosphorylation of Ser103 on serum response factor (SRF) and reduces its transcriptional activity. Binding of SRF to myocardin-related transcription factor (MRTF) is also necessary, because downregulation of MRTF by siRNA abolishes TGF-?-induced SMA expression. Taken together, these data suggest that Nox4 regulates SMA expression via activation of a p38MAPK/SRF/MRTF pathway in response to TGF-?. PMID:21074607

Martin-Garrido, Abel; Brown, David I.; Lyle, Alicia N.; Dikalova, Anna; Seidel-Rogol, Bonnie; Lassègue, Bernard; Martín, Alejandra San; Griendling, Kathy K.

2010-01-01

398

Purification of enzymatically active human lysyl oxidase and lysyl oxidase-like protein from Escherichia coli inclusion bodies  

Microsoft Academic Search

Lysyl oxidase (LOX) is an extracellular copper dependent enzyme catalyzing lysine-derived cross-links in extracellular matrix proteins. Recent molecular cloning has revealed the existence of a LOX family consisting of LOX and four lysyl oxidase-like proteins (LOXLs; LOXL, LOXL2, LOXL3, and LOXL4). Each member of the LOX family contains a copper-binding domain, residues for lysyl-tyrosyl quinone, and a cytokine receptor-like domain.

Sang Taek Jung; Moon Suk Kim; Ji Yeon Seo; Hyung Chul Kim; Youngho Kim

2003-01-01

399

Chronic monoamine oxidase-B inhibitor treatment blocks monoamine oxidase-A enzyme activity.  

PubMed

Patients with Parkinson's disease receive selective irreversible monoamine oxidase (MAO)-B inhibitors, but their effects on MAO-A activity are not known during long-term application. We determined MAO-A inhibition in plasma samples from patients with MAO-B inhibitor intake or without MAO-B inhibitor treatment and from healthy controls. We detected a 70 % reduction of MAO-A activity in patients with MAO-B inhibitor therapy in comparison to the other groups. Our results suggest that treatment with MAO-B inhibitor may also influence MAO-A activity in vivo, when administered daily. PMID:24272680

Bartl, Jasmin; Müller, Thomas; Grünblatt, Edna; Gerlach, Manfred; Riederer, Peter

2014-04-01

400

The BLI-3/TSP-15/DOXA-1 Dual Oxidase Complex Is Required for Iodide Toxicity in Caenorhabditis elegans.  

PubMed

Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962

Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long

2014-01-01

401

The BLI-3/TSP-15/DOXA-1 Dual Oxidase Complex Is Required for Iodide Toxicity in Caenorhabditis elegans  

PubMed Central

Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962

Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long

2014-01-01

402

Molecular Characterization of Taenia multiceps Isolates from Gansu Province, China by Sequencing of Mitochondrial Cytochrome C Oxidase Subunit 1  

PubMed Central

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species. PMID:23710087

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu

2013-01-01

403

Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.  

PubMed

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species. PMID:23710087

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

2013-04-01

404

A putative multicopper protein secreted by an atypical type II secretion system involved in the reduction of insoluble electron acceptors in Geobacter sulfurreducens  

Microsoft Academic Search

Extracellular electron transfer onto Fe(III) oxides in Geobacter sulfurreducens is considered to require proteins that must be exported to the outer surface of the cell. In order to investigate this, the putative gene for OxpG, the pseudopilin involved in a type II general secretion pathway of Gram-negative bacteria, was deleted. The mutant was unable to grow with insoluble Fe(III) oxide

Teena Mehta; Susan E. Childers; Richard Glaven; Derek R. Lovley; Tunde Mester

2006-01-01

405

The role of NOX2 and "novel oxidases" in airway chemoreceptor O(2) sensing.  

PubMed

In pulmonary neuroepithelial bodies (NEB), presumed airway chemoreceptors, classical NADPH oxidase (gp91 phox, NOX2) is co-expressed with O(2) sensitive K(+) channels (K(+)O(2)) and functions as an O(2) sensor. Here we examined related NADPH oxidase homologues "novel oxidases "(NOX 1, 3&4) and their possible involvement in O(2) sensing. For immunolocalization we used specific antibodies against various NADPH components and K(+) (O(2)) subunits to label NEB in rat /rabbit lung and NEB related H146 tumor cell line. For gene expression profiling of NEB cells microdissected from human lung, and H146 cells, we used custom MultiGene-12TM RT-PCR array that included NADPH oxidase components and homologues /accessory proteins (NOX1-4, phox-p22, p40, p47, p67, Rac1, NOXO1 and NOXA1) and K(+)O(2) channels (Kv -1.2, 1.5, 2.1, 3.1, 3.3, 3.4, 4.2, 4.3;TASK1-3). In rat lung, NOX2, NOX4, p22phox, Kv3.3 (and Kv3.4 in rabbit) and TASK1 localized to the apical plasma membrane of NEB cells, and membrane or sub-membrane regions in H146 cells. NEB and H146 cells expressed all NOX proteins except NOX3, as well as all K(+)O(2) channels, except Kv1.5 and Kv4.3. Co-immunoprecipitation using Western blot multicolor Quantum dot labeling showed NOX2 molecular complexes with Kv but not with TASK, while NOX4 associated with TASK1 but not with Kv channel proteins. Hypoxia -induced serotonin release was inhibited in H 146 cells by siRNA to NOX2, while siRNA to NOX4 had only a partial effect, implicating NOX 2 as the predominant NEB cell O(2) sensor. Present findings support NEB cell specific plasma membrane model of O(2) sensing, and suggest unique NOX/K(+)O(2) channel combinations for diverse physiological NEB functions. PMID:19536508

Cutz, Ernest; Pan, Jie; Yeger, Herman

2009-01-01

406