Sample records for multiple immediate-early gene-deleted

  1. Immediate-Early Transactivator Rta of Epstein-Barr Virus (EBV) Shows Multiple Epitopes Recognized by EBV-Specific Cytotoxic T Lymphocytes

    Microsoft Academic Search

    SANDRA PEPPERL; GERLINDE BENNINGER-DORING; SUSANNE MODROW; HANS WOLF; WOLFGANG JILG

    1998-01-01

    We analyzed the immediate-early transactivator Rta of Epstein-Barr virus (EBV) for its role as a target for specific cytotoxic T lymphocytes (CTL). Panels of overlapping peptides covering the entire amino acid sequence of Rta were synthesized and used to induce and analyze specific CTL responses in EBV-positive donors. Using peptide-pulsed target cells, we found nine different CTL epitopes that are

  2. Immediate-early transactivator Rta of Epstein-Barr virus (EBV) shows multiple epitopes recognized by EBV-specific cytotoxic T lymphocytes.

    PubMed

    Pepperl, S; Benninger-Döring, G; Modrow, S; Wolf, H; Jilg, W

    1998-11-01

    We analyzed the immediate-early transactivator Rta of Epstein-Barr virus (EBV) for its role as a target for specific cytotoxic T lymphocytes (CTL). Panels of overlapping peptides covering the entire amino acid sequence of Rta were synthesized and used to induce and analyze specific CTL responses in EBV-positive donors. Using peptide-pulsed target cells, we found nine different CTL epitopes that are distributed over the entire protein sequence. One epitope restricted by HLA-A24 could be mapped to the decameric sequence DYCNVLNKEF between amino acid positions 28 and 37 of the Rta protein. A second epitope could be assigned to the same region of Rta (residues 25 to 39) and was shown to be restricted by HLA-B18. Another, minimal epitope could be mapped to the nonameric sequence ATIGTAMYK between amino acid positions 134 and 142; this peptide was restricted by HLA-A11. Another four epitopes were proven to be restricted by HLA-A2, -A3, -B61, and -Cw4 and were located between Rta residues 225 and 239, 145 and 159, 529 and 543, and 393 and 407, respectively. For two other epitopes, only the location within the Rta protein is known so far (residues 121 to 135 and 441 to 455); their exact HLA restriction patterns have not yet been identified. Using target cells infected with recombinant vaccinia virus containing the gene for Rta, we showed that six of eight Rta-specific CTL lines recognized the corresponding peptides also after endogenous processing. These data suggest that Rta comprises an important target for EBV-specific cellular cytotoxicity. Together with recent findings of other immediate-early and early proteins also acting as CTL targets, they reveal the role of proteins of the lytic cycle in the immune recognition of EBV-infected cells. PMID:9765404

  3. Ribosomal protein gene deletions in Diamond-Blackfan anemia

    PubMed Central

    Vlachos, Adrianna; Atsidaftos, Eva; Carlson-Donohoe, Hannah; Markello, Thomas C.; Arceci, Robert J.; Ellis, Steven R.; Lipton, Jeffrey M.

    2011-01-01

    Diamond-Blackfan anemia (DBA) is a congenital BM failure syndrome characterized by hypoproliferative anemia, associated physical abnormalities, and a predisposition to cancer. Perturbations of the ribosome appear to be critically important in DBA; alterations in 9 different ribosomal protein genes have been identified in multiple unrelated families, along with rarer abnormalities of additional ribosomal proteins. However, at present, only 50% to 60% of patients have an identifiable genetic lesion by ribosomal protein gene sequencing. Using genome-wide single-nucleotide polymorphism array to evaluate for regions of recurrent copy variation, we identified deletions at known DBA-related ribosomal protein gene loci in 17% (9 of 51) of patients without an identifiable mutation, including RPS19, RPS17, RPS26, and RPL35A. No recurrent regions of copy variation at novel loci were identified. Because RPS17 is a duplicated gene with 4 copies in a diploid genome, we demonstrate haploinsufficient RPS17 expression and a small subunit ribosomal RNA processing abnormality in patients harboring RPS17 deletions. Finally, we report the novel identification of variable mosaic loss involving known DBA gene regions in 3 patients from 2 kindreds. These data suggest that ribosomal protein gene deletion is more common than previously suspected and should be considered a component of the initial genetic evaluation in cases of suspected DBA. PMID:22045982

  4. Large contiguous gene deletions in Sjögren-Larsson syndrome.

    PubMed

    Engelstad, Holly; Carney, Gael; S'aulis, Dana; Rise, Janae; Sanger, Warren G; Rudd, M Katharine; Richard, Gabriele; Carr, Christopher W; Abdul-Rahman, Omar A; Rizzo, William B

    2011-11-01

    Sjögren-Larsson syndrome (SLS) is an autosomal recessive disorder characterized by ichthyosis, mental retardation, spasticity and mutations in the ALDH3A2 gene for fatty aldehyde dehydrogenase, an enzyme that catalyzes the oxidation of fatty aldehyde to fatty acid. More than 70 mutations have been identified in SLS patients, including small deletions or insertions, missense mutations, splicing defects and complex nucleotide changes. We now describe 2 SLS patients whose disease is caused by large contiguous gene deletions of the ALDH3A2 locus on 17p11.2. The deletions were defined using long distance inverse PCR and microarray-based comparative genomic hybridization. A 24-year-old SLS female was homozygous for a 352-kb deletion involving ALDH3A2 and 4 contiguous genes including ALDH3A1, which codes for the major soluble protein in cornea. Although lacking corneal disease, she showed severe symptoms of SLS with uncommon deterioration in oral motor function and loss of ambulation. The other 19-month-old female patient was a compound heterozygote for a 1.44-Mb contiguous gene deletion and a missense mutation (c.407C>T, P136L) in ALDH3A2. These studies suggest that large gene deletions may account for up to 5% of the mutant alleles in SLS. Geneticists should consider the possibility of compound heterozygosity for large deletions in patients with SLS and other inborn errors of metabolism, which has implications for carrier testing and prenatal diagnosis. PMID:21684788

  5. Large Contiguous Gene Deletions in Sjögren-Larsson Syndrome

    PubMed Central

    Engelstad, Holly; Carney, Gael; S'Aulis, Dana; Rise, Janae; Sanger, Warren G.; Rudd, M. Katharine; Richard, Gabriele; Carr, Christopher W.; Abdul-Rahman, Omar A.; Rizzo, William B.

    2011-01-01

    Sjögren-Larsson syndrome (SLS) is an autosomal recessive disorder characterized by ichthyosis, mental retardation, spasticity and mutations in the ALDH3A2 gene for fatty aldehyde dehydrogenase, an enzyme that catalyzes the oxidation of fatty aldehyde to fatty acid. More than 70 mutations have been identified in SLS patients, including small deletions or insertions, missense mutations, splicing defects and complex nucleotide changes. We now describe 2 SLS patients whose disease is caused by large contiguous gene deletions of the ALDH3A2 locus on 17p11.2. The deletions were defined using long distance inverse PCR and microarray-based comparative genomic hybridization. A 24-year-old SLS female was homozygous for a 352-kb deletion involving ALDH3A2 and 4 contiguous genes including ALDH3A1, which codes for the major soluble protein in cornea. Although lacking corneal disease, she showed severe symptoms of SLS with uncommon deterioration in oral motor function and loss of ambulation. The other 19-month-old female patient was a compound heterozygote for a 1.44-Mb contiguous gene deletion and a missense mutation (c.407C>T, P136L) in ALDH3A2. These studies suggest that large gene deletions may account for up to 5% of the mutant alleles in SLS. Geneticists should consider the possibility of compound heterozygosity for large deletions in patients with SLS and other inborn errors of metabolism, which has implications for carrier testing and prenatal diagnosis. PMID:21684788

  6. Enhanced Hydrogen Production in Escherichia coli Through Chemical Mutagenesis, Gene Deletion, and Transposon Mutagenesis

    E-print Network

    Garzon Sanabria, Andrea Juliana

    2011-08-08

    ENHANCED HYDROGEN PRODUCTION IN ESCHERICHIA COLI THROUGH CHEMICAL MUTAGENESIS, GENE DELETION, AND TRANSPOSON MUTAGENESIS A Thesis by ANDREA JULIANA GARZON SANABRIA Submitted to the Office of Graduate Studies of Texas A...&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 2010 Major Subject: Chemical Engineering ENHANCED HYDROGEN PRODUCTION IN ESCHERICHIA COLI THROUGH CHEMICAL MUTAGENESIS, GENE DELETION...

  7. Enhancer RNA facilitates NELF release from immediate early genes.

    PubMed

    Schaukowitch, Katie; Joo, Jae-Yeol; Liu, Xihui; Watts, Jonathan K; Martinez, Carlos; Kim, Tae-Kyung

    2014-10-01

    Enhancer RNAs (eRNAs) are a class of long noncoding RNAs (lncRNA) expressed from active enhancers, whose function and action mechanism are yet to be firmly established. Here we show that eRNAs facilitate the transition of paused RNA polymerase II (RNAPII) into productive elongation by acting as a decoy for the negative elongation factor (NELF) complex upon induction of immediate early genes (IEGs) in neurons. eRNAs are synthesized prior to the culmination of target gene transcription and interact with the NELF complex. Knockdown of eRNAs expressed at neuronal enhancers impairs transient release of NELF from the specific target promoters during transcriptional activation, coinciding with a decrease in target mRNA induction. The enhancer-promoter interaction was unaffected by eRNA knockdown. Instead, chromatin looping might enable eRNAs to act locally at a specific promoter. Our findings highlight the spatiotemporally regulated action mechanism of eRNAs during early transcriptional elongation. PMID:25263592

  8. Constitutional and mosaic large NF1 gene deletions in neurofibromatosis type 1

    Microsoft Academic Search

    S A Rasmussen; S D Colman; V T Ho; C R Abernathy; P H Arn; L Weiss; C Schwartz; R A Saul; M R Wallace

    1998-01-01

    A set of neurofibromatosis type 1 (NF1) patients was screened for large NF1 gene deletions by comparing patient and parent genotypes at 10 intragenic polymorphic loci. Of 67 patient\\/parent sets (47 new mutation patients and 20 familial cases), five (7.5%) showed loss of heterozygosity (LOH), indicative of NF1 gene deletion. These five patients did not have severe NF1 manifestations, mental

  9. Structural analysis of the major immediate early gene of human cytomegalovirus

    Microsoft Academic Search

    R. M. Stenberg; D. R. Thomsen; M. F. Stinski

    1984-01-01

    The most abundant species of human cytomegalovirus (Towne) immediate early polysome-associated RNA originates from a region of ca. 2.8 kilobases within the XbaI-E DNA fragment. These sequences code for a 1.95-kilobase mRNA and are referred to as immediate early coding region one. The authors have utilized the nuclease mapping technique of Berk and Sharp to examine this gene in detail.

  10. Immediate early response gene X-1, a potential prognostic biomarker in cancers

    PubMed Central

    Ustyugova, Irina V.; Han, Liping; Akilov, Oleg E.

    2014-01-01

    Introduction The immediate early response gene X-1 (IEX-1) plays a pivotal role in the regulation of cell apoptosis, proliferation, differentiation and metabolism. Deregulation of IEX-1 expression has been confirmed in multiple cancers in humans, in association with either poor or better prognosis depending on the type and progression stages of the cancer. Areas covered This review summarizes clinical studies of altered IEX-1 expression in ovarian, pancreatic, blood, breast and colorectal cancers, lymphoma and myeloma. The authors also outline the current understandings of the complex functions of IEX-1 gained from studies with animal models and tumor cell lines so as to help us comprehend the significance of the clinical findings. Expert opinion IEX-1 holds great promise to be a valuable biomarker, either alone or in combination with other genes, for monitoring progression of some cancers. IEX-1 expression is highly sensitive to environmental cues and distinct between normal and cancer cells. However, use of IEX-1 as a biomarker remains a significant challenge because too little is understood about the mechanism underlying the diverse activities of IEX-1 and a standardized clinical assay for IEX-1 detection and validation of clinical results across different studies are still critically lacking. PMID:23379921

  11. Immediate-early gene induction by the stresses anisomycin and arsenite in human osteosarcoma cells involves MAPK cascade signaling to Elk1, CREB and SRF

    Microsoft Academic Search

    Magali Bébien; Sara Salinas; Carine Becamel; Véronique Richard; Laetitia Linares; Robert A Hipskind

    2003-01-01

    Cellular stress activates multiple mitogen-activated protein kinase (MAPK) cascades and immediate-early gene (IEG) transcription. To address how these events are linked, we investigated the endogenous signaling\\/transcription factor network driving IEG activation by arsenite and anisomycin in the human osteosarcoma cell line HOS\\/TE-85. Induction of IEG transcription by both stresses corresponded temporally with the phosphorylation of the regulatory factors Elk-1 and

  12. STAT3-mediated Coincidence Detection Regulates Noncanonical Immediate Early Gene Induction*

    PubMed Central

    Waitkus, Matthew S.; Chandrasekharan, Unni M.; Willard, Belinda; Haque, S. Jaharul; DiCorleto, Paul E.

    2013-01-01

    Signaling pathways interact with one another to form dynamic networks in which the cellular response to one stimulus may depend on the presence, intensity, timing, or localization of other signals. In rare cases, two stimuli may be simultaneously required for cells to elicit a significant biological output. This phenomenon, generally termed “coincidence detection,” requires a downstream signaling node that functions as a Boolean AND gate to restrict biological output from a network unless multiple stimuli are received within a specific window of time. Simultaneous activation of the EGF receptor (EGFR) and a thrombin receptor (protease-activated receptor-1, PAR-1) increases the expression of multiple immediate early genes (IEGs) associated with growth and angiogenesis. Using a bioinformatic comparison of IEG promoter regions, we identified STAT3 as a critical transcription factor for the detection of coincident EGFR/PAR-1 activation. EGFR activation induces classical STAT3 Tyr705 phosphorylation but also initiates an inhibitory signal through the PI3K-AKT signaling axis that prevents STAT3 Ser727 phosphorylation. Coincident PAR-1 signaling resolves these conflicting EGF-activated pathways by blocking AKT activation and permitting GSK-3?/?-dependent STAT3 Ser727 phosphorylation and STAT3-dependent gene expression. Functionally, combinatorial EGFR/PAR-1 signaling suppresses EGF-induced proliferation and thrombin-induced leukocyte adhesion and triggers a STAT3-dependent increase in endothelial cell migration. This study reveals a novel signaling role for STAT3 in which the simultaneous presence of extracellular EGF and thrombin is detected at the level of STAT3 post-translational modifications. Collectively, our results describe a novel regulatory mechanism in which combinatorial EGFR/PAR-1 signaling regulates STAT3-dependent IEG induction and endothelial cell migration. PMID:23504318

  13. Sequential gene deletions in Hypocrea jecorina using a single blaster cassette.

    PubMed

    Hartl, Lukas; Seiboth, Bernhard

    2005-09-01

    In Hypocrea jecorina (anamorph: Trichoderma reesei) multiple gene deletions are limited by the number of readily available selection markers. We have therefore constructed a blaster cassette which enables successive gene knock-outs in H. jecorina. This 3.5 kb pyr4 blaster cassette contains the H. jecorina pyr4 marker gene encoding orotidine-5'-monophosphate (OMP) decarboxylase flanked by two direct repeats of the Streptoalloteichus hindustanus bleomycin gene (Sh ble), which facilitate the excision of the blaster cassette by homologous recombination after each round of deletion. Functionality of this pyr4 blaster cassette was demonstrated by deletion of the glk1 encoding glucokinase and hxk1 encoding hexokinase. 1.4-1.8 kb of the non-coding flanking regions of both target genes were cloned into the respective blaster cassettes and transformation of a pyr4 negative H. jecorina strain with the two cassettes resulted in 10-13% of the transformants in the deletion of one of the two kinase genes. For excision of the pyr4 blaster cassettes, Deltaglk1 strains were selected for growth in the presence of 5-fluoroorotic acid. Recombination between the two Sh ble elements resulted in uridine auxotrophic strains which retained their respective glucokinase negative phenotype. Subsequent transformation of one of these auxotrophic Deltaglk1 strains with the hexokinase blaster cassette resulted in pyr4 prototrophic strains deleted in both glk1 and hxk1. Deltaglk1 strains showed reduced growth on d-glucose and d-fructose whereas Deltahxkl strains showed reduced compact growth on d-glucose but were unable to grow on d-fructose as carbon source. The double Deltaglk1Deltahxk1 deletion strain was completely unable to grow on either d-glucose or d-fructose. PMID:16091959

  14. Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

    PubMed

    Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

    2014-12-01

    The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. PMID:25281472

  15. Salivary IgG subclasses in individuals with and without homozygous IGHG gene deletions.

    PubMed Central

    Engström, P E; Norhagen, G; Osipova, L; Helal, A; Wiebe, V; Brusco, A; Carbonara, A O; Lefranc, G; Lefranc, M P

    1996-01-01

    In this study, the levels of salivary IgG1, IgG2, IgG3 and IgG4 from individuals with and without homozygous immunoglobulin heavy chain constant gene deletions were quantified by enzyme-linked immunosorbent assay (ELISA). To analyse the restriction of salivary IgG subclasses, we used unstimulated whole saliva and sera collected at the same time from individuals with homozygous gene deletions, two with G1 deletion, one with G4 deletion, six with both G2 and G4 deletions and from eight individuals without IGHG gene deletions and expressing all four IgG subclasses. The median values of salivary IgG from individuals with homozygous G1, or G4, or both G2 and G4 deletions, and from individuals expressing all four subclasses were 24.2 mg/l and 23.4 mg/l, respectively. The median values of serum IgG were 13.7 g/l and 15.9 g/l, respectively. Our results show that the salivary and serum IgG levels were both within the normal range in individuals with homozygous gene deletions of either G1, or G4, or both G2 and G4. PMID:8943711

  16. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1

    Microsoft Academic Search

    David Vallenet; Vanina Castelli; Marielle Besnard; Agnès Pinet; Corinne Cruaud; Sumitta Samair; Christophe Lechaplais; Gabor Gyapay; Céline Richez; Maxime Durot; Annett Kreimeyer; François Le Fèvre; Vincent Schächter; Valérie Pezo; Volker Döring; Claude Scarpelli; Claudine Médigue; Georges N Cohen; Philippe Marlière; Marcel Salanoubat; Jean Weissenbach; Véronique de Berardinis

    2008-01-01

    We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the

  17. Inhibition of Human Cytomegalovirus Immediate-Early Gene Expression by Cyclin A2-Dependent Kinase Activity

    PubMed Central

    Oduro, Jennifer D.; Uecker, Ralf

    2012-01-01

    Human cytomegalovirus (HCMV) starts its lytic replication cycle only in the G0/G1 phase of the cell division cycle. S/G2 cells can be infected but block the onset of immediate-early (IE) gene expression. This block can be overcome by inhibition of cyclin-dependent kinases (CDKs), suggesting that cyclin A2, the only cyclin with an S/G2-specific activity profile, may act as a negative regulator of viral gene expression. To directly test this hypothesis, we generated derivatives of an HCMV-permissive glioblastoma cell line that express cyclin A2 in a constitutive, cell cycle-independent manner. We demonstrate that even moderate cyclin A2 overexpression in G1 was sufficient to severely compromise the HCMV replicative cycle after high-multiplicity infection. This negative effect was composed of a strong but transient inhibition of IE gene transcription and a more sustained alteration of IE mRNA processing, resulting in reduced levels of UL37 and IE2, an essential transactivator of viral early gene expression. Consistently, cyclin A2-overexpressing cells showed a strong delay of viral early and late gene expression, as well as virus reproduction. All effects were dependent on CDK activity, as a cyclin A2 mutant deficient in CDK binding was unable to interfere with the HCMV infectious cycle. Interestingly, murine CMV, whose IE gene expression is known to be cell cycle independent, is not affected by cyclin A2. Instead, it upregulates cyclin A2-associated kinase activity upon infection. Understanding the mechanisms behind the HCMV-specific action of cyclin A2-CDK might reveal new targets for antiviral strategies. PMID:22718829

  18. Induction of the plasticity-associated immediate early gene Arc by stress and hallucinogens

    E-print Network

    Vaidya, Vidita

    Induction of the plasticity-associated immediate early gene Arc by stress and hallucinogens: role Southwestern Medical Center, Dallas, TX, USA Abstract Exposure to stress and hallucinogens in adulthood evokes induced by stress and hallucinogen exposure are thought to involve transcriptional alterations in specific

  19. Human Cytomegalovirus pUL97 Regulates the Viral Major Immediate Early Promoter by Phosphorylation-Mediated Disruption of Histone Deacetylase 1 Binding

    PubMed Central

    Bigley, Tarin M.; Reitsma, Justin M.; Mirza, Shama P.

    2013-01-01

    Human cytomegalovirus (HCMV) is a common agent of congenital infection and causes severe disease in immunocompromised patients. Current approved therapies focus on inhibiting viral DNA replication. The HCMV kinase pUL97 contributes to multiple stages of viral infection including DNA replication, controlling the cell cycle, and virion maturation. Our studies demonstrate that pUL97 also functions by influencing immediate early (IE) gene expression during the initial stages of infection. Inhibition of kinase activity using the antiviral compound maribavir or deletion of the UL97 gene resulted in decreased expression of viral immediate early genes during infection. Expression of pUL97 was sufficient to transactivate IE1 gene expression from the viral genome, which was dependent on viral kinase activity. We observed that pUL97 associates with histone deacetylase 1 (HDAC1). HDAC1 is a transcriptional corepressor that acts to silence expression of viral genes. We observed that inhibition or deletion of pUL97 kinase resulted in increased HDAC1 and decreased histone H3 lysine 9 acetylation associating with the viral major immediate early (MIE) promoter. IE expression during pUL97 inhibition or deletion was rescued following inhibition of deacetylase activity. HDAC1 associates with chromatin by protein-protein interactions. Expression of active but not inactive pUL97 kinase decreased HDAC1 interaction with the transcriptional repressor protein DAXX. Finally, using mass spectrometry, we found that HDAC1 is uniquely phosphorylated upon expression of pUL97. Our results support the conclusion that HCMV pUL97 kinase regulates viral immediate early gene expression by phosphorylation-mediated disruption of HDAC1 binding to the MIE promoter. PMID:23616659

  20. Homer 2 gene deletion in mice produces a phenotype similar to chronic cocaine treated rats

    Microsoft Academic Search

    Peter W. Kalivas; Karen K. Szumlinski; Paul Worley

    2004-01-01

    Addiction to cocaine results from changes in brain function arising from a combination of pharmacology, environmental circumstances,\\u000a as well as genetic vulnerability. One change is a reduction in Homer protein in the nucleus accumbens. In this report we summarize\\u000a the behavioral and neurochemical effects ofHomer2 gene deletion in mice and compare this with the effects of chronic cocaine treatment in

  1. Expression of immediate early genes after treatment of human astrocytoma cells with radiation and taxol

    SciTech Connect

    Gubits, R.M.; Geard, C.R.; Schiff, P.B. [Columbia Univ., New York, NY (United States)

    1993-10-20

    The promising chemotherapeutic agent, taxol, has been shown to sensitize the G18 line of human astrocytoma cells to ionizing radiation. The present studies were performed to identify specific changes in gene expression associated with this altered sensitivity. The products of immediate early genes, which are induced transiently in cells in response to a variety of treatments, including growth factors, neurotransmitters, and irradiation with UV light or X rays, are thought to initiate a cascade of genetic responses to alterations in cellular environment. The present results demonstrate a dramatic attenuation in one immediate early gene response in association with a treatment that enhances radiosensitivity in a refractory human brain tumor line. 22 refs., 5 figs., 1 tab.

  2. Phenotypes of major immediate-early gene mutants of mouse cytomegalovirus

    Microsoft Academic Search

    Andreas Busche; Ana Angulo; Penelope Kay-Jackson; Peter Ghazal; Martin Messerle

    2008-01-01

    Immediate-early (IE) genes are the first genes to be transcribed during the lytic replication cycle of cytomegaloviruses (CMV),\\u000a and encode nonstructural proteins, which are assumed to have mainly regulatory functions. The IE proteins may play important\\u000a roles in the pathogenesis of CMV in vivo, for instance during the establishment of latency and during reactivation. We constructed\\u000a mouse CMV mutants with

  3. Mechanotransduction in Stretched Osteocytes—Temporal Expression of Immediate Early and Other Genes

    Microsoft Academic Search

    Akira Kawata; Yuko Mikuni-Takagaki

    1998-01-01

    Osteocytes, dendritic bone cells, transduce signals of mechanical loading that results in bone formation. We have reported in stretched primary osteocytes that the cAMP level, IGF-I and osteocalcin protein levels were elevated (Endocrinology 137:2028, 1996). Here we report that stretching induces the expression of immediate early genes, c-fos and COX-2; inducive cyclooxygenase gene. Compared to c-fos, COX-2 as well as

  4. Effects of G-gene Deletion and Replacement on Rabies Virus Vector Gene Expression

    PubMed Central

    Sato, Sho; Ohara, Shinya; Tsutsui, Ken-Ichiro; Iijima, Toshio

    2015-01-01

    The glycoprotein-gene (G gene) -deleted rabies virus (RV) vector is a powerful tool to examine the function and structure of neural circuits. We previously reported that the deletion of the G gene enhances the transgene expression level of the RV vector. However, the mechanism of this enhancement remains to be clarified. We presume that there are two possible factors for this enhancement. The first factor is the glycoprotein of RV, which shows cytotoxicity; thus, may cause a dysfunction in the translation process of infected cells. The second possible factor is the enhanced expression of the L gene, which encodes viral RNA polymerase. In the RV, it is known that the gene expression level is altered depending on the position of the gene. Since G-gene deletion displaces the L gene in the genome, the expression of the L gene and viral transcription may be enhanced. In this study, we compared the transgene expression level and viral transcription of three recombinant RV vectors. The effect of glycoprotein was examined by comparing the viral gene expression of G-gene-intact RV and G-gene-replaced RV. Despite the fact that the L-gene transcription level of these two RV vectors was similar, the G-gene-replaced RV vector showed higher viral transcription and transgene expression level than the G-gene-intact RV vector. To examine the effect of the position of the L gene, we compared the viral gene expression of the G-gene-deleted RV and G-gene-replaced RV. The G-gene-deleted RV vector showed higher L-gene transcription, viral transcription, and transgene expression level than the G-gene-replaced RV vector. These results indicate that G-gene deletion enhances the transgene expression level through at least two factors, the absence of glycoprotein and enhancement of L-gene expression. These findings enable investigators to design a useful viral vector that shows a controlled desirable transgene expression level in applications. PMID:26023771

  5. Stress-induced hematopoietic failure in the absence of immediate early response gene X-1 (IEX-1, IER3)

    E-print Network

    Ramsey, Haley

    Expression of the immediate early response gene X-1 (IEX-1, IER3) is diminished significantly in hematopoietic stem cells in a subgroup of patients with early stage myelodysplastic syndromes, but it is not clear whether ...

  6. Transactivation, Dimerization, and DNA-Binding Activity of White Spot Syndrome Virus Immediate-Early Protein IE1

    Microsoft Academic Search

    Wang-Jing Liu; Yun-Shiang Chang; Hao-Ching Wang; Jiann-Horng Leu; Guang-Hsiung Kou; Chu-Fang Lo

    2008-01-01

    Immediate-early proteins from many viruses function as transcriptional regulators and exhibit transacti- vation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA binding domain of the

  7. Unusual presentation of Kallmannn syndrome with contiguous gene deletion in three siblings of a family

    PubMed Central

    Madhu, Sri Venkat; Kant, Saket; Holla, Vikram Venkappayya; Arora, Rakesh; Rathi, Sahaj

    2012-01-01

    We report the case of 3 brothers aged 34, 24, and 22 years, unmarried, who presented to our endocrinology clinic with absence of secondary sexual characters. There was no such history in other siblings, but their maternal uncle had similar complaints. On examination, all 3 had pre-pubertal appearance, voice, and genitalia along with anosmia and bimanual synkinesia. Cryptorchidism was noticed in 2 while third person had small hypoplastic testes. It was also noted that all 3 patients had icthyosis mainly involving trunk, back, and limbs. The hormonal assays were consistent with isolated hypogonadotrophic hypogonadism. IQ testing revealed mental retardation in the 2 patients. Ultrasound showed ectopic right kidney in one patient, atrophic right kidney in the second patient while the third patient had normal kidneys. MRI brain of all the patients showed poorly visualized olfactory tract and bulb. Kallmann syndrome (KS) was diagnosed based on hormonal evaluation and MRI results. Of the four types of KS: Synkinesia, renal anomaly, and X-linked pedigree pattern in our patients pointed towards X-linked type 1 KS as the possible cause. But, icthyosis and mental retardation are not usual presentation of type 1 KS. They are usually seen as a result of contiguous gene deletion of KAL1, steroid sulfatase (STS), and mental retardation (MRX) gene on X chromosome. Hence, the possible gene defect in our cases is inherited defect in contiguous gene deletion. The contiguous gene deletion as the cause of KS in 3 patients of same family is very rare and worth reporting. Also, the significance of phenotype-genotypic association in Kallmann syndrome is discussed PMID:23565415

  8. Size Of Gene Specific Inverted Repeat - Dependent Gene Deletion In Saccharomyces cerevisiae

    PubMed Central

    JingYing, Crystal Tear; Balagurunathan, Balaji; Wu, Jinchuan; Zhao, Hua

    2013-01-01

    We describe here an approach for rapidly producing scar-free and precise gene deletions in S. cerevisiae with high efficiency. Preparation of the disruption gene cassette in this approach was simply performed by overlap extension-PCR of an invert repeat of a partial or complete sequence of the targeted gene with URA3. Integration of the prepared disruption gene cassette to the designated position of a target gene leads to the formation of a mutagenesis cassette within the yeast genome, which consists of a URA3 gene flanked by the targeted gene and its inverted repeat between two short identical direct repeats. The inherent instability of the inverted sequences in close proximity facilitates the self-excision of the entire mutagenesis cassette deposited in the genome and promotes homologous recombination resulting in a seamless deletion via a single transformation. This rapid assembly circumvents the difficulty during preparation of disruption gene cassettes composed of two inverted repeats of the URA3, which requires the engineering of unique restriction sites for subsequent digestion and T4 DNA ligation in vitro. We further identified that the excision of the entire mutagenesis cassette flanked by two DRs in the transformed S. cerevisiae is dependent on the length of the inverted repeat of which a minimum of 800 bp is required for effective gene deletion. The deletion efficiency improves with the increase of the inverted repeat till 1.2 kb. Finally, the use of gene-specific inverted repeats of target genes enables simultaneous gene deletions. The procedure has the potential for application on other yeast strains to achieve precise and efficient removal of gene sequences. PMID:23977230

  9. Glutaredoxin 2 (Grx2) gene deletion induces early onset of age-dependent cataracts in mice.

    PubMed

    Wu, Hongli; Yu, Yibo; David, Larry; Ho, Ye-Shih; Lou, Marjorie F

    2014-12-26

    Glutaredoxin 2 (Grx2) is an isozyme of glutaredoxin1 (thioltransferase) present in the mitochondria and nucleus with disulfide reductase and peroxidase activities, and it controls thiol/disulfide balance in cells. In this study, we investigated whether Grx2 gene deletion could induce faster age-related cataract formation and elucidated the biochemical changes effected by Grx2 gene deletion that may contribute to lens opacity. Slit lamp was used to examine the lenses in Grx2 knock-out (KO) mice and age-matched wild-type (WT) mice ages 1 to 16 months. In the Grx2 null mice, the lens nuclear opacity began at 5 months, 3 months sooner than that of the control mice, and the progression of cataracts was also much faster than the age-matched controls. Lenses of KO mice contained lower levels of protein thiols and GSH with a significant accumulation of S-glutathionylated proteins. Actin, ?A-crystallin, and ?B2-crystallin were identified by Western blot and mass spectroscopy as the major S-glutathionylated proteins in the lenses of 16-month-old Grx2 KO mice. Compared with the WT control, the lens of Grx2 KO mice had only 50% of the activity in complex I and complex IV and less than 10% of the ATP pool. It was concluded that Grx2 gene deletion altered the function of lens structural proteins through S-glutathionylation and also caused severe disturbance in mitochondrial function. These combined alterations affected lens transparency. PMID:25362663

  10. Herpes Simplex Virus Immediate-Early Protein ICP0 Is Targeted by SIAH-1 for Proteasomal Degradation?†?

    PubMed Central

    Nagel, Claus-Henning; Albrecht, Nina; Milovic-Holm, Kristijana; Mariyanna, Lakshmikanth; Keyser, Britta; Abel, Bettina; Weseloh, Britta; Hofmann, Thomas G.; Eibl, Martha M.; Hauber, Joachim

    2011-01-01

    Herpes simplex virus (HSV) immediate-early protein ICP0 is a transcriptional activator with E3 ubiquitin ligase activity that induces the degradation of ND10 proteins, including the promyelocytic leukemia protein (PML) and Sp100. Moreover, ICP0 has a role in the derepression of viral genomes and in the modulation of the host interferon response to virus infection. Here, we report that ICP0 interacts with SIAH-1, a cellular E3 ubiquitin ligase that is involved in multiple cellular pathways and is itself capable of mediating PML degradation. This novel virus-host interaction profoundly stabilized SIAH-1 and recruited this cellular E3 ligase into ICP0-containing nuclear bodies. Moreover, SIAH-1 mediated the polyubiquitination of HSV ICP0 in vitro and in vivo. After infection of SIAH-1 knockdown cells with HSV, higher levels of ICP0 were produced, ICP0 was less ubiquitinated, and the half-life of this multifunctional viral regulatory protein was increased. These results indicate an inhibitory role of SIAH-1 during lytic infection by targeting ICP0 for proteasomal degradation. PMID:21632771

  11. Herpes simplex virus immediate-early protein ICP0 is targeted by SIAH-1 for proteasomal degradation.

    PubMed

    Nagel, Claus-Henning; Albrecht, Nina; Milovic-Holm, Kristijana; Mariyanna, Lakshmikanth; Keyser, Britta; Abel, Bettina; Weseloh, Britta; Hofmann, Thomas G; Eibl, Martha M; Hauber, Joachim

    2011-08-01

    Herpes simplex virus (HSV) immediate-early protein ICP0 is a transcriptional activator with E3 ubiquitin ligase activity that induces the degradation of ND10 proteins, including the promyelocytic leukemia protein (PML) and Sp100. Moreover, ICP0 has a role in the derepression of viral genomes and in the modulation of the host interferon response to virus infection. Here, we report that ICP0 interacts with SIAH-1, a cellular E3 ubiquitin ligase that is involved in multiple cellular pathways and is itself capable of mediating PML degradation. This novel virus-host interaction profoundly stabilized SIAH-1 and recruited this cellular E3 ligase into ICP0-containing nuclear bodies. Moreover, SIAH-1 mediated the polyubiquitination of HSV ICP0 in vitro and in vivo. After infection of SIAH-1 knockdown cells with HSV, higher levels of ICP0 were produced, ICP0 was less ubiquitinated, and the half-life of this multifunctional viral regulatory protein was increased. These results indicate an inhibitory role of SIAH-1 during lytic infection by targeting ICP0 for proteasomal degradation. PMID:21632771

  12. Defined Single-Gene and Multi-Gene Deletion Mutant Collections in Salmonella enterica sv Typhimurium

    PubMed Central

    Porwollik, Steffen; Santiviago, Carlos A.; Cheng, Pui; Long, Fred; Desai, Prerak; Fredlund, Jennifer; Srikumar, Shabarinath; Silva, Cecilia A.; Chu, Weiping; Chen, Xin; Canals, Rocío; Reynolds, M. Megan; Bogomolnaya, Lydia; Shields, Christine; Cui, Ping; Guo, Jinbai; Zheng, Yi; Endicott-Yazdani, Tiana; Yang, Hee-Jeong; Maple, Aimee; Ragoza, Yury; Blondel, Carlos J.; Valenzuela, Camila; Andrews-Polymenis, Helene; McClelland, Michael

    2014-01-01

    We constructed two collections of targeted single gene deletion (SGD) mutants and two collections of targeted multi-gene deletion (MGD) mutants in Salmonella enterica sv Typhimurium 14028s. The SGD mutant collections contain (1), 3517 mutants in which a single gene is replaced by a cassette containing a kanamycin resistance (KanR) gene oriented in the sense direction (SGD-K), and (2), 3376 mutants with a chloramphenicol resistance gene (CamR) oriented in the antisense direction (SGD-C). A combined total of 3773 individual genes were deleted across these SGD collections. The MGD collections contain mutants bearing deletions of contiguous regions of three or more genes and include (3), 198 mutants spanning 2543 genes replaced by a KanR cassette (MGD-K), and (4), 251 mutants spanning 2799 genes replaced by a CamR cassette (MGD-C). Overall, 3476 genes were deleted in at least one MGD collection. The collections with different antibiotic markers permit construction of all viable combinations of mutants in the same background. Together, the libraries allow hierarchical screening of MGDs for different phenotypic followed by screening of SGDs within the target MGD regions. The mutants of these collections are stored at BEI Resources (www.beiresources.org) and publicly available. PMID:25007190

  13. Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice

    PubMed Central

    Zuloaga, Kristen L.; Zhang, Wenri; Roese, Natalie E.; Alkayed, Nabil J.

    2015-01-01

    Soluble epoxide hydrolase (sEH), a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs), is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS) female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15–18 month old) and young (3–4 month old) female sEH knockout (sEHKO) mice and wild type (WT) mice were subjected to 45 min middle cerebral artery occlusion (MCAO) with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24 h thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography (OMAG). Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24 h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24 h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice. PMID:25642188

  14. A requirement for the immediate early gene zif268 in reconsolidation of recognition memory after retrieval.

    PubMed

    Bozon, Bruno; Davis, Sabrina; Laroche, Serge

    2003-11-13

    Recent research has revived interest in the possibility that previously consolidated memories need to reconsolidate when recalled to return to accessible long-term memory. Evidence suggests that both consolidation and reconsolidation of certain types of memory require protein synthesis, but whether similar molecular mechanisms are involved remains unclear. Here, we explore whether zif268, an activity-dependent inducible immediate early gene (IEG) required for consolidation of new memories, is also recruited for reconsolidation of recognition memory following reactivation. We show that when a consolidated memory for objects is recalled, zif268 mutant mice are impaired in further long-term but not short-term recognition memory. The impairment is specific to reactivation with the previously memorized objects in the relevant context, occurs in delayed recall, and does not recover over several days. These findings indicate that IEG-mediated transcriptional regulation in neurons is one common molecular mechanism for the storage of newly formed and reactivated recognition memories. PMID:14622575

  15. Inositol polyphosphate multikinase is a coactivator for serum response factor-dependent induction of immediate early genes

    PubMed Central

    Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun

    2013-01-01

    Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338

  16. Genome-scale genetic screen of lead ion-sensitive gene deletion mutations in Saccharomyces cerevisiae.

    PubMed

    Du, J; Cao, C; Jiang, L

    2015-06-01

    Pb (lead) is one of the most widespread and toxic heavy metal contaminants and imposes potential harm to human health. Pb ions cause cellular damage and induce loss of cell viability. However, mechanisms regulating Pb toxicity remain poorly understood. Through a genome-scale screen, we have identified 30 yeast single-gene deletion mutants that are sensitive to lead ions. These genes are involved in the metabolism, transcription, protein synthesis, cell cycle and DNA processing, protein folding, modification, destination, as well as cellular transport process. Comparative analyses to cadmium-sensitive mutations identified from previous studies indicate that overlapping genes of lead- and cadmium-sensitive mutations are involved in both the metabolism and the cellular transport process. Furthermore, eleven lead-sensitive mutants show elevated levels of lead contents in response to lead stress. Our findings provide a basis to understand molecular mechanisms underlying the detoxification of lead ions by yeast cells. PMID:25773006

  17. Effects of Bax Gene Deletion on Social Behaviors and Neural Response to Olfactory Cues in Mice

    PubMed Central

    Holmes, Melissa M.; Niel, Lee; Anyan, Jeff J.; Griffith, Andrew T.; Monks, D. Ashley; Forger, Nancy G.

    2011-01-01

    Bax is a pro-death protein that plays a crucial role in developmental neuronal cell death. Bax?/? mice exhibit increased neuron number and the elimination of several neural sex differences. Here we examined the effects of Bax gene deletion on social behaviors (olfactory preference, social recognition, social approach, and aggression) and the neural processing of olfactory cues. Bax deletion eliminated the normal sex difference in olfactory preference behavior. In the social recognition test, both genotypes discriminated a novel conspecific, but wildtype males and Bax?/? animals of both sexes spent much more time than wildtype females investigating stimulus animals. Similarly, Bax?/? mice were more sociable than wildtype mice in a social approach test. Bax deletion had no effect on aggression in a resident/intruder paradigm where males, regardless of genotype, exhibited a shorter latency to attack. Thus, the prevention of neuronal cell death by Bax gene deletion results in greater sociability as well as the elimination of sex differences in some social behaviors. To examine olfactory processing of socially relevant cues, we counted c-Fos immunoreactive (Fos-ir) cells in several nodes of the accessory olfactory pathway after exposure to male-soiled or control bedding. In both genotypes, exposure to male-soiled bedding increased Fos-ir cells in the posterodorsal medial amygdala, principal nucleus of the bed nucleus of the stria terminalis, and medial preoptic nucleus (MPN), and the response in the MPN was greater in females than in males. However, a reduction in Fos-ir cells was seen in the anteroventral periventricular nucleus of Bax?/? mice. PMID:22034980

  18. Detection of GST1 gene deletion by the polymerase chain reaction and its possible correlation with stomach cancer in Japanese

    Microsoft Academic Search

    Shoji Harada; Shogo Misawa; Takako Nakamura; Naomi Tanaka; Ei Ueno; Mutsumi Nozoe

    1992-01-01

    A homozygous gene deletion at the GST1 locus of genomic DNA isolated from peripheral blood was investigated for its relationship with several types of cancer using the polymerase chain reaction (PCR) technique. DNA samples were prepared from blood obtained from 128 healthy blood donors and 150 patients with cancer or chronic hepatitis. PCR primers were prepared based on the human

  19. Detection of Gene Deletions in Children with Chondrodysplasia Punctata, Ichthyosis, Kallmann Syndrome, and Ocular Albinism by FISH Studies

    Microsoft Academic Search

    Jia-Woei Hou

    Background: Contiguous gene syndrome (CGS) is characterized by a series of clinical fea- tures resulting from interstitial or terminal deletions of various adjacent genes. Several important genes have been identified in the Xp22.3 region to be responsible for genetically heterogeneous diseases. In this study, fluores- cence in situ hybridization (FISH) methods were used to detect the extent of gene deletion

  20. Gene deletions causing human genetic disease: mechanisms of mutagenesis and the role of the local DNA sequence environment

    Microsoft Academic Search

    Michael Krawczak; David N. Cooper

    1991-01-01

    Reports describing short (< 20 bp) gene deletions causing human genetic disease were collated in order to study underlying causative mechanisms. Deletion break-point junction regions were found to be non-random both at the nucleotide and dinucleotide sequence levels, an observation consistent with an endogenous sequencedirected mechanism of mutagenesis. Direct repeats of between 2 bp and 8 bp were found in

  1. HIV with multiple gene deletions as a live attenuated vaccine for AIDS.

    PubMed

    Desrosiers, R C

    1992-03-01

    Most viral vaccines currently in use in humans are live attenuated strains of virus that lack pathogenic potential. In general, such live attenuated vaccines induce the strongest longest-lasting immunity. Live attenuated strains of human immunodeficiency virus type 1 (HIV-1) have not been previously considered as vaccines for acquired immunodeficiency syndrome (AIDS) because of an inability to envision how their safety could be adequately assured. This report describes a means for making live, nonpathogenic strains of SIVmac and HIV-1 that cannot revert to a virulent form and a stepwise scheme for demonstrating their safety. Replication-competent, multiply deleted derivatives that are currently being tested are missing combinations of auxiliary genes (nef, vpr, vif, vpx, vpu) and certain control elements in the negative regulatory element (NRE) of the long terminal repeat (LTR). Since these genomic regions are in large part conserved among the SIVs and HIVs, they are likely to be important for the virus life cycle in vivo. Consistent with this line of reasoning, a replication-competent nef deletion mutant of SIVmac apparently has lost most or all of its pathogenic potential, yet it still induces strong immune responses. Multiply deleted derivatives of SIVmac and HIV-1 will have to be extensively tested in animal models prior to moving a promising HIV-1 candidate to initial trials in high-risk human volunteers. Definitive evidence for safety and general acceptance for this approach can only evolve gradually over a prolonged period of time. PMID:1571200

  2. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    Microsoft Academic Search

    M. G. Davis; S. C. Kenney; J. Kamine; J. S. Pagano; E. S. Huang

    1987-01-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene

  3. Immediate-Early Gene Region of Human Cytomegalovirus Trans-Activates the Promoter of Human Immunodeficiency Virus

    Microsoft Academic Search

    Michelle G. Davis; Shannon C. Kenney; James Kamine; Joseph S. Pagano; Eng-Shang Huang

    1987-01-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). We have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, we demonstrate that the immediate-early gene region

  4. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  5. A requirement for the immediate early gene Zif268 in the expression of late LTP and long-term memories

    Microsoft Academic Search

    M. W. Jones; M. L. Errington; P. J. French; A. Fine; T. V. P. Bliss; S. Garel; P. Charnay; B. Bozon; S. Laroche; S. Davis

    2001-01-01

    The induction of long-term potentiation (LTP) in the dentate gyrus of the hippocampus is associated with a rapid and robust transcription of the immediate early gene Zif268. We used a mutant mouse with a targeted disruption of Zif268 to ask whether this gene, which encodes a zinc finger transcription factor, is required for the maintenance of late LTP and for

  6. TISSUE-PLASMINOGEN ACTIVATOR IS INDUCED AS AN IMMEDIATE-EARLY GENE DURING SEIZURE, KINDLING, AND LONG-TERM POTENTIATION

    EPA Science Inventory

    Activity-dependent genes in brain have been identified using differential screening of hippocampal cDNA library from rats exposed to metrazol seizures under conditions of superconduction. Five immediate early genes whose expression is elevated by neural activity were identified. ...

  7. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  8. Regulation of Immediate Early Gene Expression and AP1 Binding in the Rat Nucleus Accumbens by Chronic Cocaine

    Microsoft Academic Search

    Bruce Hope; Barry Kosofsky; Steven E. Hyman; Eric J. Nestler

    1992-01-01

    Chronic treatment of rats with cocaine leads to long-term biochemical changes in the nucleus accumbens (NAc), a brain region implicated in mediating the reinforcing effects of cocaine and other drugs of abuse. Immediate early genes (IEGs) and their protein products appear to play an important role in transducing extracellular stimuli into altered patterns of cellular gene expression and, therefore, into

  9. The Mammalian Immediate-early TIS21 Protein and the Leukemia-associated BTG1 Protein Interact with a

    E-print Network

    Clarke, Steven

    immediate-early/primary response genes have been cloned on the basis of their induction characteristics. The human BTG1 gene was cloned and characterized (Rimokh et al., 1991) because of its proximityDNA was cloned by differential screening, both from a cDNA library prepared from mitogen-treated, quiescent mu

  10. Transcription Mapping and Expression Patterns of Genes in the Major Immediate-Early Region of Kaposi's Sarcoma-Associated Herpesvirus

    E-print Network

    Ronquist, Fredrik

    latency. They usually encode regulatory proteins that play crucial roles in viral life cycle and survival of these cells which are associated with the acquisition of telomerase activity and anchor- age-early stage of viral reactivation in primary effusion lymphoma cells. Three immediate-early transcripts were

  11. Acute ibogaine injection induces expression of the immediate early genes, egr-1 and c- fos, in mouse brain

    Microsoft Academic Search

    Syed F Ali; Nathalie Thiriet; Jean Zwiller

    1999-01-01

    The aim of the present study was to evaluate if an acute injection of ibogaine (IBO) induces immediate early gene expression in different regions of mouse brain. Adult male C57 mice received a single injection of IBO and were perfused transcardially with 1% paraformaldehyde 30 min after the drug administration. A single injection of IBO produced a significant increase of

  12. Human Cytomegalovirus Immediate Early Interaction with Host Nuclear Structures: Definition of an Immediate Transcript Environment

    PubMed Central

    Ishov, Alexander M.; Stenberg, Richard M.; Maul, Gerd G.

    1997-01-01

    The development of an induced transcript environment was investigated at the supramolecular level through comparative localization of the human cytomegalovirus immediate early (IE) transcripts and specific nuclear domains shortly after infection. Compact aggregates of IE transcripts form only adjacent to nuclear domain 10 (ND10), and the viral protein IE86 accumulates exclusively juxtaposed to the subpopulation of ND10 with transcripts. The stream of transcripts is funneled from ND10 into the spliceosome assembly factor SC35 domain through the accumulation of IE86 protein, which recruits some components of the basal transcription machinery. Concomitantly the IE72 protein binds to ND10 and later disperses them. The domain containing the zinc finger region of IE72 is essential for this dispersal. Positional analysis of proteins IE86 and IE72, IE transcripts, ND10, the spliceosome assembly factor SC35, and basal transcription factors defines spatially and temporally an immediate transcript environment, the basic components of which exist in the cell before viral infection, providing the structural environment for the virus to usurp. PMID:9214377

  13. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area.

    PubMed

    Wu, Hao; Xu, Feng-Lei; Yin, Yong; Da, Peng; You, Xiao-Dong; Xu, Hui-Min; Tang, Yan

    2015-08-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate?early genes (IEGs) was reported to correlate with neuronal activity, in particular activity?regulated cytoskeleton?associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N?methyl D?aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post?cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  14. Mapping vocalization-related immediate early gene expression in echolocating bats

    PubMed Central

    Schwartz, Christine P.; Smotherman, Michael S.

    2011-01-01

    Recent studies of spontaneously vocalizing primates, cetaceans, bats and rodents suggests these animals possess a limited but meaningful capacity to manipulate the timing and acoustic structure of their vocalizations, yet the neural substrate for even the simplest forms of vocal modulation in mammals remains unknown. Echolocating bats rapidly and routinely manipulate the acoustic structure of their outgoing vocalizations to improve echolocation efficiency, reflecting cognitive rather than limbic control of the vocal motor pathways. In this study, we used immunohistochemical localization of immediate early gene (c-fos) expression to map neural activity in the brains of spontaneously echolocating stationary Mexican free-tailed bats. Our results support the current model of vocal control obtained largely through microstimulation studies, but also provide evidence for the contributions of two novel regions, the dorsolateral caudate nucleus and mediodorsal thalamic nucleus, which together suggest a striatothalamic feedback loop may be involved in the control of echolocation pulse production. Additionally, we found evidence of a motivation pathway, including the lateral habenula, substantia nigra pars compacta, and raphe nuclei. These data provide novel insights into where and how mammalian vocalizations may be regulated by sensory, contextual and motivational cues. PMID:21726584

  15. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area

    PubMed Central

    WU, HAO; XU, FENG-LEI; YIN, YONG; DA, PENG; YOU, XIAO-DONG; XU, HUI-MIN; TANG, YAN

    2015-01-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate-early genes (IEGs) was reported to correlate with neuronal activity, in particular activity-regulated cytoskeleton-associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N-methyl D-aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post-cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  16. Clinical spectrum and diagnostic criteria of infantile spinal muscular atrophy: further delineation on the basis of SMN gene deletion findings.

    PubMed

    Rudnik-Schöneborn, S; Forkert, R; Hahnen, E; Wirth, B; Zerres, K

    1996-02-01

    With the evidence of deletions in the region responsible for autosomal recessive spinal muscular atrophy (SMA) on chromosome 5, it is now possible to further clarify the clinical and diagnostic findings in proximal SMA. Homozygous deletions of the survival motor neuron (SMN) gene can be detected in about 95% of patients with early onset SMA. In a series of more than 200 patients, we tested 31 patients with atypical features of SMA who fulfilled at least one exclusion criterion according to the diagnostic criteria of the International SMA Consortium for the presence of SMN gene deletions. The patients were subdivided into two groups: 1. Seven index patients being not deleted for the SMN gene who belonged to a well-defined SMA plus variant that has already been shown to be unlinked with chromosome 5q markers: diaphragmatic SMA, SMA plus olivopontocerebellar hypoplasia, SMA with congenital arthrogryposis and bone fractures. 2. Twenty-four patients with clinical signs of SMA and neurogenic findings in EMG/muscle biopsy who had unusual features or other organ involvement. In order to structure this heterogeneous group, each patient was assigned to a subgroup according to the leading atypical feature. In 5 out of 8 unrelated patients with a history of preterm birth and/or perinatal asphyxia leading to a picture of severe SMA in combination with respiratory distress and/or cerebral palsy, no deletion of the SMN gene could be detected. There were five unrelated patients with extended central nervous system involvement (cerebral atrophy, EEG abnormalities, pyramidal tract signs, evidence of cerebellar involvement). Most of these patients (4/5) proved to belong to SMA 5q on the basis of SMN gene deletion findings. The same applied to a group of three patients with classical SMA in association with congenital malformations (mainly heart defect). A fourth group of three patients was characterized mainly by an unusual improvement of the condition; in these patients no SMN gene deletions were present. In three index patients a more complex syndrome of the CNS and other organs was suggested, but the detection of SMN gene deletions in two of them made a coincidence of features more likely. In addition, SMN gene deletions were found in two patients with evidence of congenital fibre type dysproportion in one and extremely raised CK activity ( > 10fold) in the other. While the confirmation of SMN gene deletions is very useful in cases with diagnostic doubts, caution is required when offering prenatal prediction with regard to SMA 5q in families with atypical features. There is strong evidence that there are clinical entities resembling SMA which most likely have another pathogenetic background. PMID:8677029

  17. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.

    PubMed

    de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean

    2008-01-01

    We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

  18. Improved Techniques for Endogenous Epitope Tagging and Gene Deletion in Toxoplasma gondii

    PubMed Central

    Upadhya, Rajendra; Kim, Kami; Hogue-Angeletti, Ruth; Weiss, Louis M

    2011-01-01

    Toxoplasma gondii is an excellent model organism for studies on the biology of the Apicomplexa due to its ease of in vitro cultivation and genetic manipulation. Large-scale reverse genetic studies in T. gondii have, however, been difficult due to the low frequency of homologous recombination. Efforts to ensure homologous recombination have necessitated engineering long flanking regions in the targeting construct. This requirement makes it difficult to engineer chromosomally targeted epitope tags or gene knock out constructs only by restriction enzyme mediated cloning steps. To address this issue we employed multisite Gateway® recombination techniques to generate chromosomal gene manipulation targeting constructs. Incorporation of 1.5 to 2.0 kb flanking homologous sequences in PCR generated targeting constructs resulted in 90% homologous recombination events in wild type T. gondii (RH strain) as determined by epitope tagging and target gene deletion experiments. Furthermore, we report that split marker constructs were equally efficient for targeted gene disruptions using the T. gondii UPRT gene locus as a test case. The methods described in this paper represent an improved strategy for efficient epitope tagging and gene disruptions in T. gondii. PMID:21352857

  19. Construction and properties of pseudorabies virus recombinants with altered control of immediate-early gene expression.

    PubMed Central

    Glazenburg, K L; Peeters, B P; Pol, J M; Gielkens, A L; Moormann, R J

    1995-01-01

    To investigate how altered control of expression of the essential immediate-early (IE) gene of pseudorabies virus influences virus replication and virulence, we replaced the IE promoter with the tissue-specific promoters of the bovine cytokeratin IV gene (CKIV), the bovine cytokeratin VIb gene (CKVIb), or the inducible promoter of Drosophila heat shock gene HSP70. We compared expression of the IE gene of the wild-type virus and recombinant viruses in different cell types and at different temperatures and found that IE expression had become cell type or temperature dependent. When a recombinant virus was titrated on nonpermissive cells or was titrated at nonpermissive temperatures in vitro, the plating efficiency was reduced by more than 99%. Mice were inoculated subcutaneously (s.c.), intraperitoneally (i.p.), or intranasally (i.n.) with a dose equal to 100 times the 50% lethal dose of the wild-type virus. After inoculation with temperature-sensitive recombinant N-HSP, two (s.c.), two (i.p.), and four (i.n.) of five mice died. However, at this dose, recombinant N-CKIV, which contains a promoter specific for stratified epithelial tissue of the tongue mucosa, was not lethal when inoculated s.c. or i.p. but killed four mice when inoculated i.n. Recombinant N-CKVIb, which contains a promoter specific for the suprabasal layers of the epidermis, was not lethal after inoculation by any of the three routes. In explant cultures of nasal mucosa of pigs, replication of N-CKIV and N-CKVIb was not markedly reduced in the epithelium. However, in contrast to results obtained with wild-type virus, infection of the stroma was not observed. We conclude that the replicative ability and virulence of pseudorabies virus can be influenced by altering control of expression of the IE gene. PMID:7527083

  20. Identification of ocular dominance domains in New World owl monkeys by immediate-early gene expression

    PubMed Central

    Takahata, Toru; Miyashita, Masanobu; Tanaka, Shigeru; Kaas, Jon H.

    2014-01-01

    Ocular dominance columns (ODCs) have been well studied in the striate cortex (V1) of macaques, as well defined arrays of columnar structure that receive inputs from one eye or the other, whereas ODC expression seems more obscure in some New World primate species. ODCs have been identified by means of eye injections of transneuronal transporters and examination of cytochrome oxidase (CO) activity patterns after monocular enucleation. More recently, live-imaging techniques have been used to reveal ODCs. Here, we used the expression of immediate-early genes (IEGs), protooncogene, c-Fos, and zinc finger protein, Zif268, after monocular inactivation (MI) to identify ODCs in V1 of New World owl monkeys. Because IEG expression is more sensitive to activity changes than CO expression, it is capable of revealing activity maps in all layers throughout V1 and demonstrating brief activity changes within a couple of hours. Using IEGs, we not only revealed apparent ODCs in owl monkeys but also discovered a number of unique features of their ODCs. Distinct from those in macaques, these ODCs sometimes bridged to other columns in layer 4 (Brodmann layer 4C ). CO blobs straddled ODC borders in the central visual field, whereas they centered ODC patches in the peripheral visual field. In one case, the ODC pattern continued into V2. Finally, an elevation of IEG expression in layer 4 (4C) was observed along ODC borders after only brief MI. Our data provide insights into the structure and variability of ODCs in primates and revive debate over the functions and development of ODCs. PMID:24591618

  1. The immediate early gene Egr3 mediates adaptation to stress and novelty

    PubMed Central

    Gallitano-Mendel1, Amelia; Izumi, Yukitoshi; Tokuda, Kazuhiro; Zorumski, Charles F.; Howell, Maureen P.; Muglia, Louis J.; Wozniak, David F.; Milbrandt, Jeffrey

    2007-01-01

    Stress and exploration of novel environments induce neural expression of immediate early gene transcription factors (IEG-TFs). However, as yet no IEG-TF has been shown to be required for the normal biological or behavioral responses to these stimuli. Here we show that mice deficient for the IEG-TF early growth response gene (Egr) 3, display accentuated behavioral responses to the mild stress of handling paralleled by increased release of the stress hormone corticosterone. Egr3?/? mice also display abnormal responses to novelty, including heightened reactivity to novel environments and failure to habituate to social cues or startling acoustic stimuli. In a Y-maze spontaneous alternation task, they perform fewer sequential arm entries than controls, suggesting defects in immediate memory. Because stress and novelty stimulate hippocampal long-term depression (LTD), and because abnormalities in habituation to novelty and Y-maze performance have been associated with LTD deficits, we examined this form of synaptic plasticity in Egr3?/? mice. We found that Egr3?/? mice fail to establish hippocampal LTD in response to low frequency stimulation and exhibit dysfunction of an ifenprodil-sensitive (NR1/NR2B) NMDA receptor subclass. LTP induction was not altered. The NR2B-dependent dysfunction does not result from transcriptional regulation of this subunit by Egr3, because NR2B mRNA levels did not differ in the hippocampi of Egr3?/? and control mice. These findings are the first demonstration of the requirement for an IEG-TF in mediating the response to stress and novelty, and in the establishment of LTD. PMID:17692471

  2. The dusp1 Immediate Early Gene is Regulated by Natural Stimuli Predominantly in Sensory Input Neurons

    PubMed Central

    Horita, Haruhito; Wada, Kazuhiro; Rivas, Miriam V.; Hara, Erina; Jarvis, Erich D.

    2010-01-01

    Many immediate early genes (IEGs) have activity-dependent induction in a subset of brain subdivisions or neuron types. However, none have been reported yet with regulation specific to thalamic-recipient sensory neurons of the telencephalon or in the thalamic sensory input neurons themselves. Here, we report the first such gene, dual specificity phosphatase 1 (dusp1). Dusp1 is an inactivator of mitogen-activated protein kinase (MAPK), and MAPK activates expression of egr1, one of the most commonly studied IEGs, as determined in cultured cells. We found that in the brain of naturally behaving songbirds and other avian species, hearing song, seeing visual stimuli, or performing motor behavior caused high dusp1 upregulation, respectively, in auditory, visual, and somatosensory input cell populations of the thalamus and thalamic-recipient sensory neurons of the telencephalic pallium, whereas high egr1 upregulation occurred only in subsequently connected secondary and tertiary sensory neuronal populations of these same pathways. Motor behavior did not induce high levels of dusp1 expression in the motor-associated areas adjacent to song nuclei, where egr1 is upregulated in response to movement. Our analysis of dusp1 expression in mouse brain suggests similar regulation in the sensory input neurons of the thalamus and thalamic-recipient layer IV and VI neurons of the cortex. These findings suggest that dusp1 has specialized regulation to sensory input neurons of the thalamus and telencephalon; they further suggest that this regulation may serve to attenuate stimulus-induced expression of egr1 and other IEGs, leading to unique molecular properties of forebrain sensory input neurons. PMID:20506480

  3. Pathogenicity and vaccine efficacy of a thymidine kinase gene deleted infectious laryngotracheitis virus expressing the green fluorescent protein gene

    Microsoft Academic Search

    M. G. Han; C. H. Kweon; I. P. Mo; S. J. Kim

    2002-01-01

    Summary.  ?The deletion of the thymidine kinase (TK) gene of herpesviruses causes a reduction in their virulence. However, the effects\\u000a of the TK gene in infectious laryngotracheitis virus (ILTV) have not been clearly elucidated. In the present study, we constructed\\u000a a TK gene-deleted recombinant ILTV expressing the green fluorescent protein (GFP) gene as a marker. The GFP gene was inserted\\u000a in

  4. Role of hippocampus in alcohol-induced memory impairment: implications from behavioral and immediate early gene studies

    Microsoft Academic Search

    Andrey E. Ryabinin

    1998-01-01

    Acute alcohol intoxication disrupts memory acquisition in humans and laboratory animals. This review summarizes recent behavioral\\u000a and immediate early gene expression studies addressing the mechanisms of this phenomenon. Most behavioral investigations agree\\u000a that the amnestic effect of alcohol is due to its preferential detrimental effect on hippocampus-dependent than on hippocampus-independent\\u000a forms of learning. However, some hippocampal lesion studies contradict these

  5. Changes in striatal immediate early gene expression following neonatal dopaminergic lesion and effects of intrastriatal dopaminergic transplants

    Microsoft Academic Search

    D. N. Abrous; S. Desjardins; B. Sorin; D. Hancock; M. Le. Moal; J.-P. Herman

    1996-01-01

    To evaluate the functional integration of neonatal dopaminergic transplants within host brain we studied the postsynaptic effects induced by their stimulation by following the expression of immediate early genes c-fos, c-jun and egr-1. This study was conducted nine months after the intrastriatal implantation of embryonic mesencephalic neurons to rat pups having sustained a unilateral lesion of the nigrostriatal dopaminergic system.

  6. The C-Mer Gene Is Induced by Epstein-Barr Virus Immediate-Early Protein BRLF1

    Microsoft Academic Search

    Yuling Li; Nupam P. Mahajan; Jennifer Webster-Cyriaque; Prasanna Bhende; Gregory K. Hong; H. Shelton Earp; Shannon Kenney

    2004-01-01

    BRLF1 (R) is one of two Epstein-Barr virus (EBV) immediate-early proteins that mediate the switch from the latent to the lytic form of viral replication. In this report, we show that R induces expression of the cellular C-mer gene in a variety of cell lines. C-mer expression was detected in lymphoblastoid cells immortalized with wild-type EBV but not in lymphoblastoid

  7. Implications of Immediate-Early Gene Induction in the Brain Following Sexual Stimulation of Female and Male Rodents

    Microsoft Academic Search

    JAMES G. PFAUS; MICHAELA M. HEEB

    1997-01-01

    Induction of immediate-early genes (IEGs), such as c-fos, has been widely used to mark the activation of brain regions following different types of sexual stimulation and behavior. A relatively common set of hormone-concentrating basal forebrain and midbrain structures in female and male rodents is activated by copulatory stimulation, in particular, stimulation of sensory nerves that innervate the penis or vagina\\/cervix,

  8. H 2O 2 inhibits BCR-dependent immediate early induction of EBV genes in Burkitt's lymphoma cells

    Microsoft Academic Search

    Helen I. Osipova-Goldberg; Lyudmila V. Turchanowa; Barbara Adler; Josef M. Pfeilschifter

    2009-01-01

    The critical step in the Epstein–Barr virus (EBV) transition from latency to lytic replication is activation of the viral immediate early (IE) genes, BZLF1 and BRLF1. Their induction in Burkitt's lymphoma Akata cells is directly targeted by B cell receptor (BCR) signaling. On the other hand, BCR stimulation causes an outwardly directed superoxide (O2•?) burst leading to massive generation of

  9. A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

    SciTech Connect

    Gong, Y.; Li, X.M.; Shapiro, L.J. [UCSF School of Medicine, San Francisco, CA (United States)] [and others

    1994-09-01

    Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand, and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.

  10. The 19S Proteasome Activator Promotes Human Cytomegalovirus Immediate Early Gene Expression through Proteolytic and Nonproteolytic Mechanisms

    PubMed Central

    Winkler, Laura L.

    2014-01-01

    ABSTRACT Proteasomes are large, multisubunit complexes that support normal cellular activities by executing the bulk of protein turnover. During infection, many viruses have been shown to promote viral replication by using proteasomes to degrade cellular factors that restrict viral replication. For example, the human cytomegalovirus (HCMV) pp71 protein induces the proteasomal degradation of Daxx, a cellular transcriptional repressor that can silence viral immediate early (IE) gene expression. We previously showed that this degradation requires both the proteasome catalytic 20S core particle (CP) and the 19S regulatory particle (RP). The 19S RP associates with the 20S CP to facilitate protein degradation but also plays a 20S CP-independent role promoting transcription. Here, we present a nonproteolytic role of the 19S RP in HCMV IE gene expression. We demonstrate that 19S RP subunits are recruited to the major immediate early promoter (MIEP) that directs IE transcription. Depletion of 19S RP subunits generated a defect in RNA polymerase II elongation through the MIE locus during HCMV infection. Our results reveal that HCMV commandeers proteasome components for both proteolytic and nonproteolytic roles to promote HCMV lytic infection. IMPORTANCE Proteasome inhibitors decrease or eliminate 20S CP activity and are garnering increasing interest as chemotherapeutics. However, an increasing body of evidence implicates 19S RP subunits in important proteolytic-independent roles during transcription. Thus, pharmacological inhibition of the 20S CP as a means to modulate proteasome function toward therapeutic effect is an incomplete capitalization on the potential of this approach. Here, we provide an additional example of nonproteolytic 19S RP function in promoting HCMV transcription. These data provide a novel system with which to study the roles of different proteasome components during transcription, a rationale for previously described shifts in 19S RP subunit localization during HCMV infection, and a potential therapeutic intervention point at a pre-immediate early stage for the inhibition of HCMV infection. PMID:25078702

  11. The Rel/NF-?B pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity

    PubMed Central

    Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

    2012-01-01

    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in ?g. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that ?g was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of ?g from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that ?g- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in ?g. Importantly, several key immediate early genes were inhibited in ?g. In particular, transactivation of Rel/NF-?B, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in ?g and upon anti-CD3/anti-CD28 stimulation in simulated ?g. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in ?g and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that ?g was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

  12. A nonstructural polypeptide encoded by immediate-early transcription unit 1 of murine cytomegalovirus is recognized by cytolytic T lymphocytes

    PubMed Central

    1987-01-01

    We have constructed target cells by cotransfection of the MHC gene Ld and fragments of murine cytomegalovirus (MCMV) DNA coding for nonstructural immediate-early (IE) proteins. Transfectants were tested by using CTL clone IE1 with specificity for an IE epitope presented in association with Ld. Data show that clone IE1 recognizes a product of the ie1 transcription unit of MCMV, and that its specificity is shared by approximately 25% of polyclonal IE-specific CTL. The results provide the first definite evidence that expression of a herpes virus IE gene encoding a regulatory protein gives rise to antigen expression detectable by specific CTL. PMID:2439637

  13. A Novel Vitamin D-Regulated Immediate-Early Gene, IEX-1, Alters Cellular Growth and Apoptosis

    PubMed Central

    Pittelkow, Mark R.; Salisbury, Jeffrey L.; Grande, Joseph R; Im, Hee-Jeong; Feldmann, Kathrin A.; Schilling, David

    2010-01-01

    1?,25-Dihydroxyvitamin D3 (1?,25(OH)2D3) inhibits the expression of an immediate-early gene, IEX-1, which is involved in the regulation of cellular growth and apoptosis in a variety of cells. 1?,25(OH)2D3 alters the subcellular localization of IEX-1 by causing an efflux of IEX-1 from the nucleus, and the sterol decreases the expression of IEX-1 messenger RNA in cells via a novel DR3 repeat-type DNA response element. PMID:12899517

  14. High-frequency stimulation induces gradual immediate early gene expression in maturing adult-generated hippocampal granule cells.

    PubMed

    Jungenitz, Tassilo; Radic, Tijana; Jedlicka, Peter; Schwarzacher, Stephan W

    2014-07-01

    Increasing evidence shows that adult neurogenesis of hippocampal granule cells is advantageous for learning and memory. We examined at which stage of structural maturation and age new granule cells can be activated by strong synaptic stimulation. High-frequency stimulation of the perforant pathway in urethane-anesthetized rats elicited expression of the immediate early genes c-fos, Arc, zif268 and pCREB133 in almost 100% of mature, calbindin-positive granule cells. In contrast, it failed to induce immediate early gene expression in immature doublecortin-positive granule cells. Furthermore, doublecortin-positive neurons did not react with c-fos or Arc expression to mild theta-burst stimulation or novel environment exposure. Endogenous expression of pCREB133 was increasingly present in young cells with more elaborated dendrites, revealing a close correlation to structural maturation. Labeling with bromodeoxyuridine revealed cell age dependence of stimulation-induced c-fos, Arc and zif268 expression, with only a few cells reacting at 21 days, but with up to 75% of cells activated at 35-77 days of cell age. Our results indicate an increasing synaptic integration of maturing granule cells, starting at 21 days of cell age, but suggest a lack of ability to respond to activation with synaptic potentiation on the transcriptional level as long as immature cells express doublecortin. PMID:23425888

  15. The Immediate Early Gene Product EGR1 and Polycomb Group Proteins Interact in Epigenetic Programming during Chondrogenesis

    PubMed Central

    Caron, Marjolein M. J.; Prickaerts, Peggy; Rofel, Celine; Dahlmans, Vivian E. H.; Surtel, Don A. M.; Paulis, Yvette; Schweizer, Finja; Welting, Tim J. M.; Eijssen, Lars M.; Voncken, Jan Willem

    2013-01-01

    Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3) blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis. PMID:23483971

  16. The enhancer domain of the human cytomegalovirus major immediate-early promoter determines cell type-specific expression in transgenic mice.

    PubMed Central

    Baskar, J F; Smith, P P; Nilaver, G; Jupp, R A; Hoffmann, S; Peffer, N J; Tenney, D J; Colberg-Poley, A M; Ghazal, P; Nelson, J A

    1996-01-01

    The human cytomegalovirus (HCMV) major immediate-early promoter (MIEP) is one of the first promoters to activate upon infection. To examine HCMV MIEP tissue-specific expression, transgenic mice were established containing the lacZ gene regulated by the MIEP (nucleotides -670 to +54). In the transgenic mice, lacZ expression was demonstrated in 19 of 29 tissues tested by histochemical and immunochemical analyses. These tissues included brain, eye, spinal cord, esophagus, stomach, pancreas, kidney, bladder, testis, ovary, spleen, salivary gland, thymus, bone marrow, skin, cartilage, and cardiac, striated and smooth muscles. Although expression was observed in multiple organs, promoter activity was restricted to specific cell types. The cell types which demonstrated HCMV MIEP expression included retinal cells of the eye, ductile cells of the salivary gland, exocrine cells of the pancreas, mucosal cells of the stomach and intestine, neuronal cells of the brain, muscle fibers, thecal cells of the corpus luteum, and Leydig and sperm cells of the testis. These observations indicate that the HCMV MIEP is not a pan-specific promoter and that the majority of expressing tissues correlate with tissues naturally infected by the virus in the human host. PMID:8627801

  17. The enhancer domain of the human cytomegalovirus major immediate-early promoter determines cell type-specific expression in transgenic mice.

    PubMed

    Baskar, J F; Smith, P P; Nilaver, G; Jupp, R A; Hoffmann, S; Peffer, N J; Tenney, D J; Colberg-Poley, A M; Ghazal, P; Nelson, J A

    1996-05-01

    The human cytomegalovirus (HCMV) major immediate-early promoter (MIEP) is one of the first promoters to activate upon infection. To examine HCMV MIEP tissue-specific expression, transgenic mice were established containing the lacZ gene regulated by the MIEP (nucleotides -670 to +54). In the transgenic mice, lacZ expression was demonstrated in 19 of 29 tissues tested by histochemical and immunochemical analyses. These tissues included brain, eye, spinal cord, esophagus, stomach, pancreas, kidney, bladder, testis, ovary, spleen, salivary gland, thymus, bone marrow, skin, cartilage, and cardiac, striated and smooth muscles. Although expression was observed in multiple organs, promoter activity was restricted to specific cell types. The cell types which demonstrated HCMV MIEP expression included retinal cells of the eye, ductile cells of the salivary gland, exocrine cells of the pancreas, mucosal cells of the stomach and intestine, neuronal cells of the brain, muscle fibers, thecal cells of the corpus luteum, and Leydig and sperm cells of the testis. These observations indicate that the HCMV MIEP is not a pan-specific promoter and that the majority of expressing tissues correlate with tissues naturally infected by the virus in the human host. PMID:8627801

  18. Host immune response to cytomegalovirus: products of transfected viral immediate-early genes are recognized by cloned cytolytic T lymphocytes.

    PubMed Central

    Koszinowski, U H; Reddehase, M J; Keil, G M; Schickedanz, J

    1987-01-01

    To confirm that immediate-early (IE) genes of murine cytomegalovirus (MCMV) give rise to antigens recognized by specific cytolytic T lymphocytes (CTL), a 10.8-kilobase fragment of MCMV DNA which is abundantly transcribed at IE times was transfected into L cells expressing the Ld class I major histocompatibility glycoprotein. The viral genome fragment contains sequences of the three IE transcription units of MCMV: ie1, ie2, and ie3. In the transfected cell lines, only the predominant 2.75-kilobase transcript of ie1 and its translation product pp89 could be detected. The transfectants were analyzed for membrane expression of an IE antigen by employing clone IE1, an IE-specific CTL clone, as the probe. Only cells that expressed both the MCMV IE gene(s) and the Ld gene were recognized by the CTL clone. Images PMID:3033334

  19. A requirement for the immediate early gene Zif268 in the expression of late LTP and long-term memories.

    PubMed

    Jones, M W; Errington, M L; French, P J; Fine, A; Bliss, T V; Garel, S; Charnay, P; Bozon, B; Laroche, S; Davis, S

    2001-03-01

    The induction of long-term potentiation (LTP) in the dentate gyrus of the hippocampus is associated with a rapid and robust transcription of the immediate early gene Zif268. We used a mutant mouse with a targeted disruption of Zif268 to ask whether this gene, which encodes a zinc finger transcription factor, is required for the maintenance of late LTP and for the expression of long-term memory. We show that whereas mutant mice exhibit early LTP in the dentate gyrus, late LTP is absent when measured 24 and 48 hours after tetanus in the freely moving animal. In both spatial and non-spatial learning tasks, short-term memory remained intact, whereas performance was impaired in tests requiring long-term memory. Thus, Zif268 is essential for the transition from short- to long-term synaptic plasticity and for the expression of long-term memories. PMID:11224546

  20. Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate-early protein IE1.

    PubMed

    Liu, Wang-Jing; Chang, Yun-Shiang; Wang, Hao-Ching; Leu, Jiann-Horng; Kou, Guang-Hsiung; Lo, Chu-Fang

    2008-11-01

    Immediate-early proteins from many viruses function as transcriptional regulators and exhibit transactivation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA binding domain of the yeast transactivator GAL4 fused to full-length IE1. This GAL4-IE1 fusion protein successfully activated the Autographa californica multicapsid nucleopolyhedrovirus p35 basal promoter when five copies of the GAL4 DNA binding site were inserted upstream of the TATA box. A deletion series of GAL4-IE1 fusion proteins suggested that the transactivation domain of WSSV IE1 was carried within its first 80 amino acids. A point mutation assay further showed that all 12 of the acidic residues in this highly acidic domain were important for IE1's transactivation activity. DNA binding activity was confirmed by an electrophoresis mobility shift assay using a probe with (32)P-labeled random oligonucleotides. The DNA binding region of WSSV IE1 was located in its C-terminal end (amino acids 81 to 224), but mutation of a putative zinc finger motif in this C-terminal region suggested that this motif was not directly involved in the DNA binding activity. A homotypic interaction between IE1 molecules was demonstrated by glutathione S-transferase pull-down assay and a coimmunoprecipitation analysis. A glutaraldehyde cross-linking experiment and gel filtration analysis showed that this self-interaction led to the formation of stable IE1 dimers. PMID:18768963

  1. Comparative messenger ribonucleic acid analysis of immediate early genes and sex steroid receptors in human leiomyoma and healthy myometrium.

    PubMed

    Lessl, M; Klotzbuecher, M; Schoen, S; Reles, A; Stöckemann, K; Fuhrmann, U

    1997-08-01

    To shed light on the molecular mechanisms involved in the pathogenesis of uterine leiomyomas, transcript levels of the immediate early genes c-fos, c-myc, and c-jun and of the estrogen receptor (ER) and progesterone receptor (PR) were determined in tissue samples of human myometrium and leiomyoma. The messenger RNA (mRNA) content was analyzed by RT-PCR. mRNAs for c-fos, c-myc, c-jun, ER, and PR were detected in all 18 samples of leiomyoma and corresponding myometrial tissue collected in this study. Interestingly, in contrast to healthy tissues, we found a distinct and significant reduction of c-fos mRNA in the tumor. These data were substantiated by the finding of lowered c-Fos protein levels in leiomyomas tissues. Moreover, transcripts of c-jun and c-myc were less abundant in most of the leiomyomas than in the myometrium. This different expression of the protooncogenes in leiomyomas and myometrium was independent of the phase of the menstrual cycle in which samples were collected. In contrast to the reduced transcript levels observed for the immediate early genes, the ER and PR mRNA contents of the leiomyomas and myometrium did not differ. These results were confirmed by immunohistochemical studies for ER and PR protein. In conclusion, our data show that the deregulated expression of protooncogenes, especially of c-fos, is linked to the pathogenesis of leiomyomas. Confirmation of a potential role of downregulated c-fos levels for the benign character of these tumors requires further investigation. Additionally, the findings suggest that sex steroids do not influence the different expression patterns of c-fos, c-myc, and c-jun in leiomyomas, as compared with myometrium. PMID:9253340

  2. Central precocious puberty in a patient with X-linked adrenal hypoplasia congenita and Xp21 contiguous gene deletion syndrome.

    PubMed

    Koh, Ji Won; Kang, So Young; Kim, Gu Hwan; Yoo, Han Wook; Yu, Jeesuk

    2013-06-01

    X-linked adrenal hypoplasia congenita is caused by the mutation of DAX-1 gene (dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1), and can occur as part of a contiguous gene deletion syndrome in association with glycerol kinase (GK) deficiency, Duchenne muscular dystrophy and X-linked interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) gene deficiency. It is usually associated with hypogonadotropic hypogonadism, although in rare cases, it has been reported to occur in normal puberty or even central precocious puberty. This study addresses a case in which central precocious puberty developed in a boy with X-linked adrenal hypoplasia congenita who had complete deletion of the genes DAX-1, GK and IL1RAPL1 (Xp21 contiguous gene deletion syndrome). Initially he was admitted for the management of adrenal crisis at the age of 2 months, and managed with hydrocortisone and florinef. At 45 months of age, his each testicular volumes of 4 mL and a penile length of 5 cm were noted, with pubic hair of Tanner stage 2. His bone age was advanced and a gonadotropin-releasing hormone (GnRH) stimulation test showed a luteinizing hormone peak of 8.26 IU/L, confirming central precocious puberty. He was then treated with a GnRH agonist, as well as steroid replacement therapy. In Korea, this is the first case of central precocious puberty developed in a male patient with X-linked adrenal hypoplasia congenita. PMID:24904859

  3. The B-Cell-Specific Transcription Factor and Master Regulator Pax5 Promotes Epstein-Barr Virus Latency by Negatively Regulating the Viral Immediate Early Protein BZLF1

    PubMed Central

    Raver, Ryan M.; Panfil, Amanda R.; Hagemeier, Stacy R.

    2013-01-01

    The latent-to-lytic switch of Epstein-Barr virus (EBV) is mediated by the immediate early protein BZLF1 (Z). However, the cellular factors regulating this process remain incompletely characterized. In this report, we show that the B-cell-specific transcription factor Pax5 helps to promote viral latency in B cells by blocking Z function. Although Z was previously shown to directly interact with Pax5 and inhibit its activity, the effect of Pax5 on Z function has not been investigated. Here, we demonstrate that Pax5 inhibits Z-mediated lytic viral gene expression and the release of infectious viral particles in latently infected epithelial cell lines. Conversely, we found that shRNA-mediated knockdown of endogenous Pax5 in a Burkitt lymphoma B-cell line leads to viral reactivation. Furthermore, we show that Pax5 reduces Z activation of early lytic viral promoters in reporter gene assays and inhibits Z binding to lytic viral promoters in vivo. We confirm that Pax5 and Z directly interact and show that this interaction requires the carboxy-terminal DNA-binding/dimerization domain of Z and the amino-terminal DNA-binding domain of Pax5. A Pax5 DNA-binding mutant (V26G/P80R) that interacts with Z retains the ability to inhibit Z function, whereas a Pax5 mutant (?106-110) that is deficient for interaction with Z does not inhibit Z-mediated lytic viral reactivation. Since the B-cell-specific transcription factor Oct-2 also directly interacts with Z and inhibits its function, these results suggest that EBV uses multiple redundant mechanisms to establish and maintain viral latency in B cells. PMID:23678172

  4. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis

    PubMed Central

    Kubík, Št?pán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena – Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated neurons. PMID:24659959

  5. Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory

    ERIC Educational Resources Information Center

    Pevzner, Aleksandr; Guzowski, John F.

    2015-01-01

    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

  6. Rhomboids of Mycobacteria: Characterization Using an aarA Mutant of Providencia stuartii and Gene Deletion in Mycobacterium smegmatis

    PubMed Central

    Kateete, David Patrick; Katabazi, Fred Ashaba; Okeng, Alfred; Okee, Moses; Musinguzi, Conrad; Asiimwe, Benon Byamugisha; Kyobe, Samuel; Asiimwe, Jeniffer; Boom, W. Henry; Joloba, Moses Lutaakome

    2012-01-01

    Background Rhomboids are ubiquitous proteins with unknown roles in mycobacteria. However, bioinformatics suggested putative roles in DNA replication pathways and metabolite transport. Here, mycobacterial rhomboid-encoding genes were characterized; first, using the Providencia stuartii null-rhomboid mutant and then deleted from Mycobacterium smegmatis for additional insight in mycobacteria. Methodology/Principal Findings Using in silico analysis we identified in M. tuberculosis genome the genes encoding two putative rhomboid proteins; Rv0110 (referred to as “rhomboid protease 1”) and Rv1337 (“rhomboid protease 2”). Genes encoding orthologs of these proteins are widely represented in all mycobacterial species. When transformed into P. stuartii null-rhomboid mutant (?aarA), genes encoding mycobacterial orthologs of “rhomboid protease 2” fully restored AarA activity (AarA is the rhomboid protein of P. stuartii). However, most genes encoding mycobacterial “rhomboid protease 1” orthologs did not. Furthermore, upon gene deletion in M. smegmatis, the ?MSMEG_4904 single mutant (which lost the gene encoding MSMEG_4904, orthologous to Rv1337, “rhomboid protease 2”) formed the least biofilms and was also more susceptible to ciprofloxacin and novobiocin, antimicrobials that inhibit DNA gyrase. However, the ?MSMEG_5036 single mutant (which lost the gene encoding MSMEG_5036, orthologous to Rv0110, “rhomboid protease 1”) was not as susceptible. Surprisingly, the double rhomboid mutant ?MSMEG_4904–?MSMEG_5036 (which lost genes encoding both homologs) was also not as susceptible suggesting compensatory effects following deletion of both rhomboid-encoding genes. Indeed, transforming the double mutant with a plasmid encoding MSMEG_5036 produced phenotypes of the ?MSMEG_4904 single mutant (i.e. susceptibility to ciprofloxacin and novobiocin). Conclusions/Significance Mycobacterial rhomboid-encoding genes exhibit differences in complementing aarA whereby it's only genes encoding “rhomboid protease 2” orthologs that fully restore AarA activity. Additionally, gene deletion data suggests inhibition of DNA gyrase by MSMEG_4904; however, the ameliorated effect in the double mutant suggests occurrence of compensatory mechanisms following deletion of genes encoding both rhomboids. PMID:23029216

  7. The carboxy terminal region of the human cytomegalovirus immediate early 1 (IE1) protein disrupts type II inteferon signaling.

    PubMed

    Raghavan, Bindu; Cook, Charles H; Trgovcich, Joanne

    2014-04-01

    Interferons (IFNs) activate the first lines of defense against viruses, and promote innate and adaptive immune responses to viruses. We report that the immediate early 1 (IE1) protein of human cytomegalovirus (HCMV) disrupts signaling by IFN?. The carboxyl-terminal region of IE1 is required for this function. We found no defect in the initial events in IFN? signaling or in nuclear accumulation of signal transducer and activator of transcription 1 (STAT1) in IE1-expressing cells. Moreover, we did not observe an association between disruption of IFN? signaling and nuclear domain 10 (ND10) disruption. However, there is reduced binding of STAT1 homodimers to target gamma activated sequence (GAS) elements in the presence of IE1. Co-immunoprecipitation studies failed to support a direct interaction between IE1 and STAT1, although these studies revealed that the C-terminal region of IE1 was required for interaction with STAT2. Together, these results indicate that IE1 disrupts IFN? signaling by interfering with signaling events in the nucleus through a novel mechanism. PMID:24699362

  8. Interferon-gamma induces the expression of immediate early genes c-fos and c-jun in astrocytes.

    PubMed Central

    Rubio, N

    1997-01-01

    The expression of the proto-oncogenes, c-fos and c-jun, in cultured mouse astrocytes and its induction by the potent astrocyte activator interferon-gamma (IFN-gamma), were examined by Northern blot and flow cytometry. Both proto-oncogenes were induced in a dose-dependent manner, peaking around 100 U/ml of IFN-gamma. The kinetics of expression is very transient for c-fos, reaching a maximum at 30 min and decreasing rapidly thereafter. The c-jun remained high throughout the stages analysed. Cycloheximide superinduced c-fos and c-jun induction by IFN-gamma, thus indicating that both act as immediate early genes. The products of c-fos and c-jun, proteins FOS and JUN, that act in conjunction forming the regulatory factor AP-1, were detected 1 hr after stimulation in virtually all cells, using flow cytometry. The induction in astrocytes of both proto-oncogenes could be the first stage of immunological activation of these central nervous system cells by immune interferon. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9378495

  9. Retinoid-Induced Expression and Activity of an Immediate Early Tumor Suppressor Gene in Vascular Smooth Muscle Cells

    PubMed Central

    Streb, Jeffrey W.; Long, Xiaochun; Lee, Ting-Hein; Sun, Qiang; Kitchen, Chad M.; Georger, Mary A.; Slivano, Orazio J.; Blaner, William S.; Carr, Daniel W.; Gelman, Irwin H.; Miano, Joseph M.

    2011-01-01

    Retinoids are used clinically to treat a number of hyper-proliferative disorders and have been shown in experimental animals to attenuate vascular occlusive diseases, presumably through nuclear receptors bound to retinoic acid response elements (RARE) located in target genes. Here, we show that natural or synthetic retinoids rapidly induce mRNA and protein expression of a specific isoform of A-Kinase Anchoring Protein 12 (AKAP12?) in cultured smooth muscle cells (SMC) as well as the intact vessel wall. Expression kinetics and actinomycin D studies indicate Akap12? is a retinoid-induced, immediate-early gene. Akap12? promoter analyses reveal a conserved RARE mildly induced with atRA in a region that exhibits hyper-acetylation. Immunofluorescence microscopy and protein kinase A (PKA) regulatory subunit overlay assays in SMC suggest a physical association between AKAP12? and PKA following retinoid treatment. Consistent with its designation as a tumor suppressor, inducible expression of AKAP12? attenuates SMC growth in vitro. Further, immunohistochemistry studies establish marked decreases in AKAP12 expression in experimentally-injured vessels of mice as well as atheromatous lesions in humans. Collectively, these results demonstrate a novel role for retinoids in the induction of an AKAP tumor suppressor that blocks vascular SMC growth thus providing new molecular insight into how retiniods may exert their anti-proliferative effects in the injured vessel wall. PMID:21483686

  10. An immediate-early protein of white spot syndrome virus modulates the phosphorylation of focal adhesion kinase of shrimp.

    PubMed

    Lu, Huasong; Ruan, Lingwei; Xu, Xun

    2011-10-25

    WSSV interacts with integrin during infection of shrimps and modulate the focal adhesion kinase which is known as a regulator of several downstream signaling pathways. Viral protein kinases are thought to be important for virus infection by regulating the host signaling pathways. WSV083 is an immediate-early gene of white spot syndrome virus that contains a Ser/Thr protein kinase domain. So, does WSSV modulate FAK phosphorylation via the WSV083 molecule? In this study, co-transfection of WSV083 and MjFAK genes proceeded in insect cells revealed that the MjFAK phosphorylation and cell adhesion activity could be inhibited by the expression of WSV083. Kinase domain mutants of WSV083 lost its ability of inhibiting FAK phosphorylation. Moreover, silencing of FAK gene through RNAi accelerated the shrimp death rate upon WSSV challenge. These results demonstrate for the first time that modulation of FAK phosphorylation by WSV083 plays a critical role in the pathogenesis of WSSV infection. PMID:21908012

  11. Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation

    NASA Technical Reports Server (NTRS)

    Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

    1997-01-01

    Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

  12. A dihydro-pyrido-indole potently inhibits HSV-1 infection by interfering the viral immediate early transcriptional events.

    PubMed

    Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh C; Mondal, Supriya; Biswas, Aruna; Sharon, Ashoke; Van Kaer, Luc; Chakrabarty, Sekhar; Das, Gobardhan; Mitra, Debashis; Chattopadhyay, Debprasad

    2014-05-01

    In our continued quest for identifying novel molecules from ethnomedicinal source we have isolated an alkaloid 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole, also known as Harmaline (HM), from an ethnomedicinal herb Ophiorrhiza nicobarica. The compound exhibited a potent anti-HSV-1 activity against both wild type and clinical isolates of HSV-1. Further we demonstrated that HM did not interfere in viral entry but the recruitment of lysine-specific demethylase-1 (LSD1) and the binding of immediate-early (IE) complex on ICP0 promoter. This leads to the suppression of viral IE gene synthesis and thereby the reduced expression of ICP4 and ICP27. Moreover, HM at its virucidal concentration is nontoxic and reduced virus yields in cutaneously infected Balb/C mice. Thus, the interference in the binding of IE complex, a decisive factor for HSV lytic cycle or latency by HM reveals an interesting target for developing non-nucleotide antiherpetic agent with different mode of action than Acyclovir. PMID:24576908

  13. Cytomegalovirus immediate-early promoter efficiently drives heterogeneous gene expression in Spodoptera frugiperda (Sf9) insect cells.

    PubMed

    Li, S; Zhang, Q N; Zhang, X T; Zheng, X Y; Lv, Y F; Hao, Z M

    2014-01-01

    Recently, wide attention has been given to the potential of recombinant baculovirus as a gene transfer vehicle for mammalian gene therapy. In this study, we packaged the recombinant baculoviruses with cytomegalovirus immediate-early (CMV-IE) promoter in Spodoptera frugiperda (Sf9) insect cells, and found that the CMV-IE promoter could efficiently drive the exogenic gene expression in the cells 12 h post-infection (h.p.i.). The expression level at 72 h.p.i. was only around half of that driven by polyhedrin promoter (Ppolh). However, the biological activity of the reporter proteins at 72 h.p.i. were similar with that driven by Ppolh. In addition, the Sf9 cells transfected with CMV-IE-containing plasmids also expressed foreign genes, suggesting that the CMV-IE-directed heterogeneous gene expression in the Sf9 cells was baculovirus-independent. These results demonstrate that the CMV-IE promoter might be used as a regular promoter in Sf9 cells. PMID:24606722

  14. Tightly regulated expression of Autographa californica multicapsid nucleopolyhedrovirus immediate early genes emerges from their interactions and possible collective behaviors.

    PubMed

    Ono, Chikako; Sato, Masanao; Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

  15. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    SciTech Connect

    Liu Wangjing [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Chang Yunshiang [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Wang Chunghsiung [Department of Entomology, National Taiwan University, Taipei 106, Taiwan (China); Kou, Guang-Hsiung [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Lo Chufang [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China)]. E-mail: gracelow@ntu.edu.tw

    2005-04-10

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter.

  16. How necessary is the activation of the immediate early gene zif268 in synaptic plasticity and learning?

    PubMed

    Davis, Sabrina; Bozon, Bruno; Laroche, Serge

    2003-06-16

    The immediate early genes (IEGs) are activated rapidly and transiently in response to a multitude of stimuli. The zif268 belongs to a category of regulatory IEGs that activate downstream target genes and is considered to be a triggering mechanism to activate the genomic response in neurons. Several studies have shown that zif268 mRNA is upregulated during different forms of associative learning, and following tetanic stimulation that induces long-lasting LTP. To date, there is a general consensus that zif268 activation may constitute a critical mechanism for the encoding of long-lasting memories, however this is based on relatively few studies. Given the fact that zif268 can be activated by a number of different types of stimuli, it becomes important to determine exactly how it may be implicated in memory. Examination of the current literature suggests that zif268 is necessary in the processing of several types of memory, however, it is not entirely clear what aspects of memory zif268 may be implicated in. Here, we review the existing literature and emphasise that understanding the signalling pathways that lead to activation of the IEGs and the downstream targets of these genes will advance our understanding of how functional activation of zif268 may be implicated in processing long-term memories. PMID:12798262

  17. Abnormal spermatogenesis and reduced fertility in transgenic mice expressing the immediate-early protein IE180 of pseudorabies virus.

    PubMed

    Tomioka, Yukiko; Morimatsu, Masami; Taharaguchi, Satoshi; Yamamoto, Sayo; Suyama, Haruka; Ozaki, Kinuyo; Iwamori, Naoki; Ono, Etsuro

    2013-11-01

    Transcription factors of alphaherpesviruses not only control the expression of their own viral genes, but also influence the gene expression of mammalian cells. In the course of breeding of the transgenic mouse line (TgIE96) expressing the immediate-early protein IE180 of pseudorabies virus belonging to the subfamily Alphaherpesvirinae, we found that TgIE96 male mice suffered from severe breeding difficulties. Testes of TgIE96 were smaller than that of non-transgenic littermates and abnormal spermatogenesis such as morphological, numerical and functional anomalies of spermatozoa were found in the transgenic mouse line. Expression of IE180 was detected in the germ cells at all stages, especially spermatocytes, and fewer Sertoli cells. In addition, expression of IE180 was also detected in the germinal cells of C57BL/6 mice inoculated with PRV into their testes. These results suggest that IE180 of PRV induces male infertility by abnormal spermatogenesis, which effect morphological, numerical, and functional anomalies of spermatozoa, in transgenic mice. PMID:24099769

  18. Expression of immediate-early genes in the inferior colliculus and auditory cortex in salicylate-induced tinnitus in rat.

    PubMed

    Hu, S S; Mei, L; Chen, J Y; Huang, Z W; Wu, H

    2014-01-01

    Tinnitus could be associated with neuronal hyperactivity in the auditory center. As a neuronal activity marker, immediate-early gene (IEG) expression is considered part of a general neuronal response to natural stimuli. Some IEGs, especially the activity-dependent cytoskeletal protein (Arc) and the early growth response gene-1 (Egr-1), appear to be highly correlated with sensory-evoked neuronal activity. We hypothesize, therefore, an increase of Arc and Egr-1 will be observed in a tinnitus model. In our study, we used the gap prepulse inhibition of acoustic startle (GPIAS) paradigm to confirm that salicylate induces tinnitus-like behavior in rats. However, expression of the Arc gene and Egr-1 gene were decreased in the inferior colliculus (IC) and auditory cortex (AC), in contradiction of our hypothesis. Expression of N-methyl d-aspartate receptor subunit 2B (NR2B) was increased and all of these changes returned to normal 14 days after treatment with salicylate ceased. These data revealed long-time administration of salicylate induced tinnitus markedly but reversibly and caused neural plasticity changes in the IC and the AC. Decreased expression of Arc and Egr-1 might be involved with instability of synaptic plasticity in tinnitus. PMID:24704997

  19. Immediate early gene response to hearing song correlates with receptive behavior and depends on dialect in a female songbird.

    PubMed

    Maney, D L; MacDougall-Shackleton, E A; MacDougall-Shackleton, S A; Ball, G F; Hahn, T P

    2003-09-01

    Stimulus-induced expression of the immediate early gene ZENK (egr-1) in the songbird's auditory forebrain presumably depends on the behavioral significance of the stimulus. Few studies, however, have quantified both the ZENK and behavioral responses to a stimulus in the same individuals. We played conspecific male song of either hatch (local) or foreign dialect to female white-crowned sparrows (Zonotrichia leucophrys oriantha) and quantified both the auditory ZENK response and their behavioral response, which is known to depend on dialect. Birds hearing hatch dialect showed greater ZENK induction in the caudomedial hyperstriatum ventrale and the dorsal portion of the caudomedial neostriatum than birds hearing foreign dialect, supporting previous work showing a relationship between ZENK and salience of the stimulus. In the dorsal portion of the caudomedial neostriatum, ZENK induction was correlated with the amount of non-vocal courtship behavior; however, in the caudomedial hyperstriatum ventrale, ZENK induction was more highly correlated with the females' own vocal behavior and thus may have been partly self-induced. Some females sang and showed a male-like pattern of ZENK induction in their song systems. This study provides the first evidence that the ZENK response in a sensory area to a social stimulus is proportional to the animal's preference for the stimulus. PMID:12879354

  20. Enhanced susceptibility to Leishmania infection in resistant mice in the absence of immediate early response gene X-1.

    PubMed

    Akilov, Oleg E; Ustyugova, Irina V; Zhi, Liang; Hasan, Tayyaba; Wu, Mei X

    2009-12-15

    Immediate early response gene X-1 (IEX-1) is a stress-inducible gene abundantly expressed in macrophages and T cells following various stimuli. To explore a potential role for IEX-1 in control of the susceptibility to Leishmania major infection, the inflammatory response during cutaneous leishmaniasis was evaluated in 129Sv/C57BL/6-resistant mice in the presence or absence of IEX-1. Null mutation of IEX-1 enhanced the susceptibility of the mice to L. major infection, and aggravated inflammatory responses in comparison with wild-type control mice. The excessive inflammation was not ascribed to a Th2-biased immune response or a defect in Th1 polarization, but rather to an elevated level of IL-17 production by both gammadelta T and CD4(+) cells, concomitant with an increase of the neutrophil recruitment early in the infection. The lack of IEX-1 also suppressed TNF-alpha production in both macrophages and T cells, resulting in a high intralesional load of parasites and delayed healing of the lesion, both of which were reversed by TNF-alpha treatment. These findings indicate the crucial role of IL-17 and TNF-alpha in determining the outcome of L. major infection beyond a balance between Th1- and Th2-mediated immune responses. PMID:19923449

  1. Fine-structure mapping and functional analysis of temperature-sensitive mutants in the gene encoding the herpes simplex virus type 1 immediate early protein VP175.

    PubMed Central

    Dixon, R A; Schaffer, P A

    1980-01-01

    Herpes simplex virus (HSV)-specific proteins fall into at least three kinetic classes whose synthesis is sequentially and coordinaely regulated. Temperature-sensitive (ts) mutants of one complementation group (1-2) are defective in the transition from immediate early to early and late protein synthesis. To elucidate the function of the 1-2 gene product in the HSV type 1 replicative cycle, nine ts mutants in this group were mapped by fine-structure analysis and characterized members of the group lie within the terminally repeated sequences of the S region of the genome. Fine-structure genetic and physical mapping permitted the mutations to be ordered within these sequences. Because it has been shown that the message for VP175 and the DNA template specifying this protein extend beyond the limits of the physical map of the mutations, it follows that the mutations must lie within the structural gene for VP175. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis showed that most members of the group overproduced the immediate early proteins VP175, -136, -110, and -63 and markedly underproduced early and late proteins at the nonpermissive temperature. In temperature shiftup experiments, it was fund that the synthesis of early and late proteins ceased, whereas the synthesis of immediate early proteins began again. Thus, it is postulated that VP175 is (i) involved in the transition from immediate early to early protein synthesis, (ii) requird continuously to maintain early protein synthesis, (iii) autoregulated, acting to inhibit immediate early protein synthesis. Images PMID:6255206

  2. Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4.

    PubMed Central

    DeLuca, N A; McCarthy, A M; Schaffer, P A

    1985-01-01

    Using Vero cells transformed with the wild-type gene for ICP4 as the permissive host cell, we isolated herpes simplex virus type 1 (HSV-1) mutants containing deletions in both copies of the ICP4 gene. The mutants, d120 and d202, contained deletions of 4.1 and 0.5 kilobases, respectively, in each copy of ICP4. ICP4 mRNA synthesized in d202-infected Vero cells was 0.5 kilobases smaller than that synthesized in cells infected with the wild-type virus. No ICP4 mRNA was detected in d120-infected Vero cells. d120 and d202 specified polypeptides that reacted with ICP4 antiserum and were smaller than the wild-type ICP4 polypeptide by 130 and 30 kilodaltons, respectively. The only other HSV-1 gene products detectable on infection of Vero cells with d120 and d202 were ICP6 (of the early kinetic class of HSV-1 polypeptides), ICP0 (immediate early), ICP22 (immediate early), and ICP27 (immediate early). Immediate-early polypeptides ICP0 and ICP27 were expressed to a higher level in Vero cells infected with an ICP4 temperature-sensitive (ts) mutant (tsB32) at 39 degrees C, indicating immediate-early stimulatory activity associated with the ts ICP4 polypeptide. In addition, the patterns of complementation of d120, d202, and tsB32 in ICP4-transformed cells also demonstrated inhibitory activity associated with the ts form of the ICP4 polypeptide. Images PMID:2997476

  3. Total C4B Deficiency Due to Gene Deletion and Gene Conversion in a Patient with Severe Infections

    PubMed Central

    Jaatinen, Taina; Lahti, Meri; Ruuskanen, Olli; Kinos, Riikka; Truedsson, Lennart; Lahesmaa, Riitta; Lokki, Marja-Liisa

    2003-01-01

    Deficiencies of the early components of the classical complement pathway impair the actions of innate and humoral immunity and may lead to increased susceptibility to infections. We have studied the genetic basis of total C4B deficiency in a Finnish patient with recurrent meningitis, chronic fistulas and abscesses. The maternal chromosome carried a four-gene deletion including the C4B gene, and a conversion from C4B to C4A gene was found on the paternal chromosome resulting in complete deficiency of C4B. In the converted C4A gene, mutation screening did not reveal any amino acid changes or prominent mutations, yet a large number of nucleotide variations were found. Further, the patient was heterozygous for structural deficiency of mannan binding lectin (MBL) associating with medium levels of serum MBL. Our data provides new information on the genetic instability of the C4 gene region, and on the association of homozygous C4B deficiency and variant MBL genotype with increased susceptibility to recurrent and chronic infections. Importantly, plasma therapy induced a prompt clinical cure with long-term effects. PMID:12626442

  4. Macrophage Inhibitory Cytokine-1 (MIC-1/GDF15) Gene Deletion Promotes Cancer Growth in TRAMP Prostate Cancer Prone Mice

    PubMed Central

    Husaini, Yasmin; Lockwood, Glen P.; Nguyen, Trung V.; Tsai, Vicky Wang-Wei; Mohammad, Mohammad G.; Russell, Pamela J.; Brown, David A.; Breit, Samuel N.

    2015-01-01

    The divergent TGF-? superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15), is overexpressed by most cancers, including prostate cancer (PCa). Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-). On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+). Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1) had metastases than TRAMPMIC+/+ mice (p<0.0001). We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread. PMID:25695521

  5. Use of the Meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes

    PubMed Central

    Fernández-Martínez, Lorena T.; Bibb, Mervyn J.

    2014-01-01

    The search for new natural products is leading to the isolation of novel actinomycete species, many of which will ultimately require genetic analysis. Some of these isolates will likely exhibit low intrinsic frequencies of homologous recombination and fail to sporulate under laboratory conditions, exacerbating the construction of targeted gene deletions and replacements in genetically uncharacterised strains. To facilitate the genetic manipulation of such species, we have developed an efficient method to generate gene or gene cluster deletions in actinomycetes by homologous recombination that does not introduce any other changes to the targeted organism's genome. We have synthesised a codon optimised I-SceI gene for expression in actinomycetes that results in the production of the yeast I-SceI homing endonuclease which produces double strand breaks at a unique introduced 18 base pair recognition sequence. Only those genomes that undergo homologous recombination survive, providing a powerful selection for recombinants, approximately half of which possess the desired mutant genotype. To demonstrate the efficacy and efficiency of the system, we deleted part of the gene cluster for the red-pigmented undecylprodiginine complex of compounds in Streptomyces coelicolor M1141. We believe that the system we have developed will be broadly applicable across a wide range of actinomycetes. PMID:25403842

  6. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E. [Center of Integrative Genomics, University of Lausanne, CH-1015 Lausanne (Switzerland); Desplanches, D. [Laboratoire de Physiologie integrative, Cellulaire et Moleculaire, UMR 5123 CNRS, Universite Claude Bernard Lyon 1, 69622 Villeurbanne (France); Pequignot, J. [Laboratoire de Physiologie integrative, Cellulaire et Moleculaire, UMR 5123 CNRS, Universite Claude Bernard Lyon 1, 69622 Villeurbanne (France); Bordier, B. [Center of Integrative Genomics, University of Lausanne, CH-1015 Lausanne (Switzerland); Desvergne, B. [Center of Integrative Genomics, University of Lausanne, CH-1015 Lausanne (Switzerland)]. E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  7. A new variant of self-excising ?-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa.

    PubMed

    Szewczyk, Edyta; Kasuga, Takao; Fan, Zhiliang

    2014-05-01

    In a previous study, we developed a cassette employing a bacterial ?-recombinase acting on six recognition sequences (?-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette. A tedious subsequent procedure was needed to purify homokaryons due to the lack of a negative selection after cassette eviction. Additionally, the endoxylanase xylP promoter from Penicillium chrysogenum used in the construct was not strongly regulated in N. crassa, which led to low efficiency in cassette eviction. Herein we report an improved variant of the self-excising ?-recombinase/six cassette for repetitive gene deletions in N. crassa using a native endoxylanase gh10-2 promoter from N. crassa, plus the introduction of a bidirectional selection marker to facilitate homokaryon selection using a thymidine kinase (tk) gene (negative selection) in addition to the phosphinothricin resistance gene (bar(r)) (positive selection). PMID:24556286

  8. An E1B19 kDa Gene Deletion Mutant Adenovirus Demonstrates Tumor Necrosis Factor-Enhanced Cancer Selectivity and Enhanced Oncolytic Potency

    Microsoft Academic Search

    Ta-Chiang Liu; Gunnel Hallden; Yaohe Wang; Gabriel Brooks; Jennelle Francis; Nick Lemoine; David Kirn

    2004-01-01

    Oncolytic adenoviruses hold promise as a new treatment platform for cancer, but limitations have been identified, including limited spread and potency. The adenoviral protein E1B-19 kDa is a Bcl-2 homologue that blocks apoptosis induction via the intrinsic and extrinsic pathways, specifically including tumor necrosis factor-mediated cell death. We demonstrate that an E1B-19 kDa gene deletion mutant had tumor necrosis factor-enhanced

  9. HSV-2 immediate-early protein US1 inhibits IFN-? production by suppressing association of IRF-3 with IFN-? promoter.

    PubMed

    Zhang, Mudan; Liu, Yalan; Wang, Ping; Guan, Xinmeng; He, Siyi; Luo, Sukun; Li, Chang; Hu, Kai; Jin, Wei; Du, Tao; Yan, Yan; Zhang, Zhenfeng; Zheng, Zhenhua; Wang, Hanzhong; Hu, Qinxue

    2015-04-01

    HSV-2 is the major cause of genital herpes, and its infection increases the risk of HIV-1 acquisition and transmission. After initial infection, HSV-2 can establish latency within the nervous system and thus maintains lifelong infection in humans. It has been suggested that HSV-2 can inhibit type I IFN signaling, but the underlying mechanism has yet to be determined. In this study, we demonstrate that productive HSV-2 infection suppresses Sendai virus (SeV) or polyinosinic-polycytidylic acid-induced IFN-? production. We further reveal that US1, an immediate-early protein of HSV-2, contributes to such suppression, showing that US1 inhibits IFN-? promoter activity and IFN-? production at both mRNA and protein levels, whereas US1 knockout significantly impairs such capability in the context of HSV-2 infection. US1 directly interacts with DNA binding domain of IRF-3, and such interaction suppresses the association of nuclear IRF-3 with the IRF-3 responsive domain of IFN-? promoter, resulting in the suppression of IFN-? promoter activation. Additional studies demonstrate that the 217-414 aa domain of US1 is critical for the suppression of IFN-? production. Our results indicate that HSV-2 US1 downmodulates IFN-? production by suppressing the association of IRF-3 with the IRF-3 responsive domain of IFN-? promoter. Our findings highlight the significance of HSV-2 US1 in inhibiting IFN-? production and provide insights into the molecular mechanism by which HSV-2 evades the host innate immunity, representing an unconventional strategy exploited by a dsDNA virus to interrupt type I IFN signaling pathway. PMID:25712217

  10. Cyr61, a product of a growth factor-inducible immediate-early gene, promotes cell proliferation, migration, and adhesion.

    PubMed Central

    Kireeva, M L; MO, F E; Yang, G P; Lau, L F

    1996-01-01

    cyr61 was first identified as a growth factor-inducible immediate-early gene in mouse fibroblasts. The encoded Cyr61 protein is a secreted, cystein-rich heparin-binding protein that associates with the cell surface and the extracellular matrix, and in these aspects it resembles the Wnt-1 protein and a number of known growth factors. During embryogenesis, cyr61 is expressed most notably in mesenchymal cells that are differentiating into chondrocytes and in the vessel walls of the developing circulatory system. cyr61 is a member of an emerging gene family that encodes growth regulators, including the connective tissue growth factor and an avian proto-oncoprotein, Nov cyr61 also shares sequence similarities with two Drosophila genes, twisted gastrulation and short gastrulation, which interact with decapentaplegic to regulate dorsal-ventral patterning. In this report we describe the purification of the Cyr61 protein in a biologically active form, and we show that purified Cyr61 has the following activities: (i) it promotes the attachment and spreading of endothelial cells in a manner similar to that of fibronectin; (ii) it enhances the effects of basic fibroblast growth factor and platelet-derived growth factor on the rate of DNA synthesis of fibroblasts and vascular endothelial cells, although it has no detectable mitogenic activity by itself; and (iii) it acts as a chemotactic factor for fibroblasts. Taken together, these activities indicate that Cyr61 is likely to function as an extracellular matrix signaling molecule rather than as a classical growth factor and may regulate processes of cell proliferation, migration, adhesion, and differentiation during development. PMID:8657105

  11. Disruption of PML-associated nuclear bodies mediated by the human cytomegalovirus major immediate early gene product.

    PubMed

    Wilkinson, G W; Kelly, C; Sinclair, J H; Rickards, C

    1998-05-01

    The PML gene product is associated with a defined nuclear structure (10-20 per cell) known variously as PML-bodies, ND10, PODs or Kr bodies. Certain conditions are known to compromise the integrity of PML-bodies; these include environmental stress (e.g. heat shock), a chromosomal translocation-associated acute promyelocytic leukaemia, and infection with certain viruses [including human cytomegalovirus (HCMV), herpes simplex virus type 1 and adenovirus]. Expression of the HCMV major immediate early (IE) protein (IE1(491aa)) is by itself sufficient to cause disruption of PML-bodies, resulting in the dispersal of the PML antigen uniformly throughout the nucleus. In uninfected cells undergoing mitosis PML is excluded from chromatin. However, both IE1(491aa) and PML were observed to associate with mitotic chromosomes in cells infected with HCMV or transfected with the IE1 gene. A series of in-frame IE1 deletion mutants was used in DNA transfection experiments to identify two large sequence elements (aa 132-274 and the C-terminal aa 347-491) not required for dispersal of the PML antigen. However, a putative leucine-zipper domain (aa 105-139), a putative zinc-finger domain (aa 267-286) and exon 2 and 3 coding sequences (aa 6-85) were required. The association of the IE1 gene product with chromatin required an acidic domain near the C terminus (aa 421-486). The interaction of IE1(491aa) with chromatin was therefore not required for the disruption of PML-bodies. Exon 2 (aa 1-24) was shown to encode a nuclear localization signal. PMID:9603339

  12. Experience affects immediate early gene expression in response to conspecific call notes in black-capped chickadees (Poecile atricapillus).

    PubMed

    Hahn, Allison H; Guillette, Lauren M; Lee, Daniel; McMillan, Neil; Hoang, John; Sturdy, Christopher B

    2015-07-01

    Black-capped chickadees (Poecile atricapillus) produce numerous vocalizations, including the acoustically complex chick-a-dee call that is composed of A, B, C, and D notes. D notes are longer in duration and lower in frequency than the other note types and contain information regarding flock and species identification. Adult wild-caught black-capped chickadees have been shown to have similar amounts of immediate early gene (IEG) expression following playback of vocalizations with harmonic-like acoustic structure, similar to D notes. Here we examined how different environmental experiences affect IEG response to conspecific D notes. We hand-reared black-capped chickadees under three conditions: (1) with adult conspecifics, (2) with adult heterospecific mountain chickadees, and (3) without adults. We presented all hand-reared birds and a control group of field-reared black-capped chickadees, with conspecific D notes and quantified IEG expression in the caudomedial mesopallium (CMM) and caudomedial nidopallium (NCM). We found that field-reared birds that heard normal D notes had a similar neural response as a group of field-reared birds that heard playback of reversed D notes. Field-reared birds that heard normal D notes also had a similar neural response as birds reared with adult conspecifics. Birds reared without adults had a significantly reduced IEG response, whereas the IEG expression in birds reared with heterospecifics was at intermediate levels between birds reared with conspecifics and birds reared without adults. Although acoustic characteristics have been shown to drive IEG expression, our results demonstrate that experience with adults or normal adult vocalizations is also an important factor. PMID:25813748

  13. Human Cytomegalovirus Major Immediate Early 1 Protein Targets Host Chromosomes by Docking to the Acidic Pocket on the Nucleosome Surface

    PubMed Central

    Mücke, Katrin; Paulus, Christina; Bernhardt, Katharina; Gerrer, Katrin; Schön, Kathrin; Fink, Alina; Sauer, Eva-Maria; Asbach-Nitzsche, Alexandra; Harwardt, Thomas; Kieninger, Bärbel; Kremer, Werner; Kalbitzer, Hans Robert

    2014-01-01

    The 72-kDa immediate early 1 (IE1) protein encoded by human cytomegalovirus (hCMV) is a nuclearly localized promiscuous regulator of viral and cellular transcription. IE1 has long been known to associate with host mitotic chromatin, yet the mechanisms underlying this interaction have not been specified. In this study, we identify the cellular chromosome receptor for IE1. We demonstrate that the viral protein targets human nucleosomes by directly binding to core histones in a nucleic acid-independent manner. IE1 exhibits two separable histone-interacting regions with differential binding specificities for H2A-H2B and H3-H4. The H2A-H2B binding region was mapped to an evolutionarily conserved 10-amino-acid motif within the chromatin-tethering domain (CTD) of IE1. Results from experimental approaches combined with molecular modeling indicate that the IE1 CTD adopts a ?-hairpin structure, docking with the acidic pocket formed by H2A-H2B on the nucleosome surface. IE1 binds to the acidic pocket in a way similar to that of the latency-associated nuclear antigen (LANA) of the Kaposi's sarcoma-associated herpesvirus. Consequently, the IE1 and LANA CTDs compete for binding to nucleosome cores and chromatin. Our work elucidates in detail how a key viral regulator is anchored to human chromosomes and identifies the nucleosomal acidic pocket as a joint target of proteins from distantly related viruses. Based on the striking similarities between the IE1 and LANA CTDs and the fact that nucleosome targeting by IE1 is dispensable for productive replication even in “clinical” strains of hCMV, we speculate that the two viral proteins may serve analogous functions during latency of their respective viruses. PMID:24227840

  14. The Product of Kaposi's Sarcoma-Associated Herpesvirus Immediate Early Gene K4.2 Regulates Immunoglobulin Secretion and Calcium Homeostasis by Interacting with and Inhibiting pERP1

    PubMed Central

    Wong, Lai-Yee; Brulois, Kevin; Toth, Zsolt; Inn, Kyung-Soo; Lee, Sun-Hwa; O'Brien, Kathryn; Lee, Hyera; Gao, Shou-Jiang; Cesarman, Ethel; Ensser, Armin

    2013-01-01

    Chaperones are proteins that assist the noncovalent folding and assembly of macromolecular polypeptide chains, ultimately preventing the formation of nonfunctional or potentially toxic protein aggregates. Plasma cell-induced-endoplasmic reticulum (ER)-resident protein 1 (pERP1) is a cellular chaperone that is preferentially expressed in marginal-zone B cells and is highly upregulated during plasma cell differentiation. While initially identified as a dedicated factor for the assembly of secreted IgM, pERP1 has since been implicated in suppressing calcium mobilization, and its expression is misregulated in multiple tumors. A number of herpesvirus immediate early gene products play important roles in the regulation of viral gene expression and/or evasion of host immune responses. Here, we report that the Kaposi's sarcoma-associated herpesvirus (KSHV) immediate early viral gene K4.2 encodes an endoplasmic reticulum-localized protein that interacts with and inhibits pERP1. Consequently, K4.2 expression interfered with immunoglobulin secretion by delaying the kinetics of immunoglobulin assembly and also led to increased responsiveness of B-cell receptor signal transduction by enhancing phosphotyrosine signals and intracellular calcium fluxes. Furthermore, K4.2 expression also appeared to contribute to maximal lytic replication by enhancing viral glycoprotein expression levels and ultimately promoting infectious-virus production. Finally, immunohistochemistry analysis showed that pERP1 expression was readily detected in KSHV-positive cells from multicentric Castleman's disease (MCD) and Kaposi's sarcoma (KS) lesions, suggesting that pERP1 may have potential roles in the KSHV life cycle and malignancy. In conclusion, our data suggest that K4.2 participates in lytic replication by enhancing calcium flux and viral glycoprotein expression, but also by interfering with immunoglobulin assembly to potentially dampen the adaptive immune response. PMID:23986581

  15. Immunogenicity and protective efficacy of a gE, gG and US2 gene-deleted bovine herpesvirus-1 (BHV-1) vaccine.

    PubMed

    Belknap, E B; Walters, L M; Kelling, C; Ayers, V K; Norris, J; McMillen, J; Hayhow, C; Cochran, M; Reddy, D N; Wright, J; Collins, J K

    1999-05-01

    The efficacy and safety of a gene-deleted bovine herpesvirus-1 (BHV-1) vaccine was determined in a bovine herpesvirus challenge trial in calves. Three different doses of the vaccine were administered intramuscularly at 10(5), 10(6) and 10(7) PFU/ml and compared to a commercial vaccine and non vaccinated control calves. Challenge was performed by intranasal aerosolization with the Cooper strain of BHV-1 (3 x 10(4) PFU/ml). The non-vaccinated calves shed significantly (P < 0.05) more virus than all other groups on days 4, 8 and 10 post challenge. By day 14 post challenge, antibody titers for BHV-1 of calves vaccinated with 10(7) PFU/ml were significantly (P < 0.05) higher than the commercial or non-vaccinated calves. Clinical scores of non-vaccinated calves were significantly (P < 0.05) higher than all other groups on days 4-14 post challenge. With both radioimmunoprecipitation and competitive enzyme-linked immunosorbent assays (C-ELISA), calves in the gene-deleted vaccine groups mounted comparable specific responses against gB, gC and gD post vaccination as calves in the commercial vaccine group, but in a dose dependent manner. These data suggest that the gene-deleted BHV-1 vaccine tested may be used as an effective vaccine in controlling BHV-1 infections. PMID:10403598

  16. Ets-2 Repressor Factor (ERF) mediates repression of the human cytomegalovirus major immediate-early promoter in undifferentiated non-permissive cells.

    PubMed

    Bain, Mark; Mendelson, Marc; Sinclair, John

    2003-01-01

    The repression of human cytomegalovirus immediate-early (IE) lytic gene expression is crucial for the maintenance of the latent viral state. By using conditionally permissive cell lines, which provide a good model for the differentiation state-dependent repression of IE gene expression, we have identified several cellular factors that bind to the major immediate-early promoter (MIEP) and whose expression is down-regulated after differentiation to a permissive phenotype. Here we show that the cellular protein Ets-2 Repressor Factor (ERF) physically interacts with the MIEP and represses MIEP activity in undifferentiated non-permissive T2 embryonal carcinoma cells. This factor binds to the dyad element and the 21 bp repeats within the MIEP - regions known to be important for the negative regulation of MIEP activity. Finally, we show that following differentiation to a permissive phenotype ERF's repressive effects are severely abrogated. PMID:12533699

  17. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice

    PubMed Central

    Esteva-Font, Cristina; Jin, Byung-Ju; Verkman, A. S.

    2014-01-01

    Aquaporin 1 (AQP1) is a plasma membrane water-transporting protein expressed strongly in tumor microvascular endothelia. We previously reported impaired angiogenesis in implanted tumors in AQP1-deficient mice and reduced migration of AQP1-deficient endothelial cells in vitro. Here, we investigated the consequences of AQP1 deficiency in mice that spontaneously develop well-differentiated, luminal-type breast adenomas with lung metastases [mouse mammary tumor virus-driven polyoma virus middle T oncogene (MMTV-PyVT)]. AQP1+/+ MMTV-PyVT mice developed large breast tumors with total tumor mass 3.5 ± 0.5 g and volume 265 ± 36 mm3 (se, 11 mice) at age 98 d. Tumor mass (1.6±0.2 g) and volume (131±15 mm3, 12 mice) were greatly reduced in AQP1?/? MMTV-PyVT mice (P<0.005). CD31 immunofluorescence showed abnormal microvascular anatomy in tumors of AQP1?/? MMTV-PyVT mice, with reduced vessel density. HIF-1? expression was increased in tumors in AQP1?/? MMTV-PyVT mice. The number of lung metastases (5±1/mouse) was much lower than in AQP1+/+ MMTV-PyVT mice (31±8/mouse, P<0.005). These results implicate AQP1 as an important determinant of tumor angiogenesis and, hence, as a potential drug target for adjuvant therapy of solid tumors.—Esteva-Font, C., Jin, B.-J., Verkman, A. S. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice. PMID:24334548

  18. ICP27 immediate early gene, glycoprotein K (gK) and DNA helicase homologues of infectious laryngotracheitis virus (gallid herpesvirus 1) SA2 strain

    Microsoft Academic Search

    M. A. Johnson; C. T. Prideaux; K. Kongsuwan; S. G. Tyack; M. Sheppard

    1995-01-01

    Summary A 4.8 kilobase segment located at the left-terminal in the unique long (UL) region of infectious laryngotracheitis virus (ILTV) SA-2 strain contained three open reading frames (ORFs). The first of 421 amino acids (aa) was located at map units 0.065 to 0.07, and its predicted 48 kiloDaltons (kDa) protein product has significant homology to the immediate early regulatory protein

  19. Leukemia inhibitory factor and interleukin-6 trigger the same immediate early response, including tyrosine phosphorylation, upon induction of myeloid leukemia differentiation.

    PubMed Central

    Lord, K A; Abdollahi, A; Thomas, S M; DeMarco, M; Brugge, J S; Hoffman-Liebermann, B; Liebermann, D A

    1991-01-01

    Leukemia inhibitory factor (LIF) and interleukin-6 (IL-6), two multifunctional cytokines lacking structural homology and binding to distinct receptors, share interesting functional similarities, which include induction of hematopoietic differentiation in normal and myeloid leukemia cells, induction of neuronal cell differentiation, and stimulation of acute-phase protein synthesis in hepatocytes. Structural information on the LIF receptor is not yet available, whereas recent cloning of the IL-6 receptor has shown it to be bipartite, with a signal-transducing subunit that lacks sequence homology to known protein kinases and produces second messengers of unknown nature. The molecular nature of the mechanisms which LIF and IL-6 use to induce cell differentiation is not known. To address this issue, we took advantage of a clone of M1 myeloblastic leukemia cells capable of being induced for terminal differentiation by both LIF and IL-6 directly activate the same set of immediate early response genes upon induction of M1 myeloid differentiation. At least two mechanisms of gene activation, one transcriptional and the other posttranscriptional, are shown to be involved. It is also shown that the LIF and IL-6 immediate early response, at suboptimal cytokine concentrations, is additive. Using a variety of protein kinase activators and inhibitors, we have shown that the intracellular signalling pathways for both LIF and IL-6 are distinct from those of known second messengers and involve protein phosphorylation, notably tyrosine phosphorylation of a 160-kDa protein, as an essential step(s) in the immediate early activation of MyD gene expression. These observations indicate that the functional similarities of LIF and IL-6 as inducers of cell differentiation prevail at the level of the complex differentiation immediate early response and implicate common mechanisms of signal transduction for LIF- and IL-6-induced differentiation. Images PMID:1908551

  20. Expression of immediate early genes in the hippocampal formation of the black-capped chickadee ( Poecile atricapillus) during a food-hoarding task

    Microsoft Academic Search

    Tom V. Smulders; Timothy J. Devoogd

    2000-01-01

    Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal

  1. Differential effects of vocalization type, singer and listener on ZENK immediate early gene response in black-capped chickadees ( Poecile atricapillus)

    Microsoft Academic Search

    M. T. Avey; R. A. Kanyo; E. L. Irwin; C. B. Sturdy

    2008-01-01

    Here we examined immediate early gene (ZENK) induction to vocalizations in the ascending auditory pathway of black-capped chickadees (Poecile atricapillus) to assess the impact that the sex of the producer and perceiver has on ZENK induction. We manipulated the playback by both the vocal type (song\\/call) and sex of producer (male\\/female), and then presented these stimuli classes to either male

  2. Caffeine mimics the effect of a dopamine D 2 3 receptor agonist on the expression of immediate early genes in globus pallidus

    Microsoft Academic Search

    Per Svenningsson; Bertil B. Fredholm

    1997-01-01

    In order to evaluate the effect of caffeine on striatopallidal neurons we used in situ hybridization to examine the mRNA expression of the immediate early genes (IEGs), c-fos, fos B, c-jun, jun B, NGFI-A and NGFI-B in globus pallidus in rats given single or repeated administration of caffeine. A significant induction of c-fos mRNA, but not of any of the

  3. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene.

    PubMed Central

    Nelson, J A; Reynolds-Kohler, C; Smith, B A

    1987-01-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three- to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negative modulates expression in nonpermissive cells but positively influences expression in permissive cells. Images PMID:2828927

  4. Regulation of a human cytomegalovirus immediate-early gene (US3) by a silencer-enhancer combination.

    PubMed Central

    Thrower, A R; Bullock, G C; Bissell, J E; Stinski, M F

    1996-01-01

    The US3 open reading frame of human cytomegalovirus (HCMV) is transcribed at immediate-early (IE) times after infection. Upstream of the US3 promoter, between -84 and -259 bp relative to the transcription start site, there are five copies of an 18-bp repeat, referred to as 5R2. Between -340 and -560 bp there are seven copies of a 10-bp dyad repeat, referred to as 7R1. We investigated the roles of these repeats in transcription from the US3 promoter in human foreskin fibroblast or HeLa cells. In transient transfection assays, the region containing 5R2 up-regulated transcription and was responsive to the p65 subunit of NF-kappa B. The DNA region containing 7R1 down-regulated transcription from either the US3 promoter or a heterologous promoter in a position- and orientation-independent manner. Mutational analysis and transient transfections indicated that DNA containing the 10-bp dyad or one-half of the dyad was sufficient to cause repression of downstream gene expression. DNA probes containing one or more copies of the pentanucleotide sequence TGTCG specifically bound cellular proteins, as demonstrated by electrophoretic mobility shift assays and cold-competition electrophoretic mobility shift assays. Two different DNA-protein complexes were detected with DNA probes containing one or two copies of the pentanucleotide. In HCMV-infected cell nuclear extracts, one of the DNA-protein complexes was present in amounts inversely proportional to the amount of US3 transcription. Its formation was affected by dephosphorylation of the DNA-binding protein(s). Transient dephosphorylation of the cellular repressor protein may occur during HCMV infection. Repression of US3 transcription may relate to the number of pentanucleotides and the cellular proteins that bind to it. Twenty-one copies of a TRTCG motif (R = purine) were found clustered upstream of the US3 gene and also in the modulator upstream of the HCMV IE1 and IE2 genes. PMID:8523597

  5. CCR2 Gene Deletion and Pharmacologic Blockade Ameliorate a Severe Murine Experimental Autoimmune Neuritis Model of Guillain-Barré Syndrome

    PubMed Central

    Yuan, Furong; Yosef, Nejla; Lakshmana Reddy, Chetan; Huang, Ailing; Chiang, Sharon C.; Tithi, Hafiza Rahman; Ubogu, Eroboghene E.

    2014-01-01

    The molecular determinants and signaling pathways responsible for hematogenous leukocyte trafficking during peripheral neuroinflammation are incompletely elucidated. Chemokine ligand/receptor pair CCL2/CCR2 has been pathogenically implicated in the acute inflammatory demyelinating polyradiculoneuropathy variant of Guillain-Barré syndrome (GBS). We evaluated the role of CCR2 in peripheral neuroinflammation utilizing a severe murine experimental autoimmune neuritis (sm-EAN) model. Sm-EAN was induced in 8–12 week old female SJL CCR2 knockout (CCR2KO), heterozygote (CCR2HT) and wild type (CCR2WT) mice, and daily neuromuscular severity scores and weights recorded. In vitro and in vivo splenocyte proliferation and cytokine expression assays, and sciatic nerve Toll-like receptor (TLR) 2, TLR4 and CCL2 expression assays were performed to evaluate systemic and local innate immune activation at disease onset. Motor nerve electrophysiology and sciatic nerve histology were also performed to characterize the inflammatory neuropathy at expected peak severity. To further determine the functional relevance of CCR2 in sm-EAN, 20 mg/kg CCR2 antagonist, RS 102895 was administered daily for 5 days to a cohort of CCR2WT mice following sm-EAN disease onset, with efficacy compared to 400 mg/kg human intravenous immunoglobulin (IVIg). CCR2KO mice were relatively resistant to sm-EAN compared to CCR2WT and CCR2HT mice, associated with attenuated peripheral nerve demyelinating neuritis. Partial CCR2 gene deletion did not confer any protection against sm-EAN. CCR2KO mice demonstrated similar splenocyte activation or proliferation profiles, as well as TLR2, TLR4 and CCL2 expression to CCR2WT or CCR2HT mice, implying a direct role for CCR2 in sm-EAN pathogenesis. CCR2 signaling blockade resulted in rapid, near complete recovery from sm-EAN following disease onset. RS 102895 was significantly more efficacious than IVIg. CCR2 mediates pathogenic hematogenous monocyte trafficking into peripheral nerves, with consequential demyelination in sm-EAN. CCR2 is amenable to pharmacologic blockade, making it a plausible drug target for GBS. PMID:24632828

  6. Na+ dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    PubMed Central

    Christensen, Henriette L.; Nguyen, An T.; Pedersen, Fredrik D.; Damkier, Helle H.

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na+ dependent Cl?/HCO3? exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na+:HCO3? cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na+:HCO3? cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na+/H+ exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed. PMID:24155723

  7. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides

    PubMed Central

    2014-01-01

    Background Rhodosporidium toruloides is a ?-carotenoid accumulating, oleaginous yeast that has great biotechnological potential. The lack of reliable and efficient genetic manipulation tools have been a major hurdle blocking its adoption as a biotechnology platform. Results We report for the first time the development of a highly efficient targeted gene deletion method in R. toruloides ATCC 10657 via Agrobacterium tumefaciens-mediated transformation. To further improve targeting frequency, the KU70 and KU80 homologs in R. toruloides were isolated and characterized in detail. A KU70-deficient mutant (?ku70e) generated with the hygromycin selection cassette removed by the Cre-loxP recombination system showed a dramatically improved targeted gene deletion frequency, with over 90% of the transformants being true knockouts when homology sequence length of at least 1 kb was used. Successful gene targeting could be made with homologous flanking sequences as short as 100 bp in the ?ku70e strain. KU70 deficiency did not perturb cell growth although an elevated sensitivity to DNA mutagenic agents was observed. Compared to the other well-known oleaginous yeast, Yarrowia lipolytica, R. toruloides KU70/KU80 genes contain much higher density of introns and are the most GC-rich KU70/KU80 genes reported. Conclusions The KU70-deficient mutant generated herein was effective in improving gene deletion frequency and allowed shorter homology sequences to be used for gene targeting. It retained the key oleaginous and fast growing features of R. toruloides. The strain should facilitate both fundamental and applied studies in this important yeast, with the approaches taken here likely to be applicable in other species in subphylum Pucciniomycotina. PMID:25188820

  8. Autorepression of the Human Cytomegalovirus Major Immediate-Early Promoter\\/Enhancer at Late Times of Infection Is Mediated by the Recruitment of Chromatin Remodeling Enzymes by IE86

    Microsoft Academic Search

    Matthew Reeves; Jane Murphy; Richard Greaves; Jennifer Fairley; Alex Brehm; John Sinclair

    2006-01-01

    The human cytomegalovirus major immediate-early protein IE86 is pivotal for coordinated regulation of viral gene expression throughout infection. A relatively promiscuous transactivator of viral early and late gene transcription, IE86 also acts during infection to negatively regulate its own promoter via direct binding to a 14-bp palindromic IE86-binding site, the cis repression sequence (crs), located between the major immediate- early

  9. Identification of kakusei, a Nuclear Non-Coding RNA, as an Immediate Early Gene from the Honeybee, and Its Application for Neuroethological Study

    PubMed Central

    Kiya, Taketoshi; Ugajin, Atsushi; Kunieda, Takekazu; Kubo, Takeo

    2012-01-01

    The honeybee is a social insect that exhibits various social behaviors. To elucidate the neural basis of honeybee behavior, we detected neural activity in freely-moving honeybee workers using an immediate early gene (IEG) that is expressed in a neural activity-dependent manner. In European honeybees (Apis mellifera), we identified a novel nuclear non-coding RNA, termed kakusei, as the first insect IEG, and revealed the neural activity pattern in foragers. In addition, we isolated a homologue of kakusei, termed Acks, from the Japanese honeybee (Apis cerana), and detected active neurons in workers fighting with the giant hornet. PMID:23443077

  10. Construction of brewing-wine Aspergillus oryzae pyrG- mutant by pyrG gene deletion and its application in homology transformation.

    PubMed

    Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen

    2014-06-01

    pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ?pyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the ?xdh mutant was three times as much as that of the ?pyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae. PMID:24742431

  11. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    SciTech Connect

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil K.; Qian, Weijun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-09-25

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and ?alg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  12. Label-free luminescent detection of LMP1 gene deletion using an intermolecular G-quadruplex-based switch-on probe.

    PubMed

    Wang, Modi; He, Bingyong; Lu, Lihua; Leung, Chung-Hang; Mergny, Jean-Louis; Ma, Dik-Lung

    2015-08-15

    We have synthesized a series of luminescent iridium(III) complexes and investigated their ability to act as luminescent split G-quadruplex probes. After screening, the iridium(III) complex 1 [Ir(2-phenylquinoline)2(3,4,7,8-tetramethyl-1,10-phenanthroline)]PF6 was validated as a highly-selective G-quadruplex probe and was utilized to construct a label-free intermolecular G-quadruplex-based assay for the selective and sensitive detection of LMP1 gene deletion. This "mix-and-detect" assay is simple and selective, and could detect down to 10nM of the target gene in aqueous solution with a linear range from 10 to 500nM. We also investigated the performance of our split G-quadruplex-based sensing platform for LMP1 gene deletion in the presence of cellular debris, demonstrating the robustness of this sensing system in biological samples. Comparative assays were also performed using either organic dyes or labeled oligonucleotides as signal-transducing agents. PMID:25840020

  13. A nanoparticle-assisted PCR assay to improve the sensitivity for rapid detection and differentiation of wild-type pseudorabies virus and gene-deleted vaccine strains.

    PubMed

    Ma, Xingjie; Cui, Yuchao; Qiu, Zheng; Zhang, Bingkun; Cui, Shangjin

    2013-11-01

    Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the rapid amplification of DNA and has been adopted for the detection of virus because of its simplicity, rapidity, and specificity. A nanoPCR assay was developed to detect and differentiate wild-type and gene-deleted pseudorabies virus (PRV). Three pairs of primers for nanoPCR developed in this study were selected from conserved regions of PRV, producing specific amplicons of 431 bp (gB), 316 bp (gE), and 202 bp (gG). The sensitivity of this assay using purified plasmid constructs containing the specific gene fragments was 100-1000 fold higher than conventional PCR. The PRV nanoPCR assay did not amplify porcine parvovirus, porcine circovirus type 2, porcine reproductive and respiratory syndrome virus, porcine teschovirus, or African swine fever virus but produced three bands of expected size with PRV and two bands of expected size with the gene-deleted PRV-Bartha-K61. Of 110 clinical samples collected from seven provinces in China, 53% and 48% were positive for wild-type PRV according to the nanoPCR assay and virus isolation, respectively. PMID:23872268

  14. Ets-2 repressor factor recruits histone deacetylase to silence human cytomegalovirus immediate-early gene expression in non-permissive cells.

    PubMed

    Wright, Edward; Bain, Mark; Teague, Linda; Murphy, Jane; Sinclair, John

    2005-03-01

    Previous work from this laboratory has shown that expression of human cytomegalovirus (HCMV) immediate-early (IE) genes from the major immediate-early promoter (MIEP) is likely to be regulated by chromatin remodelling around the promoter affecting the acetylation state of core histone tails. The HCMV MIEP contains sequences that bind cellular transcription factors responsible for its negative regulation in undifferentiated, non-permissive cells. Ets-2 repressor factor (ERF) is one such factor that binds to such sequences and represses IE gene expression. Although it is not known how cellular transcription factors such as ERF mediate transcriptional repression of the MIEP, it is likely to involve differentiation-specific co-factors. In this study, the mechanism by which ERF represses HCMV IE gene expression was analysed. ERF physically interacts with the histone deacetylase, HDAC1, both in vitro and in vivo and this physical interaction between ERF and HDAC1 mediates repression of the MIEP. This suggests that silencing of viral IE gene expression, associated with histone deacetylation events around the MIEP, is mediated by differentiation-dependent cellular factors such as ERF, which specifically recruit chromatin remodellers to the MIEP in non-permissive cells. PMID:15722512

  15. Differential expression of the immediate early genes FOS and ZENK following auditory stimulation in the juvenile male and female zebra finch.

    PubMed

    Bailey, David J; Wade, Juli

    2003-08-19

    The brains of adult zebra finches (Taeniopygia guttata) are tuned to the songs of conspecifics. In adult males, the caudomedial neostriatum (NCM) responds to zebra finch song, and in adult females the NCM and hippocampus (HP) are active following exposure to zebra finch song more than other auditory stimuli. The caudal hyperstriatum ventrale (cHV) in both sexes also responds to song, but in females not as selectively as the NCM and HP. While much is known about the adult perceptual circuit, less is known about its development. The present study exposed d30 male and female zebra finches to conspecific or heterospecific song, tones or silence, and examined the densities of FOS- and ZENK-immunoreactive nuclei in the NCM, cHV and HP. Significant interactions existed between sex and auditory stimulus condition for both immediate early genes, but they were in opposite directions. That is, across the three regions, FOS-immunoreactive neurons were increased in females following presentation of conspecific songs; males did not show an effect of stimulus exposure. In contrast, the density of ZENK-positive neurons was increased in males, but not females, following zebra finch song exposure. The FOS results demonstrate that some neural responses required for song perception may develop earlier in females than males; data on ZENK induction suggest the opposite. Overall, differences in juvenile immediate early gene activation suggest either that males and females employ divergent neural mechanisms for song perception or that the developmental trajectories leading to common neural responses differ. PMID:12941470

  16. The immediate-early enhancer element of herpes simplex virus type 1 can replace a regulatory region of the c-Ha-ras1 oncogene required for transformation.

    PubMed Central

    Puga, A; Gomez-Marquez, J; Brayton, P R; Cantin, E M; Long, L K; Barbacid, M; Notkins, A L

    1985-01-01

    A 0.8-kilobase SacI DNA fragment in the distal 5'-noncoding region of the c-Ha-ras1 oncogene hybridized to high guanine X cytosine sites of herpes simplex virus type 1 (HSV-1) DNA restriction fragments. Nucleotide sequence comparisons localized one of these sites to the intergenic region of HSV between the immediate-early genes coding for IEmRNA-3 and IEmRNA-4/5 that has enhancer-type activity. We tested the possibility that the HSV-1 enhancer and the upstream c-Ha-ras1 SacI fragment were functionally related by assaying for the capacity of recombinant plasmids in which the HSV-1 enhancer replaced the oncogene 0.8-kilobase SacI fragment to transform NIH/3T3 cells. Deletion of the 0.8-kilobase SacI fragment abolished the biological activity of c-Ha-ras1, but its replacement by the HSV-1 enhancer fully restored it. These results confirm the enhancer properties of the HSV-1 immediate-early intergenic region and suggest that c-Ha-ras1 sequences contained within the 0.8-kilobase SacI fragment plays a role in the transcriptional activation of the oncogene. PMID:2987541

  17. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing [Expression Engineering Group, Bioprocessing Technology Institute, 20 Biopolis Way, 06-01 Centros, Singapore 138668 (Singapore); Klase, Zachary [Department of Biochemistry and Molecular Biology, George Washington University School of Medicine, Washington, DC 20037 (United States); Gao Xiaoqi; Caldwell, Jeremy S. [Genomics Institute of the Novartis Research Foundation, 10675 John Jay Hopkins Drive, San Diego, CA 92121 (United States); Stinski, Mark F. [Department of Microbiology, Carver College of Medicine, University of Iowa, Iowa City, IA 52242 (United States); Kashanchi, Fatah [Department of Biochemistry and Molecular Biology, George Washington University School of Medicine, Washington, DC 20037 (United States); Chao, S.-H. [Expression Engineering Group, Bioprocessing Technology Institute, 20 Biopolis Way, 06-01 Centros, Singapore 138668 (Singapore)], E-mail: jimmy_chao@bti.a-star.edu.sg

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein and a repressor of the UL127 promoter, while SATB1 has no effect on UL127 expression. Since CDP is known as a transcription repressor and a nuclear matrix-associated region binding protein, CDP may have a role in the regulation of human CMV transcription.

  18. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes.

    PubMed

    Lee, Jialing; Klase, Zachary; Gao, Xiaoqi; Caldwell, Jeremy S; Stinski, Mark F; Kashanchi, Fatah; Chao, Sheng-Hao

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein and a repressor of the UL127 promoter, while SATB1 has no effect on UL127 expression. Since CDP is known as a transcription repressor and a nuclear matrix-associated region binding protein, CDP may have a role in the regulation of human CMV transcription. PMID:17512569

  19. An E1B-19 kDa gene deletion mutant adenovirus demonstrates tumor necrosis factor-enhanced cancer selectivity and enhanced oncolytic potency.

    PubMed

    Liu, Ta-Chiang; Hallden, Gunnel; Wang, Yaohe; Brooks, Gabriel; Francis, Jennelle; Lemoine, Nick; Kirn, David

    2004-06-01

    Oncolytic adenoviruses hold promise as a new treatment platform for cancer, but limitations have been identified, including limited spread and potency. The adenoviral protein E1B-19 kDa is a Bcl-2 homologue that blocks apoptosis induction via the intrinsic and extrinsic pathways, specifically including tumor necrosis factor-mediated cell death. We demonstrate that an E1B-19 kDa gene deletion mutant had tumor necrosis factor-enhanced cancer selectivity, in vitro and in vivo, due to genetic blocks in apoptosis pathways in cancer cells. In addition, this mutant demonstrated significantly enhanced viral spread and antitumoral potency relative to dl1520 (aka Onyx-015) and wild-type adenovirus in vitro. Significant antitumoral efficacy was demonstrated in vivo by intratumoral and intravenous routes of administration. E1B-19 kDa deletion should be considered as a feature of oncolytic adenoviruses to enhance their safety, spread, and efficacy. PMID:15194046

  20. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression. PMID:24741094

  1. Potentially harmful advantage to athletes: a putative connection between UGT2B17 gene deletion polymorphism and renal disorders with prolonged use of anabolic androgenic steroids

    PubMed Central

    2010-01-01

    Background and objective With prolonged use of anabolic androgenic steroids (AAS), occasional incidents of renal disorders have been observed. Independently, it has also been established that there are considerable inter-individual and inter-ethnic differences, in particular with reference to the uridine diphosphate-glucuronosyltransferase 2B17 (UGT2B17) gene, in metabolising these compounds. This report postulates the association of deletion polymorphism in the UGT2B17 gene with the occurrence of renal disorders on chronic exposure to AAS. Presentation of the hypothesis The major deactivation and elimination pathway of AASs is through glucuronide conjugation, chiefly catalyzed by the UGT2B17 enzyme, followed by excretion in urine. Excretion of steroids is affected in individuals with a deletion mutation in the UGT2B17 gene. We hypothesize that UGT2B17 deficient individuals are more vulnerable to developing renal disorders with prolonged use of AAS owing to increases in body mass index and possible direct toxic effects of steroids on the kidneys. Elevated serum levels of biologically active steroids due to inadequate elimination can lead to prolonged muscle build up. An increase in body mass index may cause renal injuries due to sustained elevated glomerular pressure and flow rate. Testing the hypothesis In the absence of controlled clinical trials in humans, observational studies can be carried out. Real time PCR with allelic discrimination should be employed to examine the prevalence of different UGT2B17 genotypes in patients with impaired renal function and AAS abuse. In individuals with the UGT2B17 deletion polymorphism, blood tests, biofluid analyses, urinalysis, and hair analyses following the administration of an anabolic steroid can be used to determine the fate of the substance once in the body. Implications of the hypothesis If the hypothesis is upheld, anabolic steroid users with a deletion mutation in the UGT2B17 gene may be exposed to an increased risk of developing renal disorders. In the current detecting - sanctioning anti-doping system, athletes motivated by the potential to evade detection owing to their unique genetic make-up could subject themselves to a serious health consequence. More research on AAS metabolism in the presence of UGT2B17 gene deletion is required. Benefit - harm evaluations in therapeutic use of anabolic steroids should also consider this potential link between UGT2B17 gene deletion polymorphism and renal disorders. PMID:20429943

  2. Barrier-to-Autointegration Factor 1 (BAF/BANF1) Promotes Association of the SETD1A Histone Methyltransferase with Herpes Simplex Virus Immediate-Early Gene Promoters

    PubMed Central

    Oh, Hyung Suk; Traktman, Paula

    2015-01-01

    ABSTRACT We have shown previously that A-type lamins and intranuclear localization of the herpes simplex virus (HSV) genome are critical for the formation of the VP16 activator complex on HSV immediate-early (IE) gene promoters in murine cells, which implies a critical role for lamin A and its associated proteins in HSV gene expression. Because barrier-to-autointegration factor 1 (BAF/BANF1) has been thought to bridge chromosomes to the nuclear lamina, we hypothesized that BAF might mediate viral genome targeting to the nuclear lamina. We found that overexpression of BAF enhances HSV-1 replication and knockdown of BAF decreases HSV gene expression, delays the kinetics of viral early replication compartment formation, and reduces viral yield compared to those in control small interfering RNA-transfected cells. However, BAF depletion did not affect genome complex targeting to the nuclear periphery. Instead, we found that the levels of a histone-modifying enzyme, SETD1A methyltransferase, and histone H3 lysine 4 trimethylation were reduced on IE and early (E) gene promoters in BAF-depleted cells during HSV lytic infection. Our results demonstrate a novel function of BAF as an epigenetic regulator of HSV lytic infection. We hypothesize that BAF facilitates IE and E gene expression by recruiting the SETD1A methyltransferase to viral IE and E gene promoters. PMID:26015494

  3. Recognition by and in vitro induction of cytotoxic T lymphocytes against predicted epitopes of the immediate-early protein ICP27 of herpes simplex virus.

    PubMed Central

    Banks, T A; Nair, S; Rouse, B T

    1993-01-01

    The identification of herpes simplex virus type 1 (HSV-1) proteins and the minimal epitopes within these proteins which serve as targets for cytotoxic T lymphocytes (CTL) remains an important goal for the development of effective vaccine strategies. In this report, an H-2Kd allele-specific peptide-binding motif was used to locate putative CTL epitopes in the HSV-1 immediate-early protein ICP27, a protein previously identified as a major CTL target in the BALB/c mouse. Peptides 1 (amino acids 322 to 332) and 2 (amino acids 448 to 456) synthesized to represent two separate predicted CTL epitopes in ICP27 were able to sensitize target cells in vitro for recognition by HSV-1-specific CTL. Moreover, using a recently developed system to generate primary CTL responses in vitro, both peptides induced primary CTL which reacted with target cells expressing HSV-1. This system allowed us to verify the activity of two CTL epitopes in the ICP27 protein and holds promise as a rapid way of identifying immunogenic peptides from any protein molecule. PMID:7677961

  4. A Baculovirus Immediate-Early Gene, ie1, Promoter Drives Efficient Expression of a Transgene in Both Drosophila melanogaster and Bombyx mori

    PubMed Central

    Masumoto, Mika; Ohde, Takahiro; Shiomi, Kunihiro; Yaginuma, Toshinobu; Niimi, Teruyuki

    2012-01-01

    Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV) could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively); however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole) in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species. PMID:23152896

  5. Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)

    NASA Astrophysics Data System (ADS)

    Sayaka, Shimomura-Umemura; Ijiri, Kenichi

    2006-01-01

    Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

  6. Presentation of noise during acute restraint stress attenuates expression of immediate early genes and arginine vasopressin in the hypothalamic paraventricular nucleus but not corticosterone secretion in rats.

    PubMed

    Sugimoto, Koji; Ohmomo, Hideki; Shutoh, Fumihiro; Nogami, Haruo; Hisano, Setsuji

    2015-07-01

    The present study investigated the effect of acoustic stimulation on the activation of the hypothalamic-pituitary-adrenal (HPA) axis in rats submitted to acute restraint stress, through semi-quantitative histochemical analysis of expression of immediate early gene products (c-Fos, JunB and phosphorylated c-Jun) and arginine vasopressin (AVP) hnRNA in the paraventricular nucleus (PVN). Simultaneous presentation of white or pink noise with restraint resulted in a significant attenuation of stress-induced c-Fos and JunB expression in the dorsal body of dorsal medial parvicellular subdivision (mpdd) of the PVN, as compared with restraint without noise. However, this presentation did not change phosphorylation of c-Jun and the plasma corticosterone level. Moreover, white noise presentation during restraint led to a reduction in the number of c-Fos- or JunB-expressing corticotropin-releasing hormone (CRH) neurons and the number of neurons expressing AVP hnRNA in the mpdd. Dual-histochemical labeling revealed co-expression of c-Fos and JunB, as well as JunB and AVP hnRNA in mpdd neurons. These data suggest that acoustic stimuli have an attenuation effect on the restraint-induced activation of neuroendocrine CRH neurons, resulting in the reduction in AVP production as an adaptation of HPA axis to repeated stress. PMID:25496933

  7. Herpes Simplex Virus Immediate-Early ICP0 Protein Inhibits Toll-Like Receptor 2-Dependent Inflammatory Responses and NF-?B Signaling ?

    PubMed Central

    van Lint, Allison L.; Murawski, Matthew R.; Goodbody, Rory E.; Severa, Martina; Fitzgerald, Katherine A.; Finberg, Robert W.; Knipe, David M.; Kurt-Jones, Evelyn A.

    2010-01-01

    The discovery of the Toll-like receptors (TLRs) and their importance in the regulation of host responses to infection raised attention to the complex interplay between viral gene products and the host innate immune responses in determining the outcome of virus infection. Robust inflammatory cytokine responses are observed in herpes simplex virus (HSV)-infected animals and cells. Our studies have demonstrated that Toll-like receptor 2 (TLR2) activation by HSV results in NF-?B activation with concomitant inflammatory cytokine production and that TLR2 activation plays a critical role in HSV-induced pathology and mortality. Here we demonstrate that the HSV-1 immediate-early ICP0 protein reduces the TLR2-mediated inflammatory response to HSV 1 (HSV-1) infection. Expression of ICP0 alone is sufficient to block TLR2-driven responses to both viral and nonviral ligands at or downstream of the MyD88 adaptor and upstream of p65. ICP0 alone can also reduce the levels of MyD88 and Mal (TIRAP). In HSV-infected cells, the E3 ligase function of ICP0 and cellular proteasomal activity are required for the inhibitory activity. Our results argue for a model in which ICP0 promotes the degradation of TLR adaptor molecules and inhibition of the inflammatory response, much as it inhibits the interferon response by sequestration and degradation of interferon regulatory factor 3 (IRF-3). PMID:20686034

  8. Regulated transcription of the immediate-early gene Zif268: mechanisms and gene dosage-dependent function in synaptic plasticity and memory formation.

    PubMed

    Bozon, Bruno; Davis, Sabrina; Laroche, Serge

    2002-01-01

    The immediate-early gene Zif268 is a member of the Egr family of inducible transcription factors. Data from gene expression studies have suggested that this gene may play a critical role in initial triggering of the genetic machinery that has long been considered a necessary mechanism for maintenance of the later phases of LTP and also for the consolidation or stabilization of long-lasting memories. Until recently, however, the data supporting this assumption have been based primarily on circumstantial evidence, with no direct evidence to suggest that Zif268 is required for long-lasting synaptic plasticity and memory. In this report, we review our own data using Zif268 mutant mice; we show that although the early phase of dentate gyrus LTP is normal in these mice, the later phases are not present, and the ability of the mice to maintain learned information over a 24-h period is deficient. In addition, we present new information showing a task-dependent gene dosage effect in Zif268 heterozygous mice. We show that spatial learning is particularly sensitive to reduced levels of Zif268, as one-half of the complement of Zif268 in heterozygous mice is insufficient to maintain spatial long-term memories. PMID:12440572

  9. ATM regulates NF-?B-dependent immediate-early genes via RelA Ser 276 phosphorylation coupled to CDK9 promoter recruitment

    PubMed Central

    Fang, Ling; Choudhary, Sanjeev; Zhao, Yingxin; Edeh, Chukwudi B; Yang, Chunying; Boldogh, Istvan; Brasier, Allan R.

    2014-01-01

    Ataxia-telangiectasia mutated (ATM), a member of the phosphatidylinositol 3 kinase-like kinase family, is a master regulator of the double strand DNA break-repair pathway after genotoxic stress. Here, we found ATM serves as an essential regulator of TNF-induced NF-kB pathway. We observed that TNF exposure of cells rapidly induced DNA double strand breaks and activates ATM. TNF-induced ROS promote nuclear IKK? association with ubiquitin and its complex formation with ATM for nuclear export. Activated cytoplasmic ATM is involved in the selective recruitment of the E3-ubiquitin ligase ?-TrCP to phospho-I?B? proteosomal degradation. Importantly, ATM binds and activates the catalytic subunit of protein kinase A (PKAc), ribosmal S6 kinase that controls RelA Ser 276 phosphorylation. In ATM knockdown cells, TNF-induced RelA Ser 276 phosphorylation is significantly decreased. We further observed decreased binding and recruitment of the transcriptional elongation complex containing cyclin dependent kinase-9 (CDK9; a kinase necessary for triggering transcriptional elongation) to promoters of NF-?B-dependent immediate-early cytokine genes, in ATM knockdown cells. We conclude that ATM is a nuclear damage-response signal modulator of TNF-induced NF-?B activation that plays a key scaffolding role in I?B? degradation and RelA Ser 276 phosphorylation. Our study provides a mechanistic explanation of decreased innate immune response associated with A-T mutation. PMID:24957606

  10. Differential effects of vocalization type, singer and listener on ZENK immediate early gene response in black-capped chickadees (Poecile atricapillus).

    PubMed

    Avey, M T; Kanyo, R A; Irwin, E L; Sturdy, C B

    2008-03-17

    Here we examined immediate early gene (ZENK) induction to vocalizations in the ascending auditory pathway of black-capped chickadees (Poecile atricapillus) to assess the impact that the sex of the producer and perceiver has on ZENK induction. We manipulated the playback by both the vocal type (song/call) and sex of producer (male/female), and then presented these stimuli classes to either male or female black-capped chickadees. Neural response to the stimulus was quantified by the amount of protein of the IEG ZENK (also known as zif-268, egr-1, ngf-Ia and krox-24) in the caudal medial nidopallium (NCM) and caudomedial mesopallium (CMM). Overall, there was more ZENK induction in CMM and the dorsal parts of the caudal medial nidopallium (NCMd) than in the ventral parts of the caudal medial nidopallium (NCMv) and males had more ZENK induction than females. CMM had the most complex responding of ZENK induction to stimuli such that vocalization type, sex of producer, and sex of perceiver all affected ZENK induction. The silence controls had the least ZENK induction compared to any other group. PMID:18077008

  11. Expression of immediate early genes in the hippocampal formation of the black-capped chickadee (Poecile atricapillus) during a food-hoarding task.

    PubMed

    Smulders, T V; DeVoogd, T J

    2000-09-01

    Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal HF of both storing and retrieving chickadees compared to controls. In retrieving birds, the number of Fos-like immunoreactive neurons relates to the number of items remembered, while the number of ZENK-like immunoreactive neurons in the HF may be related to the accuracy of cache retrieval. These results imply that the brain might process complex information by recruiting more neurons into the network of active neurons. Thus, our results could help explain why food-hoarding birds have more HF neurons than non-hoarders, and why this number increases in autumn when large numbers of food items are cached. PMID:10996045

  12. miR-30c negatively regulates the migration and invasion by targeting the immediate early response protein 2 in SMMC-7721 and HepG2 cells

    PubMed Central

    Wu, Wenjuan; Zhang, Xizhi; Liao, Yuexia; Zhang, Weicheng; Cheng, Haichao; Deng, Zijing; Shen, Jingyuan; Yuan, Qing; Zhang, Yu; Shen, Weigan

    2015-01-01

    miR-30c has been reported to act as a tumor suppressor and negatively regulate cancer metastasis by directly targeting metastasis associated genes; however, miR-30c has also been shown to promote the invasion of metastatic breast cancer cells, suggesting that miR-30c might be involved in cancer cell metastasis in different ways via targeting different genes. In this study, we demonstrated that over-expression and knockdown of immediate early response protein 2 (IER2) modulated the general capacity of the migration and invasion in hepatocellular carcinoma cell line SMMC-7721 and HepG2, whereas overexpression and knockdown of miR-30c decreased and promoted cell motility, respectively. Further studies revealed that miR-30c overexpression down-regulated the expression of IER2 protein but not its mRNA level, and miR-30c can directly target the 3’ untranslated region (3’UTR) of IER2, and subsequently reducing its expression. Moreover, we also showed that suppression of cell motility by miR-30c was partially rescued by IER2 re-expression. Our results indicated that miR-30c may function as a negative regulator in cell motility, with IER2 as a direct and functional target in SMMC-7721 and HepG2 cells.

  13. Role of the CipA Scaffoldin Protein in Cellulose Solubilization, as Determined by Targeted Gene Deletion and Complementation in Clostridium thermocellum

    PubMed Central

    Olson, Daniel G.; Giannone, Richard J.; Hettich, Robert L.

    2013-01-01

    The CipA scaffoldin protein plays a key role in the Clostridium thermocellum cellulosome. Previous studies have revealed that mutants deficient in binding or solubilizing cellulose also exhibit reduced expression of CipA. To confirm that CipA is, in fact, necessary for rapid solubilization of crystalline cellulose, the gene was deleted from the chromosome using targeted gene deletion technologies. The CipA deletion mutant exhibited a 100-fold reduction in cellulose solubilization rate, although it was eventually able to solubilize 80% of the 5 g/liter cellulose initially present. The deletion mutant was complemented by a copy of cipA expressed from a replicating plasmid. In this strain, Avicelase activity was restored, although the rate was 2-fold lower than that in the wild type and the duration of the lag phase was increased. The cipA coding sequence is located at the beginning of a gene cluster containing several other genes thought to be responsible for the structural organization of the cellulosome, including olpB, orf2p, and olpA. Tandem mass spectrometry revealed a 10-fold reduction in the expression of olpB, which may explain the lower growth rate. This deletion experiment adds further evidence that CipA plays a key role in cellulose solubilization by C. thermocellum, and it raises interesting questions about the differential roles of the anchor scaffoldin proteins OlpB, Orf2p, and SdbA. PMID:23204466

  14. PU.1 is a suppressor of myeloid leukemia, inactivated in mice by gene deletion and mutation of its DNA binding domain.

    PubMed

    Cook, Wendy D; McCaw, Benjamin J; Herring, Christopher; John, Deborah L; Foote, Simon J; Nutt, Stephen L; Adams, Jerry M

    2004-12-01

    In most myeloid leukemias induced in mice by gamma-radiation, one copy of chromosome 2 has suffered a deletion. To search for a potential tumor suppressor gene in that region, we have delineated the deletions in a panel of these tumors. A commonly deleted region of 2 megabase pairs (Mbp) includes the gene encoding the PU.1 transcription factor, a powerful inducer of granulocytic/monocytic differentiation. Significantly, in 87% of these tumors the remaining PU.1 allele exhibited point mutations in the PU.1 DNA binding domain. Surprisingly, 86% of these mutations altered a single CpG, implicating deamination of deoxycytidine, a common mutational mechanism, as the origin of this lesion. The "hot spot" resides in the codon for a contact residue essential for DNA binding by PU.1. In keeping with a tumor suppressor role for PU.1, enforced expression of wild-type PU.1 in the promyelocytic leukemia cells inhibited their clonogenic growth, induced monocytic differentiation, and elicited apoptosis. The mutant PU.1 found in tumors retained only minimal growth suppressive function. The results suggest that PU.1 normally suppresses development of myeloid leukemia by promoting differentiation and that the combination of gene deletion and a point mutation that impairs its ability to bind DNA is particularly leukemogenic. PMID:15304397

  15. Screening of High-Level 4-Hydroxy-2 (or 5)-Ethyl-5 (or 2)-Methyl-3(2H)-Furanone-Producing Strains from a Collection of Gene Deletion Mutants of Saccharomyces cerevisiae

    PubMed Central

    Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

    2014-01-01

    4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1?) exhibited the maximum HEMF production capacity. Further investigations of the adh1? mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

  16. Prenatal exposure to moderate levels of ethanol alters social behavior in adult rats: Relationship to structural plasticity and immediate early gene expression in frontal cortex

    PubMed Central

    Hamilton, Derek A.; Akers, Katherine G.; Rice, James P.; Johnson, Travis E.; Candelaria-Cook, Felicha T.; Maes, Levi I.; Rosenberg, Martina; Valenzuela, C. Fernando; Savage, Daniel D.

    2009-01-01

    The goals of the present study were to characterize the effects of prenatal exposure to moderate levels of ethanol on adult social behavior, and to evaluate fetal-ethanol-related effects on dendritic morphology, structural plasticity and activity-related immediate early gene (IEG) expression in the agranular insular (AID) and prelimbic (Cg3) regions of frontal cortex. Baseline fetal-ethanol-related alterations in social behavior were limited to reductions in social investigation in males. Repeated experience with novel cage-mates resulted in comparable increases in wrestling and social investigation among saccharin- and ethanol-exposed females, whereas social behavioral effects among males were more evident in ethanol-exposed animals. Male ethanol-exposed rats also displayed profound increases in wrestling when social interaction was motivated by 24 hours of isolation. Baseline decreases in dendritic length and spine density in AID were observed in ethanol-exposed rats that were always housed with the same cage-mate. Modest experience-related decreases in dendritic length and spine density in AID were observed in saccharin-exposed rats housed with various cage-mates. In contrast, fetal-ethanol-exposed rats displayed experience-related increases in dendritic length in AID, and no experience-related changes in spine density. The only effect observed in Cg3 was a baseline increase in basilar dendritic length among male ethanol-exposed rats. Robust increases in activity-related IEG expression in AID (c-fos and Arc) and Cg3 (c-fos) were observed following social interaction in saccharin-exposed rats, however, activity-related increases in IEG expression were not observed in fetal-ethanol-exposed rats in either region. The results indicate that deficits in social behavior are among the long-lasting behavioral consequences of moderate ethanol exposure during brain development, and implicate AID, and to a lesser degree Cg3, in fetal-ethanol-related social behavior abnormalities. PMID:19852984

  17. Independent effects of song quality and experience with photostimulation on expression of the immediate, early gene ZENK (EGR-1) in the auditory telencephalon of female European starlings

    PubMed Central

    Sockman, Keith W.; Ball, Gregory F.

    2010-01-01

    Age influences behavioral decisions such as reproductive timing and effort. In photoperiodic species, such age effects may be mediated, in part, by the individual's age-accrued experience with photostimulation. In female European starlings (Sturnus vulgaris) that do not differ in age, experimental manipulation of photostimulation experience (photoexperience) affects hypothalamic, pituitary, and gonadal activity associated with reproductive development. Does photoexperience also affect activity in forebrain regions involved in processing a social cue, the song of males, which can influence mate choice and reproductive timing in females? Female starlings prefer long songs over short songs in a mate-choice context, and, like that in other songbird species, their auditory telencephalon plays a major role in processing these signals. We manipulated the photoexperience of female starlings, photostimulated them, briefly exposed them to either long or short songs, and quantified the expression of the immediate-early gene ZENK (EGR-1) in the caudomedial nidopallium as a measure of activity in the auditory telencephalon. Using an information theoretic approach, we found higher ZENK immunoreactivity in females with prior photostimulation experience than in females experiencing photostimulation for the first time. We also found that long songs elicited greater ZENK immunoreactivity than short song did. We did not find an effect of the interaction between photoexperience and song length, suggesting that photoexperience does not affect forebrain ZENK-responsiveness to song quality. Thus, photoexperience affects activity in an area of the forebrain that processes social signals, an effect that we hypothesize mediates, in part, the effects of age on reproductive decisions in photoperiodic songbirds. PMID:19224564

  18. Immediate-early MEK-1-dependent stabilization of rat smooth muscle cell cyclooxygenase-2 mRNA by Galpha(q)-coupled receptor signaling.

    PubMed

    Xu, K; Robida, A M; Murphy, T J

    2000-07-28

    Activation of Galpha(q)-coupled P2Y nucleotide receptors strongly (>100-fold) induces the rat vascular smooth muscle cell cyclooxygenase-2 (COX-2) mRNA, yet transcription is induced only approximately 3-fold over 1 h. Intact cell decay analysis of tetracycline-suppressible luciferase chimera mRNAs shows that regulated stabilization of the intrinsically unstable mRNA contributes to this response. Deletion mapping of the 2468-base COX-2 mRNA 3'-untranslated region (UTR) shows that a distal, 130-base AU-rich region functions as a cis-acting regulated stabilization response element, which under basal conditions serves as the dominant instability determinant for the 3'-UTR. Regulation of this response is through the p42/44 MAP kinases, whereas the p38 MAP kinases are not involved. The stabilization response element binds avidly and specifically to a prominent nuclear-enriched approximately 90-kDa factor and several less abundantly labeled mRNA binding proteins that are unaffected by P2Y receptor signaling. Although other instability determinants are located throughout the rat COX-2 mRNA 3'-UTR, mitogen signaling only interferes with rapid decay mediated by its most distal 130 bases. A complex of nuclear factors that bind this mRNA region specifically may include candidate targets for regulatory modulation. These observations support the general notion that the rapid induction of immediate-early gene expression through mitogenic receptors involves simultaneous activation of transcriptional and post-transcriptional mechanisms. PMID:10816563

  19. Insect cell surface expression of hemagglutinin (HA) of Egyptian H5N1 avian influenza virus under transcriptional control of whispovirus immediate early-1 promoter.

    PubMed

    Gadalla, Mohamed Rasheed; El-Deeb, Ayman Hany; Emara, Mohamed Maged; Hussein, Hussein Aly

    2014-12-28

    In the present study, whispovirus immediate early 1 promoter (ie-1) was used to initiate surface expression of the hemagglutinin (HA) protein of Egyptian H5N1 avian influenza virus (AIV) by using the baculovirus expression vector system. The HA gene and whispovirus ie-1 promoter sequence were synthesized as a fused expression cassette (ie1-HA) and successfully cloned into the pFastBac-1 transfer vector. The recombinant vector was transformed into DH10Bac competent cells, and the recombinant bacmid was generated via site-specific transposition. The recombinant bacmid was used for transfection of Spodoptera frugiperda (Sf-9) insect cells to construct the recombinant baculovirus and to induce expression of the HA protein of H5N1 AIV. The recombinant glycoprotein expressed in Sf-9 cells showed hemadsorption activity. Hemagglutination activity was also detected in both extra- and intracellular recombinant HAs. Both the HA and hemadsorption activities were inhibited by reference polyclonal anti-H5 sera. Significant expression of the recombinant protein was observed on the surface of infected insect cells by using immunofluorescence. SDS-PAGE analysis of the expressed protein revealed the presence of a visually distinguishable band of ~63 kDa in size, which was absent in the non-infected cell control. Western blot analysis confirmed that the distinct 63 kDa band corresponded to the recombinant HA glycoprotein of H5N1 AIV. This study reports the successful expression of the HA protein of H5N1 AIV. The expressed protein was displayed on the plasma membrane of infected insect cells under the control of whispovirus ie-1 promoter by using the baculovirus expression vector system. PMID:25112319

  20. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity

    PubMed Central

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks.

  1. Dopamine D4 receptor signaling in the rat paraventricular hypothalamic nucleus: Evidence of natural coupling involving immediate early gene induction and mitogen activated protein kinase phosphorylation.

    PubMed

    Bitner, Robert S; Nikkel, Arthur L; Otte, Stephani; Martino, Brenda; Barlow, Eve H; Bhatia, Pramila; Stewart, Andrew O; Brioni, Jorge D; Decker, Michael W; Moreland, Robert B

    2006-04-01

    The dopamine D4 receptor has been investigated for its potential role in several CNS disorders, notably schizophrenia and more recently, erectile dysfunction. Whereas studies have investigated dopamine D4 receptor-mediated signaling in vitro, there have been few, if any, attempts to identify dopamine D4 receptor signal transduction pathways in vivo. In the present studies, the selective dopamine D4 agonist PD168077 induces c-Fos expression and extracellular signal regulated kinase (ERK) phosphorylation in the hypothalamic paraventricular nucleus (PVN), a site known to regulate proerectile activity. The selective dopamine D4 receptor antagonist A-381393 blocked both c-Fos expression and ERK1/2 phosphorylation produced by PD168077. In addition, PD168077-induced ERK1/2 phosphorylation was prevented by SL327, an inhibitor of ERK1/2 phosphorylation. Interestingly, treatment with A-381393 alone significantly reduced the amount of Fos immunoreactivity as compared to basal expression observed in vehicle-treated controls. Dopamine D4 receptor and c-Fos coexpression in the PVN was observed using double immunohistochemical labeling, suggesting that PD168077-induced signaling may result from direct dopamine D4 receptor activation. Our results demonstrate functional dopamine D4 receptor expression and natural coupling in the PVN linked to signal transduction pathways that include immediate early gene and MAP kinase activation. Further, the ability of the selective dopamine D4 antagonist A-381393 alone to reduce c-Fos expression below control levels may imply the presence of a tonic dopamine D4 receptor activation under basal conditions in vivo. These findings provide additional evidence that the PVN may be a site of dopamine D4 receptor-mediated proerectile activity. PMID:16324724

  2. High-frequency structural gene deletion as the basis for functional hemizygosity of the adenine phosphoribosyltransferase locus in Chinese hamster ovary cells.

    PubMed Central

    Adair, G M; Stallings, R L; Nairn, R S; Siciliano, M J

    1983-01-01

    The CHO-AT3-2 Chinese hamster ovary cell line is functionally hemizygous for the adenine phosphoribosyltransferase (APRT; EC 2.4.2.7) locus. Class 1 APRT +/- heterozygotes, such as CHO-AT3-2, can be isolated at high spontaneous frequencies from wild-type CHO cell populations. Simon et al. [Simon, A. E., Taylor, M. W., Bradley, W. E. C. & Thompson, L. (1982) Mol. Cell. Biol. 2, 1126-1133] have proposed that a high-frequency event that inactivates one APRT allele might be responsible for both the spontaneous generation of class 1 APRT +/- heterozygotes and the high-frequency occurrence of APRT- mutants in class 2 APRT +/- heterozygote populations. This event appears to occur at only one of the two APRT alleles. To investigate the nature of this high-frequency event, and to determine the genetic basis for functional hemizygosity of the APRT locus in CHO-AT3-2 cells, we have mapped the APRT locus by using CHO-AT3-2-mouse somatic cell hybrids. Our data confirm that CHO-AT3-2 cells have a single functional APRT allele, which is located on the Z7 chromosome. Karyotypic analysis of CHO-AT3-2 revealed an interstitial deletion on the long arm of the Z4 chromosome, in the very region where the other APRT allele should be located. To determine whether the Z4q interstitial deletion had resulted in physical loss of the APRT gene, DNA from CHO-AT3-2-mouse cell hybrids that had either lost or retained the Z4q- chromosome was analyzed for the presence of CHO APRT coding sequences. Our data suggest that allele-specific high-frequency structural gene deletion events involving the long arm of chromosome Z4 are responsible for the spontaneous generation of functional hemizygosity at the APRT locus in CHO cells. Images PMID:6310607

  3. Immediate-early and delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through transcriptional cascades

    Microsoft Academic Search

    Wolfram G. Brenner; Georgy A. Romanov; Ireen Kollmer; Lukas Burkle; Thomas Schmulling

    Summary Cytokinins are hormones that regulate many developmental and physiological processes in plants. Recent work has revealed that the cytokinin signal is transduced by two-component systems to the nucleus where target genes are activated. Most of the rapid transcriptional responses are unknown. We measured immediate- early and delayed cytokinin responses through genome-wide expression profiling with the Affymetrix ATH1 full genome

  4. Transcriptional regulation of immediate-early gene response by THOC5, a member of mRNA export complex, contributes to the M-CSF-induced macrophage differentiation

    PubMed Central

    Tran, D DH; Saran, S; Dittrich-Breiholz, O; Williamson, A JK; Klebba-Färber, S; Koch, A; Kracht, M; Whetton, A D; Tamura, T

    2013-01-01

    Hematopoiesis and commitment to a restricted lineage are guided by a timely expressed set of cytokine receptors and their downstream transcription factors. A member of the mRNA export complex, THOC5 (suppressors of the transcriptional defects of hpr1 delta by overexpression complex 5) is a substrate for several tyrosine kinases such as macrophage colony-stimulating factor (M-CSF) receptor and various leukemogenic tyrosine kinases, such as Bcr-Abl, or NPM-ALK. THOC5 tyrosine phosphorylation is elevated in stem cells from patients with chronic myeloid leukemia, suggesting that THOC5 may be involved in leukemia development. THOC5 is also an essential element in the maintenance of hematopoiesis in adult mice. In this report, we show that THOC5 is located in the nuclear speckles, and that it is translocated from the nucleus to cytoplasm during M-CSF-induced bone marrow-derived macrophage differentiation. Furthermore, we have identified THOC5 target genes by trancriptome analysis, using tamoxifen-inducible THOC5 knockout macrophages. Although only 99 genes were downregulated in THOC5-depleted macrophages, half of the genes are involved in differentiation and/or migration. These include well-known regulators of myeloid differentiation inhibitor of DNA binding (Id)1, Id3, Smad family member 6 (Smad6) and Homeobox (Hox)A1. In addition, a subset of M-CSF-inducible genes, such as Ets family mRNAs are THOC5 target mRNAs. Upon depletion of THOC5, unspliced v-ets erythroblastosis virus E26 oncogene homolog (Ets1) mRNA was accumulated in the nucleus. Furthermore, THOC5 was recruited to chromatin where Ets1 was transcribed and bound to unspliced and spliced Ets1 transcripts, indicating that THOC5 has a role in processing/export of M-CSF-inducible genes. In conclusion, regulation of immediate-early gene response by THOC5, a member of mRNA export complex contributes to the M-CSF-induced macrophage differentiation. PMID:24157873

  5. Multiplication

    NSDL National Science Digital Library

    Ms.Roberts

    2009-02-24

    How sharp are your multiplication skills? Give these great math games a try ! Play Asteroids blaster and test your multiplication skills. How fast can you solve the problem... play a round of Baseball multiplication and see! Multiplication is fun and delicious with Crazy Cones. Help Lemonade Larry determine the correct amount! Test your multiplication skills with Tic Tac Toe! ...

  6. Multiplication

    NSDL National Science Digital Library

    Ms. Walker

    2008-03-26

    Here are some fun games to make practicing multiplication fun!!! Before you start the fun... click Multiplication Tables to review what you already know! Can you figure out the Multiplication Hidden Picture... you better know your math skills first or the picture will burst! It\\'s times to have a \\"blast\\"... Blow me away with theMultiplication Tunnel Blaster Now your ready to join the team! Show me ...

  7. Multiplication

    NSDL National Science Digital Library

    Ms. Williams

    2011-04-06

    Which way of learning multiplication helped you the best? First you will need to use organizer Then you need to go to thinking blocks Next go to multiplication rap song Then go to dinosaur game and times table and lattice method and finally flashcards after this look over your graphic organizer and think about which site was most helpful for you. You will then be divided into groups where you will make your own creative lesson ...

  8. Combinatorial Strategies for Improving Multiple-Stress Resistance in Industrially Relevant Escherichia coli Strains

    PubMed Central

    Herrgård, Markus J.

    2014-01-01

    High-cell-density fermentation for industrial production of chemicals can impose numerous stresses on cells due to high substrate, product, and by-product concentrations; high osmolarity; reactive oxygen species; and elevated temperatures. There is a need to develop platform strains of industrial microorganisms that are more tolerant toward these typical processing conditions. In this study, the growth of six industrially relevant strains of Escherichia coli was characterized under eight stress conditions representative of fed-batch fermentation, and strains W and BL21(DE3) were selected as platforms for transposon (Tn) mutagenesis due to favorable resistance characteristics. Selection experiments, followed by either targeted or genome-wide next-generation-sequencing-based Tn insertion site determination, were performed to identify mutants with improved growth properties under a subset of three stress conditions and two combinations of individual stresses. A subset of the identified loss-of-function mutants were selected for a combinatorial approach, where strains with combinations of two and three gene deletions were systematically constructed and tested for single and multistress resistance. These approaches allowed identification of (i) strain-background-specific stress resistance phenotypes, (ii) novel gene deletion mutants in E. coli that confer single and multistress resistance in a strain-background-dependent manner, and (iii) synergistic effects of multiple gene deletions that confer improved resistance over single deletions. The results of this study underscore the suboptimality and strain-specific variability of the genetic network regulating growth under stressful conditions and suggest that further exploration of the combinatorial gene deletion space in multiple strain backgrounds is needed for optimizing strains for microbial bioprocessing applications. PMID:25085490

  9. The Elk-1 and Serum Response Factor Binding Sites in the Major Immediate-Early Promoter of Human Cytomegalovirus Are Required for Efficient Viral Replication in Quiescent Cells and Compensate for Inactivation of the NF-?B Sites in Proliferating Cells?

    PubMed Central

    Caposio, Patrizia; Luganini, Anna; Bronzini, Matteo; Landolfo, Santo; Gribaudo, Giorgio

    2010-01-01

    The major immediate-early promoter (MIEP) region of human cytomegalovirus (HCMV) plays a critical role in the regulation of lytic and latent infections by integrating multiple signals supplied by the infecting virus, the type and physiological state of the host cell, and its extracellular surroundings. The interaction of cellular transcription factors with their cognate binding sites, which are present at high densities within the enhancer upstream from the MIEP core promoter, regulate the rate of IE gene transcription and thus affect the outcome of HCMV infection. We have shown previously that the NF-?B binding sites within the MIEP enhancer and cellular NF-?B activity induced by HCMV infection are required for efficient MIEP activity and viral replication in quiescent cells (P. Caposio, A. Luganini, G. Hahn, S. Landolfo, and G. Gribaudo, Cell. Microbiol. 9:2040-2054, 2007). We now show that the inactivation of either the Elk-1 or serum response factor (SRF) binding site within the enhancer also reduces MIEP activation and viral replication of recombinant HCMV viruses in quiescent fibroblasts. In these cells, we show that the expression of either Elk-1 or SRF is required for optimal IE gene expression, and that the HCMV-stimulated activation of the MEK1/2-ERK1/2 signaling axis leads to Elk-1 transcriptional competency. Furthermore, the replication kinetics of recombinant viruses in which NF-?B, Elk-1, and SRF binding sites all are inactivated demonstrate that the higher levels of Elk-1 and SRF binding to MIEP in proliferating cells can compensate even for a lack of HCMV-induced NF-?B-mediated MIEP transactivation. These observations highlight the importance of the combination of different MIEP binding sites to optimize IE gene expression in cells in different physiological states. PMID:20147408

  10. Early socio-emotional experience induces expression of the immediate-early gene Arc/arg3.1 (activity-regulated cytoskeleton-associated protein/activity-regulated gene) in learning-relevant brain regions of the newborn chick.

    PubMed

    Bock, J; Thode, C; Hannemann, O; Braun, K; Darlison, M G

    2005-01-01

    We have cloned a full-length complementary DNA from the chicken (Gallus gallus domesticus), which encodes a polypeptide that exhibits approximately 75% identity to the product of the mammalian gene Arc (activity-regulated cytoskeleton-associated protein), also known as arg3.1 (activity-regulated gene). Since this gene is an immediate-early gene that has been suggested to play a role in synaptic plasticity and learning and memory processes, its expression has been analyzed in a juvenile form of learning, namely, filial imprinting. Our results demonstrate that Arc/arg3.1 mRNA is detectable in the newborn chick brain, and that at this early age the level of this transcript can be altered by brief sensory/emotional experience. After postnatal exposure to a novel 30-min auditory imprinting stimulus, Arc/arg3.1 mRNA was found to be significantly increased in two higher associative areas, the mesopallium intermediomediale (P = 0.002) and the nidopallium dorso-caudale (P = 0.031), compared with naïve controls. The transcript level was also significantly elevated after imprinting in Area L pallii (P=0.045), which is analogous to the mammalian auditory cortex. In addition, increases were seen in the medio-rostral nidopallium/mesopallium (P = 0.054), which is presumed to be the analog of the mammalian prefrontal cortex, and the hyperpallium intercalatum (P = 0.054), but these did not quite reach significance. We discuss these data in the light of those obtained in an earlier study, in the same paradigm, for the avian immediate-early gene, zenk (an acronym for zif-268, egr-1, ngfi-a and krox-24, which are different names for the orthologous mammalian gene). We conclude that, although both the Arc/arg3.1 and zenk genes are induced by auditory imprinting, they are significantly up-regulated in different learning-relevant brain regions. It is, therefore, evident that they must be activated by different mechanisms. PMID:15908132

  11. Genetically modified strains of Ralstonia eutropha H16 with ?-ketothiolase gene deletions for production of copolyesters with defined 3-hydroxyvaleric acid contents.

    PubMed

    Lindenkamp, Nicole; Volodina, Elena; Steinbüchel, Alexander

    2012-08-01

    ?-Ketothiolases catalyze the first step of poly(3-hydroxybutyrate) [poly(3HB)] biosynthesis in bacteria by condensation of two acetyl coenzyme A (acetyl-CoA) molecules to acetoacetyl-CoA and also take part in the degradation of fatty acids. During growth on propionate or valerate, Ralstonia eutropha H16 produces the copolymer poly(3-hydroxybutyrate-co-3-hydroxyvalerate) [poly(3HB-co-3HV)]. In R. eutropha, 15 ?-ketothiolase homologues exist. The synthesis of 3-hydroxybutyryl-CoA (3HB-CoA) could be significantly reduced in an 8-fold mutant (Lindenkamp et al., Appl. Environ. Microbiol. 76:5373-5382, 2010). In this study, a 9-fold mutant deficient in nine ?-ketothiolase gene homologues (phaA, bktB, H16_A1713, H16_B1771, H16_A1528, H16_B0381, H16_B1369, H16_A0170, and pcaF) was generated. In order to examine the polyhydroxyalkanoate production capacity when short- or long-chain and even- or odd-chain-length fatty acids were provided as carbon sources, the growth and storage behavior of several mutants from the previous study and the newly generated 9-fold mutant were analyzed. Propionate, valerate, octanoate, undecanoic acid, or oleate was chosen as the sole carbon source. On octanoate, no significant differences in growth or storage behavior were observed between wild-type R. eutropha and the mutants. In contrast, during the growth on oleate of a multiple mutant lacking phaA, bktB, and H16_A0170, diminished poly(3HB) accumulation occurred. Surprisingly, the amount of accumulated poly(3HB) in the multiple mutants grown on gluconate differed; it was much lower than that on oleate. The ?-ketothiolase activity toward acetoacetyl-CoA in H16?phaA and all the multiple mutants remained 10-fold lower than the activity of the wild type, regardless of which carbon source, oleate or gluconate, was employed. During growth on valerate as a sole carbon source, the 9-fold mutant accumulated almost a poly(3-hydroxyvalerate) [poly(3HV)] homopolyester with 99 mol% 3HV constituents. PMID:22636005

  12. Elucidating timing and function of endothelin-A receptor signaling during craniofacial development using neural crest cell-specific gene deletion and receptor antagonism

    PubMed Central

    Ruest, Louis-Bruno; Clouthier, David E.

    2009-01-01

    Cranial neural crest cells (NCCs) play an intimate role in craniofacial development. Multiple signaling cascades participate in patterning cranial NCCs, some of which are regulated by endothelin-A receptor (Ednra) signaling. Ednra?/? embryos die at birth from severe craniofacial defects resulting from disruption of neural crest cell patterning and differentiation. These defects include homeotic transformation of lower jaw structures into upper jaw-like structures, suggesting that some cephalic NCCs alter their “identity” in the absence of Ednra signaling. To elucidate the temporal necessity for Ednra signaling in vivo, we undertook two strategies. We first used a conditional knockout strategy in which mice containing a conditionally targeted Ednra allele (Ednrafl) were bred with mice from the Hand2-Cre and Wnt1-Cre transgenic mouse strains, two strains in which Cre expression occurs at different time periods within cranial NCCs. In our second approach, we used an Ednra-specific antagonist to treat wild type pregnant mice between embryonic days E8.0 and E10.0, a time frame encompassing the early migration and proliferation of cranial NCCs. The combined results suggest that Ednra function is crucial for NCC development between E8.25 and E9.0, a time period encompassing the arrival of NCCs in the arches and/or early post-migratory patterning. After this time period, Ednra signaling is dispensable. Interestingly, middle ear structures are enlarged and malformed in a majority of Ednrafl/fl;Wnt1-Cre embryos, instead resembling structures found in extinct predecessors of mammals. These observations suggest that the advent of Ednra signaling in cranial NCCs may have been a crucial event in the evolution of the mammalian middle ear ossicles. PMID:19185569

  13. Human telomerase reverse transcriptase promoter-driven oncolytic adenovirus with E1B-19 kDa and E1B-55 kDa gene deletions.

    PubMed

    Doloff, Joshua C; Waxman, David J; Jounaidi, Youssef

    2008-12-01

    We constructed an oncolytic adenovirus, Adeno-hTERT-E1A, with deletions of the viral E1B, E3A, and E3B regions and insertion of a human telomerase reverse transcriptase (hTERT) promoter-driven early viral 1A (E1A) cassette that confers high transcriptional activity in multiple human tumor cell lines. The oncolytic potential of Adeno-hTERT-E1A was characterized in comparison with that of the E1B-55 kDa- and E3B-region-deleted oncolytic adenovirus ONYX-015. Tumor cells infected with Adeno-hTERT-E1A expressed dramatically higher levels of E1A oncoprotein, underwent enhanced lysis, and displayed an earlier and higher apoptotic index than cells infected with ONYX-015. Despite the increase in virus-induced apoptotic death, Adeno-hTERT-E1A replicated and produced functional progeny leading to viral spread, but with reduced efficiency compared with ONYX-015, in particular in A549 cells. Virus-induced E1A expression, host cell apoptosis, viral hexon protein production, and DNA synthesis were markedly reduced in primary human hepatocytes after infection with Adeno-hTERT-E1A as compared with ONYX-015. The strong oncolytic activity of Adeno-hTERT-E1A in tumor cell culture translated into superior antitumor activity in vivo in an MDA-MB-231 solid tumor xenograft model. Adeno-hTERT-E1A thus has strong therapeutic potential and an improved safety profile compared with ONYX-015, which may lead to reduced toxicity in the clinic. PMID:18771358

  14. Sequence characterization, polymorphism, and tissue expression profile of an effector immediate-early gene: activity-regulated cytoskeletal associated protein gene (Arc/Arg3.1) in swamp and river buffalo.

    PubMed

    Yuan, F; Huo, J L; Li, D L; Yuan, Y Y; Lu, W Z; Song, S; Li, L J; Miao, Y W

    2014-01-01

    The activity-regulated cytoskeletal associated protein (Arc/Arg3.1) has been implicated in experience-dependent synaptic plasticity and memory formation. However, information regarding its coding gene in buffalo remains scarce. In this study, the full-length of Arc/Arg3.1 was isolated and characterized (accession No. JX491649) and genetic variations of six river buffalo and eight swamp buffalo were investigated. A tissue expression profile was obtained using semi-quantitative reverse transcription-polymerase chain reaction. The coding region sequence of Arc/Arg3.1 contained 1191 nucleotides encoding a putative protein of 396 amino acids with a theoretical isoelectric point (pI) and molecular weight (Mw) of 5.4 and 45.2 kDa, respectively. Four polymorphisms (c.63T>C, c.228T>C, c.558G>A, and c.625G>C) were found in buffalo; however, only substitution c.625G>C was non-synonymous, leading to an amino acid change from Val to Leu at the 209th position of the Arc/Arg3.1 protein sequence. Bioinformatics analysis revealed that this substitution had no significant effect on Arc/Arg3.1 function (subPSEC = -1.4039, Pdeleterious = 0.1685), which indicated that Arc/Arg3.1 was highly conserved and functionally important in buffalo. Phylogenetic analysis revealed that the gene is closely related to that of Bos taurus and Bos grunniens. The gene was moderately expressed in the hypophysis and the placenta; it was weakly expressed in the kidney, milk, mammary gland, cerebrum, lung, heart, rumen, fat, and uterus; and it was almost silent in the muscle, liver, and skin. These findings will provide further insights into the structure and function of the immediate-early gene in buffalo. PMID:24737478

  15. Detection of phase-dependent transcriptomic changes and Rubisco-mediated CO2 fixation into poly (3-hydroxybutyrate) under heterotrophic condition in Ralstonia eutropha H16 based on RNA-seq and gene deletion analyses

    PubMed Central

    2013-01-01

    Background Ralstonia eutropha H16 is well known to produce polyhydroxyalkanoates (PHAs), which are potential bio-based biodegradable plastics, in an efficient manner as an energy storage material under unbalanced growth conditions. To obtain further knowledge of PHA biosynthesis, this study performed a quantitative transcriptome analysis based on deep sequencing of the complementary DNA generated from the RNA (RNA-seq) of R. eutropha H16. Results Total RNAs were extracted from R. eutropha cells in growth, PHA production, and stationary phases on fructose. rRNAs in the preparation were removed by repeated treatments with magnetic beads specific to bacterial rRNAs, and then the 36 bp sequences were determined using an Illumina high-throughput sequencer. The RNA-seq results indicated the induction of gene expression for transcription, translation, cell division, peptidoglycan biosynthesis, pilus and flagella assembly, energy conservation, and fatty acid biosynthesis in the growth phase; and the repression trends of genes involved in central metabolisms in the PHA production phase. Interestingly, the transcription of genes for Calvin-Benson-Bassham (CBB) cycle and several genes for ?-oxidation were significantly induced in the PHA production phase even when the cells were grown on fructose. Moreover, incorporation of 13C was observed in poly(3-hydroxybutyrate) synthesized by R. eutropha H16 from fructose in the presence of NaH13CO3, and further gene deletion analyses revealed that both of the two ribulose 1,5-bisphosphate carboxylase (Rubiscos) in CBB cycle were actually functional in CO2 fixation under the heterotrophic condition. Conclusions The results revealed the phase-dependent transcriptomic changes and a CO2 fixation capability under heterotrophic conditions by PHA-producing R. eutropha. PMID:23879744

  16. Choroid plexus transport: gene deletion studies

    PubMed Central

    2011-01-01

    This review examines the use of transporter knockout (KO) animals to evaluate transporter function at the choroid plexus (the blood-CSF barrier; BCSFB). Compared to the blood-brain barrier, there have been few such studies on choroid plexus (CP) function. These have primarily focused on Pept2 (an oligopeptide transporter), ATP-binding cassette (ABC) transporters, Oat3 (an organic anion transporter), Svct2 (an ascorbic acid transporter), transthyretin, ion transporters, and ion and water channels. This review focuses on the knowledge gained from such studies, both with respect to specific transporters and in general to the role of the CP and its impact on brain parenchyma. It also discusses the pros and cons of using KO animals in such studies and the technical approaches that can be used. PMID:22053861

  17. mdv1-miR-M7-5p, located in the newly identified first intron of the latency-associated transcript of Marek's disease virus, targets the immediate-early genes ICP4 and ICP27.

    PubMed

    Strassheim, S; Stik, G; Rasschaert, D; Laurent, S

    2012-08-01

    Marek's disease virus serotype 1 (MDV-1) is an oncogenic alphaherpesvirus causing fatal T-cell lymphoma in chickens. MDV latency is characterized by the production of latency-associated transcripts (LATs), a family of non-protein-coding spliced RNAs. A cluster of four microRNAs (cluster mdv1-miR-M8-M10) was identified, but not formally mapped, at the predicted LAT 5' end. We established a LAT cDNA library from latently MDV-infected cell line MSB-1. We identified 22 highly variable LATs, which were due to the extensive alternative splicing of a total of 14 introns. RACE PCR confirmed the predicted 3' end and allowed identification of the 5' end, 400 nt upstream of the previously predicted LAT end. The LATs share their transcription start site with the microRNA-expressing transcript described previously, localizing the microRNAs to the first LAT intron and identifying the LATs as the primary transcripts of the microRNAs. We identified MDV immediate-early (IE) genes ICP4 and ICP27 as putative targets of mdv1-miR-M7-5p, the third microRNA of the cluster mdv1-miR-M8-M10. Endogenously expressed mdv1-miR-M7-5p in MSB-1 cells reduced luciferase activity significantly when microRNA-responsive elements from ICP4 or ICP27 were cloned in the 3' UTR of the firefly luciferase gene. ICP27 protein levels were decreased by 70?% when the mdv1-miR-M7-5p precursor was co-expressed with an ICP27 expression plasmid. Additionally, we showed a negative correlation between the decreased expression of mdv1-miR-M7-5p and an increase in ICP27 expression during virus reactivation. Our results suggest that, by targeting two IE genes, MDV microRNAs produced from LAT transcripts may contribute to establish and/or maintain latency. PMID:22513387

  18. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    SciTech Connect

    Wang, S.P.; Robert, M.F.; Mitchell, G.A. [Hopital Sainte-Justine, Quebec (Canada)] [and others] [Hopital Sainte-Justine, Quebec (Canada); and others

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither a TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.

  19. Regulation of Immediate Early Genes in the Visual Cortex

    Microsoft Academic Search

    Raphael Pinaud; THOMAS A. TERLEPH; R. WILLIAM CURRIE; LIISA A. TREMERE

    Light is the fastest and likely the most complex source of physical energy processed by the mammalian central nervous system (CNS). Throughout evolution, most mammals that rely heavily on vision for their normal behaviors have developed an exquisitely elaborate pattern of connectivity and functionality for harnessing, processing and integrating visual information. This process allowed for remarkable environmental adaptation and ecological

  20. Cytochrome P4502E1- and cytochrome P4502B1/2B2-catalyzed carbon tetrachloride metabolism: effects on signal transduction as demonstrated by altered immediate-early (c-Fos and c-Jun) gene expression and nuclear AP-1 and NF-kappa B transcription factor levels.

    PubMed

    Gruebele, A; Zawaski, K; Kaplan, D; Novak, R F

    1996-01-01

    We have previously reported that carbon tetrachloride (CCI4) stimulates c-fos, c-jun, and Ca(2+)-activated neutral protease gene expression in rat hepatic tissue (Zawaski et al., Biochem. Biophys. Res. Comm. 197, 585-590, 1993). The proteins c-Fos and c-Jun constitute inducible transcription factors in signal transduction and regulate the transcriptional activation of a battery of genes involved in cell growth and division. The present study was initiated to characterize the role of cytochrome P450 expression and metabolic activation on the magnitude of immediate-early (i.e. c-fos and c-jun) gene expression. Animals were treated either with diallyl sulfide, N-acetylcysteine, pyridine, or phenobarbital before treatment with CCI4. Total and poly(A)+ RNA were isolated, and c-fos and c-jun mRNA levels were analyzed by Northern blot and reverse transcriptase-polymerase chain reaction analyses. Treatment of animals with CCI4 increased c-fos and c-jun mRNA levels from below the limit of detection in control tissue to intense bands within 30 min of treatment, with maximal expression monitored at 1 and 2 hr posttreatment. Treatment of animals with diallyl sulfide alone also elevated c-fos and c-jun mRNA expression to detectable levels. However, pretreatment of animals with diallyl sulfide before treatment with CCI4 produced a 76-92% decrease in c-fos and c-jun mRNA levels, relative to that monitored for CCI4-treated animals. Pretreatment with N-acetylcysteine did not affect c-fos or c-jun mRNA levels and diminished CCI4-stimulated c-fos and c-jun gene expression by 44 and 55%, respectively, relative to the immediate-early gene mRNA levels monitored in the hepatic tissue of CCI4-treated animals. Pretreatment of animals with the CYP2E1 inducer pyridine for 24 hr had only a marginal effect on c-fos mRNA levels, but increased CCI4-stimulated c-fos and c-jun mRNA levels by an additional approximately 2- to approximately 4-fold over those monitored in the uninduced hepatic tissue of CCI4-treated animals. Whereas phenobarbital treatment alone enhanced c-fos expression only marginally, CCI4 treatment of phenobarbital-pretreated animals increased c-fos expression by up to an additional approximately 8-fold and c-jun mRNA levels by up to an additional approximately 5-fold over the respective levels monitored in the hepatic tissue of CCI4-treated animals. Enhanced CYP2E1 or CYP2B1/2B2 levels after treatment with pyridine or phenobarbital elevated c-fos mRNA over untreated controls. This increase was marginal, however, and detectable only with reverse transcriptase-polymerase chain reaction. Examination of nuclear levels of the heterodimeric c-Fos and c-Jun AP-1 transcription factor complex revealed a time-dependent increase in AP-1 levels. AP-1 transcription factor binding was confirmed using competitor consensus sequences and antibody supershifts. Nuclear levels of NF-kappa B, a transcription factor complex implicated in hepatocyte proliferation and apoptotic or programmed cell death, were also examined. NF-kappa B, which consists of the p50 and p65/Rel A polypeptides, was increased in hepatic nuclear extracts at 2 and 24 hr after CCI4 administration, with a concomitant decrease in the p50 polypeptide. Thus, the magnitude of CCI4 stimulation of the immediate-early genes c-fos and c-jun is dependent on metabolic activation by the P450s, and the magnitude of the effect is dependent on the levels and isozyme composition of P450s in the tissue. Furthermore, nuclear transcription factor levels of AP-1 and NF-kappa B are elevated in response to this toxicant. PMID:8825185

  1. Ornithine Decarboxylase Gene Deletion Mutants of Leishmania donovani*

    E-print Network

    Schnaufer, Achim

    ). The ODC enzyme of protozoan parasites is a novel therapeutic target, because D,L- -difluoromethylor effective against other genera of protozoan parasites in vivo and in vitro, including Plasmodia (7), Giardia

  2. Large contiguous gene deletions in Sjögren–Larsson syndrome

    Microsoft Academic Search

    Holly Engelstad; Gael Carney; Dana S'Aulis; Janae Rise; Warren G. Sanger; M. Katharine Rudd; Gabriele Richard; Christopher W. Carr; Omar A. Abdul-Rahman; William B. Rizzo

    2011-01-01

    Sjögren–Larsson syndrome (SLS) is an autosomal recessive disorder characterized by ichthyosis, mental retardation, spasticity and mutations in the ALDH3A2 gene for fatty aldehyde dehydrogenase, an enzyme that catalyzes the oxidation of fatty aldehyde to fatty acid. More than 70 mutations have been identified in SLS patients, including small deletions or insertions, missense mutations, splicing defects and complex nucleotide changes. We

  3. Gene Deletions and Amplifications in Human Hepatocellular Carcinomas

    PubMed Central

    Nalesnik, Michael A.; Tseng, George; Ding, Ying; Xiang, Guo-Sheng; Zheng, Zhong-liang; Yu, YanPing; Marsh, James W.; Michalopoulos, George K.; Luo, Jian-Hua

    2013-01-01

    Tissues from 98 human hepatocellular carcinomas (HCCs) obtained from hepatic resections were subjected to somatic copy number variation (CNV) analysis. Most of these HCCs were discovered in livers resected for orthotopic transplantation, although in a few cases, the tumors themselves were the reason for the hepatectomies. Genomic analysis revealed deletions and amplifications in several genes, and clustering analysis based on CNV revealed five clusters. The LSP1 gene had the most cases with CNV (46 deletions and 5 amplifications). High frequencies of CNV were also seen in PTPRD (21/98), GNB1L (18/98), KIAA1217 (18/98), RP1-1777G6.2 (17/98), ETS1 (11/98), RSU1 (10/98), TBC1D22A (10/98), BAHCC1 (9/98), MAML2 (9/98), RAB1B (9/98), and YIF1A (9/98). The existing literature regarding hepatocytes or other cell types has connected many of these genes to regulation of cytoskeletal architecture, signaling cascades related to growth regulation, and transcription factors directly interacting with nuclear signaling complexes. Correlations with existing literature indicate that genomic lesions associated with HCC at the level of resolution of CNV occur on many genes associated directly or indirectly with signaling pathways operating in liver regeneration and hepatocyte growth regulation. PMID:22326833

  4. Coloboma contiguous gene deletion encompassing Snap alters hippocampal plasticity.

    PubMed

    Steffensen, S C; Wilson, M C; Henriksen, S J

    1996-03-01

    Mice heterozygous for the semidominant mutation coloboma (Cm/+) display several distinct pathologies including head bobbing, ophthalmic deformation, and locomotor hyperactivity. The Cm/+ mutation comprises a contiguous gene defect which encompasses deletion of the gene Snap encoding the presynaptic nerve terminal protein SNAP-25 that is an integral component of the synaptic vesicle docking and fusion complex. Indeed, SNAP-25 is required for axonal growth and for the regulated release of neurotransmitters at the synaptic cleft. As an extension of our studies on the behavioral deficits exhibited by these mutants, including evaluation of the hyperkinesis and dopamine-related behavioral pharmacology that might be related to attention-deficit hyperactivity disorder in humans, we have studied spontaneous electroencephalographic and evoked potential recordings in the dentate gyrus of halothane-anesthetized Cm/+ and normal (+/+) littermates to evaluate potential physiological abnormalities of synaptic function in these mice. While sensory activation elicited by brief (10 sec) tail-pinch produced 1-2 min of theta rhythmic activity in +/+ mice, theta induction was markedly reduced in Cm/+ mice. There were no significant differences in dentate afferent-evoked population excitatory postsynaptic potential (pEPSP) slopes, pEPSP facilitation, or population spike (PS) amplitudes; however, paired-pulse inhibition of dentate PS amplitudes was significantly increased in Cm/+ mice. Furthermore, although brief high-frequency stimulation of the perforant path produced robust long-term potentiation (LTP) of synaptic responses in the dentate gyrus of +/+ mice, LTP was attenuated in Cm /+ mice. It has been previously demonstrated that dopamine (DA) neurotransmission is essential for induction of one type of hippocampal theta rhythm and also may modulate hippocampal LTP, suggesting that alterations in DA synaptic transmission may underlie the behavioral abnormalities, in particular the hyperactivity, associated with Cm/+ mutant mice. PMID:9132997

  5. Trehalose-related gene deletions in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a widespread corn pathogen that causes root, stalk, and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Our goal is to assess the feasibility of exploiting trehalose metabolism as a target for F. verticillioide...

  6. Gene Deletion and Functional Analysis of Fusarium verticillioides Trehalose Metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a species of fungus that causes stalk, ear, and kernel rot of corn and produces fumonisins, a group of mycotoxins that have dangerous health effects. We have observed previously that the intracellular concentration of trehalose, a disaccharide involved in resistance to st...

  7. MUPEMURE Multiple Perspectives on Multiple

    E-print Network

    Paris-Sud XI, Université de

    MUPEMURE ­ Multiple Perspectives on Multiple Representations White Paper Organizers: The MUPEMURE-00722956,version1-6Aug2012 #12; MUPEMURE ­ Multiple Perspectives on Multiple Representations Seite 1 MUPEMURE ­ Multiple Perspectives on Multiple Representations White Paper 1. Introduction and Motivation Our

  8. SAMSN1 is a tumor suppressor gene in multiple myeloma.

    PubMed

    Noll, Jacqueline E; Hewett, Duncan R; Williams, Sharon A; Vandyke, Kate; Kok, Chung; To, Luen B; Zannettino, Andrew C W

    2014-07-01

    Multiple myeloma (MM), a hematological malignancy characterized by the clonal growth of malignant plasma cells (PCs) in the bone marrow, is preceded by the benign asymptomatic condition, monoclonal gammopathy of undetermined significance (MGUS). Several genetic abnormalities have been identified as critical for the development of MM; however, a number of these abnormalities are also found in patients with MGUS, indicating that there are other, as yet unidentified, factors that contribute to the onset of MM disease. In this study, we identify a Samsn1 gene deletion in the 5TGM1/C57BL/KaLwRij murine model of myeloma. In addition, SAMSN1 expression is reduced in the malignant CD138+ PCs of patients with MM and this reduced expression correlates to total PC burden. We identify promoter methylation as a potential mechanism through which SAMSN1 expression is modulated in human myeloma cell lines. Notably, re-expression of Samsn1 in the 5TGM1 murine PC line resulted in complete inhibition of MM disease development in vivo and decreased proliferation in stromal cell-PC co-cultures in vitro. This is the first study to identify deletion of a key gene in the C57BL/KaLwRij mice that also displays reduced gene expression in patients with MM and is therefore likely to play an integral role in MM disease development. PMID:25117979

  9. Watermarking Multiple Constant Multiplications Solutions

    E-print Network

    Wong, Jennifer L.

    Watermarking Multiple Constant Multiplications Solutions Jennifer L. Wong, Ji-Qing Ya, Miodrag Potkonjak University of California, Los Angeles, CA 90095 Abstract-- Multiplications and multipliers these requirements is to use combinations of shifts and additions to execute multiplications. The approach

  10. Multiplication 2

    NSDL National Science Digital Library

    Miss Lerdahl

    2010-11-16

    Try some harder multiplication activities! Missing Factor Meteor Blasting Complete the Missing Step Batter s Up Multiplication Sum Sense Multiplication Challenge a Friend to Grand Prix Multiplication Double Digit Multiplication https://embed.espresso.co.uk/espresso/embed/images/logo_espresso.gif ) no-repeat center center" Multiplication Fun

    NSDL National Science Digital Library

    Mrs. Young

    2007-10-25

    Play to following games to pracitce your muliplicaiton tables. Hit a Home Run! Start with Multiplication Baseball (Easy). Once your have beat this team try to beat Multiplication Baseball (Medium). When you beat the first two teams try to beat this challanging team Multiplication Baseball (Hard) Learn your multiplication facts by playing Multiplication Flash Fun ...

  11. Multiplication table

    NSDL National Science Digital Library

    bgross

    2011-04-14

    Help learn First learn go over your Learn The Multiplication table now get some extra help Learn The Multiplication table have fun Learn The multiplication table with games good luck practice test pre test pre test final test ...

  12. Mastering Multiplication

    NSDL National Science Digital Library

    Ms. Jackson

    2007-10-25

    Play the following games to practice your multiplication. Take a swing at Multplication Baseball! (Set with hard) Use your multiplication knowledge and defeat the Mayan Math Monster! (Set to hard) Quick! Stop the Multiplication Invader before it is too late! ...

  13. Multiplication Rocks!!!

    NSDL National Science Digital Library

    Mrs. Peake

    2009-04-15

    Let's practice what we've learned about multiplication. Play at least one game in each of the categories. Times Table Practice: Design the Ultimate Fashion Outfit with Math Models Blast the Meteors before they destroy the ship in Meteor Multiplication More Multiplication: Batter's Up in Baseball Multiplication Win $1,000,000 in Who Wants To Be A Millionaire? ...

  14. Multiplication World

    NSDL National Science Digital Library

    Mrs. Crawford

    2007-10-25

    We will use the following games to practice and sharpen our multiplication skills. First, lets use Sum Sense Multiplication to sharpen our skills. Next we will engage in Memory Madness for Multiplication. I have a question for the class now... is this Too much multiplication to guess?. ...

  15. Multiplication Maddness!

    NSDL National Science Digital Library

    Ms. Morgan

    2008-04-03

    Review your multiplication skills with these fun and exciting games! To excercise your brain, start with a review of your multiplication facts with Matching Multiplication! Step up to the plate and use your best swing! It\\'s time to play Batter s Up Baseball! Battle through the multiplication problems to save the princess. Begin your journey of Castle Quest! ...

  16. Multiple Sclerosis

    MedlinePLUS

    Multiple sclerosis (MS) is a nervous system disease that affects your brain and spinal cord. It damages the ... attacks healthy cells in your body by mistake. Multiple sclerosis affects women more than men. It often begins ...

  17. SAMSN1 Is a Tumor Suppressor Gene in Multiple Myeloma12

    PubMed Central

    Noll, Jacqueline E.; Hewett, Duncan R.; Williams, Sharon A.; Vandyke, Kate; Kok, Chung; To, Luen B.; Zannettino, Andrew C.W.

    2014-01-01

    Multiple myeloma (MM), a hematological malignancy characterized by the clonal growth of malignant plasma cells (PCs) in the bone marrow, is preceded by the benign asymptomatic condition, monoclonal gammopathy of undetermined significance (MGUS). Several genetic abnormalities have been identified as critical for the development of MM; however, a number of these abnormalities are also found in patients with MGUS, indicating that there are other, as yet unidentified, factors that contribute to the onset of MM disease. In this study, we identify a Samsn1 gene deletion in the 5TGM1/C57BL/KaLwRij murine model of myeloma. In addition, SAMSN1 expression is reduced in the malignant CD138 + PCs of patients with MM and this reduced expression correlates to total PC burden. We identify promoter methylation as a potential mechanism through which SAMSN1 expression is modulated in human myeloma cell lines. Notably, re-expression of Samsn1 in the 5TGM1 murine PC line resulted in complete inhibition of MM disease development in vivo and decreased proliferation in stromal cell–PC co-cultures in vitro. This is the first study to identify deletion of a key gene in the C57BL/KaLwRij mice that also displays reduced gene expression in patients with MM and is therefore likely to play an integral role in MM disease development. PMID:25117979

  18. Finger Multiplication

    ERIC Educational Resources Information Center

    Simanihuruk, Mudin

    2011-01-01

    Multiplication facts are difficult to teach. Therefore many researchers have put a great deal of effort into finding multiplication strategies. Sherin and Fuson (2005) provided a good survey paper on the multiplication strategies research area. Kolpas (2002), Rendtorff (1908), Dabell (2001), Musser (1966) and Markarian (2009) proposed the finger…

  19. Multiplication Rocks!

    NSDL National Science Digital Library

    Mrs. Hyde

    2006-10-26

    Play these three games to practice your multiplication facts and have fun. Who Want\\'s to be a Mathionaire? Who Want s to be a Mathionaire? Play Multiplication Matho three times and see if you can get less errors every time. Multiplication Matho Play Lemonade Larry three times. Lemonade Larry (Math) ...

  1. Characterization of Multiple Bistratified Retinal Ganglion Cells in A Purkinje Cell Protein 2-Cre Transgenic Mouse Line

    PubMed Central

    Ivanova, Elena; Lee, Patrick; Pan, Zhuo-Hua

    2012-01-01

    Retinal ganglion cells are categorized into multiple classes, including multiple types of bistratified ganglion cells (BGCs). The recent use of transgenic mouse lines with specific type(s) of ganglion cells that are labeled by fluorescent markers has facilitated the morphological and physiological studies of BGCs, particularly the directional-selective BGCs. The most important benefit from using transgenic animals is the capability to perform in vivo gene manipulation. In particular, the Cre/LoxP recombination system has become a powerful tool, allowing gene deletion, over-expression, and ectopic expression in a cell type-specific and temporally controlled fashion. The key to this tool is the availability of Cre mouse lines with cell or tissue type-specific expression of Cre recombinase. In this study, we characterized the Cre-positive retinal ganglion cells in a PCP2 (Purkinje cell protein 2)-cre mouse line. We found that all of the Cre-positive retinal ganglion cells were BGCs. Based on morphological criteria, we determined that they can be grouped into five types. The On- and Off-dendrites of three of these types stratified outside of the cholinergic bands and differed from directional selective ganglion cells (DSGCs) morphologically. These cells were negative for Brn-3b and positive for both calretinin and CART retina markers. The remaining two types were identified as putative On-Off and On-DSGCs. This Cre mouse line could be useful for further studies of the molecular and functional properties of BGCs in mice. PMID:23224947

  2. CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae

    PubMed Central

    Mans, Robert; van Rossum, Harmen M.; Wijsman, Melanie; Backx, Antoon; Kuijpers, Niels G.A.; van den Broek, Marcel; Daran-Lapujade, Pascale; Pronk, Jack T.; van Maris, Antonius J.A.; Daran, Jean-Marc G.

    2015-01-01

    A variety of techniques for strain engineering in Saccharomyces cerevisiae have recently been developed. However, especially when multiple genetic manipulations are required, strain construction is still a time-consuming process. This study describes new CRISPR/Cas9-based approaches for easy, fast strain construction in yeast and explores their potential for simultaneous introduction of multiple genetic modifications. An open-source tool (http://yeastriction.tnw.tudelft.nl) is presented for identification of suitable Cas9 target sites in S. cerevisiae strains. A transformation strategy, using in vivo assembly of a guideRNA plasmid and subsequent genetic modification, was successfully implemented with high accuracies. An alternative strategy, using in vitro assembled plasmids containing two gRNAs, was used to simultaneously introduce up to six genetic modifications in a single transformation step with high efficiencies. Where previous studies mainly focused on the use of CRISPR/Cas9 for gene inactivation, we demonstrate the versatility of CRISPR/Cas9-based engineering of yeast by achieving simultaneous integration of a multigene construct combined with gene deletion and the simultaneous introduction of two single-nucleotide mutations at different loci. Sets of standardized plasmids, as well as the web-based Yeastriction target-sequence identifier and primer-design tool, are made available to the yeast research community to facilitate fast, standardized and efficient application of the CRISPR/Cas9 system. PMID:25743786

  3. Characterization of multiple bistratified retinal ganglion cells in a purkinje cell protein 2-Cre transgenic mouse line.

    PubMed

    Ivanova, Elena; Lee, Patrick; Pan, Zhuo-Hua

    2013-06-15

    Retinal ganglion cells are categorized into multiple classes, including multiple types of bistratified ganglion cells (BGCs). The recent use of transgenic mouse lines with specific type(s) of ganglion cells that are labeled by fluorescent markers has facilitated the morphological and physiological studies of BGCs, particularly the directional-selective BGCs. The most important benefit from using transgenic animals is the capability to perform in vivo gene manipulation. In particular, the Cre/LoxP recombination system has become a powerful tool, allowing gene deletion, overexpression, and ectopic expression in a cell type-specific and temporally controlled fashion. The key to this tool is the availability of Cre mouse lines with cell or tissue type-specific expression of Cre recombinase. In this study we characterized the Cre-positive retinal ganglion cells in a PCP2 (Purkinje cell protein 2)-cre mouse line. We found that all of the Cre-positive retinal ganglion cells were BGCs. Based on morphological criteria, we determined that they can be grouped into five types. The On- and Off-dendrites of three of these types stratified outside of the cholinergic bands and differed from directional selective ganglion cells (DSGCs) morphologically. These cells were negative for Brn-3b and positive for both calretinin and CART retina markers. The remaining two types were identified as putative On-Off and On-DSGCs. This Cre mouse line could be useful for further studies of the molecular and functional properties of BGCs in mice. PMID:23224947

  4. Multiple Correlation versus Multiple Regression.

    ERIC Educational Resources Information Center

    Huberty, Carl J.

    2003-01-01

    Describes differences between multiple correlation analysis (MCA) and multiple regression analysis (MRA), showing how these approaches involve different research questions and study designs, different inferential approaches, different analysis strategies, and different reported information. (SLD)

  5. Multiple Trichofolliculomas Mimicking Multiple Trichoepitheliomas

    PubMed Central

    Nayak, Sudhir UK; Shenoi, Shrutakirthi D; Geetha, V; Prabhu, Smitha; Nagel, Bhawna

    2015-01-01

    Trichofolliculomas are benign hair follicle hamartomas which were initially considered as hair follicle tumors. Usually presenting as a solitary lesion associated with a tuft of vellus hairs, multiple trichofolliculomas are rare. Trichofolliculomas are characterized by a histopathological feature of dermal keratin cyst with cyst wall showing radiating hair follicles. We report this case for the rare presentation of multiple trichofolliculomas on the face which clinically mimicked multiple trichoepitheliomas. PMID:25814743

  6. Multiplication Frenzy!

    NSDL National Science Digital Library

    Ms. Burks

    2010-01-27

    Let's practice multiplication! First, try to win the first place medal in the Fish Race. Then, test your skills by blowing up meteors by getting your multiplication tables right in Meteor Buster. Last, don't let the ants eat your lunch in The Ants Go Marching. ...

  7. Representing Multiplication

    ERIC Educational Resources Information Center

    Harries, Tony; Barmby, Patrick

    2008-01-01

    In this study, the authors wish to explore the use of visual representations in facilitating the understanding of multiplication. In doing so, they examine the different aspects of multiplication that they can access through different representations. In addition, they draw on a study that they have been carrying out looking at pupils' actual use…

  8. Effect of multiple mutations in tricarboxylic acid cycle and one-carbon metabolism pathways on Edwardsiella ictaluri pathogenesis.

    PubMed

    Dahal, N; Abdelhamed, H; Lu, J; Karsi, A; Lawrence, M L

    2014-02-21

    Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of catfish (ESC). We have shown recently that tricarboxylic acid cycle (TCA) and one-carbon (C1) metabolism are involved in E. ictaluri pathogenesis. However, the effect of multiple mutations in these pathways is unknown. Here, we report four novel E. ictaluri mutants carrying double gene mutations in TCA cycle (Ei?mdh?sdhC, Ei?frdA?sdhC), C1 metabolism (Ei?glyA?gcvP), and both TCA and C1 metabolism pathways (Ei?gcvP?sdhC). In-frame gene deletions were constructed by allelic exchange and mutants' virulence and vaccine efficacy were evaluated using in vivo bioluminescence imaging (BLI) as well as end point mortality counts in catfish fingerlings. Results indicated that all the double gene mutants were attenuated compared to wild-type (wt) E. ictaluri. There was a 1.39-fold average reduction in bioluminescence, and hence bacterial numbers, from all the mutants except for Ei?frdA?sdhC at 144 h post-infection. Vaccination with mutants was very effective in protecting channel catfish against subsequent infection with virulent E. ictaluri 93-146 strain. In particular, immersion vaccination resulted in complete protection. Our results provide further evidence on the importance of TCA and C1 metabolism pathways in bacterial pathogenesis. PMID:24418045

  9. Targeting multiple targets in Pseudomonas aeruginosa PAO1 using flux balance analysis of a reconstructed genome-scale metabolic network.

    PubMed

    Perumal, Deepak; Samal, Areejit; Sakharkar, Kishore R; Sakharkar, Meena K

    2011-01-01

    Constraint-based flux balance analysis (FBA) is a powerful tool for predicting target genes that can be engineered by analyzing the redistribution of metabolic fluxes on specific gene modifications. Specifically, the effects of metabolic gene deletions on flux distribution can be examined by forcing the fluxes of different reactions catalyzed by the corresponding gene product to zero. However, the target enzyme needs to be essential for survival of the organism to ensure that efficient chemical inhibition results in cell stasis or death. Here, we investigate the essentiality of enzymes in iMO1056 metabolic model of nosocomial pathogen Pseudomonas aeruginosa by performing in silico enzyme deletions using FBA. We identified 116/113 essential enzymes in rich medium in P. aeruginosa. These were then compared with human metabolic model to identify nonhomologous enzymes that could be possible drug targets. Here, we present a refined list of 41 novel potential targets for P. aeruginosa. These targets were then matched with the enzymes belonging to 97 correlated clusters through which we propose the concept of "one target per cluster." Our approach relates to the "single drug multiple target (SDMT)" concept and has potential in efficient drug target discovery. PMID:20233082

  10. Multiplication Matho

    NSDL National Science Digital Library

    A + Math

    2007-12-12

    This site has students practice their multiplication facts. They compete against the clock while picking the correct response from numerous choices. Student have Matho when they get five colored snakes in a row.

  11. Multiple myeloma

    PubMed Central

    2010-01-01

    Abstract Advances in the imaging and treatment of multiple myeloma have occurred over the past decade. This article summarises the current status and highlights how an understanding of both is necessary for optimum management. PMID:20159661

  12. Multiple Pregnancy

    MedlinePLUS Videos and Cool Tools

    ... and fraternal. What is the role of fertility drugs and Assisted Reproductive Technology in causing multiple pregnancy? ... about 1% have triplets or more. Use of drugs to cause superovulation has caused the vast majority ...

  13. A new site-specific recombinase-mediated system for targeted multiple genomic deletions employing chimeric loxP and mrpS sites.

    PubMed

    Warth, Lydia; Altenbuchner, Josef

    2013-08-01

    A newly designed site-specific recombination system is presented which allows multiple targeted markerless deletions. The most frequently used tool for removing selection markers or to introduce genes by recombination-mediated cassette exchange is the Cre/loxP system. Many mutant loxP sites have been created for this purpose. However, this study presents a chimeric mutant loxP site denoted mroxP-site. The mroxP site consists of one Cre (loxP/2) and one MrpA (mrpS/2) binding site separated by a palindromic 6-bp spacer sequence. Two mroxP-sites can be recombined by Cre recombinase in head-to-tail as well as in head-to-head orientation. In the head-to-head orientation and the loxP half-sites inside, Cre removes the loxP half-sites during site-specific recombination, creating a new site, mrmrP. The new site is essentially a mrpS site with a palindromic spacer and cannot be used by Cre for recombination anymore. It does, however, present a substrate for the recombinase MrpA. This new system has been successfully applied introducing multiple targeted gene deletions into the Escherichia coli genome. Similar to Cre/loxP and FLP/FRT, this system may be adapted for genetic engineering of other pro- and eukaryotes. PMID:23536006

  14. Current aspects of therapeutic reduction mammaplasty for immediate early breast cancer management: An update.

    PubMed

    Munhoz, Alexandre Mendonça; Montag, Eduardo; Gemperli, Rolf

    2014-02-10

    Breast-conservation surgery (BCS) is established as a safe surgical treatment for most patients with early breast cancer. Recently, advances in oncoplastic techniques are capable of preserving the breast form and quality of life. Although most BCS defects can be managed with primary closure, the aesthetic outcome may be unpredictable. Among technical options, therapeutic reduction mammaplasty (TRM) remains a useful procedure since the BCS defect can be repaired and the preoperative appearance can be improved, resulting in more proportional breasts. As a consequence of rich breast tissue vascularization, the greater part of reduction techniques have based their planning on preserving the pedicle of the nipple-areola complex after tumor removal. Reliable circulation and improvement of a conical shape to the breast are commonly described in TRM reconstructions. With an immediate approach, the surgical process is smooth since both procedures can be carried out in one operative setting. Additionally, it permits wider excision of the tumor, with a superior mean volume of the specimen and potentially reduces the incidence of margin involvement. Regardless of the fact that there is no consensus concerning the best TRM technique, the criteria is determined by the surgeon's experience, the extent/location of glandular tissue resection and the size of the defect in relation to the size of the remaining breast. The main advantages of the technique utilized should include reproducibility, low interference with the oncological treatment and long-term results. The success of the procedure depends on patient selection, coordinated planning and careful intra-operative management. PMID:24527398

  15. Immediate, Early, and Conventional Implant Placement in a Patient with History of Periodontitis

    PubMed Central

    Lanza, Alessandro; Scognamiglio, Fabio; Femiano, Felice; Lanza, Michele

    2015-01-01

    The aim of this paper is to describe a case of implant-prosthetic rehabilitation in a patient with periodontitis, focusing on the different timing of implant placement. After initial periodontal treatment, teeth with advanced mobility degree and severe bone resorption were extracted. At different healing time oral implants were placed in a prosthetic-guided position. After osseointegration period the implants were loaded and the results at one year of follow-up are presented. PMID:25949833

  16. Human cytomegalovirus immediate-early-gene expression disrupts embryogenesis in transgenic Drosophila

    Microsoft Academic Search

    Racheli Steinberg; Yonat Shemer-Avni; Noa Adler; Shira Neuman-Silberberg

    2008-01-01

    Intrauterine infection with human cytomegalovirus (HCMV) is the leading viral cause of birth defects involving the central\\u000a nervous system. Due to the highly species specific nature of the virus, its course of natural infection cannot be studied\\u000a in animal models. Here we introduce a novel transgenic Drosophila model system for studying the effects of the major viral regulatory genes, the

  17. Wounding activates immediate early transcription of genes for ERFs in tobacco plants

    Microsoft Academic Search

    Takumi Nishiuchi; Kaoru Suzuki; Sakihito Kitajima; Fumihiko Sato; Hideaki Shinshi

    2002-01-01

    We have previously demonstrated that cutting induces the rapid response of genes for ethylene-responsive transcription factors (ERFs) in leaf strips of tobacco, and that the induction was not interfered but enhanced in the presence of the protein synthesis inhibitor cycloheximide (CHX). In this study, we analyzed the expression of genes for ERFs in tobacco plants by injuring leaf tissues with

  18. Two different heat shock transcription factors regulate immediate early expression of stress genes in Arabidopsis

    Microsoft Academic Search

    C. Lohmann; G. Eggers-Schumacher; M. Wunderlich; F. Schöffl

    2004-01-01

    In order to assess the specific functional roles of different plant heat shock transcription factors (HSFs) we have isolated T-DNA insertion mutants in the AtHsf1 and AtHsf3 genes of Arabidopsis thaliana. Complete and selective loss of the promoter binding activities of AtHSF1 or AtHSF3, verified by immunoprecipitation assays, had no obvious effects on the heat shock (HS) response in the

  19. Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes

    NASA Technical Reports Server (NTRS)

    De Luca, Laurival A Jr; Xu, Zhice; Schoorlemmer, Guus H M.; Thunhorst, Robert L.; Beltz, Terry G.; Menani, Jose V.; Johnson, Alan Kim

    2002-01-01

    Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

  20. Knockout of ERK1 Enhances Cocaine-Evoked Immediate Early Gene Expression and Behavioral Plasticity

    Microsoft Academic Search

    Susan M Ferguson; Stefania Fasano; Pengwei Yang; Riccardo Brambilla; Terry E Robinson

    2006-01-01

    The ability of cocaine to produce lasting neural adaptations in mesocorticolimbic brain regions is thought to promote drug seeking and facilitate addiction in humans. The Ras-controlled Raf-MEK-ERK protein kinase signaling cascade has been implicated in the behavioral and neurobiological actions of cocaine in animals. However, these pharmacological studies have not been able to determine the specific role of the two

  1. Pretransplant immediately early-1-specific T cell responses provide protection for CMV infection after kidney transplantation.

    PubMed

    Bestard, O; Lucia, M; Crespo, E; Van Liempt, B; Palacio, D; Melilli, E; Torras, J; Llaudó, I; Cerezo, G; Taco, O; Gil-Vernet, S; Grinyó, J M; Cruzado, J M

    2013-07-01

    Cytomegalovirus (CMV) infection is still a major complication after kidney transplantation. Although cytotoxic CMV-specific T cells play a crucial role controlling CMV survival and replication, current pretransplant risk assessment for CMV infection is only based on donor/recipient (IgG)-serostatus. Here, we evaluated the usefulness of monitoring pre- and 6-month CMV-specific T cell responses against two dominant CMV antigens (IE-1 and pp65) and a CMV lysate, using an IFN-? Elispot, for predicting the advent of CMV infection in two cohorts of 137 kidney transplant recipients either receiving routine prophylaxis (n = 39) or preemptive treatment (n = 98). Incidence of CMV antigenemia/disease within the prophylaxis and preemptive group was 28%/20% and 22%/12%, respectively. Patients developing CMV infection showed significantly lower anti-IE-1-specific T cell responses than those that did not in both groups (p < 0.05). In a ROC curve analysis, low pretransplant anti-IE-1-specific T cell responses predicted the risk of both primary and late-onset CMV infection with high sensitivity and specificity (AUC > 0.70). Furthermore, when using most sensitive and specific Elispot cut-off values, a higher than 80% and 90% sensitivity and negative predictive value was obtained, respectively. Monitoring IE-1-specific T cell responses before transplantation may be useful for predicting posttransplant risk of CMV infection, thus potentially guiding decision-making regarding CMV preventive treatment. PMID:23711167

  2. STABILITY OF MULTIPLICATION OPERATORS AND MULTIPLICATION

    E-print Network

    STABILITY OF MULTIPLICATION OPERATORS AND MULTIPLICATION SEMIGROUPS FATIH BAYAZIT, RETHA HEYMANN Abstract. We investigate uniform, strong, weak and almost weak stability of multiplication semigroups transform is that it converts a differential operator into a multiplication operator induced by some scalar

  3. Multiplication Mania

    NSDL National Science Digital Library

    Ms. Macumber

    2008-10-01

    Multiplication Mania is alive & well in 4A! With this online project, you can click on the links below & turn into a multiplication maniac no matter where you are.... Who Wants to Be a Mathionaire? See if you can earn enough money to call yourself a Mathionaire Millionaire! What facts do you need to practice? Choose here & improve your Superstars status! Do you want to practice x5? x2? x4? Choose your number & then Race Against Red to see how well you ...

  4. Lattice Multiplication

    NSDL National Science Digital Library

    Interactive Math Miscellany and Puzzles, Alexander Bogomolny

    2011-01-01

    Leonardo Fibonacci's multiplication algorithm arrays the digits of multiplicands along a rectangular lattice. Read an explanation of the technique, see a few worked examples, and watch the method in action with a Java applet. Clicking a little off-center of any digit of a multiplicand (left to increase, right to decrease) instantly changes resulting products and sums throughout the lattice.

  5. Multiplication Madness!

    NSDL National Science Digital Library

    Miss Schieffer

    2009-04-21

    Practice multiplying with these fun math games! Warm up your multiplication skills with Jungle Jim as you help him multiply with the monkeys! Begin with multiplying by 2 and move up. Next, quench your thirst with the Lemonade Game as you help calculate how much money you should get for each cup of lemonade you sell. Use the number keys ...

  6. Multiple sclerosis

    Microsoft Academic Search

    John W. Rose

    1996-01-01

    Multiple sclerosis is a chronic disease that begins in late adolescence or adulthood. It is highly variable in its expression and severity. It is believed to be autoimmune in nature. The cause is unknown; both genetic and environmental factors have been implicated in the pathogenesis. MS generally presents with the acute or subacute onset of neurologic abnormalities that may wax

  7. Multiplication Game

    NSDL National Science Digital Library

    Hooda Math

    2013-03-13

    This iOS app helps develop strategic thinking and fluency with multiplication facts. Two players take turns selecting one of two factors, 1 - 9, in order to capture products on a grid. The winner is the first player to capture four in a row. This game can be played by two players or one player against the computer.

  8. Finger Multiplication

    ERIC Educational Resources Information Center

    Holmes, Bill

    2010-01-01

    The author has been prompted to write this article about finger multiplication for a number of reasons. Firstly there are a number of related articles in past issues of "Mathematics Teaching" ("MT") which have connections to this algorithm. Secondly, very few of his primary teaching students and professional colleagues appear to be aware of the…

  9. Multiple Intelligences.

    ERIC Educational Resources Information Center

    Laughlin, Janet

    1999-01-01

    Details the characteristics of Howard Gardner's seven multiple intelligences (MI): linguistic, logical-mathematical, bodily-kinesthetic, spatial, musical, interpersonal, and intrapersonal. Discusses the implications of MI for instruction. Explores how students can study using their preferred learning style - visual, auditory, and physical study…

  10. Multiple Sclerosis.

    ERIC Educational Resources Information Center

    Plummer, Nancy; Michael, Nancy, Ed.

    This module on multiple sclerosis is intended for use in inservice or continuing education programs for persons who administer medications in long-term care facilities. Instructor information, including teaching suggestions, and a listing of recommended audiovisual materials and their sources appear first. The module goal and objectives are then…

  11. Multiple overlapping homologies between two rheumatoid antigens and immunosuppressive viruses.

    PubMed Central

    Douvas, A; Sobelman, S

    1991-01-01

    Amino acid (aa) sequence homologies between viruses and autoimmune nuclear antigens are suggestive of viral involvement in disorders such as systemic lupus erythematosus (SLE) and scleroderma. We analyzed the frequency of exact homologies of greater than or equal to 5 aa between 61 viral proteins (19,827 aa), 8 nuclear antigens (3813 aa), and 41 control proteins (11,743 aa). Both pentamer and hexamer homologies between control proteins and viruses are unexpectedly abundant, with hexamer matches occurring in 1 of 3 control proteins (or once every 769 aa). However, 2 nuclear antigens, the SLE-associated 70-kDa antigen and the scleroderma-associated CENP-B protein, are highly unusual in containing multiple homologies to a group of synergizing immunosuppressive viruses. Two viruses, herpes simplex virus 1 (HSV-1) and human immunodeficiency virus 1 (HIV-1), contain sequences exactly duplicated at 15 sites in the 70-kDa antigen and at 10 sites in CENP-B protein. The immediate-early (IE) protein of HSV-1, which activates HIV-1 regulatory functions, contains three homologies to the 70-kDa antigen (two hexamers and a pentamer) and two to CENP-B (a hexamer and pentamer). There are four homologies (including a hexamer) common to the 70-kDa antigen and Epstein-Barr virus, and three homologies (including two hexamers) common to CENP-B and cytomegalovirus. The majority of homologies in both nuclear antigens are clustered in highly charged C-terminal domains containing epitopes for human autoantibodies. Furthermore, most homologies have a contiguous or overlapping distribution, thereby creating a high density of potential epitopes. In addition to the exact homologies tabulated, motifs of matching sequences are repeated frequently in these domains. Our analysis suggests that coexpression of heterologous viruses having common immunosuppressive functions may generate autoantibodies cross-reacting with certain nuclear proteins. PMID:1712488

  12. Multiple Sclerosis

    Microsoft Academic Search

    Alex C. Tselis; Omar A. Khan

    Multiple sclerosis (MS) has emerged as a treatable disorder with several disease-modifying therapies (DMTs) now licensed in\\u000a the United States for MS treatment. These are interferon (IFN)-?-1a (two formulations, Avonex and Rebif), IFN-?-1b (Betaseron),\\u000a glatiramer acetate (GA) (Copaxone), and mitoxantrone (Novantrone). Although all five DMTs were tested in phase III randomized\\u000a controlled trials (RCTs) and shown to be superior to

  13. Multiple Sclerosis

    Microsoft Academic Search

    William A. Sheremata

    Multiple sclerosis (MS) was first described by Charcot in mid-19th century Paris. Charcot, however, attributed the original\\u000a recognition of this disorder to Cruveillier, the famed professor of anatomy. Although others also described the pathological\\u000a anatomy of the disease in remarkable detail, it was Charcot who characterized the clinical illness and correlated the illness\\u000a with its unique neuropathology (1). From the

  14. Multiplication Mania!

    NSDL National Science Digital Library

    Mrs. Reeves

    2006-11-06

    You\\'ve been practicing your multiplication facts, these games will help you develop your skills! First, you will read some stories that may help you remember your 9 X Tables better. Read through these stories and pick your favorite to share with a partner sitting close to you. Click here 9 X Tables Stories With this game, you need to save the mokeys apples so the crocodile wont eat ...

  15. Experience-dependent recruitment of Arc expression in multiple systems during rest.

    PubMed

    Gheidi, Ali; Satvat, Elham; Marrone, Diano F

    2012-09-01

    The patterns of ensemble activity in the hippocampal formation during wakeful, attentive behavior are recapitulated during subsequent resting states. This replay of activity has also been found in several brain regions across many species, indicating a very general biological phenomenon. Concomitantly, transcription of immediate-early genes (IEGs) such as Arc also reoccurs in the same hippocampal neurons, suggesting that IEGs contribute to "off-line" consolidation. If continued IEG expression during rest reflects a correlate of ensemble replay, then the same generality should be observed in IEG transcription patterns. This hypothesis was tested by examining Arc in F344 rats engaging in spatial exploration alongside a rest episode. The probability that an individual neuron participates in "constitutive" Arc expression during rest is increased by recent experience in multiple cortical regions as well as across the septal and temporal poles of the hippocampus, consistent with memory trace reactivation. That is, neurons that were recently active during spatial exploration are preferentially recruited into further Arc expression during subsequent rest. The continued Arc expression, however, occurs in only a small fraction of the cells that were engaged in transcription during previous behavior. This fraction is greatest in CA3 and progressively decreases in CA1, superficial, and deep cortical layers and is consistent with the idea that consolidation occurs rapidly in the hippocampus (centering on the CA3 recurrent network) while changes are much more gradual in neocortical synaptic networks. PMID:22535445

  16. Multiple Sclerosis

    PubMed Central

    2013-01-01

    Multiple sclerosis (MS) is a chronic progressive demyelinating disease of the central nervous system. Common manifestations include paresthesias, diplopia, loss of vision, numbness or weakness of the limbs, bowel or bladder dysfunction, spasticity, ataxia, fatigue, and mental changes. Four main patterns of MS are recognized: relapsing remitting, primary progressive, secondary progressive, and progressive relapsing. The cause of MS is unknown, although it appears to be an autoimmune disease. Much of what is known about MS has been learned from an animal model of the disease, experimental allergic encephalomyelitis. PMID:24381825

  17. Multiple sclerosis.

    PubMed

    Files, Daniel Kane; Jausurawong, Tani; Katrajian, Ruba; Danoff, Robert

    2015-06-01

    Multiple sclerosis (MS) is a chronic, debilitating disease that can have devastating effects. Presentation varies widely in symptoms, pace, and progression. In addition to a thorough history and physical examination, diagnostic tools required to diagnose MS and exclude other diagnoses include MRI, evoked potential testing, and cerebrospinal fluid analysis. Although the disease is not curable presently, quality of life can be improved by minimizing the frequency and severity of disease burden. Disease modification, symptom management, preservation of function, and treatment of psychosocial issues are paramount to enhance the quality of life for the patient affected with MS. PMID:25979578

  18. p53 gene deletions in paraffin-preserved lymphold tumors from irradiated mice.

    SciTech Connect

    Paulnesku, T.; Zhang, Y.; Gemmell, M. A.; Woloschak, G. E. R.

    2000-01-01

    Experiments were performed to measure deletions in the p53 gene in paraffin-embedded tissues (tumors and control) derived from mice exposed to {gamma}-rays or neutrons up to 28 years ago. Deletions in exons 1, 3, 4, 5, 6, 7 and 9 were monitored by PCR and Southern blotting techniques. The results of these experiments demonstrated p53 deletions in only 1/6 spontaneous tumors but in 5/6 {gamma}-ray-induced and 5/6 neutron-induced tumors. Exons deleted in tumors from {gamma}-ray exposed mice were similar to those deleted in tumors from neutron-exposed mice. They document differences in spectra of p53 deletions in comparing spontaneous radiation-induced tumors.

  19. Enhanced Hydrogen Production in Escherichia coli Through Chemical Mutagenesis, Gene Deletion, and Transposon Mutagenesis 

    E-print Network

    Garzon Sanabria, Andrea Juliana

    2011-08-08

    it activates transcription (23). The C terminal domain (amino acids 918 to 692) (37) forms a helix-turn-helix for DNA binding (37) . Metabolic engineering and genetic manipulation have been powerful tools to enhance hydrogen production in E. coli (29, 30...

  20. Parathyroid hormone ablation alters erythrocyte parameters that are rescued by calcium-sensing receptor gene deletion

    PubMed Central

    Romero, Jose R.; Youte, Rodeler; Brown, Edward M.; Pollak, Martin R.; Goltzman, David; Karaplis, Andrew; Pong, Lie-Chin; Chien, Lawrence; Chattopadhyay, Naibedya; Rivera, Alicia

    2013-01-01

    The mechanisms by which parathyroid hormone (PTH) produces anemia, are unclear. Parathyroid hormone secretion is regulated by the extracellular Ca2+-sensing receptor. We investigated the effects of ablating PTH on hematological indices and erythrocytes volume regulation in wild-type, PTH-null and Ca2+-sensing receptor-null/PTH-null mice. The erythrocyte parameters were measured in whole mouse blood and volume regulatory systems were determined by plasma membrane K+ fluxes and osmotic fragility was measured by hemoglobin determination at varying osmolarities. We observed that the absence of PTH significantly increases mean erythrocyte volume and reticulocyte counts, while decreasing erythrocyte counts, hemoglobin, hematocrit, and mean corpuscular hemoglobin concentration. These changes were accompanied by increases in erythrocyte cation content, a denser cell population and increased K+ permeability, which were in part mediated by activation of the K+/Cl? cotransporter and Gardos channel. In addition we observed that erythrocyte osmotic fragility in PTH-null compared with wild-type mice was enhanced. When Ca2+-sensing receptor gene was deleted on the background of PTH-null mice, we observed that several of the alterations in erythrocyte parameters of PTH-null mice were largely rescued, particularly those related to erythrocyte volume, K+ fluxes and osmotic fragility, and became similar to those observed in wild-type mice. Our results demonstrate that Ca2+-sensing receptor and parathyroid hormone are functionally coupled to maintain erythrocyte homeostasis. PMID:23528155

  1. TIM2 gene deletion results in susceptibility to cisplatin-induced kidney toxicity.

    PubMed

    Krishnamoorthy, Aparna; Clement, Matthew E; O'Leary, Eileen; Bonventre, Joseph V; Vaidya, Vishal S

    2010-11-01

    T-cell Immunoglobulin and Mucin domain 2 (TIM2) belongs to the receptor family of cell surface molecules expressed on kidney, liver, and T cells. Previous studies have revealed that TIM2-deficient mice (TIM2(-/-)) are more susceptible to the Th2-mediated immune response in an airway inflammation model. Here, we investigated the phenotypic response of TIM2(-/-) mice to cisplatin-induced kidney toxicity. A lethality study in male BALB/c wild-type (TIM2(+/+)) and TIM2(-/-) mice, administered with 20 mg/kg cisplatin ip, resulted in 80% mortality of TIM2(-/-) mice as compared with 30% mortality in the TIM2(+/+) group by day 5. The TIM2(-/-) mice showed approximately fivefold higher injury as estimated by blood urea nitrogen and serum creatinine at 48 h that was confirmed by significantly increased proximal tubular damage assessed histologically (H & E staining). A significantly higher expression of Th2-associated cytokines, TNF-?, IL-1?, IL-6, and TGF?, with a significant reduction of Th1-associated cytokines, RANTES and MCP-1, by 72 h was observed in the TIM2(-/-) mice as compared with TIM2(+/+) mice. A higher baseline protein expression of caspase-3 (approximately twofold) coupled with an early onset of p53 protein activation by 48 h resulted in an increased apoptosis by 48-72 h in TIM2(-/-) compared with TIM2(+/+). In conclusion, the increased expression of the proinflammatory and proapoptotic genes, with a higher number of apoptotic cells, and a pronounced increase in injury and mortality of the TIM2-deficient mice collectively suggest a protective role of TIM2 in cisplatin-induced nephrotoxicity. PMID:20702592

  2. TIM2 Gene Deletion Results in Susceptibility to Cisplatin-Induced Kidney Toxicity

    PubMed Central

    Krishnamoorthy, Aparna; Clement, Matthew E.; O'leary, Eileen; Bonventre, Joseph V.; Vaidya, Vishal S.

    2010-01-01

    T-cell Immunoglobulin and Mucin domain 2 (TIM2) belongs to the receptor family of cell surface molecules expressed on kidney, liver, and T cells. Previous studies have revealed that TIM2-deficient mice (TIM2?/?) are more susceptible to the Th2-mediated immune response in an airway inflammation model. Here, we investigated the phenotypic response of TIM2?/? mice to cisplatin-induced kidney toxicity. A lethality study in male BALB/c wild-type (TIM2+/+) and TIM2?/? mice, administered with 20 mg/kg cisplatin ip, resulted in 80% mortality of TIM2?/? mice as compared with 30% mortality in the TIM2+/+ group by day 5. The TIM2?/? mice showed approximately fivefold higher injury as estimated by blood urea nitrogen and serum creatinine at 48 h that was confirmed by significantly increased proximal tubular damage assessed histologically (H & E staining). A significantly higher expression of Th2-associated cytokines, TNF-?, IL-1?, IL-6, and TGF?, with a significant reduction of Th1-associated cytokines, RANTES and MCP-1, by 72 h was observed in the TIM2?/? mice as compared with TIM2+/+ mice. A higher baseline protein expression of caspase-3 (approximately twofold) coupled with an early onset of p53 protein activation by 48 h resulted in an increased apoptosis by 48–72 h in TIM2?/? compared with TIM2+/+. In conclusion, the increased expression of the proinflammatory and proapoptotic genes, with a higher number of apoptotic cells, and a pronounced increase in injury and mortality of the TIM2-deficient mice collectively suggest a protective role of TIM2 in cisplatin-induced nephrotoxicity. PMID:20702592

  3. Genome-Wide Analysis of Syntenic Gene Deletion in the Grasses

    PubMed Central

    Schnable, James C.; Freeling, Michael; Lyons, Eric

    2012-01-01

    The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community. PMID:22275519

  4. Increased biomass production and glycogen accumulation in apcE gene deleted Synechocystis sp. PCC 6803

    PubMed Central

    2014-01-01

    The effect of phycobilisome antenna-truncation in the cyanobacterium Synechocystis sp. PCC 6803 on biomass production and glycogen accumulation have not yet been fully clarified. To investigate these effects here, the apcE gene, which encodes the anchor protein linking the phycobilisome to the thylakoid membrane, was deleted in a glucose tolerant strain of Synechocystis sp. PCC 6803. Biomass production of the apcE-deleted strain under photoautotrophic and atmospheric air conditions was 1.6 times higher than that of strain PCC 6803 (1.32?±?0.01 versus 0.84?±?0.07 g cell-dry weight L?1, respectively) after 15 days of cultivation. In addition, the glycogen content of the apcE-deleted strain (24.2?±?0.7%) was also higher than that of strain PCC 6803 (11.1?±?0.3%). Together, these results demonstrate that antenna truncation by deleting the apcE gene was effective for increasing biomass production and glycogen accumulation under photoautotrophic and atmospheric air conditions in Synechocystis sp. PCC 6803. PMID:24949254

  5. CD36 gene deletion decreases oleoylethanolamide levels in small intestine of free-feeding mice

    Microsoft Academic Search

    Ana Guijarro; Jin Fu; Giuseppe Astarita; Daniele Piomelli

    2010-01-01

    Oleoylethanolamide (OEA) is an endogenous lipid mediator that decreases food intake and enhances lipid catabolism. Dietary fat stimulates OEA mobilization in the proximal small intestine, through a mechanism that requires the participation of the membrane glycoprotein CD36 (fatty acid translocase, FAT). CD36 is highly expressed in small-intestinal enterocytes and is involved in fatty acid uptake and intracellular signaling. Here, we

  6. Gene Deletions in Mycobacterium bovis BCG Stimulate Increased CD8+ T Cell Responses

    PubMed Central

    Panas, Michael W.; Sixsmith, Jaimie D.; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T.; Moy, Brian T.; Lee, Sunhee; Schmitz, Joern E.; Jacobs, William R.; Porcelli, Steven A.; Haynes, Barton F.; Letvin, Norman L.

    2014-01-01

    Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8+ T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8+ T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8+ T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8+ T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. PMID:25287928

  7. Does gene deletion of AMPA GluA1 phenocopy features of schizoaffective disorder?

    PubMed Central

    Fitzgerald, Paul J.; Barkus, Chris; Feyder, Michael; Wiedholz, Lisa M.; Chen, Yi-Chyan; Karlsson, Rose-Marie; Machado-Vieira, Rodrigo; Graybeal, Carolyn; Sharp, Trevor; Zarate, Carlos; Harvey-White, Judith; Du, Jing; Sprengel, Rolf; Gass, Peter; Bannerman, David; Holmes, Andrew

    2010-01-01

    Glutamatergic dysfunction is strongly implicated in schizophrenia and mood disorders. GluA1 knockout (KO) mice display schizophrenia- and depression-related abnormalities. Here, we asked whether GluA1 KO show mania-related abnormalities. KO were tested for behavior in approach/avoid conflict tests, responses to repeated forced swim exposure, and locomotor responses under stress and after psychostimulant treatment. The effects of rapid dopamine depletion and treatment with lithium or GSK-3? inhibitor on KO locomotor hyperactivity were tested. Results showed that KO exhibited novelty- and stress-induced locomotor hyperactivity, reduced forced swim immobility and alterations in approach/avoid conflict tests. Psychostimulant treatment and dopamine depletion exacerbated KO locomotor hyperactivity. Lithium, but not GSK-3? inhibitor, treatment normalized KO anxiety-related behavior and partially reversed hyperlocomotor behavior, and also reversed elevated prefrontal cortex levels of phospho-MARCKS and phospho-neuromodulin. Collectively, these findings demonstrate mania-related abnormalities in GluA1 KO and, combined with previous findings, suggest this mutant may provide a novel model of features of schizoaffective disorder. PMID:20699120

  8. Gene Deletions Resulting in Increased Nitrogen Release by Azotobacter vinelandii: Application of a Novel Nitrogen Biosensor.

    PubMed

    Barney, Brett M; Eberhart, Lauren J; Ohlert, Janet M; Knutson, Carolann M; Plunkett, Mary H

    2015-07-01

    Azotobacter vinelandii is a widely studied model diazotrophic (nitrogen-fixing) bacterium and also an obligate aerobe, differentiating it from many other diazotrophs that require environments low in oxygen for the function of the nitrogenase. As a free-living bacterium, A. vinelandii has evolved enzymes and transporters to minimize the loss of fixed nitrogen to the surrounding environment. In this study, we pursued efforts to target specific enzymes and further developed screens to identify individual colonies of A. vinelandii producing elevated levels of extracellular nitrogen. Targeted deletions were done to convert urea into a terminal product by disrupting the urease genes that influence the ability of A. vinelandii to recycle the urea nitrogen within the cell. Construction of a nitrogen biosensor strain was done to rapidly screen several thousand colonies disrupted by transposon insertional mutagenesis to identify strains with increased extracellular nitrogen production. Several disruptions were identified in the ammonium transporter gene amtB that resulted in the production of sufficient levels of extracellular nitrogen to support the growth of the biosensor strain. Further studies substituting the biosensor strain with the green alga Chlorella sorokiniana confirmed that levels of nitrogen produced were sufficient to support the growth of this organism when the medium was supplemented with sufficient sucrose to support the growth of the A. vinelandii in coculture. The nature and quantities of nitrogen released by urease and amtB disruptions were further compared to strains reported in previous efforts that altered the nifLA regulatory system to produce elevated levels of ammonium. These results reveal alternative approaches that can be used in various combinations to yield new strains that might have further application in biofertilizer schemes. PMID:25888177

  9. Development of an Unmarked Gene Deletion System for the Filamentous Fungi Aspergillus niger and Talaromyces versatilis

    PubMed Central

    Delmas, Stéphane; Llanos, Agustina; Parrou, Jean-Luc; Kokolski, Matthew; Pullan, Steven T.; Shunburne, Lee

    2014-01-01

    In this article, we present a method to delete genes in filamentous fungi that allows recycling of the selection marker and is efficient in a nonhomologous end-joining (NHEJ)-proficient strain. We exemplify the approach by deletion of the gene encoding the transcriptional regulator XlnR in the fungus Aspergillus niger. To show the efficiency and advantages of the method, we deleted 8 other genes and constructed a double mutant in this species. Moreover, we showed that the same principle also functions in a different genus of filamentous fungus (Talaromyces versatilis, basionym Penicillium funiculosum). This technique will increase the versatility of the toolboxes for genome manipulation of model and industrially relevant fungi. PMID:24682295

  10. Gene deletion of KLF9 in mice results in aberrant endometrial proliferation and myometrial function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Timely regulation of uterine function is critical for successful pregnancy. Our laboratory has previously identified Basic transcription element binding protein-1/Krüppel-like factor 9 (Bteb1/Klf9), a member of Sp/KLF family of transcription factor, as a progesterone receptor (Pgr) interacting prote...

  11. CHD5 , a Tumor Suppressor Gene Deleted From 1p36.31 in Neuroblastomas

    Microsoft Academic Search

    Tomoyuki Fujita; Jun Igarashi; Erin R. Okawa; Takahiro Gotoh; Jayanthi Manne; Venkatadri Kolla; Jessica Kim; Huaqing Zhao; Bruce R. Pawel; Wendy B. London; John M. Maris; Peter S. White; Garrett M. Brodeur

    2008-01-01

    Methods We determined the methylation status of the CHD5 gene promoter in NLF and IMR5 (with 1p deletion) and SK-N-SH and SK-N-FI neuroblastoma cell lines using methylation-specific sequencing and measured CHD5 mRNA expression by reverse transcription polymerase chain reaction in cells treated with or with- out 5-aza-2-deoxycytidine, an inhibitor of DNA methylation. We transfected the cells with CHD5 and anti-

  12. Impact of rli87 gene deletion on response of Listeria monocytogenes to environmental stress.

    PubMed

    Kun, Xie; Qingling, Meng; Qiao, Jun; Yelong, Peng; Tianli, Liu; Cheng, Chen; Yu, Ma; Zhengxiang, Hu; Xuepeng, Cai; Chuangfu, Chen

    2014-10-01

    Listeria monocytogenes (LM) is a zoonotic pathogen that widely adapts to various environments. Recent studies have found that noncoding RNAs (ncRNAs) play regulatory roles in LM responses to environmental stress. To understand the role of ncRNA rli87 in the response regulation, a rli87 deletion strain LM-?rli87 was constructed by homologous recombination and tested for stress responses to high temperature, low temperature, high osmotic pressure, alcohol, acidity, alkaline and oxidative environments, along with LM EGD-e strain (control). The results showed that compared with LM EGD-e, LM-?rli87 grew faster (P < 0.05) at low temperature (30 °C), high temperature (42 °C), and in alkaline condition (pH = 9), similarly (P > 0.05) in acidic and high osmatic pressure (10% NaCl) conditions. When cultured in medium containing 3.8% ethanol, the growth was not significantly different between the two strains (P > 0.05). When cultured at pH 9, they had similar growth rates in the first 5 h (P > 0.05), but the rates were significantly different after 6 h (P < 0.05). The expression of rsbV, rsbW, hpt, clpP, and ctsR was upregulated in LM-?rli87 compared with LM EGD-e at pH 9, indicating that the rli87 gene regulated the expression of the five genes in alkaline environment. Our results suggest that the rli87 gene has an important regulatory role in LM's response to temperature (30 and 42 °C), alkaline stresses. PMID:25091276

  13. A Partial Gene Deletion of SLC45A2 Causes Oculocutaneous Albinism in Doberman Pinscher Dogs

    PubMed Central

    Winkler, Paige A.; Gornik, Kara R.; Ramsey, David T.; Dubielzig, Richard R.; Venta, Patrick J.; Petersen-Jones, Simon M.; Bartoe, Joshua T.

    2014-01-01

    The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4?77,062,968–77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

  14. Tetrahydrodipicolinate N-Succinyltransferase and Dihydrodipicolinate Synthase from Pseudomonas aeruginosa: Structure Analysis and Gene Deletion

    PubMed Central

    Schnell, Robert; Oehlmann, Wulf; Sandalova, Tatyana; Braun, Yvonne; Huck, Carmen; Maringer, Marko; Singh, Mahavir; Schneider, Gunter

    2012-01-01

    The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD) from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1?dapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity. PMID:22359568

  15. Tetrahydrodipicolinate N-succinyltransferase and dihydrodipicolinate synthase from Pseudomonas aeruginosa: structure analysis and gene deletion.

    PubMed

    Schnell, Robert; Oehlmann, Wulf; Sandalova, Tatyana; Braun, Yvonne; Huck, Carmen; Maringer, Marko; Singh, Mahavir; Schneider, Gunter

    2012-01-01

    The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD) from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1?dapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity. PMID:22359568

  16. Human Glucocorticoid Receptor Gene Deletion following Exposure to Cancer Chemotherapeutic Drugs and Chemical Mutagens 1

    Microsoft Academic Search

    Lisa A. Palmer; Bharati Hukku; Jeffrey M. Harmon

    1992-01-01

    The sensitivity of the human glucocorticoid receptor (hGR) gene to mutagenesis by the cancer chemotherapeutic drugs adriamycin, bleomy- cin, and chlorambucil was evaluated using glucocorticoid-sensitive (dex s) subciones of the human leukemic cell line CEM-C7. Treatment of cells with either bleomycin or chlorambucil increased the frequency of glucocorticoid-resistant (dex r) clones 3.3- and 10-fold, respectively. Measurement of steroid-binding activity in

  17. Human glucocorticoid receptor gene deletion following exposure to cancer chemotherapeutic drugs and chemical mutagens.

    PubMed

    Palmer, L A; Hukku, B; Harmon, J M

    1992-12-01

    The sensitivity of the human glucocorticoid receptor (hGR) gene to mutagenesis by the cancer chemotherapeutic drugs adriamycin, bleomycin, and chlorambucil was evaluated using glucocorticoid-sensitive (dexs) subclones of the human leukemic cell line CEM-C7. Treatment of cells with either bleomycin or chlorambucil increased the frequency of glucocorticoid-resistant (dexr) clones 3.3- and 10-fold, respectively. Measurement of steroid-binding activity in intact dexr cells demonstrated that the predominant phenotype of drug-induced dexr clones was receptorless (r-). dexs CEM cells express only one functional hGR allele and, in addition, are heterozygous for a BclI restriction fragment length polymorphism in the hGR gene (L. A. Palmer and J. M. Harmon, Cancer Res., 51:5224-5231, 1991). To determine the basis of the r- phenotype, BclI digests of genomic DNA isolated from r+ and r- cell lines were examined for the presence of the polymorphic 2.4- and 4.4-kilobase digestion products. A deletion of all or part of the hGR gene was demonstrated by the absence of the 4.4-kilobase fragment in one of two bleomycin-induced dexr clones, as well as the ICR191-induced dexr cell line ICR27TK.3. Cytogenetic analysis of ICR27TK.3 showed that the distal portion of the long arm of one chromosome 5 had been replaced with a portion of chromosome 15. Thus, in at least two dexr cell lines, deletions and/or chromosome breaks in the hGR locus appear to account for the r- phenotype. PMID:1384968

  18. Identification of a PKP2 gene deletion in a family with arrhythmogenic right ventricular cardiomyopathy

    PubMed Central

    Li Mura, Ilena Egle Astrid; Bauce, Barbara; Nava, Andrea; Fanciulli, Manuela; Vazza, Giovanni; Mazzotti, Elisa; Rigato, Ilaria; De Bortoli, Marzia; Beffagna, Giorgia; Lorenzon, Alessandra; Calore, Martina; Dazzo, Emanuela; Nobile, Carlo; Luisa Mostacciuolo, Maria; Corrado, Domenico; Basso, Cristina; Daliento, Luciano; Thiene, Gaetano; Rampazzo, Alessandra

    2013-01-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a primary heart muscle disease characterized by progressive myocardial loss, with fibro-fatty replacement, and high frequency of ventricular arrhythmias that can lead to sudden cardiac death. ARVC is a genetically determined disorder, usually caused by point mutations in components of the cardiac desmosome. Conventional mutation screening of ARVC genes fails to detect causative mutations in about 50% of index cases, suggesting a further genetic heterogeneity. We performed a genome-wide linkage study and a copy number variations (CNVs) analysis, using high?density SNP arrays, in an ARVC family showing no mutations in any of the desmosomal genes. The CNVs analysis identified a heterozygous deletion of about 122?kb on chromosome 12p11.21, including the entire plakophilin-2 gene and shared by all affected family members. It was not listed on any of available public CNVs databases and was confirmed by quantitative real-time PCR. This is the first SNP array-based genome-wide study leading to the identification of a CNV segregating with the disease phenotype in an ARVC family. This result underscores the importance of performing additional analysis for possible genomic deletions/duplications in ARVC patients without point mutations in known disease genes. PMID:23486541

  19. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-04-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma} rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of {sup 60}Co {gamma} rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  20. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF[sub 1] mice irradiated with [sup 60]Co [gamma] rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of [sup 60]Co [gamma] rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from [gamma]-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5[prime] region of the mRb gene.

  1. The original shaker-with-syndactylism mutation (sy) is a contiguous gene deletion syndrome.

    PubMed

    Johnson, K R; Cook, S A; Zheng, Q Y

    1998-11-01

    Tests for allelism among mice with four different mutant alleles at the shaker-with-syndactylism locus on mouse Chromosome (Chr) 18 provide evidence that the original radiation-induced mutation, sy, is a deletion including at least two genes associated with distinct phenotypes. Mice homozygous for sy have syndactylous feet and other skeletal malformations, are deaf, and exhibit abnormal behavior characteristic of vestibular dysfunction. Two less severe spontaneous mutations, shown to be allelic with sy, cause syndactylism when homozygous (hence named fused phalanges, sy(fp) and sy(fp-2J)), but do not affect hearing and behavior. Here we describe a third spontaneous mutation allelic with sy that does not affect foot morphology (hence named no syndactylism, sy(ns)), but that does cause deafness and balance defects when homozygous. Complementation test results indicate that sy(fp) and sy(fp-2J) are alleles of the same gene, but that sy(ns) is an allele of a different gene. The original sy mutation, therefore, includes both of the genes defined by these three spontaneous mutations. Typing of DNA markers in sy/sy mice revealed a deletion of approximately 1 cM in the sy region of Chr 18, including D18Mit52, D18Mit124, D18Mit181, and D18Mit205. The genetic relationships described here will aid in positional cloning efforts to identify the genes responsible for the disparate phenotypes associated with the sy locus. PMID:9799839

  2. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    SciTech Connect

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-05-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma}-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  3. Otx2 Gene Deletion in Adult Mouse Retina Induces Rapid RPE Dystrophy and Slow Photoreceptor Degeneration

    PubMed Central

    Béby, Francis; Housset, Michael; Fossat, Nicolas; Le Greneur, Coralie; Flamant, Frédéric; Godement, Pierre; Lamonerie, Thomas

    2010-01-01

    Background Many developmental genes are still active in specific tissues after development is completed. This is the case for the homeobox gene Otx2, an essential actor of forebrain and head development. In adult mouse, Otx2 is strongly expressed in the retina. Mutations of this gene in humans have been linked to severe ocular malformation and retinal diseases. It is, therefore, important to explore its post-developmental functions. In the mature retina, Otx2 is expressed in three cell types: bipolar and photoreceptor cells that belong to the neural retina and retinal pigment epithelium (RPE), a neighbour structure that forms a tightly interdependent functional unit together with photoreceptor cells. Methodology/Principal Findings Conditional self-knockout was used to address the late functions of Otx2 gene in adult mice. This strategy is based on the combination of a knock-in CreERT2 allele and a floxed allele at the Otx2 locus. Time-controlled injection of tamoxifen activates the recombinase only in Otx2 expressing cells, resulting in selective ablation of the gene in its entire domain of expression. In the adult retina, loss of Otx2 protein causes slow degeneration of photoreceptor cells. By contrast, dramatic changes of RPE activity rapidly occur, which may represent a primary cause of photoreceptor disease. Conclusions Our novel mouse model uncovers new Otx2 functions in adult retina. We show that this transcription factor is necessary for long-term maintenance of photoreceptors, likely through the control of specific activities of the RPE. PMID:20657788

  4. Dystrophin Dp71 gene deletion induces retinal vascular inflammation and capillary degeneration.

    PubMed

    El Mathari, Brahim; Sene, Abdoulaye; Charles-Messance, Hugo; Vacca, Ophélie; Guillonneau, Xavier; Grepin, Claudine; Sennlaub, Florian; Sahel, José-Alain; Rendon, Alvaro; Tadayoni, Ramin

    2015-07-15

    We have previously shown that the deletion of the dystrophin Dp71 gene induces a highly permeable blood-retinal barrier (BRB). Given that BRB breakdown is involved in retinal inflammation and the pathophysiology of many blinding eye diseases, here we investigated whether the absence of Dp71 brings out retinal vascular inflammation and vessel loss by using specific Dp71-null mice. The expression of vascular endothelial growth factor (VEGF), quantified by quantitative polymerase chain reaction and enzyme-linked immunosorbent assay methods, was higher in the retina of Dp71-null mice than in wild-type mice. In contrast, no differences were observed in VEGFR-2 and tumor necrosis factor-? expression. Moreover, mRNA expression of water channel, aquaporin 4 (AQP4) was increased after Dp71 deletion. The Dp71 deletion was also associated with the overexpression of intercellular adhesion molecule 1, which is expressed on endothelial cells surface to recruit leukocytes. Consistent with these findings, the total number of adherent leukocytes per retina, assessed after perfusion with fluorescein isothiocyanate-conjugated concanavalin A, was increased in the absence of Dp71. Finally, a significant increase in capillary degeneration quantified after retinal trypsin digestion was observed in mice lacking Dp71. These data illustrate for the first time that the deletion of Dp71 was associated with retinal vascular inflammation, vascular lesions with increased leukocyte adhesion and capillary degeneration. Thus, dystrophin Dp71 could play a critical role in retinal vascular inflammation disease, and therefore represent a potential therapeutic target. PMID:25901007

  5. Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors

    PubMed Central

    Bornemann-Kolatzki, Kirsten; Neumann, Stephan; Escobar, Hugo Murua; Nolte, Ingo; Hammer, Susanne Conradine; Hewicker-Trautwein, Marion; Junginger, Johannes; Kaup, Franz-Josef; Brenig, Bertram; Schütz, Ekkehard

    2015-01-01

    Background A somatic deletion at the proximal end of canine chromosome 27 (CFA27) was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5) and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors. Methods Droplet digital PCR for PFDN5 was performed in DNA from 102 malignant, 40 benign mammary tumors/dysplasias, 11 non-neoplastic mammary tissues and each corresponding genomic DNA from leukocytes. The copy number of PFDN5 was normalized to a reference amplicon on canine chromosome 32 (CFA32). Z-scores were calculated, based on Gaussian distributed normalized PFDN5 copy numbers of the leukocyte DNA. Z-scores ? -3.0 in tissue were considered as being indicative of the PFDN5 deletion and called as such. The Ki-67 proliferation index was assessed in a subset of 79 tissue samples by immunohistochemistry. Results The deletion was confirmed in 24% of all malignant tumors, detected in only 7.5% of the benign tumors and was not present in any normal mammary tissue sample. The subgroup of solid carcinomas (n = 9) showed the highest frequency of the deletion (67%) and those malignomas without microscopical high fraction of benign tissue (n = 71) had a 32% frequency (p<0.01 vs. benign samples). The Ki-67 score was found to be significantly higher (p<0.05) in the PFDN5-deleted group compared to malignant tumors without the deletion. Conclusions A somatic deletion of the PFDN5 gene is recurrently present in canine mammary cancer, supporting a potential role in carcinogenesis. The association of this deletion with higher Ki-67 indicates an increased proliferation rate and thus a link to tumor aggressiveness can be hypothesized. The confirmation of earlier results warrants further studies on PFDN5 as cancer-driver gene. PMID:26132936

  6. Improved techniques for endogenous epitope tagging and gene deletion in Toxoplasma gondii

    Microsoft Academic Search

    Rajendra Upadhya; Kami Kim; Ruth Hogue-Angeletti; Louis M. Weiss

    2011-01-01

    Toxoplasma gondii is an excellent model organism for studies on the biology of the Apicomplexa due to its ease of in vitro cultivation and genetic manipulation. Large-scale reverse genetic studies in T. gondii have, however, been difficult due to the low frequency of homologous recombination. Efforts to ensure homologous recombination have necessitated engineering long flanking regions in the targeting construct.

  7. Modeling Multiplication with Fractions

    NSDL National Science Digital Library

    Joseph Ratasky

    2012-08-18

    Students will relate multiplication strategies with fractions through problem solving situations. This lesson connects prior understanding of multiplication and equal groups to multiplication of fractions.

  8. Multiple myeloma.

    PubMed Central

    MacLennan, I. C.; Drayson, M.; Dunn, J.

    1994-01-01

    Multiple myeloma occurs in over 2000 new patients in England and Wales each year. It presents most frequently as bone pain and patients tend to become dehydrated and may develop renal failure. No available treatment is curative, but about two thirds of patients achieve a stable response with low dose combination chemotherapy. Combination chemotherapy including doxorubicin and carmustine with the alkylating agents cyclophosphamide and melphalan achieve a higher stable response rate than conventional treatment with melphalan and prednisone without additional haematological toxicity. These responses are associated with loss of bone pain and patients remain symptom free for months without further treatment. Relapse occurs on average in a little under two years and, though second responses are frequently obtained, the disease eventually becomes refractory. This paper looks at who should be treated and the benefits that may be expected from the treatments available. PMID:8068084

  9. Introduction Multiple Mules

    E-print Network

    Karp, Brad

    Introduction Multiple Mules Results / Conclusion Appraisal 4C38 Presentation: "Multiple Data MulesEE, UCLA 4C38 Presentation: "Multiple Data Mules" 1/36 #12;Introduction Multiple Mules Results / Conclusion by long ears and a short mane. 4C38 Presentation: "Multiple Data Mules" 2/36 #12;Introduction Multiple

  10. Complex multiplication Real multiplication On CM and RM constructions

    E-print Network

    Kohel, David R.

    Complex multiplication Real multiplication On CM and RM constructions of abelian surfaces David R 2009 #12;Complex multiplication Real multiplication On CM and RM constructions of abelian surfaces multiplication Real multiplication Contents 1 Complex multiplication CM overview Motivation: Number theory

  11. Multiple sclerosis

    PubMed Central

    Boster, Aaron L.; Racke, Michael K.

    2013-01-01

    Summary Preliminary studies have suggested that a high salt diet may play a role in the development of autoimmune disease and possibly multiple sclerosis (MS). Promising clinical trial results for 2 new therapies for MS have been reported. Dimethyl fumarate, also known by its investigational name BG-12, became the third oral disease-modifying therapy for MS to be Food and Drug Administration (FDA)–approved in March 2013. Interestingly, dimethyl fumarate served as the active compound used for the treatment of psoriasis for decades. Alemtuzumab remains under investigation and is not currently FDA-approved for treatment of MS. Other drugs currently approved for alternative indications are being investigated for use in MS. Additionally, an investigation of alternative dosing strategies for glatiramer acetate suggests that patients may benefit from a higher dose formulation and less frequent medication administration. Advances in basic science research have identified another potential autoantigenic target in MS, KIR4.1, which may provide further insight into MS pathophysiology. PMID:24175156

  12. Varicella Viruses Inhibit Interferon-Stimulated JAK-STAT Signaling through Multiple Mechanisms

    PubMed Central

    Verweij, Marieke C.; Wellish, Mary; Whitmer, Travis; Malouli, Daniel; Lapel, Martin; Jonji?, Stipan; Haas, Juergen G.; DeFilippis, Victor R.; Mahalingam, Ravi; Früh, Klaus

    2015-01-01

    Varicella zoster virus (VZV) causes chickenpox in humans and, subsequently, establishes latency in the sensory ganglia from where it reactivates to cause herpes zoster. Infection of rhesus macaques with simian varicella virus (SVV) recapitulates VZV pathogenesis in humans thus representing a suitable animal model for VZV infection. While the type I interferon (IFN) response has been shown to affect VZV replication, the virus employs counter mechanisms to prevent the induction of anti-viral IFN stimulated genes (ISG). Here, we demonstrate that SVV inhibits type I IFN-activated signal transduction via the JAK-STAT pathway. SVV-infected rhesus fibroblasts were refractory to IFN stimulation displaying reduced protein levels of IRF9 and lacking STAT2 phosphorylation. Since previous work implicated involvement of the VZV immediate early gene product ORF63 in preventing ISG-induction we studied the role of SVV ORF63 in generating resistance to IFN treatment. Interestingly, SVV ORF63 did not affect STAT2 phosphorylation but caused IRF9 degradation in a proteasome-dependent manner, suggesting that SVV employs multiple mechanisms to counteract the effect of IFN. Control of SVV ORF63 protein levels via fusion to a dihydrofolate reductase (DHFR)-degradation domain additionally confirmed its requirement for viral replication. Our results also show a prominent reduction of IRF9 and inhibition of STAT2 phosphorylation in VZV-infected cells. In addition, cells expressing VZV ORF63 blocked IFN-stimulation and displayed reduced levels of the IRF9 protein. Taken together, our data suggest that varicella ORF63 prevents ISG-induction both directly via IRF9 degradation and indirectly via transcriptional control of viral proteins that interfere with STAT2 phosphorylation. SVV and VZV thus encode multiple viral gene products that tightly control IFN-induced anti-viral responses. PMID:25973608

  13. Overexpression of N-acetylgalactosamine-4-sulphatase induces a multiple sulphatase deficiency in mucopolysaccharidosis-type-VI fibroblasts.

    PubMed Central

    Anson, D S; Muller, V; Bielicki, J; Harper, G S; Hopwood, J J

    1993-01-01

    High-titre stocks of an amphotropic retrovirus, constructed so as to express a full-length cDNA encoding the human lysosomal enzyme N-acetylgalactosamine-4-sulphatase (4-sulphatase) from the cytomegalovirus immediate early promoter, were used to infect skin fibroblasts from a clinically severe mucopolysaccharidosis type VI (MPS VI) patient. The infected MPS VI cells showed correction of the enzymic defect with the enzyme being expressed at high levels and in the correct subcellular compartment. Surprisingly this did not result in correction of glycosaminoglycan turnover as measured by accumulation of 35S in metabolically labelled cells. We demonstrate that this is apparently caused by an induced reduction of the activities of other lysosomal sulphatases, presumably due to competition for a sulphatase-specific processing mechanism by the over-expressed 4-sulphatase. The level of steroid sulphatase, which is a microsomal sulphatase, was also reduced. Infection of skin fibroblasts from a second, clinically mildly affected, MPS VI patient with the same virus also resulted in no significant change in the level of glycosaminoglycan storage. However, in this case the cause of the observed phenomenon was less clear. These results are of obvious practical importance when considering gene therapy for a sulphatase deficiency such as MPS VI and also provide possible new avenues for exploration of the processes involved in sulphatase synthesis and genetically determined multiple sulphatase deficiency. PMID:8379921

  14. Multiple hypothesis tracking for multiple target tracking

    Microsoft Academic Search

    SAMUEL S. BLACKMAN

    2004-01-01

    Multiple hypothesis tracking (MHT) is generally accepted as the preferred method for solving the data association problem in modern multiple target tracking (MTT) systems. This paper summarizes the motivations for MHT, the basic principles behind MHT and the alternative implementations in common use. It discusses the manner in which the multiple data association hypotheses formed by MHT can be combined

  15. Highly Divergent Strains of Porcine Reproductive and Respiratory Syndrome Virus Incorporate Multiple Isoforms of Nonstructural Protein 2 into Virions

    PubMed Central

    Kappes, Matthew A.; Miller, Cathy L.

    2013-01-01

    Viral structural proteins form the critical intermediary between viral infection cycles within and between hosts, function to initiate entry, participate in immediate early viral replication steps, and are major targets for the host adaptive immune response. We report the identification of nonstructural protein 2 (nsp2) as a novel structural component of the porcine reproductive and respiratory syndrome virus (PRRSV) particle. A set of custom ?-nsp2 antibodies targeting conserved epitopes within four distinct regions of nsp2 (the PLP2 protease domain [OTU], the hypervariable domain [HV], the putative transmembrane domain [TM], and the C-terminal region [C]) were obtained commercially and validated in PRRSV-infected cells. Highly purified cell-free virions of several PRRSV strains were isolated through multiple rounds of differential density gradient centrifugation and analyzed by immunoelectron microscopy (IEM) and Western blot assays using the ?-nsp2 antibodies. Purified viral preparations were found to contain pleomorphic, predominantly spherical virions of uniform size (57.9 nm ± 8.1 nm diameter; n = 50), consistent with the expected size of PRRSV particles. Analysis by IEM indicated the presence of nsp2 associated with the viral particle of diverse strains of PRRSV. Western blot analysis confirmed the presence of nsp2 in purified viral samples and revealed that multiple nsp2 isoforms were associated with the virion. Finally, a recombinant PRRSV genome containing a myc-tagged nsp2 was used to generate purified virus, and these particles were also shown to harbor myc-tagged nsp2 isoforms. Together, these data identify nsp2 as a virion-associated structural PRRSV protein and reveal that nsp2 exists in or on viral particles as multiple isoforms. PMID:24089566

  16. Background Ideas for Faster Multiplication Chunky Multiplication Conclusions Adaptive Polynomial Multiplication

    E-print Network

    Roche, Daniel S.

    Background Ideas for Faster Multiplication Chunky Multiplication Conclusions Adaptive Polynomial Multiplication Daniel S. Roche Symbolic Computation Group School of Computer Science University of Waterloo ORCCA Multiplication Chunky Multiplication Conclusions Outline 1 Background Polynomial Multiplication Adaptive Analysis

  17. Become a Multiplication Wizard!

    NSDL National Science Digital Library

    Ms. Robinson

    2010-01-27

    Practice all levels of basic multiplication facts. Are you a math magician? Practice how speedy you can be in Be A Math Magician!. Dress up and race granny in Granny Multiplication Race to make her go faster, answer the problems correctly. Multiplication that makes your mouth water. Multiplication Ice Cream Cones ...

  18. Characterization of baculovirus Autographa californica multiple nuclear polyhedrosis virus infection in mammalian cells

    SciTech Connect

    Kitajima, Masayuki [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Departments of Immunology and Pediatrics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana Chuo-ku, Chiba 260-8670 (Japan); Hamazaki, Hiroyuki [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Miyano-Kurosaki, Naoko [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Takaku, Hiroshi [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan) and High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan)]. E-mail: hiroshi.takaku@it-chiba.ac.jp

    2006-05-05

    The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is used as a vector in many gene therapy studies. Wild-type AcMNPV infects many mammalian cell types in vitro, but does not replicate. We investigated the dynamics of AcMNPV genomic DNA in infected mammalian cells and used flow cytometric analysis to demonstrate that recombinant baculovirus containing a cytomegalovirus immediate early promoter/enhancer with green fluorescent protein (GFP) expressed high levels of GFP in Huh-7 cells, but not B16, Raw264.7, or YAC-1 cells. The addition of butyrate, a deacetylase inhibitor, markedly enhanced the percentage of GFP-expressing Huh-7 and B16 cells, but not Raw264.7 and YAC-1 cells. The addition of 5-aza-2'-deoxycytidine, a DNA methylation inhibitor, had no enhancing effect. Polymerase chain reaction analysis using AcMNPV-gp64-specific primers indicated that AcMNPV infected not only Huh-7 and B16 cells, but also Raw264.7 and YAC-1 cells in vitro. The genomic DNA was detected in Huh-7 and B16 cells 96 h after infection. Genomic AcMNPV DNA in YAC-1 cells was not transported to the nucleus. Luciferase assay indicated that AcMNPV p35 gene mRNA and p35 promoter activity were clearly expressed only in Huh-7 and B16 cells. These results suggest that viral genomic DNA expression is restricted by different host cell factors, such as degradation, deacetylation, and inhibition of nuclear transport, depending on the mammalian cell type.

  19. Elk-1 a Transcription Factor with Multiple Facets in the Brain

    PubMed Central

    Besnard, Antoine; Galan-Rodriguez, Beatriz; Vanhoutte, Peter; Caboche, Jocelyne

    2011-01-01

    The ternary complex factor (TCF) Elk-1 is a transcription factor that regulates immediate early gene (IEG) expression via the serum response element (SRE) DNA consensus site. Elk-1 is associated with a dimer of serum response factor (SRF) at the SRE site, and its phosphorylation occurs at specific residues in response to mitogen-activated protein kinases (MAPKs), including c-Jun-N terminal kinase (JNK), p38/MAPK, and extracellular-signal regulated kinase (ERK). This phosphorylation event is critical for triggering SRE-dependent transcription. Although MAPKs are fundamental actors for the instatement and maintenance of memory, and much investigation of their downstream signaling partners have been conducted, no data yet clearly implicate Elk-1 in these processes. This is partly due to the complexity of Elk-1 sub-cellular localization, and hence functions, within neurons. Elk-1 is present in its resting state in the cytoplasm, where it colocalizes with mitochondrial proteins or microtubules. In this particular sub-cellular compartment, overexpression of Elk-1 is toxic for neuronal cells. When phosphorylated by the MAPK/ERK, Elk-1 translocates to the nucleus where it is implicated in regulating chromatin remodeling, SRE-dependent transcription, and neuronal differentiation. Another post-translational modification is the conjugation to SUMO (Small Ubiquitin-like MOdifier), which relocalizes Elk-1 in the cytoplasm. Thus, Elk-1 plays a dual role in neuronal functions: pro-apoptotic within the cytoplasm, and pro-differentiation within the nucleus. To address the role of Elk-1 in the brain, one must be aware of its multiple facets, and design molecular tools that will shut down Elk-1 expression, trafficking, or activation, in specific neuronal compartments. We summarize in this review the known molecular functions of Elk-1, its regulation in neuronal cells, and present evidence of its possible implication in model systems of synaptic plasticity, learning, but also in neurodegenerative diseases. PMID:21441990

  20. Reference genes for quantitative gene expression studies in multiple avian species.

    PubMed

    Olias, Philipp; Adam, Iris; Meyer, Anne; Scharff, Constance; Gruber, Achim D

    2014-01-01

    Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species. PMID:24926893

  1. The role of the PI3K-Akt signal transduction pathway in Autographa californica multiple nucleopolyhedrovirus infection of Spodoptera frugiperda cells

    SciTech Connect

    Xiao Wei; Yang Yi; Weng Qingbei; Lin Tiehao; Yuan Meijin [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China); Yang Kai, E-mail: yangkai@mail.sysu.edu.c [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China); Pang Yi [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China)

    2009-08-15

    Many viruses activate the phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway, thereby modulating diverse downstream signaling pathways associated with antiapoptosis, proliferation, cell cycling, protein synthesis and glucose metabolism, in order to augment their replication. To date, the role of the PI3K-Akt pathway in Baculovirus replication has not been defined. In the present study, we demonstrate that infection of Sf9 cells with Autographa californica multiple nucleopolyhedrovirus (AcMNPV) elevated cellular Akt phosphorylation at 1 h post-infection. The maximum Akt phosphorylation occurred at 6 h post-infection and remained unchanged until 18 h post-infection. The PI3K-specific inhibitor, LY294002, suppressed Akt phosphorylation in a dose-dependent manner, suggesting that AcMNPV-induced Akt phosphorylation is PI3K-dependent. The inhibition of PI3K-Akt activation by LY294002 significantly reduced the viral yield, including a reduction in budded viruses and occlusion bodies. The virus production was reduced only when the inhibitor was added within 24 h of infection, implying that activation of PI3K occurred early in infection. Correspondingly, both viral DNA replication and late (VP39) and very late (POLH) viral protein expression were impaired by LY294002 treatment; LY294002 had no effect on immediate-early (IE1) and early-late (GP64) protein expression. These results demonstrate that the PI3K-Akt pathway is required for efficient Baculovirus replication.

  2. Challenges of Parenting Multiples

    MedlinePLUS

    ... Parenting Multiples There are many psychological, social, and economic issues associated with multiple pregnancies. These issues should be given the same amount of attention as the medical risks. Fertility treatment makes you ...

  3. Multiplication as Replication

    NSDL National Science Digital Library

    WNET

    2008-10-07

    Students build tables and use patterns as an introduction to multiplication. They are encouraged to use multiplication by 10 or 100 for larger values as the beginnings of commutativity and distribution are introduced.

  4. Depression and Multiple Sclerosis

    MedlinePLUS

    ... various forms is common during the course of multiple sclerosis. In fact, studies have suggested that clinical depression, ... is easy to understand how a diagnosis of multiple sclerosis, a chronic condition with the potential for progressing ...

  5. Multiple Contraction Revisited

    Microsoft Academic Search

    Wolfgang Spohn

    \\u000a Multiple contraction consists in giving up several beliefs at once. The treatments of multiple contraction in AGM belief revision\\u000a theory have remained unsatisfactory. The paper proposes a clear, plausible, and general model for multiple contraction in\\u000a ranking-theoretic terms according to which multiple contraction turns out to reduce to single contractions. The belief set\\u000a multiply contracted by {A\\u000a 1, …, A

  6. Systolic Modular Multiplication

    Microsoft Academic Search

    Colin D. Walter

    1993-01-01

    A systolic array for modular multiplication is presented using the ideally suited algorithm of P.L. Montgomery (1985). Throughput is one modular multiplication every clock cycle, with a latency of 2n+2 cycles for multiplicands having n digits. Its main use would be where many consecutive multiplications are done, as in RSA cryptosystems.

  7. Lack of increased immediate early gene expression in rats reinstating cocaine-seeking behavior to discrete sensory cues.

    PubMed

    Riedy, Matthew D; Keefe, Kristen A

    2013-01-01

    Drug-seeking behavior elicited by drug-associated cues contributes to relapse in addiction; however, whether relapse elicited by drug-associated conditioned reinforcers (CR) versus discriminative stimuli (DS) involves distinct or overlapping neuronal populations is unknown. To address this question, we developed a novel cocaine self-administration and cue-induced reinstatement paradigm that exposed the same rats to distinct cocaine-associated CR and DS. Rats were trained to self-administer cocaine in separate sessions. In one, a DS signaled cocaine availability; in the other, cocaine delivery was paired with a different CR. After extinction training and reinstatement testing, where both cues were presented in separate sessions, rats were sacrificed and processed for cellular analysis of temporal activity by fluorescent in situ hybridization (CatFISH) for activity regulated cytoskeleton-associated protein (Arc) mRNA and for radioactive in situ hybridization for Arc and zif268 mRNAs. CatFISH did not reveal significant changes in Arc mRNA expression. Similar results were obtained with radioactive in situ hybridization. We have shown that while rats reinstate drug seeking in response to temporally discrete presentations of distinct drug-associated cues, such reinstatement is not associated with increased transcriptional activation of Arc or zif268 mRNAs, suggesting that expression of these genes may not be necessary for cue-induced reinstatement of drug-seeking behavior. PMID:24069163

  8. Lack of Increased Immediate Early Gene Expression in Rats Reinstating Cocaine-Seeking Behavior to Discrete Sensory Cues

    PubMed Central

    Riedy, Matthew D.; Keefe, Kristen A.

    2013-01-01

    Drug-seeking behavior elicited by drug-associated cues contributes to relapse in addiction; however, whether relapse elicited by drug-associated conditioned reinforcers (CR) versus discriminative stimuli (DS) involves distinct or overlapping neuronal populations is unknown. To address this question, we developed a novel cocaine self-administration and cue-induced reinstatement paradigm that exposed the same rats to distinct cocaine-associated CR and DS. Rats were trained to self-administer cocaine in separate sessions. In one, a DS signaled cocaine availability; in the other, cocaine delivery was paired with a different CR. After extinction training and reinstatement testing, where both cues were presented in separate sessions, rats were sacrificed and processed for cellular analysis of temporal activity by fluorescent in situ hybridization (CatFISH) for activity regulated cytoskeleton-associated protein (Arc) mRNA and for radioactive in situ hybridization for Arc and zif268 mRNAs. CatFISH did not reveal significant changes in Arc mRNA expression. Similar results were obtained with radioactive in situ hybridization. We have shown that while rats reinstate drug seeking in response to temporally discrete presentations of distinct drug-associated cues, such reinstatement is not associated with increased transcriptional activation of Arc or zif268 mRNAs, suggesting that expression of these genes may not be necessary for cue-induced reinstatement of drug-seeking behavior. PMID:24069163

  9. Group 2 coronaviruses prevent immediate early interferon induction by protection of viral RNA from host cell recognition

    SciTech Connect

    Versteeg, Gijs A. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Bredenbeek, Peter J. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Worm, Sjoerd H.E. van den [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Spaan, Willy J.M. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands)]. E-mail: w.j.m.spaan@lumc.nl

    2007-04-25

    Many viruses encode antagonists to prevent interferon (IFN) induction. Infection of fibroblasts with the murine hepatitis coronavirus (MHV) and SARS-coronavirus (SARS-CoV) did not result in nuclear translocation of interferon-regulatory factor 3 (IRF3), a key transcription factor involved in IFN induction, and induction of IFN mRNA transcription. Furthermore, MHV and SARS-CoV infection could not prevent IFN induction by poly (I:C) or Sendai virus, suggesting that these CoVs do not inactivate IRF3-mediated transcription regulation, but apparently prevent detection of replicative RNA by cellular sensory molecules. Our data indicate that shielding of viral RNA to host cell sensors might be the main general mechanism for coronaviruses to prevent IFN induction.

  10. Leucine zipper-containing WRKY proteins widen the spectrum of immediate early elicitor-induced WRKY transcription factors in parsley

    Microsoft Academic Search

    Robert S. Cormack; Thomas Eulgem; Paul J. Rushton; Petra Köchner; Klaus Hahlbrock; Imre E. Somssich

    2002-01-01

    Two new WRKY transcription factors from parsley (Petroselinum crispum), WRKY4 and WRKY5, were isolated using the yeast one-hybrid system. In yeast, both proteins interacted sequence-specifically with W boxes (TTGACC) and activated transcription. They appear to contain functional leucine zippers, which increase their affinities for W boxes. Co-transfection experiments in parsley protoplasts confirmed their in vivo-binding specificity for W boxes. Elicitor-mediated

  11. Murine Gammaherpesvirus 68 Open Reading Frame 45 Plays an Essential Role during the Immediate-Early Phase of Viral Replication

    PubMed Central

    Jia, Qingmei; Chernishof, Vasili; Bortz, Eric; Mchardy, Ian; Wu, Ting-Ting; Liao, Hsiang-I; Sun, Ren

    2005-01-01

    Murine gammaherpesvirus 68 (MHV-68) has been developed as a model for the human gammaherpesviruses Epstein-Barr virus and human herpesvirus 8/Kaposi's sarcoma-associated herpesvirus (HHV-8/KSHV), which are associated with several types of human diseases. Open reading frame 45 (ORF45) is conserved among the members of the Gammaherpesvirinae subfamily and has been suggested to be a virion tegument protein. The repression of ORF45 expression by small interfering RNAs inhibits MHV-68 viral replication. However, the gene product of MHV-68 ORF45 and its function have not yet been well characterized. In this report, we show that MHV-68 ORF45 is a phosphorylated nuclear protein. We constructed an ORF45-null MHV-68 mutant virus (45STOP) by the insertion of translation termination codons into the portion of the gene encoding the N terminus of ORF45. We demonstrated that the ORF45 protein is essential for viral gene expression immediately after the viral genome enters the nucleus. These defects in viral replication were rescued by providing ORF45 in trans or in an ORF45-null revertant (45STOP.R) virus. Using a transcomplementation assay, we showed that the function of ORF45 in viral replication is conserved with that of its KSHV homologue. Finally, we found that the C-terminal 23 amino acids that are highly conserved among the Gammaherpesvirinae subfamily are critical for the function of ORF45 in viral replication. PMID:15795297

  12. Calcium Influx via the NMDA Receptor Induces Immediate Early Gene Transcription by a MAP Kinase\\/ERK-Dependent Mechanism

    Microsoft Academic Search

    Zhengui Xia; Henryk Dudek; Cindy K. Miranti; Michael E. Greenberg

    1996-01-01

    The regulation of gene expression by neurotransmitters is likely to play a key role in neuroplasticity both during development and in the adult animal. Therefore, it is important to determine the mechanisms of neuronal gene regulation to understand fully the mechanisms of learning, memory, and other long-term adaptive changes in neurons. The neurotransmitter glutamate stimulates rapid and transient induction of

  13. Calcium influx via the NMDA receptor induces immediate early gene transcription by a MAP kinase/ERK-dependent mechanism.

    PubMed

    Xia, Z; Dudek, H; Miranti, C K; Greenberg, M E

    1996-09-01

    The regulation of gene expression by neurotransmitters is likely to play a key role in neuroplasticity both during development and in the adult animal. Therefore, it is important to determine the mechanisms of neuronal gene regulation to understand fully the mechanisms of learning, memory, and other long-term adaptive changes in neurons. The neurotransmitter glutamate stimulates rapid and transient induction of many genes, including the c-fos proto-oncogene. The c-fos promoter contains several critical regulatory elements, including the serum response element (SRE), that mediate glutamate-induced transcription in neurons; however, the mechanism by which the SRE functions in neurons has not been defined. In this study, we sought to identify transcription factors that mediate glutamate induction of transcription through the SRE in cortical neurons and to elucidate the mechanism(s) of transcriptional activation by these factors. To facilitate this analysis, we developed an improved calcium phosphate coprecipitation procedure to transiently introduce DNA into primary neurons, both efficiently and consistently. Using this protocol, we demonstrate that the transcription factors serum response factor (SRF) and Elk-1 can mediate glutamate induction of transcription through the SRE in cortical neurons. There are at least two distinct pathways by which glutamate signals through the SRE: an SRF-dependent pathway that can operate in the absence of Elk and an Elk-dependent pathway. Activation of the Elk-dependent pathway of transcription seems to require phosphorylation of Elk-1 by extracellular signal-regulated kinases (ERKs), providing evidence for a physiological function of ERKs in glutamate signaling in neurons. Taken together, these findings suggest that SRF, Elk, and ERKs may have important roles in neuroplasticity. PMID:8757255

  14. Fun with Multiplication Facts

    NSDL National Science Digital Library

    Ms. Shields

    2007-10-25

    We are going to practice our multiplication facts by having fun in the jungle! Drummin Up Our Multiplication Facts will help Jungle Jim as he beats his drums to learn his facts After you have helped Jungle Jim with his drums, join Jungle Jim and the Monkeys of Monamona while Swinging with Fact Families Memorize Multiplication Facts for extra practice after you have helped Jungle Jim! ...

  15. Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.

    PubMed

    Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

    2013-01-01

    odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

  16. Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication

    PubMed Central

    Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

    2013-01-01

    odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

  17. Multiple Linear Regression

    NSDL National Science Digital Library

    Lacey, Michelle

    This site, created by Michelle Lacey of Yale University, gives an explanation, a definition and an example of multiple linear regression. Topics include: confidence intervals, tests of significance, and squared multiple correlation. While brief, this is still a valuable site for anyone interested in statistics.

  18. Constraining Multiple Grammars

    ERIC Educational Resources Information Center

    Hopp, Holger

    2014-01-01

    This article offers the author's commentary on the Multiple Grammars (MG) language acquisition theory proposed by Luiz Amaral and Tom Roeper in the present issue. Multiple Grammars advances the claim that optionality is a constitutive characteristic of any one grammar, with interlanguage grammars being perhaps the clearest examples of a…

  19. Orchestrating Multiple Intelligences

    ERIC Educational Resources Information Center

    Moran, Seana; Kornhaber, Mindy; Gardner, Howard

    2006-01-01

    Education policymakers often go astray when they attempt to integrate multiple intelligences theory into schools, according to the originator of the theory, Howard Gardner, and his colleagues. The greatest potential of a multiple intelligences approach to education grows from the concept of a profile of intelligences. Each learner's intelligence…

  20. Multiple antibiotic allergies.

    PubMed

    Harris, R J; Harris, R L

    1978-12-01

    A case of an 18-year-old woman with postoperative infectious complications and multiple antibiotic allergies is discussed. The case poses several problems: the selection of an appropriate antibiotic to combat the infection, the persistence of the infection, and the treatment of multiple allergic responses to each of the antibiotic agents chosen. PMID:281442

  1. Multiple intracranial enterogenous cysts

    Microsoft Academic Search

    T J Walls; D P Purohit; W S Aji; I S Schofield; D D Barwick

    1986-01-01

    The case of a 40-year-old woman with increasing ataxia is described. Although the clinical presentation and evoked response studies raised the possibility of multiple sclerosis, further investigation revealed multiple cystic intracranial lesions. Surgical excision of one of the lesions relieved the patient's symptoms. Histological examination revealed that this was an enterogenous cyst. Although single cysts of this type have rarely

  2. Hadron Multiplicities at HERMES

    E-print Network

    A. Hillenbrand; M. Hartig

    2007-11-24

    Hadron multiplicities of $\\pim$, $\\pip$, $\\km$ and $\\kp$ have been measured in the deep-inelastic scattering of 27.5 GeV positrons off a hydrogen target. The data used in this analysis have been collected during the 2000 HERA running period. The multiplicities were obtained for 0.15$$ = 2.5 GeV$^2$.

  3. The Multiple Tasks Test

    Microsoft Academic Search

    Bastiaan R Bloem; Vibeke V Valkenburg; Mathilde Slabbekoorn; Mirjam D Willemsen

    2001-01-01

    Simultaneous challenge of posture and cognition (‘dual tasks’) may predict falls better than tests of isolated components of postural control. We describe a new balance test (the Multiple Tasks Test, MTT) which (1) is based upon simultaneous assessment of multiple (>2) postural components; (2) represents everyday situations; and (3) can be applied by clinicians. Relevant risk factors for falls and

  4. Interactive Multiple Scale Small Multiples Andrew S. Forsberg

    E-print Network

    Laidlaw, David

    Interactive Multiple Scale Small Multiples Jian Chen * Andrew S. Forsberg * Sharon M. Swartz this data in a 3D environment, we designed a visualization technique called multiple scale small multiples (MSSM), in which each view behaves like an environment in itself. Aggregated multiple views can also

  5. Orthopoxvirus genes for Kelch-like proteins: III. Construction of Mousepox (ectromelia) virus variants with targeted gene deletions

    Microsoft Academic Search

    G. V. Kochneva; I. V. Kolosova; T. A. Lupan; G. F. Sivolobova; P. V. Yudin; A. A. Grazhdantseva; E. I. Ryabchikova; N. Yu. Kandrina; S. N. Shchelkunov

    2009-01-01

    The mousepox (ectromelia) virus genome contains four genes encoding kelch-like proteins EVM018, EVM027, EVM150, and EVM167.\\u000a A complete set of insertion plasmids was constructed to produce recombinant ectromelia viruses with targeted deletions of\\u000a one to four genes of the kelch family, both individual (single mutants) and combined (double, triple, and quadruple mutants). It was shown that deletions\\u000a EVM018, EVM027, or

  6. AQP4 gene deletion in mice does not alter blood–brain barrier integrity or brain morphology

    Microsoft Academic Search

    S. Saadoun; M. J. Tait; A. Reza; D. Ceri Davies; B. A. Bell; A. S. Verkman; M. C. Papadopoulos

    2009-01-01

    The glial cell water channel aquaporin-4 (AQP4) plays an important role in brain edema, astrocyte migration, and neuronal excitability. Zhou et al. [Zhou J, Kong H, Hua X, Xiao M, Ding J, Hu G (2008) Altered blood–brain barrier integrity in adult aquaporin-4 knockout mice. Neuroreport 19:1–5] recently reported that AQP4 deletion significantly altered blood–brain barrier integrity and glial fibrillary acidic

  7. Efficacy of a novel virulence gene-deleted Salmonella Typhimurium vaccine for protection against Salmonella infections in growing piglets

    Microsoft Academic Search

    Jin Hur; Suck Oh Song; Jae Sam Lim; In Kie Chung; John Hwa Lee

    2011-01-01

    We have previously developed a novel attenuated Salmonella Typhimurium (S. Typhimurium) ?cpxR ?lon vaccine. This study was carried out to examine whether this vaccine could effectively protect growing piglets against Salmonella infection. Attenuated S. Typhimurium secreting the B subunit of Escherichia coli heat-labile enterotoxin was also used as a mucosal adjuvant. Pregnant sows in groups A and B were primed

  8. AQP4 gene deletion in mice does not alter blood-brain barrier integrity or brain morphology.

    PubMed

    Saadoun, S; Tait, M J; Reza, A; Davies, D Ceri; Bell, B A; Verkman, A S; Papadopoulos, M C

    2009-07-01

    The glial cell water channel aquaporin-4 (AQP4) plays an important role in brain edema, astrocyte migration, and neuronal excitability. Zhou et al. [Zhou J, Kong H, Hua X, Xiao M, Ding J, Hu G (2008) Altered blood-brain barrier integrity in adult aquaporin-4 knockout mice. Neuroreport 19:1-5] recently reported that AQP4 deletion significantly altered blood-brain barrier integrity and glial fibrillary acidic protein (GFAP) immunoreactivity in their AQP4 null mice. Here we describe a detailed characterization of baseline brain properties in our AQP4 null mice, including gross appearance, neuronal, astrocyte and oligodendrocyte characteristics, and blood-brain barrier integrity. Gross anatomical measurements included estimates of brain and ventricle size. Neurons, astrocytes and oligodendrocytes were assessed using the neuronal nuclear marker NeuN, the astrocyte marker GFAP, and the myelin stain Luxol Fast Blue. The blood-brain barrier was studied by electron microscopy and the horseradish peroxidase extravasation technique. There were no differences in brain and ventricle sizes between wild type and AQP4 null mice, nor were there differences in the cerebral cortical density of NeuN positive nuclei, perimicrovessel and glia limitans GFAP immunoreactivity, or the thickness and myelination of the corpus callosum. The ultrastructure of microvessels in the frontal cortex and caudate nucleus of wild type vs. AQP4 null mice was indistinguishable, with features including intact endothelial tight junctions, absence of perimicrovessel astrocyte foot process edema, and absence of horseradish peroxidase extravasation. In contrast to the report by Zhou et al. (2008), our data show that AQP4 deletion in mice does not produce major structural abnormalities in the brain. PMID:19345723

  9. An ITPR1 gene deletion causes spinocerebellar ataxia 15/16: a genetic, clinical and radiological description.

    PubMed

    Novak, Marianne J U; Sweeney, Mary G; Li, Abi; Treacy, Colm; Chandrashekar, Hoskote S; Giunti, Paola; Goold, Robert G; Davis, Mary B; Houlden, Henry; Tabrizi, Sarah J

    2010-10-15

    The purpose of this study was to characterise a novel family with very slowly progressive pure spinocerebellar ataxia (SCA) caused by a deletion in the inositol 1,4,5-triphosphate receptor 1 (ITPR1) gene on chromosome 3. This is a detailed clinical, genetic, and radiological description of the genotype. Deletions in ITPR1 have been shown to cause SCA15/SCA16 in six families to date. A further Japanese family has been identified with an ITPR1 point mutation. The exact prevalence is as yet unknown, but is probably higher than previously thought. The clinical phenotype of the family is described, and videotaped clinical examinations are presented. Serial brain magnetic resonance imaging studies were carried out on one affected individual, and genetic analysis was performed on several family members. Protein analysis confirmed the ITPR1 deletion. Affected subjects display a remarkably slow, almost pure cerebellar syndrome. Serial magnetic resonance imaging shows moderate cerebellar atrophy with mild inferior parietal and temporal cortical volume loss. Genetic analysis shows a deletion of 346,487 bp in ITPR1 (the second largest ITPR1 deletion reported to date), suggesting SCA15 is due to a loss of ITPR1 function. Western blotting of lymphoblastoid cell line protein confirms reduced ITPR1 protein levels. SCA15 is a slowly or nonprogressive pure cerebellar ataxia, which appears to be caused by a loss of ITPR1 function and a reduction in the translated protein. Patients with nonprogressive or slowly progressive ataxia should be screened for ITPR1 defects. PMID:20669319

  10. Featured Article: Beta cell specific pyruvate dehydrogenase alpha gene deletion results in a reduced islet number and ?-cell mass postnatally.

    PubMed

    Patel, Mulchand S; Srinivasan, Malathi; Strutt, Brenda; Mahmood, Saleh; Hill, David J

    2014-05-20

    The ability of pancreatic ?-cells to undertake glucose-stimulated insulin secretion (GSIS) depends on the generation of adenosine triphosphate (ATP) within the mitochondria from pyruvate, a major rate-limiting enzyme being pyruvate dehydrogenase (PDH) complex (PDC). However, glucose metabolism also controls ?-cell mass. To examine the role of PDC in the regulation of pancreatic ?-cell development and maturation, we generated ?-cell-targeted PDH? subunit knock-out male mice (?-PDHKO) and compared these with control males (?-PDHCT) from birth until 6-8 weeks age. Pancreas morphology, transcription factor expression, pancreatic insulin content, and circulating glucose and insulin values were compared. Compared to ?-PDHCT male mice, ?-PDHKO animals had significantly reduced pancreatic insulin content from birth, a lower serum insulin content from day 15, and relative hyperglycemia from day 30. Isolated islets from ?-PDHKO mice demonstrated a reduced GSIS. The number of islets per pancreatic area, mean islet area, and the proportion of islet cells that were ?-cells were all reduced in ?-PDHKO animals. Similarly the number of insulin-immunopositive, extra-islet small endocrine cell clusters, a possible source of ?-cell progenitors, was lower in ?-PDHKO mice. Analysis of pancreatic expression of transcription factors responsible for ?-cell lineage commitment, proliferation, and maturation, Pdx1, Neurogenin3, and NeuroD1 showed that mRNA abundance was reduced in the ?-PDHKO. This demonstrates that PDC is not only required for insulin expression and glucose-stimulated secretion, but also directly influences ?-cell growth and maturity, and positions glucose metabolism as a direct regulator of ?-cell mass and plasticity. PMID:24845368

  11. Col2CreER(T2), a mouse model for a chondrocyte-specific and inducible gene deletion.

    PubMed

    Chen, M; Li, S; Xie, W; Wang, B; Chen, D

    2014-01-01

    In 2007 and 2008, we published two articles reporting a tamoxifen (TM)-inducible, chondrocyte-specific gene-targeting mouse model in which the expression of CreER(T2) is driven by the type II collagen promoter (Col2CreER(T2)). The fusion protein is specifically expressed and translocated into the nucleus upon TM administration, which in turn triggers gene recombination. Since then, this animal model has become a powerful tool to study the molecular mechanism of skeletal development and degenerative cartilage diseases, including knee joint osteoarthritis (OA), temporomandibular joint (TMJ) OA, and intervertebral disc (IVD) degeneration. In this review article, we summarise the application of Col2CreER(T2) mice and discuss the potential usage of this animal model in a broad spectrum of cartilage development and molecular pathology studies. PMID:25340803

  12. In ovo vaccination of commercial broilers with a glycoprotein J gene-deleted strain of infectious laryngotracheitis virus.

    PubMed

    Mashchenko, Anna; Riblet, Sylva M; Zavala, Guillermo; García, Maricarmen

    2013-06-01

    Conventional live attenuated vaccines have been used as the main tool worldwide for the control of infectious laryngotracheitis. However, their suboptimal attenuation combined with poor mass administration practices allowed chicken embryo origin vaccine-derived isolates to circulate in the field, regain virulence, and be the cause of continuous outbreaks of the disease. Previous studies indicated that stable attenuation of infectious laryngotracheitis virus (ILTV) can be achieved by the deletion of individual viral genes that are not essential for viral replication in vitro. One of these genes is the glycoprotein J (gJ) gene. Its deletion provided significant attenuation to virulent ILTV strains from Europe and the United States. The objective of this study was to construct an attenuated gJ-deleted ILTV strain and evaluate its safety and efficacy for in ovo (IO) administration of commercial broilers. A novel gJ-deleted virus (N(delta)gJ) was constructed, and a 10(3) median tissue culture infective dose administered at 18 days of embryo age was considered safe because it did not affect hatchability or survivability of chickens during the first week posthatch. Broilers vaccinated IO and IO + eye drop at 14 days of age presented a significant reduction in clinical signs and reduction of virus loads after challenge, as compared with the nonvaccinated challenged group of chickens. Therefore, this study presents initial proof that the N(delta)gJ strain is a potential ILTV live-attenuated vaccine candidate suitable for IO vaccination of commercial broilers. PMID:23901771

  13. Angiotensin converting enzyme gene deletion allele is independently and strongly associated with coronary atherosclerosis and myocardial infarction.

    PubMed Central

    Arbustini, E.; Grasso, M.; Fasani, R.; Klersy, C.; Diegoli, M.; Porcu, E.; Banchieri, N.; Fortina, P.; Danesino, C.; Specchia, G.

    1995-01-01

    OBJECTIVE--To investigate the association of the three angiotensin converting enzyme (ACE) genotypes, DD, ID, and II, with the occurrence or absence of coronary atherosclerosis and with myocardial infarction and hypertension. DESIGN--Cohort analysis study. SETTING--North-Italy reference centre. SUBJECTS--388 white Italian patients (281 males; mean age 60.7 (SD 12.5) years) with proven coronary atherosclerosis (n = 255) or with angiographically normal coronary arteries (n = 133). A further group of 290 healthy blood donors was tested for allele frequency comparison. INTERVENTIONS--ACE/ID polymorphism was analysed with polymerase chain reaction on DNA from white blood cells. MAIN OUTCOME MEASURES--Coronary atherosclerosis, myocardial infarction, hypertension. RESULTS--The D and I allele frequencies were respectively 0.63 and 0.37 in the overall healthy blood donor group and 0.66 and 0.34 in the overall study group. In the latter, univariate analysis showed (1) that coronary atherosclerosis (255 patients) was associated with the deletion allele, with an odds ratio (OR) of 5.78 for DD/II, P < 0.001, and 2.39 for ID/II, P = 0.006; and (2) that myocardial infarction (154 patients) was associated with the DD genotype (OR DD/II = 2.56, P = 0.007), but not with the ID genotype (OR DD/II = 1.96, P = 0.056). Finally, hypertension proved to be unrelated with the ACE genotype. The distribution between the three genotypes of known risk factors for coronary artery disease was similar. Logistic regression modelling, performed to test the association of the selected risk factors simultaneously with coronary atherosclerosis and myocardial infarction, showed that the deletion allele (whether DD or ID) was the strongest risk factor for atherosclerosis, and that the D allele was significantly associated with the risk of infarction (although to a lesser extent than with coronary atherosclerosis). CONCLUSION--ACE deletion polymorphism is strongly and independently associated with coronary atherosclerosis and, to a lesser extent, with myocardial infarction. As such, the results are analogous to what has already been reported in French white, Japanese, and Welsh coronary patients. Images PMID:8541160

  14. ?2?-1 Gene Deletion Affects Somatosensory Neuron Function and Delays Mechanical Hypersensitivity in Response to Peripheral Nerve Damage

    PubMed Central

    Patel, Ryan; Bauer, Claudia S.; Nieto-Rostro, Manuela; Margas, Wojciech; Ferron, Laurent; Chaggar, Kanchan; Crews, Kasumi; Ramirez, Juan D.; Bennett, David L. H.; Schwartz, Arnold; Dickenson, Anthony H.

    2013-01-01

    The ?2?-1 subunit of voltage-gated calcium channels is upregulated after sensory nerve injury and is also the therapeutic target of gabapentinoid drugs. It is therefore likely to play a key role in the development of neuropathic pain. In this study, we have examined mice in which ?2?-1 gene expression is disrupted, to determine whether ?2?-1 is involved in various modalities of nociception, and for the development of behavioral hypersensitivity after partial sciatic nerve ligation (PSNL). We find that naive ?2?-1?/? mice show a marked behavioral deficit in mechanical and cold sensitivity, but no change in thermal nociception threshold. The lower mechanical sensitivity is mirrored by a reduced in vivo electrophysiological response of dorsal horn wide dynamic range neurons. The CaV2.2 level is reduced in brain and spinal cord synaptosomes from ?2?-1?/? mice, and ?2?-1?/? DRG neurons exhibit lower calcium channel current density. Furthermore, a significantly smaller number of DRG neurons respond to the TRPM8 agonist menthol. After PSNL, ?2?-1?/? mice show delayed mechanical hypersensitivity, which only develops at 11 d after surgery, whereas in wild-type littermates it is maximal at the earliest time point measured (3 d). There is no compensatory upregulation of ?2?-2 or ?2?-3 after PSNL in ?2?-1?/? mice, and other transcripts, including neuropeptide Y and activating transcription factor-3, are upregulated normally. Furthermore, the ability of pregabalin to alleviate mechanical hypersensitivity is lost in PSNL ?2?-1?/? mice. Thus, ?2?-1 is essential for rapid development of mechanical hypersensitivity in a nerve injury model of neuropathic pain. PMID:24133248

  15. Predicted and observed sizes of dystrophin in some patients with gene deletions that disrupt the open reading frame.

    PubMed Central

    Nicholson, L V; Bushby, K M; Johnson, M A; den Dunnen, J T; Ginjaar, I B; van Ommen, G J

    1992-01-01

    Among 85 patients with Duchenne and Becker muscular dystrophy, 29 were found to have mutations which disrupted the open reading frame for dystrophin. Thus any dystrophin detected in this group of patients should consist of the severely truncated polypeptides that represent prematurely terminated translation products. Dystrophin was detected in blots from 17/29 biopsies and the observed sizes of the polypeptides were compared with predicted sizes calculated in two ways: if translation was terminated at the stop codon generated by each frameshifting deletion, and if the reading frame was restored and translation proceeded. In every case the observed size matched the size predicted on the basis of a restored reading frame. This was in accord with immunocytochemical labelling of scattered dystrophin positive fibres which were found on serial sections labelled with antibodies to both the rod and C-terminal domains. Thus analysis at the protein level supports genetic evidence of exon skipping as a mechanism which restores frameshifting mutations in some fibres. Images PMID:1479604

  16. The NPHP1 Gene Deletion Associated with Juvenile Nephronophthisis Is Present in a Subset of Individuals with Joubert Syndrome

    PubMed Central

    Parisi, Melissa A.; Bennett, Craig L.; Eckert, Melissa L.; Dobyns, William B.; Gleeson, Joseph G.; Shaw, Dennis W. W.; McDonald, Ruth; Eddy, Allison; Chance, Phillip F.; Glass, Ian A.

    2004-01-01

    Joubert syndrome (JS) is an autosomal recessive multisystem disease characterized by cerebellar vermis hypoplasia with prominent superior cerebellar peduncles (the “molar tooth sign” [MTS] on axial magnetic resonance imaging), mental retardation, hypotonia, irregular breathing pattern, and eye-movement abnormalities. Some individuals with JS have retinal dystrophy and/or progressive renal failure characterized by nephronophthisis (NPHP). Thus far, no mutations in the known NPHP genes, particularly the homozygous deletion of NPHP1 at 2q13, have been identified in subjects with JS. A cohort of 25 subjects with JS and either renal and/or retinal complications and 2 subjects with only juvenile NPHP were screened for mutations in the NPHP1 gene by standard methods. Two siblings affected with a mild form of JS were found to have a homozygous deletion of the NPHP1 gene identical, by mapping, to that in subjects with NPHP alone. A control subject with NPHP and with a homozygous NPHP1 deletion was also identified, retrospectively, as having a mild MTS and borderline intelligence. The NPHP1 deletion represents the first molecular defect associated with JS in a subset of mildly affected subjects. Cerebellar malformations consistent with the MTS may be relatively common in patients with juvenile NPHP without classic symptoms of JS. PMID:15138899

  17. Evaluation of a modified-live, gene deletion mutant pseudorabies virus vaccine for field use in swine 

    E-print Network

    Lawhorn, Donald Bruce

    1989-01-01

    , 1986. 19 Previous safety evaluations had been conducted in older pigs. Pigs for this study were a three-day-old female, a three-day-old castrated male and a five-day-old castrated male pig. The three-day-old pigs were li ttermates . All pigs were... pasteurized cows' milk fed four or five times a day in heavy ceramic bowls. The five-day-old castrated male pig and the three-day-old female pig were inoculated in the neck muscle with 2 ml (10 PFU/ml) of TK- 7 PRV (8UK d13) vaccine. The unvaccinated three...

  18. Size Reversion of African Cassava Mosaic Virus Coat Protein Gene Deletion Mutants during Infection of Nicotiana benthamiana

    Microsoft Academic Search

    PANTEA ETESSAMI; JOHN WATTS; JOHN STANLEY

    1989-01-01

    SUMMARY Mutants of African cassava mosaic virus containing extensive deletions across the coat protein gene that remove up to one-third of the genomic component have been constructed and shown to be infectious when mechanically inoculated onto Nicotiana benthamiana by leaf abrasion. Using N. tabacum protoplasts we demonstrate that mutant pCLV. CPA 11, containing a 712 bp deletion, is competent for

  19. Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB

    SciTech Connect

    Lin, Hui [ORNL] [ORNL; Hurt, Jr., Richard Ashley [ORNL; Johs, Alexander [ORNL] [ORNL; Parks, Jerry M [ORNL] [ORNL; Morrell-Falvey, Jennifer L [ORNL] [ORNL; Liang, Liyuan [ORNL] [ORNL; Elias, Dwayne A [ORNL] [ORNL; Gu, Baohua [ORNL] [ORNL

    2014-01-01

    The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT, accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.

  20. CONSTRUCTION AND CHARACTERIZATION OF PTA GENE DELETED MUTANT OF C CLOSTRIDIUM TYROBUTYRICUM FOR BUTYRIC ACID FERMENTATION. (R829479C016)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  1. Glycosylation Defects and Virulence Phenotypes of Leishmania mexicana Phosphomannomutase and Dolicholphosphate-Mannose Synthase Gene Deletion Mutants

    Microsoft Academic Search

    ATTILA GARAMI; ANGELA MEHLERT; THOMAS ILG

    2001-01-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophospho- glycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glyco- inositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana

  2. Multiple Myeloma and Diabetes

    PubMed Central

    Issa, Zeinab A.; Zantout, Mira S.; Azar, Sami T.

    2011-01-01

    Multiple myeloma is a malignant plasma cell disorder that accounts for approximately 10% of all hematologic cancers. It is characterized by accumulation of clonal plasma cells, predominantly in the bone marrow. The prevalence of type 2 diabetes is increasing; therefore, it is expected that there will be an increase in the diagnosis of multiple myeloma with concomitant diabetes mellitus. The treatment of multiple myeloma and diabetes mellitus is multifaceted. The coexistence of the two conditions in a patient forms a major challenge for physicians. PMID:22363889

  3. Basic Multiple Regression

    NSDL National Science Digital Library

    Lowry, Richard, 1940-

    This page will perform basic multiple regression analysis for the case where there are several independent predictor variables, X1, X2, etc., and one dependent or criterion variable, Y. Requires import of data from a spreadsheet.

  4. Multiple Myeloma Research Foundation

    MedlinePLUS

    ... the information you need! MMRF CoMMunity Gateway Next KNOWLEDGE LEADS TO CURES. Stay informed with our newsletter. ... unacceptable. The model we have created for drug discovery and development is revolutionary. It brings multiple myeloma ...

  5. A Multiple Procedure DDT

    E-print Network

    Knight, Thomas

    1968-01-01

    This Memo. Describes a version of DDT used as the command level of the A.I. Group PDP-6 Time Sharing System (ITS). Special features include capability to handle multiple jobs, ability to stop open read or write references ...

  6. Marsh Geomorphology: Multiple methods

    E-print Network

    Savidge, Dana

    Marsh Geomorphology: Multiple methods: · RTK GPS pedestrian surveys · Single beam echo sounding · Multibeam echo sounding · RTK/single beam - 300,000 readings; multibeam - about 2,000,000 readings Purpose

  7. Rituximab and multiple sclerosis.

    PubMed

    Kitsos, Dimitrios K; Tsiodras, Sotirios; Stamboulis, Eleftherios; Voumvourakis, Konstantine I

    2012-01-01

    B lymphocytes seem to have a fundamental role in multiple sclerosis, acting as sensors, coordinators, and regulators of the immune response. Furthermore, they are important in activating T cells and they can mediate tissue injury through diverse mechanisms. Such findings have important therapeutic implications in autoimmune central nervous system diseases in a fashion similar to other autoimmune processes. The best known monoclonal antibody targeting B cells that has been used as a novel therapy for various autoimmune conditions, as well as multiple sclerosis, is rituximab. This review summarizes the available data on the role of B cell in multiple sclerosis and further reports on current knowledge on the B-cell-depleting monoclonal antibody rituximab, its mechanism of action, and its efficacy on multiple sclerosis. Data presented were categorized in 3 groups based on the nature of data presented (radiological, clinical, and immunological data). Both case-control studies and case reports were included, while table classification was in chronological order. PMID:22421587

  8. Highly divergent strains of porcine reproductive and respiratory syndrome virus incorporate multiple isoforms of nonstructural protein 2 into virions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral structural proteins formulate the critical intermediary between viral infection cycles within and between hosts, function to initiate entry, participate in immediate-early viral replication steps, and are major targets for the host adaptive immune response. We report the identification of nons...

  9. Cannabinoids and Multiple Sclerosis

    Microsoft Academic Search

    Roger G. Pertwee

    2007-01-01

    This review discusses clinical and preclinical evidence that supports the use of cannabinoid receptor agonists for the management\\u000a of multiple sclerosis. In addition, it considers preclinical findings that suggest that as well as ameliorating signs and\\u000a symptoms of multiple sclerosis, cannabinoid CB1 and\\/or CB2 receptor activation may suppress some of the pathological changes that give rise to these signs and

  10. Mobile multiple access study

    NASA Technical Reports Server (NTRS)

    1977-01-01

    Multiple access techniques (FDMA, CDMA, TDMA) for the mobile user and attempts to identify the current best technique are discussed. Traffic loading is considered as well as voice and data modulation and spacecraft and system design. Emphasis is placed on developing mobile terminal cost estimates for the selected design. In addition, design examples are presented for the alternative techniques of multiple access in order to compare with the selected technique.

  11. Multiple chemical sensitivity (MCS)

    Microsoft Academic Search

    Christian Wolf

    1996-01-01

    Multiple Chemical Sensitivity (MCS) is a systemic disorder causing central nervous, irritative and gastrointestinal symptoms,\\u000a and can be included in the category of “idiopathic environmental intolerance” (IEI). This term describes phenomena with multiple,\\u000a recurrent symptoms associated with various environmental factors that are tolerated by most people without problems. Those\\u000a advocating these concepts attribute the symptoms to exogenous substances. Those opposing

  12. Multiple Time Dimensions

    E-print Network

    Steven Weinstein

    2008-12-19

    The possibility of physics in multiple time dimensions is investigated. Drawing on recent work by Walter Craig and myself, I show that, contrary to conventional wisdom, there is a well-posed initial value problem--deterministic, stable evolution--for theories in multiple time dimensions. Though similar in many ways to ordinary, single-time theories, multi-time theories have some rather intriguing properties which suggest new directions for the understanding of fundamental physics.

  13. Multiplication as Combinations

    NSDL National Science Digital Library

    WNET.org Education

    2006-01-01

    In this lesson plan students explore how to use multiplication to find the number of combinations possible in various situations. They follow the Cyberchase kids through two short videos as they explore creating a matrix and a tree diagram to solve the number of combinations; looking for patterns across data and leading to the conclusion that the same solutions could have been found through multiplication (counting principle). The lesson plan includes two student worksheets, two assessment options, and an answer key (rtf).

  14. Extramedullary multiple myeloma

    Microsoft Academic Search

    J. Renau-Piqueras; O. Wetter; F. Miragall; A. Miguel; Ch. Hertenstein; J. Cervera; D. Brandhorst

    1982-01-01

    Summary  A case of multiple myeloma with a mediastinal tumor and other unusual findings is described. The findings included the presence\\u000a of extramedullary tumor masses at multiple sites in addition to the medullary tumor and, more interestingly, the occurence\\u000a of pleural and peritoneal effusions. The plasma cells from these effusions were analyzed using stereological morphometric\\u000a methods. The plasma cells were also

  15. Pyrochemical multiplicity counter development

    SciTech Connect

    Langner, D.G.; Dytlewski, N.; Krick, M.S.

    1991-01-01

    Impure plutonium-bearing materials from pyrochemical processes often display both significant self-multiplication and variable ({alpha},n) reaction rates. Standard neutron coincidence counting techniques usually fail to accurately measure these materials. Neutron multiplicity counters measure the third moment of the neutron multiplicity distribution and thus make it possible to deduce the fertile plutonium mass of a sample even when both the self-multiplication and the ({alpha},n) reaction rate are unknown. A multiplicity counter suitable for measuring pyrochemical materials has been designed and built. This paper describes the results of characterization studies for the new counter. The counter consists of 126 helium-3 tubes arranged in 4 concentric rings in a polyethylene moderator; the average spacing between the tubes is 1.59 cm. The end plugs for the counter are made of graphite, and the 24.1- by 37.5-cm sample cavity is cadmium lined. The counter consists of two distinct halves from which the neutron counts are summed. The counter is capable of operation in either a freestanding mode with the two halves coupled together by an external cabinet or in a glove-box mode with the two halves placed around a glovebox well and then mated. For a {sup 252}Cf source centered in the sample cavity, the measured efficiency of the new multiplicity counter is 57.7% and its die-away time is 47.2{mu}s. 8 refs., 9 figs.

  16. Multiple stage multiple filter hydrate store

    DOEpatents

    Bjorkman, Jr., Harry K. (Birmingham, MI)

    1983-05-31

    An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means or separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means.

  17. Multiple indicators, multiple causes measurement error models.

    PubMed

    Tekwe, Carmen D; Carter, Randy L; Cullings, Harry M; Carroll, Raymond J

    2014-11-10

    Multiple indicators, multiple causes (MIMIC) models are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times, however, when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are as follows: (i) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model; (ii) to develop likelihood-based estimation methods for the MIMIC ME model; and (iii) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

  18. 1 Multiple String Alignment Efficient methods for multiple sequence

    E-print Network

    Gusfield, Daniel M.

    1 Multiple String Alignment Efficient methods for multiple sequence alignment with guaranteed error Multiple string (sequence) alignment is a difficult and important problem in computa- tional biology, where for evaluating the goodness of a multiple alignment, but no efficient methods are known which compute the optimal

  19. Aspirin and multiple sclerosis.

    PubMed

    Tsau, Sheila; Emerson, Mitchell R; Lynch, Sharon G; LeVine, Steven M

    2015-01-01

    Aspirin is widely used to lessen the risks of cardiovascular events. Some studies suggest that patients with multiple sclerosis have an increased risk for some cardiovascular events, for example, venous thromboembolism and perhaps ischemic strokes, raising the possibility that aspirin could lessen these increased risks in this population or subgroups (patients with limited mobility and/or antiphospholipid antibodies). However, aspirin causes a small increased risk of hemorrhagic stroke, which is a concern as it could potentially worsen a compromised blood-brain barrier. Aspirin has the potential to ameliorate the disease process in multiple sclerosis (for example, by limiting some components of inflammation), but aspirin also has the potential to inhibit mitochondrial complex I activity, which is already reduced in multiple sclerosis. In an experimental setting of a cerebral ischemic lesion, aspirin promoted the proliferation and/or differentiation of oligodendrocyte precursors, raising the possibility that aspirin could facilitate remyelination efforts in multiple sclerosis. Other actions by aspirin may lead to small improvements of some symptoms (for example, lessening fatigue). Here we consider potential benefits and risks of aspirin usage by patients with multiple sclerosis. PMID:26123634

  20. Online multiple instance regression

    NASA Astrophysics Data System (ADS)

    Wang, Zhi-Gang; Zhao, Zeng-Shun; Zhang, Chang-Shui

    2013-09-01

    The multiple instance regression problem has become a hot research topic recently. There are several approaches to the multiple instance regression problem, such as Salience, Citation KNN, and MI-ClusterRegress. All of these solutions work in batch mode during the training step. However, in practice, examples usually arrive in sequence. Therefore, the training step cannot be accomplished once. In this paper, an online multiple instance regression method “OnlineMIR" is proposed. OnlineMIR can not only predict the label of a new bag, but also update the current regression model with the latest arrived bag. The experimental results show that OnlineMIR achieves good performances on both synthetic and real data sets.

  1. Multiple Meaning Words

    NSDL National Science Digital Library

    2013-01-28

    In this lesson, students will explore the concept that many words have multiple meaning. The students will be engaged in activities where they will use reference materials to look up the various definitions of the words and identify their parts of speech, as well as understand how the meaning of the words change depending on the context of the sentence. Students will compose sentences for words with multiple meanings, as well as write a riddle where both definitions of the word will help the reader solve the riddle. Students will work independently, as well as with their peers, in order gain a better understanding of multiple meaning words and how to identify their correct meanings using reference materials and context clues.

  2. Multiple sine, multiple elliptic gamma functions and rational cones

    E-print Network

    Tizzano, Luigi

    2015-01-01

    We define generalizations of the multiple elliptic gamma functions and the multiple sine functions, labelled by rational cones in $\\mathbb{R}^r$. For $r=2,3$ we prove that the generalized multiple elliptic gamma functions enjoy a modular property determined by the cone. This generalizes the modular properties of the elliptic gamma function studied by Felder and Varchenko. The generalized multiple sine enjoy a related infinite product representation, generalizing the results of Narukawa for the ordinary multiple sine functions.

  3. [Multiple intracranial arteriovenous malformation].

    PubMed

    Gelabert-González, Miguel; Santin-Amo, José María; Román-Pena, Paula; Vázquez Herrero, Fernando

    2015-01-01

    Multiple cerebral arteriovenous malformations (AVMs) are thought to be exceedingly rare lesions and have usually been reported as single cases. The incidence of multiple cerebral AVMs in major series ranges from 0.3% to 9% and, in the majority of cases, these malformations are associated with other vascular anomalies of the brain or soft tissues. We report a 62-year-old woman that presented with a left temporal haemorrhage. Angiography showed 3 AVMs located in the left temporal lobe, left cerebellar hemisphere and right temporal lobe. The lesions were treated with radiosurgery. PMID:25596643

  4. Multiple sort flow cytometer

    DOEpatents

    Van den Engh, Ger (Seattle, WA); Esposito, Richard J. (Seattle, WA)

    1996-01-01

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane.

  5. Factor-multiple Chains

    NSDL National Science Digital Library

    This problem offers opportunities for students to reinforce their understanding of factors and multiples and provides them the chance to justify their solutions. The goal is for the students to create number chains of four whole numbers that can range from 2 to 100 and each consecutive number is a multiple of the previous number. The Teachers' Notes page offers suggestions for implementation, key discussion questions, ideas for extension and support, and a link to a spreadsheet for students to experiment with placing numbers in specific boxes in the chain.

  6. Multiple impalement with survival

    Microsoft Academic Search

    Steven N Vaslef; Joel B Dragelin; Medhat W Takla; E. John Saliba

    1997-01-01

    An unusual case of multiple impalement by chain-link fence posts is presented in which facial, thoracic, and abdominal injuries were sustained following a rollover motor vehicle crash. Torso impalement injuries are briefly reviewed and guidelines for the management of such injuries are described.

  7. Multiple equilibrium laboratory devices

    NASA Astrophysics Data System (ADS)

    Whitehead, J. A.

    2001-12-01

    Devices{* } will be demonstrated and videotapes played of a number of laboratory studies that exhibit multiple equilibrium. All devices have two competing effects driving the flow. In two of them, temperature and salinity oppose each other. In another, air and water compete. In a fourth, wave propagation is opposed by inertia. Connection with hypothesized ocean behavior will be made. {* } Whitehead, J. A. 2000 Stratified Convection with Multiple States. Ocean Modelling, 2, 109-121. Whitehead, J. A. W. Gregory Lawson and John Salzig. 2001 Multistate flow devices for geophysical fluid dynamics and climate. American Journal of Physics, 69 546-553. Whitehead, J. A. and P. G. Baines. 2000. Hydraulic Jump Location as a Multiple Equilibrium feature. 2000 Ocean Sciences Meeting, American Geophysical Union, San Antonio Texas, January 25, 2000. Abstract: EOS 80 #46 (Supplement), OS125. Whitehead, J. A. , M. L. E. Timmermans, W. Gregory Lawson, S. N. Bulgakov, A. M. Zatarian, J. F. A. Medina, and John Salzig, Laboratory studies of thermally and/or Salinity-driven flows with partial mixing: Part 1 Stommel transitions and multiple flow states. In preparation

  8. Automatic multiple applicator electrophoresis

    NASA Technical Reports Server (NTRS)

    Grunbaum, B. W.

    1977-01-01

    Easy-to-use, economical device permits electrophoresis on all known supporting media. System includes automatic multiple-sample applicator, sample holder, and electrophoresis apparatus. System has potential applicability to fields of taxonomy, immunology, and genetics. Apparatus is also used for electrofocusing.

  9. ?Teriflunomide for multiple sclerosis.

    PubMed

    2014-07-01

    ?Teriflunomide (Aubagio-Genzyme Therapeutics), the main metabolite of the disease-modifying anti-rheumatic drug leflunomide,1 is an immunomodulatory agent with anti-inflammatory properties.2 It is a new oral treatment licensed for adults with relapsing-remitting multiple sclerosis. Here we discuss the evidence for its effectiveness and safety, and consider its place in therapy. PMID:25012149

  10. Polycrystal Plasticity -Multiple Slip"

    E-print Network

    Rollett, Anthony D.

    Polycrystal Plasticity - Multiple Slip" 27-750 Texture, Microstructure & Anisotropy A.D. Rollett;2 Objective" The objective of this lecture is to show how plastic deformation in polycrystals requires of Los Alamos polycrystal plasticity, LApp; also the Viscoplastic Selfconsistent code, VPSC; also

  11. 10monkeys Multiplication

    NSDL National Science Digital Library

    2013-07-03

    This free iOS app provides practice with multiplication facts in an arcade-like format. Students choose from among 10 levels (2 to 10 times tables and mixed times tables) and identify products of given factors in order to free trapped monkeys. Scoring rewards both accuracy and speed.

  12. Therapy of multiple personality

    Microsoft Academic Search

    Margaretta K. Bowers; Sylvia Brecher-marer; Bernauer W. Newton; Zygmunt Piotrowski; Thea C. Spyer; William S. Taylor; John G. Watkins

    1971-01-01

    In multiple personality, conflicting portions of the original personality have become 2 or more, largely disparate and autonomous personalities. Being a portion, each may be called a subpersonality. Of each 2 subpersonalities, at least one has some amnesia for the other.The therapist must be especially competent, particularly if he uses any hypnosis, deep analysis, or strong suggestion. He must avoid

  13. Unfolding Fraction Multiplication

    ERIC Educational Resources Information Center

    Wyberg, Terry; Whitney, Stephanie R.; Cramer, Kathleen A.; Monson, Debra S.; Leavitt, Seth

    2011-01-01

    Students often have difficulty understanding fractions, in general, and understanding how to multiply fractions, in particular. To move past this potential problem area, students need to develop a deeper understanding of multiplication and connect the ideas to fractions. In this article, the authors share their insights into teaching fraction…

  14. Multiplication in Newton's Principia

    E-print Network

    Jaroslaw Wawrzycki

    2012-09-24

    Newton in his Principia gives an ingenious generalization of the Hellenistic theory of ratios and inspired experimentally gives a tensor-like definition of multiplication of quantities measured with his ratios. An extraordinary feature of his definition is generality: namely his definition a priori allows non commutativity of multiplication of measured quantities, which may give a non-trivial linkage to experimental facts subject to quantum mechanics discovered some two hundred years later. Mathematical scheme he introduces with this ingenious definition is closely related to the contemporary approach in spectral geometry. His definition reveals in particular that commutativity of the multiplication of quantities with physical dimension has the status of experimental assumption and does not have to be fulfilled in reality, although neither the mathematical tools nor experimental evidence could allow Newton to carry out the case when the multiplication is noncommutative. We present a detailed analysis of his definition as well as a linkage to the theory of representations of algebras with involution (and with normal forms of von Neumann algebras and Jordan Banach algebras).

  15. Multiple Grammars and MOGUL

    ERIC Educational Resources Information Center

    Truscott, John

    2014-01-01

    Optionality is a central phenomenon in second language acquisition (SLA), for which any adequate theory must account. Amaral and Roeper (this issue; henceforth A&R) offer an appealing approach to it, using Roeper's Multiple Grammars Theory, which was created with first language in mind but which extends very naturally to SLA. They include…

  16. Combining Multiple Weak Clusterings

    Microsoft Academic Search

    Alexander P. Topchy; Anil K. Jain; William F. Punch

    2003-01-01

    A data set can be clustered in many ways depending on the clustering algorithm employed, parameter settings used and other factors. Can multiple clusterings be combined so that the final partitioning of data provides better clustering? The answer depends on the quality of clusterings to be combined as well as the properties of the fusion method. First, we introduce a

  17. Core Multiplication in Childhood

    ERIC Educational Resources Information Center

    McCrink, Koleen; Spelke, Elizabeth S.

    2010-01-01

    A dedicated, non-symbolic, system yielding imprecise representations of large quantities (approximate number system, or ANS) has been shown to support arithmetic calculations of addition and subtraction. In the present study, 5-7-year-old children without formal schooling in multiplication and division were given a task requiring a scalar…

  18. Multiple personality disorder.

    PubMed

    Salama, A A

    1995-02-01

    This paper presents a description of Multiple Personality Disorder--its development, etiology, and presentation. The paper stresses the criteria for diagnosis that can help professionals to identify individuals at an early stage. An overview of treatment approaches and indications for hospitalization, length of treatment, and goals are also explained. PMID:7891008

  19. Effects of multiple interventions

    Microsoft Academic Search

    James Robins; Miguel Hernan; Uwe Siebert

    The purpose of this chapter is (i) to describe some currently available analytical methods for using individual level epidemiological data to estimate the impact of multiple risk factor interventions on health and (ii) to carefully review the conditions under which these methods deliver unbiased estimates of impact. The chapter is organized as follows. In sections 2 and 3, we discuss

  20. Multiple Choice Test

    NSDL National Science Digital Library

    Jay Parkes

    This site presents a guide to developing and deploying effective multiple choice tests. The site also discusses the costs and benefits of this method, as well as the philosophy of this commonly used assessment method. Links to more detailed information are included as well.

  1. Multiple Stakeholders and Evaluation.

    ERIC Educational Resources Information Center

    Eichelberger, R. Tony

    Evaluations occur within a political decision-making mileau, where multiple stakeholders are contending for limited funds. Given the subjective basis of empirical information, different conclusions or recommendations about a program may result from different ideological, theoretical, and disciplinary perspectives. The logic behind the…

  2. Immunotherapy for multiple myeloma.

    PubMed

    Rosenblatt, Jacalyn; Bar-Natan, Michal; Munshi, Nikhil C; Avigan, David E

    2014-02-01

    The potential potency of the immune system in targeting malignant plasma cells in multiple myeloma is best demonstrated in the allogeneic transplant setting, where durable responses can be achieved. However, allogeneic transplantation is associated with significant morbidity and mortality related to graft versus host disease, due to the non-specific nature of allo-reactive T cell responses mediated by donor lymphocytes. Immunotherapeutic approaches that more specifically target the malignant plasma cells have the potential to improve outcomes in multiple myeloma. The development of clinically efficacious immunotherapy in multiple myeloma is dependent on achieving a greater understanding of the complex interactions between the immunologic milieu and the growth of the malignant plasma cell clone. A number of antigens have been identified on malignant plasma cells that may be targeted by both humoral and cell mediated immunotherapeutic strategies. Encouraging results have been demonstrated both pre-clinically and in clinical trials. In this review, we summarize the clinical data evaluating immunotherapeutic approaches for the treatment of multiple myeloma. PMID:24417573

  3. Olfaction in Multiple Sclerosis

    Microsoft Academic Search

    Khurshed A. Ansari

    1976-01-01

    Serial binary dilutions of amyl acetate and nitrobenzene were used in a double-blind test to determine olfactory acuity of 40 multiple sclerosis (MS) patients. Similar determinations were made on 24 age- and sex-matched controls. Results of repeated measurements on 18 patients indicated that the methodology was reliably reproducible. When mean olfactory threshold on MS patients was compared with that of

  4. IMMUNOLOGY OF MULTIPLE SCLEROSIS

    Microsoft Academic Search

    Mireia Sospedra; Roland Martin

    2005-01-01

    Ke yW ords autoimmunity, autoimmune mechanisms, neuroimmunology, demyelinating dieseases, EAE ? Abstract Multiple sclerosis (MS) develops in young adults with a complex pre- disposing genetic trait and probably requires an inciting environmental insult such as a viral infection to trigger the disease. The activation of CD4+ autoreactive T cells and their differentiation into a Th1 phenotype is a crucial event

  5. Multiple Docking Adapter Illustration

    NASA Technical Reports Server (NTRS)

    1972-01-01

    This cutaway drawing details the major characteristics of the Skylab Multiple Docking Adapter (MDA). The MDA, built under the direction of the Marshall Space Flight Center, housed the control units for the Apollo Telescope Mount (ATM), Earth Resources Experiment Package (EREP), and Zero-Gravity Materials Processing Facility, and provided a docking port for the Apollo Command Module (CM).

  6. Portable multiplicity counter

    DOEpatents

    Newell, Matthew R. (Los Alamos, NM); Jones, David Carl (Los Alamos, NM)

    2009-09-01

    A portable multiplicity counter has signal input circuitry, processing circuitry and a user/computer interface disposed in a housing. The processing circuitry, which can comprise a microcontroller integrated circuit operably coupled to shift register circuitry implemented in a field programmable gate array, is configured to be operable via the user/computer interface to count input signal pluses receivable at said signal input circuitry and record time correlations thereof in a total counting mode, coincidence counting mode and/or a multiplicity counting mode. The user/computer interface can be for example an LCD display/keypad and/or a USB interface. The counter can include a battery pack for powering the counter and low/high voltage power supplies for biasing external detectors so that the counter can be configured as a hand-held device for counting neutron events.

  7. Curability of Multiple Myeloma

    PubMed Central

    Alexanian, Raymond; Delasalle, Kay; Wang, Michael; Thomas, Sheeba; Weber, Donna

    2012-01-01

    Among 792 patients with multiple myeloma treated from 1987 to 2010 and assessed after 18 months, there were 167 patients with complete remission. For those 60 patients treated between 1987–1998 and with long followup, the latest relapse occurred after 11.8 years, so that 13 patients have remained in sustained complete remission for longer than 12 years (range 12–22 years). These results suggest that 3% of all patients treated during that period may be cured of multiple myeloma. In addition to immunofixation, more sensitive techniques for the detection of residual disease should be applied more consistently in patients with apparent complete remission in order to identify those with potential cure. PMID:22675638

  8. Core Multiplication in Childhood

    PubMed Central

    McCrink, Koleen; Spelke, Elizabeth S.

    2011-01-01

    A dedicated, non-symbolic, system yielding imprecise representations of large quantities (Approximate Number System, or ANS) has been shown to support arithmetic calculations of addition and subtraction. In the present study, 5–7-year-old children without formal schooling in multiplication and division were given a task requiring a scalar transformation of large approximate numerosities, presented as arrays of objects. In different conditions, the required calculation was doubling, quadrupling, or increasing by a fractional factor (2.5). In all conditions, participants were able to represent the outcome of the transformation at above-chance levels, even on the earliest training trials. Their performance could not be explained by processes of repeated addition, and it showed the critical ratio signature of the ANS. These findings provide evidence for an untrained, intuitive process of calculating multiplicative numerical relationships, providing a further foundation for formal arithmetic instruction. PMID:20537618

  9. Pediatric multiple sclerosis

    Microsoft Academic Search

    Brenda L. Banwell

    2004-01-01

    The onset of multiple sclerosis (MS) in childhood is being increasingly recognized. Despite this, there currently exist several\\u000a barriers to the prompt diagnosis of MS in children. Many clinicians view MS as an exclusively adult-onset disease, and thus\\u000a they may not entertain the diagnosis in a child. Also, the clinical and radiographic criteria for the diagnosis of MS have\\u000a not

  10. Clustering with Multiple Graphs

    Microsoft Academic Search

    Wei Tang; Zhengdong Lu; Inderjit S. Dhillon

    2009-01-01

    In graph-based learning models, entities are often represented as vertices in an undirected graph with weighted edges describing the relationships between entities. In many real-world application, however, entities are often associ- ated with relations of different types and\\/or from different sources, which can be well captured by multiple undirected graphs over the same set of vertices. How to exploit such

  11. Multiple membrane cavity optomechanics

    E-print Network

    M. Bhattacharya; P. Meystre

    2008-04-08

    We investigate theoretically the extension of cavity optomechanics to multiple membrane systems. We describe such a system in terms of the coupling of the collective normal modes of the membrane array to the light fields. We show these modes can be optically addressed individually and be cooled, trapped and characterized, e.g. via quantum nondemolition measurements. Analogies between this system and a linear chain of trapped ions or dipolar molecules imply the possibility of related applications in the quantum regime.

  12. Lipedema with multiple lipomas.

    PubMed

    Pascucci, Anabella; Lynch, Peter J

    2010-01-01

    Lipedema is an underdiagnosed syndrome of unclear etiology, characterized by symmetric painful enlargement of the buttocks and lower extremities, which spares the feet. This enlargement is caused by the deposition of adipose tissue. It was first described by Allen and Hines in 1940, who observed that it had a female predilection; patients commonly had an associated family history. We describe a patient with classic lipedema and multiple lipomas of her arms and trunk. PMID:20875325

  13. Multiple jet interactions 

    E-print Network

    Hehr, Roger James

    1983-01-01

    MULTIPLE JET INTERACTIONS A Thesis by ROGER JAMES HEHR Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE August 1983 Major Subject: Aerospace Engineering... augmenting ejector systems in 3 such aircraft as the Mar1ne Corps/McDonnell Douglas AV-BB "Harrier". Schetz and Krzywoblocki present comprehensive reviews on the 2 4 works published concerning jets. The theoretical and experimental work relevant...

  14. Fatigue in multiple sclerosis

    Microsoft Academic Search

    Lauren B. Krupp; Christopher Christodoulou

    2001-01-01

    Fatigue is among the most common, yet least understood, symptoms of multiple sclerosis (MS) [1·]. It can profoundly disrupt\\u000a the occupational and social functioning of patients, and is recognized as a criterion for MS disability by the Social Security\\u000a Administration. Most approaches to fatigue assessment can be classified as either self-report scales or performance-based\\u000a measures of motor or cognitive output.

  15. Multiplication of Long Integers (Faster than Long Multiplication)

    E-print Network

    Mehlhorn, Kurt

    Kapitel 1 Multiplication of Long Integers (Faster than Long Multiplication) Arno Eigenwillig und Kurt Mehlhorn An algorithm for multiplication of integers is taught already in primary school is an example: 5 6 7 8 · 4 3 2 1 2 2 7 1 2 1 7 0 3 4 1 1 3 5 6 5 6 7 8 2 4 5 3 4 6 3 8 The multiplication

  16. Factorial Invariance in Multiple Populations: A Multiple Testing Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.; Millsap, Roger E.

    2013-01-01

    A multiple testing method for examining factorial invariance for latent constructs evaluated by multiple indicators in distinct populations is outlined. The procedure is based on the false discovery rate concept and multiple individual restriction tests and resolves general limitations of a popular factorial invariance testing approach. The…

  17. Thread Organization and Matrix Multiplication matrix matrix multiplication

    E-print Network

    Verschelde, Jan

    Thread Organization and Matrix Multiplication 1 PyCUDA matrix matrix multiplication 2 Thread Multiplication L-32 4 April 2014 1 / 37 #12;about PyCUDA A. Klöckner, N. Pinto, Y. Lee, B. Catanzaro, P. Ivanov, and A. Fasih: PyCUDA and PyOpenCL: A scripting-based approach to GPU run-time code generation. Parallel

  18. Multiply with MI: Using Multiple Intelligences To Master Multiplication.

    ERIC Educational Resources Information Center

    Willis, Jody Kenny; Johnson, Aostre N.

    2001-01-01

    Explores how to use Gardner's Multiple Intelligence theory to help students' master multiplication. Focuses on helping children use their different intelligence strength to attain conceptual understanding of multiplication, develop their own thinking strategies for harder facts, and build mastery through practice and problem solving. (KHR)

  19. The Functions of Multiple Representations.

    ERIC Educational Resources Information Center

    Ainsworth, Shaaron

    1999-01-01

    Discusses multiple representations and multimedia learning environments; describes a functional taxonomy of MERs (multiple external representations); and considers how MERs are used to support cognitive processes in learning and problem solving with computers. (Contains 41 references.) (Author/LRW)

  20. Energy efficient multiple antenna communication

    E-print Network

    Ray, Siddharth, 1979-

    2006-01-01

    We consider a multiple-input, multiple-output (MIMO) wideband Rayleigh block fading channel where the channel state is unknown at the transmitter and receiver and there is only an average input power constraint. We compute ...

  1. Twins, Triplets, and Other Multiples

    MedlinePLUS

    ... what? Pregnancy This information in Spanish ( en español ) Twins, triplets, and other multiples How twins are formed ... can increase the likelihood of multiple births. How twins are formed Twins form in one of two ...

  2. Marijuana (Cannabis) and Multiple Sclerosis

    MedlinePLUS

    ... sativa — should be used for symptom management in multiple sclerosis (MS) is a complex one. It is generally ... pdf) Download Brochure Complementary and Alternative Medicine and Multiple Sclerosis (book) Find Book Massage and Bodywork Learn More ...

  3. Achieving NTRU with Montgomery Multiplication

    E-print Network

    Achieving NTRU with Montgomery Multiplication Colleen O'Rourke and Berk Sunar, Member, IEEE Abstract--In this paper, we propose a new unified architecture that utilizes the Montgomery Multiplication algorithm to perform a modular multiplication for both integers and binary polynomials and NTRU's polynomial

  4. On the Essence of Multiplication.

    ERIC Educational Resources Information Center

    Boulet, Genevieve

    1998-01-01

    Presents and criticizes current theories of multiplication in order to pave the way for an alternative foundation for the concept of multiplication. Formulates a uniform concept of multiplication that recognizes anew the importance of the roles of multiplier and multiplicand. (Contains 22 references.) (ASK)

  5. Racial predilection in multiple sclerosis

    Microsoft Academic Search

    Milton Alter; Mary Harshe

    1975-01-01

    Comparisons between the geographic distribution of multiple sclerosis and the habitats of various racial groups showed that racial factors alone could not explain the increase in prevalence of the disease with latitude. Racially similar groups living in different areas had different frequencies of multiple sclerosis. Conversely, racially different groups, living in the same area, had similar prevalence rates of multiple

  6. Multiple Sclerosis and Vitamin D

    MedlinePLUS

    ... 2011;77;e99-e100 Neurology Andrew J. Solomon Multiple sclerosis and vitamin D This information is current as ... http://www.neurology.org//cgi/collection/multiple_sclerosis Multiple sclerosis s http://www.neurology.org//cgi/collection/all_demyelinating_ ...

  7. Multiple Sparse Representations Classification

    PubMed Central

    Plenge, Esben; Klein, Stefan S.; Niessen, Wiro J.; Meijering, Erik

    2015-01-01

    Sparse representations classification (SRC) is a powerful technique for pixelwise classification of images and it is increasingly being used for a wide variety of image analysis tasks. The method uses sparse representation and learned redundant dictionaries to classify image pixels. In this empirical study we propose to further leverage the redundancy of the learned dictionaries to achieve a more accurate classifier. In conventional SRC, each image pixel is associated with a small patch surrounding it. Using these patches, a dictionary is trained for each class in a supervised fashion. Commonly, redundant/overcomplete dictionaries are trained and image patches are sparsely represented by a linear combination of only a few of the dictionary elements. Given a set of trained dictionaries, a new patch is sparse coded using each of them, and subsequently assigned to the class whose dictionary yields the minimum residual energy. We propose a generalization of this scheme. The method, which we call multiple sparse representations classification (mSRC), is based on the observation that an overcomplete, class specific dictionary is capable of generating multiple accurate and independent estimates of a patch belonging to the class. So instead of finding a single sparse representation of a patch for each dictionary, we find multiple, and the corresponding residual energies provides an enhanced statistic which is used to improve classification. We demonstrate the efficacy of mSRC for three example applications: pixelwise classification of texture images, lumen segmentation in carotid artery magnetic resonance imaging (MRI), and bifurcation point detection in carotid artery MRI. We compare our method with conventional SRC, K-nearest neighbor, and support vector machine classifiers. The results show that mSRC outperforms SRC and the other reference methods. In addition, we present an extensive evaluation of the effect of the main mSRC parameters: patch size, dictionary size, and sparsity level. PMID:26177106

  8. Multiple zeta values The Jackson integral

    E-print Network

    Baer, Christian

    Outline Multiple zeta values The Jackson integral q-multiple zeta values Multiple zeta values-9th 2013 D. Manchon Multiple zeta values and their q-analogues #12;Outline Multiple zeta values The Jackson integral q-multiple zeta values 1 Multiple zeta values Main properties Word description

  9. Factors and Multiples Puzzle

    NSDL National Science Digital Library

    This puzzle, played with cards on a board (downloadable file), provides an interesting context in which students can apply their knowledge of number properties. Students attempt to arrange 25 numbers and 10 property headings into a 5 by 5 grid so that each number satisfies two conditions. Properties addressed include primes, square and triangular numbers, specific sets of multiples and factors, and parity. It can be worked individually or in small groups cooperatively. The Teachers' Notes page offers suggestions for implementation, discussion questions, ideas for extension and support, and links to an article, "Using Games in the Classroom" (catalogued separately).

  10. Multiple jet interactions

    E-print Network

    Hehr, Roger James

    1983-01-01

    Multiple Jet Interactions. (August 1983) Roger James Hehr, B. S. , Texas A&M University Chairman of Advisory Committee: Dr. David J. Norton An experimental study to determine the effects of changing the nozzle separation ratio, h/D, of a linear array... of round jets on the veloc1ty field 40 nozzle diameters downstream of the nozzle exits was conducted. An init1al study of the individual jets comprisino the array was also conducted to provide a basis of comparison for future stud1es and for ver1ficat1...

  11. Multiplication Tables - Matching Cards

    NSDL National Science Digital Library

    This interactive Flash version of the familiar Concentration game ("pelmanism" in the UK) helps a single user practice multiplication facts while developing memory and concentration skills. The player can choose an array of 16, 20, or 24 cards, which appear face down. The goal is to flip two cards at a time to match all the pairs of factors with their products as efficiently as possible. A scoring feature discourages random guessing. Users can choose to work with factors in three ranges: 2x-10x, 2x-21x, or 11x-21x. Printable versions of the game cards are available to download.

  12. Recognizing multiple personality disorder.

    PubMed

    Curtin, S L

    1993-02-01

    1. It currently takes an average of 5 to 7 years and repeated hospitalizations for a person with multiple personality disorder (MPD) to be accurately diagnosed. 2. Reasons for misdiagnosis include the assumption that MPD is rare, the complex polysymptomatic presentation of the disorder, and failure of standard psychiatric histories to elicit pertinent diagnostic information. 3. Nurses are often the first to observe the behavioral, clinical, and physiological symptoms associated with MPD. 4. It is important to include questions that will elicit pertinent diagnostic information in the nursing history and assessment. As nurses become more adept at recognizing this disorder, individuals with MPD will receive more prompt and appropriate treatment. PMID:8437140

  13. Multiple personality disorder.

    PubMed

    Piper, A

    1994-05-01

    Five aspects of the diagnosis and treatment of multiple personality disorder (MPD) were examined. The following five conclusions were made: the contemporary diagnostic criteria are vague and overinclusive; the recent alleged increase in prevalence of the disorder is almost certainly artefactual; legal proceedings involving MPD patients raise disturbing questions about personal responsibility; there is little literature support for the theory that MPD results from childhood trauma; and many of the techniques used to diagnose and treat the condition reinforce its symptoms. A careful revision of diagnostic criteria for the disorder is recommended. PMID:7921709

  14. Complex Gaussian Multiplicative Chaos

    NASA Astrophysics Data System (ADS)

    Lacoin, Hubert; Rhodes, Rémi; Vargas, Vincent

    2015-07-01

    In this article, we study complex Gaussian multiplicative chaos. More precisely, we study the renormalization theory and the limit of the exponential of a complex log-correlated Gaussian field in all dimensions (including Gaussian Free Fields in dimension 2). Our main working assumption is that the real part and the imaginary part are independent. We also discuss applications in 2 D string theory; in particular we give a rigorous mathematical definition of the so-called Tachyon fields, the conformally invariant operators in critical Liouville Quantum Gravity with a c = 1 central charge, and derive the original KPZ formula for these fields.

  15. Multiple stars: designation, catalogues, statistics

    E-print Network

    A. Tokovinin

    2006-01-23

    Discussion of the designation of multiple-star components leads to a conclusion that, apart from components, we need to designate systems and centers-of-mass. The hierarchy is coded then by simple links to parent. This system is adopted in the multiple star catalogue, now available on-line. A short review of multiple-star statistics is given: the frequency of different multiplicities in the field, periods of spectroscopic sub-systems, relative orbit orientation, empirical stability criterion, and period-period diagram with its possible connection to formation of multiple stars.

  16. Phase-multiplication holography

    SciTech Connect

    Collins, H.D.; Prince, J.M.; Davis, T.J.

    1982-01-25

    This disclosure relates generally to nondestructive testing for identifying structural characteristics of an object by scanned holographic techniques using a known source of radiation, such as electromagnetic or acoustical radiation. It is an object of this invention to provide an apparatus and method for synthetic aperture expansion in holographic imaging applications to construct fringe patterns capable of holographic reproduction where aperture restrictions in nondestructive testing applications would conventionally make such imaging techniques impossible. The apparatus and method result in the production of a sharply defined frontal image of structural characteristics which could not otherwise be imaged because they occur either near the surface of the object or are confined by geometry restricting aperture dimensions available for scanning purposes. The depth of the structural characteristic below the surface of the object can also be determined by the reconstruction parameters which produce the sharpest focus. Lateral resolution is established by simulated reduction in the radiation wavelength and may easily be an order of magnitude less than the electromagnetic wavelength in the material or 2 times the standard depth of penetration. Since the phase multiplication technique is performed on the detected data, the penetration depth available due to the longer wavelength signals applied to the test object remains unchanged. The phase multiplication technique can also be applied to low frequency acoustic holography, resulting in a test which combines excellent penetration of difficult materials with high resolution images.

  17. Multiple food allergy.

    PubMed

    Speer, F

    1975-02-01

    This paper is devoted to a study of multiple food allergy, here defined as sensitivity to three or more foods. The purpose of the study is to report findings obtained from a study of 250 private patients and to show what type of persons develop this condition, how it affects them, and what their common allergens are. It was found that multiple food allergy occurs in both sexes and at all ages but is more common in boys than in girls and more common in women then in men. The clinical manifestations were much like those caused by the more familiar inhalant allergy but with a much more widespread constitutional disturbance. The great majority of patients (86%) also reacted to such air-borne allergens as molds, pollens, house dust, and animal epithelials. This indicates that food allergy and inhalant allergy are fundamentally the same phenomenon. The common food allergens were such everyday foods as milk, chocolate, corn, egg, tomato, peanut, and citrus fruits. PMID:1173207

  18. Multiple Representations of Buoyancy

    NASA Astrophysics Data System (ADS)

    Oliviera, Jessica; Weglarz, Meredith; Vesenka, James

    2009-10-01

    For many students the concept of buoyancy falls under a category that can be loosely described as ``knowing it when they see it.'' Unfortunately some of the misconceptions this generates are that ``objects float because they are light'' and ``objects float because they are full of air'' [1]. Those these can some times be true, these descriptions are vague at best, and frequently can be wrong. Part of these misconceptions may stem from incomplete immersion of the object in the fluid and the vector nature of forces. We describe a demonstration/lab activity to help students make sense about relationship between the tension on and weight of an object immersed in water. The activity is in rich in multiple representations, graphical, diagrammatical as well as mathematical. A simple four question multiple choice pre/post test survey has been developed to evaluate the effectiveness of the lab activity.[4pt] [1] Bruce Harlan ``Diving Science'', www.stmatthewsschool.com/deep/pdfs/Diving%20Science.pdf

  19. Multiple organ dysfunction syndrome.

    PubMed Central

    Murray, M. J.; Coursin, D. B.

    1993-01-01

    The multiple organ dysfunction syndrome (MODS), though newly described, has manifested itself in intensive care unit (ICU) patients for several decades. As the name implies, it is a syndrome in which more than one organ system fails. Failure of these multiple organ systems may or may not be related to the initial injury or disease process for which the patient was admitted to the ICU. MODS is the leading cause of morbidity and mortality in current ICU practice. While the pathophysiology of MODS is not completely known, much evidence indicates that, during the initial injury which precipitates ICU admission, a chain of events is initiated which results in activation of several endogenous metabolic pathways. These pathways release compounds which, in and of themselves, are usually cytoprotective. However, an over exuberant activation of these endogenous systems results in an inflammatory response which can lead to development of failure in distant organs. As these organs fail, they activate and propagate the systemic inflammatory response. No therapy has proven entirely efficacious at modulating this inflammatory response and the incidence and severity of MODS. In current ICU practice, treatment is focused on prevention and treating individual organ dysfunction as it develops. With increased understanding of the pathophysiology of MODS therapy will come newer modalities which inhibit or interfere with the propagation of the endogenous systemic inflammatory response. These newer therapies hold great promise and already some are undergoing clinical investigation. PMID:7825351

  20. Multiple symbol differential detection

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush (inventor); Simon, Marvin K. (inventor)

    1991-01-01

    A differential detection technique for multiple phase shift keying (MPSK) signals is provided which uses a multiple symbol observation interval on the basis of which a joint decision is made regarding the phase of the received symbols. In accordance with the invention, a first difference phase is created between first and second received symbols. Next, the first difference phase is correlated with the possible values thereof to provide a first plurality of intermediate output signals. A second difference phase is next created between second and third received symbols. The second difference phase is correlated with plural possible values thereof to provide a second plurality of intermediate output signals. Next, a third difference phase is created between the first and third symbols. The third difference phase is correlated with plural possible values thereof to provide a third plurality of intermediate output signals. Each of the first plurality of intermediate outputs are combined with each of the second plurality of intermediate outputs and each of the third plurality of intermediate outputs to provide a plurality of possible output values. Finally, a joint decision is made by choosing from the plurality of possible output values the value which represents the best combined correlation of the first, second and third difference values with the possible values thereof.

  1. Bayes multiple decision functions

    PubMed Central

    Wu, Wensong; Peña, Edsel A.

    2014-01-01

    This paper deals with the problem of simultaneously making many (M) binary decisions based on one realization of a random data matrix X. M is typically large and X will usually have M rows associated with each of the M decisions to make, but for each row the data may be low dimensional. Such problems arise in many practical areas such as the biological and medical sciences, where the available dataset is from microarrays or other high-throughput technology and with the goal being to decide which among of many genes are relevant with respect to some phenotype of interest; in the engineering and reliability sciences; in astronomy; in education; and in business. A Bayesian decision-theoretic approach to this problem is implemented with the overall loss function being a cost-weighted linear combination of Type I and Type II loss functions. The class of loss functions considered allows for use of the false discovery rate (FDR), false nondiscovery rate (FNR), and missed discovery rate (MDR) in assessing the quality of decision. Through this Bayesian paradigm, the Bayes multiple decision function (BMDF) is derived and an efficient algorithm to obtain the optimal Bayes action is described. In contrast to many works in the literature where the rows of the matrix X are assumed to be stochastically independent, we allow a dependent data structure with the associations obtained through a class of frailty-induced Archimedean copulas. In particular, non-Gaussian dependent data structure, which is typical with failure-time data, can be entertained. The numerical implementation of the determination of the Bayes optimal action is facilitated through sequential Monte Carlo techniques. The theory developed could also be extended to the problem of multiple hypotheses testing, multiple classification and prediction, and high-dimensional variable selection. The proposed procedure is illustrated for the simple versus simple hypotheses setting and for the composite hypotheses setting through simulation studies. The procedure is also applied to a subset of a microarray data set from a colon cancer study. PMID:25414762

  2. [Multiple myeloma stem cell].

    PubMed

    Hosen, Naoki

    2015-01-01

    Multiple myeloma (MM) is characterized by the clonal expansion of malignant plasma cells. MM patients harbor phenotypic CD19+ B cells expressing the immunoglobulin gene sequence and the idiotype unique to the individual myeloma clone. However, in most MM patients CD19+ clonotypic B cells do not reconstitute MM disease upon transplantation into immune-deficient mice. In the SCID-rab and SCID-hu models, which enable engraftment of human MM in vivo, CD19-CD38++ plasma cells engrafted and rapidly propagated MM. These results indicate that MM-initiating cells are derived from plasma cells, which are terminally differentiated cells. It should be now clarified whether all MM plasma cells can exert as MM-initiating cells when located in the appropriate niche or only distinct myeloma stem cells can propagate MM. PMID:25626303

  3. Dancing with Multiple Partners

    NSDL National Science Digital Library

    Darren G. Woodside (Texas Biotechnology Corporation; REV)

    2002-03-19

    Transmembrane proteins, such as G protein-coupled receptors (GPCRs) and integrins, activate intracellular signaling pathways through interactions with downstream binding partners. Woodside discusses two examples in which GPCRs and integrins interact in a noncompeting manner with more than one partner. The specific GPCR described is the thrombin receptor, in experiments where G protein peptides selectively block signaling through a particular G protein that does not appear to inhibit coupling of the receptor to other G proteins. The second system described is the ?IIb?3 integrin and its activation of the nonreceptor tyrosine kinase Syk. Syk appeared capable of interacting with both the integrin and intracellular domains of immune response receptors, because binding of Syk to the integrin was not inhibited by peptides based on the Syk binding site in immune response receptors. Thus, multiple, noncompeting binding partners add to the complexity of signal transduction outputs from a single receptor complex.

  4. Pomalidomide for multiple myeloma.

    PubMed

    Fouquet, Guillemette; Bories, Claire; Guidez, Stéphanie; Renaud, Loïc; Herbaux, Charles; Javed, Sahir; Facon, Thierry; Leleu, Xavier

    2014-12-01

    Once characterized by a very poor outcome, multiple myeloma (MM) now has a significantly prolonged survival, with major improvements allowed by the use of 'novel agents': proteasome inhibitors (first-in-class bortezomib) and immunomodulatory compounds (IMiDs; first-in-class thalidomide and lenalidomide). However, the vast majority - if not all - of patients with MM ultimately end up being refractory to all existing drugs, including these efficient novel agents. There is a clear unmet medical need in this situation, which warrants the development of the next generation of proteasome inhibitors and IMiDs, as well as new drug classes. This drug profile focuses on pomalidomide, the next generation IMiD, recently approved by the US FDA and the EMA for patients with relapsed or refractory MM who have received at least two prior therapies, including lenalidomide and bortezomib, and have demonstrated disease progression on their last therapy. PMID:25265911

  5. Note on multiplicity

    E-print Network

    Katz, Daniel L.

    1988-12-01

    (/": yi) C\\ Ie = /n_1 for all n > c. Write / = Ei=0 riZ\\ in R[Z] and suppose / G (InR[Z]: g) n ICR[Z]. Then f ? 9 = -yiro + (x2ro ~ y\\ri)Z H-h (x2ra_i - yirs)Zs + x2rsZs+1. It follows that r0 G (In:yi) n Ie. Thus r0 G 7n_1, so x2r0 G /". This implies ri G... Philos. Soc. 57 (1961), 8-17. 7. D. Rees and R. Y. Sharp, On a theorem o¡ B. Teissier on multiplicities o¡ ideals in local rings, 3. London Math. Soc. 18 (1978), 449-463. 8. B. Teissier, Cycles evanescents, sections planes, et conditions de Whitney...

  6. Tremor in multiple sclerosis

    PubMed Central

    Mostert, Jop; Heersema, Dorothea; De Keyser, Jacques

    2007-01-01

    Tremor is estimated to occur in about 25 to 60 percent of patients with multiple sclerosis (MS). This symptom, which can be severely disabling and embarrassing for patients, is difficult to manage. Isoniazid in high doses, carbamazepine, propranolol and gluthetimide have been reported to provide some relief, but published evidence of effectiveness is very limited. Most trials were of small size and of short duration. Cannabinoids appear ineffective. Tremor reduction can be obtained with stereotactic thalamotomy or thalamic stimulation. However, the studies were small and information on long-term functional outcome is scarce. Physiotherapy, tremor reducing orthoses, and limb cooling can achieve some functional improvement. Tremor in MS remains a significant challenge and unmet need, requiring further basic and clinical research. PMID:17318714

  7. Multiple layer insulation cover

    DOEpatents

    Farrell, James J. (Livingston Manor, NY); Donohoe, Anthony J. (Ovid, NY)

    1981-11-03

    A multiple layer insulation cover for preventing heat loss in, for example, a greenhouse, is disclosed. The cover is comprised of spaced layers of thin foil covered fabric separated from each other by air spaces. The spacing is accomplished by the inflation of spaced air bladders which are integrally formed in the cover and to which the layers of the cover are secured. The bladders are inflated after the cover has been deployed in its intended use to separate the layers of the foil material. The sizes of the material layers are selected to compensate for sagging across the width of the cover so that the desired spacing is uniformly maintained when the cover has been deployed. The bladders are deflated as the cover is stored thereby expediting the storage process and reducing the amount of storage space required.

  8. Multiple Membranes from Gauged Supergravity

    E-print Network

    Eric A. Bergshoeff; Mees de Roo; Olaf Hohm; Diederik Roest

    2008-08-26

    Starting from gauged N=8 supergravity in three dimensions we construct actions for multiple membranes by taking the limit to global supersymmetry for different choices of the embedding tensor. This provides a general framework that reproduces many recent results on multiple membrane actions as well as generalisations thereof. As examples we discuss conformal (non-conformal) gaugings leading to multiple M2-branes (D2-branes) and massive deformations of these systems.

  9. Multiple pathogens infect multiple hosts: Inference for incidence, infection, & impact

    E-print Network

    Wolpert, Robert L

    Multiple pathogens infect multiple hosts: Inference for incidence, infection, & impact #12;Nature · Competing species can coexist if each is attacked when it becomes abundant · Requires a different pathogen to regulate each host · If Janzen-Connell effects maintain diversity through pathogens, then ­ Pathogens

  10. Multiple pathogens infect multiple hosts: Inference for incidence, infection, & impact

    E-print Network

    Wolpert, Robert L

    Multiple pathogens infect multiple hosts: Inference for incidence, infection, & impact #12 a different pathogen to regulate each host · If Janzen-Connell effects maintain diversity through pathogens, then ­ Pathogens effects are host-specific (N pathogens for N hosts) ­ Strongest effect when host is abundant #12

  11. Multiple-input multiple-output (MIMO) radar: performance issues

    Microsoft Academic Search

    K. W. Forsythe; D. W. Bliss; G. S. Fawcett

    2004-01-01

    The application of multiple-input multiple-output (MIMO) techniques to multistage radar offers a number of advantages, including improved resolution and sensitivity. Depending upon the radar's mode of operation, the array design and the environment, these advantages may or may not be significant. In this paper, a simple analytic model for ground moving target indicator (GMTI) radar detection is presented and its

  12. Multiple Imputation Strategies for Multiple Group Structural Equation Models

    Microsoft Academic Search

    Craig K. Enders; Amanda C. Gottschall

    2011-01-01

    Although structural equation modeling software packages use maximum likelihood estimation by default, there are situations where one might prefer to use multiple imputation to handle missing data rather than maximum likelihood estimation (e.g., when incorporating auxiliary variables). The selection of variables is one of the nuances associated with implementing multiple imputation, because the imputer must take special care to preserve

  13. Decisions and the Evolution of Memory: Multiple Systems, Multiple Functions

    E-print Network

    Cosmides, Leda

    information or knowledge. . . . Owners of biolog- ical memory systems are capable of behaving more: "Memory in biological systems always entails learning (the acquisition of information) and . . . learningDecisions and the Evolution of Memory: Multiple Systems, Multiple Functions Stanley B. Klein, Leda

  14. Disability in multiple sclerosis

    PubMed Central

    Chamot, Eric; Salter, Amber R.; Cutter, Gary R.; Bacon, Tamar E.; Herbert, Joseph

    2013-01-01

    Objective: To create a reference table of disability outcomes in multiple sclerosis (MS) that would enable patients to rank their disability relative to others' with similar disease duration and to develop a cost-effective research tool for comparing MS severity across patient populations and time periods. Methods: The North American Research Committee on Multiple Sclerosis (NARCOMS) Registry collects disability data from patients with MS on a validated, 9-point Patient-Determined Disease Steps (PDDS) scale. We compiled the Disability Expectancy Table, which displays cumulative frequencies of PDDS scores for each year of disease duration, from 0 to 45 years. We also tabulated disease duration–adjusted mean ranks of PDDS scores, referred to as Patient-derived MS Severity Scores (P-MSSS). Results: The cohort consisted of 27,918 NARCOMS enrollees, 72.7% of whom were female and 90.1% of whom were white. Mean age at symptom onset was 30.1 ± 10.1 years, and age at enrollment was 47.1 ± 11.0 years. The Disability Expectancy Table and P-MSSS afford a detailed overview of disability outcomes in a large MS cohort over a 45-year period. In the first year of disease, 15% of patients reported need of ambulatory aid, and 4% needed bilateral assistance or worse; after 45 years of disease, 76% of patients required ambulatory aid, and 52% bilateral assistance or worse. Proportion of patients who reported minimal or no interference in daily activities (PDDS ? 1) declined from 63% in the first year to 8% after 45 years of disease. Conclusion: The Disability Expectancy Table allows individual patients to determine how their disability ranks relative to NARCOMS enrollees with the same disease duration. P-MSSS may be used to compare disability across patient populations and to track disease progression in patient cohorts. P-MSSS does not require a formal neurologic examination and may therefore find wide applicability as a practical and cost-effective outcome measure in epidemiologic studies. PMID:23427319

  15. Multiple identity enactments and multiple personality disorder: a sociocognitive perspective.

    PubMed

    Spanos, N P

    1994-07-01

    People who enact multiple identities behave as if they possess 2 or more selves, each with its own characteristic moods, memories, and behavioral repertoire. Under different names, this phenomenon occurs in many cultures; in North American culture, it is frequently labeled multiple personality disorder (MPD). This article reviews experimental, cross-cultural, historical, and clinical findings concerning multiplicity and examines the implications of these findings for an understanding of MPD. Multiplicity is viewed from a sociocognitive perspective, and it is concluded that MPD, like other forms of multiplicity, is socially constructed. It is context bounded, goal-directed, social behavior geared to the expectations of significant others, and its characteristics have changed over time to meet changing expectations. PMID:8078970

  16. Multiple thermocouple testing device

    NASA Astrophysics Data System (ADS)

    Hildebrand, J. R.; Sobanski, K. J.

    1986-02-01

    An automated multiple thermocouple testing device determines short and open circuits in a thermocouple system. The thermocouple system that has a plurality of temperature probes, each probe has a first thermocouple. The device applies a direct current voltage to the first thermocouple to cause heating in the second thermocouple and a second thermocouple and then reads the temperature response of the second thermocouple. The first thermocouples have a common lead and the second thermocouples are connected in two parallel groups. The temperature output of the second thermocouple is digitized and read by a computer. These readings are compared to criteria which determine if there is an open circuit. Before the open circuit test is applied, the device also determines which thermocouple probe has a possible short circuit. This device can automatically test for short and open circuits in a thermocouple system within a few minutes without the necessity of removing the probes from their installed position. This device was adapted to perform the above testing on a F100 fan turbine inlet temperature (FTIT) system.

  17. “Undiagnosing” multiple sclerosis

    PubMed Central

    Klein, Eran P.; Bourdette, Dennis

    2012-01-01

    Objective: To describe the clinical characteristics of encounters with patients misdiagnosed with multiple sclerosis (MS). Methods: A cross-sectional Internet-based physician survey of MS specialists was performed. Results: The response rate for the survey was 50.4%. Of those who responded, the majority (95%) reported having evaluated 1 or more patients who had been diagnosed with MS, but who they strongly felt did not have MS, within the last year. The majority of respondents (>90%) also reported the use of disease-modifying therapy in a proportion of these patients. Most respondents (94%) found clinical encounters with these patients equally or more challenging than giving a new diagnosis of MS. Fourteen percent of respondents reported that they did not always inform such patients of their opinion that they did not have MS. Conclusions: The misdiagnosis of MS is common and has significant consequences for patient care and health care system costs. Caring for a patient with a misdiagnosis of MS is challenging, and at times honest disclosure of a misdiagnosis represents an important ethical concern for neurologists. More data are needed on this patient population to improve diagnostic acumen and the care of these patients. PMID:22581930

  18. Thermoregulation in multiple sclerosis.

    PubMed

    Davis, Scott L; Wilson, Thad E; White, Andrea T; Frohman, Elliot M

    2010-11-01

    Multiple sclerosis (MS) is a progressive neurological disorder that disrupts axonal myelin in the central nervous system. Demyelination produces alterations in saltatory conduction, slowed conduction velocity, and a predisposition to conduction block. An estimated 60-80% of MS patients experience temporary worsening of clinical signs and neurological symptoms with heat exposure. Additionally, MS may produce impaired neural control of autonomic and endocrine functions. This review focuses on five main themes regarding the current understanding of thermoregulatory dysfunction in MS: 1) heat sensitivity; 2) central regulation of body temperature; 3) thermoregulatory effector responses; 4) heat-induced fatigue; and 5) countermeasures to improve or maintain function during thermal stress. Heat sensitivity in MS is related to the detrimental effects of increased temperature on action potential propagation in demyelinated axons, resulting in conduction slowing and/or block, which can be quantitatively characterized using precise measurements of ocular movements. MS lesions can also occur in areas of the brain responsible for the control and regulation of body temperature and thermoregulatory effector responses, resulting in impaired neural control of sudomotor pathways or neural-induced changes in eccrine sweat glands, as evidenced by observations of reduced sweating responses in MS patients. Fatigue during thermal stress is common in MS and results in decreased motor function and increased symptomatology likely due to impairments in central conduction. Although not comprehensive, some evidence exists concerning treatments (cooling, precooling, and pharmacological) for the MS patient to preserve function and decrease symptom worsening during heat stress. PMID:20671034

  19. Immunopathogenesis of multiple sclerosis

    PubMed Central

    Racke, Michael K.

    2009-01-01

    Multiple sclerosis (MS) is a suspected autoimmune disease in which myelin-specific CD4+ and CD8+ T cells enter the central nervous system (CNS) and initiate an inflammatory response directed against myelin and other components of the CNS. Acute MS exacerbations are believed be the result of active inflammation, and progression of disability is generally believed to reflect accumulation of damage to the CNS, particularly axonal damage. Over the last several years, the pathophysiology of MS is being appreciated to be much more complex, and it appears that the development of the MS plaque involves a large number of cell populations, including CD8+ T lymphocytes, B cells, and Th17 cells (a population of helper T cells that secrete the inflammatory cytokine IL-17). The axonal transection and degeneration that is thought to represent the basis for progressive MS is now recognized to begin early in the disease process and to continue in the progressive forms of the disease. Molecules important for limiting aberrant neural connections in the CNS have been identified, which suppress axonal sprouting and regeneration of transected axons within the CNS. Pathways have also been identified that prevent remyelination of the MS lesion by oligodendrocyte precursors. Novel neuroimaging methodologies and potential biomarkers are being developed to monitor various aspects of the disease process in MS. As we identify the pathways responsible for the clinical phenomena of MS, we will be able to develop new therapeutic strategies for this disabling illness of young adults. PMID:20182567

  20. Learning multiple layers of representation

    Microsoft Academic Search

    Geoffrey E. Hinton

    2007-01-01

    Abstract To achieve its’ impressive performance at tasks such as speech or object recognition, the brain extracts multiple levels of representation from the sensory input. Backpropagation was the first computation- ally efficient model of how neural networks could learn multiple layers of representation, but it required labeled training data and it did not work well in deep networks. The limitations

  1. Modular Inverse Algorithms without Multiplications

    Microsoft Academic Search

    Laszlo Hars

    2004-01-01

    the basic left-shift, right-shift and shifting Euclidean modular inverse algorithms are presented with new optimization tricks. These algorithms are based on the corresponding extended GCD algorithms, but only one multiplicator, the modular inverse is computed. On many computational platforms, for operand lengths used in cryptography, the fastest modular inverse algorithms need about twice the modular multiplication time, or even less.

  2. Multiple patterns of parental care

    Microsoft Academic Search

    James N. Webb; Alasdair I. Houston; John M. McNamara; TamáS SzéKely

    1999-01-01

    Many animals show multiple patterns of parental care, where more than one of the four basic patterns (biparental care, uniparental care by males or females, or no care) is present within a single population during a single breeding season. We consider three reasons for the existence of multiple patterns of parental care: (1) mixed-strategy behaviours; (2) time-dependent behaviour with parents

  3. Multiple chemical sensitivities: an overview

    Microsoft Academic Search

    Lawrence Fishbein

    1996-01-01

    At the present time multiple chemical sensitivities (MCS) is generally acknowledged to be a poorly understood clinical syndrome which is exhibited by individuals exposed to low levels of exposure to environmental agents that the general population tolerate quite well. A wide range of individual symptoms (typically multiple and related to neurologic, endocrine\\/metabolic, and immunological, often occurring simultaneously) are displayed by

  4. Global Optimization of Multiplicative Programs

    Microsoft Academic Search

    Hong-Seo Ryoo; Nikolaos V. Sahinidis

    2003-01-01

    This paper develops global optimization algorithms for linear multiplicative and generalized linear multiplicative programs based upon the lower bounding procedure of Ryoo and Sahinidis [30] and new greedy branching schemes that are applicable in the context of any rectangular branch-and-bound algorithm. Extensive computational results are presented on a wide range of problems from the literature, including quadratic and bilinear programs,

  5. Teaching for Mastery of Multiplication

    ERIC Educational Resources Information Center

    Wallace, Ann H.; Gurganus, Susan P.

    2005-01-01

    The strategies for learning multiplication concepts are discussed. The strategies involve introduction of the multiplication concepts through problem solutions with linkage between new concepts and prior knowledge, provision of concrete experiences and semi-concrete representations prior to purely symbolic notations, explicit teaching of the rules…

  6. Multiplication Fact Fluency Using Doubles

    ERIC Educational Resources Information Center

    Flowers, Judith M.; Rubenstein, Rheta N.

    2010-01-01

    Not knowing multiplication facts creates a gap in a student's mathematics development and undermines confidence and disposition toward further mathematical learning. Learning multiplication facts is a first step in proportional reasoning, "the capstone of elementary arithmetic and the gateway to higher mathematics" (NRC 2001, p. 242). Proportional…

  7. Introduction to Multiplication using Literature

    NSDL National Science Digital Library

    Scholastic

    2011-11-19

    This lesson plan can be used to introduce the concept of multiplication to students through the use of literature. The story Amanda Bean's Amazing Dream is used to demonstrate the different ways to count items and how multiplication can make that process much faster.

  8. Multiple strategy generation for wargaming

    Microsoft Academic Search

    Timothy Revello; Robert McCartney; Eugene Santos Jr.

    2004-01-01

    In this paper we present a framework for the automated generation of strategies that accounts for the multiple kinds of uncertainty found in war games, provides for a domain independent approach to strategy generation, and results in robust strategies. Our approach is to sample over multiple trials for varying victory conditions, different threat profiles, and variable system performance to achieve

  9. Symptomatic therapy in multiple sclerosis

    PubMed Central

    Frohman, Teresa C.; Castro, Wanda; Shah, Anjali; Courtney, Ardith; Ortstadt, Jeffrey; Davis, Scott L.; Logan, Diana; Abraham, Thomas; Abraham, Jaspreet; Remington, Gina; Treadaway, Katherine; Graves, Donna; Hart, John; Stuve, Olaf; Lemack, Gary; Greenberg, Benjamin; Frohman, Elliot M.

    2011-01-01

    Multiple sclerosis is the most common disabling neurological disease of young adults. The ability to impact the quality of life of patients with multiple sclerosis should not only incorporate therapies that are disease modifying, but should also include a course of action for the global multidisciplinary management focused on quality of life and functional capabilities. PMID:21694806

  10. Coloring Multiples in Pascal's Triangle

    NSDL National Science Digital Library

    2010-01-01

    In this activity, you will learn more about Pascal's Triangle! You will color numbers in Pascal's Triangle by rolling a number and then clicking on all entries that are multiples of the number rolled. This activity will allow you to practice multiplication tables, investigate number patterns, and investigate fractal patterns.

  11. Multiple personality disorder following childbirth.

    PubMed

    O'Dwyer, J M; Friedman, T

    1993-06-01

    A case of multiple personality disorder is described as a coping mechanism protecting the patient from the abuse to which she was subjected throughout her life. The multiple personalities became more prominent following the birth of a severely handicapped child. PMID:8330114

  12. Dynamics of multiple goal pursuit

    Microsoft Academic Search

    Maria J. Louro; Rik Pieters; Marcel Zeelenberg

    2007-01-01

    The authors propose and test a model of multiple-goal pursuit that specifies how individuals allocate effort among multiple goals over time. The model predicts that whether individuals decide to step up effort, coast, abandon the current goal, or switch to pursue another goal is determined jointly by the emotions that flow from prior goal progress and the proximity to future

  13. Multiple vehicle detection and tracking

    Microsoft Academic Search

    Margrit Betke; Esin Haritaoglu; Larry S. Davis

    1997-01-01

    A hard real time vision system has been developed that recognizes and tracks multiple cars from video sequences taken from a car driving on highways and country roads. Recognition is accomplished by combining the analysis of single image frames with the analysis of the motion information provided by multiple consecutive image frames. In single image frames, cars are recognized by

  14. Folklore and the Multiple Intelligences.

    ERIC Educational Resources Information Center

    Koehnecke, Dianne Swenson

    1995-01-01

    Explores using Howard Gardner's multiple intelligences for folklore analysis. States that when listening to folktales, linguistic intelligence was used, as opposed to drawing pictures of the stories, which used spatial intelligence. Provides some ideas on how to bring folklore studies and the use of multiple intelligences into the classroom. (PA)

  15. Undecidability of Multiplicative Subexponential Logic

    E-print Network

    Paris-Sud XI, Université de

    Undecidability of Multiplicative Subexponential Logic Kaustuv Chaudhuri INRIA, France kaustuv.chaudhuri@inria.fr [Presented at LINEARITY 2014, July 13, 2014] Abstract Subexponential logic is a variant of linear logic show that classical propositional multiplicative linear logic extended with one unrestricted and two

  16. Dissertationsthema Pseudo-multiplicative unitaries

    E-print Network

    Timmermann, Thomas

    Mathematik Dissertationsthema Pseudo-multiplicative unitaries and pseudo-Kac systems on C -modules¨ufung: 30.06.2005 Tag der Promotion: 13.07.2005 #12;Abstract We study pseudo-multiplicative unitaries and pseudo-Kac systems on C- modules in general and examples arising from locally compact groupoids in par

  17. Multiple fractional Fourier transform holography

    NASA Astrophysics Data System (ADS)

    Zeng, Yangsu; Zhang, Yixiao; Gao, Feng; Gao, Fuhua; Huang, Xiaoyang; Guo, Yongkang

    2002-04-01

    In this paper, we introduce the recording and reconstruction theories of the multiple fractional Fourier transform hologram (M-FRTH). We fabricated a multiple fractional Fourier transform hologram, and obtained satisfying reconstruction results. The experimental result shows that the M-FRTH has a high anti-counterfeiting capacity and can be used in the fabrication of the trademark, ID, and the notes.

  18. [Clinical problems in multiple osteochondroma].

    PubMed

    Ham, S J John; de Lange, Jan; van der Zwan, Arnard L; Schaap, Gerard R; van der Woude, Henk-Jan; Heeg, Minne

    2012-01-01

    Multiple osteochondroma, also known as hereditary multiple exostoses, is a relatively rare genetic disorder characterized by the presence of multiple osteochondromas. The disease is frequently painful, with restriction of the activities of daily living, problems with carrying out an occupation and performance at school. In addition, characteristic skeletal deformities and postural abnormalities of the joints very frequently occur in patients with this disorder. Malignant transformation of osteochondroma to chondrosarcoma occurs in 1-5% of the patients with multiple osteochondroma. Treatment of patients with multiple osteochondromas must be tuned to the problems experienced by the patient. Symptomatic osteochondromas are often an indication for excision; knowledge of the natural progression of the abnormality is important in this. Periodical screening is essential: in children to prevent or correct deformity and postural abnormalities and in adults to detect and treat malignant transformation of osteochondroma at an early stage. PMID:22414670

  19. Multiplicity in Early Stellar Evolution

    E-print Network

    Reipurth, Bo; Boss, Alan P; Goodwin, Simon P; Rodriguez, Luis Felipe; Stassun, Keivan G; Tokovinin, Andrei; Zinnecker, Hans

    2014-01-01

    Observations from optical to centimeter wavelengths have demonstrated that multiple systems of two or more bodies is the norm at all stellar evolutionary stages. Multiple systems are widely agreed to result from the collapse and fragmentation of cloud cores, despite the inhibiting influence of magnetic fields. Surveys of Class 0 protostars with mm interferometers have revealed a very high multiplicity frequency of about 2/3, even though there are observational difficulties in resolving close protobinaries, thus supporting the possibility that all stars could be born in multiple systems. Near-infrared adaptive optics observations of Class I protostars show a lower binary frequency relative to the Class 0 phase, a declining trend that continues through the Class II/III stages to the field population. This loss of companions is a natural consequence of dynamical interplay in small multiple systems, leading to ejection of members. We discuss observational consequences of this dynamical evolution, and its influenc...

  20. Multiple Intracranial Aneurysms

    PubMed Central

    Mont’alverne, F.; Tournade, A.; Riquelme, C.; Musacchio, M.

    2002-01-01

    Summary We evaluate endovascular treatment (EVT) as an option to deal with multiple intracranial aneurysms(MA). From 1994 to 2001,24 patients underwent EVT for 59 MA. Patients were followed-up clinically and angiographically in a period ranging from 6 to 93 months (mean time of 22.2) and from 4 to 69 months (mean time of 19.3), respectively. Ten patients (41.6%) were treated either by EVT (n=7, 29,16%) or by mixed treatment (EVT and surgery; n=3, 12.5%). Reasons for treating just ruptured aneurysms: six (25%) had aneurysms smaller than 5 mm; three (12.5%) deaths; two (8.33%) were in the subacute period; two (8.33%) lost to follow-up; one (4.17%) authorised no procedure. No rebleeding was detected at the clinical follow-up, but there were five deaths. At immediate arteriographic control: 28 (85%) aneurysms were fully occluded, four (12%) with neck flow and one (03%) with sac flow. For 20 aneurysms followed-up: stability of occlusion was reached in seven cases (35%) and repermeabilization in 13 (65%). Management of recanalization was close arteriography in seven (54%), re-embolization in five (38%) and surgery in one (08%). When treating MA, EVT is advisable either alone or in mixed therapy. As a high degree of repermeabilization was disclosed, strict arteriographic control is required. The mechanisms underlying aneurysmal formation may be also involved in the recanalization phenomenon , a possible new manifestation of the fragility of the arterial wall. PMID:20594518

  1. Midkine and multiple sclerosis

    PubMed Central

    Takeuchi, Hideyuki

    2014-01-01

    Multiple sclerosis (MS) is an autoimmune neurological disease characterized by inflammatory demyelination with subsequent neuronal damage in the CNS. MS and its animal model, experimental autoimmune encephalomyelitis (EAE), have been thought as autoreactive Th1 and Th17 cell-mediated diseases. CD4+CD25+FoxP3+ regulatory T-cell (Treg) plays a pivotal role in autoimmune tolerance, and tolerogenic dendritic cells (DCreg) drive the development of inducible Treg cells. Thus, a dysfunction in the development of Treg and DCreg leads to the development of autoimmune diseases. However, the factors that regulate Treg and DCreg are largely unknown. We recently showed that removal of midkine (MK) suppressed EAE due to an expansion of the Treg cell population as well as a decrease in the numbers of autoreactive Th1 and Th17 cells. MK decreased the Treg cell population by suppressing the phosphorylation of STAT5, which is essential for the expression of Foxp3, the master transcriptional factor of Treg cell differentiation. Furthermore, MK reduces the DCreg cell population by inhibiting the phosphorylation of STAT3, which is critical for DCreg development. Blockade of MK signalling by a specific RNA aptamer significantly elevated the population of DCreg and Treg cells and ameliorated EAE without detectable adverse effects. Therefore, the inhibition of MK may provide an effective therapeutic strategy against autoimmune diseases including MS. Linked Articles This article is part of a themed section on Midkine. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014.171.issue-4 PMID:24460675

  2. Multiple-input, multiple-output pass transistor logic

    Microsoft Academic Search

    M. SHAMANNA; K. CAMERON; S. R. WHITAKER

    1995-01-01

    Techniques are presented for the design of multiple-input, multiple-output pass transistor circuits. By using shared functions as map-entered variables, dramatic reductions in transistor count can be achieved. Applied to a Viterbi decoder design for NASA, the transistor count of a CMOS integrated circuit was reduced by nearly 100000 transistors over the best previously known techniques. A proof is presented which

  3. Multiple-input-multiple-output measurements and modeling in Manhattan

    Microsoft Academic Search

    Dmitry Chizhik; Jonathan Ling; Peter W. Wolniansky; Reinaldo A. Valenzuela; Nelson Costa; Kris Huber

    2003-01-01

    Narrowband multiple-input-multiple-output (MIMO) measurements using 16 transmitters and 16 receivers at 2.11 GHz were carried out in Manhattan. High capacities were found for full, as well as smaller array configurations, all within 80% of the fully scattering channel capacity. Correlation model parameters are derived from data. Spatial MIMO channel capacity statistics are found to be well represented by the separate

  4. A Multiple Center Study of Multiple Chemical Sensitivity Syndrome

    Microsoft Academic Search

    D. J. Kutsogiannis; Ann L. Davidoff

    2001-01-01

    The lack of widely accepted, standardized, clinical and epidemiologic criteria for Multiple Chemical Sensitivity syndrome has led to confusion about the identification of the condition and has slowed pertinent research. In this article, the authors evaluated the psychometric properties of 2 sets of clinical\\/epidemiologic criteria for Multiple Chemical Sensitivity syndrome. In this cross-sectional survey of 1,166 patients who visited outpatient

  5. All About Multiplication: Modeling Multiplication with Rows and Columns

    NSDL National Science Digital Library

    Illuminations National Council of Teachers of Math

    2009-03-16

    "This lesson encourages students to explore the array model of multiplication. The lesson focuses on the factors 4 and 6. Students will also explore products with 0 or 1 as a factors. First students make arrays with counters, and then they create a second concrete example of the array model using toothpicks. They also write problems which involve multiplication." (from NCTM's Illuminations) This is lesson 3 in a 4-lesson unit.

  6. Phenomenology of high multiplicity events

    NASA Astrophysics Data System (ADS)

    Kokoulina, E. S.; SVD Collaboration

    2015-05-01

    Study of high multiplicity events in proton-proton (nucleus) interactions is carried out at U-70 accelerator of IHEP, Protvino. These events are extremely rare. Usually, MC codes underestimate topological cross sections in this region. Gluon dominance model has been offered to describe them. Some collective phenomena can be observed in high multiplicity events. SVD-2 Collaboration has obtained the evidence of pion condensate formation at high total multiplicity. Our future program is aimed at studying soft photon yield puzzle at U-70 and Nuclotronfacility at JINR, Dubna.

  7. On Multiple-Layered Vortices

    NASA Technical Reports Server (NTRS)

    Rossow, Vernon J.

    2011-01-01

    As part of an ongoing effort to find ways to make vortex flow fields decompose more quickly, photographs and observations are presented of vortex flow fields that indicate the presence of multiple layers of fluid rotating about a common axis. A survey of the literature indicates that multiple-layered vortices form in waterspouts, tornadoes and lift-generated vortices of aircraft. An explanation for the appearance of multiple-layered structures in vortices is suggested. The observations and data presented are intended to improve the understanding of the formation and persistence of vortex flow fields.

  8. Establishment of Murine Cytomegalovirus Latency In Vivo Is Associated with Changes in Histone Modifications and Recruitment of Transcriptional Repressors to the Major Immediate-Early Promoter

    Microsoft Academic Search

    Xue-feng Liu; Shixian Yan; Michael Abecassis; Mary Hummel

    2008-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous herpesvi- rus with the ability to establish a lifelong latent infection. Reactivation of latent virus is associated with increased risk of morbidity and mortality in immunocompromised hosts, includ- ing AIDS patients, cancer patients, and recipients of solid organ and bone marrow transplants (41). Reactivation of virus in immunocompetent individuals is generally asymptomatic but contributes

  9. Dynamic Shifts in Corticostriatal Expression Patterns of the Immediate Early Genes "Homer 1a" and "Zif268" during Early and Late Phases of Instrumental Training

    ERIC Educational Resources Information Center

    Kelley, Ann E.; Hernandez, Pepe J.; Schiltz, Craig A.

    2006-01-01

    Adaptive motor actions require prior knowledge of instrumental contingencies. With practice, these actions can become highly automatic in nature. However, the molecular and anatomical substrates mediating these related forms of learning are not understood. In the present study, we used in situ hybridization to measure the mRNA levels of two…

  10. A dynamic model of gene expression in monocytes reveals differences in immediate/early response genes between adult and neonatal cells

    PubMed Central

    Lawrence, Shelley; Tang, Yuhong; Frank, M Barton; Dozmorov, Igor; Jiang, Kaiyu; Chen, Yanmin; Cadwell, Craig; Turner, Sean; Centola, Michael; Jarvis, James N

    2007-01-01

    Neonatal monocytes display immaturity of numerous functions compared with adult cells. Gene expression arrays provide a promising tool for elucidating mechanisms underlying neonatal immune function. We used a well-established microarray to analyze differences between LPS-stimulated human cord blood and adult monocytes to create dynamic models for interactions to elucidate observed deficiencies in neonatal immune responses. We identified 168 genes that were differentially expressed between adult and cord monocytes after 45 min incubation with LPS. Of these genes, 95% (159 of 167) were over-expressed in adult relative to cord monocytes. Differentially expressed genes could be sorted into nine groups according to their kinetics of activation. Functional modelling suggested differences between adult and cord blood in the regulation of apoptosis, a finding confirmed using annexin binding assays. We conclude that kinetic studies of gene expression reveal potentially important differences in gene expression dynamics that may provide insight into neonatal innate immunity. PMID:17306030

  11. Immediate-early gene expression in concurrent prenatal ethanol- and\\/or cocaine-exposed rat pups: intrauterine differences in cocaine levels and Fos expression

    Microsoft Academic Search

    Ellen S Mitchell; Richard W Keller; Abigail Snyder-Keller

    2002-01-01

    Concurrent use of cocaine and ethanol is a common mode of abuse. Cocaine and ethanol have distinctive pharmacologies but both have been shown to cause uterine vasoconstriction and fetal hypoxia. We developed a paradigm of chronic ethanol exposure via liquid diet coupled with binge cocaine exposure on the last day of gestation. Lipton et al. [16] demonstrated unequal segregation of

  12. The immediate-early gene product Egr-1 regulates the human interleukin-2 receptor beta-chain promoter through noncanonical Egr and Sp1 binding sites.

    PubMed Central

    Lin, J X; Leonard, W J

    1997-01-01

    The interleukin-2 IL-2 receptor beta-chain (IL-2Rbeta) is an essential component of the receptors for IL-2 and IL-15. Although IL-2Rbeta is constitutively expressed by lymphocytes, its expression can be further induced by a number of stimuli, including phorbol 12-myristate 13-acetate (PMA). We have now characterized factors that bind to an enhancer region located between nucleotides -170 and -139 of the human IL-2Rbeta promoter. Both Sp1 and Sp3 bound to the 5' portion of this region, whereas a PMA-inducible factor (PIF) mainly bound to its 3' portion and bound to the Sp binding motifs as well. In Jurkat T cells, induction of PIF DNA binding activity was rapidly induced, required de novo protein synthesis, and was sustained at a high level for at least 23 h. Interestingly, PIF was constitutively activated in human T-cell leukemia virus type 1-transformed MT-2 cells. In this paper, we demonstrate that PIF is Egr-1 based on its recognition by anti-Egr-1 antisera in gel mobility shift assays, even though the IL-2Rbeta DNA binding motif differed substantially from the canonical Egr-1 binding site. In addition, Egr-1 bound to the Sp binding site. In Jurkat cells, both sites were required for maximal IL-2Rbeta promoter activity, and in HeLaS3 cells, transfection of Egr-1 could drive activity of a reporter construct containing both sites. Moreover, Sp1 and Egr-1 could form a complex with kinetics that correlated with the production of Egr-1 in Jurkat cells upon PMA stimulation. Thus, Sp1 and Egr-1 physically and functionally cooperate to mediate maximal IL-2Rbeta promoter activity. PMID:9199305

  13. Spontaneous expression of immediately-early response genes c-fos and egr-1 in collagenase-producing rheumatoid synovial fibroblasts

    Microsoft Academic Search

    A. Trabandt; W. K. Aicher; R. E. Gay; V. P. Sukhatme; H.-G. Fassbender; S. Gay

    1992-01-01

    In view of the important role of interstitial collagenase in the pathogenesis of rheumatoid arthritis (RA), we studied the expression of fibroblast-type collagenase in rheumatoid synovium and searched for its potential transcription factors, namely the oncoprotein c-fos and the early-growth-response gene-1 (egr-1), an inducible zinc-finger encoding gene. Elevated levels of RNA sequences complimentary to c-fos and egr-1 cDNA probes could

  14. HIV-1 gp120 induces the activation of both c-fos and c-jun immediate-early genes in HEL megakaryocytic cells.

    PubMed

    Gibellini, D; Re, M C; Bassini, A; Guidotti, L; Catani, L; La Placa, M; Zauli, G

    1999-01-01

    We have previously demonstrated that the addition in culture of recombinant HIV-1 IIIB envelope gp120 affects the survival/growth of pluripotent haemopoietic progenitors, and, in particular, of those committed towards the megakaryocytic lineage. To characterize some of the molecular mechanisms involved in this phenomenon, we investigated the expression of members of the activating protein-1 (AP-1) complex in the HEL megakaryoblastic cell line. Following the treatment of HEL cells with recombinant IIIB envelope gp120, we noticed: (i) increased levels of endogenous c-fos and c-jun mRNA and proteins, (ii) activation of both c-fos and c-jun promoters, and (iii) a very rapid stimulation of a MAPK/ERK pathway. PMID:10027715

  15. An indole alkaloid from a tribal folklore inhibits immediate early event in HSV-2 infected cells with therapeutic efficacy in vaginally infected mice.

    PubMed

    Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh Chandra; Mondal, Supriya; Chandra, Nidhi S; Nandi, Suman; Sharon, Ashoke; Sarkar, Mamta Chawla; Chakrabarti, Sekhar; Chattopadhyay, Debprasad

    2013-01-01

    Herpes genitalis, caused by HSV-2, is an incurable genital ulcerative disease transmitted by sexual intercourse. The virus establishes life-long latency in sacral root ganglia and reported to have synergistic relationship with HIV-1 transmission. Till date no effective vaccine is available, while the existing therapy frequently yielded drug resistance, toxicity and treatment failure. Thus, there is a pressing need for non-nucleotide antiviral agent from traditional source. Based on ethnomedicinal use we have isolated a compound 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole (HM) from the traditional herb Ophiorrhiza nicobarica Balkr, and evaluated its efficacy on isolates of HSV-2 in vitro and in vivo. The cytotoxicity (CC50), effective concentrations (EC50) and the mode of action of HM was determined by MTT, plaque reduction, time-of-addition, immunofluorescence (IFA), Western blot, qRT-PCR, EMSA, supershift and co-immunoprecipitation assays; while the in vivo toxicity and efficacy was evaluated in BALB/c mice. The results revealed that HM possesses significant anti-HSV-2 activity with EC50 of 1.1-2.8 µg/ml, and selectivity index of >20. The time kinetics and IFA demonstrated that HM dose dependently inhibited 50-99% of HSV-2 infection at 1.5-5.0 µg/ml at 2-4 h post-infection. Further, HM was unable to inhibit viral attachment or penetration and had no synergistic interaction with acyclovir. Moreover, Western blot and qRT-PCR assays demonstrated that HM suppressed viral IE gene expression, while the EMSA and co-immunoprecipitation studies showed that HM interfered with the recruitment of LSD-1 by HCF-1. The in vivo studies revealed that HM at its virucidal concentration was nontoxic and reduced virus yield in the brain of HSV-2 infected mice in a concentration dependent manner, compared to vaginal tissues. Thus, our results suggest that HM can serve as a prototype to develop non-nucleotide antiviral lead targeting the viral IE transcription for the management of HSV-2 infections. PMID:24167591

  16. Striatal patch compartment lesions alter methamphetamine-induced behavior and immediate early gene expression in the striatum, substantia nigra and frontal cortex.

    PubMed

    Murray, Ryan C; Gilbert, Yamiece E; Logan, Anna S; Hebbard, John C; Horner, Kristen A

    2014-07-01

    Methamphetamine (METH) induces stereotypy, which is characterized as inflexible, repetitive behavior. Enhanced activation of the patch compartment of the striatum has been correlated with stereotypy, suggesting that stereotypy may be related to preferential activation of this region. However, the specific contribution of the patch compartment to METH-induced stereotypy is not clear. To elucidate the involvement of the patch compartment to the development of METH-induced stereotypy, we determined if destruction of this sub-region altered METH-induced behaviors. Animals were bilaterally infused in the striatum with the neurotoxin dermorphin-saporin (DERM-SAP; 17 ng/?l) to specifically ablate the neurons of the patch compartment. Eight days later, animals were treated with METH (7.5 mg/kg), placed in activity chambers, observed for 2 h and killed. DERM-SAP pretreatment significantly reduced the number and total area of mu-labeled patches in the striatum. DERM-SAP pretreatment significantly reduced the intensity of METH-induced stereotypy and the spatial immobility typically observed with METH-induced stereotypy. In support of this observation, DERM-SAP pretreatment also significantly increased locomotor activity in METH-treated animals. In the striatum, DERM-SAP pretreatment attenuated METH-induced c-Fos expression in the patch compartment, while enhancing METH-induced c-Fos expression in the matrix compartment. DERM-SAP pretreatment followed by METH administration augmented c-Fos expression in the SNpc and reduced METH-induced c-Fos expression in the SNpr. In the medial prefrontal, but not sensorimotor cortex, c-Fos and zif/268 expression was increased following METH treatment in animals pre-treated with DERM-SAP. These data indicate that the patch compartment is necessary for the expression of repetitive behaviors and suggests that alterations in activity in the basal ganglia may contribute to this phenomenon. PMID:23625147

  17. Gene expression profiling in a mouse model of infantile neuronal ceroid lipofuscinosis reveals upregulation of immediate early genes and mediators of the inflammatory response

    Microsoft Academic Search

    Xingwen Qiao; Jui-Yun Lu; Sandra L Hofmann

    2007-01-01

    BACKGROUND: The infantile form of neuronal ceroid lipofuscinosis (also known as infantile Batten disease) is caused by hereditary deficiency of a lysosomal enzyme, palmitoyl-protein thioesterase-1 (PPT1), and is characterized by severe cortical degeneration with blindness and cognitive and motor dysfunction. The PPT1-deficient knockout mouse recapitulates the key features of the disorder, including seizures and death by 7–9 months of age.

  18. Direct Quantification of Human Cytomegalovirus Immediate-Early and Late mRNA Levels in Blood of Lung Transplant Recipients by Competitive Nucleic Acid Sequence-Based Amplification

    PubMed Central

    Greijer, Astrid E.; Verschuuren, Erik A. M.; Harmsen, Martin C.; Dekkers, Chantal A. J.; Adriaanse, Henriëtte M. A.; The, T. Hauw; Middeldorp, Jaap M.

    2001-01-01

    The dynamics of active human cytomegalovirus (HCMV) infection was monitored by competitive nucleic acid sequence-based amplification (NASBA) assays for quantification of IE1 (UL123) and pp67 (UL65) mRNA expression levels in the blood of patients after lung transplantation. RNA was isolated from 339 samples of 13 lung transplant recipients and analyzed by the quantitative IE1 and pp67 NASBA in parallel with pp65 antigenemia and serology. Rapid increases in IE1 RNA exceeding 104 copies per 100 ?l of blood were associated with active infection, whereas lower levels were suggestive for abortive, subclinical viral activity. Any positive value for pp67 RNA was indicative for active infection, and quantification of pp67 mRNA did not give additional diagnostic information. The onset of IE1-positive NASBA preceded pp67 NASBA and was earlier than the pp65 antigenemia assay, confirming previous studies with qualitative NASBA. Effective antiviral treatment was reflected by a rapid disappearance of pp67 mRNA, whereas IE1 mRNA remained detectable for longer periods. Quantification of IE1 might be relevant to monitor progression of HCMV infection but should be validated in prospective studies. PMID:11136779

  19. Dopamine D 4 receptor signaling in the rat paraventricular hypothalamic nucleus: Evidence of natural coupling involving immediate early gene induction and mitogen activated protein kinase phosphorylation

    Microsoft Academic Search

    Robert S. Bitner; Arthur L. Nikkel; Stephani Otte; Brenda Martino; Eve H. Barlow; Pramila Bhatia; Andrew O. Stewart; Jorge D. Brioni; Michael W. Decker; Robert B. Moreland

    2006-01-01

    The dopamine D4 receptor has been investigated for its potential role in several CNS disorders, notably schizophrenia and more recently, erectile dysfunction. Whereas studies have investigated dopamine D4 receptor-mediated signaling in vitro, there have been few, if any, attempts to identify dopamine D4 receptor signal transduction pathways in vivo. In the present studies, the selective dopamine D4 agonist PD168077 induces

  20. Conjunction of Vocal Production and Perception Regulates Expression of the Immediate Early Gene ZENK in a Novel Cortical Region of Songbirds

    PubMed Central

    Alderete, Tanya L.; Chang, Daniel

    2010-01-01

    The cortical nucleus LMAN (lateral magnocellular nucleus of the anterior nidopallium) provides the output of a basal ganglia pathway that is necessary for acquisition of learned vocal behavior during development in songbirds. LMAN is composed of two subregions, a core and a surrounding shell, that give rise to independent pathways that traverse the forebrain in parallel. The LMANshell pathway forms a recurrent loop that includes a cortical region, the dorsal region of the caudolateral nidopallium (dNCL), hitherto unknown to be involved with learned vocal behavior. Here we show that vocal production strongly induces the IEG product ZENK in dNCL of zebra finches. Hearing tutor song while singing is more effective at inducing expression in dNCL of juvenile birds during the auditory–motor integration stage of vocal learning than is hearing conspecific song. In contrast, hearing conspecific song is relatively more effective at inducing expression in adult birds, regardless of whether they are producing song. Furthermore, ZENK+ neurons in dNCL include projection neurons that are part of the LMANshell recurrent loop and a high proportion of dNCL projection neurons express ZENK in singing juvenile birds that hear tutor song. Thus juvenile birds that are actively refining their vocal pattern to imitate a tutor song show high levels of ZENK induction in dNCL neurons when they are singing while hearing the song of their tutor and low levels when they hear a novel conspecific. This pattern indicates that dNCL is a novel brain region involved with vocal learning and that its function is developmentally regulated. PMID:20107119

  1. Multiple polymersomes for programmed release of multiple components.

    PubMed

    Kim, Shin-Hyun; Shum, Ho Cheung; Kim, Jin Woong; Cho, Jun-Cheol; Weitz, David A

    2011-09-28

    Long-term storage and controlled release of multiple components while avoiding cross-contamination have potentially important applications for pharmaceuticals and cosmetics. Polymersomes are very promising delivery vehicles but cannot be used to encapsulate multiple independent components and release them in a controlled manner. Here, we report a microfluidic approach to produce multiple polymersomes, or polymersomes-in-polymersome by design, enabling encapsulation and programmed release of multiple components. Monodisperse polymersomes are prepared from templates of double-emulsion drops, which in turn are injected as the innermost phase to form the second level of double-emulsion drops, producing double polymersomes. Using the same strategy, higher-order polymersomes are also prepared. In addition, incorporation of hydrophobic homopolymer into the different bilayers of the multiple polymersomes enables controlled and sequential dissociation of the different bilayer membranes in a programmed fashion. The high encapsulation efficiency of this microfluidic approach, as well as its programmability and the biocompatibility of the materials used to form the polymersomes, will provide new opportunities for practical delivery systems of multiple components. PMID:21838246

  2. Correctly rounded multiplication by arbitrary precision constants

    E-print Network

    Brisebarre, Nicolas

    Correctly rounded multiplication by arbitrary precision constants J.-M. Muller Ar´enaire, LIP, ´E;Multiplications by constants Many numerical algorithms : multiplications by constants that are not exactly multiplications by constants. Correctly rounded multiplication by arbitrary precision constants 2/26 #12;Correctly

  3. Multiple Regression and Its Discontents

    ERIC Educational Resources Information Center

    Snell, Joel C.; Marsh, Mitchell

    2012-01-01

    Multiple regression is part of a larger statistical strategy originated by Gauss. The authors raise questions about the theory and suggest some changes that would make room for Mandelbrot and Serendipity.

  4. Multiple tone operation of edgetones

    Microsoft Academic Search

    G. R. Stegen; K. Karamcheti

    1970-01-01

    Multiple tone operation of an edgetone is examined experimentally. It is shown that during stage 2 operation two discrete modes of operation may exist simultaneously. The second mode of operation is proven to be a persistence of stage 1 operation.

  5. LIDAR multiple scattering from clouds

    NASA Astrophysics Data System (ADS)

    Bissonnette, L. R.; Bruscaglioni, P.; Ismaelli, A.; Zaccanti, G.; Cohen, A.; Benayahu, Y.; Kleiman, M.; Egert, S.; Flesia, C.; Schwendimann, P.; Starkov, A. V.; Noormohammadian, M.; Oppel, U. G.; Winker, D. M.; Zege, E. P.; Katsev, I. L.; Polonsky, I. N.

    1995-04-01

    Multiple-scattering LIDAR return calculations obtained by seven different models for the same specified numerical experiment are compared. This work results from an international joint effort stimulated by the workshop group called MUSCLE for MUltiple SCattering Lidar Experiments. The models include approximations to the radiative-transfer theory, Monte-Carlo calculations, a stochastic model of the process of multiple scattering, and an extension of Mie theory for particles illuminated by direct and scattered light. The model solutions are similar in form but differ by up to a factor of 5 in the strength of the multiple-scattering contributions. Various reasons for the observed differences are explored and their practical significance is discussed.

  6. Genetics Home Reference: Multiple sclerosis

    MedlinePLUS

    ... The triggers of clinical attacks and remissions are unknown. After about 10 years, relapsing-remitting MS usually ... 1 in 20,000 people are affected. For unknown reasons, most forms of multiple sclerosis affect women ...

  7. Wearable multiple sensor acquisition device

    E-print Network

    Elledge, Christopher Lee, 1980-

    2003-01-01

    The wearable multiple sensor acquisition device is targeted as the primary sensor hub for the next revision of the MIThril wearable computer architecture. The device provides 3-axis acceleration sensing, infrared transmission ...

  8. Let's Practice Multiplication and Division!

    NSDL National Science Digital Library

    Miss Aycock

    2009-04-15

    Use the games below to improve your multiplication and division skills. Today, we are going to play some fun games that help us get better at multiplication and division. Follow the directions below: 1. Choose one of the following games. If you are a boy, you may wish to play with the catapult in Flight of the Knight. If you are a girl, you could ...

  9. Secure Sketch for Multiple Secrets

    Microsoft Academic Search

    Chengfang Fang; Qiming Li; Ee-Chien Chang

    2010-01-01

    \\u000a Secure sketches are useful in extending cryptographic schemes to biometric data since they allow recovery of fuzzy secrets\\u000a under inevitable noise. In practice, secrets derived from biometric data are seldom used alone, but typically employed in\\u000a a multi-factor or a multimodality setting where multiple secrets with different roles and limitations are used together. To\\u000a handle multiple secrets, we can generate

  10. Multiple Interactions in Pythia 8

    E-print Network

    Richard Corke

    2009-01-19

    Modelling multiple partonic interactions in hadronic events is vital for understanding minimum-bias physics, as well as the underlying event of hard processes. A brief overview of the current Pythia 8 multiple interactions (MI) model is given, before looking at two additional effects which can be included in the MI framework. With rescattering, a previously scattered parton is allowed to take part in another subsequent scattering, while with enhanced screening, the effects of varying initial-state fluctuations are modelled.

  11. Quantum spread spectrum multiple access

    E-print Network

    Juan Carlos Garcia-Escartin; Pedro Chamorro-Posada

    2014-11-27

    We describe a quantum multiple access scheme that can take separate single photon channels and combine them in the same path. We propose an add-drop multiplexer that can insert or extract a single photon into an optical fibre carrying the qubits of all the other users. The system follows the principle of code division multiple access, a spread spectrum technique widely used in cellular networks.

  12. Multiple imputation analysis of casecohort studies

    E-print Network

    Paris-Sud XI, Université de

    Multiple imputation analysis of casecohort studies Helena MARTI Biostatistics, CESP Centre de and multiple imputation 5 4 Validation of the method 8 4.1 Simulations casecohort studies rely on sometimes not fully ecient weighted estimators. Multiple imputation might

  13. Algorithms for Multiple Vehicle Routing Problems

    E-print Network

    Bae, Jung Yun

    2014-06-02

    is a multiple depot, multiple terminal, Hamiltonian Path problem. Given multiple vehicles starting at distinct depots, a set of targets and terminal locations, the objective of this problem is to find a vertex-disjoint path for each vehicle...

  14. Emotional Disorders in People with Multiple Sclerosis

    MedlinePLUS

    ... and their FAMILIES EMOTIONAL DISORDERS IN PEOPLE WITH MULTIPLE SCLEROSIS This fact sheet presents the current research on ... American Association of Neuroscience Nurses, the Consortium of Multiple Sclerosis Centers, and the International Organization of Multiple Sclerosis ...

  15. NEW HAIL DIAGNOSTIC PARAMETERS DERVIED BY INTEGRATING MULTIPLE RADARS AND MULTIPLE SENSORS

    E-print Network

    Smith, Travis

    multiple-radars and multiple-sensors to rapidly prototype some new applications to diagnose hail in stormsP7.8 NEW HAIL DIAGNOSTIC PARAMETERS DERVIED BY INTEGRATING MULTIPLE RADARS AND MULTIPLE SENSORS. The ORPG is limited in that it cannot integrate data from multiple-radars or multiple-sensors

  16. Biological auctions with multiple rewards.

    PubMed

    Reiter, Johannes G; Kanodia, Ayush; Gupta, Raghav; Nowak, Martin A; Chatterjee, Krishnendu

    2015-08-01

    The competition for resources among cells, individuals or species is a fundamental characteristic of evolution. Biological all-pay auctions have been used to model situations where multiple individuals compete for a single resource. However, in many situations multiple resources with various values exist and single reward auctions are not applicable. We generalize the model to multiple rewards and study the evolution of strategies. In biological all-pay auctions the bid of an individual corresponds to its strategy and is equivalent to its payment in the auction. The decreasingly ordered rewards are distributed according to the decreasingly ordered bids of the participating individuals. The reproductive success of an individual is proportional to its fitness given by the sum of the rewards won minus its payments. Hence, successful bidding strategies spread in the population. We find that the results for the multiple reward case are very different from the single reward case. While the mixed strategy equilibrium in the single reward case with more than two players consists of mostly low-bidding individuals, we show that the equilibrium can convert to many high-bidding individuals and a few low-bidding individuals in the multiple reward case. Some reward values lead to a specialization among the individuals where one subpopulation competes for the rewards and the other subpopulation largely avoids costly competitions. Whether the mixed strategy equilibrium is an evolutionarily stable strategy (ESS) depends on the specific values of the rewards. PMID:26180069

  17. Subpixel resolution from multiple images

    NASA Technical Reports Server (NTRS)

    Cheeseman, Peter; Kanefsky, Rob; Stutz, John; Kraft, Richard

    1994-01-01

    Multiple images taken from similar locations and under similar lighting conditions contain similar, but not identical, information. Slight differences in instrument orientation and position produces mismatches between the projected pixel grids. These mismatches ensure that any point on the ground is sampled differently in each image. If all the images can be registered with respect to each other to a small fraction of a pixel accuracy, then the information from the multiple images can be combined to increase linear resolution by roughly the square root of the number of images. In addition, the gray-scale resolution of the composite image is also improved. We describe methods for multiple image registration and combination, and discuss some of the problems encountered in developing and extending them. We display test results with 8:1 resolution enhancement, and Viking Orbiter imagery with 2:1 and 4:1 enhancements.

  18. Multiplicity of chemically peculiar stars

    E-print Network

    S. Hubrig; N. Ageorges; M. Schoeller

    2005-10-11

    Recently, with the goal to study multiplicity of chemically peculiar stars, we carried out a survey of 40 stars using diffraction limited near infrared (IR) imaging with NAOS-CONICA (NACO) at the VLT. Here, we announce the detection of 27 near IR companion candidates around 25 late B-type chemically peculiar stars exhibiting strong overabundances of the chemical elements Hg and Mn in their atmospheres. A key point for the understanding of the abundance patterns in these stars may be connected with binarity and multiplicity. It is intriguing that more than half of the sample of HgMn stars studied previously by speckle interferometry and recently using the adaptive optics system NACO belong to multiple systems.

  19. Convergence and Discriminant: Assessing Multiple Traits Using Multiple Methods

    ERIC Educational Resources Information Center

    Pae, Hye K.

    2012-01-01

    Multiple traits of language proficiency as well as test method effects were concurrently analyzed to investigate interrelations of construct validity, convergent validity, and discriminant validity using multitrait-multimethod (MTMM) matrices. A total of 585 test takers' scores were derived from the field test of the "Pearson Test of English…

  20. Multiple-Symbol Detection Of Multiple-Trellis-Coded MDPSK

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; Simon, Marvin K.; Shahshahani, Mehrdad M.

    1991-01-01

    In proposed scheme for detection and decoding of multiple-trellis-coded multilevel differential-phase-shift-keyed (MDPSK) radio signals, observation time for differential detection extended from conventional 2 to larger number of symbol periods. Decreases rate of error in differential detection of uncoded MDPSK by increasing number of symbol periods.

  1. Multiple Imputation Strategies for Multiple Group Structural Equation Models

    ERIC Educational Resources Information Center

    Enders, Craig K.; Gottschall, Amanda C.

    2011-01-01

    Although structural equation modeling software packages use maximum likelihood estimation by default, there are situations where one might prefer to use multiple imputation to handle missing data rather than maximum likelihood estimation (e.g., when incorporating auxiliary variables). The selection of variables is one of the nuances associated…

  2. Multiple Sclerosis and its Management

    PubMed Central

    Weinshenker, Brian

    1992-01-01

    Multiple sclerosis, the most common disabling disease of the central nervous system affecting young adults, is diagnosed primarily from a history of typical relapsing and remitting white matter symptoms supported by objective signs. Multiple sclerosis may present in more insidious ways or may be mimicked by other diseases, which seemingly satisfy the diagnostic criteria of dissemination in time and space. Patients need psychological support to deal with an uncertain future. A multidisciplinary team approach can best manage both acute temporary disability and, often later, progressive physical and occasionally mental disability. ImagesFigures 1-3 PMID:21221279

  3. SPSS Tutorial for Multiple Comparisons

    NSDL National Science Digital Library

    Little, Laura

    Authored by Laura Little of the University of Washington, this tutorial exposes students to conducting multiple comparisons in SPSS. This html based tutorial provides extensive screen shots and an example data set. Topics covered in the tutorial include: one way ANOVA, preplanned contrasts, Bonferroni, Post Hoc Tukey's HSD, and Scheffe's multiple contrasts. This is a great example of how to use statistical tools such as SPSS in a psychological statistics course. Little does excellent work in providing a step by step approach to learning these methods.

  4. Bilateral Multiple Level Lateral Meningocoele

    PubMed Central

    Kumar, B. E. Panil; Hegde, Kishor V.; Kumari, G. Lalitha; Agrawal, Amit

    2013-01-01

    Lateral meningocoele is a very rare disorder characterized by extensions of the dura and arachnoid through an enlarged neural foramen. We report a case of a 23-year-old female with deformity of spine who presented with low back pain and no neurological deficits. A whole spine magnetic resonance imaging showed multiple well-defined cystic masses involving dorsal, lumbar, and sacral spinal levels bilaterally, with dural ectasia and neural foraminal widening suggestive of bilateral multiple level lateral meningocoele. The patient is being managed conservatively and is on regular follow-up. PMID:23607071

  5. Multiple resonant railgun power supply

    DOEpatents

    Honig, E.M.; Nunnally, W.C.

    1985-06-19

    A multiple repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. A plurality of serially connected paired parallel rails are powered by similar power supplies. Each supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles. The multiple serial operation permits relatively small energy components to deliver overall relatively large amounts of energy to the projectiles being propelled.

  6. Multiple scattering in single scatterers

    NASA Astrophysics Data System (ADS)

    Cai, Liang-Wu

    2004-03-01

    Scattering by a multilayered scatterer is analyzed via a novel multiple-scattering approach. Based on the recognition that multiple scattering occurs within single scatterers having internal interfaces, the solution procedure follows the physical process, and yields analytically exact solutions. A simple two-layered scatterer subjected to SH incident waves is used to illustrate the detailed solution procedure. The solution is then verified by a two-layered circular cylindrical scatterer, whose exact analytical solution has previously been obtained by the author [J. Acoust. Soc. Am. (2004)]. The proposed approach opens new ways for analyzing scatterers of more complicated geometrical and physical compositions.

  7. Multiple order common path spectrometer

    NASA Technical Reports Server (NTRS)

    Newbury, Amy B. (Inventor)

    2010-01-01

    The present invention relates to a dispersive spectrometer. The spectrometer allows detection of multiple orders of light on a single focal plane array by splitting the orders spatially using a dichroic assembly. A conventional dispersion mechanism such as a defraction grating disperses the light spectrally. As a result, multiple wavelength orders can be imaged on a single focal plane array of limited spectral extent, doubling (or more) the number of spectral channels as compared to a conventional spectrometer. In addition, this is achieved in a common path device.

  8. Multiplicity description by gluon model

    E-print Network

    E. S. Kokoulina

    2015-04-07

    Study of high multiplicity events in proton-proton interactions is carried out at the U-70 accelerator (IHEP, Protvino). These events are extremely rare. Usually, Monte Carlo codes underestimate topological cross sections in this region. The gluon dominance model (GDM) was offered to describe them. It is based on QCD and a phenomenological scheme of a hadronization stage. This model indicates a recombination mechanism of hadronization and a gluon fission. Future program of the SVD Collaboration is aimed at studying a long-standing puzzle of excess soft photon yield and its connection with high multiplicity at the U-70 and Nuclotron facility at JINR, Dubna.

  9. Multiple teleportation via the partially entangled states

    E-print Network

    Meiyu Wang; Fengli Yan

    2009-03-08

    We investigate the multiple teleportation with some nonmaximally entangled channels. The efficiencies of two multiple teleportation protocols, the separate multiple teleportation protocol (SMTP) and the global multiple teleportation protocol (GMTP), are calculated. We show that GMTP is more efficient than SMTP.

  10. Fast sparse matrix multiplication Raphael Yuster

    E-print Network

    Yuster, Raphael

    Fast sparse matrix multiplication Raphael Yuster Uri Zwick Abstract Let A and B two n Ã? n.e., multiplications, additions and subtractions) over R. The naive matrix multiplication algorithm, on the other hand faster than the best known matrix multiplication algorithm for dense matrices which uses O(n2

  11. Multiple stars: designation, catalogues, A. Tokovinin1

    E-print Network

    Tokovinin, Andrei A.

    Multiple stars: designation, catalogues, statistics A. Tokovinin1 Cerro Tololo Inter of multiple-star components leads to a conclusion that, apart from components, we need to designate systems in the multiple star catalogue, now available on-line. A short review of multiple-star statistics is given

  12. Modular Multiplication using Redundant Digit Division

    E-print Network

    California at Davis, University of

    Modular Multiplication using Redundant Digit Division Ping Tak Peter Tang Intel Corporation 2200 multiplication, ABR-1 mod N, instead of modular multiplication, AB mod N, even the former re- quires some transformational overheads. This is so because a state-of-the-art Montgomery multiplication implementa- tion has

  13. Dean's Great Discovery: Multiplication, Division and Fractions

    ERIC Educational Resources Information Center

    Vale, Colleen; Davies, Anne

    2007-01-01

    Multiplication, division and fractions are "hotspots" for students in the middle years with many students experiencing difficulty with these concepts. Arrays effectively model multiplication and help children develop multiplicative thinking and learn multiplication facts. In this article the authors show how an open-ended array problem enabled a…

  14. Bivariate Polynomial Multiplication \\Lambda Markus Blaser

    E-print Network

    Bläser, Markus

    Bivariate Polynomial Multiplication \\Lambda Markus BlË?aser Institut fË?ur Informatik II, Universit in [5], we study the mul­ tiplicative complexity and the rank of the multiplication in the local))\\Delta dim Tn for the multiplicative complexity of the multiplication in R m;n and Tn , respectively

  15. On the Time Required to Perform Multiplication

    Microsoft Academic Search

    Shmuel Winograd; Yorktown Heights

    1967-01-01

    The time required to perform multiplication is investigated. A lower bound on the time required to perform multiplication, as well as multiplication modulo N, is derived and it is shown that these lower bounds can be approached. Then a lower bound on the amount of time required to perform the most significant part of multiplication (⌞xy\\/N⌟) is derived.

  16. Immunization of pregnant sows with a novel virulence gene deleted live Salmonella vaccine and protection of their suckling piglets against salmonellosis

    Microsoft Academic Search

    Jin Hur; John Hwa Lee

    2010-01-01

    This study was carried out to examine a novel Salmonella Typhimurium (S. Typhimurium) vaccine for protection of suckling piglets against salmonellosis by immunization of pregnant sows using various administration routes. The vaccine strain was constructed by deletion of cpxR and lon from a wild type S. Typhimurium and the S. Typhimurium ?cpxR?lon?asd secreting the B subunit of the Escherichia coli

  17. Nociceptor-specific gene deletion reveals a major role for Nav1.7 (PN1) in acute and inflammatory pain

    Microsoft Academic Search

    Mohammed A. Nassar; L. Caroline Stirling; Greta Forlani; Mark D. Baker; Elizabeth A. Matthews; Anthony H. Dickenson; John N. Wood

    2004-01-01

    Nine voltage-gated sodium channels are expressed in complex patterns in mammalian nerve and muscle. Three channels, Nav1.7, Nav1.8, and Nav1.9, are expressed selectively in peripheral damage-sensing neurons. Because there are no selective blockers of these channels, we used gene ablation in mice to examine the function of Nav1.7 (PN1) in pain pathways. A global Nav1.7-null mutant was found to die

  18. Variation in Plasmodium falciparum Histidine-Rich Protein 2 (Pfhrp2) and Plasmodium falciparum Histidine-Rich Protein 3 (Pfhrp3) Gene Deletions in Guyana and Suriname

    PubMed Central

    Akinyi Okoth, Sheila; Abdallah, Joseph F.; Ceron, Nicolas; Adhin, Malti R.; Chandrabose, Javin; Krishnalall, Karanchand; Huber, Curtis S.; Goldman, Ira F.; Macedo de Oliveira, Alexandre; Barnwell, John W.; Udhayakumar, Venkatachalam

    2015-01-01

    Guyana and Suriname have made important progress in reducing the burden of malaria. While both countries use microscopy as the primary tool for clinical diagnosis, malaria rapid diagnostic tests (RDTs) are useful in remote areas of the interior where laboratory support may be limited or unavailable. Recent reports indicate that histidine-rich protein 2 (PfHRP2)-based diagnostic tests specific for detection of P. falciparum may provide false negative results in some parts of South America due to the emergence of P. falciparum parasites that lack the pfhrp2 gene, and thus produce no PfHRP2 antigen. Pfhrp2 and pfhrp3 genes were amplified in parasite isolates collected from Guyana and Suriname to determine if there were circulating isolates with deletions in these genes. Pfhrp3 deletions were monitored because some monoclonal antibodies utilized in PfHRP2-based RDTs cross-react with the PfHRP3 protein. We found that all 97 isolates from Guyana that met the inclusion criteria were both pfhrp2- and pfhrp3-positive. In Suriname (N = 78), 14% of the samples tested were pfhrp2-negative while 4% were pfhrp3-negative. Furthermore, analysis of the genomic region proximal to pfhrp2 and pfhrp3 revealed that genomic deletions extended to the flanking genes. We also investigated the population substructure of the isolates collected to determine if the parasites that had deletions of pfhrp2 and pfhrp3 belonged to any genetic subtypes. Cluster analysis revealed that there was no predominant P. falciparum population substructure among the isolates from either country, an indication of genetic admixture among the parasite populations. Furthermore, the pfhrp2-deleted parasites from Suriname did not appear to share a single, unique genetic background. PMID:25978499

  19. Generation of G gene-deleted viral hemorrhagic septicemia virus (VHSV) and evaluation of its vaccine potential in olive flounder (Paralichthys olivaceus).

    PubMed

    Kim, Min Sun; Park, Ji Sun; Kim, Ki Hong

    2015-08-01

    Generation of recombinant viruses lacking an essential gene for the production of infective viral particles would be a way to produce safety-enhanced live viral vaccines. The rhabdoviral envelope-spiked glycoprotein (G) plays critical roles in the attachment of viruses on the cell surface receptor and in the transfer of endocytosed viruses to the cytoplasm by fusion to the endosomal membrane. In the present study, we produced a G gene-lacking recombinant viral hemorrhagic septicemia virus (rVHSV-?G) that has no ability to form plaques in the cells without a trans-supply of the G protein, which suggests that rVHSV-?G is a single cycle virus and progenies of rVHSV-?G are not infectious. One of the major advantages of attenuated vaccines is the maintenance of replication ability in the host, which enforces the adaptive immune responses. However, in spite of lacking an ability to produce infective viral particles, immunization with the present rVHSV-?G induced significantly higher serum neutralization titers and survival rates against virulent VHSV challenge in olive flounder (Paralichthys olivaceus) fingerlings, indicating that the present rVHSV-?G has a high potential as a prophylactic vaccine. PMID:26052020

  20. A Rhomboid Protease Gene Deletion Affects a Novel Oligosaccharide N-Linked to the S-layer Glycoprotein of Haloferax volcanii*

    PubMed Central

    Parente, Juliana; Casabuono, Adriana; Ferrari, María Celeste; Paggi, Roberto Alejandro; De Castro, Rosana Esther; Couto, Alicia Susana; Giménez, María Inés

    2014-01-01

    Rhomboid proteases occur in all domains of life; however, their physiological role is not completely understood, and nothing is known of the biology of these enzymes in Archaea. One of the two rhomboid homologs of Haloferax volcanii (RhoII) is fused to a zinc finger domain. Chromosomal deletion of rhoII was successful, indicating that this gene is not essential for this organism; however, the mutant strain (MIG1) showed reduced motility and increased sensitivity to novobiocin. Membrane preparations of MIG1 were enriched in two glycoproteins, identified as the S-layer glycoprotein and an ABC transporter component. The H. volcanii S-layer glycoprotein has been extensively used as a model to study haloarchaeal protein N-glycosylation. HPLC analysis of oligosaccharides released from the S-layer glycoprotein after PNGase treatment revealed that MIG1 was enriched in species with lower retention times than those derived from the parent strain. Mass spectrometry analysis showed that the wild type glycoprotein released a novel oligosaccharide species corresponding to GlcNAc-GlcNAc(Hex)2-(SQ-Hex)6 in contrast to the mutant protein, which contained the shorter form GlcNAc2(Hex)2-SQ-Hex-SQ. A glycoproteomics approach of the wild type glycopeptide fraction revealed Asn-732 peptide fragments linked to the sulfoquinovose-containing oligosaccharide. This work describes a novel N-linked oligosaccharide containing a repeating SQ-Hex unit bound to Asn-732 of the H. volcanii S-layer glycoprotein, a position that had not been reported as glycosylated. Furthermore, this study provides the first insight on the biological role of rhomboid proteases in Archaea, suggesting a link between protein glycosylation and this protease family. PMID:24596091