These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector  

SciTech Connect

Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV gene products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli {beta}-galactosidase induced durable {beta}-gal-specific IgG and CD8{sup +} T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes.

Watanabe, Daisuke [Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115 (United States); Brockman, Mark A. [Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115 (United States); Ndung'u, Thumbi [Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115 (United States); Mathews, Lydia [Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115 (United States); Lucas, William T. [Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115 (United States); Murphy, Cynthia G. [Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115 (United States); Felber, Barbara K. [National Cancer Institute-Frederick, Frederick, MD 21702 (United States); Pavlakis, George N. [National Cancer Institute-Frederick, Frederick, MD 21702 (United States); Deluca, Neal A. [Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261 (United States); Knipe, David M. [Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115 (United States)]. E-mail: david_knipe@hms.harvard.edu

2007-01-20

2

Construction and application of an efficient multiple-gene-deletion system in Corynebacterium glutamicum.  

PubMed

Gene deletion techniques are important for modifying Corynebacterium glutamicum, the bacterium for industrial production of amino acids. In this study, a novel multiple-gene-deletion system for C. glutamicum was developed. The system is composed of three plasmids pDTW109, pDTW201 and pDTW202. pDTW109 is a temperature-sensitive vector which harbors a cat gene under the tacM promoter, a cre gene under the tac promoter, an origin oriE for replicating in Escherichia coli, and another origin rep(TS) for replicating in C. glutamicum only at low temperatures; it has high transformation efficiency in C. glutamicum and can be easily eliminated by growing at 37°C. pDTW201 and pDTW202 carry loxp-flanked or mutant lox-flanked kan, respectively. This deletion system combines homologous recombination and Cre/lox site-specific recombination, could efficiently delete the aceE gene from the chromosome of C. glutamicum ATCC13032, ATCC13869 or ATCC14067, respectively, and could also delete both genes of aceE and ilvA from the chromosome of C. glutamicum ATCC14067. The system is simple and efficient, and can be easily implemented for multiple-gene-deletion in C. glutamicum. PMID:23856168

Hu, Jinyu; Tan, Yanzhen; Li, Yanyan; Hu, Xiaoqing; Xu, Daqing; Wang, Xiaoyuan

2013-11-01

3

The green monster process for the generation of yeast strains carrying multiple gene deletions.  

PubMed

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition(1,2). There are examples where many genes need to be deleted to unmask hidden gene functions(3,4). Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative. In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker(5,6,7,8,9,10). However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated. Here we describe the Green Monster method for routinely engineering multiple deletions in yeast(11). In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction. The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci-either Green Monster GMToolkit-a or GMToolkit-? at the can1? locus (Figure 3). Using strains from the yeast deletion collection(12), GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or ?-mating-type-specific haploid selection marker(1) and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids. The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation. PMID:23271437

Suzuki, Yo; Stam, Jason; Novotny, Mark; Yachie, Nozomu; Lasken, Roger S; Roth, Frederick P

2012-01-01

4

A possible role of the P53 gene deletion as a prognostic factor in multiple myeloma.  

PubMed

The role of P53 gene abnormalities in the pathogenesis of multiple myeloma (MM) and their potential use as prognostic indicators remain uncertain. To further define this question, we studied genomic DNA from 50 MM and one plasma cell leukemia patients by polymerase chain reaction single-strand conformation polymorphism and sequencing, and fluorescence in situ hybridization in order to detect P53 mutation and deletion, respectively. Kaplan-Meier survival curves and the log-rank test were used to analyze the survival data. No P53 mutation was detected in our patients. In contrast, P53 deletion, predominantly monoallelic, was detected in 8 of 51 (15.7%) patients. Similar frequencies of P53 deletion were observed in patients stratified by age ( P=0.71), gender ( P=0.44), status, and stage of the disease ( P=0.70 and P=0.23, respectively). However, patients with P53 deletion had significantly shorter median overall survival compared with those without a deletion (7.4 vs 139.0 months, P<0.0001). On univariate regression analysis, P53 deletion was a parameter for predicting shortened survival ( P=0.02). We concluded that P53 mutation may be seen as a prognostic indicator of limited value in MM. In contrast, P53 deletion may be seen as a prognostic indicator of poor outcome. However, as the cohort of patients is rather limited for a prognostic analysis, these results should be confirmed by further studies with larger sized samples. PMID:12783209

Ortega, M M; Melo, M B; De Souza, C A; Lorand-Metze, I; Costa, F F; Lima, C S P

2003-07-01

5

Deletion of multiple immediate-early genes from herpes simplex virus reduces cytotoxicity and permits long-term gene expression in neurons.  

PubMed

Herpes simplex virus type 1 (HSV-1) has many attractive features that suggest its utility for gene transfer to neurons. However, viral cytotoxicity and transient transgene expression limit practical applications even in the absence of viral replication. Mutant viruses deleted for the immediate early (IE) gene, ICP4, an essential transcriptional transactivator, are toxic to many cell types in culture in which only the remaining IE genes are expressed. In order to test directly the toxicity of other IE gene products in neurons and develop a mutant background capable of longterm transgene expression, we generated mutants deleted for multiple IE genes in various combinations and tested their relative cytotoxicity in 9L rat gliosarcoma cells, Vero monkey kidney cells, and primary rat cortical and dorsal root neurons in culture. Viral mutants deleted simultaneously for the IE genes encoding ICP4, ICP22 and ICP27 showed substantially reduced cytotoxicity compared with viruses deleted for ICP4 alone or ICP4 in combination with either ICP22, ICP27 or ICP47. Infection of neurons in culture with these triple IE deletion mutants substantially enhanced cell survival and permitted transgene expression for over 21 days. Such mutants may prove useful for efficient gene transfer and extended transgene expression in neurons in vitro and in vivo. PMID:10023438

Krisky, D M; Wolfe, D; Goins, W F; Marconi, P C; Ramakrishnan, R; Mata, M; Rouse, R J; Fink, D J; Glorioso, J C

1998-12-01

6

Equine herpesvirus 1 gene 12 can substitute for vmw65 in the growth of herpes simplex virus (HSV) type 1, allowing the generation of optimized cell lines for the propagation of HSV vectors with multiple immediate-early gene defects.  

PubMed

Herpes simplex virus (HSV) has often been suggested for development as a vector, particularly for the nervous system. Considerable evidence has shown that for use of HSV as a vector, immediate-early (IE) gene expression must be minimized or abolished, otherwise such vectors are likely to be highly cytotoxic. Mutations of vmw65 which abolish IE promoter transactivating activity may also be included to reduce IE gene expression generally. However, when vmw65 mutations are combined with an IE gene deletion, such viruses are hard to propagate, even on cells which otherwise complement the IE gene deletion effectively. We have found that vmw65 mutants can be effectively grown on cell lines expressing equine herpesvirus 1 gene 12, a non-HSV homologue of vmw65 with little sequence similarity to its HSV counterpart. This prevents repair by homologous recombination of vmw65 mutations in the virus, which would occur if mutations were complemented by vmw65 itself. The gene 12 protein is not packaged into HSV virions, which is important if viruses grown on such cells are to be used as vectors. These results not only further strengthen the evidence for direct functional homology between and similar modes of action of the two proteins but have allowed the generation of gene 12-containing cell lines in which ICP4 and ICP27 expression is induced by virus infection (probably by ICP0) and which give efficient growth of viruses deficient in ICP27, ICP4, and vmw65 (the viruses also have ICP34.5/ORFP deleted). Efficient growth of such viruses has not previously been possible. As these viruses are highly deficient in IE gene expression generally, such virus-cell line combinations may provide an alternative to HSV vectors with deletions of all four of the regulatory IE genes which, for optimal growth, require cell lines containing all four IE genes but which are hard to generate due to the intrinsic cytotoxicity of each of the proteins. PMID:10438830

Thomas, S K; Lilley, C E; Latchman, D S; Coffin, R S

1999-09-01

7

Equine Herpesvirus 1 Gene 12 Can Substitute for vmw65 in the Growth of Herpes Simplex Virus (HSV) Type 1, Allowing the Generation of Optimized Cell Lines for the Propagation of HSV Vectors with Multiple Immediate-Early Gene Defects  

PubMed Central

Herpes simplex virus (HSV) has often been suggested for development as a vector, particularly for the nervous system. Considerable evidence has shown that for use of HSV as a vector, immediate-early (IE) gene expression must be minimized or abolished, otherwise such vectors are likely to be highly cytotoxic. Mutations of vmw65 which abolish IE promoter transactivating activity may also be included to reduce IE gene expression generally. However, when vmw65 mutations are combined with an IE gene deletion, such viruses are hard to propagate, even on cells which otherwise complement the IE gene deletion effectively. We have found that vmw65 mutants can be effectively grown on cell lines expressing equine herpesvirus 1 gene 12, a non-HSV homologue of vmw65 with little sequence similarity to its HSV counterpart. This prevents repair by homologous recombination of vmw65 mutations in the virus, which would occur if mutations were complemented by vmw65 itself. The gene 12 protein is not packaged into HSV virions, which is important if viruses grown on such cells are to be used as vectors. These results not only further strengthen the evidence for direct functional homology between and similar modes of action of the two proteins but have allowed the generation of gene 12-containing cell lines in which ICP4 and ICP27 expression is induced by virus infection (probably by ICP0) and which give efficient growth of viruses deficient in ICP27, ICP4, and vmw65 (the viruses also have ICP34.5/ORFP deleted). Efficient growth of such viruses has not previously been possible. As these viruses are highly deficient in IE gene expression generally, such virus-cell line combinations may provide an alternative to HSV vectors with deletions of all four of the regulatory IE genes which, for optimal growth, require cell lines containing all four IE genes but which are hard to generate due to the intrinsic cytotoxicity of each of the proteins. PMID:10438830

Thomas, S. K.; Lilley, C. E.; Latchman, D. S.; Coffin, R. S.

1999-01-01

8

Interstitial deletion of 11(p11.2p12): A newly described contiguous gene deletion syndrome involving the gene for hereditary multiple exostoses  

SciTech Connect

Individuals with deletions of the proximal portion of the short arm of chromosome 11 share many manifestations including mental retardation, biparietal foramina, minor facial anomalies, and multiple cartilaginous exostoses. The finding of multiple exostoses in these patients is remarkable as the disorder hereditary multiple exostoses, which is inherited in an autosomal dominant manner, has recently been mapped by linkage to three regions, including proximal 11p. We report the clinical and molecular findings in an additional patient with an 11(p11.2p12) deletion. Cytogenetic and molecular analysis demonstrated a de novo, paternally derived deletion for markers which have been shown to be tightly linked to the 11p locus (EXT2). These data support the location of EXT2 within this region and also provide information regarding the ordering of polymorphic markers on 11p. Deletion 11(p11.2p12) is a rare, yet specific, deletion syndrome involving the EXT2 locus, a gene for parietal foramina, and a mental retardation locus, and therefore can be classified as a contiguous gene deletion syndrome. 24 refs., 4 figs., 1 tab.

Potocki, L.; Shaffer, L.G. [Baylor College of Medicine, Houston, TX (United States)] [Baylor College of Medicine, Houston, TX (United States)

1996-03-29

9

Deletion of multiple immediate–early genes from herpes simplex virus reduces cytotoxicity and permits long-term gene expression in neurons  

Microsoft Academic Search

Herpes simplex virus type 1 (HSV-1) has many attractive features that suggest its utility for gene transfer to neurons. However, viral cytotoxicity and transient transgene expression limit practical applications even in the absence of viral replication. Mutant viruses deleted for the immediate–early (IE) gene, ICP4, an essential transcriptional transactivator, are toxic to many cell types in culture in which only

DM Krisky; D Wolfe; WF Goins; PC Marconi; R Ramakrishnan; M Mata; RJD Rouse; DJ Fink; JC Glorioso

1998-01-01

10

Multiple immediate-early gene-deficient herpes simplex virus vectors allowing efficient gene delivery to neurons in culture and widespread gene delivery to the central nervous system in vivo.  

PubMed

Herpes simplex virus (HSV) has several potential advantages as a vector for delivering genes to the nervous system. The virus naturally infects and remains latent in neurons and has evolved the ability of highly efficient retrograde transport from the site of infection at the periphery to the site of latency in the spinal ganglia. HSV is a large virus, potentially allowing the insertion of multiple or very large transgenes. Furthermore, HSV does not integrate into the host chromosome, removing any potential for insertional activation or inactivation of cellular genes. However, the development of HSV vectors for the central nervous system that exploit these properties has been problematical. This has mainly been due to either vector toxicity or an inability to maintain transgene expression. Here we report the development of highly disabled versions of HSV-1 deleted for ICP27, ICP4, and ICP34.5/open reading frame P and with an inactivating mutation in VP16. These viruses express only minimal levels of any of the immediate-early genes in noncomplementing cells. Transgene expression is maintained for extended periods with promoter systems containing elements from the HSV latency-associated transcript promoter (J. A. Palmer et al., J. Virol. 74:5604-5618, 2000). Unlike less-disabled viruses, these vectors allow highly effective gene delivery both to neurons in culture and to the central nervous system in vivo. Gene delivery in vivo is further enhanced by the retrograde transport capabilities of HSV. Here the vector is efficiently transported from the site of inoculation to connected sites within the nervous system. This is demonstrated by gene delivery to both the striatum and substantia nigra following striatal inoculation; to the spinal cord, spinal ganglia, and brainstem following injection into the spinal cord; and to retinal ganglion neurons following injection into the superior colliculus and thalamus. PMID:11287583

Lilley, C E; Groutsi, F; Han, Z; Palmer, J A; Anderson, P N; Latchman, D S; Coffin, R S

2001-05-01

11

Equine Herpesvirus 1 Gene 12 Can Substitute for vmw65 in the Growth of Herpes Simplex Virus (HSV) Type 1, Allowing the Generation of Optimized Cell Lines for the Propagation of HSV Vectors with Multiple Immediate-Early Gene Defects  

Microsoft Academic Search

Herpes simplex virus (HSV) has often been suggested for development as a vector, particularly for the nervous system. Considerable evidence has shown that for use of HSV as a vector, immediate-early (IE) gene expression must be minimized or abolished, otherwise such vectors are likely to be highly cytotoxic. Mutations of vmw65 which abolish IE promoter transactivating activity may also be

S. K. THOMAS; C. E. LILLEY; D. S. LATCHMAN; R. S. COFFIN

1999-01-01

12

Somatic mosaicism for a DMD gene deletion  

SciTech Connect

Mosaicism is a mixed state, with two cell populations of different genetic origins caused by a cell mutation occurring after fertilization. In the present case, DNA analysis of lymphocytes led to a DMD diagnosis before death. Postmortem immunocytochemical and DNA analysis showed somatic mosaicism. At age 18 years, blood lymphocyte DNA analysis showed a DMD gene deletion, upstream from exon 7 to the 5{prime} end containing both muscle and brain promoters. As the patient`s mother and elder sister had no deletions, he was considered to have a new mutation. Immunocytochemical studies of postmortem tissues showed that dystrophin was absent from the tongue, deltoid, intercostal, psoas and rectus femoris muscles, but there was a mix of dystrophin-positive and negative fibers in the rectus abdominis, cardiac, temporalis and sternocleidomastoid muscles. All diaphragm cells were dystrophin positive. Polymerase chain reaction (PCR) amplification from all tissues except the temporalis and sternocleidomastoid muscles, diaphragm and kidney, in which no deletion was found, showed the deletion from at least exon 6 to the 5{prime} end containing both muscle and brain promoters. In this case, a genomic deletion of the DMD gene contributed to the formation of tissues derived from both ectoderm and endoderm, and cells of mesodermal origin showed genotypic and phenotypic heterogeneity. Our results indicate a mutation of the present case may have occurred just before the period of germ layer formation. 34 refs., 7 figs.

Saito, Kayoko; Ikeya, Kiyoko; Kondo, Eri [Tokyo Women`s Medical College (Japan)] [and others

1995-03-13

13

Induction of the plasticity-associated immediate early gene Arc by stress and hallucinogens  

E-print Network

Induction of the plasticity-associated immediate early gene Arc by stress and hallucinogens: role effector immediate early genes. The immediate early gene, activity regulated cytoskeletal Stress and hallucinogen exposure evokes changes in neuronal structure and function often observed

Vaidya, Vidita

14

Evolutionary Conservation of the Egr-1 Immediate-Early Gene Response in a  

E-print Network

, California 94305 ABSTRACT Immediate-early gene expression is a key part of a neuron's response as part of the immediate-early gene response, the first wave of gene expression induced in a neuronEvolutionary Conservation of the Egr-1 Immediate-Early Gene Response in a Teleost SABRINA S

Fernald, Russell

15

Molecular basis of human growth hormone gene deletions  

Microsoft Academic Search

Crossover sites resulting from unequal recombination within the human growth hormone (GH) gene cluster that cause GH1 gene deletions and isolated GH deficiency type 1A were localized in nine patients. In eight unrelated subjects homozygous for 6.7-kilobase (kb) deletions, the breakpoints are within two blocks of highly homologous DNA sequences that lie 5â² and 3â² to the GH1 gene. In

C. L. Vnencak-Jones; J. A. Phillips; E. Y. Chen; P. H. Seeburg

1988-01-01

16

Large Contiguous Gene Deletions in Sjögren-Larsson Syndrome  

PubMed Central

Sjögren-Larsson syndrome (SLS) is an autosomal recessive disorder characterized by ichthyosis, mental retardation, spasticity and mutations in the ALDH3A2 gene for fatty aldehyde dehydrogenase, an enzyme that catalyzes the oxidation of fatty aldehyde to fatty acid. More than 70 mutations have been identified in SLS patients, including small deletions or insertions, missense mutations, splicing defects and complex nucleotide changes. We now describe 2 SLS patients whose disease is caused by large contiguous gene deletions of the ALDH3A2 locus on 17p11.2. The deletions were defined using long distance inverse PCR and microarray-based comparative genomic hybridization. A 24-year-old SLS female was homozygous for a 352-kb deletion involving ALDH3A2 and 4 contiguous genes including ALDH3A1, which codes for the major soluble protein in cornea. Although lacking corneal disease, she showed severe symptoms of SLS with uncommon deterioration in oral motor function and loss of ambulation. The other 19-month-old female patient was a compound heterozygote for a 1.44-Mb contiguous gene deletion and a missense mutation (c.407C>T, P136L) in ALDH3A2. These studies suggest that large gene deletions may account for up to 5% of the mutant alleles in SLS. Geneticists should consider the possibility of compound heterozygosity for large deletions in patients with SLS and other inborn errors of metabolism, which has implications for carrier testing and prenatal diagnosis. PMID:21684788

Engelstad, Holly; Carney, Gael; S'Aulis, Dana; Rise, Janae; Sanger, Warren G.; Rudd, M. Katharine; Richard, Gabriele; Carr, Christopher W.; Abdul-Rahman, Omar A.; Rizzo, William B.

2011-01-01

17

A Proteomic Analysis of Immediate-Early Response Plasma Proteins After 70% and 90% Partial Hepatectomy  

PubMed Central

Partial hepatectomy (PH) induces robust hepatic regenerative and metabolic responses that are considered to be triggered by humoral factors. The aim of the study was to identify plasma protein factors that potentially trigger or reflect the body’s immediate-early responses to liver mass reduction. Male C57BL/6 mice were subjected to sham operation, 70% PH, or 90% PH. Blood was collected from the inferior vena cava at 20, 60, and 180 minutes after surgery. Using a label-free quantitative mass spectrometry-based proteomics approach, we identified 399 proteins exhibiting significant changes in plasma expression between any two groups. Of the 399 proteins, 167 proteins had multiple unique sequences and high peptide ID confidence (>90%) and were defined as priority 1 proteins. A group of plasma proteins largely associated with metabolism is enriched after 70% PH. Among the plasma proteins that respond to 90% PH are a dominant group of proteins that are also associated with metabolism and one known cytokine (platelet factor 4). Ninety percent PH and 70% PH induces similar changes in plasma protein profile. Our findings enable us to gain insight into the immediate-early response of plasma proteins to liver mass loss. Our data support the notion that increased metabolic demands of the body after massive liver mass loss may function as a sensor that calibrates hepatic regenerative response. PMID:23279269

Kumar, Sudhanshu; Zou, Yuhong; Bao, Qi; Wang, Mu; Dai, Guoli

2015-01-01

18

Enhancer RNA facilitates NELF release from immediate early genes.  

PubMed

Enhancer RNAs (eRNAs) are a class of long noncoding RNAs (lncRNA) expressed from active enhancers, whose function and action mechanism are yet to be firmly established. Here we show that eRNAs facilitate the transition of paused RNA polymerase II (RNAPII) into productive elongation by acting as a decoy for the negative elongation factor (NELF) complex upon induction of immediate early genes (IEGs) in neurons. eRNAs are synthesized prior to the culmination of target gene transcription and interact with the NELF complex. Knockdown of eRNAs expressed at neuronal enhancers impairs transient release of NELF from the specific target promoters during transcriptional activation, coinciding with a decrease in target mRNA induction. The enhancer-promoter interaction was unaffected by eRNA knockdown. Instead, chromatin looping might enable eRNAs to act locally at a specific promoter. Our findings highlight the spatiotemporally regulated action mechanism of eRNAs during early transcriptional elongation. PMID:25263592

Schaukowitch, Katie; Joo, Jae-Yeol; Liu, Xihui; Watts, Jonathan K; Martinez, Carlos; Kim, Tae-Kyung

2014-10-01

19

Brain mechanisms of mammalian fluid homeostasis: Insights from use of immediate early gene mapping  

Microsoft Academic Search

A comprehensive review of the literature through mid-1997 is presented on the application of immediate early gene mapping to problems related to brain mechanisms of fluid homeostasis and cardiovascular regulation in mammals. First, the basic mechanisms of fluid intake and the principles and pitfalls of immediate early gene mapping are briefly introduced. Then, data from several principal paradigms are reviewed.

Neil E Rowland

1998-01-01

20

Caspase-3 Gene Deletion Prolongs Survival in Polycystic Kidney Disease  

PubMed Central

Pan-caspase inhibition reduces tubular apoptosis and proliferation and slows progression of disease in a rat model of polycystic kidney disease (PKD). It is unknown, however, which specific caspases are involved in PKD progression. Because caspase-3 is a major mediator of apoptosis, its role in autosomal recessive PKD was determined. Mice with caspase-3 gene deletion were crossed with mice harboring the congenital polycystic kidney (cpk) mutation to generate double-mutant mice. cpk;casp3?/? mice lived nearly 4 times longer than littermate control cpk mice (mean survival of 117 d versus 32 d, P < 0.01), and cpk;casp3+/? mice lived slightly longer than controls (mean survival of 56 d). In addition, the kidney weight, relative to body weight, was significantly lower in the cpk;casp3?/? mice than in the cpk and cpk;casp3+/? mice. Despite deletion of caspase-3, however, apoptosis occurred and cysts formed; therefore, the alternative pathways of apoptosis in cystic kidneys were investigated. Caspase-7 was up-regulated and the anti-apoptotic protein Bcl-2 was down-regulated in cpk, cpk;casp3+/?, and cpk;casp3?/? mice compared with wild-type controls. In summary, homozygous deletion of caspase-3 markedly prolongs survival of cpk mice, but a caspase-7-mediated pathway may compensate for the deficiency of functional caspase-3. These findings suggest that pan-caspase inhibition may have a greater therapeutic effect than selective caspase inhibition in PKD. PMID:18272845

Tao, Yunxia; Zafar, Iram; Kim, Jun; Schrier, Robert W.; Edelstein, Charles L.

2008-01-01

21

Molecular basis of human growth hormone gene deletions  

SciTech Connect

Crossover sites resulting from unequal recombination within the human growth hormone (GH) gene cluster that cause GH1 gene deletions and isolated GH deficiency type 1A were localized in nine patients. In eight unrelated subjects homozygous for 6.7-kilobase (kb) deletions, the breakpoints are within two blocks of highly homologous DNA sequences that lie 5{prime} and 3{prime} to the GH1 gene. In seven of these eight cases, the breakpoints map within a 1,250-base-pair (bp) region composed of 300-bp Alu sequences of 86% homology and flanking non-Alu sequences that are 600 and 300 bp in length and are of 96% and 88% homology, respectively. In the eighth patient, the breakpoints are 5{prime} to these Alu repeats and are most likely within a 700-bp-region of 96% homologous DNA sequences. In the ninth patient homozygous for a 7.6-kb deletion, the breakpoints are contained with a 29-bp perfect repeat lying 5{prime} to GH1 and the human chorionic somatomammotropin pseudogene (CSHP1). Together, these results indicate that the presence of highly homologous DNA sequences flanking GH1 predispose to recurrent unequal recombinational events presumably through chromosomal misalignment.

Vnencak-Jones, C.L.; Phillips, J.A. III; Chen, E.Y.; Seeburg, P.H. (Vanderbilt Univ. School of Medicine, Nashville, TN (USA))

1988-08-01

22

Human cytomegalovirus UL29/28 protein interacts with components of the NuRD complex which promote accumulation of immediate-early RNA.  

PubMed

Histone deacetylation plays a pivotal role in regulating human cytomegalovirus gene expression. In this report, we have identified candidate HDAC1-interacting proteins in the context of infection by using a method for rapid immunoisolation of an epitope-tagged protein coupled with mass spectrometry. Putative interactors included multiple human cytomegalovirus-coded proteins. In particular, the interaction of pUL38 and pUL29/28 with HDAC1 was confirmed by reciprocal immunoprecipitations. HDAC1 is present in numerous protein complexes, including the HDAC1-containing nucleosome remodeling and deacetylase protein complex, NuRD. pUL38 and pUL29/28 associated with the MTA2 component of NuRD, and shRNA-mediated knockdown of the RBBP4 and CHD4 constituents of NuRD inhibited HCMV immediate-early RNA and viral DNA accumulation; together this argues that multiple components of the NuRD complex are needed for efficient HCMV replication. Consistent with a positive acting role for the NuRD elements during viral replication, the growth of pUL29/28- or pUL38-deficient viruses could not be rescued by treating infected cells with the deacetylase inhibitor, trichostatin A. Transient expression of pUL29/28 enhanced activity of the HCMV major immediate-early promoter in a reporter assay, regardless of pUL38 expression. Importantly, induction of the major immediate-early reporter activity by pUL29/28 required functional NuRD components, consistent with the inhibition of immediate-early RNA accumulation within infected cells after knockdown of RBBP4 and CHD4. We propose that pUL29/28 modifies the NuRD complex to stimulate the accumulation of immediate-early RNAs. PMID:20585571

Terhune, Scott S; Moorman, Nathaniel J; Cristea, Ileana M; Savaryn, John Paul; Cuevas-Bennett, Christian; Rout, Michael P; Chait, Brian T; Shenk, Thomas

2010-01-01

23

Immediate early response gene X-1, a potential prognostic biomarker in cancers  

PubMed Central

Introduction The immediate early response gene X-1 (IEX-1) plays a pivotal role in the regulation of cell apoptosis, proliferation, differentiation and metabolism. Deregulation of IEX-1 expression has been confirmed in multiple cancers in humans, in association with either poor or better prognosis depending on the type and progression stages of the cancer. Areas covered This review summarizes clinical studies of altered IEX-1 expression in ovarian, pancreatic, blood, breast and colorectal cancers, lymphoma and myeloma. The authors also outline the current understandings of the complex functions of IEX-1 gained from studies with animal models and tumor cell lines so as to help us comprehend the significance of the clinical findings. Expert opinion IEX-1 holds great promise to be a valuable biomarker, either alone or in combination with other genes, for monitoring progression of some cancers. IEX-1 expression is highly sensitive to environmental cues and distinct between normal and cancer cells. However, use of IEX-1 as a biomarker remains a significant challenge because too little is understood about the mechanism underlying the diverse activities of IEX-1 and a standardized clinical assay for IEX-1 detection and validation of clinical results across different studies are still critically lacking. PMID:23379921

Ustyugova, Irina V.; Han, Liping; Akilov, Oleg E.

2014-01-01

24

Serum immunoglobulin levels in heterozygous subjects with immunoglobulin heavy chain constant region gene deletions.  

PubMed

The immunoglobulin heavy chain constant region locus is a multigene family composed of nine genes and two pseudogenes, whose high homology is often responsible for meiotic mispairings leading to deleted and duplicated haplotypes. These rearrangements have a population frequency of about 1.5% and 4.5% respectively, with a significant difference between deletions and duplications (P < 0.001). Both positive selection of duplications or negative selection against deletions can account for this imbalance. Serum levels of IgG and IgA subclasses, of IgE, of isohemagglutinins and of IgG antibodies to tetanus toxoid and pneumococcal antigens were evaluated in 11 heterozygous carriers of constant region deletions. There was no gross abnormality in serum IgG and IgA subclass levels, with the possible exception of G1-deleted individuals; furthermore, isohemagglutinins and anti-tetanus toxoid and pneumococcal IgG antibodies are in the normal range, suggesting that the humoral immune response is normal in these carriers. The influence of single and multiple immunoglobulin heavy chain constant region gene deletions on the humoral response is discussed. PMID:8562982

Brusco, A; Boccazzi, C; Plebani, A; DeLange, G G; Depelchin, S; Carbonara, A O

1995-01-01

25

Inhibition of Human Cytomegalovirus Immediate-Early Gene Expression by Cyclin A2-Dependent Kinase Activity  

PubMed Central

Human cytomegalovirus (HCMV) starts its lytic replication cycle only in the G0/G1 phase of the cell division cycle. S/G2 cells can be infected but block the onset of immediate-early (IE) gene expression. This block can be overcome by inhibition of cyclin-dependent kinases (CDKs), suggesting that cyclin A2, the only cyclin with an S/G2-specific activity profile, may act as a negative regulator of viral gene expression. To directly test this hypothesis, we generated derivatives of an HCMV-permissive glioblastoma cell line that express cyclin A2 in a constitutive, cell cycle-independent manner. We demonstrate that even moderate cyclin A2 overexpression in G1 was sufficient to severely compromise the HCMV replicative cycle after high-multiplicity infection. This negative effect was composed of a strong but transient inhibition of IE gene transcription and a more sustained alteration of IE mRNA processing, resulting in reduced levels of UL37 and IE2, an essential transactivator of viral early gene expression. Consistently, cyclin A2-overexpressing cells showed a strong delay of viral early and late gene expression, as well as virus reproduction. All effects were dependent on CDK activity, as a cyclin A2 mutant deficient in CDK binding was unable to interfere with the HCMV infectious cycle. Interestingly, murine CMV, whose IE gene expression is known to be cell cycle independent, is not affected by cyclin A2. Instead, it upregulates cyclin A2-associated kinase activity upon infection. Understanding the mechanisms behind the HCMV-specific action of cyclin A2-CDK might reveal new targets for antiviral strategies. PMID:22718829

Oduro, Jennifer D.; Uecker, Ralf

2012-01-01

26

Stressor and Glucocorticoid-Dependent Induction of the Immediate Early Gene Kruppel-Like Factor 9  

E-print Network

Stressor and Glucocorticoid-Dependent Induction of the Immediate Early Gene Kru¨ppel-Like Factor 9 expression plasmid into living tadpole brain by electro- poration-mediated gene transfer. Forced expression extension and branching (14­18). Forced ex

Denver, Robert J.

27

Kisspeptin Regulates Gonadotropin Genes via Immediate Early Gene Induction in Pituitary  

E-print Network

(including kisspeptin neurons). Kisspeptin, the product of the Kiss1 gene, and its Gq/11- coupled receptorKisspeptin Regulates Gonadotropin Genes via Immediate Early Gene Induction in Pituitary regulation of the gonadotropin gene -subunits, LH and FSH , using L T2 gonadotrope cells and murine primary

Mellon, Pamela L.

28

Cortically Driven Immediate-Early Gene Expression Reflects Modular Influence of Sensorimotor Cortex on Identified Striatal  

E-print Network

Cortically Driven Immediate-Early Gene Expression Reflects Modular Influence of Sensorimotor Cortex on Identified Striatal Neurons in the Squirrel Monkey H.B. Parthasarathy and A.M. Graybiel Department of Brain patterns of convergent and divergent cortical inputs to striatal projection neurons. To test

Graybiel, Ann M.

29

Induction of transcription of {open_quotes}Immediate early genes{close_quotes} by low-dose ionizing radiation  

SciTech Connect

The induction of transition of specific genes after exposure to ionizing radiation has previously been reported after lethal doses of radiation (2-50 Gy). Little attention has been focused on expression of {open_quotes}immediate early genes{close_quotes} after low doses of ionizing radiation, where cell viability remains high. This dose range (0.25-2.0 Gy) is above the diagnostic dose level but at or below the doses typical for a single exposure in fractionated radiotherapy treatment of cancer. In this study, it was observed that doses in the range of 0.25-2.0 Gy induced different amounts of the mRNAs of the proto-oncogenes c-fos, c-jun, c-myc and c-Ha-ras at a given dose and time in Epstein-Barr virus-transformed human lymphoblastoid 244B cells. A maximum response was seen after a dose of 0.5 Gy for all but c-fos, which showed a maximum response after exposure to 0.25 Gy. Time-course studies demonstrated that the induction was transient, reaching a maximum at 1 h and declining to the constitutive level at 4 h after irradiation. Using second-messenger specific inhibitors, the signaling pathways involved in the induction of these proto-oncogenes was also investigated. The results showed that all four of the proto-oncogenes induced after 0.5 Gy shared a common pathway of tyrosine kinase activation. Other signaling pathways included protein kinase C, reactive oxygen intermediates and calcium-dependent kinases; these were found to be differentially involved in the induction of transcription of the individual proto-oncogenes. In summary, this study suggests that low-dose ionizing radiation (0.25-2.0 Gy) can modulate expression of immediate early genes. Secondly, the activation of immediate early genes after low-dose exposure involves multiple second-messenger signaling pathways. Third, the magnitude of involvement of the different signaling pathways after low-dose radiation is different for each proto-oncogene expressed. 43 refs., 6 figs., 1 tab.

Prasad, A.V.; Mohan, N.; Chandrasekar, B.; Meltz, M.L. [Univ. of Texas Health Science Center, San Antonio, TX (United States)

1995-09-01

30

Human Cytomegalovirus pUL97 Regulates the Viral Major Immediate Early Promoter by Phosphorylation-Mediated Disruption of Histone Deacetylase 1 Binding  

PubMed Central

Human cytomegalovirus (HCMV) is a common agent of congenital infection and causes severe disease in immunocompromised patients. Current approved therapies focus on inhibiting viral DNA replication. The HCMV kinase pUL97 contributes to multiple stages of viral infection including DNA replication, controlling the cell cycle, and virion maturation. Our studies demonstrate that pUL97 also functions by influencing immediate early (IE) gene expression during the initial stages of infection. Inhibition of kinase activity using the antiviral compound maribavir or deletion of the UL97 gene resulted in decreased expression of viral immediate early genes during infection. Expression of pUL97 was sufficient to transactivate IE1 gene expression from the viral genome, which was dependent on viral kinase activity. We observed that pUL97 associates with histone deacetylase 1 (HDAC1). HDAC1 is a transcriptional corepressor that acts to silence expression of viral genes. We observed that inhibition or deletion of pUL97 kinase resulted in increased HDAC1 and decreased histone H3 lysine 9 acetylation associating with the viral major immediate early (MIE) promoter. IE expression during pUL97 inhibition or deletion was rescued following inhibition of deacetylase activity. HDAC1 associates with chromatin by protein-protein interactions. Expression of active but not inactive pUL97 kinase decreased HDAC1 interaction with the transcriptional repressor protein DAXX. Finally, using mass spectrometry, we found that HDAC1 is uniquely phosphorylated upon expression of pUL97. Our results support the conclusion that HCMV pUL97 kinase regulates viral immediate early gene expression by phosphorylation-mediated disruption of HDAC1 binding to the MIE promoter. PMID:23616659

Bigley, Tarin M.; Reitsma, Justin M.; Mirza, Shama P.

2013-01-01

31

Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants  

Technology Transfer Automated Retrieval System (TEKTRAN)

Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

32

Evolutionary conservation of the egr-1 immediate-early gene response in a teleost.  

PubMed

Immediate-early gene expression is a key part of a neuron's response to behaviorally relevant stimuli and, as a result, localization of immediate-early gene expression can be a useful marker for neural activity. We characterized the immediate-early gene egr-1 (also called zif268, NGFI-A, krox-24, ZENK) in the teleost Astatotilapia (Haplochromis) burtoni. We compared the A. burtoni egr-1 predicted protein sequence to that of other vertebrates, characterized its gene expression time course, and localized its induced expression throughout the brain. The A. burtoni egr-1 predicted protein shared putative functional domains with egr-1 of other vertebrates and shared 81% sequence similarity with zebrafish and 66% with mouse. We identified distinct mammalian and teleost inserts rich in serine residues within one activation domain, suggesting convergent responses to selection pressures to increase the number of serine residues in this region. Functionally, we found that A. burtoni egr-1 gene expression peaked near 30 minutes after pharmacological stimulation and thereby displayed the transient expression above basal levels characteristic of egr-1 expression in birds and mammals. Finally, we observed distinct patterns of egr-1 gene induction in the brain by natural and pharmacological stimuli. Unstimulated males had very low expression levels of egr-1, whereas males stimulated by their normal environment showed higher levels of expression specific to particular brain regions. Males injected with a glutamate receptor agonist also had region-specific induction of egr-1 expression. We conclude that the egr-1 immediate-early gene response is evolutionarily conserved and will, therefore, be useful for identifying functional neural responses in nontraditional model species. PMID:15562507

Burmeister, Sabrina S; Fernald, Russell D

2005-01-10

33

Phenotypes of major immediate-early gene mutants of mouse cytomegalovirus  

Microsoft Academic Search

Immediate-early (IE) genes are the first genes to be transcribed during the lytic replication cycle of cytomegaloviruses (CMV),\\u000a and encode nonstructural proteins, which are assumed to have mainly regulatory functions. The IE proteins may play important\\u000a roles in the pathogenesis of CMV in vivo, for instance during the establishment of latency and during reactivation. We constructed\\u000a mouse CMV mutants with

Andreas Busche; Ana Angulo; Penelope Kay-Jackson; Peter Ghazal; Martin Messerle

2008-01-01

34

Transcriptional Dynamics Reveal Critical Roles for Non-coding RNAs in the Immediate-Early Response  

PubMed Central

The immediate-early response mediates cell fate in response to a variety of extracellular stimuli and is dysregulated in many cancers. However, the specificity of the response across stimuli and cell types, and the roles of non-coding RNAs are not well understood. Using a large collection of densely-sampled time series expression data we have examined the induction of the immediate-early response in unparalleled detail, across cell types and stimuli. We exploit cap analysis of gene expression (CAGE) time series datasets to directly measure promoter activities over time. Using a novel analysis method for time series data we identify transcripts with expression patterns that closely resemble the dynamics of known immediate-early genes (IEGs) and this enables a comprehensive comparative study of these genes and their chromatin state. Surprisingly, these data suggest that the earliest transcriptional responses often involve promoters generating non-coding RNAs, many of which are produced in advance of canonical protein-coding IEGs. IEGs are known to be capable of induction without de novo protein synthesis. Consistent with this, we find that the response of both protein-coding and non-coding RNA IEGs can be explained by their transcriptionally poised, permissive chromatin state prior to stimulation. We also explore the function of non-coding RNAs in the attenuation of the immediate early response in a small RNA sequencing dataset matched to the CAGE data: We identify a novel set of microRNAs responsible for the attenuation of the IEG response in an estrogen receptor positive cancer cell line. Our computational statistical method is well suited to meta-analyses as there is no requirement for transcripts to pass thresholds for significant differential expression between time points, and it is agnostic to the number of time points per dataset. PMID:25885578

Aitken, Stuart; Magi, Shigeyuki; Alhendi, Ahmad M. N.; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Daub, Carsten O.; Arner, Erik; Carninci, Piero; Forrest, Alistair R. R.; Hayashizaki, Yoshihide; Khachigian, Levon M.; Okada-Hatakeyama, Mariko; Semple, Colin A.

2015-01-01

35

Human Cytomegalovirus Immediate-Early 2 Gene Expression Blocks Virus-Induced Beta Interferon Production  

Microsoft Academic Search

The effect of human cytomegalovirus (HCMV) gene expression on beta interferon (IFN-) expression was examined. We demonstrate that the HCMV immediate-early 2 (IE2) gene product IE86 can effectively block the induction of IFN- during HCMV infection. IE86 also efficiently blocked the induction of IFN- following Sendai virus infection, demonstrating that IE86's ability to block induction of IFN- is not limited

R. Travis Taylor; Wade A. Bresnahan

2005-01-01

36

Mechanotransduction in Stretched Osteocytes—Temporal Expression of Immediate Early and Other Genes  

Microsoft Academic Search

Osteocytes, dendritic bone cells, transduce signals of mechanical loading that results in bone formation. We have reported in stretched primary osteocytes that the cAMP level, IGF-I and osteocalcin protein levels were elevated (Endocrinology 137:2028, 1996). Here we report that stretching induces the expression of immediate early genes, c-fos and COX-2; inducive cyclooxygenase gene. Compared to c-fos, COX-2 as well as

Akira Kawata; Yuko Mikuni-Takagaki

1998-01-01

37

Molecular interpretation of ERK signal duration by immediate early gene products  

Microsoft Academic Search

The duration of intracellular signalling is associated with distinct biological responses, but how cells interpret differences in signal duration are unknown. We show that the immediate early gene product c-Fos functions as a sensor for ERK1 (extracellular-signal-regulated kinase 1) and ERK2 signal duration. When ERK activation is transient, its activity declines before the c-Fos protein accumulates, and under these conditions

Leon O. Murphy; Sallie Smith; Rey-Huei Chen; Diane C. Fingar; John Blenis

2002-01-01

38

Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii.  

PubMed

The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin; Choi, Chul Hee; Han, Kyudong

2015-05-15

39

Cohesins Repress Kaposi's Sarcoma-Associated Herpesvirus Immediate Early Gene Transcription during Latency  

PubMed Central

Chromatin-organizing factors such as CTCF and cohesins have been implicated in the control of complex viral regulatory programs. We investigated the role of CTCF and cohesins in the control of the switch from latency to the lytic cycle for Kaposi's sarcoma-associated herpesvirus (KSHV). We found that cohesin subunits but not CTCF are required for the repression of KSHV immediate early gene transcription. Depletion of the cohesin subunits Rad21, SMC1, and SMC3 resulted in lytic cycle gene transcription and viral DNA replication. In contrast, depletion of CTCF failed to induce lytic transcription or DNA replication. Chromatin immunoprecipitation with high-throughput sequencing (ChIP-Seq) revealed that cohesins and CTCF bound to several sites within the immediate early control region for ORF50 and to more distal 5? sites that also regulate the divergently transcribed ORF45-ORF46-ORF47 gene cluster. Rad21 depletion led to a robust increase in ORF45, ORF46, ORF47, and ORF50 transcripts, with similar kinetics to that observed with chemical induction by sodium butyrate. During latency, the chromatin between the ORF45 and ORF50 transcription start sites was enriched in histone H3K4me3, with elevated H3K9ac at the ORF45 promoter and elevated H3K27me3 at the ORF50 promoter. A paused form of RNA polymerase II (Pol II) was loosely associated with the ORF45 promoter region during latency but was converted to an active elongating form upon reactivation induced by Rad21 depletion. Butyrate treatment caused a rapid dissociation of cohesins and loss of CTCF binding at the immediate early gene locus, suggesting that cohesins may be a direct target of butyrate-mediated lytic induction. Our findings implicate cohesins as a major repressor of KSHV lytic gene activation and show that they function coordinately with CTCF to regulate the switch between latent and lytic gene activity. PMID:22740398

Chen, Horng-Shen; Wikramasinghe, Priyankara; Showe, Louise

2012-01-01

40

Stress-induced hematopoietic failure in the absence of immediate early response gene X-1 (IEX-1, IER3)  

E-print Network

Expression of the immediate early response gene X-1 (IEX-1, IER3) is diminished significantly in hematopoietic stem cells in a subgroup of patients with early stage myelodysplastic syndromes, but it is not clear whether ...

Ramsey, Haley

41

Pheromone-induced expression of immediate early genes in the mouse vomeronasal sensory system.  

PubMed

Immediate early genes (IEGs) are powerful tools for visualizing activated neurons and extended circuits that are stimulated by sensory input. Several kinds of IEGs (e.g., c-fos, egr-1) have been utilized for detecting activated receptor neurons in the pheromone sensory organ called the vomeronasal organ (VNO), as well as for mapping the neurons within the central nervous system (CNS) excited by pheromones.In this chapter, we describe the procedure for the detection of pheromone-induced neural activation in the VNO and CNS using the c-Fos immunostaining technique. PMID:24014367

Haga-Yamanaka, Sachiko; Touhara, Kazushige

2013-01-01

42

Efficient and simple generation of unmarked gene deletions in Mycobacterium smegmatis.  

PubMed

Genetic research in molecular laboratories relies heavily on directed mutagenesis and gene deletion techniques. In mycobacteria, however, genetic analysis is often hindered by difficulties in the preparation of deletion mutants. Indeed, in comparison to the allelic exchange systems available for the study of other common model organisms, such as Saccharomyces cerevisiae and Escherichia coli, mycobacterial gene disruption systems suffer from low mutant isolation success rates, mostly due to inefficient homologous recombination and a high degree of non-specific recombination. Here, we present a gene deletion system that combines efficient homologous recombination with advanced screening of mutants. This novel methodology allows for gene disruption in three consecutive steps. The first step relies on the use of phage Che9c recombineering proteins for directed insertion into the chromosome of a linear DNA fragment that encodes GFP and confers hygromycin resistance. In the second step, GFP positive and hygromycin resistant colonies are selected, and in the last step, the gfp-hyg cassette is excised from the chromosome, thus resulting in the formation of an unmarked deletion. We provide a detailed gene deletion methodology and demonstrate the use of this genetic system by deleting the prcSBA operon of Mycobacterium smegmatis. PMID:24100088

Shenkerman, Yael; Elharar, Yifat; Vishkautzan, Marina; Gur, Eyal

2014-01-01

43

Kisspeptin regulates gonadotropin genes via immediate early gene induction in pituitary gonadotropes.  

PubMed

Kisspeptin signaling through its receptor, Kiss1R, is crucial for many reproductive functions including puberty, sex steroid feedback, and overall fertility. Although the importance of Kiss1R in the brain is firmly established, its role in regulating reproduction at the level of the pituitary is not well understood. This study presents molecular analysis of the role of kisspeptin and Kiss1R signaling in the transcriptional regulation of the gonadotropin gene ?-subunits, LH? and FSH?, using L?T2 gonadotrope cells and murine primary pituitary cells. We show that kisspeptin induces LH? and FSH? gene expression, and this induction is protein kinase C dependent and mediated by the immediate early genes, early growth response factor 1 and cFos, respectively. Additionally, kisspeptin induces transcription of the early growth response factor 1 and cFos promoters in L?T2 cells. Kisspeptin also increases gonadotropin gene expression in mouse primary pituitary cells in culture. Furthermore, we find that Kiss1r expression is enhanced in the pituitary of female mice during the estradiol-induced LH surge, a critical component of the reproductive cycle. Overall, our findings indicate that kisspeptin regulates gonadotropin gene expression through the activation of Kiss1R signaling through protein kinase C, inducing immediate early genes in vitro, and responds to physiologically relevant cues in vivo, suggesting that kisspeptin affects pituitary gene expression to regulate reproductive function. PMID:23770611

Witham, Emily A; Meadows, Jason D; Hoffmann, Hanne M; Shojaei, Shadi; Coss, Djurdjica; Kauffman, Alexander S; Mellon, Pamela L

2013-08-01

44

trans activation of an immediate-early frog virus 3 promoter by a virion protein.  

PubMed Central

We investigated the protein and DNA sequence requirements for the expression of an immediate-early frog virus 3 (FV3) gene, infected-cell RNA (ICR) 169. We used a plasmid containing the 78 nucleotides 5' to the transcription start site of ICR-169 placed upstream from the coding sequence for the bacterial enzyme chloramphenicol acetyltransferase (CAT). This construction, when introduced by CaPO4-mediated transfection into various eucaryotic cell lines, promoted CAT synthesis only if the transfected cells were subsequently infected with FV3. Dot-blot hybridization of RNA extracted from transfected, FV3-infected cells with a radioactive CAT probe showed that the induction of CAT synthesis by FV3 was at the level of transcription. When transfected cells were infected with FV3 in the presence of cycloheximide, induction of CAT-specific RNA still occurred, demonstrating that a virion protein was responsible for the trans activation. FV3-induced CAT synthesis was inhibited by alpha-amanitin in wild-type Chinese hamster ovary (CHO) cells but not in CHO cells with an alpha-amanitin-resistant RNA polymerase II. The results suggest that a virion protein alters either the DNA template or the host polymerase to allow transcription from immediate-early FV3 promoters. Images PMID:3863966

Willis, D B; Granoff, A

1985-01-01

45

Evaluation of a modified-live, gene deletion mutant pseudorabies virus vaccine for field use in swine  

E-print Network

EVALUATION OF A MODIFIED-LIVE, GENE DELETION MUTANT PSEUDORABIES VIRUS VACCINE FOR FIELD USE IN SWINE A Thesis by DONALD BRUCE LAWHORN Submitted to the Office of Graduate Studies of Texas ASM University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE August 1989 Major Subject: Veterinary Microbiblogy EVALUATION OF A MODIFIED-LIVE, GENE DELETION MUTANT PSEUDORABIES VIRUS VACCINE FOR FIELD USE IN SWINE A Thesis by DONALD BRUCE LAWHORN Approved...

Lawhorn, Donald Bruce

1989-01-01

46

Satb1 ablation alters temporal expression of immediate early genes and reduces dendritic spine density during postnatal brain development.  

PubMed

Complex behaviors, such as learning and memory, are associated with rapid changes in gene expression of neurons and subsequent formation of new synaptic connections. However, how external signals are processed to drive specific changes in gene expression is largely unknown. We found that the genome organizer protein Satb1 is highly expressed in mature neurons, primarily in the cerebral cortex, dentate hilus, and amygdala. In Satb1-null mice, cortical layer morphology was normal. However, in postnatal Satb1-null cortical pyramidal neurons, we found a substantial decrease in the density of dendritic spines, which play critical roles in synaptic transmission and plasticity. Further, we found that in the cerebral cortex, Satb1 binds to genomic loci of multiple immediate early genes (IEGs) (Fos, Fosb, Egr1, Egr2, Arc, and Bdnf) and other key neuronal genes, many of which have been implicated in synaptic plasticity. Loss of Satb1 resulted in greatly alters timing and expression levels of these IEGs during early postnatal cerebral cortical development and also upon stimulation in cortical organotypic cultures. These data indicate that Satb1 is required for proper temporal dynamics of IEG expression. Based on these findings, we propose that Satb1 plays a critical role in cortical neurons to facilitate neuronal plasticity. PMID:22064485

Balamotis, Michael A; Tamberg, Nele; Woo, Young Jae; Li, Jingchuan; Davy, Brian; Kohwi-Shigematsu, Terumi; Kohwi, Yoshinori

2012-01-01

47

THOC5 controls 3?end-processing of immediate early genes via interaction with polyadenylation specific factor 100 (CPSF100)  

PubMed Central

Transcription of immediate early genes (IEGs) in response to extrinsic and intrinsic signals is tightly regulated at multiple stages. It is known that untranslated regions of the RNA can play a role in these processes. Here we show that THOC5, a member of the TREX (transcription/export) complex, plays a role in expression of only a subset of constitutively active genes, however transcriptome analysis reveals that more than 90% of IEG were not induced by serum in THOC5 depleted cells. Furthermore, THOC5 depletion does not influence the expression of the most rapidly induced IEGs, e.g. Fos and Jun. One group of THOC5 target genes, including Id1, Id3 and Wnt11 transcripts, were not released from chromatin in THOC5 depleted cells. Genes in another group, including Myc and Smad7 transcripts, were released with shortening of 3?UTR by alternative cleavage, and were spliced but export was impaired in THOC5 depleted cells. By interactome analysis using THOC5 as bait, we show that upon stimulation with serum THOC5 forms a complex with polyadenylation-specific factor 100 (CPSF100). THOC5 is required for recruitment of CPSF100 to 3?UTR of THOC5 target genes. These data suggest the presence of a novel mechanism for the control of IEG response by THOC5 via 3?end-processing. PMID:25274738

Tran, Doan Duy Hai; Saran, Shashank; Williamson, Andrew J.K.; Pierce, Andrew; Dittrich-Breiholz, Oliver; Wiehlmann, Lutz; Koch, Alexandra; Whetton, Anthony D.; Tamura, Teruko

2014-01-01

48

Monitoring immediate-early gene expression through firefly luciferase imaging of HRS/J hairless mice  

PubMed Central

Background Gene promoters fused to the firefly luciferase gene (luc) are useful for examining gene regulation in live transgenic mice and they provide unique views of functioning organs. The dynamics of gene expression in cells and tissues expressing luciferase can be observed by imaging this enzyme's bioluminescent oxidation of luciferin. Neural pathways involved in specific behaviors have been identified by localizing expression of immediate-early genes such as c-fos. A transgenic mouse line with luc controlled by the human c-fos promoter (fos::luc) has enabled gene expression imaging in brain slice cultures. To optimize imaging of immediate-early gene expression throughout intact mice, the present study examined fos::luc mice and a second transgenic mouse containing luc controlled by the human cytomegalovirus immediate-early gene 1 promoter and enhancer (CMV::luc). Because skin pigments and hair can significantly scatter light from underlying structures, the two transgenic lines were crossed with a hairless albino mouse (HRS/J) to explore which deep structures could be imaged. Furthermore, live anesthetized mice were compared with overdosed mice. Results Bioluminescence imaging of anesthetized mice over several weeks corresponded with expression patterns in mice imaged rapidly after a lethal overdose. Both fos::luc and CMV::luc mice showed quantifiable bright bioluminescence in ear, nose, paws, and tail whether they were anesthetized or overdosed. CMV::luc and fos::luc neonates had bioluminescence patterns similar to those of adults, although intensity was significantly higher in neonates. CMV::luc mice crossed with HRS/J mice had high expression in bone, claws, head, pancreas, and skeletal muscle, but less in extremities than haired CMV::luc mice. Imaging of brain bioluminescence through the neonatal skull was also practical. By imaging luciferin autofluorescence it was clear that substrate distribution did not restrict bioluminescence imaging to capillaries after injection. Luciferin treatment and anesthesia during imaging did not adversely affect circadian rhythms in locomotor activity. Conclusions Imaging of gene expression patterns with luciferase can be extended from studies of live animals to rapid imaging of mice following a pentobarbital overdose before significant effects from postmortem changes occurs. Bioluminescent transgenic mice crossed with HRS/J mice are valuable for examining gene expression in deep tissues. PMID:12927048

Collaco, Anne M; Geusz, Michael E

2003-01-01

49

Characterization of regulatory functions of the HSV-1 immediate-early protein ICP22.  

PubMed

Previous work has shown that the 68-kDa immediate-early protein of herpes simplex virus type 1 (HSV-1), also known as ICP22, is involved in the control of viral gene expression, although the precise mechanism remains to be elucidated. In order to study the function(s) of this protein, we constructed expression vectors containing the coding sequence of the ICP22 gene placed under the control of the SV40 or HCMV promoter. After cell transfection, ICP22 synthesis was studied by immunoblotting, using a specific antiserum. In transient expression experiments in COS cells in which the ICP22 vector was under the control of the SV40 promoter, we found that ICP22 was able to inhibit chloramphenicol acetyltransferase (CAT) expression under the control of either the alpha 22 (IE4) promoter or other immediate-early promoters, such as alpha 4 (IE3), alpha 0 (IE1), and alpha 27 (IE2). CAT expression under the control of the alpha 4 (IE3) promoter was inhibited in these cells by expression of ICP22 under the control of the HCMV promoter; it was also inhibited in RAT-1 cells by ICP22 expressed under the control of the SV40 or HCMV promoter. In contrast, CAT expression directed by the SV40 or HCMV promoters was only weakly or not inhibited by the ICP22 vectors. We also constructed an expression vector for UL13, a gene whose product is implicated in the phosphorylation of ICP22. Although CAT expression under the control of the alpha 4 (IE3) promoter was also negatively regulated by the UL13 gene product, the effects of the ICP22 (directed by the SV40 or HCMV promoter) and UL13 vectors were not synergistic; furthermore, at a particular molar ratio of the two vectors, inhibition of CAT activity was partially reversed. The results in the present work suggest that ICP22 can negatively regulate the expression of immediate-early viral genes and that its phosphorylation by UL13 protein kinase might be involved in the modulation of its function. PMID:8955059

Prod'hon, C; Machuca, I; Berthomme, H; Epstein, A; Jacquemont, B

1996-12-15

50

Human cytomegalovirus immediate-early 2 protein IE86 blocks virus-induced chemokine expression.  

PubMed

The effect of human cytomegalovirus (HCMV) gene expression on cytokine (beta interferon) and chemokine (RANTES, MIG, MCP-2, MIP-1alpha, and interleukin-8) expression was examined. We demonstrate that HCMV gene expression is required to suppress the transcriptional induction of these cytokines and that the HCMV immediate-early 2 gene product IE86 can effectively block the expression of cytokines and proinflammatory chemokines during HCMV and Sendai virus infection. Additionally, we present data on viral mutants and ectopic protein expression which demonstrate that pp65, another identified HCMV cytokine antagonist, is not involved in regulating these proinflammatory cytokines. This is the first report to demonstrate that IE86 can act to suppress virus-induced proinflammatory cytokine transcript expression, extending the antiviral properties of this multifunctional viral protein. PMID:16378994

Taylor, R Travis; Bresnahan, Wade A

2006-01-01

51

Central Renin Injections: Effects on Drinking and Expression of Immediate Early Genes  

NASA Technical Reports Server (NTRS)

This study investigated the drinking response and the expression of Fos- and Egr-1-immunoreactivity (Fos-ir, Egr-1-ir) in the brain induced by endogenous angiotensin generated by intracerebroventricular (i.c.v.) injection of renin. Renin induced Fos-ir in the subformical organ (SFO), median preoptic (MnPO), supraoptic and paraventricular nuclei (SON and PVN), area postrema (AP), nuclei of the solitary tract (NTS) and lateral parabrachial nuclei (LPBN). Renin-induced Egr-1-ir exhibited a similar pattern of distribution as that observed for Fos-ir. The dose of i.c.v. renin that induced expression of immediate early gene (IEG) product immunoreactivity also produced vigorous drinking. When renin-injected rats were pretreated with captopril, an angiotensin converting enzyme inhibitor, drinking was blocked. With the same captopril pretreatment, both Fos- and Egr-1-ir in the SFO, MnPO, SON, PVN, AP and LPBN were also significantly reduced.

Xu, Zhice; Johnson, Alan Kim

1998-01-01

52

Characterization of two unusual RS1 gene deletions segregating in Danish retinoschisis families.  

PubMed

Over 100 distinct retinoschisis gene (RS1) mutations, of which approximately 10% are single exon deletions, have been described to date. In this paper we have characterized in detail two dissimilar RS1 gene deletions which are accountable for RS in one-third of Danish patients. First, a 136 kb deletion, spanning from the 5' region of the RS1 gene to intron 3, was identified. Unexpectedly this large deletion abolishes exons of three adjacent genes: serine-threonine phosphatase gene (PPEF-1)/serine-threonine protein phosphatase gene (PP7), retinoschisis gene (RS1), and serine-threonine kinase gene (STK9). We demonstrate that the RS1 and STK9 genes are partly overlapping and the sequences of the PP7 and PPEF-1 genes are identical. This is the first study which reports of retinoschisis patients who also suffer from deletions in genes adjacent to RS1. The 136 kb deletion is also the first gross deletion of the retinoschisis gene deleting three exons. It results from a recombination between two repetitive sequences of the Alu family, one in 5' region of the RS1 gene and the other in RS1 intron 3. The second alteration, the actual Danish RS founder mutation, is a 4.4 kb noncontiguous two-part deletion composed of two deleted 1.5 and 2.9 kb segments, separated by an intact 1.2 kb segment. It extends from the 5' flanking region of the retinoschisis gene to RS intron 1. RS1 gene deletions of this type have not been identified previously. Despite these two unique deletions, which either lead to severely defective transcription or total absence of the retinoschisin and PPEF-1 protein, all the patients have a typical retinoschisis phenotype. PMID:11013441

Huopaniemi, L; Tyynismaa, H; Rantala, A; Rosenberg, T; Alitalo, T

2000-10-01

53

Metabolic consequences of NDUFS4 gene deletion in immortalized mouse embryonic fibroblasts.  

PubMed

Human mitochondrial complex I (CI) deficiency is associated with progressive neurological disorders. To better understand the CI pathomechanism, we here studied how deletion of the CI gene NDUFS4 affects cell metabolism. To this end we compared immortalized mouse embryonic fibroblasts (MEFs) derived from wildtype (wt) and whole-body NDUFS4 knockout (KO) mice. Mitochondria from KO cells lacked the NDUFS4 protein and mitoplasts displayed virtually no CI activity, moderately reduced CII, CIII and CIV activities and normal citrate synthase and CV (F(o)F(1)-ATPase) activity. Native electrophoresis of KO cell mitochondrial fractions revealed two distinct CI subcomplexes of ~830kDa (enzymatically inactive) and ~200kDa (active). The level of fully-assembled CII-CV was not affected by NDUFS4 gene deletion. KO cells exhibited a moderately reduced maximal and routine O(2) consumption, which was fully inhibited by acute application of the CI inhibitor rotenone. The aberrant CI assembly and reduced O(2) consumption in KO cells were fully normalized by NDUFS4 gene complementation. Cellular [NAD(+)]/[NADH] ratio, lactate production and mitochondrial tetramethyl rhodamine methyl ester (TMRM) accumulation were slightly increased in KO cells. In contrast, NDUFS4 gene deletion did not detectably alter [NADP(+)]/[NADPH] ratio, cellular glucose consumption, the protein levels of hexokinases (I and II) and phosphorylated pyruvate dehydrogenase (P-PDH), total cellular adenosine triphosphate (ATP) level, free cytosolic [ATP], cell growth rate, and reactive oxygen species (ROS) levels. We conclude that the NDUFS4 subunit is of key importance in CI stabilization and that, due to the metabolic properties of the immortalized MEFs, NDUFS4 gene deletion has only modest effects at the live cell level. This article is part of a special issue entitled: 17th European Bioenergetics Conference (EBEC 2012). PMID:22430089

Valsecchi, Federica; Monge, Claire; Forkink, Marleen; de Groof, Ad J C; Benard, Giovanni; Rossignol, Rodrigue; Swarts, Herman G; van Emst-de Vries, Sjenet E; Rodenburg, Richard J; Calvaruso, Maria A; Nijtmans, Leo G J; Heeman, Bavo; Roestenberg, Peggy; Wieringa, Be; Smeitink, Jan A M; Koopman, Werner J H; Willems, Peter H G M

2012-10-01

54

Markerless chromosomal gene deletion in Clostridium beijerinckii using CRISPR/Cas9 system.  

PubMed

The anaerobic spore-forming, gram-positive, solventogenic clostridia are notorious for being difficult to genetically engineer. Based on CRISPR/Cas9 assisted homologous recombination, we demonstrated that clean markerless gene deletion from the chromosome can be easily achieved with a high efficiency through a single-step transformation in Clostridium beijerinckii NCIMB 8052, one of the most prominent strains for acetone, butanol and ethanol (ABE) production. This highly efficient genome engineering system can be further explored for multiplex genome engineering purposes. The protocols and principles developed in this study provided valuable references for genome engineering in other microorganisms lacking developed genetic engineering tools. PMID:25680931

Wang, Yi; Zhang, Zhong-Tian; Seo, Seung-Oh; Choi, Kijoong; Lu, Ting; Jin, Yong-Su; Blaschek, Hans P

2015-04-20

55

Cell-specific activity of the modulator region in the human cytomegalovirus major immediate-early gene  

SciTech Connect

In this paper the authors demonstrate that modular sequences upstream of the enhancer of the major immediate-early promoter of human cytomegalovirus exert a differential effort on the level of transcription in a variety of cells and that this region has the capacity to interact with specific nuclear protein. Depending on the cell type, these modulator sequences increased or decreased transcriptional activation from the IE1 gene promoter-enhancer. The cell lines identified in this report should be useful to study the molecular mechanism of cell-specific transcriptional repression and activation exerted by the major immediate-early promoter upstream region.

Lubon, H.K.; Hennighausen, L. (Lab. of Biochemistry and Metabolism, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD (US)); Ghazal, P.; Reynolds-Kohler, C.; Lockshin, C.; Nelson, J. (Scripps Clinic and Research Foundation, La Jolla, CA (USA))

1989-03-01

56

Targeted gene deletion in Candida parapsilosis demonstrates the role of secreted lipase in virulence  

PubMed Central

Candida parapsilosis is a major cause of human disease, yet little is known about the pathogen’s virulence. We have developed an efficient gene deletion system for C. parapsilosis based on the repeated use of the dominant nourseothricin resistance marker (caSAT1) and its subsequent deletion by FLP-mediated, site-specific recombination. Using this technique, we deleted the lipase locus in the C. parapsilosis genome consisting of adjacent genes CpLIP1 and CpLIP2. Additionally we reconstructed the CpLIP2 gene, which restored lipase activity. Lipolytic activity was absent in the null mutants, whereas the WT, heterozygous, and reconstructed mutants showed similar lipase production. Biofilm formation was inhibited with lipase-negative mutants and their growth was significantly reduced in lipid-rich media. The knockout mutants were more efficiently ingested and killed by J774.16 and RAW 264.7 macrophage-like cells. Additionally, the lipase-negative mutants were significantly less virulent in infection models that involve inoculation of reconstituted human oral epithelium or murine intraperitoneal challenge. These studies represent what we believe to be the first targeted disruption of a gene in C. parapsilosis and show that C. parapsilosis–secreted lipase is involved in disease pathogenesis. This efficient system for targeted gene deletion holds great promise for rapidly enhancing our knowledge of the biology and virulence of this increasingly common invasive fungal pathogen. PMID:17853941

Gácser, Attila; Trofa, David; Schäfer, Wilhelm; Nosanchuk, Joshua D.

2007-01-01

57

Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice  

SciTech Connect

This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF{sub 1} male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P < 0.05) higher percentage of mRb deletions in lung adenocarcinomas from mice exposed to 60 once-weekly {gamma}-ray doses than those from mice receiving 24 once-weekly {gamma}-ray doses at low doses and low dose rates; however, the percentage was not significantly different (P > 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose {gamma} irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed.

Zhang, Y.; Woloschak, G.E. [Argonne National Lab., IL (United States). Center for Mechanistic Biology and Biotechnology

1997-08-01

58

Defined single-gene and multi-gene deletion mutant collections in Salmonella enterica sv Typhimurium.  

PubMed

We constructed two collections of targeted single gene deletion (SGD) mutants and two collections of targeted multi-gene deletion (MGD) mutants in Salmonella enterica sv Typhimurium 14028s. The SGD mutant collections contain (1), 3517 mutants in which a single gene is replaced by a cassette containing a kanamycin resistance (KanR) gene oriented in the sense direction (SGD-K), and (2), 3376 mutants with a chloramphenicol resistance gene (CamR) oriented in the antisense direction (SGD-C). A combined total of 3773 individual genes were deleted across these SGD collections. The MGD collections contain mutants bearing deletions of contiguous regions of three or more genes and include (3), 198 mutants spanning 2543 genes replaced by a KanR cassette (MGD-K), and (4), 251 mutants spanning 2799 genes replaced by a CamR cassette (MGD-C). Overall, 3476 genes were deleted in at least one MGD collection. The collections with different antibiotic markers permit construction of all viable combinations of mutants in the same background. Together, the libraries allow hierarchical screening of MGDs for different phenotypic followed by screening of SGDs within the target MGD regions. The mutants of these collections are stored at BEI Resources (www.beiresources.org) and publicly available. PMID:25007190

Porwollik, Steffen; Santiviago, Carlos A; Cheng, Pui; Long, Fred; Desai, Prerak; Fredlund, Jennifer; Srikumar, Shabarinath; Silva, Cecilia A; Chu, Weiping; Chen, Xin; Canals, Rocío; Reynolds, M Megan; Bogomolnaya, Lydia; Shields, Christine; Cui, Ping; Guo, Jinbai; Zheng, Yi; Endicott-Yazdani, Tiana; Yang, Hee-Jeong; Maple, Aimee; Ragoza, Yury; Blondel, Carlos J; Valenzuela, Camila; Andrews-Polymenis, Helene; McClelland, Michael

2014-01-01

59

Generation of stable mutants and targeted gene deletion strains in Cryptococcus neoformans through electroporation.  

PubMed

Cryptococcus neoformans is the etiologic agent of cryptococcal meningitis that causes more than half a million deaths worldwide each year. This capsulated basidiomycetous yeast also serves as a model for micropathogenic studies. The ability to make stable mutants, either via ectopic integration or homologous recombination, has been accomplished using biolistic transformation. This technical advance has greatly facilitated the research on the basic biology and pathogenic mechanisms of this pathogen in the past two decades. However, biolistic transformation is costly, and its reproducibility varies widely. Here we found that stable ectopic integration or targeted gene deletion via homologous replacement could be accomplished through electroporative transformation. The stability of the transformants obtained through electroporation and the frequency of homologous replacement is highly dependent on the selective marker. A frequency of homologous recombination among the stable transformants obtained by electroporation is comparable to those obtained by biolistic transformation (?10%) when dominant drug selection markers are used, which is much higher than what has been previously reported for electroporation when auxotrophic markers were used (0.001% to 0.1%). Furthermore, disruption of the KU80 gene or generation of gene deletion constructs using the split marker strategy, two approaches known to increase homologous replacement among transformants obtained through biolistic transformation, also increase the frequency of homologous replacement among transformants obtained through electroporation. Therefore, electroporation provides a low cost alternative for mutagenesis in Cryptococcus. PMID:25541555

Lin, Xiaorong; Chacko, Nadia; Wang, Linqi; Pavuluri, Yashwant

2015-04-01

60

Role of Herpes Simplex Virus 1 Immediate Early Protein ICP22 in Viral Nuclear Egress  

PubMed Central

ABSTRACT In order to investigate the novel function(s) of the herpes simplex virus 1 (HSV-1) immediate early protein ICP22, we screened for ICP22-binding proteins in HSV-1-infected cells. Our results were as follows. (i) Tandem affinity purification of ICP22 from infected cells, coupled with mass spectrometry-based proteomics and subsequent analyses, demonstrates that ICP22 forms a complex(es) with the HSV-1 proteins UL31, UL34, UL47 (or VP13/14), and/or Us3. All these proteins were previously reported to be important for viral egress through the nuclear membrane. (ii) ICP22 colocalizes with UL31 and UL34 at the nuclear membrane in wild-type HSV-1-infected cells. (iii) The UL31-null mutation prevents the targeting of ICP22 to the nuclear membrane. (iv) The ICP22-null mutation resulted in UL31 and UL34 being mislocalized in the endoplasmic reticulum (in addition to the nuclear membrane) and significantly reduced numbers of primary enveloped virions in the perinuclear space, although capsids accumulated in the nuclei. Collectively, these results suggest that (i) ICP22 interacts with HSV-1 regulators of nuclear egress, including UL31, UL34, UL47, and Us3 in HSV-1-infected cells; (ii) UL31 mediates the recruitment and anchorage of ICP22 at the nuclear membrane; and (iii) ICP22 plays a regulatory role in HSV-1 primary envelopment, probably by interacting with and regulating UL31 and UL34. Here we report a previously unknown function for ICP22 in the regulation of HSV-1 nuclear egress. IMPORTANCE The herpes simplex virus 1 (HSV-1) immediate early protein ICP22 is recognized primarily as a regulator of viral gene expression. In this study, we show that ICP22 interacts with the HSV-1 proteins UL31 and UL34, which play crucial roles at the nuclear membrane in HSV-1 primary envelopment during viral nuclear egress. We also demonstrate that UL31 is required for the targeting of ICP22 to the nuclear membrane and that ICP22 is required for the correct localization of UL31 and/or UL34. Furthermore, we confirm that ICP22 is required for efficient HSV-1 primary envelopment during viral nuclear egress. Thus, we report, for the first time, that ICP22 plays a regulatory role in HSV-1 nuclear egress. PMID:24741100

Maruzuru, Yuhei; Shindo, Keiko; Liu, Zhuoming; Oyama, Masaaki; Kozuka-Hata, Hiroko; Arii, Jun; Kato, Akihisa

2014-01-01

61

Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice  

PubMed Central

Soluble epoxide hydrolase (sEH), a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs), is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS) female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15–18 month old) and young (3–4 month old) female sEH knockout (sEHKO) mice and wild type (WT) mice were subjected to 45 min middle cerebral artery occlusion (MCAO) with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24 h thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography (OMAG). Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24 h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24 h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice. PMID:25642188

Zuloaga, Kristen L.; Zhang, Wenri; Roese, Natalie E.; Alkayed, Nabil J.

2015-01-01

62

TISSUE-PLASMINOGEN ACTIVATOR IS INDUCED AS AN IMMEDIATE-EARLY GENE DURING SEIZURE, KINDLING, AND LONG-TERM POTENTIATION  

EPA Science Inventory

Activity-dependent genes in brain have been identified using differential screening of hippocampal cDNA library from rats exposed to metrazol seizures under conditions of superconduction. Five immediate early genes whose expression is elevated by neural activity were identified. ...

63

Regulation of Immediate Early Gene Expression and AP1 Binding in the Rat Nucleus Accumbens by Chronic Cocaine  

Microsoft Academic Search

Chronic treatment of rats with cocaine leads to long-term biochemical changes in the nucleus accumbens (NAc), a brain region implicated in mediating the reinforcing effects of cocaine and other drugs of abuse. Immediate early genes (IEGs) and their protein products appear to play an important role in transducing extracellular stimuli into altered patterns of cellular gene expression and, therefore, into

Bruce Hope; Barry Kosofsky; Steven E. Hyman; Eric J. Nestler

1992-01-01

64

Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning  

ERIC Educational Resources Information Center

Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

Mokin, Maxim; Keifer, Joyce

2005-01-01

65

Estrogen-Mediated Renoprotection following Cardiac Arrest and Cardiopulmonary Resuscitation Is Robust to GPR30 Gene Deletion  

PubMed Central

Introduction Acute kidney injury is a serious,sexually dimorphic perioperative complication, primarily attributed to hypoperfusion. We previously found that estradiol is renoprotective after cardiac arrest and cardiopulmonary resuscitation in ovariectomized female mice. Additionally, we found that neither estrogen receptor alpha nor beta mediated this effect. We hypothesized that the G protein estrogen receptor (GPR30) mediates the renoprotective effect of estrogen. Methods Ovariectomized female and gonadally intact male wild-type and GPR30 gene-deleted mice were treated with either vehicle or 17?-estradiol for 7 days, then subjected to cardiac arrest and cardiopulmonary resuscitation. Twenty four hours later, serum creatinine and urea nitrogen were measured, and histologic renal injury was evaluated by unbiased stereology. Results In both males and females, GPR30 gene deletion was associated with reduced serum creatinine regardless of treatment. Estrogen treatment of GPR30 gene-deleted males and females was associated with increased preprocedural weight. In ovariectomized female mice, estrogen treatment did not alter resuscitation, but was renoprotective regardless of GPR30 gene deletion. In males, estrogen reduced the time-to-resuscitate and epinephrine required. In wild-type male mice, serum creatinine was reduced, but neither serum urea nitrogen nor histologic outcomes were affected by estrogen treatment. In GPR30 gene-deleted males, estrogen did not alter renal outcomes. Similarly, renal injury was not affected by G1 therapy of ovariectomized female wild-type mice. Conclusion Treatment with 17?-estradiol is renoprotective after whole-body ischemia-reperfusion in ovariectomized female mice irrespective of GPR30 gene deletion. Treatment with the GPR30 agonist G1 did not alter renal outcome in females. We conclude GPR30 does not mediate the renoprotective effect of estrogen in ovariectomized female mice. In males, estrogen therapy was not renoprotective. Estrogen treatment of GPR30 gene-deleted mice was associated with increased preprocedural weight in both sexes. Of significance to further investigation, GPR30 gene deletion was associated with reduced serum creatinine, regardless of treatment. PMID:24923556

Hutchens, Michael P.; Kosaka, Yasuharu; Zhang, Wenri; Fujiyoshi, Tetsuhiro; Murphy, Stephanie; Alkayed, Nabil; Anderson, Sharon

2014-01-01

66

Poly(ADP-ribosyl)ation of a herpes simplex virus immediate early polypeptide  

SciTech Connect

In vitro poly(ADP-ribosyl)ation of the herpes simplex virus type 1 (HSV-1) immediate early polypeptide Vmw175 is reported. The phenomenon was most clearly observed by use of the temperature-sensitive mutant tsK, which overproduces Vmw175 at the nonpermissive temperature (NPT) and has a mutation in the coding sequences for this polypeptide. Nuclei prepared from cells which were infected with tsK at NPT and subsequently downshifted to the permissive temperature incorporated (/sup 32/P)NAD into Vmw175. This reaction did not occur when nuclei were prepared from cells constantly maintained at NPT, showing that only functional Vmw175 can be radiolabeled with (/sup 32/P)NAD. The identity of the acceptor protein was confirmed by demonstrating the expected electrophoretic mobility differences between the HSV-1 and HSV-2 counterparts of Vmw175. The use of suitable inhibitors demonstrated that the reaction represented mono- or poly(ADP-ribosyl)ation, and further analysis showed the presence of long poly(ADP-ribose) chains attached to Vmw175. Poly(ADP-ribosyl)ation may be important as a cause or result of the regulation of viral transcription by Vmw175. Radiolabeling of another virus-specified polypeptide (approximate molecular weight 38,000), thought to be a structural component of the input virus, is also reported.

Preston, C.M.; Notarianni, E.L.

1983-12-01

67

Mapping vocalization-related immediate early gene expression in echolocating bats  

PubMed Central

Recent studies of spontaneously vocalizing primates, cetaceans, bats and rodents suggests these animals possess a limited but meaningful capacity to manipulate the timing and acoustic structure of their vocalizations, yet the neural substrate for even the simplest forms of vocal modulation in mammals remains unknown. Echolocating bats rapidly and routinely manipulate the acoustic structure of their outgoing vocalizations to improve echolocation efficiency, reflecting cognitive rather than limbic control of the vocal motor pathways. In this study, we used immunohistochemical localization of immediate early gene (c-fos) expression to map neural activity in the brains of spontaneously echolocating stationary Mexican free-tailed bats. Our results support the current model of vocal control obtained largely through microstimulation studies, but also provide evidence for the contributions of two novel regions, the dorsolateral caudate nucleus and mediodorsal thalamic nucleus, which together suggest a striatothalamic feedback loop may be involved in the control of echolocation pulse production. Additionally, we found evidence of a motivation pathway, including the lateral habenula, substantia nigra pars compacta, and raphe nuclei. These data provide novel insights into where and how mammalian vocalizations may be regulated by sensory, contextual and motivational cues. PMID:21726584

Schwartz, Christine P.; Smotherman, Michael S.

2011-01-01

68

Mapping vocalization-related immediate early gene expression in echolocating bats.  

PubMed

Recent studies of spontaneously vocalizing primates, cetaceans, bats and rodents suggest these animals possess a limited but meaningful capacity to manipulate the timing and acoustic structure of their vocalizations, yet the neural substrate for even the simplest forms of vocal modulation in mammals remains unknown. Echolocating bats rapidly and routinely manipulate the acoustic structure of their outgoing vocalizations to improve echolocation efficiency, reflecting cognitive rather than limbic control of the vocal motor pathways. In this study, we used immunohistochemical localization of immediate early gene (c-fos) expression to map neural activity in the brains of spontaneously echolocating stationary Mexican free-tailed bats. Our results support the current model of vocal control obtained largely through microstimulation studies, but also provide evidence for the contributions of two novel regions, the dorsolateral caudate nucleus and mediodorsal thalamic nucleus, which together suggest a striatothalamic feedback loop may be involved in the control of echolocation pulse production. Additionally, we found evidence of a motivation pathway, including the lateral habenula, substantia nigra pars compacta, and raphe nuclei. These data provide novel insights into where and how mammalian vocalizations may be regulated by sensory, contextual and motivational cues. PMID:21726584

Schwartz, Christine P; Smotherman, Michael S

2011-10-31

69

Presentation of an Immunodominant Immediate-Early CD8+ T Cell Epitope Resists Human Cytomegalovirus Immunoevasion  

PubMed Central

Control of human cytomegalovirus (HCMV) depends on CD8+ T cell responses that are shaped by an individual's repertoire of MHC molecules. MHC class I presentation is modulated by a set of HCMV-encoded proteins. Here we show that HCMV immunoevasins differentially impair T cell recognition of epitopes from the same viral antigen, immediate-early 1 (IE-1), that are presented by different MHC class I allotypes. In the presence of immunoevasins, HLA-A- and HLA-B-restricted T cell clones were ineffective, but HLA-C*0702-restricted T cell clones recognized and killed infected cells. Resistance of HLA-C*0702 to viral immunoevasins US2 and US11 was mediated by the alpha3 domain and C-terminal region of the HLA heavy chain. In healthy donors, HLA-C*0702-restricted T cells dominated the T cell response to IE-1. The same HLA-C allotype specifically protected infected cells from attack by NK cells that expressed a corresponding HLA-C-specific KIR. Thus, allotype-specific viral immunoevasion allows HCMV to escape control by NK cells and HLA-A- and HLA-B-restricted T cells, while the virus becomes selectively vulnerable to an immunodominant population of HLA-C-restricted T cells. Our work identifies a T cell population that may be of particular efficiency in HCMV-specific immunotherapy. PMID:23717207

Ameres, Stefanie; Mautner, Josef; Schlott, Fabian; Neuenhahn, Michael; Busch, Dirk H.; Plachter, Bodo; Moosmann, Andreas

2013-01-01

70

Promoter function and structure of the growth factor-inducible immediate early gene cyr61.  

PubMed Central

cyr61 is an immediate early gene that is transcriptionally activated in 3T3 fibroblasts by serum, platelet-derived growth factor, fibroblast growth factor, and the tumor promoter TPA with kinetics similar to the induction of c-fos. cyr61 encodes a secreted protein that is associated with the cell surface and the extracellular matrix, and may play a role in cell-cell communication. We report here the complete nucleotide sequence of the mouse cyr61 gene, which contains four short introns. The transcription start site was mapped by S1 nuclease and primer extension analyses. A 2 kb 5' flanking DNA fragment functions as a serum-inducible promoter. This DNA fragment contains a poly(CA) sequence that can adopt the Z DNA form. In addition, it contains a sequence that resembles the serum response element (SRE) originally identified in the c-fos promoter. We show that deletion of the cry61 SRE-like sequence abrogates serum inducibility. Furthermore, this SRE-like sequence is sufficient to confer serum and growth factor inducibility when linked to a basal promoter, and binds the 67 kD serum response factor in vitro. We conclude that the cyr61 SRE functions as a serum response element and may account for the coordinate activation of cyr61 and c-fos. Images PMID:2062642

Latinkic, B V; O'Brien, T P; Lau, L F

1991-01-01

71

CNS axon regeneration inhibitors stimulate an immediate early gene response via MAP kinase-SRF signaling.  

PubMed

BackgroundCNS axon regeneration inhibitors such as Nogo and CSPGs (Chondroitin Sulfate Proteoglycans) are major extrinsic factors limiting outgrowth of severed nerve fibers. However, knowledge on intracellular signaling cascades and gene expression programs activated by these inhibitors in neurons is sparse. Herein we studied intracellular signaling cascades activated by total myelin, Nogo and CSPGs in primary mouse CNS neurons.ResultsTotal myelin, Nogo and CSPGs stimulated gene expression activity of the serum response factor (SRF), a central gene regulator of immediate early (IEG) and actin cytoskeletal gene transcription. As demonstrated by pharmacological interference, SRF-mediated IEG activation by myelin, Nogo or CSPGs depended on MAP kinase, to a lesser extent on Rho-GTPase but not on PKA signaling. Stimulation of neurons with all three axon growth inhibitors activated the MAP kinase ERK. In addition to ERK activation, myelin activated the IEG c-Fos, an important checkpoint of neuronal survival vs. apoptosis. Employing Srf deficient neurons revealed that myelin-induced IEG activation requires SRF. This suggests an SRF function in mediating neuronal signaling evoked by axon regeneration associated inhibitors. Besides being a signaling target of axon growth inhibitors, we show that constitutively-active SRF-VP16 can be employed to circumvent neurite growth inhibition imposed by myelin, Nogo and CSPGs.ConclusionIn sum, our data demonstrate that axon regeneration inhibitors such as Nogo trigger gene expression programs including an SRF-dependent IEG response via MAP kinases and Rho-GTPases. PMID:25406759

Stern, Sina; Knöll, Bernd

2014-11-19

72

Hippocampal immediate early gene transcription in the rat fluid percussion traumatic brain injury model.  

PubMed

Traumatic brain injury (TBI) is one of the leading causes of neurological disability and death in the USA across all age groups, ethnicities, and incomes. In addition to the short-term morbidity and mortality, TBI leads to epilepsy and severe neurocognitive symptoms, both of which are referenced to post-traumatic hippocampal dysfunction, although the mechanisms of such hippocampal dysfunction are incompletely understood. Here, we study the temporal profile of the transcription of three select immediate early gene (IEG) markers of neuronal hyperactivation, plasticity, and injury, c-fos, brain-derived neurotrophic factor (BDNF), and Bax, in the acute period following the epileptogenic lateral fluid percussion injury in a rodent TBI model. We found that lateral fluid percussion injury leads to enhanced expression of the selected IEGs within 24?h of TBI. Specifically, BDNF and c-fos increase maximally 1-6?h after TBI in the ipsilesional hippocampus, whereas Bax increases in the hippocampus bilaterally in this time window. Antagonism of the N-methyl-D-aspartate-type glutamate receptor by MK801 attenuates the increase in BDNF and Bax, which underscores a therapeutic role for N-methyl-D-aspartate-type glutamate receptor antagonism in the acute post-traumatic time period and suggests a value to a hippocampal IEG readout as an outcome after injury or acute therapeutic intervention. PMID:24978397

Wang, Yingpeng; Hameed, Mustafa Q; Rakhade, Sanjay N; Iglesias, Antonio H; Muller, Paul A; Mou, Dan-Lei; Rotenberg, Alexander

2014-08-20

73

New types of multiple and single gene deletions in the human IgCH locus.  

PubMed

The locus for human immunoglobulin heavy chain constant region genes (IgCH) is characterized by a significant frequency of deleted or duplicated haplotypes, due to unequal crossing-over events. Four types of deletions and one duplication have been reported so far. We describe here a molecular study of four cases of IgCH deletions. Two of the three types of deletions are reported here for the first time. Analysis of genetic markers associated with the deleted haplotypes pointed to the independent origin of similar deletions and the involvement of intergenic sequences in the mispairing-recombination process. The reduced or absent transcription of the C gamma 4 gene in two C gamma 2-deleted haplotypes offers an insight into the requirements for the isotype switch mechanism. PMID:2535700

Bottaro, A; De Marchi, M; De Lange, G; Boccazzi, C; Caldesi, F; Gallina, R; Carbonara, A O

1989-01-01

74

Novel human immunoglobulin heavy chain constant region gene deletion haplotypes characterized by pulsed-field electrophoresis.  

PubMed Central

Fifteen patients with selective IgG1 deficiency were screened for immunoglobulin H chain C region locus (IGHC) gene deletions and three deletion haplotypes were found: del G1, del G1-G4 and del G4. These haplotypes, together with four deletion haplotypes described by us previously (del G1 (NY), del G1 (VIT) del G1-G2 (NY) and del G2-G4 (HJE)), were further characterized using pulsed-field gel electrophoresis (PFGE) to determine the physical extent of the deletions. The MluI fragment sizes confirmed the deletions, although the deduced sizes of the most extensive deletions indicated that material had been inserted into the locus. Images Fig. 1 Fig. 2 PMID:8403523

Olsson, P G; Rabbani, H; Hammarström, L; Smith, C I

1993-01-01

75

Genome-scale genetic screen of lead ion-sensitive gene deletion mutations in Saccharomyces cerevisiae.  

PubMed

Pb (lead) is one of the most widespread and toxic heavy metal contaminants and imposes potential harm to human health. Pb ions cause cellular damage and induce loss of cell viability. However, mechanisms regulating Pb toxicity remain poorly understood. Through a genome-scale screen, we have identified 30 yeast single-gene deletion mutants that are sensitive to lead ions. These genes are involved in the metabolism, transcription, protein synthesis, cell cycle and DNA processing, protein folding, modification, destination, as well as cellular transport process. Comparative analyses to cadmium-sensitive mutations identified from previous studies indicate that overlapping genes of lead- and cadmium-sensitive mutations are involved in both the metabolism and the cellular transport process. Furthermore, eleven lead-sensitive mutants show elevated levels of lead contents in response to lead stress. Our findings provide a basis to understand molecular mechanisms underlying the detoxification of lead ions by yeast cells. PMID:25773006

Du, J; Cao, C; Jiang, L

2015-06-01

76

Effects of Bax gene deletion on social behaviors and neural response to olfactory cues in mice.  

PubMed

Bax is a pro-death protein that plays a crucial role in developmental neuronal cell death. Bax(-/-) mice exhibit increased neuron number and lack several neural sex differences. Here we examined the effects of Bax gene deletion on social behaviors (olfactory preference, social recognition, social approach and aggression) and the neural processing of olfactory cues. Bax deletion eliminated the normal sex difference in olfactory preference behavior. In the social recognition test, both genotypes discriminated a novel conspecific, but wild-type males and Bax(-/-) animals of both sexes spent much more time than wild-type females investigating stimulus animals. Similarly, Bax(-/-) mice were more sociable than wild-type mice in a social approach test. Bax deletion had no effect on aggression in a resident/intruder paradigm where males, regardless of genotype, exhibited a shorter latency to attack. Thus, the prevention of neuronal cell death by Bax gene deletion results in greater sociability as well as the elimination of sex differences in some social behaviors. To examine olfactory processing of socially relevant cues, we counted c-Fos-immunoreactive (Fos-ir) cells in several nodes of the accessory olfactory pathway after exposure to male-soiled or control bedding. In both genotypes, exposure to male-soiled bedding increased Fos-ir cells in the posterodorsal medial amygdala, principal nucleus of the bed nucleus of the stria terminalis and medial preoptic nucleus (MPN), and the response in the MPN was greater in females than in males. However, a reduction in Fos-ir cells was seen in the anteroventral periventricular nucleus of Bax(-/-) mice. PMID:22034980

Holmes, Melissa M; Niel, Lee; Anyan, Jeff J; Griffith, Andrew T; Monks, D Ashley; Forger, Nancy G

2011-11-01

77

The dusp1 Immediate Early Gene is Regulated by Natural Stimuli Predominantly in Sensory Input Neurons  

PubMed Central

Many immediate early genes (IEGs) have activity-dependent induction in a subset of brain subdivisions or neuron types. However, none have been reported yet with regulation specific to thalamic-recipient sensory neurons of the telencephalon or in the thalamic sensory input neurons themselves. Here, we report the first such gene, dual specificity phosphatase 1 (dusp1). Dusp1 is an inactivator of mitogen-activated protein kinase (MAPK), and MAPK activates expression of egr1, one of the most commonly studied IEGs, as determined in cultured cells. We found that in the brain of naturally behaving songbirds and other avian species, hearing song, seeing visual stimuli, or performing motor behavior caused high dusp1 upregulation, respectively, in auditory, visual, and somatosensory input cell populations of the thalamus and thalamic-recipient sensory neurons of the telencephalic pallium, whereas high egr1 upregulation occurred only in subsequently connected secondary and tertiary sensory neuronal populations of these same pathways. Motor behavior did not induce high levels of dusp1 expression in the motor-associated areas adjacent to song nuclei, where egr1 is upregulated in response to movement. Our analysis of dusp1 expression in mouse brain suggests similar regulation in the sensory input neurons of the thalamus and thalamic-recipient layer IV and VI neurons of the cortex. These findings suggest that dusp1 has specialized regulation to sensory input neurons of the thalamus and telencephalon; they further suggest that this regulation may serve to attenuate stimulus-induced expression of egr1 and other IEGs, leading to unique molecular properties of forebrain sensory input neurons. PMID:20506480

Horita, Haruhito; Wada, Kazuhiro; Rivas, Miriam V.; Hara, Erina; Jarvis, Erich D.

2010-01-01

78

The equine herpesvirus 1 immediate-early protein interacts with EAP, a nucleolar-ribosomal protein.  

PubMed

The equine herpesvirus 1 (EHV-1) immediate-early (IE) phosphoprotein is essential for the activation of transcription from viral early and late promoters and regulates transcription from its own promoter. The IE protein of 1487 amino acids contains a serine-rich tract (SRT) between residues 181 and 220. Deletion of the SRT decreased transactivation activity of the IE protein. Previous results from investigation of the ICP4 protein, the IE homolog of herpes simplex virus 1 (HSV-1), revealed that a domain containing a serine-rich tract interacts with EAP (Epstein-Barr virus-encoded small nuclear RNA-associated protein), a 15-kDa nucleolar-ribosomal protein (R. Leopardi, and B. Roizman, Proc. Natl. Acad. Sci. USA 93, 4572-4576, 1996). DNA binding assays revealed that (i) glutathione S-transferase (GST)-EAP disrupted the binding of HSV-1 ICP4 to its cognate DNA in a dose-dependent manner, (ii) GST-EAP interacted with the EHV-1 IE protein, but did not disrupt its binding to its cognate site in viral DNA. GST-pulldown assays indicated that the SRT of the IE protein is required for physical interaction with EAP. The IE protein and EAP colocalized in the cytoplasm of the infected equine ETCC cells at late times of the infection cycle. This latter finding may be important in EHV-1 gene regulation since late viral gene expression is greatly influenced by the EICP0 trans-activator protein whose function is antagonized by the IE protein. PMID:11145900

Kim, S K; Buczynski, K A; Caughman, G B; O'Callaghan, D J

2001-01-01

79

Detection of GST1 gene deletion by the polymerase chain reaction and its possible correlation with stomach cancer in Japanese  

Microsoft Academic Search

A homozygous gene deletion at the GST1 locus of genomic DNA isolated from peripheral blood was investigated for its relationship with several types of cancer using the polymerase chain reaction (PCR) technique. DNA samples were prepared from blood obtained from 128 healthy blood donors and 150 patients with cancer or chronic hepatitis. PCR primers were prepared based on the human

Shoji Harada; Shogo Misawa; Takako Nakamura; Naomi Tanaka; Ei Ueno; Mutsumi Nozoe

1992-01-01

80

Gene deletions causing human genetic disease: mechanisms of mutagenesis and the role of the local DNA sequence environment  

Microsoft Academic Search

Reports describing short (< 20 bp) gene deletions causing human genetic disease were collated in order to study underlying causative mechanisms. Deletion break-point junction regions were found to be non-random both at the nucleotide and dinucleotide sequence levels, an observation consistent with an endogenous sequencedirected mechanism of mutagenesis. Direct repeats of between 2 bp and 8 bp were found in

Michael Krawczak; David N. Cooper

1991-01-01

81

A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa  

Technology Transfer Automated Retrieval System (TEKTRAN)

In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

82

Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp  

Microsoft Academic Search

Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently

Wang-Jing Liu; Yun-Shiang Chang; Chung-Hsiung Wang; Guang-Hsiung Kou; Chu-Fang Lo

2005-01-01

83

Identification of an Intercistronic Internal Ribosome Entry Site in a Marek's Disease Virus Immediate-Early Gene  

Microsoft Academic Search

In this study, we have identified an internal ribosome entry site (IRES) from the highly infectious herpes- virus Marek's disease virus (MDV). The IRES was mapped to the intercistronic region (ICR) of a bicistronic mRNA that we cloned from the MDV-transformed CD4 T-cell line MSB-1. The transcript is a member of a family of mRNAs expressed as immediate-early genes with

Abdessamad Tahiri-Alaoui; Lorraine P. Smith; Suzan Baigent; Lydia Kgosana; Lawrence J. Petherbridge; Luke S. Lambeth; William James; Venugopal Nair

2009-01-01

84

Varicella-Zoster Virus Gene 63 Encodes an Immediate-Early Protein That Is Abundantly Expressed during Latency  

Microsoft Academic Search

Varicella-zoster virus (VZV) gene 63 encodes a protein with a predicted molecular mass of 30.5 kDa which has amino acid similarities with the immediate-early (IE) protein 22 (ICP-22) of herpes simplex virus type 1. In order to study the expression of this protein during lytic and latent infection, gene 63 was cloned in frame and downstream from the glutathione-S-transferase gene,

SERGE DEBRUS; CATHERINE SADZOT-DELVAUX; ARJEN F. NIKKELS; JACQUES PIETTE; ANDBERNARD RENTIER

1995-01-01

85

Transcriptional Coactivators Are Not Required for Herpes Simplex Virus Type 1 Immediate-Early Gene Expression In Vitro  

Microsoft Academic Search

Virion protein 16 (VP16) of herpes simplex virus type 1 (HSV-1) is a potent transcriptional activator of viral immediate-early (IE) genes. The VP16 activation domain can recruit various transcriptional coactivators to target gene promoters. However, the role of transcriptional coactivators in HSV-1 IE gene expression during lytic infection had not been fully defined. We showed previously that transcriptional coactivators such

Sebla B. Kutluay; Sarah L. DeVos; Jennifer E. Klomp; Steven J. Triezenberg

2009-01-01

86

Requirement of the immediate early gene vesl-1S\\/homer-1a for fear memory formation  

Microsoft Academic Search

BACKGROUND: The formation of long-term memory (LTM) and the late phase of long-term potentiation (L-LTP) depend on macromolecule synthesis, translation, and transcription in neurons. vesl-1S (VASP\\/Ena-related gene upregulated during seizure and LTP, also known as homer-1a) is an LTP-induced immediate early gene. The short form of Vesl (Vesl-1S) is an alternatively spliced isoform of the vesl-1 gene, which also encodes

Naoko Inoue; Harumi Nakao; Rika Migishima; Toshiaki Hino; Minoru Matsui; Fumihiko Hayashi; Kazuki Nakao; Toshiya Manabe; Atsu Aiba; Kaoru Inokuchi

2009-01-01

87

Role of hippocampus in alcohol-induced memory impairment: implications from behavioral and immediate early gene studies  

Microsoft Academic Search

Acute alcohol intoxication disrupts memory acquisition in humans and laboratory animals. This review summarizes recent behavioral\\u000a and immediate early gene expression studies addressing the mechanisms of this phenomenon. Most behavioral investigations agree\\u000a that the amnestic effect of alcohol is due to its preferential detrimental effect on hippocampus-dependent than on hippocampus-independent\\u000a forms of learning. However, some hippocampal lesion studies contradict these

Andrey E. Ryabinin

1998-01-01

88

Gene deletional strategies reveal novel physiological roles for myoglobin in striated muscle.  

PubMed

Myoglobin is an abundant hemoprotein that is expressed in cardiomyocytes and oxidative skeletal myofibers of vertebrates. Elegant studies using physiological, biochemical and spectroscopic analyses support a role for myoglobin in facilitated oxygen transport and as a reservoir for oxygen in muscle of diving and hypoxia-adapted animals. In contrast, the functional role of myoglobin in terrestrial animals that function at ambient oxygen levels is a subject of debate. This debate was further fueled by the observation that genetically engineered mice that lack myoglobin are viable and capable of withstanding the hemodynamic stress associated with reproduction. Analysis of the myoglobin mutant striated muscle reveals a spectrum of adaptive mechanisms that partially compensate for the absence of myoglobin and further supports an important function for this hemoprotein in the maintenance of contractile function during exercise under ambient and hypoxic conditions. Future studies utilizing transgenic and gene deletional strategies will further enhance our understanding of myoglobin function under normoxic and hypoxic conditions and will impact our understanding of exercise physiology. PMID:16413834

Kanatous, Shane B; Garry, Daniel J

2006-04-28

89

The psychopharmacology-molecular biology interface: exploring the behavioural roles of dopamine receptor subtypes using targeted gene deletion (‘knockout’)  

Microsoft Academic Search

1.In the absence of selective agonists and antagonists able to discriminate between individual members of the D1-like and D2-like families of dopamine receptor subtypes, functional parcellation has remained problematic.2.‘Knockout’ of these subtypes by targeted gene deletion offers a new approach to evaluating their roles in the regulation of behaviour.3.Like any new technique, ‘knockout’ has associated with it a number of

John L. Waddington; Jeremiah J. Clifford; Fergal N. McNamara; Katsunori Tomiyama; Noriaki Koshikawa; David T. Croke

2001-01-01

90

The Rel/NF-?B pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity  

PubMed Central

This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in ?g. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that ?g was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of ?g from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that ?g- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in ?g. Importantly, several key immediate early genes were inhibited in ?g. In particular, transactivation of Rel/NF-?B, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in ?g and upon anti-CD3/anti-CD28 stimulation in simulated ?g. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in ?g and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that ?g was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

2012-01-01

91

Epigenetic Regulations of Immediate Early Genes Expression Involved in Memory Formation by the Amyloid Precursor Protein of Alzheimer Disease  

PubMed Central

We previously demonstrated that APP epigenetically regulates Egr1 expression both in cultured neurons and in vivo. Since Egr1 is an immediate early gene involved in memory formation, we wondered whether other early genes involved in memory were regulated by APP and we studied molecular mechanisms involved. By comparing prefrontal (PF) cortex from wild type (APP+/+) and APP knockout mice (APP?/?), we observed that APP down regulates expression of four immediate early genes, Egr1, c-Fos, Bdnf and Arc. Down regulation of Egr1, c-Fos and Bdnf transcription resulted from a decreased enrichment of acetylated histone H4 on the corresponding gene promoter. Further characterization of H4 acetylation at Egr1 and c-Fos promoters revealed increased acetylation of H4K5 and H4K12 residues in APP?/? mice. Whereas APP affected Egr1 promoter activity by reducing access of the CREB transcription factor, its effect on c-Fos appeared to depend on increased recruitment of HDAC2 histone deacetylase to the gene promoter. The physiological relevance of the epigenetic regulation of Egr1 and c-Fos gene transcription by APP was further analyzed following exposure of mice to novelty. Although transcription of Egr1 and c-Fos was increased following exposure of APP+/+ mice to novelty, such an induction was not possible in APP?/? mice with a high basal level of expression of these immediate early genes. Altogether, these results demonstrate that APP-mediated regulation of c-Fos and Egr1 by different epigenetic mechanisms is needed for their induction during exposure to novelty. PMID:24919190

Hendrickx, Aurélie; Pierrot, Nathalie; Tasiaux, Bernadette; Schakman, Olivier; Kienlen-Campard, Pascal; De Smet, Charles; Octave, Jean-Noël

2014-01-01

92

Medial amygdala lesions modify aggressive behavior and immediate early gene expression in oxytocin and vasopressin neurons during intermale exposure.  

PubMed

The medial amygdala and neuropeptides oxytocin (OXT) and vasopressin (VSP) have been associated aggressive behavior regulation. However, the specific mechanism involved in OXT and VSP modulation in distinct brain regions during hostile intermale aggressive behavior is undetermined. A retrograde tracer mouse model was employed using male C57BL/6 mice injected with rhodamine-conjugated latex microsphere suspensions in the right hypothalamic paraventricular nucleus. Adult male C57BL/6 mice (aged 14-16 weeks) were subjected to resident-intruder testing using juvenile intruder mice (aged 3 weeks) or adult intruder mice (aged 8 weeks). Following exposure, Fos protein expression was increased in the medial amygdala neurons of resident mice receiving the retrograde tracer. Thus, medial amygdala neurons projecting to or localized in the vicinity of the hypothalamic paraventricular nucleus showed immediate early gene (IEG) expression following resident-intruder testing that was considered an indirect marker of activation. Additionally, intermale aggression-related behaviors were inhibited or modified by exposure to juvenile or adult intruders, respectively, in mice that underwent medial amygdala lesioning. Furthermore, Fos protein expression in OXT-positive neurons was attenuated. Thus, ablation of medial amygdala neurons prevented immediate early gene expression in OXT- and VSP-positive neurons in the hypothalamus, bed nucleus of stria terminalis, and medial preoptic area during intermale exposure. These findings indicate that the medial amygdala likely modulates hostile aggressive behavior associated with immediate early gene expression in OXT and VSP neurons in specific brain areas, which may actually be instrumental in beneficial social interaction-related aggressive responses associated with mating, territorial defense, and offspring protection. PMID:23403283

Wang, Yu; He, Zhiyi; Zhao, Chuansheng; Li, Lei

2013-05-15

93

VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes  

PubMed Central

Rationale Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP?/?) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure. Methods We examined VIP?/?and wild type (WT) mice using Magnetic Resonance Imaging (MRI) for evidence of cardiomyopathy associated with biventricular dilation and wall thickness changes. Lung tissue from VIP?/? and WT mice was subjected to whole-genome gene microarray analysis. Results Lungs from VIP?/? mice showed overexpression of cardiomyopathy genes: Myh1 was upregulated 224 times over WT, and Mylpf was increased 72 fold. Tnnt3 was increased 105 times and tnnc2 181 fold. Hearts were dilated in VIP?/? mice, with thinning of LV wall and increase in RV and LV chamber size, though RV enlargement varied. Weights of VIP?/? mice were consistently lower. Conclusions Critically-important heart failure-related genes are upregulated in VIP?/? mice associated with the spontaneous cardiomyopathy phenotype, involving both left and right ventricles, suggesting that loss of the VIP gene orchestrates a panoply of pathogenic genes which are detrimental to both left and right cardiac homeostasis. PMID:23700405

Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene

2013-01-01

94

PYRETHROID INDUCED ALTERATIONS IN TRANSCRIPTION OF CALCIUM RESPONSIVE AND IMMEDIATE EARLY GENES IN VIVO.  

EPA Science Inventory

Multiple molecular targets for pyrethroid insecticides have been evaluated in in vitro preparations, including but not limited to voltage-sensitive sodium channels (VSSCs), voltage-sensitive calcium channels (VSCCs), GABAergic receptors, ATPases and mitochondrial respiratory chai...

95

The enhancer domain of the human cytomegalovirus major immediate-early promoter determines cell type-specific expression in transgenic mice.  

PubMed

The human cytomegalovirus (HCMV) major immediate-early promoter (MIEP) is one of the first promoters to activate upon infection. To examine HCMV MIEP tissue-specific expression, transgenic mice were established containing the lacZ gene regulated by the MIEP (nucleotides -670 to +54). In the transgenic mice, lacZ expression was demonstrated in 19 of 29 tissues tested by histochemical and immunochemical analyses. These tissues included brain, eye, spinal cord, esophagus, stomach, pancreas, kidney, bladder, testis, ovary, spleen, salivary gland, thymus, bone marrow, skin, cartilage, and cardiac, striated and smooth muscles. Although expression was observed in multiple organs, promoter activity was restricted to specific cell types. The cell types which demonstrated HCMV MIEP expression included retinal cells of the eye, ductile cells of the salivary gland, exocrine cells of the pancreas, mucosal cells of the stomach and intestine, neuronal cells of the brain, muscle fibers, thecal cells of the corpus luteum, and Leydig and sperm cells of the testis. These observations indicate that the HCMV MIEP is not a pan-specific promoter and that the majority of expressing tissues correlate with tissues naturally infected by the virus in the human host. PMID:8627801

Baskar, J F; Smith, P P; Nilaver, G; Jupp, R A; Hoffmann, S; Peffer, N J; Tenney, D J; Colberg-Poley, A M; Ghazal, P; Nelson, J A

1996-05-01

96

A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells  

SciTech Connect

Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand, and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.

Gong, Y.; Li, X.M.; Shapiro, L.J. [UCSF School of Medicine, San Francisco, CA (United States)] [and others

1994-09-01

97

Variation of DNA sequence in immediate-early gene of human herpesvirus 6 and variant identification by PCR.  

PubMed Central

The complete nucleotide sequence of one of the immediate-early genes of human herpesvirus 6 variant B was determined and compared with that of variant A reported by Martin et al. (M.D. Martin, J. Nicholas, B. J. Thomson, C. Newman, and R. W. Honess, J. Virol. 65:5381-5390, 1991). While it was reported that two open reading frames exist in this region of variant A, only one open reading frame was found in variant B and the putative coding region of variant B was 2,679 nucleotides long. Furthermore, two additive regions of 108 and 228 bp were found in variant B. Primers covering one of these regions deleted in variant A were synthesized and used for PCR amplification. Twelve isolates from patients were clearly classified into variants A and B by PCR amplification with these primers. All isolates from patients with exanthem subitum were variant B. Images PMID:8150960

Yamamoto, T; Mukai, T; Kondo, K; Yamanishi, K

1994-01-01

98

The Human Cytomegalovirus Major Immediate-Early Proteins as Antagonists of Intrinsic and Innate Antiviral Host Responses  

PubMed Central

The major immediate-early (IE) gene of human cytomegalovirus (CMV) is believed to have a decisive role in acute infection and its activity is an important indicator of viral reactivation from latency. Although a variety of gene products are expressed from this region, the 72-kDa IE1 and the 86-kDa IE2 nuclear phosphoproteins are the most abundant and important. Both proteins have long been recognized as promiscuous transcriptional regulators. More recently, a critical role of the IE1 and IE2 proteins in counteracting non-adaptive host cell defense mechanisms has been revealed. In this review we will briefly summarize the available literature on IE1- and IE2-dependent mechanisms contributing to CMV evasion from intrinsic and innate immune responses. PMID:21994568

Paulus, Christina; Nevels, Michael

2009-01-01

99

Direct stimulation of immediate-early genes by intranuclear insulin in trypsin-treated H35 hepatoma cells.  

PubMed

H35 hepatoma cells were treated with trypsin to abolish insulin binding and insulin-stimulated receptor kinase activity. Insulin was, however, internalized by fluid-phase endocytosis in trypsin-treated cells. Furthermore, nuclear accumulation of insulin was similar in control and trypsin-treated hepatoma cells. Northern blot analysis revealed insulin increased g33 and c-fos mRNA concentrations identically in control and trypsin-treated cells but had no effect on beta 2-microglobulin mRNA. Actinomycin D treatment prior to or after insulin addition demonstrated that insulin increased gene transcription and had no effect on mRNA degradation. These studies suggest that the accumulation of intact insulin in cell nuclei may be directly involved in the increased transcription of immediate-early genes. PMID:1409684

Lin, Y J; Harada, S; Loten, E G; Smith, R M; Jarett, L

1992-10-15

100

Characterization of a Replication-Incompetent Pseudorabies Virus Mutant Lacking the Sole Immediate Early Gene IE180  

PubMed Central

ABSTRACT The alphaherpesvirus pseudorabies virus (PRV) encodes a single immediate early gene called IE180. The IE180 protein is a potent transcriptional activator of viral genes involved in DNA replication and RNA transcription. A PRV mutant with both copies of IE180 deleted was constructed 20 years ago (S. Yamada and M. Shimizu, Virology 199:366–375, 1994, doi:10.1006/viro.1994.1134), but propagation of the mutant depended on complementing cell lines that expressed the toxic IE180 protein constitutively. Recently, Oyibo et al. constructed a novel set of PRV IE180 mutants and a stable cell line with inducible IE180 expression (H. Oyibo, P. Znamenskiy, H. V. Oviedo, L. W. Enquist, A. Zador, Front. Neuroanat. 8:86, 2014, doi:10.3389/fnana.2014.00086), which we characterized further here. These mutants failed to replicate new viral genomes, synthesize immediate early, early, or late viral proteins, and assemble infectious virions. The PRV IE180-null mutant did not form plaques in epithelial cell monolayers and could not spread from primary infected neurons to second-order neurons in culture. PRV IE180-null mutants lacked the property of superinfection exclusion. When PRV IE180-null mutants infected cells first, subsequent superinfecting viruses were not blocked in cell entry and formed replication compartments in epithelial cells, fibroblasts, and neurons. Cells infected with PRV IE180-null mutants survived as long as uninfected cells in culture while expressing a fluorescent reporter gene. Transcomplementation with IE180 in epithelial cells restored all mutant phenotypes to wild type. The conditional expression of PRV IE180 protein enables the propagation of replication-incompetent PRV IE180-null mutants and will facilitate construction of long-term single-cell-infecting PRV mutants for precise neural circuit tracing and high-capacity gene delivery vectors. PMID:25389174

Wu, Brendan W.

2014-01-01

101

Truncation of the C-terminal acidic transcriptional activation domain of herpes simplex virus VP16 renders expression of the immediate-early genes almost entirely dependent on ICP0.  

PubMed

The herpes simplex virus (HSV) proteins VP16 and ICP0 play key roles in stimulating the onset of the viral lytic cycle. We sought to explore the regulatory links between these proteins by studying the phenotypes of viral mutants in which the activation functions of both were simultaneously inactivated. This analysis unexpectedly revealed that truncation of the C-terminal transcriptional activation domain of VP16 (allele V422) in an ICP0-deficient background almost completely eliminated immediate-early gene expression and virus replication in Vero and HEL cells. The doubly mutant viral genome persisted in a quiescent state for at least 10 days in HEL cells infected at high multiplicity and could be reactivated by superinfection with wild-type HSV. In contrast, the in1814 VP16 mutation produced a markedly less severe phenotype in the same ICP0-deficient background. These data demonstrate that expression of the immediate-early genes requires ICP0 when the C-terminal activation domain of VP16 is deleted and raise the possibility that the in1814 form of VP16 retains a residual ability to stimulate gene expression during virus infection. PMID:10559282

Mossman, K L; Smiley, J R

1999-12-01

102

Excision of Unstable Artificial Gene-Specific Inverted Repeats Mediates Scar-Free Gene Deletions in Escherichia coli.  

PubMed

Inverted repeat and palindromic sequences have the propensity to form non-beta cruciform structures during DNA replication, leading to perturbations within the genome or plasmid replicon. In this study, the tolerance of the Escherichia coli genome to inverted repeat sequences from 25 to 1200 bp was investigated. Genomic inverted repeats were readily created via the homologous insertion of an overlap extension PCR product containing a gene-specific region of the genome together with thyA coding sequence, creating inverted repeat sequences of various lengths flanking the thyA selection marker in the resulting genome. Inverted repeat sequences below 100 bp were stably propagated, while those above and up to 1200 bp were found to be transiently unstable under auxotrophic thymine selection. Excision efficiency improves with increases of the inverted repeat until 600-800 bp, indicating that the genomic stability of inverted repeat sequences is due to secondary structure formation. Its effectiveness of creating precise and scar-free gene deletions was further demonstrated by deleting a number of genes in E. coli. The procedure can be readily adapted for sequence integration and point mutations in E. coli genome. It also has the potential for applications on other bacteria for efficient gene deletions. PMID:25427592

Tear, Crystal Jing Ying; Lim, Chanyuen; Zhao, Hua

2015-02-01

103

Time Course of Immediate Early Gene Protein Expression in the Spinal Cord following Conditioning Stimulation of the Sciatic Nerve in Rats  

PubMed Central

Long-term potentiation induced by conditioning electrical stimulation of afferent fibers is a widely studied form of synaptic plasticity in the brain and the spinal cord. In the spinal cord dorsal horn, long-term potentiation is induced by a series of high-frequency trains applied to primary afferent fibers. Conditioning stimulation (CS) of sciatic nerve primary afferent fibers also induces expression of immediate early gene proteins in the lumbar spinal cord. However, the time course of immediate early gene expression and the rostral-caudal distribution of expression in the spinal cord have not been systematically studied. Here, we examined the effects of sciatic nerve conditioning stimulation (10 stimulus trains, 0.5 ms stimuli, 7.2 mA, 100 Hz, train duration 2 s, 8 s intervals between trains) on cellular expression of immediate early genes, Arc, c-Fos and Zif268, in anesthetized rats. Immunohistochemical analysis was performed on sagittal sections obtained from Th13- L5 segments of the spinal cord at 1, 2, 3, 6 and 12 h post-CS. Strikingly, all immediate early genes exhibited a monophasic increase in expression with peak increases detected in dorsal horn neurons at 2 hours post-CS. Regional analysis showed peak increases at the location between the L3 and L4 spinal segments. Both Arc, c-Fos and Zif268 remained significantly elevated at 2 hours, followed by a sharp decrease in immediate early gene expression between 2 and 3 hours post-CS. Colocalization analysis performed at 2 hours post-CS showed that all c-Fos and Zif268 neurons were positive for Arc, while 30% and 43% of Arc positive neurons were positive for c-Fos and Zif268, respectively. The present study identifies the spinal cord level and time course of immediate early gene (IEGP) expression of relevance for analysis of IEGPs function in neuronal plasticity and nociception. PMID:25860146

Bojovic, Ognjen; Panja, Debabrata; Bittins, Margarethe; Bramham, Clive R.; Tjølsen, Arne

2015-01-01

104

MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis  

PubMed Central

Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena – Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated neurons. PMID:24659959

Kubík, Št?pán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

2014-01-01

105

The Products of Herpes Simplex Virus Type 1 (HSV1) Immediate Early Genes 1, 2 and 3 Can Activate HSV1 Gene Expression in trans  

Microsoft Academic Search

SUMMARY Expression of the early and late genes of herpes simplex virus type 1 (HSV-1) during infection of tissue culture cells requires the prior expression of the immediate early (IE) genes. The requirement for the product of IE gene 3, Vmw175, for the activation of early promoters has been revealed by studies with temperature-sensitive virus mutants. Recent experiments using transfection

R. D. Everett

1986-01-01

106

RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia of latently infected mice  

Microsoft Academic Search

Transcription of the type 1 herpes simplex virus (HSV-1) genome in trigeminal ganglia of latently infected mice was studied using in situ hybridization. Probes representative of each temporal gene class were used to determine the regions of the genome that encode the transcripts present in latently infected cells. Probes encoding HSV-1 sequences of the five immediate early genes and representative

A. M. Deatly; J. G. Spivack; E. Lavi; N. W. Fraser

1987-01-01

107

POLY I:C INHIBITS THE EXPRESSION OF CHANNEL CATFISH VIRUS IMMEDIATE-EARLY GENE ORF 1 AT EARLY TIMES AFTER INFECTION  

Technology Transfer Automated Retrieval System (TEKTRAN)

Channel catfish virus (CCV) is a herpes virus that infects channel catfish fry and fingerlings. Previous research has demonstrated that Type I interferons inhibit the expression of immediate-early (IE) genes of some mammalian herpesviruses. However, CCV is distantly related to the mammalian herpesvi...

108

Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory  

ERIC Educational Resources Information Center

No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

Pevzner, Aleksandr; Guzowski, John F.

2015-01-01

109

Expression of Immediate-Early Genes in the Inferior Colliculus and Auditory Cortex in Salicylate-Induced Tinnitus in Rat  

PubMed Central

Tinnitus could be associated with neuronal hyperactivity in the auditory center. As a neuronal activity marker, immediate-early gene (IEG) expression is considered part of a general neuronal response to natural stimuli. Some IEGs, especially the activity-dependent cytoskeletal protein (Arc) and the early growth response gene-1 (Egr-1), appear to be highly correlated with sensory-evoked neuronal activity. We hypothesize, therefore, an increase of Arc and Egr-1 will be observed in a tinnitus model. In our study, we used the gap prepulse inhibition of acoustic startle (GPIAS) paradigm to confirm that salicylate induces tinnitus-like behavior in rats. However, expression of the Arc gene and Egr-1 gene were decreased in the inferior colliculus (IC) and auditory cortex (AC), in contradiction of our hypothesis. Expression of N-methyl D-aspartate receptor subunit 2B (NR2B) was increased and all of these changes returned to normal 14 days after treatment with salicylate ceased. These data revealed long-time administration of salicylate induced tinnitus markedly but reversibly and caused neural plasticity changes in the IC and the AC. Decreased expression of Arc and Egr-1 might be involved with instability of synaptic plasticity in tinnitus. PMID:24704997

Hu, S.S.; Mei, L.; Chen, J.Y.; Huang, Z.W.; Wu, H.

2014-01-01

110

Suppression of CD8+ T-cell recognition in the immediate-early phase of human cytomegalovirus infection.  

PubMed

Human cytomegalovirus (HCMV) interferes with MHC class I-restricted antigen presentation and thereby reduces recognition by CD8(+) T-cells. This interference is mediated primarily by endoplasmic reticulum-resident glycoproteins that are encoded in the US2-11 region of the viral genome. Such a suppression of recognition would be of particular importance immediately after infection, because several immunodominant viral antigens are already present in the cell in this phase. However, which of the evasion proteins gpUS2-11 interfere(s) with antigen presentation to CD8(+) T-cells at this time of infection is not known. Here we address this question, using recombinant viruses (RV) that express only one of the immunoevasins gpUS2, gpUS3 or gpUS11. Infection with RV-US3 had only a limited impact on the presentation of peptides from the CD8(+) T-cell antigens IE1 and pp65 under immediate-early (IE) conditions imposed by cycloheximide/actinomycin D blocking. Unexpectedly, both RV-US2 and RV-US11 considerably impaired the recognition of IE1 and pp65 by CD8(+) T-cells, and both US2 and, to a lesser extent, US11 were transcribed under IE conditions. Thus, gpUS2 and gpUS11 are key effectors of MHC class I immunoevasion immediately after HCMV infection. PMID:23100361

Hesse, Julia; Ameres, Stefanie; Besold, Katrin; Krauter, Steffi; Moosmann, Andreas; Plachter, Bodo

2013-02-01

111

Binding of SP1 to the immediate-early protein-responsive element of the human cytomegalovirus DNA polymerase promoter.  

PubMed Central

Human cytomegalovirus (HCMV), a member of the herpesvirus family of DNA viruses, encodes two major immediate-early (IE) transcription factors, IE72 and IE86, that are important for regulated expression of the viral genome. The purpose of this study was to identify the host cellular components required for regulation of the HCMV DNA polymerase promoter (UL54) by HCMV IE proteins. Extensive mutagenesis defined a DNA element located between -54 and -43 relative to the transcription start site that was required for both basal transcriptional activity and transactivation by viral IE proteins. A single copy of the UL54 -54/-43 sequence enhanced the responsiveness of a heterologous minimal promoter to HCMV IE proteins. Fractionation of extracts prepared from uninfected cells led to the isolation of two cellular proteins with apparent molecular masses of 95 and 105 kDa that bound specifically to the UL54 -54/-43 element. Biochemical and immunochemical analyses identified this protein as the transcription factor SP1. Although initial inspection of the UL54 -54/-43 sequence did not predict an SP1 binding site, subsequent analyses indicated that it is indeed a nonconsensus GC box. We propose that SP1 is required to direct basal levels of promoter activity and that SP1-regulated transcription complexes allow the entry of HCMV IE proteins into the transcription cycle. PMID:9261391

Luu, P; Flores, O

1997-01-01

112

Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation  

NASA Technical Reports Server (NTRS)

Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

1997-01-01

113

Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp  

SciTech Connect

Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter.

Liu Wangjing [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Chang Yunshiang [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Wang Chunghsiung [Department of Entomology, National Taiwan University, Taipei 106, Taiwan (China); Kou, Guang-Hsiung [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Lo Chufang [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China)]. E-mail: gracelow@ntu.edu.tw

2005-04-10

114

Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors  

PubMed Central

To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

2015-01-01

115

A dihydro-pyrido-indole potently inhibits HSV-1 infection by interfering the viral immediate early transcriptional events.  

PubMed

In our continued quest for identifying novel molecules from ethnomedicinal source we have isolated an alkaloid 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole, also known as Harmaline (HM), from an ethnomedicinal herb Ophiorrhiza nicobarica. The compound exhibited a potent anti-HSV-1 activity against both wild type and clinical isolates of HSV-1. Further we demonstrated that HM did not interfere in viral entry but the recruitment of lysine-specific demethylase-1 (LSD1) and the binding of immediate-early (IE) complex on ICP0 promoter. This leads to the suppression of viral IE gene synthesis and thereby the reduced expression of ICP4 and ICP27. Moreover, HM at its virucidal concentration is nontoxic and reduced virus yields in cutaneously infected Balb/C mice. Thus, the interference in the binding of IE complex, a decisive factor for HSV lytic cycle or latency by HM reveals an interesting target for developing non-nucleotide antiherpetic agent with different mode of action than Acyclovir. PMID:24576908

Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh C; Mondal, Supriya; Biswas, Aruna; Sharon, Ashoke; Van Kaer, Luc; Chakrabarty, Sekhar; Das, Gobardhan; Mitra, Debashis; Chattopadhyay, Debprasad

2014-05-01

116

Expression of the immediate-early gene-encoded protein Egr-1 (zif268) during in vitro classical conditioning.  

PubMed

Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink classical conditioning. The results showed that Egr-1 protein expression as determined by immunocytochemistry and Western blot analysis rapidly increased during the early stages of conditioning and remained elevated during the later stages. Further, expression of Egr-1 protein required NMDA receptor activation as it was blocked by bath application of AP-5. These findings suggest that the IEG-encoded proteins such as Egr-1 are activated during relatively simple forms of learning in vertebrates. In this case, Egr-1 may have a functional role in the acquisition phase of conditioning as well as in maintaining expression of conditioned responses. PMID:15805312

Mokin, Maxim; Keifer, Joyce

2005-01-01

117

Expression of the immediate-early gene–encoded protein Egr-1 (zif268) during in vitro classical conditioning  

PubMed Central

Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink classical conditioning. The results showed that Egr-1 protein expression as determined by immunocytochemistry and Western blot analysis rapidly increased during the early stages of conditioning and remained elevated during the later stages. Further, expression of Egr-1 protein required NMDA receptor activation as it was blocked by bath application of AP-5. These findings suggest that the IEG-encoded proteins such as Egr-1 are activated during relatively simple forms of learning in vertebrates. In this case, Egr-1 may have a functional role in the acquisition phase of conditioning as well as in maintaining expression of conditioned responses. PMID:15805312

Mokin, Maxim; Keifer, Joyce

2005-01-01

118

Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors.  

PubMed

To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

Ono, Chikako; Sato, Masanao; Taka, Hitomi; Asano, Shin-Ichiro; Matsuura, Yoshiharu; Bando, Hisanori

2015-01-01

119

Calcium-dependent immediate-early gene induction in lymphocytes is negatively regulated by p21Ha-ras.  

PubMed Central

The induction of immediate-early (IE) response genes, such as egr-1, c-fos, and c-jun, occurs rapidly after the activation of T lymphocytes. The process of activation involves calcium mobilization, activation of protein kinase C (PKC), and phosphorylation of tyrosine kinases. p21(ras), a guanine nucleotide binding factor, mediates T-cell signal transduction through PKC-dependent and PKC-independent pathways. The involvement of p21(ras) in the regulation of calcium-dependent signals has been suggested through analysis of its role in the activation of NF-AT. We have investigated the inductions of the IE genes in response to calcium signals in Jurkat cells (in the presence of activated p21(ras)) and their correlated consequences. The expression of activated p21(ras) negatively regulated the induction of IE genes by calcium ionophore. This inhibition of calcium-activated IE gene induction was reversed by treatment with cyclosporin A, suggesting the involvement of calcineurin in this regulation. A later result of inhibition of this activation pathway by p21(ras) was down-regulation of the activity of the transcription factor AP-1 and subsequent coordinate reductions in IL-2 gene expression and protein production. These results suggest that p2l(ras) is an essential mediator in generating not only positive but also negative modulatory mechanisms controlling the competence of T cells in response to inductive stimulations. PMID:8887687

Chen, C Y; Forman, L W; Faller, D V

1996-01-01

120

BACE1 gene deletion prevents neuron loss and memory deficits in 5XFAD APP/PS1 transgenic mic  

PubMed Central

Evidence suggests that ?-amyloid (A?) peptide triggers a pathogenic cascade leading to neuronal loss in Alzheimer’s disease (AD). However, the causal link between A? and neuron death in vivo remains unclear since most animal models fail to recapitulate the dramatic cell loss observed in AD. We have recently developed transgenic mice that overexpress human APP and PS1 with five familial AD mutations (5XFAD mice) and exhibit robust neuron death. Here, we demonstrate that genetic deletion of the ?-secretase (BACE1) not only abrogates A? generation and blocks amyloid deposition but also prevents neuron loss found in the cerebral cortex and subiculum, brain regions manifesting the most severe amyloidosis in 5XFAD mice. Importantly, BACE1 gene deletion also rescues memory deficits in 5XFAD mice. Our findings provide strong evidence that A? ultimately is responsible for neuron death in AD and validate the therapeutic potential of BACE1-inhibiting approaches for the treatment of AD. PMID:17258906

Ohno, Masuo; Cole, Sarah L.; Yasvoina, Marina; Zhao, Jie; Citron, Martin; Berry, Robert; Disterhoft, John F.; Vassar, Robert

2007-01-01

121

Complement factor I deficiency: a not so rare immune defect. Characterization of new mutations and the first large gene deletion  

PubMed Central

Background Complement Factor I (CFI) is a serine protease with an important role in complement alternative pathway regulation. Complete factor I deficiency is strongly associated with severe infections. Approximately 30 families with this deficiency have been described worldwide. Patients and methods We have studied five new Spanish families suffering from CFI deficiency. From 19 screened people, 7 homozygous, 10 heterozygous and 2 healthy subjects were identified. Clinical, biochemical and genetic descriptions are included. Results Molecular studies demonstrated 4 novel mutations in the screened individuals; amongst them, we describe here the first great gene deletion reported in the CFI locus, which includes full exon 2 and part of the large intron 1. Conclusion CFI deficiency is possibly an underestimated defect and the eventual existence of this deficiency should be tested in those patients exhibiting low C3 and recurrent bacterial infections. We propose a simple diagnostic flowchart to help clinicians in the identification and correct diagnosis of such patients. PMID:22710145

2012-01-01

122

Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4.  

PubMed Central

Using Vero cells transformed with the wild-type gene for ICP4 as the permissive host cell, we isolated herpes simplex virus type 1 (HSV-1) mutants containing deletions in both copies of the ICP4 gene. The mutants, d120 and d202, contained deletions of 4.1 and 0.5 kilobases, respectively, in each copy of ICP4. ICP4 mRNA synthesized in d202-infected Vero cells was 0.5 kilobases smaller than that synthesized in cells infected with the wild-type virus. No ICP4 mRNA was detected in d120-infected Vero cells. d120 and d202 specified polypeptides that reacted with ICP4 antiserum and were smaller than the wild-type ICP4 polypeptide by 130 and 30 kilodaltons, respectively. The only other HSV-1 gene products detectable on infection of Vero cells with d120 and d202 were ICP6 (of the early kinetic class of HSV-1 polypeptides), ICP0 (immediate early), ICP22 (immediate early), and ICP27 (immediate early). Immediate-early polypeptides ICP0 and ICP27 were expressed to a higher level in Vero cells infected with an ICP4 temperature-sensitive (ts) mutant (tsB32) at 39 degrees C, indicating immediate-early stimulatory activity associated with the ts ICP4 polypeptide. In addition, the patterns of complementation of d120, d202, and tsB32 in ICP4-transformed cells also demonstrated inhibitory activity associated with the ts form of the ICP4 polypeptide. Images PMID:2997476

DeLuca, N A; McCarthy, A M; Schaffer, P A

1985-01-01

123

HSV-2 Immediate-Early Protein US1 Inhibits IFN-? Production by Suppressing Association of IRF-3 with IFN-? Promoter.  

PubMed

HSV-2 is the major cause of genital herpes, and its infection increases the risk of HIV-1 acquisition and transmission. After initial infection, HSV-2 can establish latency within the nervous system and thus maintains lifelong infection in humans. It has been suggested that HSV-2 can inhibit type I IFN signaling, but the underlying mechanism has yet to be determined. In this study, we demonstrate that productive HSV-2 infection suppresses Sendai virus (SeV) or polyinosinic-polycytidylic acid-induced IFN-? production. We further reveal that US1, an immediate-early protein of HSV-2, contributes to such suppression, showing that US1 inhibits IFN-? promoter activity and IFN-? production at both mRNA and protein levels, whereas US1 knockout significantly impairs such capability in the context of HSV-2 infection. US1 directly interacts with DNA binding domain of IRF-3, and such interaction suppresses the association of nuclear IRF-3 with the IRF-3 responsive domain of IFN-? promoter, resulting in the suppression of IFN-? promoter activation. Additional studies demonstrate that the 217-414 aa domain of US1 is critical for the suppression of IFN-? production. Our results indicate that HSV-2 US1 downmodulates IFN-? production by suppressing the association of IRF-3 with the IRF-3 responsive domain of IFN-? promoter. Our findings highlight the significance of HSV-2 US1 in inhibiting IFN-? production and provide insights into the molecular mechanism by which HSV-2 evades the host innate immunity, representing an unconventional strategy exploited by a dsDNA virus to interrupt type I IFN signaling pathway. PMID:25712217

Zhang, Mudan; Liu, Yalan; Wang, Ping; Guan, Xinmeng; He, Siyi; Luo, Sukun; Li, Chang; Hu, Kai; Jin, Wei; Du, Tao; Yan, Yan; Zhang, Zhenfeng; Zheng, Zhenhua; Wang, Hanzhong; Hu, Qinxue

2015-04-01

124

Contrasting Networks for Recognition Memory and Recency Memory Revealed by Immediate-Early Gene Imaging in the Rat  

PubMed Central

The expression of the immediate-early gene c-fos was used to compare networks of activity associated with recency memory (temporal order memory) and recognition memory. In Experiment 1, rats were first familiarized with sets of objects and then given pairs of different, familiar objects to explore. For the recency test group, each object in a pair was separated by 110 min in the time between their previous presentations. For the recency control test, each object in a pair was separated by less than a 1 min between their prior presentations. Temporal discrimination of the objects correlated with c-fos activity in the recency test group in several sites, including area Te2, the perirhinal cortex, lateral entorhinal cortex, as well as the dentate gyrus, hippocampal fields CA3 and CA1. For both the test and control conditions, network models were derived using structural equation modeling. The recency test model emphasized serial connections from the perirhinal cortex to lateral entorhinal cortex and then to the CA1 subfield. The recency control condition involved more parallel pathways, but again highlighted CA1 within the hippocampus. Both models contrasted with those derived from tests of object recognition (Experiment 2), because stimulus novelty was associated with pathways from the perirhinal cortex to lateral entorhinal cortex that then involved both the dentate gyrus (and CA3) and CA1 in parallel. The present findings implicate CA1 for the processing of familiar stimuli, including recency discriminations, while the dentate gyrus and CA3 pathways are recruited when the perirhinal cortex signals novel stimuli. PMID:24933661

2014-01-01

125

Co-Localization of Immediate Early Genes in Catecholamine Cells after Song Exposure in Female Zebra Finches (Taeniopygia guttata)  

PubMed Central

The physiological state of animals in many taxonomic groups can be modified via social interactions, including simply receiving communication signals from conspecifics. Here, we explore whether the catecholaminergic system of female songbirds responds during social interactions that are limited to song reception. We measured the protein product of an immediate early gene (ZENK) within three catecholaminergic brain regions in song-exposed (N = 11) and silent-exposed (N = 6) female zebra finches (Taeniopygia guttata). ZENK-ir induction was quantified in catecholamine cells as well as within cells of unknown phenotypes in three brain regions that synthesize catecholamines, the ventral tegmental area (VTA), the periaqueductal gray (PAG) and the locus coeruleus (LoC). Our results reveal that there are no significant differences in the overall number of cells expressing ZENK between song-exposed and silent-exposed females. However, when we limited our measurements to catecholamine-containing cells, we show a greater number of catecholamine-containing cells expressing ZENK within the LoC in the song-exposed females as compared to silent-exposed females. Furthermore, we measured five behaviors during the song and silent-exposed period, as behavioral differences between these groups may account for differences in the co-induction of ZENK and TH-ir. Our results reveal that there were no statistically significant differences in the five measured behaviors between song and silent-exposed females. Our study demonstrates that noradrenergic cells within the LoC are involved in the neural architecture underlying sound perception and that cells within the catecholaminergic system are modulated by social interactions, particularly the reception of signals used in animal communication. PMID:22572406

Lynch, Kathleen S.; Diekamp, Bettina; Ball, Gregory F.

2013-01-01

126

Rhomboids of Mycobacteria: Characterization Using an aarA Mutant of Providencia stuartii and Gene Deletion in Mycobacterium smegmatis  

PubMed Central

Background Rhomboids are ubiquitous proteins with unknown roles in mycobacteria. However, bioinformatics suggested putative roles in DNA replication pathways and metabolite transport. Here, mycobacterial rhomboid-encoding genes were characterized; first, using the Providencia stuartii null-rhomboid mutant and then deleted from Mycobacterium smegmatis for additional insight in mycobacteria. Methodology/Principal Findings Using in silico analysis we identified in M. tuberculosis genome the genes encoding two putative rhomboid proteins; Rv0110 (referred to as “rhomboid protease 1”) and Rv1337 (“rhomboid protease 2”). Genes encoding orthologs of these proteins are widely represented in all mycobacterial species. When transformed into P. stuartii null-rhomboid mutant (?aarA), genes encoding mycobacterial orthologs of “rhomboid protease 2” fully restored AarA activity (AarA is the rhomboid protein of P. stuartii). However, most genes encoding mycobacterial “rhomboid protease 1” orthologs did not. Furthermore, upon gene deletion in M. smegmatis, the ?MSMEG_4904 single mutant (which lost the gene encoding MSMEG_4904, orthologous to Rv1337, “rhomboid protease 2”) formed the least biofilms and was also more susceptible to ciprofloxacin and novobiocin, antimicrobials that inhibit DNA gyrase. However, the ?MSMEG_5036 single mutant (which lost the gene encoding MSMEG_5036, orthologous to Rv0110, “rhomboid protease 1”) was not as susceptible. Surprisingly, the double rhomboid mutant ?MSMEG_4904–?MSMEG_5036 (which lost genes encoding both homologs) was also not as susceptible suggesting compensatory effects following deletion of both rhomboid-encoding genes. Indeed, transforming the double mutant with a plasmid encoding MSMEG_5036 produced phenotypes of the ?MSMEG_4904 single mutant (i.e. susceptibility to ciprofloxacin and novobiocin). Conclusions/Significance Mycobacterial rhomboid-encoding genes exhibit differences in complementing aarA whereby it's only genes encoding “rhomboid protease 2” orthologs that fully restore AarA activity. Additionally, gene deletion data suggests inhibition of DNA gyrase by MSMEG_4904; however, the ameliorated effect in the double mutant suggests occurrence of compensatory mechanisms following deletion of genes encoding both rhomboids. PMID:23029216

Kateete, David Patrick; Katabazi, Fred Ashaba; Okeng, Alfred; Okee, Moses; Musinguzi, Conrad; Asiimwe, Benon Byamugisha; Kyobe, Samuel; Asiimwe, Jeniffer; Boom, W. Henry; Joloba, Moses Lutaakome

2012-01-01

127

Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes  

Microsoft Academic Search

An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection

Jialing Lee; Zachary Klase; Xiaoqi Gao; Jeremy S. Caldwell; Mark F. Stinski; Fatah Kashanchi; Sheng-Hao Chao

2007-01-01

128

Herpes Simplex Virus Type 1 Immediate-Early Protein Vmw110 Induces the Proteasome-Dependent Degradation of the Catalytic Subunit of DNA-Dependent Protein Kinase  

Microsoft Academic Search

Herpes simplex virus type 1 (HSV-1) infection causes the active degradation of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), and this process is reliant on the expression of the HSV-1 immediate-early protein Vmw110. In this study we investigated in more detail the mechanism by which the degradation occurs, the domains of Vmw110 which are required, and whether Vmw110 is

JANE PARKINSON; SUSAN P. LEES-MILLER; ROGER D. EVERETT

1999-01-01

129

Antiviral Effect of an Oligo(Nucleoside Methylphosphonate) Complementary to the Splice Junction of Herpes Simplex Virus Type 1 Immediate Early Pre-mRNAs 4 and 5  

Microsoft Academic Search

Selective inhibition of regulatory immediate early (IE) genes of herepes simplex virus type 1 (HSV-1) should inhibit virus growth. Treatment of HSV-1-infected cells with the oligo(nucleoside methylphosphonate) d(TpCCTCCTG) (deoxynucleoside methylphosphonate residues in italic), which is complementary to the acceptor splice junction of HSV-1 IE pre-mRNA 4 and 5, before (1-24hr) or at the time of infection caused a dose-dependent inhibition

Cynthia C. Smith; Laure Aurelian; M. Parameswara Reddy; Paul S. Miller; Paul O. P. Ts'o

1986-01-01

130

Expression of immediate early genes in the hippocampal formation of the black-capped chickadee ( Poecile atricapillus) during a food-hoarding task  

Microsoft Academic Search

Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal

Tom V. Smulders; Timothy J. Devoogd

2000-01-01

131

Differential effects of vocalization type, singer and listener on ZENK immediate early gene response in black-capped chickadees ( Poecile atricapillus)  

Microsoft Academic Search

Here we examined immediate early gene (ZENK) induction to vocalizations in the ascending auditory pathway of black-capped chickadees (Poecile atricapillus) to assess the impact that the sex of the producer and perceiver has on ZENK induction. We manipulated the playback by both the vocal type (song\\/call) and sex of producer (male\\/female), and then presented these stimuli classes to either male

M. T. Avey; R. A. Kanyo; E. L. Irwin; C. B. Sturdy

2008-01-01

132

Nucleotide Sequence and Molecular Analysis of the Rhesus Cytomegalovirus Immediate-Early Gene and the UL121–117 Open Reading Frames  

Microsoft Academic Search

Cytomegalovirus (CMV) has been isolated from many nonhuman primates, including rhesus macaques (Macaca mulatta). To better understand the molecular biology of rhesus CMV (RhCMV), a 9.2-kb DNA restriction fragment spanning the immediate-early (IE) gene has been molecularly cloned and sequenced. Open reading frames (ORF) have been identified and transcripts mapped for regions corresponding to exons 1, 2, 3, and 4

PETER A. BARRY; DONALD J. ALCENDOR; MICHAEL D. POWER; HEATHER KERR; PAUL A. LUCIW

1996-01-01

133

Dynamic Transcription of the Immediate-Early Gene Arc in Hippocampal Neuronal Networks: Insights into the Molecular and Cellular Bases of Memory Formation  

Microsoft Academic Search

The activity-regulated cytoskeletal-associated protein (Arc) is an immediate-early gene (IEG) that is dynamically regulated by neuronal activity. IEGs encode a diverse range of proteins\\u000a including regulatory transcription factors, structural and signal transduction proteins, growth factors, proteases, and enzymes\\u000a [reviewed in (Lanahan and Worley, 1998)]. Moreover, several IEGs have been shown to be required for long-lasting synaptic\\u000a plasticity and memory consolidation

John F. Guzowski; Ting Nie; Teiko Miyashita

134

The hallucinogen d-lysergic acid diethylamide ( d-LSD) induces the immediate-early gene c-Fos in rat forebrain  

Microsoft Academic Search

The hallucinogen d-lysergic acid diethylamide (d-LSD) evokes dramatic somatic and psychological effects. In order to analyze the neural activation induced by this unique psychoactive drug, we tested the hypothesis that expression of the immediate-early gene product c-Fos is induced in specific regions of the rat forebrain by a relatively low, behaviorally active, dose of d-LSD (0.16 mg\\/kg, i.p.); c-Fos protein

Paul S Frankel; Kathryn A Cunningham

2002-01-01

135

In vivo and in vitro analysis of transcriptional activation mediated by the human cytomegalovirus major immediate-early proteins.  

PubMed Central

To define mechanistically how the human cytomegalovirus (HCMV) major immediate-early (IE) proteins induce early-gene transcription, the IE1 72-kDa protein, the IE2 55-kDa protein, and the IE2 86-kDa protein were analyzed for their ability to activate transcription from an HCMV early promoter in vivo and in vitro. In transient-expression assays in U373MG astrocytoma/glioblastoma and HeLa cells, only the IE2 86-kDa protein was able to activate the HCMV early promoter to high levels. In HeLa cells, the IE1 72-kDa protein was able to activate the promoter to a low but detectable level, and the level of promoter activity observed in response to the IE2 86-kDa protein was increased synergistically following cotransfection of the constructs expressing both IE proteins. To examine the interaction of the HCMV IE proteins with the RNA polymerase II transcription machinery, we assayed the ability of Escherichia coli-synthesized proteins to activate the HCMV early promoter in nuclear extracts prepared from U373MG cells, HeLa cells, and Drosophila embryos. The results of the in vitro experiments correlated well with those obtained in vivo. The basal activity of the promoter was minimal in both the HeLa and U373MG extracts but was stimulated 6- to 10-fold by the IE2 86-kDa protein. With a histone H1-deficient extract from Drosophila embryos, the HCMV early promoter was quite active and was stimulated two- to fourfold by the IE2 86-kDa protein. Addition of histone H1 at 1 molecule per 40 to 50 bp of DNA template significantly repressed basal transcription from this promoter. However, the IE2 86-kDa protein, but none of the other IE proteins, was able to counteract the H1-mediated repression and stimulate transcription at least 10- to 20-fold. The promoter specificity of the activation was demonstrated by the inability of the IE2 86-kDa protein to activate the Drosophila Krüppel promoter in either the presence or absence of histone H1. These results suggest that one mechanism of transcription activation by the IE2 86-kDa protein involves antirepression. Images PMID:8423789

Klucher, K M; Sommer, M; Kadonaga, J T; Spector, D H

1993-01-01

136

Human Cytomegalovirus Tegument Proteins ppUL82 (pp71) and ppUL35 Interact and Cooperatively Activate the Major Immediate-Early Enhancer  

PubMed Central

The tegument protein ppUL82 (pp71) of human cytomegalovirus (HCMV) has previously been shown to activate the immediate-early transcription of HCMV and to enhance the infectivity of viral DNA. This is concordant with its localization adjacent to promyelocytic leukemia oncogenic domains (PODs) immediately after infection. In a yeast two-hybrid screen, we identified the tegument protein ppUL35 as an interacting partner of ppUL82. The interaction could be confirmed in transfected and infected cells. The domain responsible for interaction was narrowed down to amino acids 447 to 516 within ppUL35, thus allowing both forms of ppUL35 to interact with ppUL82. Immunofluorescence experiments showed a relocalization of ppUL35 from a diffuse nuclear pattern when expressed alone to PODs when expressed together with ppUL82. In accordance with this observation and the role of ppUL82 as a transactivator, we observed a cooperative activation of the HCMV major immediate-early enhancer but not of heterologous viral enhancer elements. These results suggest an important role for this interaction in the stimulation of viral immediate-early gene expression and viral infection. PMID:15308743

Schierling, Karina; Stamminger, Thomas; Mertens, Thomas; Winkler, Michael

2004-01-01

137

RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia of latently infected mice  

SciTech Connect

Transcription of the type 1 herpes simplex virus (HSV-1) genome in trigeminal ganglia of latently infected mice was studied using in situ hybridization. Probes representative of each temporal gene class were used to determine the regions of the genome that encode the transcripts present in latently infected cells. Probes encoding HSV-1 sequences of the five immediate early genes and representative early (thymidine kinase), early-late (major capsid protein), and late (glycoprotein C) genes were used in these experiments. Of the probes tested, only those encoding the immediate early gene product infected-cell polypeptide (ICP) 0 hybridized to RNA in latently infected tissues. Probes containing the other immediate early genes (ICP4, ICP22, ICP27, and ICP47) and the representative early, early-late, and late genes did not hybridize. Two probes covering approx. = 30% of the HSV-1 genome and encoding over 20 early and late transcripts also did not hybridize to RNA in latently infected tissues. These results, with probes spanning > 60% of the HSV-1 genome, suggest that transcription of the HSV-1 genome is restricted to one region in latently infected mouse trigeminal ganglia.

Deatly, A.M.; Spivack, J.G.; Lavi, E.; Fraser, N.W.

1987-05-01

138

The cellular transcription factor USF cooperates with varicella-zoster virus immediate-early protein 62 to symmetrically activate a bidirectional viral promoter.  

PubMed Central

The mechanisms governing the function of cellular USF and herpesvirus immediate-early transcription factors are subjects of considerable interest. In this regard, we identified a novel form of coordinate gene regulation involving a cooperative interplay between cellular USF and the varicella-zoster virus immediate-early protein 62 (IE 62). A single USF-binding site defines the potential level of IE 62-dependent activation of a bidirectional viral early promoter of the DNA polymerase and major DNA-binding protein genes. We also report a dominant negative USF-2 mutant lacking the DNA-binding domain that permits the delineation of the biological role of both USF-1 and USF-2 in this activation process. The symmetrical stimulation of the bidirectional viral promoter by IE 62 is achieved at concentrations of USF-1 (43 kDa) or USF-2 (44 kDa) already existing in cells. Our observations support the notion that cellular USF can intervene in and possibly target promoters for activation by a herpesvirus immediate-early protein. Images PMID:7935407

Meier, J L; Luo, X; Sawadogo, M; Straus, S E

1994-01-01

139

Use of the Meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes  

PubMed Central

The search for new natural products is leading to the isolation of novel actinomycete species, many of which will ultimately require genetic analysis. Some of these isolates will likely exhibit low intrinsic frequencies of homologous recombination and fail to sporulate under laboratory conditions, exacerbating the construction of targeted gene deletions and replacements in genetically uncharacterised strains. To facilitate the genetic manipulation of such species, we have developed an efficient method to generate gene or gene cluster deletions in actinomycetes by homologous recombination that does not introduce any other changes to the targeted organism's genome. We have synthesised a codon optimised I-SceI gene for expression in actinomycetes that results in the production of the yeast I-SceI homing endonuclease which produces double strand breaks at a unique introduced 18 base pair recognition sequence. Only those genomes that undergo homologous recombination survive, providing a powerful selection for recombinants, approximately half of which possess the desired mutant genotype. To demonstrate the efficacy and efficiency of the system, we deleted part of the gene cluster for the red-pigmented undecylprodiginine complex of compounds in Streptomyces coelicolor M1141. We believe that the system we have developed will be broadly applicable across a wide range of actinomycetes. PMID:25403842

Fernández-Martínez, Lorena T.; Bibb, Mervyn J.

2014-01-01

140

Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle  

SciTech Connect

The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

Bedu, E. [Center of Integrative Genomics, University of Lausanne, CH-1015 Lausanne (Switzerland); Desplanches, D. [Laboratoire de Physiologie integrative, Cellulaire et Moleculaire, UMR 5123 CNRS, Universite Claude Bernard Lyon 1, 69622 Villeurbanne (France); Pequignot, J. [Laboratoire de Physiologie integrative, Cellulaire et Moleculaire, UMR 5123 CNRS, Universite Claude Bernard Lyon 1, 69622 Villeurbanne (France); Bordier, B. [Center of Integrative Genomics, University of Lausanne, CH-1015 Lausanne (Switzerland); Desvergne, B. [Center of Integrative Genomics, University of Lausanne, CH-1015 Lausanne (Switzerland)]. E-mail: beatrice.desvergne@unil.ch

2007-06-15

141

Enhanced heterologous protein display on bacterial magnetic particles using a lon protease gene deletion mutant in Magnetospirillum magneticum AMB-1.  

PubMed

Bacterial magnetic particles (BacMPs) produced by the magnetotactic bacterium Magnetospirillum magneticum AMB-1, are used as magnetic supports or carriers for a variety of biomedical and environmental applications. Although protein expression systems on BacMPs have been established in previous studies, the expression efficiency was dependent on the introduced protein sequences. Recombinant human proteins are often poorly expressed on BacMPs because of proteolytic degradation by endogenous proteases. We constructed a lon protease gene deletion mutant strain (?lon) of M. magneticum AMB-1 by homologous recombination to increase the efficiency of functional protein display on BacMPs using ?lon host cells. Wild-type and ?lon-M. magneticum AMB-1 cells were transformed using expression plasmids for human proteins, thyroid-stimulating hormone receptor (TSHR) and the class II major histocompatibility complex (MHC II) molecules onto BacMPs. Although mRNA expression of both TSHR and MHC II was the same level in the wild-type and ?lon transformants, the protein expression levels in ?lon transformants were significantly increased versus wild-type cells. Furthermore, the amounts of two different human proteins on BacMPs were successfully improved. This phenomenon could be due to the reduction of the degradation of target proteins in the ?lon strain. This is the first report to construct a protease deletion mutant in magnetotactic bacteria. The ?lon strain is a useful host to provide BacMPs displaying target proteins for various experimental, and ultimately, clinical applications. PMID:23578586

Kanetsuki, Yuka; Tanaka, Tsuyoshi; Matsunaga, Tadashi; Yoshino, Tomoko

2013-07-01

142

A de novo complete BRCA1 gene deletion identified in a Spanish woman with early bilateral breast cancer  

PubMed Central

Background Germline mutations in either of the two tumor-suppressor genes, BRCA1 and BRCA2, account for a significant proportion of hereditary breast and ovarian cancer cases. Most of these mutations consist of deletions, insertions, nonsense mutations, and splice variants, however an increasing number of large genomic rearrangements have been identified in these genes. Methods We analysed BRCA1 and BRCA2 genes by direct sequencing and MLPA. We confirmed the results by an alternative MLPA kit and characterized the BRCA1 deletion by Array CGH. Results We describe the first case of a patient with no strong family history of the disease who developed early-onset bilateral breast cancer with a de novo complete BRCA1 gene deletion in the germinal line. The detected deletion started from the region surrounding the VAT1 locus to the beginning of NBR1 gene, including the RND2, ?BRCA1, BRCA1 and NBR2 complete genes. Conclusion This finding supports the large genomic rearrangement screening of BRCA genes in young breast cancer patients without family history, as well as in hereditary breast and ovarian cancer families previously tested negative for other variations. PMID:21989022

2011-01-01

143

Macrophage Inhibitory Cytokine-1 (MIC-1/GDF15) Gene Deletion Promotes Cancer Growth in TRAMP Prostate Cancer Prone Mice  

PubMed Central

The divergent TGF-? superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15), is overexpressed by most cancers, including prostate cancer (PCa). Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-). On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+). Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1) had metastases than TRAMPMIC+/+ mice (p<0.0001). We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread. PMID:25695521

Husaini, Yasmin; Lockwood, Glen P.; Nguyen, Trung V.; Tsai, Vicky Wang-Wei; Mohammad, Mohammad G.; Russell, Pamela J.; Brown, David A.; Breit, Samuel N.

2015-01-01

144

Genotype-phenotype correlation of contiguous gene deletions of SLC6A8, BCAP31 and ABCD1.  

PubMed

The BCAP31 gene is located between SLC6A8, associated with X-linked creatine transporter deficiency, and ABCD1, associated with X-linked adrenoleukodystrophy. Recently, loss-of-function mutations in BCAP31 were reported in association with severe developmental delay, deafness and dystonia. We characterized the break points in eight patients with deletions of SLC6A8, BCAP31 and/or ABCD1 and studied the genotype-phenotype correlations. The phenotype in patients with contiguous gene deletions involving BCAP31 overlaps with the phenotype of isolated BCAP31 deficiency. Only deletions involving both BCAP31 and ABCD1 were associated with hepatic cholestasis and death before 1?year, which might be explained by a synergistic effect. Remarkably, a patient with an isolated deletion at the 3'-end of SLC6A8 had a similar severe phenotype as seen in BCAP31 deficiency but without deafness. This might be caused by the disturbance of a regulatory element between SLC6A8 and BCAP31. PMID:24597975

van de Kamp, J M; Errami, A; Howidi, M; Anselm, I; Winter, S; Phalin-Roque, J; Osaka, H; van Dooren, S J M; Mancini, G M; Steinberg, S J; Salomons, G S

2015-02-01

145

EAAC1 Gene Deletion Increases Neuronal Death and Blood Brain Barrier Disruption after Transient Cerebral Ischemia in Female Mice  

PubMed Central

EAAC1 is important in modulating brain ischemic tolerance. Mice lacking EAAC1 exhibit increased susceptibility to neuronal oxidative stress in mice after transient cerebral ischemia. EAAC1 was first described as a glutamate transporter but later recognized to also function as a cysteine transporter in neurons. EAAC1-mediated transport of cysteine into neurons contributes to neuronal antioxidant function by providing cysteine substrates for glutathione synthesis. Here we evaluated the effects of EAAC1 gene deletion on hippocampal blood vessel disorganization after transient cerebral ischemia. EAAC1?/? female mice subjected to transient cerebral ischemia by common carotid artery occlusion for 30 min exhibited twice as much hippocampal neuronal death compared to wild-type female mice as well as increased reduction of neuronal glutathione, blood–brain barrier (BBB) disruption and vessel disorganization. Pre-treatment of N-acetyl cysteine, a membrane-permeant cysteine prodrug, increased basal glutathione levels in the EAAC1?/? female mice and reduced ischemic neuronal death, BBB disruption and vessel disorganization. These findings suggest that cysteine uptake by EAAC1 is important for neuronal antioxidant function under ischemic conditions. PMID:25350110

Choi, Bo Young; Kim, Jin Hee; Kim, Hyun Jung; Lee, Bo Eun; Kim, In Yeol; Sohn, Min; Suh, Sang Won

2014-01-01

146

A new variant of self-excising ?-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa.  

PubMed

In a previous study, we developed a cassette employing a bacterial ?-recombinase acting on six recognition sequences (?-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette. A tedious subsequent procedure was needed to purify homokaryons due to the lack of a negative selection after cassette eviction. Additionally, the endoxylanase xylP promoter from Penicillium chrysogenum used in the construct was not strongly regulated in N. crassa, which led to low efficiency in cassette eviction. Herein we report an improved variant of the self-excising ?-recombinase/six cassette for repetitive gene deletions in N. crassa using a native endoxylanase gh10-2 promoter from N. crassa, plus the introduction of a bidirectional selection marker to facilitate homokaryon selection using a thymidine kinase (tk) gene (negative selection) in addition to the phosphinothricin resistance gene (bar(r)) (positive selection). PMID:24556286

Szewczyk, Edyta; Kasuga, Takao; Fan, Zhiliang

2014-05-01

147

Identification of kakusei, a Nuclear Non-Coding RNA, as an Immediate Early Gene from the Honeybee, and Its Application for Neuroethological Study  

PubMed Central

The honeybee is a social insect that exhibits various social behaviors. To elucidate the neural basis of honeybee behavior, we detected neural activity in freely-moving honeybee workers using an immediate early gene (IEG) that is expressed in a neural activity-dependent manner. In European honeybees (Apis mellifera), we identified a novel nuclear non-coding RNA, termed kakusei, as the first insect IEG, and revealed the neural activity pattern in foragers. In addition, we isolated a homologue of kakusei, termed Acks, from the Japanese honeybee (Apis cerana), and detected active neurons in workers fighting with the giant hornet. PMID:23443077

Kiya, Taketoshi; Ugajin, Atsushi; Kunieda, Takekazu; Kubo, Takeo

2012-01-01

148

CCR2 Gene Deletion and Pharmacologic Blockade Ameliorate a Severe Murine Experimental Autoimmune Neuritis Model of Guillain-Barré Syndrome  

PubMed Central

The molecular determinants and signaling pathways responsible for hematogenous leukocyte trafficking during peripheral neuroinflammation are incompletely elucidated. Chemokine ligand/receptor pair CCL2/CCR2 has been pathogenically implicated in the acute inflammatory demyelinating polyradiculoneuropathy variant of Guillain-Barré syndrome (GBS). We evaluated the role of CCR2 in peripheral neuroinflammation utilizing a severe murine experimental autoimmune neuritis (sm-EAN) model. Sm-EAN was induced in 8–12 week old female SJL CCR2 knockout (CCR2KO), heterozygote (CCR2HT) and wild type (CCR2WT) mice, and daily neuromuscular severity scores and weights recorded. In vitro and in vivo splenocyte proliferation and cytokine expression assays, and sciatic nerve Toll-like receptor (TLR) 2, TLR4 and CCL2 expression assays were performed to evaluate systemic and local innate immune activation at disease onset. Motor nerve electrophysiology and sciatic nerve histology were also performed to characterize the inflammatory neuropathy at expected peak severity. To further determine the functional relevance of CCR2 in sm-EAN, 20 mg/kg CCR2 antagonist, RS 102895 was administered daily for 5 days to a cohort of CCR2WT mice following sm-EAN disease onset, with efficacy compared to 400 mg/kg human intravenous immunoglobulin (IVIg). CCR2KO mice were relatively resistant to sm-EAN compared to CCR2WT and CCR2HT mice, associated with attenuated peripheral nerve demyelinating neuritis. Partial CCR2 gene deletion did not confer any protection against sm-EAN. CCR2KO mice demonstrated similar splenocyte activation or proliferation profiles, as well as TLR2, TLR4 and CCL2 expression to CCR2WT or CCR2HT mice, implying a direct role for CCR2 in sm-EAN pathogenesis. CCR2 signaling blockade resulted in rapid, near complete recovery from sm-EAN following disease onset. RS 102895 was significantly more efficacious than IVIg. CCR2 mediates pathogenic hematogenous monocyte trafficking into peripheral nerves, with consequential demyelination in sm-EAN. CCR2 is amenable to pharmacologic blockade, making it a plausible drug target for GBS. PMID:24632828

Yuan, Furong; Yosef, Nejla; Lakshmana Reddy, Chetan; Huang, Ailing; Chiang, Sharon C.; Tithi, Hafiza Rahman; Ubogu, Eroboghene E.

2014-01-01

149

Na+ dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies  

PubMed Central

The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na+ dependent Cl?/HCO3? exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na+:HCO3? cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na+:HCO3? cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na+/H+ exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed. PMID:24155723

Christensen, Henriette L.; Nguyen, An T.; Pedersen, Fredrik D.; Damkier, Helle H.

2013-01-01

150

Induction of the plasticity-associated immediate early gene Arc by stress and hallucinogens: role of brain-derived neurotrophic factor.  

PubMed

Exposure to stress and hallucinogens in adulthood evokes persistent alterations in neurocircuitry and emotional behaviour. The structural and functional changes induced by stress and hallucinogen exposure are thought to involve transcriptional alterations in specific effector immediate early genes. The immediate early gene, activity regulated cytoskeletal-associated protein (Arc), is important for both activity and experience dependent plasticity. We sought to examine whether trophic factor signalling through brain-derived neurotrophic factor (BDNF) contributes to the neocortical regulation of Arc mRNA in response to distinct stimuli such as immobilization stress and the hallucinogen 2,5-dimethoxy-4-iodoamphetamine (DOI). Acute exposure to either immobilization stress or DOI induced Arc mRNA levels within the neocortex. BDNF infusion into the neocortex led to a robust up-regulation of local Arc transcript expression. Further, baseline Arc mRNA expression in the neocortex was significantly decreased in inducible BDNF knockout mice with an adult-onset, forebrain specific BDNF loss. The induction of Arc mRNA levels in response to both acute immobilization stress or a single administration of DOI was significantly attenuated in the inducible BDNF knockout mice. Taken together, our results implicate trophic factor signalling through BDNF in the regulation of cortical Arc mRNA expression, both under baseline conditions and following stress and hallucinogen exposure. These findings suggest the possibility that the regulation of Arc expression via BDNF provides a molecular substrate for the structural and synaptic plasticity observed following stimuli such as stress and hallucinogens. PMID:22404904

Benekareddy, Madhurima; Nair, Amrita R; Dias, Brian G; Suri, Deepika; Autry, Anita E; Monteggia, Lisa M; Vaidya, Vidita A

2013-03-01

151

Fibroblasts from long-lived mutant mice show diminished ERK1/2 phosphorylation but exaggerated induction of immediate early genes.  

PubMed

Skin-derived fibroblasts from long-lived mutant mice, including the Snell dwarf mice and mice defective in growth hormone receptor (GHRKO mice), are resistant to death induced by oxidative stress or by UV light, but the molecular mechanism for their stress resistance is unknown. This study shows that phosphorylation of the stress-activated protein kinases ERK1/2 induced by peroxide, cadmium, or paraquat is attenuated in cells from these mice. Induction of ERK phosphorylation by UV light was not altered in the Snell dwarf cells, and neither JNK nor p38 kinase showed increased phosphorylation in response to any of the stresses tested. Surprisingly, stress-induced elevation of mRNA for certain immediate early genes (Egr-1 and Fos) was higher in Snell-derived cells than in control cells, despite the evidence of lower ERK phosphorylation. Thus cells from Snell dwarf mice differ from controls in two ways: (a) lower induction of ERK1/2 phosphorylation and (b) increased expression of some ERK-dependent immediate early genes. These alterations in kinase pathways may contribute to the resistance of these cells to lethal injury. PMID:19786089

Sun, Liou Y; Steinbaugh, Michael J; Masternak, Michal M; Bartke, Andrzej; Miller, Richard A

2009-12-15

152

The promoter of the white spot syndrome virus immediate-early gene WSSV108 is activated by the cellular KLF transcription factor.  

PubMed

A series of deletion and mutation assays of the white spot syndrome virus (WSSV) immediate-early gene WSSV108 promoter showed that a Krüppel-like factor (KLF) binding site located from -504 to -495 (relative to the transcription start site) is important for the overall level of WSSV108 promoter activity. Electrophoretic mobility shift assays further showed that overexpressed recombinant Penaeus monodon KLF (rPmKLF) formed a specific protein-DNA complex with the (32)P-labeled KLF binding site of the WSSV108 promoter, and that higher levels of Litopenaeus vannamei KLF (LvKLF) were expressed in WSSV-infected shrimp. A transactivation assay indicated that the WSSV108 promoter was strongly activated by rPmKLF in a dose-dependent manner. Lastly, we found that specific silencing of LvKLF expression in vivo by dsRNA injection dramatically reduced both WSSV108 expression and WSSV replication. We conclude that shrimp KLF is important for WSSV genome replication and gene expression, and that it binds to the WSSV108 promoter to enhance the expression of this immediate-early gene. PMID:25445906

Liu, Wang-Jing; Lo, Chu-Fang; Kou, Guang-Hsiung; Leu, Jiann-Horng; Lai, Ying-Jang; Chang, Li-Kwan; Chang, Yun-Shiang

2015-03-01

153

Epstein-Barr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism.  

PubMed Central

Epstein-Barr virus (EBV), the causative agent of infectious mononucleosis, is a human herpesvirus associated with epithelial cell malignancies (nasopharyngeal carcinoma) as well as B-cell malignancies. Understanding how viral latency is disrupted is a central issue in herpesvirus biology. Epithelial cells are the major site of lytic EBV replication within the human host, and viral reactivation occurs in EBV-associated nasopharyngeal carcinomas. It is known that expression of a single viral immediate-early protein, BZLF1, is sufficient to initiate the switch from latent to lytic infection in B cells. Cellular regulation of BZLF1 transcription is therefore thought to play a key role in regulating the stringency of viral latency. Here we show that, unexpectedly, expression of another viral immediate-early protein, BRLF1, can disrupt viral latency in an epithelial cell-specific fashion. Therefore, the mechanisms leading to disruption of EBV latency appear to be cell-type specific. Images Fig. 2 Fig. 3 Fig. 4 PMID:8799177

Zalani, S; Holley-Guthrie, E; Kenney, S

1996-01-01

154

The extreme carboxyl terminus of the equine herpesvirus 1 homolog of herpes simplex virus VP16 is essential for immediate-early gene activation.  

PubMed Central

Gene 12 of equine herpesvirus 1 (EHV-1), the homolog of herpes simplex virus (HSV) VP16 (alpha TIF, Vmw65), was cloned into a eukaryotic expression vector by PCR and used in transactivation studies of both the EHV-1 and HSV-1 IE1 promoters. Results demonstrated that the product of gene 12 is a potent transactivator of immediate-early gene expression of both viruses, which requires sequences in the upstream HSV-1 promoter for activity. Mutational analysis of the gene 12 open reading frame indicated that removal of the C-terminal 7 amino acids, which contain a short region of homology with the extreme C terminus of VP16, inactivated the protein. Within this region, only a single methionine residue appeared to be essential for activity, implying that gene 12 may have a modular array of organization similar to that of VP16. However, fusion of the gene 12 C terminus to a truncated form of VP16, which contained the complex formation domain, did not restore activity to the HSV-1 protein. These data demonstrate that the EHV-1 immediate-early transactivator may not be functionally colinear with VP16, with transactivation requiring both the C terminus and another region(s) present within the N-terminal portion. Images PMID:8035487

Elliott, G D

1994-01-01

155

Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides  

PubMed Central

Background Rhodosporidium toruloides is a ?-carotenoid accumulating, oleaginous yeast that has great biotechnological potential. The lack of reliable and efficient genetic manipulation tools have been a major hurdle blocking its adoption as a biotechnology platform. Results We report for the first time the development of a highly efficient targeted gene deletion method in R. toruloides ATCC 10657 via Agrobacterium tumefaciens-mediated transformation. To further improve targeting frequency, the KU70 and KU80 homologs in R. toruloides were isolated and characterized in detail. A KU70-deficient mutant (?ku70e) generated with the hygromycin selection cassette removed by the Cre-loxP recombination system showed a dramatically improved targeted gene deletion frequency, with over 90% of the transformants being true knockouts when homology sequence length of at least 1 kb was used. Successful gene targeting could be made with homologous flanking sequences as short as 100 bp in the ?ku70e strain. KU70 deficiency did not perturb cell growth although an elevated sensitivity to DNA mutagenic agents was observed. Compared to the other well-known oleaginous yeast, Yarrowia lipolytica, R. toruloides KU70/KU80 genes contain much higher density of introns and are the most GC-rich KU70/KU80 genes reported. Conclusions The KU70-deficient mutant generated herein was effective in improving gene deletion frequency and allowed shorter homology sequences to be used for gene targeting. It retained the key oleaginous and fast growing features of R. toruloides. The strain should facilitate both fundamental and applied studies in this important yeast, with the approaches taken here likely to be applicable in other species in subphylum Pucciniomycotina. PMID:25188820

2014-01-01

156

Gene deletion reveals roles for annexin A1 in the regulation of lipolysis and IL-6 release in epididymal adipose tissue  

PubMed Central

In this study, epididymal adipose tissue from male annexin 1 (ANXA1)-null and wild-type control mice were used to explore the potential role of ANXA1 in adipocyte biology. ANXA1 was detected by Western blot analysis in wild-type tissue and localized predominantly to the stromal-vascular compartment. Epididymal fat pad mass was reduced by ANXA1 gene deletion, but adipocyte size was unchanged, suggesting that ANXA1 is required for the maintenance of adipocyte and/or preadipocyte cell number. Epididymal tissue from wild-type mice responded in vitro to noradrenaline and isoprenaline with increased glycerol release, reduced IL-6 release, and increased cAMP accumulation. Qualitatively similar but significantly attenuated responses to the catecholamines were observed in tissue from ANXA1-null mice, an effect that was not associated with changes in ?-adrenoceptor mRNA expression. Lipopolysaccharide (LPS) also stimulated lipolysis in vitro, but its effects were muted by ANXA1 gene deletion. By contrast, LPS failed to influence IL-6 release from wild-type tissue but stimulated the release of the cytokine from tissue from ANXA1-null mice. ANXA1 gene deletion did not affect glucocorticoid receptor expression or the ability of dexamethasone to suppress catecholamine-induced lipolysis. It did, however, augment IL-6 expression and modify the inhibitory effects of glucocorticoids on IL-6 release. Collectively, these studies suggest that ANXA1 supports aspects of adipose tissue mass and alters the sensitivity of epididymal adipose tissue to catecholamines, glucocorticoids, and LPS, thereby modulating lipolysis and IL-6 release. PMID:16835395

Warne, James P.; John, Christopher D.; Christian, Helen C.; Morris, John F.; Flower, Roderick J.; Sugden, David; Solito, Egle; Gillies, Glenda E.; Buckingham, Julia C.

2007-01-01

157

Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes  

SciTech Connect

An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein and a repressor of the UL127 promoter, while SATB1 has no effect on UL127 expression. Since CDP is known as a transcription repressor and a nuclear matrix-associated region binding protein, CDP may have a role in the regulation of human CMV transcription.

Lee Jialing [Expression Engineering Group, Bioprocessing Technology Institute, 20 Biopolis Way, 06-01 Centros, Singapore 138668 (Singapore); Klase, Zachary [Department of Biochemistry and Molecular Biology, George Washington University School of Medicine, Washington, DC 20037 (United States); Gao Xiaoqi; Caldwell, Jeremy S. [Genomics Institute of the Novartis Research Foundation, 10675 John Jay Hopkins Drive, San Diego, CA 92121 (United States); Stinski, Mark F. [Department of Microbiology, Carver College of Medicine, University of Iowa, Iowa City, IA 52242 (United States); Kashanchi, Fatah [Department of Biochemistry and Molecular Biology, George Washington University School of Medicine, Washington, DC 20037 (United States); Chao, S.-H. [Expression Engineering Group, Bioprocessing Technology Institute, 20 Biopolis Way, 06-01 Centros, Singapore 138668 (Singapore)], E-mail: jimmy_chao@bti.a-star.edu.sg

2007-09-15

158

The major immediate-early genes of human cytomegalovirus induce two novel proteins with molecular weights of 91 and 102 kilodaltons.  

PubMed

Mouse monoclonal antibody MAB810 is known to recognize the major immediate-early (IE) proteins, 68 kDa IE1 (IE1p68) and 80 kDa IE2 (IE2p80), of human cytomegalovirus (HCMV). Using this antibody we found that two additional proteins with higher molecular weights of approximately 91 (p91) and 102 kDa (p102) are also synthesized in HCMV-infected cells. p91 and p102 were produced in cells stably transfected with plasmid expressing IE1p68 and IE2p80, respectively, and shown to be related with IE1p68 and IE2p80, respectively, in primary amino acid sequence. Taken together, these results indicate that p91 and p102 are expressed from the IE1 and IE2 genes, respectively. PMID:10948998

Sadanari, H; Yamada, R; Yamagoshi, T; Ohnishi, K; Matsubara, K; Fukuda, S; Tanaka, J

2000-01-01

159

Variable rate of singing and variable song duration are associated with high immediate early gene expression in two anterior forebrain song nuclei  

PubMed Central

The duration of songs and the intervals between these songs are more variable when wild, adult, free-ranging chipping sparrows sing at dawn than when they sing during the day. The more variable delivery is used to interact with males, and the stereotyped delivery is used to attract females. In captive birds, however, the variability observed at dawn persists during the day. We quantified the expression of an immediate early gene, ZENK, in wild and captive birds and found that the level of song-associated ZENK expression in two song nuclei, Area X and lMAN, was positively related to variability in song duration and intersong interval and could be dissociated from the social context in which the song occurred. Thus, a combination of field and laboratory approaches helped us identify nuclei, context, and behavioral features associated with a change in gene expression thought to be a marker of behavioral variability. PMID:16030143

Liu, Wan-chun; Nottebohm, Fernando

2005-01-01

160

Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger  

SciTech Connect

ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and ?alg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

Dai, Ziyu; Aryal, Uma K.; Shukla, Anil K.; Qian, Weijun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

2013-09-25

161

Blockade of neurotensin receptors suppresses the dopamine D1/D2 synergism on immediate early gene expression in the rat brain.  

PubMed

A remarkable feature of dopamine functioning is that the concomitant activation of D1-like and D2-like receptors acts to intensify the expression of various dopamine-dependent effects, in particular the expression of the immediate-early genes, c-fos and zif268. Using non-peptide neurotensin receptor antagonists, including SR48692, we have determined that blockade of neurotensin receptors reduced the cooperative responses of direct acting D2-like (quinpirole) and partial D1-like (SKF38393) dopamine agonists on the expression of Fos-like antigens and zif268 mRNA. Pretreatment with SR48692 (3 and 10 mg/kg) reduced the number of Fos-like immunoreactive cells produced by the combined administration of SKF38393 (20 mg/kg) and quinpirole (1 mg/kg) in the caudate-putamen, nucleus accumbens, globus pallidus and ventral pallidum. High-affinity neurotensin receptors are likely to be involved in these D1-like/D2-like cooperative responses, as compounds structurally related to SR48692, SR48527 (3 mg/kg) and its (-)antipode, SR49711 (3 mg/kg), exerted a stereospecific antagonism in all selected brain regions. Pretreatment with SR48692 (10 mg/kg) also diminished Fos induction by the indirect dopamine agonist, cocaine (25 mg/kg), particularly at the rostral level of the caudate-putamen. In situ hybridization experiments in the caudate-putamen indicated that SR48692 (10 mg/kg) markedly reduced zif268 mRNA labelling produced by SKF38393 plus quinpirole in cells not expressing enkephalin mRNA, but was unable to affect the concomitant decrease of zif268 mRNA labelling in enkephalin-positive cells. Taken together, the results of the present study indicate that neurotensin is a key element for the occurrence of cooperative responses of D2-like and partial D1-like agonists on immediate-early gene expression. PMID:10103090

Alonso, R; Gnanadicom, H; Fréchin, N; Fournier, M; Le Fur, G; Soubrié, P

1999-03-01

162

Intranasal application of vasopressin fails to elicit changes in brain immediate early gene expression, neural activity and behavioral performance of rats  

PubMed Central

Intranasal administration has been widely used to investigate effects of the neuropeptides vasopressin and oxytocin on human behaviors and neurological disorders, but exactly what happens when these neuropeptides are administered intranasally is far from clear. In particular, it is not clear whether a physiological significant amount of peptide enters the brain to account for the observed effects. Here, we investigated whether intranasal administration of vasopressin and oxytocin to rats induces expression of the immediate-early gene product Fos in brain areas that are sensitive to centrally administered peptide, whether it alters neuronal activity in the way that centrally administered peptide does, and whether it affects behavior in ways expected from studies of centrally administered peptide. We found that, whereas intracerebroventricular (icv) injection of very low doses of vasopressin or oxytocin increased Fos expression in several distinct brain regions, intranasal administration of large doses of the peptides had no significant effect. In contrast to the effects of vasopressin applied topically to the main olfactory bulb, we saw no changes in the electrical activity of olfactory bulb mitral cells after intranasal vasopressin administration. In addition, vasopressin given intranasally had no significant effects on social recognition or short-term recognition memory. Finally, intranasal infusions of vasopressin had no significant effects on the parameters monitored on the elevated plus maze, a rodent model of anxiety. Our data in rats suggest that, after intranasal administration, significant amounts of vasopressin and oxytocin do not reach areas in the brain at levels sufficient to change immediate early gene expression, neural activity or behavior in the ways described for central administration of the peptides. PMID:23656518

Ludwig, Mike; Tobin, Vicky A.; Callahan, Michael F.; Papadaki, Eirini; Becker, Axel; Engelmann, Mario; Leng, Gareth

2013-01-01

163

Cyclin-Dependent Kinase Activity Is Required at Early Times for Accurate Processing and Accumulation of the Human Cytomegalovirus UL122-123 and UL37 Immediate-Early Transcripts and at Later Times for Virus Production  

PubMed Central

Human cytomegalovirus (HCMV) infection leads to dysregulation of multiple cell cycle-regulatory proteins. In this study, we examined the effects of inhibition of cyclin-dependent kinase (cdk) activity on viral replication. With the drug Roscovitine, a specific inhibitor of cyclin-dependent kinases 1, 2, 5, 7, and 9, we have shown that during the first 6 h of infection, cyclin-dependent kinase-dependent events occurred that included the regulated processing and accumulation of the immediate-early (IE) UL122-123 transcripts and UL36-37 transcripts. Altered processing of UL122-123 led to a loss of IE1-72 and an increase in IE2-86. The ratio of spliced to unspliced UL37 transcripts also changed. These effects did not require de novo protein synthesis or degradation of proteins by the proteasome. Addition of Roscovitine at the beginning of the infection was also associated with inhibition of expression of selected viral early gene products, viral DNA replication, and late viral gene expression. When Roscovitine was added after the first 6 h of infection, the effects on IE gene expression were no longer observed and viral replication proceeded through the late phase, but viral titers were reduced. The reduction in viral titer was observed even when Roscovitine was first added at 48 h postinfection, indicating that cyclin-dependent kinase activity is required at both IE and late times. Flavopiridol, another specific inhibitor of cyclin-dependent kinases, had similar effects on IE and early gene expression. These results underscore the importance of accurate RNA processing and reiterate the significant role of cell cycle-regulatory factors in HCMV infection. PMID:15452241

Sanchez, Veronica; McElroy, Anita K.; Yen, Judy; Tamrakar, Sama; Clark, Charles L.; Schwartz, Rachel A.; Spector, Deborah H.

2004-01-01

164

Chronic methamphetamine exposure suppresses the striatal expression of members of multiple families of immediate early genes (IEGs) in the rat: normalization by an acute methamphetamine injection  

Microsoft Academic Search

Rationale  Repeated injections of cocaine cause blunted responses to acute cocaine challenge-induced increases in the expression of immediate\\u000a early genes (IEGs).\\u000a \\u000a \\u000a \\u000a \\u000a Objectives  The aim of this study was to test if chronic methamphetamine (METH) exposure might cause similar blunting of acute METH-induced\\u000a increases in IEG expression.\\u000a \\u000a \\u000a \\u000a \\u000a Results  Repeated saline or METH injections were given to rats over 14 days. After 1 day of withdrawal, they

Michael T. McCoy; Subramaniam Jayanthi; Jacqueline A. Wulu; Genevieve Beauvais; Bruce Ladenheim; Tracey A. Martin; Irina N. Krasnova; Amber B. Hodges; Jean Lud Cadet

2011-01-01

165

CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication  

PubMed Central

ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression. PMID:24741094

Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

2014-01-01

166

Cooperativity among herpes simplex virus type 1 immediate-early regulatory proteins: ICP4 and ICP27 affect the intracellular localization of ICP0.  

PubMed Central

The results of transient expression assays and studies of viral mutants have shown that three of the five immediate-early proteins of herpes simplex virus type 1 (HSV-1) perform regulatory functions, individually and cooperatively. As part of efforts designed to explore the molecular basis for the functional cooperativity among ICP0, ICP4, and ICP27 in the regulation of HSV gene expression, we have examined the intracellular localization of ICP0 in cells infected with ICP4 and ICP27 null mutant viruses by indirect immunofluorescence. Although ICP0 was localized predominantly to the nuclei of wild-type virus-infected cells, it was found exclusively in the nuclei of ICP27 mutant-infected cells and in both the cytoplasm and nuclei of ICP4 mutant-infected cells, the cytoplasmic component being especially strong. These observations indicate that both ICP4 and ICP27 can affect the intracellular localization of ICP0. Transient expression assays with plasmids that express wild-type and mutant forms of ICP0, ICP4, and ICP27 confirmed that ICP4 promotes and that ICP27 inhibits the nuclear localization of ICP0. These results confirm the observations made for mutant virus-infected cells and indicate that the localization pattern seen in infected cells can be established by these three immediate-early proteins exclusive of other viral proteins. The C-terminal half of ICP27 was shown to be required to achieve its inhibitory effect on the nuclear localization of ICP0. The region of ICP0 responsive to ICP27 was mapped to the C terminus of the molecule between amino acid residues 720 and 769. In addition, the concentration of ICP27 was shown to have a significant effect on the intracellular localization of ICP0. Because the major regulatory activities of ICP0, ICP4, and ICP27 are expressed in the nucleus, the ability of these three proteins collectively to determine their own localization patterns within cells adds a new dimension to the complex process of viral gene regulation in HSV. Images PMID:8151771

Zhu, Z; Cai, W; Schaffer, P A

1994-01-01

167

Elimination of ie1 significantly attenuates murine cytomegalovirus virulence but does not alter replicative capacity in cell culture  

Microsoft Academic Search

The major immediate-early (MIE) genes of cytomegaloviruses (CMV) are broadly thought to be decisive regulators of lytic replication and reactivation from latency. To directly assess the role of the MIE protein IE1 during the infection of murine CMV (MCMV), we constructed an MCMV with exon 4 of the ie1 gene deleted. We found that, independent of the multiplicity of infection,

Peter Ghazal; Astrid E. Visser; Montse Gustems; R. Garcia; E. M. Borst; K. Sullivan; M. Messerle; A. Angulo

2005-01-01

168

Herpes simplex virus immediate-early proteins ICP0 and ICP4 activate the endogenous human alpha-globin gene in nonerythroid cells.  

PubMed

Globin genes are normally expressed only in erythroid cell lineages. However, we found that the endogenous alpha-globin gene is activated following infection of human fibroblasts and HeLa cells with herpes simplex virus (HSV), leading to accumulation of correctly initiated transcripts driven by the alpha-globin promoter. The alpha1- and alpha2-globin genes were both induced, but expression of beta- or zeta-globin genes could not be detected. Experiments using HSV mutants showed that null mutations in the genes encoding the viral immediate-early proteins ICP4 and ICP22 reduced induction approximately 10-fold, while loss of ICP0 function had a smaller inhibitory effect. Transient transfection experiments showed that ICP0 and ICP4 are each sufficient to trigger detectable expression of the endogenous gene, while ICP22 had no detectable effect in this assay. ICP4 also strongly enhanced expression of transfected copies of the alpha2-globin gene. In contrast, the adenovirus E1a protein did not activate the endogenous gene and inhibited expression of the plasmid-borne alpha2-globin gene. Previous studies have led to the hypothesis that chromosomal alpha-globin genes are subject to chromatin-dependent repression mechanism that prevents expression in nonerythroid cells. Our data suggest that HSV ICP0 and ICP4 either break or bypass this cellular gene silencing mechanism. PMID:9032307

Cheung, P; Panning, B; Smiley, J R

1997-03-01

169

Comparative analysis of CD8+ T cell responses against human cytomegalovirus proteins pp65 and immediate early 1 shows similarities in precursor frequency, oligoclonality, and phenotype.  

PubMed

CD8+ T cells are key effectors of the immune response against human cytomegalovirus (HCMV). A number of HCMV-derived CD8+ T cell epitopes are known. Using epitope prediction and subsequent testing for interferon-gamma responses by the ELISPOT assay, we identified an optimal human leukocyte antigen (HLA)-A*0201-restricted CD8+ T cell epitope derived from the major immediate early 1 (IE-1) gene product. As many as one-third of HLA-A*0201-positive, HCMV-seropositive donors make responses to this peptide (residues 316-324 [VLEETSVML]), which can exceed responses against a published immunodominant pp65 epitope (residues 495-503 [NLVPMVATV]). Major histocompatibility complex peptide tetramer staining facilitated detailed phenotypic analyses and revealed populations that resemble terminally differentiated effector cells (CD57+ and CD28-), with considerable restriction in T cell receptor beta-chain variable region use. The results confirm that, although pp65 is a major target for CD8+ T cells, the IE-1 protein may itself stimulate comparable responses in some persons. PMID:11930311

Khan, Naeem; Cobbold, Mark; Keenan, Russell; Moss, Paul A H

2002-04-15

170

Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)  

NASA Astrophysics Data System (ADS)

Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

Sayaka, Shimomura-Umemura; Ijiri, Kenichi

2006-01-01

171

Mitogen and Stress Activated Kinases Act Co-operatively with CREB during the Induction of Human Cytomegalovirus Immediate-Early Gene Expression from Latency  

PubMed Central

The devastating clinical consequences associated with human cytomegalovirus (HCMV) infection and reactivation underscores the importance of understanding triggers of HCMV reactivation in dendritic cells (DC). Here we show that ERK-mediated reactivation is dependent on the mitogen and stress activated kinase (MSK) family. Furthermore, this MSK mediated response is dependent on CREB binding to the viral major immediate early promoter (MIEP). Specifically, CREB binding to the MIEP provides the target for MSK recruitment. Importantly, MSK mediated phosphorylation of histone H3 is required to promote histone de-methylation and the subsequent exit of HCMV from latency. Taken together, these data suggest that CREB binding to the MIEP is necessary for the recruitment of the kinase activity of MSKs to initiate the chromatin remodelling at the MIEP required for reactivation. Thus the importance of CREB during HCMV reactivation is to promote chromatin modifications conducive for viral gene expression as well as acting as a classical transcription factor. Clearly, specific inhibition of this interaction between CREB and MSKs could provide a strategy for therapeutic intervention. PMID:24945302

Kew, Verity G.; Yuan, Jinxiang; Meier, Jeffery; Reeves, Matthew B.

2014-01-01

172

A Baculovirus Immediate-Early Gene, ie1, Promoter Drives Efficient Expression of a Transgene in Both Drosophila melanogaster and Bombyx mori  

PubMed Central

Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV) could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively); however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole) in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species. PMID:23152896

Masumoto, Mika; Ohde, Takahiro; Shiomi, Kunihiro; Yaginuma, Toshinobu; Niimi, Teruyuki

2012-01-01

173

Fibroblasts from Long-Lived Mutant Mice Show Diminished ERK1/2 Phosphorylation But Exaggerated Induction of Immediate Early Genes  

PubMed Central

Skin-derived fibroblasts from long-lived mutant mice, including the Snell dwarf mice and mice defective in growth hormone receptor (“GHRKO”), are resistant to death induced by oxidative stresses or by UV light, but the molecular mechanism for their stress resistance is unknown. The present study showed that phosphorylation of the stress-activated protein kinases ERK1/2 induced by peroxide, cadmium, or paraquat was attenuated in cells from these mice. Induction of ERK phosphorylation by UV light was not altered in the Snell dwarf cells, and neither JNK nor p38 kinases showed increased phosphorylation in response to any of the stresses tested. Surprisingly, stress-induced elevation of mRNA for certain Immediate Early Genes (egr-1 and fos) was higher in Snell-derived cells than in control cells, despite the evidence of lower ERK phosphorylation. Thus cells from Snell dwarf mice differ from controls in two ways: (a) lower induction of ERK1/2 phosphorylation, and (b) increased expression of some ERK-dependent IEGs. These alterations in kinase pathways may contribute to the resistance of these cells to lethal injury. PMID:19786089

Sun, Liou Y.; Steinbaugh, Michael J.; Masternak, Michal M.; Bartke, Andrzej; Miller, Richard A.

2009-01-01

174

Voxel-based analysis of the immediate early gene, c-jun, in the honey bee brain after a sucrose stimulus.  

PubMed

Immediate early genes (IEGs) have served as useful markers of brain neuronal activity in mammals, and more recently in insects. The mammalian canonical IEG, c-jun, is part of regulatory pathways conserved in insects and has been shown to be responsive to alarm pheromone in honey bees. We tested whether c-jun was responsive in honey bees to another behaviourally relevant stimulus, sucrose, in order to further identify the brain regions involved in sucrose processing. To identify responsive regions, we developed a new method of voxel-based analysis of c-jun mRNA expression. We found that c-jun is expressed in somata throughout the brain. It was rapidly induced in response to sucrose stimuli, and it responded in somata near the antennal and mechanosensory motor centre, mushroom body calices and lateral protocerebrum, which are known to be involved in sucrose processing. c-jun also responded to sucrose in somata near the lateral suboesophageal ganglion, dorsal optic lobe, ventral optic lobe and dorsal posterior protocerebrum, which had not been previously identified by other methods. These results demonstrate the utility of voxel-based analysis of mRNA expression in the insect brain. PMID:25773289

McNeill, M S; Robinson, G E

2015-06-01

175

Expression of immediate early genes in the hippocampal formation of the black-capped chickadee (Poecile atricapillus) during a food-hoarding task.  

PubMed

Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal HF of both storing and retrieving chickadees compared to controls. In retrieving birds, the number of Fos-like immunoreactive neurons relates to the number of items remembered, while the number of ZENK-like immunoreactive neurons in the HF may be related to the accuracy of cache retrieval. These results imply that the brain might process complex information by recruiting more neurons into the network of active neurons. Thus, our results could help explain why food-hoarding birds have more HF neurons than non-hoarders, and why this number increases in autumn when large numbers of food items are cached. PMID:10996045

Smulders, T V; DeVoogd, T J

2000-09-01

176

Differential effects of vocalization type, singer and listener on ZENK immediate early gene response in black-capped chickadees (Poecile atricapillus).  

PubMed

Here we examined immediate early gene (ZENK) induction to vocalizations in the ascending auditory pathway of black-capped chickadees (Poecile atricapillus) to assess the impact that the sex of the producer and perceiver has on ZENK induction. We manipulated the playback by both the vocal type (song/call) and sex of producer (male/female), and then presented these stimuli classes to either male or female black-capped chickadees. Neural response to the stimulus was quantified by the amount of protein of the IEG ZENK (also known as zif-268, egr-1, ngf-Ia and krox-24) in the caudal medial nidopallium (NCM) and caudomedial mesopallium (CMM). Overall, there was more ZENK induction in CMM and the dorsal parts of the caudal medial nidopallium (NCMd) than in the ventral parts of the caudal medial nidopallium (NCMv) and males had more ZENK induction than females. CMM had the most complex responding of ZENK induction to stimuli such that vocalization type, sex of producer, and sex of perceiver all affected ZENK induction. The silence controls had the least ZENK induction compared to any other group. PMID:18077008

Avey, M T; Kanyo, R A; Irwin, E L; Sturdy, C B

2008-03-17

177

Regulation of the immediate-early genes of white spot syndrome virus by Litopenaeus vannamei kruppel-like factor (LvKLF).  

PubMed

Kruppel-like factors (KLFs) belong to a subclass of Cys2/His2 zinc-finger DNA-binding proteins, and act as important regulators with diverse roles in cell growth, proliferation, differentiation, apoptosis and tumorigenesis. Our previous research showed that PmKLF from Penaeus monodon is crucial for white spot syndrome virus (WSSV) infection, yet the mechanisms by which PmKLF influences WSSV infection remain unclear. This study cloned KLF from Litopenaeus vannamei (LvKLF), which had 93% similarity with PmKLF. LvKLF formed a dimer via the C-terminal zinc-finger motif. Knockdown of LvKLF expression by dsRNA injection in WSSV-challenged shrimps was found to significantly inhibit the transcription of two important immediate-early (IE) genes, IE1 and WSSV304, and also reduced WSSV copy numbers. Moreover, reporter assays revealed that the promoter activities of these two WSSV IE genes were substantially enhanced by LvKLF. Mutations introduced in the promoter sequences of IE1 and WSSV304 were shown to abolish LvKLF activation of promoter activities; and an electrophoretic mobility shift assay demonstrated that LvKLF binds to putative KLF-response elements (KRE) in the promoters. Taken together, these results indicate that LvKLF transcriptional regulation of key IE genes is critical to WSSV replication. PMID:24881625

Huang, Ping-Han; Lu, Shao-Chia; Yang, Shu-Han; Cai, Pei-Si; Lo, Chu-Fang; Chang, Li-Kwan

2014-10-01

178

Immediate-early gene-encoded protein Arc is associated with synaptic delivery of GluR4-containing AMPA receptors during in vitro classical conditioning.  

PubMed

The immediate-early gene Arc is rapidly expressed in response to neuronal activity and is thought to be involved in mechanisms of synaptic plasticity. The function of Arc in these processes remains unknown. The present study demonstrates that during an in vitro neural correlate of eyeblink classical conditioning, there is a rapid and transient increase in levels of Arc protein that require activation of N-methyl-d-aspartate receptors. In the early phase of conditioning during conditioned response (CR) acquisition, there is significantly greater colocalization of Arc protein and GluR4-containing AMPA receptors at synaptic sites, however, colocalization of Arc and GluR4 was not observed after later stages of conditioning during CR expression. There was also significantly enhanced coimmunoprecipitation of Arc with GluR4 subunits and actin early in conditioning but not of Arc with NR1 subunits, and these associations declined to control levels in later stages of conditioning. These data suggest a role for Arc protein in the synaptic delivery of GluR4-containing AMPA receptors by interactions with cytoskeletal protein complexes during the acquisition phase of in vitro classical conditioning. PMID:16339507

Mokin, Maxim; Lindahl, Josette S; Keifer, Joyce

2006-01-01

179

Interference of the Simian Virus 40 Origin of Replication by the Cytomegalovirus Immediate Early Gene Enhancer: Evidence for Competition of Active Regulatory Chromatin Conformation in a Single Domain  

PubMed Central

Replication origins are often found closely associated with transcription regulatory elements in both prokaryotic and eukaryotic cells. To examine the relationship between these two elements, we studied the effect of a strong promoter-enhancer on simian virus 40 (SV40) DNA replication. The human cytomegalovirus (CMV) immediate early gene enhancer-promoter was found to exert a strong inhibitory effect on SV40 origin-based plasmid replication in Cos-1 cells in a position- and dose-dependent manner. Deletion analysis indicated that the effect was exerted by sequences located in the enhancer portion of the CMV sequence, thus excluding the mechanism of origin occlusion by transcription. Insertion of extra copies of the SV40 origin only partially alleviated the inhibition. Analysis of nuclease-sensitive cleavage sites of chromatin containing the transfected plasmids indicate that the chromatin was cleaved at one of the regulatory sites in the plasmids containing more than one regulatory site, suggesting that only one nuclease-hypersensitive site existed per chromatin. A positive correlation was found between the degree of inhibition of DNA replication and the decrease of P1 cleavage frequency at the SV40 origin. The CMV enhancer was also found to exhibit an inhibitory effect on the CMV enhancer-promoter driving chloramphenicol acetyltransferase expression in a dose-dependent manner. Together these results suggest that inhibition of SV40 origin-based DNA replication by the CMV enhancer is due to intramolecular competition for the formation of active chromatin structure. PMID:10805748

Chen, Peng-Hui; Tseng, Wen-Bin; Chu, Yi; Hsu, Ming-Ta

2000-01-01

180

FMRP phosphorylation reveals an immediate-early signaling pathway triggered by group I mGluR and mediated by PP2A.  

PubMed

Fragile X syndrome is a common form of inherited mental retardation and is caused by loss of fragile X mental retardation protein (FMRP), a selective RNA-binding protein that influences the translation of target messages. Here, we identify protein phosphatase 2A (PP2A) as an FMRP phosphatase and report rapid FMRP dephosphorylation after immediate group I metabotropic glutamate receptor (mGluR) stimulation (<1 min) in neurons caused by enhanced PP2A enzymatic activity. In contrast, extended mGluR activation (1-5 min) resulted in mammalian target of rapamycin (mTOR)-mediated PP2A suppression and FMRP rephosphorylation. These activity-dependent changes in FMRP phosphorylation were also observed in dendrites and showed a temporal correlation with the translational profile of select FMRP target transcripts. Collectively, these data reveal an immediate-early signaling pathway linking group I mGluR activity to rapid FMRP phosphorylation dynamics mediated by mTOR and PP2A. PMID:18160642

Narayanan, Usha; Nalavadi, Vijayalaxmi; Nakamoto, Mika; Pallas, David C; Ceman, Stephanie; Bassell, Gary J; Warren, Stephen T

2007-12-26

181

ATM regulates NF-?B-dependent immediate-early genes via RelA Ser 276 phosphorylation coupled to CDK9 promoter recruitment  

PubMed Central

Ataxia-telangiectasia mutated (ATM), a member of the phosphatidylinositol 3 kinase-like kinase family, is a master regulator of the double strand DNA break-repair pathway after genotoxic stress. Here, we found ATM serves as an essential regulator of TNF-induced NF-kB pathway. We observed that TNF exposure of cells rapidly induced DNA double strand breaks and activates ATM. TNF-induced ROS promote nuclear IKK? association with ubiquitin and its complex formation with ATM for nuclear export. Activated cytoplasmic ATM is involved in the selective recruitment of the E3-ubiquitin ligase ?-TrCP to phospho-I?B? proteosomal degradation. Importantly, ATM binds and activates the catalytic subunit of protein kinase A (PKAc), ribosmal S6 kinase that controls RelA Ser 276 phosphorylation. In ATM knockdown cells, TNF-induced RelA Ser 276 phosphorylation is significantly decreased. We further observed decreased binding and recruitment of the transcriptional elongation complex containing cyclin dependent kinase-9 (CDK9; a kinase necessary for triggering transcriptional elongation) to promoters of NF-?B-dependent immediate-early cytokine genes, in ATM knockdown cells. We conclude that ATM is a nuclear damage-response signal modulator of TNF-induced NF-?B activation that plays a key scaffolding role in I?B? degradation and RelA Ser 276 phosphorylation. Our study provides a mechanistic explanation of decreased innate immune response associated with A-T mutation. PMID:24957606

Fang, Ling; Choudhary, Sanjeev; Zhao, Yingxin; Edeh, Chukwudi B; Yang, Chunying; Boldogh, Istvan; Brasier, Allan R.

2014-01-01

182

Correlated basal expression of immediate early gene egr1 and tyrosine hydroxylase in zebrafish brain and downregulation in olfactory bulb after transitory olfactory deprivation.  

PubMed

Imprinting on kin occurs during the sixth day of larval development in zebrafish and depends on olfactory signals. In rodents, the immediate early gene egr1 is involved in maintaining the dopaminergic phenotype of periglomerular olfactory bulb cells in an activity dependent way. Furthermore, egr1 is upregulated in medial amygdalar dopamine cells in some rodents (prairie voles) dependent on social pheromone interactions. Thus, we aimed to investigate whether egr1 is involved in imprinting processes and later kin recognition in zebrafish in olfactory centers, such as the olfactory bulb and suspected medial amygdala. In the present paper, we focus on a basic investigation of basal egr1 expression throughout zebrafish brain development and its co-localization with tyrosine hydroxylase as a marker for dopaminergic neurons. Indeed, there is unambiguous co-localization of egr1 and tyrosine hydroxylase in the zebrafish olfactory bulb and hypothetical medial amygdala. Furthermore, as in rodents, ipsilateral transient olfactory deprivation through Triton X-100 treatment of the olfactory epithelium leads to downregulation of egr1 and tyrosine hydroxylase expression in the olfactory bulb, but apparently not in secondary olfactory targets of the zebrafish brain. This indicates that similar processes might be at work in zebrafish and rodent olfactory systems, but their more specific involvement in imprinting in zebrafish has to be further tested. PMID:23022747

Kress, Sigrid; Wullimann, Mario F

2012-12-01

183

ES2, a gene deleted in DiGeorge syndrome, encodes a nuclear protein and is expressed during early mouse development, where it shares an expression domain with a Goosecoid-like gene  

Microsoft Academic Search

ES2 is a gene deleted in DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) which has homologs in species as distant as Caenorhabditis elegans and Drosophila. The function of ES2 is unknown, and the predicted protein sequence does not contain motifs which suggest a particular role in the developmental defects present in DGS and VCFS. Here we show that the mouse

Elizabeth A. Lindsay; Emma L. Harvey; Peter J. Scambler; Antonio Baldini

1998-01-01

184

Independent effects of song quality and experience with photostimulation on expression of the immediate, early gene ZENK (EGR-1) in the auditory telencephalon of female European starlings  

PubMed Central

Age influences behavioral decisions such as reproductive timing and effort. In photoperiodic species, such age effects may be mediated, in part, by the individual's age-accrued experience with photostimulation. In female European starlings (Sturnus vulgaris) that do not differ in age, experimental manipulation of photostimulation experience (photoexperience) affects hypothalamic, pituitary, and gonadal activity associated with reproductive development. Does photoexperience also affect activity in forebrain regions involved in processing a social cue, the song of males, which can influence mate choice and reproductive timing in females? Female starlings prefer long songs over short songs in a mate-choice context, and, like that in other songbird species, their auditory telencephalon plays a major role in processing these signals. We manipulated the photoexperience of female starlings, photostimulated them, briefly exposed them to either long or short songs, and quantified the expression of the immediate-early gene ZENK (EGR-1) in the caudomedial nidopallium as a measure of activity in the auditory telencephalon. Using an information theoretic approach, we found higher ZENK immunoreactivity in females with prior photostimulation experience than in females experiencing photostimulation for the first time. We also found that long songs elicited greater ZENK immunoreactivity than short song did. We did not find an effect of the interaction between photoexperience and song length, suggesting that photoexperience does not affect forebrain ZENK-responsiveness to song quality. Thus, photoexperience affects activity in an area of the forebrain that processes social signals, an effect that we hypothesize mediates, in part, the effects of age on reproductive decisions in photoperiodic songbirds. PMID:19224564

Sockman, Keith W.; Ball, Gregory F.

2010-01-01

185

Differential Role of Sp100 Isoforms in Interferon-Mediated Repression of Herpes Simplex Virus Type 1 Immediate-Early Protein Expression  

PubMed Central

Nuclear domains called ND10 or PML nuclear bodies contain interferon (IFN)-upregulated proteins like PML and Sp100. Paradoxically, herpes simplex virus 1 (HSV-1) begins its transcriptional cascade at aggregates of ND10-associated proteins, which in turn are destroyed by the HSV-1 immediate-early protein ICP0. While PML is essential in the formation of ND10, the function of Sp100 in the cells' defense against viral infection is unknown. In this study we investigated the potential antiviral effect of IFN-?-induced Sp100. We found that IFN-? treatment leads to a differential accumulation of four Sp100 isoforms in different cell lines. Using an HEK293 cell line derivative, 293-S, producing no detectable amounts of Sp100 even after IFN exposure, we analyzed individual Sp100 isoforms for their effect on HSV-1 infection. Sp100 isoforms B, C, and HMG, but not Sp100A, suppressed ICP0 and ICP4 early after infection. Isoforms B, C, and HMG suppressed expression from the ICP0 promoter in transient transfection, whereas Sp100A enhanced expression. Moreover, Sp100A localized in ND10, whereas the repressive isoforms were either dispersed within the nucleus or, at unphysiologically higher expression levels, formed new aggregates. The repressive activity was dependent on an intact SAND domain, since Sp100B bearing a W655Q mutation in the SAND domain lost this repressive activity and accumulated in ND10. Using RNA interference to knock down the repressive Sp100 isoforms B, C, and HMG, we find that they are an essential part of the IFN-?-mediated suppression of ICP0 expression. These data suggest that repression by the Sp100 isoforms B, C, and HMG takes place outside of ND10 and raise the possibility that viral genomes at Sp100A accumulations are more likely to start their transcription program because of a more permissive local environment. PMID:16873258

Negorev, Dmitri G.; Vladimirova, Olga V.; Ivanov, Alexey; Rauscher, Frank; Maul, Gerd G.

2006-01-01

186

Expansion of human cytomegalovirus (HCMV) immediate-early 1-specific CD8+ T cells and control of HCMV replication after allogeneic stem cell transplantation.  

PubMed

Recovery of human cytomegalovirus (HCMV)-specific T immunity is critical for protection against HCMV disease in the early phase after allogeneic stem cell transplantation (SCT). Using an enzyme-linked immunospot assay with overlapping 15-mer peptides spanning pp65 and immediate-early 1 HCMV proteins, we investigated which HCMV-specific CD8(+) gamma interferon-positive (IFN-gamma(+)) T-cell responses against pp65 and IE-1 were associated with control of HCMV replication in 48 recipients of unmanipulated HLA-matched allografts at 3 months (M3) and 6 months (M6) after SCT and in 23 donors. At M3 after SCT, the magnitude of the pp65-specific IFN-gamma-producing CD8(+) T-cell response was greater in recipients than in donors, regardless of HCMV status. In contrast, expansion of IE-1-specific CD8(+) T cells at M3 was associated with protection against HCMV, and no patient with this expansion had HCMV replication at M3. At M6, the number of HCMV-specific CD8(+) T cells against both pp65 and IE-1 had expanded in all recipients, regardless of their previous levels of HCMV replication. The recipients' HCMV-specific CD8(+) T cells already detectable in related donors were predominantly targeting pp65. In contrast, in 40% of the cases, the HCMV-specific CD8(+) T cells in recipients involved new CD8(+) T-cell specificities undetectable in their related donors and preferentially targeting IE-1. Taken together, these results showed that the delay in reconstituting IE-1-specific CD8(+) T cells is correlated with the lack of protection against HCMV in the first 3 months after SCT. They also show that IE-1 is a major antigenic determinant of the early restoration of protective immunity to HCMV after SCT. PMID:18684826

Sacre, Karim; Nguyen, Stéphanie; Deback, Claire; Carcelain, Guislaine; Vernant, Jean-Paul; Leblond, Véronique; Autran, Brigitte; Dhedin, Nathalie

2008-10-01

187

Murine Cytomegalovirus Immediate-Early 1 Gene Expression Correlates with Increased GVHD after Allogeneic Hematopoietic Cell Transplantation in Recipients Reactivating from Latent Infection  

PubMed Central

The success of allogeneic (allo) hematopoietic cell transplantation (HCT) is limited by its treatment related complications, mostly graft versus host disease (GVHD) and fungal and viral infections. CMV reactivation after HCT has been associated with increased morbidity and mortality, and a causal relation between GVHD, immunosuppressive therapy and vice versa has been postulated. Using a low GVHD severity murine HCT model, we assessed the role of MCMV reactivation and GVHD development. BALB/c mice were infected with either murine CMV (MCMV) or mock and monitored for 25 weeks to establish latency, followed by sublethal irradiation conditioning and infusion of bone marrow plus splenocytes from either syngeneic (syn) BALB/c or allo B10.D2 donors. Engraftment of allo donor cells was confirmed by PCR for D2Mit265 gene product size. Day+100 mortality and overall GVHD severity in allo MCMV pre-infected recipients was higher than in allo mock controls. Pathologic changes of lung and liver GVHD in immediate-early gene 1 (IE1) positive recipients were significantly increased compared to mock controls, and were only slightly increased in IE1 negative. No significant gut injury was seen in any group. Aggravated lung injury in IE1 positive recipients correlated with higher BAL cell counts both for total cells and for CD4+ T cells when compared with mock controls, and also with protein expression of lung IFN-gamma and liver TNF. No evidence for CMV specific morphologic changes was seen on histopathology in any organ of IE1 positive recipients, suggesting that CMV reactivation is related to increased GVHD severity but does not require active CMV disease, strengthening the concept of a reciprocal relationship between CMV and GVHD. PMID:23596528

Palaniyandi, Senthilnathan; Radhakrishnan, Sabarinath Venniyil; Karlsson, Fridrik J.; Stokes, Karen Y.; Kittan, Nicolai; Huber, Elisabeth; Hildebrandt, Gerhard C.

2013-01-01

188

Target structures of the CD8(+)-T-cell response to human cytomegalovirus: the 72-kilodalton major immediate-early protein revisited.  

PubMed

Cell-mediated immunity plays an essential role in the control of infection with the human cytomegalovirus (HCMV). However, only a few CD8(+)-T-cell epitopes are known, with the majority being contained in the pp65 phosphoprotein, which is believed to dominate the CD8(+)-T-cell response to HCMV. Here, we have readdressed the issue of CD8(+) T cells specific for the 72-kDa major immediate-early protein (IE-1), which is nonstructural but is found very early and throughout the replicative cycle. Using a novel flow-cytometric assay, we were able to identify CD8(+)-T-cell epitopes (by IE-1 peptide-specific induction of cytokine synthesis) and simultaneously measure the frequency of cells directed against them. For this purpose, 81 pentadecamer peptides covering the complete 491-amino-acid sequence of IE-1 were tested on peripheral blood mononuclear cells of anti-HCMV immunoglobulin G-seropositive donors. At least 10 new epitopes were identified, and the fine specificity and presenting HLA molecule of the first of them was determined. The frequencies of CD8(+) T cells directed against IE-1 were similar to those directed against pp65 in donors tested with known pp65-derived peptides. Importantly, additional testing of a corresponding set of peptides covering the complete sequence of pp65 on 10 of these donors identified individuals whose CD8(+) T cells recognized IE-1 but not pp65 and vice versa, clearly illustrating that either protein may be a major target. In summary, our results suggest that IE-1 is far more important as a CD8(+)-T-cell target than current opinion suggests. PMID:10482568

Kern, F; Surel, I P; Faulhaber, N; Frömmel, C; Schneider-Mergener, J; Schönemann, C; Reinke, P; Volk, H D

1999-10-01

189

Human cytomegalovirus proteins pp65 and immediate early protein 1 are common targets for CD8+ T cell responses in children with congenital or postnatal human cytomegalovirus infection.  

PubMed

Recombinant modified vaccinia Ankara- and peptide-based IFN-gamma ELISPOT assays were used to detect and measure human CMV (HCMV)-specific CD8(+) T cell responses to the pp65 (UL83) and immediate early protein 1 (IE1; UL123) gene products in 16 HCMV-infected infants and children. Age at study ranged from birth to 2 years. HCMV-specific CD8(+) T cells were detected in 14 (88%) of 16 children at frequencies ranging from 60 to >2000 spots/million PBMC. Responses were detected as early as 1 day of age in infants with documented congenital infection. Nine children responded to both pp65 and IE1, whereas responses to pp65 or IE1 alone were detected in three and two children, respectively. Regardless of the specificity of initial responses, IE1-specific responses predominated by 1 year of age. Changes in HCMV epitopes targeted by the CD8(+) T cell responses were observed over time; epitopes commonly recognized by HLA-A2(+) adults with latent HCMV infection did not fully account for responses detected in early childhood. Finally, the detection of HCMV-specific CD8(+) T cell responses was temporally associated with a decrease in peripheral blood HCMV load. Taken altogether, these data demonstrate that the fetus and young infant can generate virus-specific CD8(+) T cell responses. Changes observed in the protein and epitope-specificity of HCMV-specific CD8(+) T cells over time are consistent with those observed after other primary viral infections. The temporal association between the detection of HCMV-specific CD8(+) T cell responses and the reduction in blood HCMV load supports the importance of CD8(+) T cells in controlling primary HCMV viremia. PMID:14764694

Gibson, Laura; Piccinini, Giampiero; Lilleri, Daniele; Revello, Maria Grazia; Wang, Zhongde; Markel, Susan; Diamond, Don J; Luzuriaga, Katherine

2004-02-15

190

Human cytomegalovirus pp71 stimulates major histocompatibility complex class i presentation of IE1-derived peptides at immediate early times of infection.  

PubMed

Suppression of major histocompatibility complex (MHC) class I-mediated presentation of human cytomegalovirus (HCMV) peptides is an important mechanism to avoid CD8 T lymphocyte recognition and killing of infected cells. Of particular interest is how MHC class I presentation of essential regulatory immediate early (IE) proteins of HCMV can be effectively compromised at times when known viral immunoevasins are not abundantly expressed. The tegument protein pp71 had been suggested to be involved in MHC class I downregulation. Intriguingly, this polypeptide is also critically engaged in the initial derepression of the major IE gene locus, leading to enhanced expression of IE proteins IE1-pp72 and IE2-pp86. Using a set of viral mutants, we addressed the role of pp71 in MHC class I presentation of IE1-pp72-derived peptides. We show that the amount of "incoming" pp71 positively correlates with IE1-pp72 protein levels and with the presentation of IE1-derived peptides. This indicates that the amount of the IE1 protein, induced by pp71, rather than a putative immunoevasive function of the tegument protein, determines MHC class I antigen presentation of IE1-derived peptides. This process proved to be independent of the presence of pp65, which had been reported to interfere with IE1 presentation. It may thus be beneficial for the success of HCMV replication to limit the level of pp71 delivered from infecting particles in order to avoid critical levels of MHC class I presentation of IE protein-derived peptides. PMID:23449799

Hesse, Julia; Reyda, Sabine; Tenzer, Stefan; Besold, Katrin; Reuter, Nina; Krauter, Steffi; Büscher, Nicole; Stamminger, Thomas; Plachter, Bodo

2013-05-01

191

Human Cytomegalovirus pp71 Stimulates Major Histocompatibility Complex Class I Presentation of IE1-Derived Peptides at Immediate Early Times of Infection  

PubMed Central

Suppression of major histocompatibility complex (MHC) class I-mediated presentation of human cytomegalovirus (HCMV) peptides is an important mechanism to avoid CD8 T lymphocyte recognition and killing of infected cells. Of particular interest is how MHC class I presentation of essential regulatory immediate early (IE) proteins of HCMV can be effectively compromised at times when known viral immunoevasins are not abundantly expressed. The tegument protein pp71 had been suggested to be involved in MHC class I downregulation. Intriguingly, this polypeptide is also critically engaged in the initial derepression of the major IE gene locus, leading to enhanced expression of IE proteins IE1-pp72 and IE2-pp86. Using a set of viral mutants, we addressed the role of pp71 in MHC class I presentation of IE1-pp72-derived peptides. We show that the amount of “incoming” pp71 positively correlates with IE1-pp72 protein levels and with the presentation of IE1-derived peptides. This indicates that the amount of the IE1 protein, induced by pp71, rather than a putative immunoevasive function of the tegument protein, determines MHC class I antigen presentation of IE1-derived peptides. This process proved to be independent of the presence of pp65, which had been reported to interfere with IE1 presentation. It may thus be beneficial for the success of HCMV replication to limit the level of pp71 delivered from infecting particles in order to avoid critical levels of MHC class I presentation of IE protein-derived peptides. PMID:23449799

Hesse, Julia; Reyda, Sabine; Tenzer, Stefan; Besold, Katrin; Reuter, Nina; Krauter, Steffi; Büscher, Nicole; Stamminger, Thomas

2013-01-01

192

Herpes Simplex Virus Type 1 Induces CD83 Degradation in Mature Dendritic Cells with Immediate-Early Kinetics via the Cellular Proteasome? †  

PubMed Central

Mature dendritic cells (DCs) are the most potent antigen-presenting cells within the human immune system. However, Herpes simplex virus type 1 (HSV-1) is able to interfere with DC biology and to establish latency in infected individuals. In this study, we provide new insights into the mechanism by which HSV-1 disarms DCs by the manipulation of CD83, a functionally important molecule for DC activation. Fluorescence-activated cell sorter (FACS) analyses revealed a rapid downmodulation of CD83 surface expression within 6 to 8 h after HSV-1 infection, in a manner strictly dependent on viral gene expression. Soluble CD83 enzyme-linked immunosorbent assays, together with Western blot analysis, demonstrated that CD83 rapidly disappears from the cell surface after contact with HSV-1 by a mechanism that involves protein degradation rather than shedding of CD83 from the cell surface into the medium. Infection experiments with an ICP0 deletion mutant demonstrated an important role for this viral immediate-early protein during CD83 degradation, since this particular mutant strain leads to strongly reduced CD83 degradation. This hypothesis was further strengthened by cotransfection of plasmids expressing CD83 and ICP0 into 293T cells, which led to significantly reduced accumulation of CD83. In strong contrast, transfection of plasmids expressing CD83 and a mutant ICP0 defective in its RING finger-mediated E3 ubiquitin ligase function did not reduce CD83 expression. Inhibition of the proteasome, the cellular protein degradation machinery, almost completely restored CD83 surface expression during HSV-1 infection, indicating that proteasome-mediated degradation and HSV-1 ICP0 play crucial roles in this novel viral immune escape mechanism. PMID:17428858

Kummer, Mirko; Turza, Nadine M.; Muhl-Zurbes, Petra; Lechmann, Matthias; Boutell, Chris; Coffin, Robert S.; Everett, Roger D.; Steinkasserer, Alexander; Prechtel, Alexander T.

2007-01-01

193

Prenatal exposure to moderate levels of ethanol alters social behavior in adult rats: Relationship to structural plasticity and immediate early gene expression in frontal cortex  

PubMed Central

The goals of the present study were to characterize the effects of prenatal exposure to moderate levels of ethanol on adult social behavior, and to evaluate fetal-ethanol-related effects on dendritic morphology, structural plasticity and activity-related immediate early gene (IEG) expression in the agranular insular (AID) and prelimbic (Cg3) regions of frontal cortex. Baseline fetal-ethanol-related alterations in social behavior were limited to reductions in social investigation in males. Repeated experience with novel cage-mates resulted in comparable increases in wrestling and social investigation among saccharin- and ethanol-exposed females, whereas social behavioral effects among males were more evident in ethanol-exposed animals. Male ethanol-exposed rats also displayed profound increases in wrestling when social interaction was motivated by 24 hours of isolation. Baseline decreases in dendritic length and spine density in AID were observed in ethanol-exposed rats that were always housed with the same cage-mate. Modest experience-related decreases in dendritic length and spine density in AID were observed in saccharin-exposed rats housed with various cage-mates. In contrast, fetal-ethanol-exposed rats displayed experience-related increases in dendritic length in AID, and no experience-related changes in spine density. The only effect observed in Cg3 was a baseline increase in basilar dendritic length among male ethanol-exposed rats. Robust increases in activity-related IEG expression in AID (c-fos and Arc) and Cg3 (c-fos) were observed following social interaction in saccharin-exposed rats, however, activity-related increases in IEG expression were not observed in fetal-ethanol-exposed rats in either region. The results indicate that deficits in social behavior are among the long-lasting behavioral consequences of moderate ethanol exposure during brain development, and implicate AID, and to a lesser degree Cg3, in fetal-ethanol-related social behavior abnormalities. PMID:19852984

Hamilton, Derek A.; Akers, Katherine G.; Rice, James P.; Johnson, Travis E.; Candelaria-Cook, Felicha T.; Maes, Levi I.; Rosenberg, Martina; Valenzuela, C. Fernando; Savage, Daniel D.

2009-01-01

194

Analysis of Human Cytomegalovirus-Encoded SUMO Targets and Temporal Regulation of SUMOylation of the Immediate-Early Proteins IE1 and IE2 during Infection  

PubMed Central

Post-translational modification of proteins by members of the small ubiquitin-like modifier (SUMO) is involved in diverse cellular functions. Many viral proteins are SUMO targets and also interact with the cellular SUMOylation system. During human cytomegalovirus (HCMV) infection, the immediate-early (IE) proteins IE1 and IE2 are covalently modified by SUMO. IE2 SUMOylation promotes its transactivation activity, whereas the role of IE1 SUMOylation is not clear. We performed in silico, genome-wide analysis to identify possible SUMOylation sites in HCMV-encoded proteins and evaluated their modification using the E. coli SUMOylation system and in vitro assays. We found that only IE1 and IE2 are substantially modified by SUMO in E. coli, although US34A was also identified as a possible SUMO target in vitro. We also found that SUMOylation of IE1 and IE2 is temporally regulated during viral infection. Levels of SUMO-modified form of IE1 were increased during the early phase of infection, but decreased in the late phase when IE2 and its SUMO-modified forms were expressed at high levels. IE2 expression inhibited IE1 SUMOylation in cotransfection assays. As in IE2 SUMOylation, PIAS1, a SUMO E3 ligase, interacted with IE1 and enhanced IE1 SUMOylation. In in vitro assays, an IE2 fragment that lacked covalent and non-covalent SUMO attachment sites, but was sufficient for PIAS1 binding, effectively inhibited PIAS1-mediated SUMOylation of IE1, indicating that IE2 expression negatively regulates IE1 SUMOylation. We also found that the IE2-mediated downregulation of IE1 SUMOylation correlates with the IE1 activity to repress the promoter containing the interferon stimulated response elements. Taken together, our data demonstrate that IE1 and IE2 are the main viral SUMO targets in HCMV infection and that temporal regulation of their SUMOylation may be important in the progression of this infection. PMID:25050850

Kim, Eui Tae; Kim, Young-Eui; Kim, Ye Ji; Lee, Myoung Kyu; Hayward, Gary S.; Ahn, Jin-Hyun

2014-01-01

195

Analysis of human cytomegalovirus-encoded SUMO targets and temporal regulation of SUMOylation of the immediate-early proteins IE1 and IE2 during infection.  

PubMed

Post-translational modification of proteins by members of the small ubiquitin-like modifier (SUMO) is involved in diverse cellular functions. Many viral proteins are SUMO targets and also interact with the cellular SUMOylation system. During human cytomegalovirus (HCMV) infection, the immediate-early (IE) proteins IE1 and IE2 are covalently modified by SUMO. IE2 SUMOylation promotes its transactivation activity, whereas the role of IE1 SUMOylation is not clear. We performed in silico, genome-wide analysis to identify possible SUMOylation sites in HCMV-encoded proteins and evaluated their modification using the E. coli SUMOylation system and in vitro assays. We found that only IE1 and IE2 are substantially modified by SUMO in E. coli, although US34A was also identified as a possible SUMO target in vitro. We also found that SUMOylation of IE1 and IE2 is temporally regulated during viral infection. Levels of SUMO-modified form of IE1 were increased during the early phase of infection, but decreased in the late phase when IE2 and its SUMO-modified forms were expressed at high levels. IE2 expression inhibited IE1 SUMOylation in cotransfection assays. As in IE2 SUMOylation, PIAS1, a SUMO E3 ligase, interacted with IE1 and enhanced IE1 SUMOylation. In in vitro assays, an IE2 fragment that lacked covalent and non-covalent SUMO attachment sites, but was sufficient for PIAS1 binding, effectively inhibited PIAS1-mediated SUMOylation of IE1, indicating that IE2 expression negatively regulates IE1 SUMOylation. We also found that the IE2-mediated downregulation of IE1 SUMOylation correlates with the IE1 activity to repress the promoter containing the interferon stimulated response elements. Taken together, our data demonstrate that IE1 and IE2 are the main viral SUMO targets in HCMV infection and that temporal regulation of their SUMOylation may be important in the progression of this infection. PMID:25050850

Kim, Eui Tae; Kim, Young-Eui; Kim, Ye Ji; Lee, Myoung Kyu; Hayward, Gary S; Ahn, Jin-Hyun

2014-01-01

196

Insect cell surface expression of hemagglutinin (HA) of Egyptian H5N1 avian influenza virus under transcriptional control of whispovirus immediate early-1 promoter.  

PubMed

In the present study, whispovirus immediate early 1 promoter (ie-1) was used to initiate surface expression of the hemagglutinin (HA) protein of Egyptian H5N1 avian influenza virus (AIV) by using the baculovirus expression vector system. The HA gene and whispovirus ie-1 promoter sequence were synthesized as a fused expression cassette (ie1-HA) and successfully cloned into the pFastBac-1 transfer vector. The recombinant vector was transformed into DH10Bac competent cells, and the recombinant bacmid was generated via site-specific transposition. The recombinant bacmid was used for transfection of Spodoptera frugiperda (Sf-9) insect cells to construct the recombinant baculovirus and to induce expression of the HA protein of H5N1 AIV. The recombinant glycoprotein expressed in Sf-9 cells showed hemadsorption activity. Hemagglutination activity was also detected in both extra- and intracellular recombinant HAs. Both the HA and hemadsorption activities were inhibited by reference polyclonal anti-H5 sera. Significant expression of the recombinant protein was observed on the surface of infected insect cells by using immunofluorescence. SDS-PAGE analysis of the expressed protein revealed the presence of a visually distinguishable band of ~63 kDa in size, which was absent in the non-infected cell control. Western blot analysis confirmed that the distinct 63 kDa band corresponded to the recombinant HA glycoprotein of H5N1 AIV. This study reports the successful expression of the HA protein of H5N1 AIV. The expressed protein was displayed on the plasma membrane of infected insect cells under the control of whispovirus ie-1 promoter by using the baculovirus expression vector system. PMID:25112319

Gadalla, Mohamed Rasheed; El-Deeb, Ayman Hany; Emara, Mohamed Maged; Hussein, Hussein Aly

2014-12-28

197

Effect of a modulator deletion on transcription of the human cytomegalovirus major immediate-early genes in infected undifferentiated and differentiated cells.  

PubMed Central

Differentiation-dependent expression of the human cytomegalovirus (HCMV) major immediate-early (MIE) genes, encoding IE1 and IE2, may partly govern virus replication in monocytic THP-1 and embryonal carcinoma (Tera-2) cells. The modulator of the MIE promoter was shown previously in transient transfection assays to repress transcription from promoter segments in undifferentiated THP-1 and Tera-2 cells but not in differentiated cells. To determine the biological importance of these findings, we constructed a recombinant HCMV (r delta MSVgpt) without a modulator. In comparison to wild-type (WT) virus, r delta MSVgpt exhibits a slight delay in growth in human fibroblasts, but there is no appreciable change in IE1 and IE2 transcription. Moreover, there is no appreciable change in the early/late kinetics of transcription of RNAs colinear with the predicted UL128 coding region, which is adjacent to the modulator, although the size distribution and abundance of these RNAs are altered. In infected undifferentiated THP-1 and Tera-2 cells, WT and r alpha MSVgpt viruses produce minimal but comparable amounts of IE1 RNAs. The genomes of both viruses are detectable in similar amounts within these undifferentiated cells. Induction of cellular differentiation before infection overcomes the block in MIE gene transcription. WT and r alpha MSVgpt infections of differentiated THP-1 cells produce similar levels of IE1 and IE2 RNAs. Thus, differentiation-dependent control of MIE gene transcription involves regulatory mechanisms other than the modulator. Possible alternative functions of the modulator are discussed. PMID:8995648

Meier, J L; Stinski, M F

1997-01-01

198

Latency of Epstein-Barr virus is stabilized by antisense-mediated control of the viral immediate-early gene BZLF-1.  

PubMed

The ability of the Epstein-Barr virus (EBV) to avoid lytic replication and to establish a latent infection in B-lymphocytes is fundamental for its lifelong persistence and the pathogenesis of various EBV-associated diseases. The viral immediate-early gene BZLF-1 plays a key role for the induction of lytic replication and its activity is strictly regulated on different levels of gene expression. Recently, it was demonstrated that BZLF-1 is also controlled by a posttranscriptional mechanism. Transient synthesis of a mutated competitor RNA saturated this mechanism and caused both expression of the BZLF-1 protein and the induction of lytic viral replication. Using short overlapping fragments of the competitor, it is shown that this control acts on the unspliced primary transcript. RT-PCR demonstrated unspliced BZLF-1 RNA in latently infected B-lymphocytes in the absence of BZLF-1 protein. Due to the complementarity of the gene BZLF-1 and the latency-associated gene EBNA-1 on the opposite strand of the genome, we propose an antisense-mediated mechanism. RNase protection assays demonstrated transcripts in antisense orientation to the BZLF-1 transcript during latency, which comprise a comparable constellation to other herpesviruses. A combined RNAse protection/RT-PCR assay detected the double-stranded hybrid RNA, consisting of the unspliced BZLF-1 transcript and a noncoding intron of the EBNA-1 gene. Binding of BZLF-1 transcripts is suggested to be an important backup control mechanism in addition to transcriptional regulation, stabilizing latency and preventing inappropriate lytic viral replication in vivo. PMID:10534735

Prang, N; Wolf, H; Schwarzmann, F

1999-12-01

199

The Murine Gammaherpesvirus Immediate-Early Rta Synergizes with IRF4, Targeting Expression of the Viral M1 Superantigen to Plasma Cells  

PubMed Central

MHV68 is a murine gammaherpesvirus that infects laboratory mice and thus provides a tractable small animal model for characterizing critical aspects of gammaherpesvirus pathogenesis. Having evolved with their natural host, herpesviruses encode numerous gene products that are involved in modulating host immune responses to facilitate the establishment and maintenance of lifelong chronic infection. One such protein, MHV68 M1, is a secreted protein that has no known homologs, but has been shown to play a critical role in controlling virus reactivation from latently infected macrophages. We have previous demonstrated that M1 drives the activation and expansion of V?4+ CD8+ T cells, which are thought to be involved in controlling MHV68 reactivation through the secretion of interferon gamma. The mechanism of action and regulation of M1 expression are poorly understood. To gain insights into the function of M1, we set out to evaluate the site of expression and transcriptional regulation of the M1 gene. Here, using a recombinant virus expressing a fluorescent protein driven by the M1 gene promoter, we identify plasma cells as the major cell type expressing M1 at the peak of infection in the spleen. In addition, we show that M1 gene transcription is regulated by both the essential viral immediate-early transcriptional activator Rta and cellular interferon regulatory factor 4 (IRF4), which together potently synergize to drive M1 gene expression. Finally, we show that IRF4, a cellular transcription factor essential for plasma cell differentiation, can directly interact with Rta. The latter observation raises the possibility that the interaction of Rta and IRF4 may be involved in regulating a number of viral and cellular genes during MHV68 reactivation linked to plasma cell differentiation. PMID:25101696

O'Flaherty, Brigid M.; Soni, Tanushree; Wakeman, Brian S.; Speck, Samuel H.

2014-01-01

200

Contrasting role of phospholipase C-{gamma}1 in the expression of immediate early genes induced by epidermal or platelet-derived growth factors  

SciTech Connect

While significant progress has been achieved in identifying the signal transduction elements that operate downstream of activated receptor tyrosine kinases, it remains unclear how different receptors utilize these signaling elements to achieve a common response. This study compares the capacity of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) to elicit the induction of immediate early gene (IEG) mRNAs in the presence or absence of phospholipase C-{gamma}1 (PLC-{gamma}1). The results show that while PDGF induction of nearly all IEG mRNAs is abrogated in plcg1 null cells, EGF induction of the same genes is variable in the null cells and exhibits three distinct responses. Five IEG mRNAs (Nup475, Cyr61, TF, Gly, TS7) are completely inducible by EGF in the presence or absence of PLC-{gamma}1, while three others (JE, KC, FIC) exhibit a stringent requirement for the presence of PLC-{gamma}1. The third type of response is exhibited by c-fos and COX-2. While these mRNAs are completely induced by EGF in the absence of PLC-{gamma}1, the time course of their accumulation is significantly delayed. No IEG was identified as completely inducible by EGF and PDGF in the absence of PLC-{gamma}1. Electrophoretic mobility shift assays (EMSA) demonstrate that PLC-{gamma}1 is necessary for nuclear extracts from PDGF-treated cells, but not EGF-treated cells, to interact with probes for AP-1 or NF-{kappa}B.

Liao Hongjun [Department of Biochemistry, Vanderbilt University School of Medicine, 606 Light Hall, Nashville, TN 37232-0146 (United States); Santos, Josue de los [Department of Biochemistry, Vanderbilt University School of Medicine, 606 Light Hall, Nashville, TN 37232-0146 (United States); Carpenter, Graham [Department of Biochemistry, Vanderbilt University School of Medicine, 606 Light Hall, Nashville, TN 37232-0146 (United States)]. E-mail: graham.carpenter@vanderbilt.edu

2006-04-01

201

Stressor and Glucocorticoid-Dependent Induction of the Immediate Early Gene Krüppel-Like Factor 9: Implications for Neural Development and Plasticity  

PubMed Central

Krüppel-like factor 9 (KLF9) is a thyroid hormone-induced, immediate early gene implicated in neural development in vertebrates. We analyzed stressor and glucocorticoid (GC)-dependent regulation of KLF9 expression in the brain of the frog Xenopus laevis, and investigated a possible role for KLF9 in neuronal differentiation. Exposure to shaking/confinement stressor increased plasma corticosterone (CORT) concentration, and KLF9 immunoreactivity in several brain regions, which included the medial amygdala and bed nucleus of the stria terminalis, anterior preoptic area (homologous to the mammalian paraventricular nucleus), and optic tectum (homologous to the mammalian superior colliculus). The stressor-induced KLF9 mRNA expression in the brain was blocked by pretreatment with the GC receptor antagonist RU486, or mimicked by injection of CORT. Treatment with CORT also caused a rapid and dose-dependent increase in KLF9 mRNA in X. laevis XTC-2 cells that was resistant to inhibition of protein synthesis. The action of CORT on KLF9 expression in XTC-2 cells was blocked by RU486, but not by the mineralocorticoid receptor antagonist spironolactone. To test for functional consequences of up-regulation of KLF9, we introduced a KLF9 expression plasmid into living tadpole brain by electroporation-mediated gene transfer. Forced expression of KLF9 in tadpole brain caused an increase in Golgi-stained cells, reflective of neuronal differentiation/maturation. Our results support that KLF9 is a direct, GC receptor target gene that is induced by stress, and functions as an intermediary in the actions of GCs on brain gene expression and neuronal structure. PMID:19036875

Bonett, Ronald M.; Hu, Fang; Bagamasbad, Pia; Denver, Robert J.

2009-01-01

202

Lack of reduction in body fat after treatment with insulin-like growth factor-I in two children with growth hormone gene deletions.  

PubMed

Two patients with growth hormone (GH) gene deletions were treated with recombinant insulin-like growth factor-I (IGF-I) (80-240 (microg/kg/day) and the effects on bone mass and body composition were compared to administration of GH (0.075 U/kg/day) to 8 patients with idiopathic GH deficiency. Bone mass and body composition were measured by dual photon X-ray absorptiometry (DEXA ) before and 3 and 6 months after treatment with GH or IGF-I. Similar increases in growth velocities were observed after GH and IGF-I treatment. Treatment with GH resulted in prompt and significant reduction in body fat percentage (basal, 3 and 6 months: 22+/-10, 17+/-9, and 16+/-9%) whereas body fat percentage remained unchanged after IGF-I therapy (basal, 3 and 6 months: 49, 52 and 48% in patient 1 and 45, 42 and 43% in patient 2, respectively). Fat percentage remained elevated after 18 months of IGF-I treatment in patients 1 (51%) and 2 (44%), respectively. Lean mass and bone mineral content increased with GH and IGF-I therapies. We conclude that reduction of body fat measured by DEXA, observed after administration of GH but not after IGF-I treatment in these children with GH deficiency, suggests that the GH effect on body fat mass is not mediated by circulating IGF-I. PMID:10853714

Arnhold, I J; Oliveira, S B; Osorio, M G; Carrilho, A J; Nicolau, W; Bianco, A C; Mendonca, B B

2000-04-01

203

What is the relevance of Ikaros gene deletions as a prognostic marker in pediatric Philadelphia-negative B-cell precursor acute lymphoblastic leukemia?  

PubMed Central

New prognostic markers are needed for upfront identification of patients with acute lymphocytic leukemia with a high risk of relapse or who are not likely to respond to the most aggressive chemotherapy. We focused our analysis on Ikaros (IKZF1) gene deletions in a homogeneous cohort of 410 pediatric patients with Philadelphia chromosome-negative, B-cell precursor acute lymphoblastic leukemia enrolled in Italy into the AIEOP-BFM ALL2000 study. We confirm their reported poor prognostic value, although the associated event-free survival was relatively high (approximately 70%). The difference in the cumulative incidence of relapse between patients positive or not for IKZF1 deletions was not marked: 24.2% (5.9) versus 13.1% (1.8) overall and 23.9% (6.6) versus 16.5% (2.5) in the intermediate-risk subgroup. In line with this, IKZF1 deletions were not an independent prognostic factor for the hazard of relapse. Most IKZF1-deleted cases stratified in the high-risk group relapsed, suggesting that once identified, patients with these deletions require an alternative treatment. In conclusion, the need of and benefit from introducing IKZF1 deletions as an additional stratification marker for patients with Philadelphia-negative B-cell precursor acute lymphoblastic leukemia remain questionable. PMID:23585525

Palmi, Chiara; Valsecchi, Maria Grazia; Longinotti, Giulia; Silvestri, Daniela; Carrino, Valentina; Conter, Valentino; Basso, Giuseppe; Biondi, Andrea; Kronnie, Geertruy Te; Cazzaniga, Giovanni

2013-01-01

204

Advanced significance analysis of microarray data based on weighted resampling: a comparative study and application to gene deletions in Mycobacterium bovis  

PubMed Central

Motivation When analyzing microarray data, non-biological variation introduces uncertainty in the analysis and interpretation. In this paper we focus on the validation of significant differences in gene expression levels, or normalized channel intensity levels with respect to different experimental conditions and with replicated measurements. A myriad of methods have been proposed to study differences in gene expression levels and to assign significance values as a measure of confidence. In this paper we compare several methods, including SAM, regularized t-test, mixture modeling, Wilk’s lambda score and variance stabilization. From this comparison we developed a weighted resampling approach and applied it to gene deletions in Mycobacterium bovis. Results We discuss the assumptions, model structure, computational complexity and applicability to microarray data. The results of our study justified the theoretical basis of the weighted resampling approach, which clearly outperforms the others. Availability Algorithms were implemented using the statistical programming language R and available on the author’s web-page. PMID:14960462

Kutalik, Zoltan; Inwald, Jacqueline; Gordon, Steve V.; Hewinson, R. Glyn; Butcher, Philip; Hinds, Jason; Cho, Kwang-Hyun; Wolkenhauer, Olaf

2011-01-01

205

Raf and Fibroblast Growth Factor Phosphorylate Elk1 and Activate the Serum Response Element of the Immediate Early Gene pip92 by Mitogen-Activated Protein Kinase-Independent as Well as Dependent Signaling Pathways  

Microsoft Academic Search

Previous studies have shown that a mitogen activated protein (MAP) kinase (MEK)-independent signaling pathway is required by activated Raf or fibroblast-derived growth factor (FGF) for the differentiation of rat hippocampal neuronal H19-7 cells. We now demonstrate that both Raf and FGF similarly induce prolonged transcription and translation of the immediate early gene pip92 in the absence of activation of the

KWANG-CHUL CHUNG; IGNATIUS GOMES; DANHUI WANG; LESTER F. LAU; MARSHA RICH ROSNER; Ben May

1998-01-01

206

Transcriptional regulation of immediate-early gene response by THOC5, a member of mRNA export complex, contributes to the M-CSF-induced macrophage differentiation  

PubMed Central

Hematopoiesis and commitment to a restricted lineage are guided by a timely expressed set of cytokine receptors and their downstream transcription factors. A member of the mRNA export complex, THOC5 (suppressors of the transcriptional defects of hpr1 delta by overexpression complex 5) is a substrate for several tyrosine kinases such as macrophage colony-stimulating factor (M-CSF) receptor and various leukemogenic tyrosine kinases, such as Bcr-Abl, or NPM-ALK. THOC5 tyrosine phosphorylation is elevated in stem cells from patients with chronic myeloid leukemia, suggesting that THOC5 may be involved in leukemia development. THOC5 is also an essential element in the maintenance of hematopoiesis in adult mice. In this report, we show that THOC5 is located in the nuclear speckles, and that it is translocated from the nucleus to cytoplasm during M-CSF-induced bone marrow-derived macrophage differentiation. Furthermore, we have identified THOC5 target genes by trancriptome analysis, using tamoxifen-inducible THOC5 knockout macrophages. Although only 99 genes were downregulated in THOC5-depleted macrophages, half of the genes are involved in differentiation and/or migration. These include well-known regulators of myeloid differentiation inhibitor of DNA binding (Id)1, Id3, Smad family member 6 (Smad6) and Homeobox (Hox)A1. In addition, a subset of M-CSF-inducible genes, such as Ets family mRNAs are THOC5 target mRNAs. Upon depletion of THOC5, unspliced v-ets erythroblastosis virus E26 oncogene homolog (Ets1) mRNA was accumulated in the nucleus. Furthermore, THOC5 was recruited to chromatin where Ets1 was transcribed and bound to unspliced and spliced Ets1 transcripts, indicating that THOC5 has a role in processing/export of M-CSF-inducible genes. In conclusion, regulation of immediate-early gene response by THOC5, a member of mRNA export complex contributes to the M-CSF-induced macrophage differentiation. PMID:24157873

Tran, D DH; Saran, S; Dittrich-Breiholz, O; Williamson, A JK; Klebba-Färber, S; Koch, A; Kracht, M; Whetton, A D; Tamura, T

2013-01-01

207

Production and Characterization of Improved Adenovirus Vectors with the E1, E2b, and E3 Genes Deleted  

PubMed Central

Adenovirus (Ad)-based vectors have great potential for use in the gene therapy of multiple diseases, both genetic and nongenetic. While capable of transducing both dividing and quiescent cells efficiently, Ad vectors have been limited by a number of problems. Most Ad vectors are engineered such that a transgene replaces the Ad E1a, E1b, and E3 genes; subsequently the replication-defective vector can be propagated only in human 293 cells that supply the deleted E1 gene functions in trans. Unfortunately, the use of high titers of E1-deleted vectors has been repeatedly demonstrated to result in low-level expression of viral genes still resident in the vector. In addition, the generation of replication-competent Ad (RCA) by recombination events with the E1 sequences residing in 293 cells further limits the usefulness of E1-deleted Ad vectors. We addressed these problems by isolating new Ad vectors deleted for the E1, E3, and the E2b gene functions. The new vectors can be readily grown to high titers and have several improvements, including an increased carrying capacity and a theoretically decreased risk for generating RCA. We have also demonstrated that the further block to Ad vector replication afforded by the deletion of both the E1 and E2b genes significantly diminished Ad late gene expression in comparison to a conventional E1-deleted vector, without destabilization of the modified vector genome. The results suggested that these modified vectors may be very useful both for in vitro and in vivo gene therapy applications. PMID:9444984

Amalfitano, Andrea; Hauser, Michael A.; Hu, Huimin; Serra, Delila; Begy, Catherine R.; Chamberlain, Jeffrey S.

1998-01-01

208

Screening of high-level 4-hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone-producing strains from a collection of gene deletion mutants of Saccharomyces cerevisiae.  

PubMed

4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1?) exhibited the maximum HEMF production capacity. Further investigations of the adh1? mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

Uehara, Kenji; Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

2015-01-01

209

Multiplication  

NSDL National Science Digital Library

How sharp are your multiplication skills? Give these great math games a try ! Play Asteroids blaster and test your multiplication skills. How fast can you solve the problem... play a round of Baseball multiplication and see! Multiplication is fun and delicious with Crazy Cones. Help Lemonade Larry determine the correct amount! Test your multiplication skills with Tic Tac Toe! ...

Ms.Roberts

2009-02-24

210

CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice  

PubMed Central

We have previously shown that deletion of CuZnSOD in mice (Sod1?/? mice) leads to accelerated loss of muscle mass and contractile force during aging. To dissect the relative roles of skeletal muscle and motor neurons in this process, we used a Cre-Lox targeted approach to establish a skeletal muscle-specific Sod1-knockout (mKO) mouse to determine whether muscle-specific CuZnSOD deletion is sufficient to cause muscle atrophy. Surprisingly, mKO mice maintain muscle masses at or above those of wild-type control mice up to 18 mo of age. In contrast, maximum isometric specific force measured in gastrocnemius muscle is significantly reduced in the mKO mice. We found no detectable increases in global measures of oxidative stress or ROS production, no reduction in mitochondrial ATP production, and no induction of adaptive stress responses in muscle from mKO mice. However, Akt-mTOR signaling is elevated and the number of muscle fibers with centrally located nuclei is increased in skeletal muscle from mKO mice, which suggests elevated regenerative pathways. Our data demonstrate that lack of CuZnSOD restricted to skeletal muscle does not lead to muscle atrophy but does cause muscle weakness in adult mice and suggest loss of CuZnSOD may potentiate muscle regenerative pathways.—Zhang, Y., Davis, C., Sakellariou, G.K., Shi, Y., Kayani, A.C., Pulliam, D., Bhattacharya, A., Richardson, A., Jackson, M.J., McArdle, A., Brooks, S.V., Van Remmen, H. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice. PMID:23729587

Zhang, Yiqiang; Davis, Carol; Sakellariou, George K.; Shi, Yun; Kayani, Anna C.; Pulliam, Daniel; Bhattacharya, Arunabh; Richardson, Arlan; Jackson, Malcolm J.; McArdle, Anne; Brooks, Susan V.; Van Remmen, Holly

2013-01-01

211

Novel System for Efficient Isolation of Clostridium Double-Crossover Allelic Exchange Mutants Enabling Markerless Chromosomal Gene Deletions and DNA Integration  

PubMed Central

Isolation of Clostridium mutants based on gene replacement via allelic exchange remains a major limitation for this important genus. Use of a heterologous counterselection marker can facilitate the identification of the generally rare allelic exchange events. We report on the development of an inducible counterselection marker and describe its utility and broad potential in quickly and efficiently generating markerless DNA deletions and integrations at any genomic locus without the need for auxotrophic mutants or the use of the mobile group II introns. This system is based on a codon-optimized mazF toxin gene from Escherichia coli under the control of a lactose-inducible promoter from Clostridium perfringens. This system is potentially applicable to almost all members of the genus Clostridium due to their similarly low genomic GC content and comparable codon usage. We isolated all allelic-exchange-based gene deletions (ca_p0167, sigF, and sigK) or disruptions (ca_p0157 and sigF) we attempted and integrated a 3.6-kb heterologous DNA sequence (made up of a Clostridium ljungdahlii 2.1-kb formate dehydrogenase [fdh] gene plus a FLP recombination target [FRT]-flanked thiamphenicol resistance marker) into the Clostridium acetobutylicum chromosome. Furthermore, we report on the development of a plasmid system with inducible segregational instability, thus enabling efficient deployment of the FLP-FRT system to generate markerless deletion or integration mutants. This enabled expeditious deletion of the thiamphenicol resistance marker from the fdh integrant strain as well as the sigK deletion strain. More generally, our system can potentially be applied to other organisms with underdeveloped genetic tools. PMID:22983967

Al-Hinai, Mohab A.; Fast, Alan G.

2012-01-01

212

Differential Functions of Interferon-Upregulated Sp100 Isoforms: Herpes Simplex Virus Type 1 Promoter-Based Immediate-Early Gene Suppression and PML Protection from ICP0-Mediated Degradation?  

PubMed Central

Cells have intrinsic defenses against virus infection, acting before the innate or the adaptive immune response. Preexisting antiviral proteins such as PML, Daxx, and Sp100 are stored in specific nuclear domains (ND10). In herpes simplex virus type 1 (HSV-1), the immediate-early protein ICP0 serves as a counterdefense through degradation of the detrimental protein PML. We asked whether interferon (IFN)-upregulated Sp100 is similarly antagonized by ICP0 in normal human fibroblasts by using a selective-knockdown approach. We find that of the four Sp100 isoforms, the three containing a SAND domain block the transcription of HSV-1 proteins ICP0 and ICP4 at the promoter level and that IFN changes the differential splicing of the Sp100 transcript in favor of the inhibitor Sp100C. At the protein level, ICP0 activity does not lead to the hydrolysis of any of the Sp100 isoforms. The SAND domain-containing isoforms are not general inhibitors of viral promoters, as the activity of the major immediate-early cytomegalovirus promoter is not diminished, whereas the long terminal repeat of a retrovirus, like the ICP0 promoter, is strongly inhibited. Since we could not find a specific promoter region in the ICP0 gene that responds to the SAND domain-containing isoforms, we questioned whether Sp100 could act through other antiviral proteins such as PML. We find that all four Sp100 isoforms stabilize ND10 and protect PML from ICP0-based hydrolysis. Loss of either all PML isoforms or all Sp100 isoforms reduces the opposite constituent ND10 protein, suggesting that various interdependent mechanisms of ND10-based proteins inhibit virus infection at the immediate-early level. PMID:19279115

Negorev, Dmitri G.; Vladimirova, Olga V.; Maul, Gerd G.

2009-01-01

213

Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger.  

PubMed

Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl ?-1,3-mannosyltransferase (also known as "asparagine-linked glycosylation 3", or ALG3) is involved in early N-linked glycan synthesis and thus is essential for formation of N-linked protein glycosylation. In this study, we examined the effects of alg3 gene deletion (alg3?) on growth, development, pigment production, protein secretion and recombinant Trichoderma reesei cellobiohydrolase (rCel7A) expressed in Aspergillus niger. The alg3? delayed spore germination in liquid cultures of complete medium (CM), potato dextrose (PD), minimal medium (MM) and CM with addition of cAMP (CM+cAMP), and resulted in significant reduction of hyphal growth on CM, potato dextrose agar (PDA), and CM+cAMP and spore production on CM. The alg3? also led to a significant accumulation of red pigment on both liquid and solid CM cultures. The relative abundances of 54 of the total 215 proteins identified in the secretome were significantly altered as a result of alg3?, 63% of which were secreted at higher levels in alg3? strain than the parent. The rCel7A expressed in the alg3? mutant was smaller in size than that expressed in both wild-type and parental strains, but still larger than T. reesei Cel7A. The circular dichroism (CD)-melt scans indicated that change in glycosylation of rCel7A does not appear to impact the secondary structure or folding. Enzyme assays of Cel7A and rCel7A on nanocrystalline cellulose and bleached kraft pulp demonstrated that the rCel7As have improved activities on hydrolyzing the nanocrystalline cellulose. Overall, the results suggest that alg3 is critical for growth, sporulation, pigment production, and protein secretion in A. niger, and demonstrate the feasibility of this alternative approach to evaluate the roles of N-linked glycosylation in glycoprotein secretion and function. PMID:24076077

Dai, Ziyu; Aryal, Uma K; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D; Magnuson, Jon K; Adney, William S; Beckham, Gregg T; Brunecky, Roman; Himmel, Michael E; Decker, Stephen R; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E

2013-12-01

214

A Suitable Streptomycin-Resistant Mutant for Constructing Unmarked In-Frame Gene Deletions Using rpsL as a Counter-Selection Marker  

PubMed Central

The streptomycin counter-selection system is a useful tool for constructing unmarked in-frame gene deletions, which is a fundamental approach to study bacteria and their pathogenicity at the molecular level. A prerequisite for this system is acquiring a streptomycin-resistant strain due to rpsL mutations, which encodes the ribosomal protein S12. However, in this study no streptomycin resistance was found to be caused by rpsL mutations in all 127 clinical strains of Klebsiella pneumoniae isolated from liver abscess patients. By screening 107 spontaneous mutants of streptomycin resistance from a clinical strain of K. pneumoniae, nucleotide substitution or insertion located within the rpsL was detected in each of these strains. Thirteen different mutants with varied S12 proteins were obtained, including nine streptomycin-dependent mutants. The virulence of all four streptomycin-resistant mutants was further evaluated. Compared with the parental strain, the K42N, K42T and K87R mutants showed a reduction in growth rate, and the K42N and K42T mutants became susceptible to normal human serum. In the mice LD50 (the bacterial dose that caused 50% death) assay, the K42N and K42T mutants were ?1,000-fold less lethal (?2×105 CFU) and the K87R mutant was ?50-fold less lethal (?1×104 CFU) than the parental strain (?2×102 CFU). A K42R mutant showed non-observable effects on the above assays, while this mutant exhibited a small cost (P<0.01) in an in vitro growth competition experiment. In summary, most of the K. pneumoniae strains with streptomycin resistance caused by rpsL mutations are less virulent than their parental strain in the absence of streptomycin. The K42R mutant showed similar pathogenicity to its parental strain and should be one of the best choices when using rpsL as a counter-selection marker. PMID:25268958

Tsai, Yu-Kuo; Liou, Ci-Hong; Lin, Jung-Chung; Ma, Ling; Fung, Chang-Phone; Chang, Feng-Yee; Siu, L. Kristopher

2014-01-01

215

Multiplication  

NSDL National Science Digital Library

Here are some fun games to make practicing multiplication fun!!! Before you start the fun... click Multiplication Tables to review what you already know! Can you figure out the Multiplication Hidden Picture... you better know your math skills first or the picture will burst! It\\'s times to have a \\"blast\\"... Blow me away with theMultiplication Tunnel Blaster Now your ready to join the team! Show me ...

Ms. Walker

2008-03-26

216

Two live attenuated Shigella flexneri 2a strains WRSf2G12 and WRSf2G15: a new combination of gene deletions for 2nd generation live attenuated vaccine candidates.  

PubMed

Shigella infections are a major cause of inflammatory diarrhea and dysentery worldwide. First-generation virG-based live attenuated Shigella strains have been successfully tested in phase I and II clinical trials and are a leading approach for Shigella vaccine development. Additional gene deletions in senA, senB and msbB2 have been engineered into second-generation virG-based Shigella flexneri 2a strains producing WRSf2G12 and WRSf2G15. Both strains harbor a unique combination of gene deletions designed to increase the safety of live Shigella vaccines. WRSf2G12 and WRSf2G15 are genetically stable and highly attenuated in both cell culture and animal models of infection. Ocular immunization of guinea pigs with either strain induces robust systemic and mucosal immune responses that protect against homologous challenge with wild-type Shigella. The data support further evaluation of the second-generation strains in a phase I clinical trial. PMID:22658966

Ranallo, Ryan T; Fonseka, Suramya; Boren, Tara L; Bedford, Lisa A; Kaminski, Robert W; Thakkar, Sejal; Venkatesan, Malabi M

2012-07-20

217

Multiplication  

NSDL National Science Digital Library

Which way of learning multiplication helped you the best? First you will need to use organizer Then you need to go to thinking blocks Next go to multiplication rap song Then go to dinosaur game and times table and lattice method and finally flashcards after this look over your graphic organizer and think about which site was most helpful for you. You will then be divided into groups where you will make your own creative lesson ...

Ms. Williams

2011-04-06

218

Development and use of a gene deletion strategy for Flavobacterium johnsoniae to identify the redundant gliding motility genes remF, remG, remH, and remI.  

PubMed

Cells of Flavobacterium johnsoniae exhibit rapid gliding motility over surfaces. Cell movement is thought to involve motor complexes comprised of Gld proteins that propel the cell surface adhesin SprB. The four distal genes of the sprB operon (sprC, sprD, sprB, and sprF) are required for normal motility and for formation of spreading colonies, but the roles of the remaining three genes (remF, remG, and fjoh_0982) are unclear. A gene deletion strategy was developed to determine whether these genes are involved in gliding. A spontaneous streptomycin-resistant rpsL mutant of F. johnsoniae was isolated. Introduction of wild-type rpsL on a plasmid restored streptomycin sensitivity, demonstrating that wild-type rpsL is dominant to the mutant allele. The gene deletion strategy employed a suicide vector carrying wild-type rpsL and used streptomycin for counterselection. This approach was used to delete the region spanning remF, remG, and fjoh_0982. The mutant cells formed spreading colonies, demonstrating that these genes are not required for normal motility. Analysis of the genome revealed a paralog of remF (remH) and a paralog of remG (remI). Deletion of remH and remI had no effect on motility of wild-type cells, but cells lacking remF and remH, or cells lacking remG and remI, formed nonspreading colonies. The motility defects resulting from the combination of mutations suggest that the paralogous proteins perform redundant functions in motility. The rpsL counterselection strategy allows construction of unmarked mutations to determine the functions of individual motility proteins or to analyze other aspects of F. johnsoniae physiology. PMID:21421754

Rhodes, Ryan G; Pucker, Halley G; McBride, Mark J

2011-05-01

219

Development and Use of a Gene Deletion Strategy for Flavobacterium johnsoniae To Identify the Redundant Gliding Motility Genes remF, remG, remH, and remI ? †  

PubMed Central

Cells of Flavobacterium johnsoniae exhibit rapid gliding motility over surfaces. Cell movement is thought to involve motor complexes comprised of Gld proteins that propel the cell surface adhesin SprB. The four distal genes of the sprB operon (sprC, sprD, sprB, and sprF) are required for normal motility and for formation of spreading colonies, but the roles of the remaining three genes (remF, remG, and fjoh_0982) are unclear. A gene deletion strategy was developed to determine whether these genes are involved in gliding. A spontaneous streptomycin-resistant rpsL mutant of F. johnsoniae was isolated. Introduction of wild-type rpsL on a plasmid restored streptomycin sensitivity, demonstrating that wild-type rpsL is dominant to the mutant allele. The gene deletion strategy employed a suicide vector carrying wild-type rpsL and used streptomycin for counterselection. This approach was used to delete the region spanning remF, remG, and fjoh_0982. The mutant cells formed spreading colonies, demonstrating that these genes are not required for normal motility. Analysis of the genome revealed a paralog of remF (remH) and a paralog of remG (remI). Deletion of remH and remI had no effect on motility of wild-type cells, but cells lacking remF and remH, or cells lacking remG and remI, formed nonspreading colonies. The motility defects resulting from the combination of mutations suggest that the paralogous proteins perform redundant functions in motility. The rpsL counterselection strategy allows construction of unmarked mutations to determine the functions of individual motility proteins or to analyze other aspects of F. johnsoniae physiology. PMID:21421754

Rhodes, Ryan G.; Pucker, Halley G.; McBride, Mark J.

2011-01-01

220

Early socio-emotional experience induces expression of the immediate-early gene Arc/arg3.1 (activity-regulated cytoskeleton-associated protein/activity-regulated gene) in learning-relevant brain regions of the newborn chick.  

PubMed

We have cloned a full-length complementary DNA from the chicken (Gallus gallus domesticus), which encodes a polypeptide that exhibits approximately 75% identity to the product of the mammalian gene Arc (activity-regulated cytoskeleton-associated protein), also known as arg3.1 (activity-regulated gene). Since this gene is an immediate-early gene that has been suggested to play a role in synaptic plasticity and learning and memory processes, its expression has been analyzed in a juvenile form of learning, namely, filial imprinting. Our results demonstrate that Arc/arg3.1 mRNA is detectable in the newborn chick brain, and that at this early age the level of this transcript can be altered by brief sensory/emotional experience. After postnatal exposure to a novel 30-min auditory imprinting stimulus, Arc/arg3.1 mRNA was found to be significantly increased in two higher associative areas, the mesopallium intermediomediale (P = 0.002) and the nidopallium dorso-caudale (P = 0.031), compared with naïve controls. The transcript level was also significantly elevated after imprinting in Area L pallii (P=0.045), which is analogous to the mammalian auditory cortex. In addition, increases were seen in the medio-rostral nidopallium/mesopallium (P = 0.054), which is presumed to be the analog of the mammalian prefrontal cortex, and the hyperpallium intercalatum (P = 0.054), but these did not quite reach significance. We discuss these data in the light of those obtained in an earlier study, in the same paradigm, for the avian immediate-early gene, zenk (an acronym for zif-268, egr-1, ngfi-a and krox-24, which are different names for the orthologous mammalian gene). We conclude that, although both the Arc/arg3.1 and zenk genes are induced by auditory imprinting, they are significantly up-regulated in different learning-relevant brain regions. It is, therefore, evident that they must be activated by different mechanisms. PMID:15908132

Bock, J; Thode, C; Hannemann, O; Braun, K; Darlison, M G

2005-01-01

221

Combinatorial strategies for improving multiple-stress resistance in industrially relevant Escherichia coli strains.  

PubMed

High-cell-density fermentation for industrial production of chemicals can impose numerous stresses on cells due to high substrate, product, and by-product concentrations; high osmolarity; reactive oxygen species; and elevated temperatures. There is a need to develop platform strains of industrial microorganisms that are more tolerant toward these typical processing conditions. In this study, the growth of six industrially relevant strains of Escherichia coli was characterized under eight stress conditions representative of fed-batch fermentation, and strains W and BL21(DE3) were selected as platforms for transposon (Tn) mutagenesis due to favorable resistance characteristics. Selection experiments, followed by either targeted or genome-wide next-generation-sequencing-based Tn insertion site determination, were performed to identify mutants with improved growth properties under a subset of three stress conditions and two combinations of individual stresses. A subset of the identified loss-of-function mutants were selected for a combinatorial approach, where strains with combinations of two and three gene deletions were systematically constructed and tested for single and multistress resistance. These approaches allowed identification of (i) strain-background-specific stress resistance phenotypes, (ii) novel gene deletion mutants in E. coli that confer single and multistress resistance in a strain-background-dependent manner, and (iii) synergistic effects of multiple gene deletions that confer improved resistance over single deletions. The results of this study underscore the suboptimality and strain-specific variability of the genetic network regulating growth under stressful conditions and suggest that further exploration of the combinatorial gene deletion space in multiple strain backgrounds is needed for optimizing strains for microbial bioprocessing applications. PMID:25085490

Lennen, Rebecca M; Herrgård, Markus J

2014-10-01

222

Combinatorial Strategies for Improving Multiple-Stress Resistance in Industrially Relevant Escherichia coli Strains  

PubMed Central

High-cell-density fermentation for industrial production of chemicals can impose numerous stresses on cells due to high substrate, product, and by-product concentrations; high osmolarity; reactive oxygen species; and elevated temperatures. There is a need to develop platform strains of industrial microorganisms that are more tolerant toward these typical processing conditions. In this study, the growth of six industrially relevant strains of Escherichia coli was characterized under eight stress conditions representative of fed-batch fermentation, and strains W and BL21(DE3) were selected as platforms for transposon (Tn) mutagenesis due to favorable resistance characteristics. Selection experiments, followed by either targeted or genome-wide next-generation-sequencing-based Tn insertion site determination, were performed to identify mutants with improved growth properties under a subset of three stress conditions and two combinations of individual stresses. A subset of the identified loss-of-function mutants were selected for a combinatorial approach, where strains with combinations of two and three gene deletions were systematically constructed and tested for single and multistress resistance. These approaches allowed identification of (i) strain-background-specific stress resistance phenotypes, (ii) novel gene deletion mutants in E. coli that confer single and multistress resistance in a strain-background-dependent manner, and (iii) synergistic effects of multiple gene deletions that confer improved resistance over single deletions. The results of this study underscore the suboptimality and strain-specific variability of the genetic network regulating growth under stressful conditions and suggest that further exploration of the combinatorial gene deletion space in multiple strain backgrounds is needed for optimizing strains for microbial bioprocessing applications. PMID:25085490

Herrgård, Markus J.

2014-01-01

223

SUMO-1 modification of the major immediate-early (IE) 1 and 2 proteins of human cytomegalovirus is regulated by different mechanisms and modulates the intracellular localization of the IE1, but not IE2, protein.  

PubMed

We have previously shown that two proteins with apparent molecular masses of 91- and 102-kDa (p91 and p102, respectively) in human cytomegalovirus (HCMV)-infected cells are antigenically and structurally related to the major immediate-early (IE) 1 and 2 proteins (IE1p68 and IE2p80, respectively) of HCMV, respectively. In this study, we extended the characterization of p91 and p102 and our results were as follows; (i) Lysine at amino acid position 450 in IE1p68 and at amino acid position 175 or 180 in IE2p80, to which SUMO-1 has been shown to be covalently linked, are required for production of p91 and p102, respectively. (ii) A reversal of cycloheximide (CH) block in the presence of actinomycin D imposed at the time of infection inhibited production of p91, but not p102. (iii) The steady-state levels of p91, but not p102, were remarkably decreased by treatment with proteasome inhibitor MG132, but coincubation with CH inhibited this decrease of p91. (iv) Cell fractionation by differential detergent extraction demonstrated that p91 is preferentially found in detergent-insoluble fraction, although p102 as well as IE1p68 and IE2p80 distributes into all fractions. These results demonstrate that p91 and p102 correspond to SUMO-1-modified IE1p68 and IE2p80, respectively, that the production and degradation of SUMO-1-modified IE1p68 is regulated by mechanisms different from those of SUMO-1-modified IE2p80, and that SUMO-1 modification modulates the intracellular localization of IE1p68, but not IE2p80. PMID:15931461

Sadanari, H; Yamada, R; Ohnishi, K; Matsubara, K; Tanaka, J

2005-09-01

224

Transcription Factor Sp1 Mediates Cell-Specific trans-Activation of the Human Cytomegalovirus DNA Polymerase Gene Promoter by Immediate-Early Protein IE86 in Glioblastoma U373MG Cells  

PubMed Central

Human cytomegalovirus (HCMV) gene expression is highly cell and tissue specific. Cell factor-mediated regulatory interactions are involved in regulating the restricted expression of the HCMV major immediate-early (IE) gene (J. F. Baskar, P. P. Smith, G. Nilaver, R. A. Jupp, S. Hoffmann, N. J. Peffer, D. J. Tenney, A. M. Colberg-Poley, P. Ghazal, and J. A. Nelson, 70:3207–3213, 1996). To gain an understanding of HCMV early gene activation, we studied the effect of each of the three major IE proteins, IE72, IE86, and IE55, on the HCMV DNA polymerase gene (pol; UL54) promoter. In transient-expression assays, the IE86 protein alone was able to transactivate the pol promoter, but IE72 and IE55 were not, in permissive U373MG cells. However, we were unable to detect IE86-mediated transactivation in nonpermissive HeLa or C33-A cells. Using electrophoretic mobility shift assays (EMSAs), we found that expression of the IE86 protein in U373MG cells resulted in specific binding of a DNA complex to an inverted-repeat element, IR1, of the pol promoter. Antibody supershifting and EMSA-Western blotting experiments further showed that IE86 and the cellular transcription factor Sp1 were components of the IR1 DNA-binding complex. Furthermore, we found that binding of DNA by Sp1 was dramatically increased in the presence of IE86. Interestingly, this IE86-induced DNA-binding activity of Sp1 was inhibited by a repressor activity presented in HeLa cells. In summary, our study suggests that a viral regulatory protein can modulate the DNA binding activity of a cellular transcription factor, resulting in cell-specific transactivation of viral genes. PMID:9420220

Wu, Jun; O’Neill, Joseph; Barbosa, Miguel S.

1998-01-01

225

Immediate early gene-X1 interferes with 26 S proteasome activity by attenuating expression of the 19 S proteasomal components S5a/Rpn10 and S1/Rpn2  

PubMed Central

The stress response gene IEX-1 (immediate early gene-X-1) is involved in the regulation of cell growth and cellular viability. To some extent, these effects include an interference with the proteasomal turnover of certain regulatory proteins. Here, we show that IEX-1 directly attenuates the activity and formation of the 26 S proteasome in HEK-293 cells (human embryonic kidney cells). We further demonstrate that IEX-1 reduces the overall expression levels of certain protein components of the 19 S proteasomal subunit such as S5a/Rpn10 and S1/Rpn2, whereas the expression of other proteasomal proteins was less or not affected. In contrast with direct apoptotic stimuli, such as the anti-cancer drug etoposide, leading to caspase-dependent degradation of S1 and S5a, the effect of IEX-1 is independent of proteolytic cleavage of these proteins. Furthermore, the decreasing effect of IEX-1 on S5a and S1 expression is still seen in the presence of cycloheximide, but not in the presence of actinomycin D, and quantitative real-time PCR revealed lower mRNA levels of S5a and S1 in IEX-1-overexpressing cells, suggesting an interference of IEX-1 with the gene transcription of S5a and S1. Additionally, luciferase assays confirmed an interference of IEX-1 with the activity of the S5a promoter. These findings indicate a role of IEX-1 in the maintenance and assembly of the 26 S proteasome, obviously involving an altered gene expression of certain proteasomal proteins. Thereby, IEX-1 may essentially modulate signalling pathways related to 26 S proteasome activity and involved in cellular growth control and apoptosis. PMID:17107344

Arlt, Alexander; Minkenberg, Jörg; Kruse, Marie-Luise; Grohmann, Frauke; Fölsch, Ulrich R.; Schäfer, Heiner

2006-01-01

226

Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II  

SciTech Connect

Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

Sample, Robert [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Bryan, Locke [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Long, Scott [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Majji, Sai [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Hoskins, Glenn [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Sinning, Allan [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Olivier, Jake [Department of Preventive Medicine, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Chinchar, V. Gregory [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States)]. E-mail: vchinchar@microbio.umsmed.edu

2007-02-20

227

Genetically Modified Strains of Ralstonia eutropha H16 with ?-Ketothiolase Gene Deletions for Production of Copolyesters with Defined 3-Hydroxyvaleric Acid Contents  

PubMed Central

?-Ketothiolases catalyze the first step of poly(3-hydroxybutyrate) [poly(3HB)] biosynthesis in bacteria by condensation of two acetyl coenzyme A (acetyl-CoA) molecules to acetoacetyl-CoA and also take part in the degradation of fatty acids. During growth on propionate or valerate, Ralstonia eutropha H16 produces the copolymer poly(3-hydroxybutyrate-co-3-hydroxyvalerate) [poly(3HB-co-3HV)]. In R. eutropha, 15 ?-ketothiolase homologues exist. The synthesis of 3-hydroxybutyryl-CoA (3HB-CoA) could be significantly reduced in an 8-fold mutant (Lindenkamp et al., Appl. Environ. Microbiol. 76:5373–5382, 2010). In this study, a 9-fold mutant deficient in nine ?-ketothiolase gene homologues (phaA, bktB, H16_A1713, H16_B1771, H16_A1528, H16_B0381, H16_B1369, H16_A0170, and pcaF) was generated. In order to examine the polyhydroxyalkanoate production capacity when short- or long-chain and even- or odd-chain-length fatty acids were provided as carbon sources, the growth and storage behavior of several mutants from the previous study and the newly generated 9-fold mutant were analyzed. Propionate, valerate, octanoate, undecanoic acid, or oleate was chosen as the sole carbon source. On octanoate, no significant differences in growth or storage behavior were observed between wild-type R. eutropha and the mutants. In contrast, during the growth on oleate of a multiple mutant lacking phaA, bktB, and H16_A0170, diminished poly(3HB) accumulation occurred. Surprisingly, the amount of accumulated poly(3HB) in the multiple mutants grown on gluconate differed; it was much lower than that on oleate. The ?-ketothiolase activity toward acetoacetyl-CoA in H16?phaA and all the multiple mutants remained 10-fold lower than the activity of the wild type, regardless of which carbon source, oleate or gluconate, was employed. During growth on valerate as a sole carbon source, the 9-fold mutant accumulated almost a poly(3-hydroxyvalerate) [poly(3HV)] homopolyester with 99 mol% 3HV constituents. PMID:22636005

Lindenkamp, Nicole; Volodina, Elena

2012-01-01

228

Hearing loss is an early consequence of Npc1 gene deletion in the mouse model of Niemann-Pick disease, type C.  

PubMed

Niemann-Pick disease, type C1 (NPC1) is a rare lysosomal lipidosis that is most often the result of biallelic mutations in NPC1, and is characterized by a fatal neurological degeneration. The pathophysiology is complex, and the natural history of the disease is poorly understood. Recent findings from patients with NPC1 and hearing loss suggest that multiple steps along the auditory pathway are affected. The current study was undertaken to determine the auditory phenotype in the Npc1 (nih) mutant mouse model, to extend analyses to histologic evaluation of the inner ear, and to compare our findings to those reported from human patients. Auditory testing revealed a progressive high-frequency hearing loss in Npc1 (-/-) mice that is present as early as postnatal day 20 (P20), well before the onset of overt neurological symptoms, with evidence of abnormalities involving the cochlea, auditory nerve, and brainstem auditory centers. Distortion product otoacoustic emission amplitude and auditory brainstem response latency data provided evidence for a disruption in maturational development of the auditory system in Npc1 (-/-) mice. Anatomical study demonstrated accumulation of lysosomes in neurons, hair cells, and supporting cells of the inner ear in P30 Npc1 (-/-) mice, as well as increased numbers of inclusion bodies, myelin figures, and swollen nerve endings in older (P50-P70) mutant animals. These findings add unique perspective to the pathophysiology of NPC disease and suggest that hearing loss is an early and sensitive marker of disease progression. PMID:24839095

King, Kelly A; Gordon-Salant, Sandra; Pawlowski, Karen S; Taylor, Anna M; Griffith, Andrew J; Houser, Ari; Kurima, Kiyoto; Wassif, Christopher A; Wright, Charles G; Porter, Forbes D; Repa, Joyce J; Brewer, Carmen C

2014-08-01

229

Detection of phase-dependent transcriptomic changes and Rubisco-mediated CO2 fixation into poly (3-hydroxybutyrate) under heterotrophic condition in Ralstonia eutropha H16 based on RNA-seq and gene deletion analyses  

PubMed Central

Background Ralstonia eutropha H16 is well known to produce polyhydroxyalkanoates (PHAs), which are potential bio-based biodegradable plastics, in an efficient manner as an energy storage material under unbalanced growth conditions. To obtain further knowledge of PHA biosynthesis, this study performed a quantitative transcriptome analysis based on deep sequencing of the complementary DNA generated from the RNA (RNA-seq) of R. eutropha H16. Results Total RNAs were extracted from R. eutropha cells in growth, PHA production, and stationary phases on fructose. rRNAs in the preparation were removed by repeated treatments with magnetic beads specific to bacterial rRNAs, and then the 36 bp sequences were determined using an Illumina high-throughput sequencer. The RNA-seq results indicated the induction of gene expression for transcription, translation, cell division, peptidoglycan biosynthesis, pilus and flagella assembly, energy conservation, and fatty acid biosynthesis in the growth phase; and the repression trends of genes involved in central metabolisms in the PHA production phase. Interestingly, the transcription of genes for Calvin-Benson-Bassham (CBB) cycle and several genes for ?-oxidation were significantly induced in the PHA production phase even when the cells were grown on fructose. Moreover, incorporation of 13C was observed in poly(3-hydroxybutyrate) synthesized by R. eutropha H16 from fructose in the presence of NaH13CO3, and further gene deletion analyses revealed that both of the two ribulose 1,5-bisphosphate carboxylase (Rubiscos) in CBB cycle were actually functional in CO2 fixation under the heterotrophic condition. Conclusions The results revealed the phase-dependent transcriptomic changes and a CO2 fixation capability under heterotrophic conditions by PHA-producing R. eutropha. PMID:23879744

2013-01-01

230

An Obligatory Role of NF-?B in Mediating Bone Marrow Derived Endothelial Progenitor Cell Recruitment and Proliferation Following Endotoxemic Multiple Organ Injury in Mice  

PubMed Central

Background Recruitment of bone marrow derived endothelial progenitor cells (BMDEPCs) alleviates multiple organ injury (MOI) and improves outcomes. However, mechanisms mediating BMDEPC recruitment following septic MOI remain largely unknown. This study characterized the kinetics of BMDEPC recruitment and proliferation and defined the role of NF-?B in regulating BMDEPC recruitment and proliferation. Methods and Main Findings Chimeric mice with an intact or disrupted NF-?B p50 gene and BMDEPC-restricted expression of green fluorescent protein were created and injected with LPS (2 mg/kg, i.p.). BMDEPC recruitment and proliferation in multiple organs were quantified. BMDEPC recruitment and proliferation are highly organ-dependent. Lungs had the highest number of BMDEPC recruitment, whereas heart, liver and kidney had only a small fraction of the number of BMDEPCs in lungs. Number of proliferating BMDEPCs was several-fold higher in lungs than in other 3 organs. Kinetically, BMDEPC recruitment into different organs showed different time course profiles. NF-?B plays obligatory roles in mediating BMDEPC recruitment and proliferation. Universal deletion of NF-?B p50 gene inhibited LPS-induced BMDEPC recruitment and proliferation by 95% and 69% in heart. However, the contribution of NF-?B to these regulations varies significantly between organs. In liver, universal p50 gene deletion reduced LPS-induced BMDEPC recruitment and proliferation only by 49% and 35%. NF-?B activities in different tissue compartments play distinct roles. Selective p50 gene deletion either in stromal/parenchymal cells or in BM/blood cells inhibited BMDEPC recruitment by a similar extent. However, selective p50 gene deletion in BM/blood cells inhibited, but in stromal/parenchymal cells augmented BMDEPC proliferation. Conclusions BMDEPC recruitment and proliferation display different kinetics in different organs following endotoxemic MOI. NF-?B plays obligatory and organ-dependent roles in regulating BMDEPC recruitment and proliferation. NF-?B activities in different tissue compartments play distinct roles in regulating BMDEPC proliferation. PMID:25333282

Mao, Sun-Zhong; Ye, Xiaobing; Liu, Gang; Song, Dongmei; Liu, Shu Fang

2014-01-01

231

Contrasting hippocampal and perirhinalcortex function using immediate early gene imaging  

Microsoft Academic Search

The perirhinal cortex and hippocampus have close anatomical links, and it might, therefore, be predicted that they have close, interlinked roles in memory. Lesion studies have, however, often failed to support this prediction, providing dissociations and double dissociations between the two regions on tests of object recognition and spatial memory. In a series of rat studies we have compared these

John P. Aggleton; Malcolm W. Brown

2005-01-01

232

Regulation of Immediate Early Genes in the Visual Cortex  

Microsoft Academic Search

Light is the fastest and likely the most complex source of physical energy processed by the mammalian central nervous system (CNS). Throughout evolution, most mammals that rely heavily on vision for their normal behaviors have developed an exquisitely elaborate pattern of connectivity and functionality for harnessing, processing and integrating visual information. This process allowed for remarkable environmental adaptation and ecological

Raphael Pinaud; THOMAS A. TERLEPH; R. WILLIAM CURRIE; LIISA A. TREMERE

233

3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients  

SciTech Connect

3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither a TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.

Wang, S.P.; Robert, M.F.; Mitchell, G.A. [Hopital Sainte-Justine, Quebec (Canada)] [and others] [Hopital Sainte-Justine, Quebec (Canada); and others

1996-04-01

234

The platelet-derived growth factor beta receptor triggers multiple cytoplasmic signaling cascades that arrive at the nucleus as distinguishable inputs.  

PubMed

Stimulation of the platelet-derived growth factor beta receptor (betaPDGFR) activates enzymes such as phosphatidylinositol 3-kinase (PI3K) and phospholipase Cgamma1 (PLCgamma), which ultimately initiate nuclear responses such as enhanced expression of immediate early genes. In an attempt to compare the signaling cascades initiated by PI3K and PLCgamma, we examined the activation of a panel of immediate early genes by betaPDGFR mutants, which preferentially engage PI3K or PLCgamma. When expressed in A431 cells, the wild type receptor and to a lesser extent the mutant receptor that associates with PLCgamma (Y1021) was able to up-regulate c-fos, junB, and KC mRNA expression. In contrast, the receptor mutant that engages PI3K (Y740/51) poorly stimulated c-fos mRNA expression and did not significantly stimulate expression of either JunB or KC. Receptor mutants that did not associate with either PI3K or PLCgamma were dramatically compromised or unable to increase expression of any of these immediate early genes. The differential ability of the Y1021 and Y740/51 receptors to activate c-fos correlated well with an apparent difference in their ability to engage distinct protein kinase C family members. However there did appear to be a degree of redundancy in the cytoplasmic signaling pathways initiated by PI3K and PLCgamma, since both the Y1021 and Y740/51 receptors were able to activate an AP-1-responsive element. We conclude that recruitment of signal relay enzymes to the betaPDGFR is necessary for PDGF-dependent activation of at least some immediate early genes. In addition, whereas the betaPDGFR activates multiple signaling enzymes capable of activating the same nuclear response (activation of c-fos), these signaling cascades do not appear to converge in the cytoplasm but arrive at the nucleus as distinguishable inputs. PMID:9405485

Montmayeur, J P; Valius, M; Vandenheede, J; Kazlauskas, A

1997-12-19

235

Ornithine Decarboxylase Gene Deletion Mutants of Leishmania donovani*  

E-print Network

). The ODC enzyme of protozoan parasites is a novel therapeutic target, because D,L- -difluoromethylor effective against other genera of protozoan parasites in vivo and in vitro, including Plasmodia (7), Giardia

Schnaufer, Achim

236

Glucocerebrosidase 2 gene deletion rescues type 1 Gaucher disease.  

PubMed

The inherited deficiency of the lysosomal glucocerebrosidase (GBA) due to mutations in the GBA gene results in Gaucher disease (GD). A vast majority of patients present with nonneuronopathic, type 1 GD (GD1). GBA deficiency causes the accumulation of two key sphingolipids, glucosylceramide (GL-1) and glucosylsphingosine (LysoGL-1), classically noted within the lysosomes of mononuclear phagocytes. How metabolites of GL-1 or LysoGL-1 produced by extralysosomal glucocerebrosidase GBA2 contribute to the GD1 pathophysiology is not known. We recently recapitulated hepatosplenomegaly, cytopenia, hypercytokinemia, and the bone-formation defect of human GD1 through conditional deletion of Gba in Mx1-Cre(+):GD1 mice. Here we show that the deletion of Gba2 significantly rescues the GD1 clinical phenotype, despite enhanced elevations in GL-1 and LysoGL-1. Most notably, the reduced bone volume and bone formation rate are normalized. These results suggest that metabolism of GL-1 or LysoGL-1 into downstream bioactive lipids is a major contributor to the bone-formation defect. Direct testing revealed a strong inhibition of osteoblast viability by nanomolar concentrations of sphingosine, but not of ceramide. These findings are consistent with toxicity of high circulating sphingosine levels in GD1 patients, which decline upon enzyme-replacement therapy; serum ceramide levels remain unchanged. Together, complementary results from mice and humans affected with GD1 not only pinpoint sphingosine as being an osteoblast toxin, but also set forth Gba2 as a viable therapeutic target for the development of inhibitors to ameliorate certain disabling consequences of GD1. PMID:24639522

Mistry, Pramod K; Liu, Jun; Sun, Li; Chuang, Wei-Lien; Yuen, Tony; Yang, Ruhua; Lu, Ping; Zhang, Kate; Li, Jianhua; Keutzer, Joan; Stachnik, Agnes; Mennone, Albert; Boyer, James L; Jain, Dhanpat; Brady, Roscoe O; New, Maria I; Zaidi, Mone

2014-04-01

237

Trehalose-related gene deletions in Fusarium verticillioides  

Technology Transfer Automated Retrieval System (TEKTRAN)

Fusarium verticillioides is a widespread corn pathogen that causes root, stalk, and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Our goal is to assess the feasibility of exploiting trehalose metabolism as a target for F. verticillioide...

238

Global Gene Deletion Analysis Exploring Yeast Filamentous Growth  

E-print Network

. cerevisiae filamentous growth is regulated by the nutrient-sensing cyclic adenosine mono- phosphate (cAMP)­protein kinase A (PKA) path- way (5, 7, 8) and a mitogen-activated protein kinase (MAPK) pathway (9, 10), whose

Gifford, David K.

239

CHARACTERIZING FUMONISIN BIOSYNTHESIS THROUGH ANALYSIS OF FUM GENE DELETION MUTANTS  

Technology Transfer Automated Retrieval System (TEKTRAN)

Fumonisins are produced by Gibberella moniliformis, a causal agent of maize ear and stalk rot, and pose a health risk to humans and livestock alike. Recently, a fumonisin biosynthetic gene cluster was described in G. moniliformis. The cluster consists of 15 co-regulated genes (FUM1 and FUM6 throug...

240

Maternal duplication associated with gene deletion in sporadic hemophilia.  

PubMed Central

Sporadic occurrences of X-linked disorders can give insights into mutagenesis in man. In a case of sporadic hemophilia, associated with a partial deletion of the factor VIII gene, an unexpected inheritance pattern of gene rearrangements was observed. The factor VIII gene was found to be partially duplicated in the hemophiliac's mother. A pedigree analysis indicates that the mother has contributed both aberrant genes as well as the normal gene to her offspring. One simple model for the evolution of the deletion in this family is that the duplication is the precursor to the deletion. Images Figure 1 Figure 2 Figure 4 PMID:2901224

Gitschier, J

1988-01-01

241

Multiple replication origins with diverse control mechanisms in Haloarcula hispanica  

PubMed Central

The use of multiple replication origins in archaea is not well understood. In particular, little is known about their specific control mechanisms. Here, we investigated the active replication origins in the three replicons of a halophilic archaeon, Haloarcula hispanica, by extensive gene deletion, DNA mutation and genome-wide marker frequency analyses. We revealed that individual origins are specifically dependent on their co-located cdc6 genes, and a single active origin/cdc6 pairing is essential and sufficient for each replicon. Notably, we demonstrated that the activities of oriC1 and oriC2, the two origins on the main chromosome, are differently controlled. A G-rich inverted repeat located in the internal region between the two inverted origin recognition boxes (ORBs) plays as an enhancer for oriC1, whereas the replication initiation at oriC2 is negatively regulated by an ORB-rich region located downstream of oriC2-cdc6E, likely via Cdc6E-titrating. The oriC2 placed on a plasmid is incompatible with the wild-type (but not the ?oriC2) host strain, further indicating that strict control of the oriC2 activity is important for the cell. This is the first report revealing diverse control mechanisms of origins in haloarchaea, which has provided novel insights into the use and coordination of multiple replication origins in the domain of Archaea. PMID:24271389

Wu, Zhenfang; Liu, Jingfang; Yang, Haibo; Liu, Hailong; Xiang, Hua

2014-01-01

242

Multiple Sclerosis  

MedlinePLUS

MENU Return to Web version Multiple Sclerosis Overview What is multiple sclerosis (MS)? Multiple sclerosis is an autoimmune disease that affects the nervous system. Normally, antibodies produced by ...

243

The first Korean patient with Potocki-Shaffer syndrome: a rare cause of multiple exostoses.  

PubMed

Potocki-Shaffer syndrome (PSS, OMIM #601224) is a rare contiguous gene deletion syndrome caused by haploinsufficiency of genes located on the 11p11.2p12. Affected individuals have a number of characteristic features including multiple exostoses, biparietal foramina, abnormalities of genitourinary system, hypotonia, developmental delay, and intellectual disability. We report here on the first Korean case of an 8-yr-old boy with PSS diagnosed by high resolution microarray. Initial evaluation was done at age 6 months because of a history of developmental delay, hypotonia, and dysmorphic face. Coronal craniosynostosis and enlarged parietal foramina were found on skull radiographs. At age 6 yr, he had severe global developmental delay. Multiple exostoses of long bones were detected during a radiological check-up. Based on the clinical and radiological features, PSS was highly suspected. Subsequently, chromosomal microarray analysis identified an 8.6 Mb deletion at 11p11.2 [arr 11p12p11.2 (Chr11:39,204,770-47,791,278)×1]. The patient continued rehabilitation therapy for profound developmental delay. The progression of multiple exostosis has being monitored. This case confirms and extends data on the genetic basis of PSS. In clinical and radiologic aspect, a patient with multiple exostoses accompanying with syndromic features, including craniofacial abnormalities and mental retardation, the diagnosis of PSS should be considered. PMID:25653495

Sohn, Young Bae; Yim, Shin-Young; Cho, Eun-Hae; Kim, Ok-Hwa

2015-02-01

244

The First Korean Patient with Potocki-Shaffer Syndrome: A Rare Cause of Multiple Exostoses  

PubMed Central

Potocki-Shaffer syndrome (PSS, OMIM #601224) is a rare contiguous gene deletion syndrome caused by haploinsufficiency of genes located on the 11p11.2p12. Affected individuals have a number of characteristic features including multiple exostoses, biparietal foramina, abnormalities of genitourinary system, hypotonia, developmental delay, and intellectual disability. We report here on the first Korean case of an 8-yr-old boy with PSS diagnosed by high resolution microarray. Initial evaluation was done at age 6 months because of a history of developmental delay, hypotonia, and dysmorphic face. Coronal craniosynostosis and enlarged parietal foramina were found on skull radiographs. At age 6 yr, he had severe global developmental delay. Multiple exostoses of long bones were detected during a radiological check-up. Based on the clinical and radiological features, PSS was highly suspected. Subsequently, chromosomal microarray analysis identified an 8.6 Mb deletion at 11p11.2 [arr 11p12p11.2 (Chr11:39,204,770-47,791,278)×1]. The patient continued rehabilitation therapy for profound developmental delay. The progression of multiple exostosis has being monitored. This case confirms and extends data on the genetic basis of PSS. In clinical and radiologic aspect, a patient with multiple exostoses accompanying with syndromic features, including craniofacial abnormalities and mental retardation, the diagnosis of PSS should be considered. PMID:25653495

2015-01-01

245

Multiplication 2  

NSDL National Science Digital Library

Try some harder multiplication activities! Missing Factor Meteor Blasting Complete the Missing Step Batter s Up Multiplication Sum Sense Multiplication Challenge a Friend to Grand Prix Multiplication Double Digit Multiplication https://embed.espresso.co.uk/espresso/embed/images/logo_espresso.gif ) no-repeat center center"

Miss Lerdahl

2010-11-16

246

Mastering Multiplication  

NSDL National Science Digital Library

Play the following games to practice your multiplication. Take a swing at Multplication Baseball! (Set with hard) Use your multiplication knowledge and defeat the Mayan Math Monster! (Set to hard) Quick! Stop the Multiplication Invader before it is too late! ...

Ms. Jackson

2007-10-25

247

Multiplication table  

NSDL National Science Digital Library

Help learn First learn go over your Learn The Multiplication table now get some extra help Learn The Multiplication table have fun Learn The multiplication table with games good luck practice test pre test pre test final test ...

bgross

2011-04-14

248

Parenting Multiples  

MedlinePLUS

... the birth of a child. So parents of twins or higher-order multiples (triplets or more) can ... the chances of having multiples. The incidence of twin and higher-order multiple births has climbed rapidly ...

249

Multiplication Rocks!!!  

NSDL National Science Digital Library

Let's practice what we've learned about multiplication. Play at least one game in each of the categories. Times Table Practice: Design the Ultimate Fashion Outfit with Math Models Blast the Meteors before they destroy the ship in Meteor Multiplication More Multiplication: Batter's Up in Baseball Multiplication Win $1,000,000 in Who Wants To Be A Millionaire? ...

Mrs. Peake

2009-04-15

250

Multiplication Mania!  

NSDL National Science Digital Library

These assignments will help you practice your multiplication facts. Work through these multiplication facts. Click on each link and scroll down past the red box to the orange box. Click on \\"Start Multiplication\\". After you type in your answer click on the \\"Check\\" box to check your answer. 1. Practice your multiplication facts 0-3. ...

Mrs. Packard

2005-10-25

251

Multiplication Practice  

NSDL National Science Digital Library

Practice Your Multiplication Skills! Watch These Fun Multiplication Videos *Need a review? Watch the Multiplication is Repeated Addition Video Four Legged Zoo I ve Got 6 Ready or Not Here I Come (5s) Twelve Toes Elementary My Dear 2s Figure 8 Lucky 7s Video My Hero Zero Naughty Number 9 Practice your multiplication skills with these fun games: Multiplication Facts Become the king of multiplication with Castle Quest Dish up some ice cream with Crazy Cone Multiplication. Earn disco moves to make a dinosaur dance with Disco Dino. Design your own granny and make her race in a ...

Miss Lerdahl

2010-02-23

252

Multiple Sclerosis  

MedlinePLUS

Multiple sclerosis (MS) is a nervous system disease that affects your brain and spinal cord. It damages the ... attacks healthy cells in your body by mistake. Multiple sclerosis affects women more than men. It often begins ...

253

Multiple Correlation versus Multiple Regression.  

ERIC Educational Resources Information Center

Describes differences between multiple correlation analysis (MCA) and multiple regression analysis (MRA), showing how these approaches involve different research questions and study designs, different inferential approaches, different analysis strategies, and different reported information. (SLD)

Huberty, Carl J.

2003-01-01

254

Multiplication Mania!  

NSDL National Science Digital Library

Fun games to practice your multiplication facts! Need a refreshing break? Come on over to the lemonade stand...Lemonade Stand At the beach, you can swim, sun, and practice your multiplication facts...Beach Multiplication How fast are you? Click here to...Race the Clock Do you have your spacesuit and astronaut food, are you ready for your...Mission to the Moon ...

Ms. Hoeman

2008-09-18

255

Multiple Trichofolliculomas Mimicking Multiple Trichoepitheliomas  

PubMed Central

Trichofolliculomas are benign hair follicle hamartomas which were initially considered as hair follicle tumors. Usually presenting as a solitary lesion associated with a tuft of vellus hairs, multiple trichofolliculomas are rare. Trichofolliculomas are characterized by a histopathological feature of dermal keratin cyst with cyst wall showing radiating hair follicles. We report this case for the rare presentation of multiple trichofolliculomas on the face which clinically mimicked multiple trichoepitheliomas.

Nayak, Sudhir UK; Shenoi, Shrutakirthi D; Geetha, V; Prabhu, Smitha; Nagel, Bhawna

2015-01-01

256

Multiplication Frenzy!  

NSDL National Science Digital Library

Let's practice multiplication! First, try to win the first place medal in the Fish Race. Then, test your skills by blowing up meteors by getting your multiplication tables right in Meteor Buster. Last, don't let the ants eat your lunch in The Ants Go Marching. ...

Ms. Burks

2010-01-27

257

SAMSN1 Is a Tumor Suppressor Gene in Multiple Myeloma12  

PubMed Central

Multiple myeloma (MM), a hematological malignancy characterized by the clonal growth of malignant plasma cells (PCs) in the bone marrow, is preceded by the benign asymptomatic condition, monoclonal gammopathy of undetermined significance (MGUS). Several genetic abnormalities have been identified as critical for the development of MM; however, a number of these abnormalities are also found in patients with MGUS, indicating that there are other, as yet unidentified, factors that contribute to the onset of MM disease. In this study, we identify a Samsn1 gene deletion in the 5TGM1/C57BL/KaLwRij murine model of myeloma. In addition, SAMSN1 expression is reduced in the malignant CD138 + PCs of patients with MM and this reduced expression correlates to total PC burden. We identify promoter methylation as a potential mechanism through which SAMSN1 expression is modulated in human myeloma cell lines. Notably, re-expression of Samsn1 in the 5TGM1 murine PC line resulted in complete inhibition of MM disease development in vivo and decreased proliferation in stromal cell–PC co-cultures in vitro. This is the first study to identify deletion of a key gene in the C57BL/KaLwRij mice that also displays reduced gene expression in patients with MM and is therefore likely to play an integral role in MM disease development. PMID:25117979

Noll, Jacqueline E.; Hewett, Duncan R.; Williams, Sharon A.; Vandyke, Kate; Kok, Chung; To, Luen B.; Zannettino, Andrew C.W.

2014-01-01

258

Multiple homicides.  

PubMed

A study of multiple homicides or multiple deaths involving a solitary incident of violence by another individual was performed on the case files of the Office of the Medical Examiner of Metropolitan Dade County in Miami, Florida, during 1983-1987. A total of 107 multiple homicides were studied: 88 double, 17 triple, one quadruple, and one quintuple. The 236 victims were analyzed regarding age, race, sex, cause of death, toxicologic data, perpetrator, locale of the incident, and reason for the incident. This article compares this type of slaying with other types of homicide including those perpetrated by serial killers. Suggestions for future research in this field are offered. PMID:2782297

Copeland, A R

1989-09-01

259

CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae.  

PubMed

A variety of techniques for strain engineering in Saccharomyces cerevisiae have recently been developed. However, especially when multiple genetic manipulations are required, strain construction is still a time-consuming process. This study describes new CRISPR/Cas9-based approaches for easy, fast strain construction in yeast and explores their potential for simultaneous introduction of multiple genetic modifications. An open-source tool (http://yeastriction.tnw.tudelft.nl) is presented for identification of suitable Cas9 target sites in S. cerevisiae strains. A transformation strategy, using in vivo assembly of a guideRNA plasmid and subsequent genetic modification, was successfully implemented with high accuracies. An alternative strategy, using in vitro assembled plasmids containing two gRNAs, was used to simultaneously introduce up to six genetic modifications in a single transformation step with high efficiencies. Where previous studies mainly focused on the use of CRISPR/Cas9 for gene inactivation, we demonstrate the versatility of CRISPR/Cas9-based engineering of yeast by achieving simultaneous integration of a multigene construct combined with gene deletion and the simultaneous introduction of two single-nucleotide mutations at different loci. Sets of standardized plasmids, as well as the web-based Yeastriction target-sequence identifier and primer-design tool, are made available to the yeast research community to facilitate fast, standardized and efficient application of the CRISPR/Cas9 system. PMID:25743786

Mans, Robert; van Rossum, Harmen M; Wijsman, Melanie; Backx, Antoon; Kuijpers, Niels G A; van den Broek, Marcel; Daran-Lapujade, Pascale; Pronk, Jack T; van Maris, Antonius J A; Daran, Jean-Marc G

2015-03-01

260

Multiplication Matho  

NSDL National Science Digital Library

This site has students practice their multiplication facts. They compete against the clock while picking the correct response from numerous choices. Student have Matho when they get five colored snakes in a row.

A + Math

2007-12-12

261

Multiple myeloma  

MedlinePLUS

Plasma cell dyscrasia; Plasma cell myeloma; Malignant plasmacytoma; Plasmacytoma of bone; Myeloma - multiple ... myeloma most commonly causes a low red blood cell count ( anemia ), which can lead to fatigue and ...

262

Integer Multiplication  

NSDL National Science Digital Library

In this lesson, middle school students investigate integer multiplication as repeated addition or subtraction using visual models. An accompanying voice explains the visual set-up. The investigation leads students to see how the sign of the factors determines whether the product is positive or negative. An interactive section allows learners to change the factors being multiplied. Ten multiple choice questions wrap up this learning activity.

2007-01-01

263

Multiple Intelligences  

NSDL National Science Digital Library

Objective: To explore Howard Gardner\\'s Multiple Intelligences and apply what you have learned. Materials needed: Computer, Internet access, Word processor. Part 1: Learn who Howard Gardner is. Steps: 1. Go to the following site Howard Gardner Bio. 2. Read Howard Gardner\\'s bio. Part 2: Learn what the multiple intelligences are. Steps: 1. Visit Intelligences in a nut shell or the previous site. 2. Write, in a word processor, a brief description of the intelligences that Dr. ...

Mr. Jepsen

2005-12-02

264

Multiple Sclerosis.  

ERIC Educational Resources Information Center

This module on multiple sclerosis is intended for use in inservice or continuing education programs for persons who administer medications in long-term care facilities. Instructor information, including teaching suggestions, and a listing of recommended audiovisual materials and their sources appear first. The module goal and objectives are then…

Plummer, Nancy; Michael, Nancy, Ed.

265

Multiplication Game  

NSDL National Science Digital Library

This iOS app helps develop strategic thinking and fluency with multiplication facts. Two players take turns selecting one of two factors, 1 - 9, in order to capture products on a grid. The winner is the first player to capture four in a row. This game can be played by two players or one player against the computer.

Hooda Math

2013-03-13

266

Lattice Multiplication  

NSDL National Science Digital Library

Leonardo Fibonacci's multiplication algorithm arrays the digits of multiplicands along a rectangular lattice. Read an explanation of the technique, see a few worked examples, and watch the method in action with a Java applet. Clicking a little off-center of any digit of a multiplicand (left to increase, right to decrease) instantly changes resulting products and sums throughout the lattice.

Interactive Math Miscellany and Puzzles, Alexander Bogomolny

2011-01-01

267

Immediate early responses of avian tracheal epithelial cells to infection with highly pathogenic avian influenza  

Technology Transfer Automated Retrieval System (TEKTRAN)

Highly pathogenic (HP) avian influenza viruses (AIV) present an on going threat to the U.S. poultry industry. In order to develop new AIV control strategies it is necessary to understand the underlying mechanism of viral infection. Because the early events of AIV infection can occur on tracheal ep...

268

Current aspects of therapeutic reduction mammaplasty for immediate early breast cancer management: An update.  

PubMed

Breast-conservation surgery (BCS) is established as a safe surgical treatment for most patients with early breast cancer. Recently, advances in oncoplastic techniques are capable of preserving the breast form and quality of life. Although most BCS defects can be managed with primary closure, the aesthetic outcome may be unpredictable. Among technical options, therapeutic reduction mammaplasty (TRM) remains a useful procedure since the BCS defect can be repaired and the preoperative appearance can be improved, resulting in more proportional breasts. As a consequence of rich breast tissue vascularization, the greater part of reduction techniques have based their planning on preserving the pedicle of the nipple-areola complex after tumor removal. Reliable circulation and improvement of a conical shape to the breast are commonly described in TRM reconstructions. With an immediate approach, the surgical process is smooth since both procedures can be carried out in one operative setting. Additionally, it permits wider excision of the tumor, with a superior mean volume of the specimen and potentially reduces the incidence of margin involvement. Regardless of the fact that there is no consensus concerning the best TRM technique, the criteria is determined by the surgeon's experience, the extent/location of glandular tissue resection and the size of the defect in relation to the size of the remaining breast. The main advantages of the technique utilized should include reproducibility, low interference with the oncological treatment and long-term results. The success of the procedure depends on patient selection, coordinated planning and careful intra-operative management. PMID:24527398

Munhoz, Alexandre Mendonça; Montag, Eduardo; Gemperli, Rolf

2014-02-10

269

Current aspects of therapeutic reduction mammaplasty for immediate early breast cancer management: An update  

PubMed Central

Breast-conservation surgery (BCS) is established as a safe surgical treatment for most patients with early breast cancer. Recently, advances in oncoplastic techniques are capable of preserving the breast form and quality of life. Although most BCS defects can be managed with primary closure, the aesthetic outcome may be unpredictable. Among technical options, therapeutic reduction mammaplasty (TRM) remains a useful procedure since the BCS defect can be repaired and the preoperative appearance can be improved, resulting in more proportional breasts. As a consequence of rich breast tissue vascularization, the greater part of reduction techniques have based their planning on preserving the pedicle of the nipple-areola complex after tumor removal. Reliable circulation and improvement of a conical shape to the breast are commonly described in TRM reconstructions. With an immediate approach, the surgical process is smooth since both procedures can be carried out in one operative setting. Additionally, it permits wider excision of the tumor, with a superior mean volume of the specimen and potentially reduces the incidence of margin involvement. Regardless of the fact that there is no consensus concerning the best TRM technique, the criteria is determined by the surgeon’s experience, the extent/location of glandular tissue resection and the size of the defect in relation to the size of the remaining breast. The main advantages of the technique utilized should include reproducibility, low interference with the oncological treatment and long-term results. The success of the procedure depends on patient selection, coordinated planning and careful intra-operative management. PMID:24527398

Munhoz, Alexandre Mendonça; Montag, Eduardo; Gemperli, Rolf

2014-01-01

270

Mapping vocalization-related immediate early gene expression in echolocating bats  

Microsoft Academic Search

Recent studies of spontaneously vocalizing primates, cetaceans, bats and rodents suggest these animals possess a limited but meaningful capacity to manipulate the timing and acoustic structure of their vocalizations, yet the neural substrate for even the simplest forms of vocal modulation in mammals remains unknown. Echolocating bats rapidly and routinely manipulate the acoustic structure of their outgoing vocalizations to improve

Christine P. Schwartz; Michael S. Smotherman

2011-01-01

271

Sustained transcription of the immediate early gene Arc in the dentate gyrus after spatial exploration.  

PubMed

After spatial exploration in rats, Arc mRNA is expressed in ?2% of dentate gyrus (DG) granule cells, and this proportion of Arc-positive neurons remains stable for ?8 h. This long-term presence of Arc mRNA following behavior is not observed in hippocampal CA1 pyramidal cells. We report here that in rats ?50% of granule cells with cytoplasmic Arc mRNA, induced some hours previously during exploration, also show Arc expression in the nucleus. This suggests that recent transcription can occur long after the exploration behavior that elicited it. To confirm that the delayed nuclear Arc expression was indeed recent transcription, Actinomycin D was administered immediately after exploration. This treatment resulted in inhibition of recent Arc expression both when evaluated shortly after exploratory behavior as well as after longer time intervals. Together, these data demonstrate a unique kinetic profile for Arc transcription in hippocampal granule neurons following behavior that is not observed in other cell types. Among a number of possibilities, this sustained transcription may provide a mechanism that ensures that the synaptic connection weights in the sparse population of granule cells recruited during a given behavioral event are able to be modified. PMID:23345235

Ramirez-Amaya, Victor; Angulo-Perkins, Arafat; Chawla, Monica K; Barnes, Carol A; Rosi, Susanna

2013-01-23

272

Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes  

NASA Technical Reports Server (NTRS)

Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

De Luca, Laurival A Jr; Xu, Zhice; Schoorlemmer, Guus H M.; Thunhorst, Robert L.; Beltz, Terry G.; Menani, Jose V.; Johnson, Alan Kim

2002-01-01

273

Rapid effects of triiodothyronine on immediate-early gene expression in Schwann cells.  

PubMed

In the peripheral nervous system, triiodothyronine (T3) plays an important role in the development and regeneration of nerve fibers and in myelin formation. However, the target genes of T3 in peripheral nerves remain to be identified. We investigated whether T3 activated genes of transcription factors in Schwann cells. Expression of egr-1 (krox-24), egr-2 (krox-20), egr-3, c-jun, junB, c-fos, fosB, fra-1, fra-2, and CREB genes was analyzed by reverse transcription-polymerase chain reaction (RT-PCR) in Schwann cells isolated from neonatal rat sciatic nerves and in the cell lines MSC-80 (mouse Schwann cells), NIH-3T3 (mouse fibroblasts), and CHO (Chinese hamster ovary cells). Some of these transcription factors have been shown to be involved in Schwann cell differentiation. T3 triggered a rapid (15-30 min), transient (1-2-h) and strong (6- to 15-fold) stimulation of Egr-1, Egr-2, Egr-3, Jun B, c-Fos, and Fos B mRNA expression in Schwann cells. In contrast, expression of c-Jun, Fra-1, Fra-2, and CREB mRNA was not affected by T3. The stimulatory effects of T3 could be abolished by adding actinomycin D. T3 triggered the same pattern of gene stimulation in the mouse Schwann cell line MSC80, but not in the NIH-3T3 and CHO cell lines. Serum activated all the genes that responded to T3 and in addition fra-1 and fra-2, but not c-jun and CREB. Immunoblotting showed that the increase in Egr-1 and c-Fos mRNA levels was accompanied by an increase in the corresponding proteins. In addition, shifts of the protein bands indicated a posttranslational modification of the two proteins. These effects of T3 are likely to be mediated by the intracellular T3 receptor, as the D-isomer RT3 and T0, which do not bind to T3 receptors, proved ineffective. The present data suggested that T3 may regulate Schwann cell functions and differentiation by transiently activating the expression of specific transcription factors. PMID:11460264

Mercier, G; Turque, N; Schumacher, M

2001-08-01

274

Two different heat shock transcription factors regulate immediate early expression of stress genes in Arabidopsis  

Microsoft Academic Search

In order to assess the specific functional roles of different plant heat shock transcription factors (HSFs) we have isolated T-DNA insertion mutants in the AtHsf1 and AtHsf3 genes of Arabidopsis thaliana. Complete and selective loss of the promoter binding activities of AtHSF1 or AtHSF3, verified by immunoprecipitation assays, had no obvious effects on the heat shock (HS) response in the

C. Lohmann; G. Eggers-Schumacher; M. Wunderlich; F. Schöffl

2004-01-01

275

Sex Differences in Social Interaction in Rats: Role of the Immediate-Early Gene zif268  

Microsoft Academic Search

Given both the high prevalence of anxiety disorders in women and the fact that little is known about the mechanisms of gender differences in anxiety, our primary aim in this study was to investigate the neurobiological mechanisms underlying sex differences in social anxiety-like behavior in rats. Through the use of zif268 antisense oligodeoxynucleotides (zif ASO), we induced a temporary downregulation

Ashley Stack; Nicole Carrier; David Dietz; Fiona Hollis; Jamie Sorenson; Mohamed Kabbaj

2010-01-01

276

The NR4A subgroup: immediate early response genes with pleiotropic physiological roles  

PubMed Central

The nuclear hormone receptor (NR) superfamily includes the orphan NR4A subgroup, comprised of Nur77 (NR4A1), Nurr1 (NR4A2) and NOR-1 (NR4A3). These NRs are classified as early response genes, are induced by a diverse range of signals, including fatty acids, stress, growth factors, cytokines, peptide hormones, phorbol esters, neurotransmitters, and physical stimuli (for example magnetic fields, shear stress). The ability to sense and rapidly respond to changes in the cellular environment thus appears to be a hallmark of this subfamily. The members of the NR4A subgroup are well conserved in the DNA binding domain (~91-95%) and the C-terminal ligand-binding domain (~60%), but are divergent in the N-terminal AB region. These receptors bind as monomers, homodimers and heterodimers with RXRs (to mediate retinoid signaling) to different permutations of the canonical NR binding motif. The NR4A subgroup activates gene expression in a constitutive ligand-independent manner. NR4A-mediated trans-activation (LBD) involves unusually active N-terminal AF-1 domains that mediate coactivator recruitment. Moreover, the NR4A receptors encode atypical LBDs and AF-2 domains. For example, the LBDs contain no cavity due to bulky hydrophobic residue side chains, and lack the classical coactivator-binding cleft constituted by helices 3, 4 and 12. However, a hydrophobic patch exists between helices 11 and 12, that encodes a novel cofactor interface that modulates transcriptional activity. In line with the pleiotropic physiological stimuli that induce the NR4A subgroup, these orphan NRs have been implicated in cell cycle regulation (and apoptosis), neurological disease, steroidogenesis, inflammation, carcinogenesis and atherogenesis. PMID:16604165

Maxwell, Megan A.; Muscat, George E.O.

2006-01-01

277

A PDGF-Regulated Immediate Early Gene Response Initiates Neuronal Differentiation in Ventricular Zone Progenitor Cells  

Microsoft Academic Search

When exposed to platelet-derived growth factor (PDGF), uncommitted neuroepithelial cells from the developing cortex of embryonic day 14 (E14) rats develop into neurons. Outward signs of the neuronal phenotype are not observed for 4 days following exposure to PDGF. However, only a brief (2–3 hr) period of PDGF receptor activation is required to initiate neuronal development. During the window of

Brenda P Williams; John K Park; John A Alberta; Stephan G Muhlebach; Grace Y Hwang; Thomas M Roberts; Charles D Stiles

1997-01-01

278

[Multiple myeloma].  

PubMed

Multiple myeloma causes debilitating clinical symptoms including intractable bone pain, disabling multiple fractures and hypercalcemia. Bisphosphonates, potent inhibitors of osteoclast-mediated bone destruction, prevent skeletal-related events in myeloma. However, the impact of long-term bisphosphonate use remains unclear because of insufficient follow-up, while osteonecrosis of the jaw (ONJ) emerges as a major concern. The proteosome inhibitor bortezomib is a novel anti-myeloma agent, which has been recently drawn a considerable attention in its anabolic effects to resume bone formation in patients with myeloma. It is important to clarify the roles of these bone-targeting agents in the treatment for a myeloma bone disease and make the best use of them by eliminating underlying risk of their adverse effects. PMID:19432122

Abe, Masahiro

2009-05-01

279

Multiplication Mania!  

NSDL National Science Digital Library

You\\'ve been practicing your multiplication facts, these games will help you develop your skills! First, you will read some stories that may help you remember your 9 X Tables better. Read through these stories and pick your favorite to share with a partner sitting close to you. Click here 9 X Tables Stories With this game, you need to save the mokeys apples so the crocodile wont eat ...

Mrs. Reeves

2006-11-06

280

Multiple Nuclear Localization Signals Mediate Nuclear Localization of the GATA Transcription Factor AreA  

PubMed Central

The Aspergillus nidulans GATA transcription factor AreA activates transcription of nitrogen metabolic genes in response to nitrogen limitation and is known to accumulate in the nucleus during nitrogen starvation. Sequence analysis of AreA revealed multiple nuclear localization signals (NLSs), five putative classical NLSs conserved in fungal AreA orthologs but not in the Saccharomyces cerevisiae functional orthologs Gln3p and Gat1p, and one putative noncanonical RRX33RXR bipartite NLS within the DNA-binding domain. In order to identify the functional NLSs in AreA, we constructed areA mutants with mutations in individual putative NLSs or combinations of putative NLSs and strains expressing green fluorescent protein (GFP)-AreA NLS fusion genes. Deletion of all five classical NLSs individually or collectively did not affect utilization of nitrogen sources or AreA-dependent gene expression and did not prevent AreA nuclear localization. Mutation of the bipartite NLS conferred the inability to utilize alternative nitrogen sources and abolished AreA-dependent gene expression likely due to effects on DNA binding but did not prevent AreA nuclear localization. Mutation of all six NLSs simultaneously prevented AreA nuclear accumulation. The bipartite NLS alone strongly directed GFP to the nucleus, whereas the classical NLSs collaborated to direct GFP to the nucleus. Therefore, AreA contains multiple conserved NLSs, which show redundancy and together function to mediate nuclear import. The noncanonical bipartite NLS is conserved in GATA factors from Aspergillus, yeast, and mammals, indicating an ancient origin. PMID:24562911

Hunter, Cameron C.; Siebert, Kendra S.; Downes, Damien J.; Wong, Koon Ho; Kreutzberger, Sara D.; Fraser, James A.; Clarke, David F.; Hynes, Michael J.; Davis, Meryl A.

2014-01-01

281

Screening of point mutations by multiple SSCP analysis in the dystrophin gene  

SciTech Connect

Duchenne muscular dystrophy (DMD) is a lethal, X-linked neuromuscular disorder. The population frequency of DMD is one in approximately 3500 boys, of which one third is thought to be a new mutant. The DMD gene is the largest known to date, spanning over 2,3 Mb in band Xp21.2; 79 exons are transcribed into a 14 Kb mRNA coding for a protein of 427 kD which has been named dystrophin. It has been shown that about 65% of affected boys have a gene deletion with a wide variation in localization and size. The remaining affected individuals who have no detectable deletions or duplications would probably carry more subtle mutations that are difficult to detect. These mutations occur in several different exons and seem to be unique to single patients. Their identification represents a formidable goal because of the large size and complexity of the dystrophin gene. SSCP is a very efficient method for the detection of point mutations if the parameters that affect the separation of the strands are optimized for a particular DNA fragment. The multiple SSCP allows the simultaneous study of several exons, and implies the use of different conditions because no single set of conditions will be optimal for all fragments. Seventy-eight DMD patients with no deletion or duplication in the dystrophin gene were selected for the multiple SSCP analysis. Genomic DNA from these patients was amplified using the primers described for the diagnosis procedure (muscle promoter and exons 3, 8, 12, 16, 17, 19, 32, 45, 48 and 51). We have observed different mobility shifts in bands corresponding to exons 8, 12, 43 and 51. In exons 17 and 45, altered electrophoretic patterns were found in different samples identifying polymorphisms already described.

Lasa, A.; Baiget, M.; Gallano, P. [Hospital Sant Pau, Barcelona (Spain)

1994-09-01

282

Multiple Myeloma  

NSDL National Science Digital Library

This patient education program discusses multiple myeloma including the causes, symptoms, diagnosis, and treatment options for this type of cancer, with their benefits and side effects. This resource is a MedlinePlus Interactive Health Tutorial from the National Library of Medicine, designed and developed by the Patient Education Institute. NOTE: This tutorial requires a special Flash plug-in, version 4 or above. If you do not have Flash, you will be prompted to obtain a free download of the software before you start the tutorial. You will also need an Acrobat Reader, available as a free download, in order to view the Reference Summary.

Patient Education Institute

283

Multiple sclerosis  

PubMed Central

Multiple sclerosis is a complex genetic disease associated with inflammation in the CNS white matter thought to be mediated by autoreactive T cells. Clonal expansion of B cells, their antibody products, and T cells, hallmarks of inflammation in the CNS, are found in MS. This review discusses new methods to define the molecular pathology of human disease with high-throughput examination of germline DNA haplotypes, RNA expression, and protein structures that will allow the generation of a new series of hypotheses that can be tested to develop better understanding of and therapies for this disease. PMID:15067307

Hafler, David A.

2004-01-01

284

Multiple System Atrophy  

MedlinePLUS

NINDS Multiple System Atrophy Information Page Condensed from Multiple System Atrophy Fact Sheet Table of Contents (click to jump to sections) ... being done? Clinical Trials Organizations What is Multiple System Atrophy? Multiple system atrophy (MSA) is a progressive ...

285

Multiple myeloma.  

PubMed

Multiple myeloma (MM) is a B cell neoplasm of the bone marrow with a complex array of clinical manifestations including anemia, bone lesions, hypercalcemia, renal dysfunction, and compromised immune function. It accounts for 10%-15% of all hematologic malignancies, and 20% of deaths related to cancers of the blood and bone marrow. The diagnosis of MM is based on the presence of neoplastic plasma cells in the bone marrow or other extramedullary sites, along with evidence of disease-related organ dysfunction. Although the disease remains incurable, significant advances in both basic and translational research have enhanced understanding of disease pathogenesis and guided the development of new and more effective therapies. These agents include the immunomodulatory drugs thalidomide and lenalidomide, the proteasome inhibitor bortezomib, and other therapeutics that are currently being evaluated. This review highlights important historical landmarks in the field of MM, examines the pathogenesis and clinical manifestations of the disease, and outlines principles of both diagnosis and treatment of MM. PMID:21090965

Laubach, Jacob; Richardson, Paul; Anderson, Kenneth

2011-01-01

286

Methionine adenosyltransferase 1A gene deletion disrupts hepatic VLDL assembly in mice  

PubMed Central

Very-low-density lipoprotein (VLDL) secretion provides a mechanism to export triglycerides (TG) from the liver to peripheral tissues, maintaining lipid homeostasis. In non-alcoholic fatty-liver disease (NAFLD) VLDL secretion disturbances are unclear. Methionine adenosyltransferase (MAT) is responsible for S-adenosylmethionine (SAMe) synthesis and MAT I and III are the products of MAT1A gene. Deficient MAT I and III activities and SAMe content in the liver have been associated with NAFLD but whether MAT1A is required for normal VLDL assembly remains unknown. We investigated the role of MAT1A on VLDL assembly in two metabolic contexts: in 3-month-old MAT1A-knockout mice (3-KO), with no signs of liver injury, and in 8-month-old MAT1A-knockout mice (8-KO), harbouring non-alcoholic steatohepatitis (NASH). In 3-KO mice liver there is a potent effect of MAT1A deletion on lipid handling, decreasing mobilization of TG stores and secretion in VLDL and phosphatidylcholine synthesis via phosphatidylethanolamine N-methyltransferase. MAT1A deletion also increased VLDL-apoB secretion leading to small, lipid poor VLDL particles. Administration of SAMe to 3-KO mice for 7 days recovered crucial altered processes in VLDL assembly and features of the secreted lipoproteins. The unfolded-protein-response was activated in 8-KO mice liver, in which TG-accumulated and the phosphatidylcholine to phosphatidylethanolamine ratio reduced in the ER, whereas the secretion of TG and apoB in VLDL increased and the VLDL physical characteristics resembled that in 3-KO. MAT1A deletion also altered plasma lipid homeostasis, with an increase in lipid transport in LDL-subclasses and decrease in HDL-subclasses. Conclusions MAT1A is required for normal VLDL assembly and plasma lipid homeostasis in mice. Impaired VLDL synthesis, mainly due to SAMe deficiency, contributes to NAFLD development in MAT1A-KO mice. PMID:21837751

Cano, Ainara; Buqué, Xabier; Martínez-Uña, Maite; Aurrekoetxea, Igor; Menor, Ariane; García-Rodriguez, Juan L; Lu, Shelly C; Martínez-Chantar, M. Luz; Mato, José M.; Ochoa, Begoña; Aspichueta, Patricia

2011-01-01

287

Unequal interchromosomal rearrangements may result in elastin gene deletions causing the Williams-Beuren syndrome  

Microsoft Academic Search

Williams-Beuren syndrome (WBS) is generally the consequence of an interstitial microdeletion at 7q11.23, which includes the elastin gene, thus causing hemizygosity at the elastin gene locus. The origin of the deletion has been reported by many authors to be maternal in ~60% and paternal in 40% of cases. Segregation analysis of grandparental markers flanking the microdeletion region in WBS patients

Fabrizio Dutly; Albert Schinzel

1996-01-01

288

Mutation mismatch repair gene deletions in diffuse large B-cell lymphoma.  

PubMed

To further unravel the molecular pathogenesis of diffuse large B-cell lymphoma (DLBCL), we performed high-resolution comparative genomic hybridization on lymph node biopsies from 70 patients. With this strategy, we identified microdeletions of genes involved in the mutation mismatch repair (MMR) pathway in two samples. The first patient presented with a homozygous deletion of MSH2-MSH6 due to duplication of an unbalanced pericentric inversion of chromosome 2. The other case showed a PMS2 heterozygous deletion. PMS2 and MSH2-MSH6 abnormalities, respectively, resulted in a decrease and complete loss of gene expression. However, unlike tumors associated with the hereditary non-polyposis colorectal cancer syndrome or immunodeficiency-related lymphomas, no microsatellite instability was detected. Mutational profiles revealed especially in one patient an aberrant hypermutation without a clear activation-induced cytidine deaminase signature, indicating a breakdown of the high-fidelity repair in favor of the error-prone repair pathway. Our findings suggest that in a rare subset of patients, inactivation of the genes of the MMR pathway is likely an important step in the molecular pathogenesis of DLBCL and does not involve the same molecular mechanisms as other common neoplasms with MMR deficiency. PMID:23066952

Couronné, Lucile; Ruminy, Philippe; Waultier-Rascalou, Agathe; Rainville, Vinciane; Cornic, Marie; Picquenot, Jean-Michel; Figeac, Martin; Bastard, Christian; Tilly, Hervé; Jardin, Fabrice

2013-05-01

289

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas  

SciTech Connect

From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma}-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1994-05-01

290

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas  

SciTech Connect

From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma} rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of {sup 60}Co {gamma} rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1993-04-01

291

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas  

SciTech Connect

From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF[sub 1] mice irradiated with [sup 60]Co [gamma] rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of [sup 60]Co [gamma] rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from [gamma]-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5[prime] region of the mRb gene.

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1993-01-01

292

Enhanced transduction of CAR-negative cells by protein IX-gene deleted adenovirus 5 vectors.  

PubMed

In human adenoviruses (HAdV), 240 copies of the 14.3-kDa minor capsid protein IX stabilize the capsid. Three N-terminal domains of protein IX form triskelions between hexon capsomers. The C-terminal domains of four protein IX monomers associate near the facet periphery. The precise biological role of protein IX remains enigmatic. Here we show that deletion of the protein IX gene from a HAdV-5 vector enhanced the reporter gene delivery 5 to 25-fold, specifically to Coxsackie and Adenovirus Receptor (CAR)-negative cell lines. Deletion of the protein IX gene also resulted in enhanced activation of peripheral blood mononuclear cells. The mechanism for the enhanced transduction is obscure. No differences in fiber loading, integrin-dependency of transduction, or factor-X binding could be established between protein IX-containing and protein IX-deficient particles. Our data suggest that protein IX can affect the cell tropism of HAdV-5, and may function to dampen the innate immune responses against HAdV particles. PMID:21130482

de Vrij, Jeroen; van den Hengel, Sanne K; Uil, Taco G; Koppers-Lalic, Danijela; Dautzenberg, Iris J C; Stassen, Oscar M J A; Bárcena, Montserrat; Yamamoto, Masato; de Ridder, Corrina M A; Kraaij, Robert; Kwappenberg, Kitty M; Schilham, Marco W; Hoeben, Rob C

2011-02-01

293

The integrated response of primary metabolites to gene deletions and the environment.  

PubMed

Intracellular metabolites arise from the molecular integration of genomic and environmental factors that jointly determine metabolic activity. However, it is not clear how the interplay of genotype, nutrients, growth, and fluxes affect metabolite concentrations globally. Here we used quantitative metabolomics to assess the combined effect of environment and genotype on the metabolite composition of a yeast cell. We analyzed a panel of 34 yeast single-enzyme knockout mutants grown on three archetypical carbon sources, generating a dataset of 400 unique metabolome samples. The different carbon sources globally affected the concentrations of intermediates, both directly, by changing the thermodynamic potentials (?(r)G) as a result of the substrate influx, and indirectly, by cellular regulation. In contrast, enzyme deletion elicited only local accumulation of the metabolic substrate immediately upstream of the lesion. Key biosynthetic precursors and cofactors were generally robust under all tested perturbations in spite of changes in fluxes and growth rate. PMID:23340584

Ewald, Jennifer Christina; Matt, Tanja; Zamboni, Nicola

2013-03-01

294

Gene Deletion of VIP Leads to Increased Mortality Associated with Progressive Right Ventricular Hypertrophy.  

PubMed

Vasoactive Intestinal Peptide (VIP) knockout mice exhibit asthma, pulmonary hypertension, and left ventricular wall thinning. Humans with these disorders have premature death. We show here that VIP KO mice have reduced survival (100% mortality at 20 months), vs. 100% survival among WT C57BL/6 mice. Moreover, the ratios of weights of right ventricle divided by left ventricle plus septum were progressively increased in VIP KO mice with age. Core temperatures were lower in VIP KO mice when compared to WT littermates, with an associated pro-inflammatory cytokine milieu. Overall, our results indicate that VIP is important for survival in mice. Its absence leads to increased mortality, with progressive right ventricular hypertrophy as a surrogate of pulmonary hypertension, lower body weight, hypothermia, and pro-inflammatory milieu. These studies support VIP as a novel therapeutic agent in pulmonary hypertension. PMID:24860842

Szema, Anthony M; Hamidi, Sayyed A

2014-04-01

295

Gene Deletion of VIP Leads to Increased Mortality Associated with Progressive Right Ventricular Hypertrophy  

PubMed Central

Vasoactive Intestinal Peptide (VIP) knockout mice exhibit asthma, pulmonary hypertension, and left ventricular wall thinning. Humans with these disorders have premature death. We show here that VIP KO mice have reduced survival (100% mortality at 20 months), vs. 100% survival among WT C57BL/6 mice. Moreover, the ratios of weights of right ventricle divided by left ventricle plus septum were progressively increased in VIP KO mice with age. Core temperatures were lower in VIP KO mice when compared to WT littermates, with an associated pro-inflammatory cytokine milieu. Overall, our results indicate that VIP is important for survival in mice. Its absence leads to increased mortality, with progressive right ventricular hypertrophy as a surrogate of pulmonary hypertension, lower body weight, hypothermia, and pro-inflammatory milieu. These studies support VIP as a novel therapeutic agent in pulmonary hypertension. PMID:24860842

Szema, Anthony M.; Hamidi, Sayyed A.

2014-01-01

296

SPC-Cre-ERT2 transgenic mouse for temporal gene deletion in alveolar epithelial cells.  

PubMed

Although several Cre-loxP-based gene knockout mouse models have been generated for the study of gene function in alveolar epithelia in the lung, their applications are still limited. In this study, we developed a SPC-Cre-ER(T2) mouse model, in which a tamoxifen-inducible Cre recombinase (Cre-ER(T2)) is under the control of the human surfactant protein C (SPC) promoter. The specificity and efficiency of Cre-ER(T2) activity was first evaluated by crossing SPC-Cre-ER(T2) mouse with ROSA26R mouse, a ?-galactosidase reporter strain. We found that Cre-ER(T2) was expressed in 30.7% type II alveolar epithelial cells of SPC-Cre-ER(T2)/ROSA26R mouse lung tissues in the presence of tamoxifen. We then tested the tamoxifen-inducible recombinase activity of Cre-ER(T2) in a mouse strain bearing TSC1 conditional knockout alleles (TSC1(fx/fx)). TSC1 deletion was detected in the lungs of tamoxifen treated SPC-Cre-ER(T2)/TSC1(fx/fx) mice. Therefore this SPC-Cre-ER(T2) mouse model may be a valuable tool to investigate functions of genes in lung development, physiology and disease. PMID:23049940

Gui, Yao-Song; Wang, Lianmei; Tian, Xinlun; Feng, Ruie; Ma, Aiping; Cai, Baiqiang; Zhang, Hongbing; Xu, Kai-Feng

2012-01-01

297

SPC-Cre-ERT2 Transgenic Mouse for Temporal Gene Deletion in Alveolar Epithelial Cells  

PubMed Central

Although several Cre-loxP-based gene knockout mouse models have been generated for the study of gene function in alveolar epithelia in the lung, their applications are still limited. In this study, we developed a SPC-Cre-ERT2 mouse model, in which a tamoxifen-inducible Cre recombinase (Cre-ERT2) is under the control of the human surfactant protein C (SPC) promoter. The specificity and efficiency of Cre-ERT2 activity was first evaluated by crossing SPC-Cre-ERT2 mouse with ROSA26R mouse, a ?-galactosidase reporter strain. We found that Cre-ERT2 was expressed in 30.7% type II alveolar epithelial cells of SPC-Cre-ERT2/ROSA26R mouse lung tissues in the presence of tamoxifen. We then tested the tamoxifen-inducible recombinase activity of Cre-ERT2 in a mouse strain bearing TSC1 conditional knockout alleles (TSC1fx/fx). TSC1 deletion was detected in the lungs of tamoxifen treated SPC-Cre-ERT2/TSC1fx/fx mice. Therefore this SPC-Cre-ERT2 mouse model may be a valuable tool to investigate functions of genes in lung development, physiology and disease. PMID:23049940

Gui, Yao-Song; Wang, Lianmei; Tian, Xinlun; Feng, Ruie; Ma, Aiping; Cai, Baiqiang; Zhang, Hongbing; Xu, Kai-Feng

2012-01-01

298

Left-sided cryptorchidism in mice with Wilms Tumour 1 gene deletion in gubernaculum testis  

PubMed Central

A significant number of patients with germline mutations in the Wilms tumour 1 (WT1) gene, a transcriptional factor essential for early renal and gonadal development, displays cryptorchidism or non-scrotal testis position. We show here that WT1 is expressed during development in the mouse gubernacular ligament connecting the testis to the abdominal wall. Conditional inactivation of Wt1 in the gubernaculum (GU-WT1KO animals) resulted in abnormal differentiation of the gubernacula during development and in about 40 % adult males, unilateral, always left-sided, cryptorchidism. At birth the right testis was positioned above the processus vaginalis and eventually moved into the developing scrotal pouch. In affected mutants the left testis was displaced from the normal position and the left processus vaginalis failed to form. The analysis of testicular descent at different stages of postnatal development suggests that the unilateral cryptorchidism might be caused by the asymmetry in the position of abdominal organs providing a higher degree of mobility for the left testis. Spermatogenesis in GU-WT1KO animals was blocked in cryptorchid testes located in a high pararenal position but was maintained in testes located in a low abdominal position. Conditional inactivation of both Wt1 and androgen receptor (Ar) genes in gubernaculum led to a bilateral asymmetrical cryptorchidism in all mutant males with the left testis again located higher than the right one. The malformations induced by WT1 and AR deficiency in gubernaculum and processus vaginalis, in combination with mechanical constraints on testis descent, determine the final position of the testes. In summary, our data indicate that WT1 is directly involved in gubernaculum differentiation. Taken together the results of the study underline the complex nature of testicular descent with an involvement in this process of several genetic factors and developmental events. PMID:23288785

Kaftanovskaya, Elena M.; Neukirchner, Giselle; Huff, Vicki; Agoulnik, Alexander I.

2013-01-01

299

Gene-deleted live-attenuated Trypanosoma cruzi parasites as vaccines to protect against Chagas disease.  

PubMed

Chagas disease is a neglected tropical disease caused by the protozoan parasite Trypanosoma cruzi. This illness is now becoming global, mainly due to congenital transmission, and so far, there are no prophylactic or therapeutic vaccines available to either prevent or treat Chagas disease. Therefore, different approaches aimed at identifying new protective immunogens are urgently needed. Live vaccines are likely to be more efficient in inducing protection, but safety issues linked with their use have been raised. The development of improved protozoan genetic manipulation tools and genomic and biological information has helped to increase the safety of live vaccines. These advances have generated a renewed interest in the use of genetically attenuated parasites as vaccines against Chagas disease. This review discusses the protective capacity of genetically attenuated parasite vaccines and the challenges and perspectives for the development of an effective whole-parasite Chagas disease vaccine. PMID:25496192

Sánchez-Valdéz, Fernando J; Pérez Brandán, Cecilia; Ferreira, Arturo; Basombrío, Miguel Ángel

2015-05-01

300

Partial Gene Deletions of PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies  

PubMed Central

Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal neuropathy that is commonly caused by a reciprocal 1.5?Mb deletion on chromosome 17p11.2, at the site of the peripheral myelin protein 22 (PMP22) gene. Other patients with similar phenotypes have been shown to harbor point mutations or small deletions, although there is some clinical variation across these patients. In this report, we describe a case of HNPP with copy number changes in exon or promoter regions of PMP22. Multiplex ligation-dependent probe analysis revealed an exon 1b deletion in the patient, who had been diagnosed with HNPP in the first decade of life using molecular analysis. PMID:25506001

Cho, Sun-Mi; Kim, Yoonjung; Lee, Sang Guk; Yang, Jin-Young

2014-01-01

301

Increased antidepressant sensitivity after prefrontal cortex glucocorticoid receptor gene deletion in mice.  

PubMed

Our laboratory has previously shown that antidepressants regulate glucocorticoid receptor (GR) expression in the prefrontal cortex (PFC). To determine if PFC GR are involved in antidepressant effects on behavior or hypothalamic-pituitary-adrenocortical (HPA) axis activity, we treated floxed GR male mice with saline or 15 or 30 mg/kg/d imipramine after PFC injection of adeno-associated virus 2/9 vectors transducing expression of Cre recombinase, to knock-down GR (PFC-GRKD), or green fluorescent protein (PFC-GFP), to serve as a control. The pattern of virally transduced GR deletion, common to all imipramine treatment groups, included the infralimbic, prelimbic, and medial anterior cingulate cortex at its largest extent, but was confined to the prelimbic and anterior cingulate cortex at its smallest extent. PFC GR knock-down increased behavioral sensitivity to imipramine, with imipramine-treated PFC-GRKD but not PFC-GFP mice exhibiting significant decreases in depression-like immobility during forced swim. PFC GR deletion did not alter general locomotor activity. The 30 mg/kg dose of imipramine increased plasma corticosterone levels immediately after a 5-min forced swim, but PFC GR knock-down had no significant effect on plasma corticosterone under these experimental conditions. We conclude that PFC GR knock-down, likely limited to the medial prelimbic and anterior cingulate cortices, can increase behavioral sensitivity to antidepressants. These findings indicate a novel role for PFC GR in influencing antidepressant response. PMID:25447332

Hussain, Rifat J; Jacobson, Lauren

2015-01-01

302

Nrf2 gene deletion fails to alter psychostimulant-induced behavior or neurotoxicity  

Microsoft Academic Search

The transcription factor NF-E2-related factor (Nrf2) regulates the induction of phase 2 detoxifying enzymes by oxidative stress, including synthesis of the catalytic subunit (xCT) of the heterodimeric cystine–glutamate exchanger (system xc-). Repeated cocaine treatment in rats causes persistent neuroadaptations in glutamate neurotransmission in the nucleus accumbens that result, in part, from reduced activity of system xc-. Since in vitro under-

Alejandra M. Pacchioni; Joseph Vallone; Roberto I. Melendez; Andy Shih; Timothy H. Murphy; Peter W. Kalivas

2007-01-01

303

Deciphering the effects of gene deletion on yeast longevity using network and machine learning approaches.  

PubMed

Longevity is one of the most basic and one of the most essential properties of all living organisms. Identification of genes that regulate longevity would increase understanding of the mechanisms of aging, so as to help facilitate anti-aging intervention and extend the life span. In this study, based on the network features and the biochemical/physicochemical features of the deletion network and deletion genes, as well as their functional features, a two-layer model was developed for predicting the deletion effects on yeast longevity. The first stage of our prediction approach was to identify whether the deletion of one gene would change the life span of yeast; if it did, the second stage of our procedure would automatically proceed to predict whether the deletion of one gene would increase or decrease the life span. It was observed by analyzing the predicted results that the functional features (such as mitochondrial function and chromatin silencing), the network features (such as the edge density and edge weight density of the deletion network), and the local centrality of deletion gene, would have important impact for predicting the deletion effects on longevity. It is anticipated that our model may become a useful tool for studying longevity from the angle of genes and networks. Moreover, it has not escaped our notice that, after some modification, the current model can also be used to study many other phenotype prediction problems from the angle of systems biology. PMID:22239951

Huang, Tao; Zhang, Jian; Xu, Zhong-Ping; Hu, Le-Le; Chen, Lei; Shao, Jian-Lin; Zhang, Lei; Kong, Xiang-Yin; Cai, Yu-Dong; Chou, Kuo-Chen

2012-04-01

304

5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)  

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

305

Detection of 98% of DMD\\/BMD gene deletions by polymerase chain reaction  

Microsoft Academic Search

We describe oligonucleotide primer sequences that can be used to amplify eight exons plus the muscle promoter of the dystrophin gene in a single multiplex polymerase chain reaction (PCR). When used in conjunction with an existing primer set, these two multiplex reactions detect about 98% of deletions in patients with Duchenne or Becker muscular dystrophy (DMD, BMD). Furthermore, these primers

Alan H. Beggs; Michel Koenig; Frederick M. Boyce; Louis M. Kunkel

1990-01-01

306

Identification of Sites of STAT3 Action in the Female Reproductive Tract through Conditional Gene Deletion  

PubMed Central

The STAT3 transcription factor is a pleiotropic transducer of signalling by hormones, growth factors and cytokines that has been identified in the female reproductive tract from oocytes and granulosa cells of the ovary to uterine epithelial and stromal cells. In the present study we used transgenic models to investigate the importance of STAT3 for reproductive performance in these different tissues. The Cre-LoxP system was used to delete STAT3 in oocytes by crossing Stat3fl/fl with Zp3-cre+ mice, or in ovarian granulosa cells and uterine stroma by crossing with Amhr2-Cre+ mice. Surprisingly, deletion of STAT3 in oocytes had no effect on fertility indicating that the abundance of STAT3 protein in maturing oocytes and fertilized zygotes is not essential to these developmental stages. In Stat3fl/fl;Amhr2-cre+ females impaired fertility was observed through significantly fewer litters and smaller litter size. Ovulation rate, oocyte fertilization and development to blastocyst were unaffected in this line; however, poor recombination efficiency in granulosa cells had yielded no net change in STAT3 protein abundance. In contrast, uteri from these mice showed STAT3 protein depletion selectively from the stomal compartment. A significant reduction in number of viable fetuses on gestational day 18, increased fetal resorptions and disrupted placental morphology were evident causes of the reduced fertility. In conclusion, this study defines an important role for STAT3 in uterine stromal cells during embryo implantation and the development of a functional placenta. PMID:24983622

Robker, Rebecca L.; Watson, Laura N.; Robertson, Sarah A.; Dunning, Kylie R.; McLaughlin, Eileen A.; Russell, Darryl L.

2014-01-01

307

Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe  

Microsoft Academic Search

We report the construction and analysis of 4,836 heterozygous diploid deletion mutants covering 98.4% of the fission yeast genome providing a tool for studying eukaryotic biology. Comprehensive gene dispensability comparisons with budding yeast—the only other eukaryote for which a comprehensive knockout library exists—revealed that 83% of single-copy orthologs in the two yeasts had conserved dispensability. Gene dispensability differed for certain

Dong-Uk Kim; Jacqueline Hayles; Dongsup Kim; Valerie Wood; Han-Oh Park; Misun Won; Hyang-Sook Yoo; Trevor Duhig; Miyoung Nam; Georgia Palmer; Sangjo Han; Linda Jeffery; Seung-Tae Baek; Hyemi Lee; Young Sam Shim; Minho Lee; Lila Kim; Kyung-Sun Heo; Eun Joo Noh; Ah-Reum Lee; Young-Joo Jang; Kyung-Sook Chung; Shin-Jung Choi; Jo-Young Park; Youngwoo Park; Hwan Mook Kim; Song-Kyu Park; Hae-Joon Park; Eun-Jung Kang; Hyong Bai Kim; Hyun-Sam Kang; Hee-Moon Park; Kyunghoon Kim; Kiwon Song; Kyung Bin Song; Paul Nurse; Kwang-Lae Hoe

2010-01-01

308

A Partial Gene Deletion of SLC45A2 Causes Oculocutaneous Albinism in Doberman Pinscher Dogs  

PubMed Central

The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4?77,062,968–77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

Winkler, Paige A.; Gornik, Kara R.; Ramsey, David T.; Dubielzig, Richard R.; Venta, Patrick J.; Petersen-Jones, Simon M.; Bartoe, Joshua T.

2014-01-01

309

Catabolic instability, plasmid gene deletion and recombination in Alcaligenes sp. BR60  

Microsoft Academic Search

An Alcaligenes sp. BR60, isolated from surface runoff waters of the Hyde Park industrial landfill, contained a novel 85 kb catabolic plasmid (pBR60) functional in 3-chlorobenzoate (3Cba) degradation. The plasmid exhibited a spontaneous 3.2% frequency of deletion of a 14 kb fragment specifying 3Cba degradation. The deletion mutant BR40 and mitomycin C cured strains were not able to grow on

R. Campbell Wyndham; Rama K. Singh; Neil A. Straus

1988-01-01

310

Genome-Wide Analysis of Syntenic Gene Deletion in the Grasses  

PubMed Central

The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community. PMID:22275519

Schnable, James C.; Freeling, Michael; Lyons, Eric

2012-01-01

311

Forebrain glucocorticoid receptor gene deletion attenuates behavioral changes and antidepressant responsiveness during chronic stress.  

PubMed

Stress is an important risk factor for mood disorders. Stress also stimulates the secretion of glucocorticoids, which have been found to influence mood. To determine the role of forebrain glucocorticoid receptors (GR) in behavioral responses to chronic stress, the present experiments compared behavioral effects of repeated social defeat in mice with forebrain GR deletion and in floxed GR littermate controls. Repeated defeat produced alterations in forced swim and tail suspension immobility in floxed GR mice that did not occur in mice with forebrain GR deletion. Defeat-induced changes in immobility in floxed GR mice were prevented by chronic antidepressant treatment, indicating that these behaviors were dysphoria-related. In contrast, although mice with forebrain GR deletion exhibited antidepressant-induced decreases in tail suspension immobility in the absence of stress, this response did not occur in mice with forebrain GR deletion after defeat. There were no marked differences in plasma corticosterone between genotypes, suggesting that behavioral differences depended on forebrain GR rather than on abnormal glucocorticoid secretion. Defeat-induced gene expression of the neuronal activity marker c-fos in the ventral hippocampus, paraventricular thalamus and lateral septum correlated with genotype-related differences in behavioral effects of defeat, whereas c-fos induction in the nucleus accumbens and central and basolateral amygdala correlated with genotype-related differences in behavioral responses to antidepressant treatment. The dependence of both negative (dysphoria-related) and positive (antidepressant-induced) behaviors on forebrain GR is consistent with the contradictory effects of glucocorticoids on mood, and implicates these or other forebrain regions in these effects. PMID:25168761

Jacobson, Lauren

2014-10-01

312

Tetrahydrodipicolinate N-Succinyltransferase and Dihydrodipicolinate Synthase from Pseudomonas aeruginosa: Structure Analysis and Gene Deletion  

PubMed Central

The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD) from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1?dapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity. PMID:22359568

Schnell, Robert; Oehlmann, Wulf; Sandalova, Tatyana; Braun, Yvonne; Huck, Carmen; Maringer, Marko; Singh, Mahavir; Schneider, Gunter

2012-01-01

313

PAX3 gene deletion detected by microarray analysis in a girl with hearing loss  

PubMed Central

Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16?year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862?kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype. PMID:24839464

2014-01-01

314

Survival motor neuron gene deletion in the arthrogryposis multiplex congenita-spinal muscular atrophy association.  

PubMed Central

The survival motor neuron (SMN) gene was lacking in 6/12 patients with arthrogryposis multiplex congenita (AMC) associated with spinal muscular atrophy (SMA). Neither point mutation in the SMN gene nor evidence for linkage to chromosome 5q13 were found in the other patients. Hitherto, arthrogryposis was regarded as an exclusion criterion in SMA. Our data strongly suggest that AMC of neurogenic origin is genetically heterogeneous, with a subgroup being allelic to SMA. Absence or interruption of the SMN gene in the AMC-SMA association will make the diagnosis easier and genetic counselling will now become feasible. PMID:8787675

Bürglen, L; Amiel, J; Viollet, L; Lefebvre, S; Burlet, P; Clermont, O; Raclin, V; Landrieu, P; Verloes, A; Munnich, A; Melki, J

1996-01-01

315

Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients  

SciTech Connect

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.

Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y. [Tel Aviv Univ. (Israel)

1994-02-15

316

Temporal Association of Herpes Simplex Virus ICP4 with Cellular Complexes Functioning at Multiple Steps in PolII Transcription  

PubMed Central

The herpes simplex virus type 1 (HSV-1) immediate early protein, ICP4, participates in the regulation of viral gene expression by both activating and repressing RNA polII transcription. We used affinity purification of ICP4 expressed in infected cells followed by mass spectrometry and western blot analysis to determine the composition of cellular complexes associated with ICP4 throughout infection. ICP4 was associated with TFIID complexes containing a distinct set of TAFs. These complexes were most abundant early, but were detected throughout infection, whereas Mediator was found in ICP4 containing complexes later in infection, indicating a temporal pattern for the utilization of these complexes for the transcription of the viral genome. The form of Mediator copurifying with ICP4 was enriched for the kinase domain and also lacked the activator-specific component, Med26, suggesting that Mediator-ICP4 interactions may be involved in repression of viral transcription. The N-terminal 774 amino acids of ICP4, which retains partial function, were sufficient to form complexes with TFIID and Mediator, although these interactions were not as strong as with full-length ICP4. Additionally, components involved in transcription elongation, chromatin remodeling, and mRNA processing were isolated with ICP4. Together our data indicate that ICP4 plays a more integrated role in mediating HSV transcription, possibly affecting multiple steps in transcription and gene expression. PMID:24147125

Wagner, Lauren M.; DeLuca, Neal A.

2013-01-01

317

Recombinant bovine neurokinin-2 receptor stably expressed in Chinese hamster ovary cells couples to multiple signal transduction pathways.  

PubMed Central

Neurokinins are a family of neuropeptides with widespread distribution mediating a broad spectrum of physiological actions through three distinct receptor subtypes: NK-1, NK-2, and NK-3. We investigated some of the second messenger and cellular processes under control by the recombinant bovine NK-2 receptor stably expressed in Chinese hamster ovary cells. In this system the NK-2 receptor displays its expected pharmacological characteristics, and the physiological agonist neurokinin A stimulates several cellular responses. These include 1) transient inositol 1,4,5-trisphosphate (IP3) formation and Ca2+ mobilization, 2) increased out put of arachidonic acid and prostaglandin E2 (PGE2), 3) enhanced cyclic AMP (cAMP) generation, 4) increased de novo DNA synthesis, and 5) an induction of the "immediate early" genes c-fos and c-jun. Although NK-2 receptor-mediated IP3 formation involves activation of a pertussis toxin-insensitive G-protein, increased cAMP production is largely a secondary response and can be at least partially attributed to autocrine stimulation by endogenously generated eicosanoids, particularly PGE2. This is the first demonstration that a single recombinant neurokinin receptor subtype can regulate, either directly or indirectly, multiple signal transduction pathways and suggests several potential important mediators of neurokinin actions under physiological conditions. Images PMID:1666301

Eistetter, H R; Church, D J; Mills, A; Godfrey, P P; Capponi, A M; Brewster, R; Schulz, M F; Kawashima, E; Arkinstall, S J

1991-01-01

318

NGF-induction of the metalloproteinase-transin/stromelysin in PC12 cells: involvement of multiple protein kinases  

PubMed Central

In previous work, we found that nerve growth factor (NGF) induced expression of the mRNA transcript encoding the metalloproteinase transin/stromelysin in PC12 cells. Transin was found, moreover, to be a "late" gene product whose expression correlated with neurites extension. In this study, various aspects of the NGF intracellular signaling pathway in PC12 cells are investigated. We show that the protein kinase inhibitor staurosporine, but not various other kinase inhibitors, specifically blocked the NGF induction of transin. Preliminary characterization of this staurosporine-sensitive kinase suggest that it does not correspond to a tyrosine kinase, nor various serine kinases, and that it is involved both at the transcriptional and posttranscriptional levels of transin gene regulation. In contrast to these effects of staurosporine, various activators of protein kinases C and A augmented the NGF induction of transin. Similar effects of these kinase inhibitors and activators were also observed with the expression of various immediate-early genes that have been proposed to mediate the transcriptional effects of NGF, including c-fos and c-jun. These data suggest, therefore, that the NGF induction of transin mRNA expression involves multiple protein kinases acting at a number of postreceptor regulatory steps in the NGF signaling pathway. PMID:1908468

1991-01-01

319

Become a Multiplication Wizard!  

NSDL National Science Digital Library

Practice all levels of basic multiplication facts. Are you a math magician? Practice how speedy you can be in Be A Math Magician!. Dress up and race granny in Granny Multiplication Race to make her go faster, answer the problems correctly. Multiplication that makes your mouth water. Multiplication Ice Cream Cones ...

Ms. Robinson

2010-01-27

320

Multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase causing excessive acetaldehyde production from ethanol by oral streptococci  

PubMed Central

Ethanol consumption and poor oral hygiene are risk factors for oral and oesophageal cancers. Although oral streptococci have been found to produce excessive acetaldehyde from ethanol, little is known about the mechanism by which this carcinogen is produced. By screening 52 strains of diverse oral streptococcal species, we identified Streptococcus gordonii V2016 that produced the most acetaldehyde from ethanol. We then constructed gene deletion mutants in this strain and analysed them for alcohol and acetaldehyde dehydrogenases by zymograms. The results showed that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol and ethanol, respectively. Two additional dehydrogenases, S-AdhA and TdhA, were identified with specificities to the secondary alcohol 2-propanol and threonine, respectively, but not to ethanol. S. gordonii V2016 did not show a detectable acetaldehyde dehydrogenase even though its adhE gene encodes a putative bifunctional acetaldehyde/alcohol dehydrogenase. Mutants with adhE deletion showed greater tolerance to ethanol in comparison with the wild-type and mutant with adhA or adhB deletion, indicating that AdhE is the major alcohol dehydrogenase in S. gordonii. Analysis of 19 additional strains of S. gordonii, S. mitis, S. oralis, S. salivarius and S. sanguinis showed expressions of up to three alcohol dehydrogenases, but none showed detectable acetaldehyde dehydrogenase, except one strain that showed a novel ALDH. Therefore, expression of multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase may contribute to excessive production of acetaldehyde from ethanol by certain oral streptococci. PMID:23637459

Pavlova, Sylvia I.; Jin, Ling; Gasparovich, Stephen R.

2013-01-01

321

Highly divergent strains of porcine reproductive and respiratory syndrome virus incorporate multiple isoforms of nonstructural protein 2 into virions.  

PubMed

Viral structural proteins form the critical intermediary between viral infection cycles within and between hosts, function to initiate entry, participate in immediate early viral replication steps, and are major targets for the host adaptive immune response. We report the identification of nonstructural protein 2 (nsp2) as a novel structural component of the porcine reproductive and respiratory syndrome virus (PRRSV) particle. A set of custom ?-nsp2 antibodies targeting conserved epitopes within four distinct regions of nsp2 (the PLP2 protease domain [OTU], the hypervariable domain [HV], the putative transmembrane domain [TM], and the C-terminal region [C]) were obtained commercially and validated in PRRSV-infected cells. Highly purified cell-free virions of several PRRSV strains were isolated through multiple rounds of differential density gradient centrifugation and analyzed by immunoelectron microscopy (IEM) and Western blot assays using the ?-nsp2 antibodies. Purified viral preparations were found to contain pleomorphic, predominantly spherical virions of uniform size (57.9 nm ± 8.1 nm diameter; n = 50), consistent with the expected size of PRRSV particles. Analysis by IEM indicated the presence of nsp2 associated with the viral particle of diverse strains of PRRSV. Western blot analysis confirmed the presence of nsp2 in purified viral samples and revealed that multiple nsp2 isoforms were associated with the virion. Finally, a recombinant PRRSV genome containing a myc-tagged nsp2 was used to generate purified virus, and these particles were also shown to harbor myc-tagged nsp2 isoforms. Together, these data identify nsp2 as a virion-associated structural PRRSV protein and reveal that nsp2 exists in or on viral particles as multiple isoforms. PMID:24089566

Kappes, Matthew A; Miller, Cathy L; Faaberg, Kay S

2013-12-01

322

Uncovering multiple molecular targets for caffeine using a drug target validation strategy combining A2A receptor knockout mice with microarray profiling  

PubMed Central

Caffeine is the most widely consumed psychoactive substance and has complex pharmacological actions in brain. In this study, we employed a novel drug target validation strategy to uncover the multiple molecular targets of caffeine using combined A2A receptor (A2AR) knockouts (KO) and microarray profiling. Caffeine (10 mg/kg) elicited a distinct profile of striatal gene expression in WT mice compared with that by A2AR gene deletion or by administering caffeine into A2AR KO mice. Thus, A2ARs are required but not sufficient to elicit the striatal gene expression by caffeine (10 mg/kg). Caffeine (50 mg/kg) induced complex expression patterns with three distinct sets of striatal genes: 1) one subset overlapped with those elicited by genetic deletion of A2ARs; 2) the second subset elicited by caffeine in WT as well as A2AR KO mice; and 3) the third subset elicited by caffeine only in A2AR KO mice. Furthermore, striatal gene sets elicited by the phosphodiesterase (PDE) inhibitor rolipram and the GABAA receptor antagonist bicucullin, overlapped with the distinct subsets of striatal genes elicited by caffeine (50 mg/kg) administered to A2AR KO mice. Finally, Gene Set Enrichment Analysis reveals that adipocyte differentiation/insulin signaling is highly enriched in the striatal gene sets elicited by both low and high doses of caffeine. The identification of these distinct striatal gene populations and their corresponding multiple molecular targets, including A2AR, non-A2AR (possibly A1Rs and pathways associated with PDE and GABAAR) and their interactions, and the cellular pathways affected by low and high doses of caffeine, provides molecular insights into the acute pharmacological effects of caffeine in the brain. PMID:19258493

Yu, Liqun; Coelho, Joana E.; Zhang, Xiaoling; Fu, Yutao; Tillman, Abigail; Karaoz, Ulas; Fredholm, Bertil B.; Weng, Zhiping; Chen, Jiang-Fan

2009-01-01

323

Multiple-Ring Digital Communication Network  

NASA Technical Reports Server (NTRS)

Optical-fiber digital communication network to support data-acquisition and control functions of electric-power-distribution networks. Optical-fiber links of communication network follow power-distribution routes. Since fiber crosses open power switches, communication network includes multiple interconnected loops with occasional spurs. At each intersection node is needed. Nodes of communication network include power-distribution substations and power-controlling units. In addition to serving data acquisition and control functions, each node acts as repeater, passing on messages to next node(s). Multiple-ring communication network operates on new AbNET protocol and features fiber-optic communication.

Kirkham, Harold

1992-01-01

324

Jalyn's Multiplication Mania!  

NSDL National Science Digital Library

Multiplication Games For My Favorite Gillenwater Jalyn Will Love Serving Aliens Lunch! Ms. Gillenwater Will Have Fun With Multiplication In Murbia! When Jalyn Plays This Game She Will Go Bananas! Buy A Pet From Gillenwater s Pet Shop! ...

Mr. Huey

2011-10-11

325

Coffee and Multiple Sclerosis  

MedlinePLUS Videos and Cool Tools

... right-hand corner of the player. Coffee and Multiple Sclerosis HealthDay February 27, 2015 Related MedlinePlus Pages Caffeine Multiple Sclerosis Transcript For all the coffee lovers out there… ...

326

Multiple sclerosis - discharge  

MedlinePLUS

Your doctor has told you that you have multiple sclerosis. This disease affects the brain and spinal cord ( ... your doctor may prescribe medicine. Some people with multiple sclerosis need to use a urinary catheter . This is ...

327

Preparing for Multiple Births  

MedlinePLUS

... prior pregnancies. "Supertwins" is a common term for triplets and other higher-order multiple births, such as ... will be delivered by C-section. And most triplets and other higher-order multiples are born by ...

328

Twins, Triplets, Multiple Births  

MedlinePLUS

... by C-section, especially if there are three babies or more. Parenting multiples can be a challenge. Volunteer help and support groups for parents of multiples can help. Dept. of Health and Human Services Office on Women's Health

329

(10, k) Reversible Multiples  

E-print Network

We consider the integers having the property of reversing when multiplied by a specific integer k. First, we proved that k should be either 1, 4 or 9. Second, we classify these integers as (10, 1)- reverse multiples, (10, 4)- reverse multiples and (10, 9)- reverse multiples. Then we conclude their general form.

Madline Al- Tahan

2015-04-20

330

Reference genes for quantitative gene expression studies in multiple avian species.  

PubMed

Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species. PMID:24926893

Olias, Philipp; Adam, Iris; Meyer, Anne; Scharff, Constance; Gruber, Achim D

2014-01-01

331

Reference Genes for Quantitative Gene Expression Studies in Multiple Avian Species  

PubMed Central

Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species. PMID:24926893

Meyer, Anne; Scharff, Constance; Gruber, Achim D.

2014-01-01

332

Characterization of baculovirus Autographa californica multiple nuclear polyhedrosis virus infection in mammalian cells  

SciTech Connect

The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is used as a vector in many gene therapy studies. Wild-type AcMNPV infects many mammalian cell types in vitro, but does not replicate. We investigated the dynamics of AcMNPV genomic DNA in infected mammalian cells and used flow cytometric analysis to demonstrate that recombinant baculovirus containing a cytomegalovirus immediate early promoter/enhancer with green fluorescent protein (GFP) expressed high levels of GFP in Huh-7 cells, but not B16, Raw264.7, or YAC-1 cells. The addition of butyrate, a deacetylase inhibitor, markedly enhanced the percentage of GFP-expressing Huh-7 and B16 cells, but not Raw264.7 and YAC-1 cells. The addition of 5-aza-2'-deoxycytidine, a DNA methylation inhibitor, had no enhancing effect. Polymerase chain reaction analysis using AcMNPV-gp64-specific primers indicated that AcMNPV infected not only Huh-7 and B16 cells, but also Raw264.7 and YAC-1 cells in vitro. The genomic DNA was detected in Huh-7 and B16 cells 96 h after infection. Genomic AcMNPV DNA in YAC-1 cells was not transported to the nucleus. Luciferase assay indicated that AcMNPV p35 gene mRNA and p35 promoter activity were clearly expressed only in Huh-7 and B16 cells. These results suggest that viral genomic DNA expression is restricted by different host cell factors, such as degradation, deacetylation, and inhibition of nuclear transport, depending on the mammalian cell type.

Kitajima, Masayuki [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Departments of Immunology and Pediatrics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana Chuo-ku, Chiba 260-8670 (Japan); Hamazaki, Hiroyuki [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Miyano-Kurosaki, Naoko [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Takaku, Hiroshi [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan) and High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan)]. E-mail: hiroshi.takaku@it-chiba.ac.jp

2006-05-05

333

Calcium Influx via the NMDA Receptor Induces Immediate Early Gene Transcription by a MAP Kinase\\/ERK-Dependent Mechanism  

Microsoft Academic Search

The regulation of gene expression by neurotransmitters is likely to play a key role in neuroplasticity both during development and in the adult animal. Therefore, it is important to determine the mechanisms of neuronal gene regulation to understand fully the mechanisms of learning, memory, and other long-term adaptive changes in neurons. The neurotransmitter glutamate stimulates rapid and transient induction of

Zhengui Xia; Henryk Dudek; Cindy K. Miranti; Michael E. Greenberg

1996-01-01

334

Identification of a Novel Pathway Essential for the Immediate-Early, Interferon-Independent Antiviral Response to Enveloped Virions  

Microsoft Academic Search

Viral infection elicits the activation of numerous cellular signal transduction pathways, leading to the induction of both innate and adaptive immunity. Previously we showed that entry of virion particles from a diverse array of enveloped virus families was capable of eliciting an interferon regulatory factor 3 (IRF-3)- mediated antiviral state in human fibroblasts in the absence of interferon production. Here

Ryan S. Noyce; Susan E. Collins; Karen L. Mossman

2006-01-01

335

A Herpes Simplex Virus Type 1 Immediate-Early Gene Product, IE63, Regulates Small Nuclear Ribonucleoprotein Distribution  

Microsoft Academic Search

Herpes simplex virus 1 (HSV-1), a nuclear replicating DNA virus, has 73 identified genes of which only 4 contain introns. For this reason the virus probably makes only minimal use of the cellular RNA-splicing machinery. Antigens associated with the small nuclear ribonucleoprotein particles (snRNPs) that are subunits of splicing complexes have been reported to redistribute in the nucleus and become

A. Phelan; M. Carmo-Fonseca; J. McLauchlan; A. I. Lamond; J. B. Clements

1993-01-01

336

White Spot Syndrome Virus Annexes a Shrimp STAT To Enhance Expression of the Immediate-Early Gene ie1  

Microsoft Academic Search

Received 30 August 2006\\/Accepted 12 October 2006 Although the Janus kinase-signal transducer and activator of transcription (JAK-STAT) signaling pathway is part of the antiviral response in arthropods such as Drosophila, here we show that white spot syndrome virus (WSSV) uses a shrimp STAT as a transcription factor to enhance viral gene expression in host cells. In a series of deletion

Wang-Jing Liu; Yun-Shiang Chang; Andrew H.-J. Wang; Guang-Hsiung Kou; Chu-Fang Lo

2007-01-01

337

Group 2 coronaviruses prevent immediate early interferon induction by protection of viral RNA from host cell recognition  

SciTech Connect

Many viruses encode antagonists to prevent interferon (IFN) induction. Infection of fibroblasts with the murine hepatitis coronavirus (MHV) and SARS-coronavirus (SARS-CoV) did not result in nuclear translocation of interferon-regulatory factor 3 (IRF3), a key transcription factor involved in IFN induction, and induction of IFN mRNA transcription. Furthermore, MHV and SARS-CoV infection could not prevent IFN induction by poly (I:C) or Sendai virus, suggesting that these CoVs do not inactivate IRF3-mediated transcription regulation, but apparently prevent detection of replicative RNA by cellular sensory molecules. Our data indicate that shielding of viral RNA to host cell sensors might be the main general mechanism for coronaviruses to prevent IFN induction.

Versteeg, Gijs A. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Bredenbeek, Peter J. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Worm, Sjoerd H.E. van den [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Spaan, Willy J.M. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands)]. E-mail: w.j.m.spaan@lumc.nl

2007-04-25

338

The role of the PI3K-Akt signal transduction pathway in Autographa californica multiple nucleopolyhedrovirus infection of Spodoptera frugiperda cells  

SciTech Connect

Many viruses activate the phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway, thereby modulating diverse downstream signaling pathways associated with antiapoptosis, proliferation, cell cycling, protein synthesis and glucose metabolism, in order to augment their replication. To date, the role of the PI3K-Akt pathway in Baculovirus replication has not been defined. In the present study, we demonstrate that infection of Sf9 cells with Autographa californica multiple nucleopolyhedrovirus (AcMNPV) elevated cellular Akt phosphorylation at 1 h post-infection. The maximum Akt phosphorylation occurred at 6 h post-infection and remained unchanged until 18 h post-infection. The PI3K-specific inhibitor, LY294002, suppressed Akt phosphorylation in a dose-dependent manner, suggesting that AcMNPV-induced Akt phosphorylation is PI3K-dependent. The inhibition of PI3K-Akt activation by LY294002 significantly reduced the viral yield, including a reduction in budded viruses and occlusion bodies. The virus production was reduced only when the inhibitor was added within 24 h of infection, implying that activation of PI3K occurred early in infection. Correspondingly, both viral DNA replication and late (VP39) and very late (POLH) viral protein expression were impaired by LY294002 treatment; LY294002 had no effect on immediate-early (IE1) and early-late (GP64) protein expression. These results demonstrate that the PI3K-Akt pathway is required for efficient Baculovirus replication.

Xiao Wei; Yang Yi; Weng Qingbei; Lin Tiehao; Yuan Meijin [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China); Yang Kai, E-mail: yangkai@mail.sysu.edu.c [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China); Pang Yi [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China)

2009-08-15

339

Multiple Endocrine Neoplasia  

Microsoft Academic Search

\\u000a The term “multiple endocrine neoplasia” was first used by Steiner in the late 1960s when he described three distinct endocrine\\u000a disorders. The first disorder, multiple endocrine neoplasia type I (MEN 1) (also known as Wermer syndrome), described patients\\u000a with familial pituitary, parathyroid, and pancreatic islet cell tumors. The second syndrome, multiple endocrine neoplasia\\u000a type II (MEN 2) (also known as

Christine S. Landry; Thereasa Rich; Camilo Jimenez; Elizabeth G. Grubbs; Jeffrey E. Lee; Nancy D. Perrier

340

Multiple Epiphyseal Dysplasia  

MedlinePLUS

... Creveld Dysplasia Hypochondroplasia Kniest Dysplasia Metatropic Dysplasia Morquio Syndrome Multiple Epiphyseal ... Endowed Chair in Orthopedics William G. Mackenzie, MD Dr. Mackenzie is an internationally ...

341

Multiplication is Fun!  

NSDL National Science Digital Library

Let's play some multiplication games! If asked to pick a fact family or a leve, pick the one you are most comfortable with first then go to the harder one. Penguin Jump Click on the ice cube that has the answer to the multiplication problem at the bottom. Snagger s Pond For this game, first you will pick a Fact Family 0-5, 2-9, 3-12. Then answer the Multiplication fact. Let s Multiply! Select a level, then answer the multiplication facts by clicking on the ice cream ...

Miss Gross

2010-10-09

342

Multiple Approaches to Multiple Agent Problem Solving  

Microsoft Academic Search

Tick up any modern operating systems textbook, and you will find sections on distributed processing - the sharing of computation among multiple physical proces­ sors. Familiarity with this literature brings the reader into contact with a jargon filled with the sorts of terms that computer science thrives on: load balancing, net­ work topology, routing strategics, circuit switching, col- lision detection,

James A. Hendler; Daniel G. Bobrow; Les Gasser; Carl Hewitt; Marvin Minsky

1991-01-01

343

Genome duplications within the Xenopodinae do not increase the multiplicity of antimicrobial peptides in Silurana paratropicalis and Xenopus andrei skin secretions.  

PubMed

A putative genome duplication event within the Silurana lineage has given rise to the tetraploid frog S. paratropicalis and a second polyploidization within the Xenopus lineage has produced the octoploid frog X. andrei. Peptidomic analysis of norepinephrine-stimulated skin secretions of S. paratropicalis and X. andrei led to identification of multiple peptides with growth-inhibitory activity against Escherichia coli and Staphylococcus aureus. Structural characterization demonstrated that the S. paratropicalis components comprised three peptides belonging to the caerulein-precursor fragment family (CPF-SP1, -SP2 and -SP3), two peptides from the xenopsin-precursor fragment family (XPF-SP1 and -SP2), and one peptide orthologous to peptide glycine-leucine-amide (PGLa-SP1). The CPF peptides showed potent, broad-spectrum antimicrobial activity. The X. andrei components comprised two peptides from the magainin family, (magainin-AN1 and -AN2), two from the XPF family (XPF-AN1 and -AN2), two from the PGLa family(PGLa-AN1 and -AN2), and one caerulein-precursor fragment (CPF-AN1).The primary structures of these peptides indicate a close phylogenetic relationship between X. andrei and the octoploid frog X. amieti. Under the same experimental conditions, seven orthologous antimicrobial peptides were previously isolated from the diploid frog S. tropicalis, nine from the tetraploid frog X. borealis, and five from the tetraploid frog X. clivii. The data indicate, therefore, that nonfunctionalization (gene deletion) has been the most common fate of duplicated antimicrobial peptide genes following polyploidization events in the Silurana and Xenopus lineages. PMID:21498136

Mechkarska, Milena; Eman, Ahmed; Coquet, Laurent; Jérôme, Leprince; Jouenne, Thierry; Vaudry, Hubert; King, Jay D; Takada, Koji; Conlon, J Michael

2011-06-01

344

Applying Multiple Intelligences  

ERIC Educational Resources Information Center

The ideas of multiple intelligences introduced by Howard Gardner of Harvard University more than 25 years ago have taken form in many ways, both in schools and in other sometimes-surprising settings. The silver anniversary of Gardner's learning theory provides an opportunity to reflect on the ways multiple intelligences theory has taken form and…

Christodoulou, Joanna A.

2009-01-01

345

Multiple density layered insulator  

DOEpatents

A multiple density layered insulator for use with a laser is disclosed wh provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation.

Alger, Terry W. (Tracy, CA)

1994-01-01

346

Single password, multiple accounts  

Microsoft Academic Search

Most users have multiple accounts on the Internet where each account is protected by a password. To avoid the headache in remembering and managing a long list of different and unrelated passwords, most users simply use the same password for multiple accounts. Unfortunately, the predominant HTTP basic authentication protocol (even over SSL) makes this common practice remarkably dangerous: an attacker

E. Saravanakumar; A. Mohan

2008-01-01

347

Single Password, Multiple Accounts  

Microsoft Academic Search

Most users have multiple accounts on the Internet where each account is protected by a password. To avoid the headache in re- membering and managing a long list of dieren t and unrelated passwords, most users simply use the same password for multiple accounts. Unfortu- nately, the predominant HTTP basic authentication protocol (even over SSL) makes this common practice remarkably

Mohamed G. Gouda; Alex X. Liu; Lok M. Leung; Mohamed A. Alam

348

Constraining Multiple Grammars  

ERIC Educational Resources Information Center

This article offers the author's commentary on the Multiple Grammars (MG) language acquisition theory proposed by Luiz Amaral and Tom Roeper in the present issue. Multiple Grammars advances the claim that optionality is a constitutive characteristic of any one grammar, with interlanguage grammars being perhaps the clearest examples of a…

Hopp, Holger

2014-01-01

349

Fractions--Rectangle Multiplication  

NSDL National Science Digital Library

This interactive applet provides a visual model of fraction multiplication using rectangular arrays. The applet offers both a demonstration/exploration mode ("show me") and a practice mode ("test me") in which students arrange the rectangle to display a given multiplication problem. Teaching ideas and applet instructions are available through the links at the top of the page.

2007-01-01

350

Hadron Multiplicities at HERMES  

E-print Network

Hadron multiplicities of $\\pim$, $\\pip$, $\\km$ and $\\kp$ have been measured in the deep-inelastic scattering of 27.5 GeV positrons off a hydrogen target. The data used in this analysis have been collected during the 2000 HERA running period. The multiplicities were obtained for 0.15$$ = 2.5 GeV$^2$.

A. Hillenbrand; M. Hartig

2007-11-24

351

Multiple Linear Regression  

NSDL National Science Digital Library

This site, created by Michelle Lacey of Yale University, gives an explanation, a definition and an example of multiple linear regression. Topics include: confidence intervals, tests of significance, and squared multiple correlation. While brief, this is still a valuable site for anyone interested in statistics.

Lacey, Michelle

352

Sexuality in multiple sclerosis  

Microsoft Academic Search

Summary. Sexuality and partnership have an important influence on the quality of life of every person and also on people with chronic disorders such as multiple sclerosis. The findings in literature show high evidence that people with multiple sclerosis experience high levels of sexual dysfunction, most of them with hypoactive sexual behaviour often associated with dissatisfaction in relationship, and also

E. Z. Schmidt; P. Hofmann; G. Niederwieser; H.-P. Kapfhammer; R. M. Bonelli

2005-01-01

353

Multiple density layered insulator  

DOEpatents

A multiple density layered insulator for use with a laser is disclosed which provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation. 4 figs.

Alger, T.W.

1994-09-06

354

Multiple pancreatic pseudocyst disease.  

PubMed Central

In an effort to determine the incidence of multiple pseudocyst disease and establish the optimal approach to this problem, the records of 91 consecutive patients diagnosed during a 36-month period as having pancreatic pseudocyst disease by sonography or computerized tomographic scanning were reviewed. Thirteen patients (14.3%) had multiple cysts; all received sonograms and six had CT scans. The combined false negative and false positive rate with sonography was 9%. Spontaneous resolution occurred involving five cysts (18%) up to 6.5 cm in size. The diagnosis of cyst multiplicity was confirmed at operation in seven cases; two of the seven operations were excisional and the remaining patients received drainage procedures. There were no operative deaths; complications included one patient who required chronic enzyme replacement therapy after excision and another patient who developed a subphrenic abscess after attempted percutaneous drainage. The incidence of multiple pseudocyst disease in our series is just over 14%. The possibility of multiplicity should be carefully investigated in each patient with pseudocyst disease. In light of the rate of spontaneous resolution, not all patients with multiple pseudocysts may require operative therapy. Because of the 7.7% false negative diagnoses with sonography, CT scanning is especially helpful when the diagnosis of multiple pseudocysts is suspected or in preoperative preparation of pseudocyst drainage. If an operation becomes necessary, a drainage procedure rather than excision should be used whenever possible to maximize gland salvage. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. PMID:6691732

Goulet, R J; Goodman, J; Schaffer, R; Dallemand, S; Andersen, D K

1984-01-01

355

Statistics of multiple stars  

NASA Astrophysics Data System (ADS)

The statistics of stellar systems of multiplicity three and higher is reviewed. They are frequent, 0.15-0.25 of all stellar systems. Some 700 multiples are expected among the 3383 stars of spectral type F, G, and K within 50 pc, while only 76 of them are actually known. Many (if not all) close binaries have distant tertiary components, indicating that angular momentum exchange within multiple systems was probably critical in forming short-period binaries. The ratio of outer to inner periods in the best-studied nearby multiples and in low-mass pre-main sequence multiples does not exceed 104 at the formation epoch; larger ratios are produced by subsequent orbital evolution. All multiples with well-defined orbits are dynamically stable, the eccentricities of outer orbits obey the empirical stability limit P[out](1 - e[out])3/P[in] > 5 that is more strict than current theoretical limits. Relative orientation of orbits in triple stars shows some degree of alignment, especially in weakly-hierarchical systems. The statistics support the idea that most multiple stars originated from dynamical interactions in small clusters.

Tokovinin, A.

2004-08-01

356

Multiple sclerosis and pregnancy.  

PubMed

The question of pregnancy in patients with multiple sclerosis is regularly raised due to the prevalence of the disease in middle age women. The multiple sclerosis think tank (Groupe de Réflexion sur la Sclérose en Plaques [GRESEP]) decided to develop recommendations on this issue, with consideration to both the impact of multiple sclerosis on pregnancy, and that of pregnancy on the disease. As with topics of previous works, the formal expert consensus method was used. The working group was composed of hospital-based and private practice neurologists. The reading group was composed of neurologists, anaesthetists and obstetricians. Each recommendation is presented with the relevant level of consensus. PMID:24684929

Bodiguel, E; Bensa, C; Brassat, D; Laplaud, D; Le Page, E; Ouallet, J-C; Zephir, H; De Seze, J

2014-04-01

357

Strongly Multiplicative and 3-Multiplicative Linear Secret Sharing Schemes  

E-print Network

Strongly multiplicative linear secret sharing schemes (LSSS) have been a powerful tool for constructing secure multiparty computation protocols. However, it remains open whether or not there exist efficient constructions of strongly multiplicative LSSS from general LSSS. In this paper, we propose the new concept of a 3-multiplicative LSSS, and establish its relationship with strongly multiplicative LSSS. More precisely, we show that any 3-multiplicative LSSS is a strongly multiplicative LSSS, but the converse is not true; and that any strongly multiplicative LSSS can be efficiently converted into a 3-multiplicative LSSS. Furthermore, we apply 3-multiplicative LSSS to the computation of unbounded fan-in multiplication, which reduces its round complexity to four (from five of the previous protocol based on strongly multiplicative LSSS). We also give two constructions of 3-multiplicative LSSS from Reed-Muller codes and algebraic geometric codes. We believe that the construction and verification of 3-multiplicati...

Zhang, Zhifang; Chee, Yeow Meng; Ling, San; Wang, Huaxiong; 10.1007/978-3-540-89255-7

2008-01-01

358

Matrix Multiplication with CUDA  

NSDL National Science Digital Library

This module teaches matrix multiplication in the context of enumerating paths in a graph and the basics of programming in CUDA. It emphasizes the power of using shared memory when programming on GPGPU architectures.

Rob Hochberg

359

High-multiplicity study  

SciTech Connect

Theoretical and experimental problems of multiparticle production are analyzed in the high-multiplicity region. Interesting collective phenomena may be revealed in this region. Preliminary results of the Thermalization Project are being reported.

Kokoulina, E. S., E-mail: kokoulin@sunse.jinr.r [Joint Institute for Nuclear Research (Russian Federation); Kutov, A. Ya., E-mail: kutov@dm.komisc.r [Russian Academy of Sciences, Department of Mathematics, Ural Division (Russian Federation)

2008-09-15

360

Immunoparalysis after multiple trauma.  

PubMed

The immunological sequelae following multiple trauma constitute an ongoing challenge in critical care management. The overall immune response to multiple trauma is a multilevel complex interdependently involving neurohormonal, cellular and haemodynamic factors. Immunoparalysis is characterised by a reduced capacity to present antigens via downregulated HLA-DR and an unbalanced monocyte-T cell interaction. Trauma-induced death of functionally conducive immune cells in the early recovery phase is significant in the emergence of posttraumatic multiple organ dysfunction or failure. Novel findings may contribute to more appropriate immunomonitoring and improved treatment. We must consider the preservation and support of immune function as the ultimate therapeutic goal, which may override the current strategy of simply antagonising excessive pro- or anti-inflammatory immune responses of the severely injured person. This review focuses on the injury-induced conduct of key immune effector cells and associated effects promoting immunoparalysis after multiple trauma. PMID:18048039

Tschoeke, Sven K; Ertel, Wolfgang

2007-12-01

361

A Multiple Procedure DDT  

E-print Network

This Memo. Describes a version of DDT used as the command level of the A.I. Group PDP-6 Time Sharing System (ITS). Special features include capability to handle multiple jobs, ability to stop open read or write references ...

Knight, Thomas

1968-01-01

362

Caring for Multiples  

MedlinePLUS

... NICU families. Mothering Multiples: Breastfeeding and Caring for Twins or More, by Karen Kerkhoff Gromada (La Leche League International, 1999). Mothers of Super Twins (MOST) A support network of families who have ...

363

Mobile multiple access study  

NASA Technical Reports Server (NTRS)

Multiple access techniques (FDMA, CDMA, TDMA) for the mobile user and attempts to identify the current best technique are discussed. Traffic loading is considered as well as voice and data modulation and spacecraft and system design. Emphasis is placed on developing mobile terminal cost estimates for the selected design. In addition, design examples are presented for the alternative techniques of multiple access in order to compare with the selected technique.

1977-01-01

364

Multiple simultaneous gastric carcinomas.  

PubMed Central

A total of 1664 patients with gastric cancer were examined to evaluate the rate of multiple synchronous primary tumours. In cases of multiple synchronous cancer (MSC), the tumours were analysed immunohistochemically for their expression pattern of p53, c-erbB2, ras, E-cadherin and proliferative activity. Multiple synchronous gastric carcinomas (MSCs) were observed in 61 out of 1664 patients (3.7%), with a total of 134 carcinomas. In our series, early carcinoma was observed more frequently in MSC than in solitary cancers. The comparison of tumour stage in MSC and solitary tumours revealed that multiple early gastric cancers were significantly more often of type I (protruded type) and IIa (superficial elevated type) than solitary early cancer. Multiple advanced carcinomas were more often of a lower pT category than solitary advanced gastric cancer. Performing immunohistochemistry for p53, c-erbB2 and ras in 134 tumours with MSCs, we observed positivity rates of 33%, 59% and 87% respectively. In 43 patients, the multiple tumours in each individual patient demonstrated an identical status of p53 and c-erbB2, and in 42 patients a similar pattern of E-cadherin expression was observed. The proliferative index, determined by proliferating cell nuclear antigen (PCNA) immunolabelling, did not differ significantly between the MSC in each patient. Ras immunostaining was detected in 53 out of 61 patients, but also in metaplasia and regenerative hyperplasia in the specimens. In survival analysis, no difference was observed between patients with solitary or multiple early or advanced carcinomas. Our results suggest that in at least a high proportion of patients with gastric cancer multiple primary tumours arise from precancerous conditions leading to similar genetic alterations. PMID:9413949

Wittekind, C.; Klimpfinger, M.; Hermanek, P.; Tannapfel, A.

1997-01-01

365

QCD and multiplicity scaling  

Microsoft Academic Search

In QCD, the similarity of multiplicity distributions is violated i) by the running of the strong coupling constant alpha_s and ii) by the self-similar nature of parton cascades. It will be shown that the data collapsing behavior of P_n onto a unique scaling curve can be restored by performing the original scaling prescription (translation and dilatation) in the multiplicity moments'

S. Hegyi

2001-01-01

366

Cannabinoids and Multiple Sclerosis  

Microsoft Academic Search

This review discusses clinical and preclinical evidence that supports the use of cannabinoid receptor agonists for the management\\u000a of multiple sclerosis. In addition, it considers preclinical findings that suggest that as well as ameliorating signs and\\u000a symptoms of multiple sclerosis, cannabinoid CB1 and\\/or CB2 receptor activation may suppress some of the pathological changes that give rise to these signs and

Roger G. Pertwee

2007-01-01

367

Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.  

PubMed

odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

2013-01-01

368

Systematic condition-dependent annotation of metabolic genes  

E-print Network

. This study employs a large-scale model of the metabolism of Saccharomyces cerevisiae to investigate in Saccharomyces cerevisiae based on large-scale pheno- typic screens and gene deletion phenotypes across multiple

Shamir, Ron

369

Multiple stage multiple filter hydrate store  

DOEpatents

An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means or separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means.

Bjorkman, Jr., Harry K. (Birmingham, MI)

1983-05-31

370

Multiple Indicators, Multiple Causes Measurement Error Models  

PubMed Central

Multiple Indicators, Multiple Causes Models (MIMIC) are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times however when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are: (1) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model, (2) to develop likelihood based estimation methods for the MIMIC ME model, (3) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

Tekwe, Carmen D.; Carter, Randy L.; Cullings, Harry M.; Carroll, Raymond J.

2014-01-01

371

Multiple indicators, multiple causes measurement error models.  

PubMed

Multiple indicators, multiple causes (MIMIC) models are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times, however, when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are as follows: (i) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model; (ii) to develop likelihood-based estimation methods for the MIMIC ME model; and (iii) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

Tekwe, Carmen D; Carter, Randy L; Cullings, Harry M; Carroll, Raymond J

2014-11-10

372

Multiple stage multiple filter hydrate store  

DOEpatents

An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means for separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means. 7 figs.

Bjorkman, H.K. Jr.

1983-05-31

373

Strongly Multiplicative and 3Multiplicative Linear Secret Sharing Schemes  

Microsoft Academic Search

Strongly multiplicative linear secret sharing schemes (LSSS) have been a powerful tool for constructing secure multi-party computa- tion protocols. However, it remains open whether or not there exist effi- cient constructions of strongly multiplicative LSSS from general LSSS. In this paper, we propose the new concept of a 3-multiplicative LSSS, and establish its relationship with strongly multiplicative LSSS. More pre-

Zhifang Zhang; Mulan Liu; Yeow Meng Chee; San Ling; Huaxiong Wang

2008-01-01

374

Multiple Birth and Cut Algorithm for Multiple Object Detection  

E-print Network

Multiple Birth and Cut Algorithm for Multiple Object Detection Ahmed Gamal-Eldin, Xavier Descombes.zerubia}@inria.fr Abstract--In this paper, we describe a new optimization method which we call Multiple Birth and Cut (MBC). It combines the recently developed Multiple Birth and Death (MBD) algorithm and the Graph-Cut algorithm. MBD

Boyer, Edmond

375

Enhancing multiple disciplinary teamwork.  

PubMed

Multiple disciplinary research provides an opportunity to bring together investigators across disciplines to provide new views and develop innovative approaches to important questions. Through this shared experience, novel paradigms are formed, original frameworks are developed, and new language is generated. Integral to the successful construction of effective cross-disciplinary teams is the recognition of antecedent factors that affect the development of the team such as intrapersonal, social, physical environmental, organizational, and institutional influences. Team functioning is enhanced with well-developed behavioral, affective, interpersonal, and intellectual processes. Outcomes of effective multiple disciplinary research teams include novel ideas, integrative models, new training programs, institutional change, and innovative policies that can also influence the degree to which antecedents and processes contribute to team performance. Ongoing evaluation of team functioning and achievement of designated outcomes ensures the continued development of the multiple disciplinary team and confirmation of this approach as important to the advancement of science. PMID:18501748

Weaver, Terri E

2008-01-01

376

Neutron multiplicity analysis tool  

SciTech Connect

I describe the capabilities of the EXCOM (EXcel based COincidence and Multiplicity) calculation tool which is used to analyze experimental data or simulated neutron multiplicity data. The input to the program is the count-rate data (including the multiplicity distribution) for a measurement, the isotopic composition of the sample and relevant dates. The program carries out deadtime correction and background subtraction and then performs a number of analyses. These are: passive calibration curve, known alpha and multiplicity analysis. The latter is done with both the point model and with the weighted point model. In the current application EXCOM carries out the rapid analysis of Monte Carlo calculated quantities and allows the user to determine the magnitude of sample perturbations that lead to systematic errors. Neutron multiplicity counting is an assay method used in the analysis of plutonium for safeguards applications. It is widely used in nuclear material accountancy by international (IAEA) and national inspectors. The method uses the measurement of the correlations in a pulse train to extract information on the spontaneous fission rate in the presence of neutrons from ({alpha},n) reactions and induced fission. The measurement is relatively simple to perform and gives results very quickly ({le} 1 hour). By contrast, destructive analysis techniques are extremely costly and time consuming (several days). By improving the achievable accuracy of neutron multiplicity counting, a nondestructive analysis technique, it could be possible to reduce the use of destructive analysis measurements required in safeguards applications. The accuracy of a neutron multiplicity measurement can be affected by a number of variables such as density, isotopic composition, chemical composition and moisture in the material. In order to determine the magnitude of these effects on the measured plutonium mass a calculational tool, EXCOM, has been produced using VBA within Excel. This program was developed to help speed the analysis of Monte Carlo neutron transport simulation (MCNP) data, and only requires the count-rate data to calculate the mass of material using INCC's analysis methods instead of the full neutron multiplicity distribution required to run analysis in INCC. This paper describes what is implemented within EXCOM, including the methods used, how the program corrects for deadtime, and how uncertainty is calculated. This paper also describes how to use EXCOM within Excel.

Stewart, Scott L [Los Alamos National Laboratory

2010-01-01

377

Multiple sort flow cytometer  

DOEpatents

A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane. 8 figs.

Engh, G. van den; Esposito, R.J.

1996-01-09

378

Multiple origins of life  

NASA Technical Reports Server (NTRS)

There is some indication that life may have originated readily under primitive earth conditions. If there were multiple origins of life, the result could have been a polyphyletic biota today. Using simple stochastic models for diversification and extinction, we conclude: (1) the probability of survival of life is low unless there are multiple origins, and (2) given survival of life and given as many as 10 independent origins of life, the odds are that all but one would have gone extinct, yielding the monophyletic biota we have now. The fact of the survival of our particular form of life does not imply that it was unique or superior.

Raup, D. M.; Valentine, J. W.

1983-01-01

379

Practical Multiple Sequence Alignment  

NASA Astrophysics Data System (ADS)

Multiple sequence alignment as a means of comparing DNA, RNA, or amino acid sequences is an essential precondition for various analyses, including structure prediction, modeling binding sites, phylogeny, or function prediction. This range of applications implies a demand for versatile, flexible, and specialized methods to compute accurate alignments. This chapter summarizes the key algorithmic insights gained in the past years to facilitate an easy understanding of the current multiple sequence alignment literature and to enable the readers to use and apply current tools in their own research.

Rausch, Tobias; Reinert, Knut

380

Constellation Precoded Multiple Beamforming  

Microsoft Academic Search

Beamforming techniques that employ Singular Value Decomposition (SVD) are commonly used in Multi-Input Multi-Output (MIMO) wireless communication systems. In the absence of channel coding, when a single symbol is transmitted, these systems achieve the full diversity order provided by the channel; whereas when multiple symbols are simultaneously transmitted, this property is lost. When channel coding is employed, full diversity order

Hong Ju Park; Boyu Li; Ender Ayanoglu

2011-01-01

381

Automatic multiple applicator electrophoresis  

NASA Technical Reports Server (NTRS)

Easy-to-use, economical device permits electrophoresis on all known supporting media. System includes automatic multiple-sample applicator, sample holder, and electrophoresis apparatus. System has potential applicability to fields of taxonomy, immunology, and genetics. Apparatus is also used for electrofocusing.

Grunbaum, B. W.

1977-01-01

382

MULTIPLE VIEW Anders Heyden  

E-print Network

thorough description of projective geometry is given. Section 3.3 gives a short introduction to tensor elements in video. 45 #12;46 Multiple View Geometry Chapter 3 3.2 Projective Geometry Projective geometry view geometry. The main reason is that the image formation process can be regarded as a projective

Pollefeys, Marc

383

10monkeys Multiplication  

NSDL National Science Digital Library

This free iOS app provides practice with multiplication facts in an arcade-like format. Students choose from among 10 levels (2 to 10 times tables and mixed times tables) and identify products of given factors in order to free trapped monkeys. Scoring rewards both accuracy and speed.

2013-07-03

384

Factors and Multiples Puzzle  

NSDL National Science Digital Library

This puzzle provides an interesting context which challenges learners to apply their knowledge of the properties of numbers. Learners need to work with various types of numbers at the same time and consider their relationships to each other (e.g. primes, squares and specific sets of multiples).

2012-06-01

385

Managing advanced multiple sclerosis.  

PubMed Central

Multiple sclerosis is one of the most common neurologic conditions in Canada. Many individuals with MS eventually develop the progressive form of the disease. The neurologic and psychosocial manifestations of the later stages of MS are numerous. Family physicians ought to have some understanding of patients with advanced MS and some knowledge of how to manage them. PMID:8499793

Teasell, R. W.

1993-01-01

386

IMMUNOLOGY OF MULTIPLE SCLEROSIS  

Microsoft Academic Search

Ke yW ords autoimmunity, autoimmune mechanisms, neuroimmunology, demyelinating dieseases, EAE ? Abstract Multiple sclerosis (MS) develops in young adults with a complex pre- disposing genetic trait and probably requires an inciting environmental insult such as a viral infection to trigger the disease. The activation of CD4+ autoreactive T cells and their differentiation into a Th1 phenotype is a crucial event

Mireia Sospedra; Roland Martin

2005-01-01

387

Nutrition and multiple gestation.  

PubMed

Multiple pregnancy represents a state of magnified nutritional requirements, resulting in a greater nutrient drain on maternal resources and an accelerated depletion of nutritional reserves. The accelerated starvation which occurs in pregnancy is exaggerated with a multiple gestation, particularly during the second half of pregnancy, with more rapid depletion of glycogen stores and resultant metabolism of fat between meals and during an overnight fast. A reduced glucose stream from mother to fetus results in slower fetal growth, smaller birth size, as well as a higher risk of preterm labor and preterm birth. For this reason, diet therapy with a diabetic regimen of 20% of calories from protein, 40% of calories from carbohydrate, and 40% of calories from fat may be particularly useful. Iron-deficiency anemia has also been linked to preterm delivery and other adverse pregnancy outcomes. Mobilization of maternal iron stores, in addition to an adequate amount and pattern of gestational weight gain (including BMI-specific weight gain goals by 20 and 28 weeks gestation), has been associated with significantly better fetal growth and longer gestations in twin pregnancies. Supplementation with calcium, magnesium, and zinc, as well as multivitamins and essential fatty acids may also reduce pregnancy complications and improve postnatal health for infants born from a multiple gestation. Diet therapy for women pregnant with multiples is an important component of effective prenatal care. PMID:16360494

Luke, Barbara

2005-10-01

388

Multiple Access Trade Study  

NASA Technical Reports Server (NTRS)

The Personal Access Satellite System (PASS) strawman design uses a hybrid Time Division Multiple Access (TDMA)/Frequency Division Multiple Access (FDMA) implementation. TDMA is used for the forward direction (from Suppliers to Users), and FDMA for the return direction (from Users to Suppliers). An alternative architecture is proposed that will require minimal real time coordination and yet provide a fast access method by using random access Code Division Multiple Access (CDMA). The CDMA system issues are addressed such as connecting suppliers and users, both of whom may be located anywhere in the CONUS, when the user terminals are constrained in size and weight; and providing efficient traffic routing under highly variable traffic requirements. It is assumed that bandwidth efficiency is not of paramount importance. CDMA or Spread Spectrum Multiple Access (SSMA) communication is a method in which a group of carriers operate at the same nominal center frequency but are separable from each other by the low cross correlation of the spreading codes used. Interference and multipath rejection capability, ease of selective addressing and message screening, low density power spectra for signal hiding and security, and high resolution ranging are among the benefits of spread spectrum communications.

Motamedi, Masoud

1990-01-01

389

Multiple Grammars and MOGUL  

ERIC Educational Resources Information Center

Optionality is a central phenomenon in second language acquisition (SLA), for which any adequate theory must account. Amaral and Roeper (this issue; henceforth A&R) offer an appealing approach to it, using Roeper's Multiple Grammars Theory, which was created with first language in mind but which extends very naturally to SLA. They include…

Truscott, John

2014-01-01

390

Mastering the Multiplication Facts  

ERIC Educational Resources Information Center

The purpose of this paper is to share the results of a six-week research project (after baseline data was collected) that focused on three different strategies (flashcards, interactive games, and music) and their effectiveness in helping fifth grade students memorize the basic multiplication facts. Many teachers face a serious problem when their…

D'Ettorre, Jenna

2009-01-01

391

Multiple booster spaceports  

Microsoft Academic Search

The need for building a new multiple booster spaceport as a more cost-effective alternative to the currently used vehicle-specific launch facilities is demonstrated. Despite the differences, the current space boosters have a number of systems in common. They all use propellants, require communication systems, launch processing systems, electrical power distribution and control systems, and have structural as well as access

Alan W. Arata

1992-01-01

392

Marsh Geomorphology: Multiple methods  

E-print Network

Marsh Geomorphology: Multiple methods: · RTK GPS pedestrian surveys · Single beam echo soundingIO Measurement Clark Alexander, SkIO Geomorphology Julie Amft, SkIO Measurement Trent Moore, SkIO Measurement Mike Robinson, SkIO, Geomorphology Al Garrett, SRNL Model Dave Hayes, SRNL Dye Dana Savidge, SkIO Radar

Savidge, Dana

393

Multiple Choice Test  

NSDL National Science Digital Library

This site presents a guide to developing and deploying effective multiple choice tests. The site also discusses the costs and benefits of this method, as well as the philosophy of this commonly used assessment method. Links to more detailed information are included as well.

Jay Parkes

394

Simplifying Algebraic Expressions: Multiplication  

NSDL National Science Digital Library

This learning object from Wisc-Online covers simplifying algebraic expressions using multiplication. The unit's activities include defining the terminology associated with algebraic operations, using the fundamental laws of algebra to simplify those expressions, removing the symbols of grouping and changing the signs of the appropriate terms to simplify expressions. Practice questions are also included.

Blohowiak, Chad

395

Assessing Multiple Intelligences.  

ERIC Educational Resources Information Center

This paper explains Howard Gardner's Theory of Multiple Intelligences (MI) and discusses questions raised about MI theory in regard to validity, assessment, and implications for instructional activities. MI theory asserts that human cognitive competence is best described in terms of a set of abilities, talents, and mental skills that each child…

Martin, William C.

396

Reasoning About Multiplication & Division  

NSDL National Science Digital Library

This 7-minute video features Drew Crandall working with his third grade class to develop concepts involving properties of operations and the relationship between multiplication and division. His approach allows students to learn from each other, to construct and revise their own meaning, and to develop communication skills. A downloadable transcript of the video is available (doc).

2013-01-01

397

Occurrence of p53 Gene Deletions and Human Papilloma Virus Infection in Human Head and Neck Cancer1  

Microsoft Academic Search

Little is known regarding the molecular genetic events in head and neck carcinoma. Epidemiológica!evidence suggests that both alcohol and tobacco use are related to the development of these neoplasms, and viral infections have also been postulated to play a role in some tumors. Loss of pSi tumor suppressor gene function has been found in many malignancies and can occur through

David G. Brachman; Deborah Graves; Everett Yokes; Michael Beckett; Daniel Haraf; Antony Montag; Edward Dunphy; Rosemarie Mick; David Yandell; Ralph R. Weichselbaum

1992-01-01

398

A gene deleted in Kallmann's syndrome shares homology with neural cell adhesion and axonal path-finding molecules  

Microsoft Academic Search

Kallmann's syndrome (clinically characterized by hypogonadotropic hypogonadism and inability to smell) is caused by a defect in the migration of olfactory neurons, and neurons producing hypothalamic gonadotropin-releasing hormone. A gene has now been isolated from the critical region on Xp22.3 to which the syndrome locus has been assigned: this gene escapes X inactivation, has a homologue on the Y chromosome,

Brunella Franco; Silvana Guioli; Antonella Pragliola; Barbara Incerti; Barbara Bardoni; Rossana Tonlorenzi; Romeo Carrozzo; Elena Maestrini; Maura Pieretti; Patricia Taillon-Miller; Carolyn J. Brown; Huntington F. Willard; Charles Lawrence; M. Graziella Persico; Giovanna Camerino; Andrea Ballabio

1991-01-01

399

Correlations between long inverted repeat (LIR) features, deletion size and distance from breakpoint in human gross gene deletions  

PubMed Central

Long inverted repeats (LIRs) have been shown to induce genomic deletions in yeast. In this study, LIRs were investigated within ±10?kb spanning each breakpoint from 109 human gross deletions, using Inverted Repeat Finder (IRF) software. LIR number was significantly higher at the breakpoint regions, than in control segments (P < 0.001). In addition, it was found that strong correlation between 5? and 3? LIR numbers, suggesting contribution to DNA sequence evolution (r = 0.85, P < 0.001). 138 LIR features at ±3?kb breakpoints in 89 (81%) of 109 gross deletions were evaluated. Significant correlations were found between distance from breakpoint and loop length (r = ?0.18, P < 0.05) and stem length (r = ?0.18, P < 0.05), suggesting DNA strands are potentially broken in locations closer to bigger LIRs. In addition, bigger loops cause larger deletions (r = 0.19, P < 0.05). Moreover, loop length (r = 0.29, P < 0.02) and identity between stem copies (r = 0.30, P < 0.05) of 3? LIRs were more important in larger deletions. Consequently, DNA breaks may form via LIR-induced cruciform structure during replication. DNA ends may be later repaired by non-homologous end-joining (NHEJ), with following deletion. PMID:25657065

Aygun, Nevim

2015-01-01

400

Col2CreERT2, A MOUSE MODEL FOR A CHONDROCYTE-SPECIFIC AND INDUCIBLE GENE DELETION  

PubMed Central

In 2007 and 2008, we published two articles reporting a tamoxifen (TM)-inducible, chondrocyte-specific gene-targeting mouse model in which the expression of CreERT2 is driven by the type II collagen promoter (Col2CreERT2). The fusion protein is specifically expressed and translocated into the nucleus upon TM administration, which in turn triggers gene recombination. Since then, this animal model has become a powerful tool to study the molecular mechanism of skeletal development and degenerative cartilage diseases, including knee joint osteoarthritis (OA), temporomandibular joint (TMJ) OA, and intervertebral disc (IVD) degeneration. In this review article, we summarise the application of Col2CreERT2 mice and discuss the potential usage of this animal model in a broad spectrum of cartilage development and molecular pathology studies. PMID:25340803

Chen, M.; Li, S.; Xie, W.; Wang, B.; Chen, D.

2014-01-01

401

Detection of small RB1 gene deletions in retinoblastoma by multiplex PCR and high-resolution gel electrophoresis  

Microsoft Academic Search

Loss of function of both copies of the RB1 gene is a causal event in the development of retinoblastoma. The predisposition to this tumor can be inherited as an autosomal dominant trait. Direct detection of the genetic defect is important for presymptomatic DNA diagnosis and genetic counseling in families with hereditary retinoblastoma. We have used multiplex polymerase chain reaction and

Dietmar Lohmann; Bernhard Horsthemke; Gabriele Gillessen-Kaesbach; Fritz Heinrich Stefani; Heinz Höfler

1992-01-01

402

Glycosylation Defects and Virulence Phenotypes of Leishmania mexicana Phosphomannomutase and Dolicholphosphate-Mannose Synthase Gene Deletion Mutants  

Microsoft Academic Search

Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophospho- glycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glyco- inositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana

ATTILA GARAMI; ANGELA MEHLERT; THOMAS ILG

2001-01-01

403

Inducible gene deletion in the entire cardiac conduction system using Hcn4-CreERT2 BAC transgenic mice.  

PubMed

Developmental defects and disruption of molecular pathways of the cardiac conduction system (CCS) can cause life-threatening cardiac arrhythmias. Despite decades of effort, knowledge about the development and molecular control of the CCS remains primitive. Mouse genetics, complementary to other approaches such as human genetics, has become a key tool for exploring the developmental processes of various organs and associated diseases. Genetic analysis using mouse models will likely provide great insights about the development of the CCS, which can facilitate the development of novel therapeutic strategies to treat arrhythmias. To enable genetic studies of the CCS, CCS-associated Cre mouse models are essential. However, existing mouse models with Cre activity reported in the CCS have various limitations such as Cre leak, haploinsufficiency, and inadequate specificity of the Cre activity. To circumvent those limitations, we successfully generated Hcn4-CreERT2 bacterial artificial chromosome (BAC) transgenic mice using BAC recombineering in which Cre activity was specifically detected in the entire CCS after tamoxifen induction. Our Hcn4-CreERT2 BAC transgenic line will be an invaluable genetic tool with which to dissect the developmental control of CCS and arrhythmias. PMID:24281837

Wu, Meng; Peng, Siwu; Zhao, Yong

2014-02-01

404

A tailored galK counterselection system for efficient markerless gene deletion and chromosomal tagging in Magnetospirillum gryphiswaldense.  

PubMed

Magnetotactic bacteria have emerged as excellent model systems to study bacterial cell biology, biomineralization, vesicle formation, and protein targeting because of their ability to synthesize single-domain magnetite crystals within unique organelles (magnetosomes). However, only few species are amenable to genetic manipulation, and the limited methods for site-specific mutagenesis are tedious and time-consuming. Here, we report the adaptation and application of a fast and convenient technique for markerless chromosomal manipulation of Magnetospirillum gryphiswaldense using a single antibiotic resistance cassette and galK-based counterselection for marker recycling. We demonstrate the potential of this technique by genomic excision of the phbCAB operon, encoding enzymes for polyhydroxyalkanoate (PHA) synthesis, followed by chromosomal fusion of magnetosome-associated proteins to fluorescent proteins. Because of the absence of interfering PHA particles, these engineered strains are particularly suitable for microscopic analyses of cell biology and magnetosome biosynthesis. PMID:24814778

Raschdorf, Oliver; Plitzko, Jürgen M; Schüler, Dirk; Müller, Frank D

2014-07-01

405

Oculo-facio-cardio-dental (OFCD) syndrome: The first Italian case of BCOR and co-occurring OTC gene deletion.  

PubMed

Oculo-facio-cardio-dental (OFCD) syndrome is a rare genetic disorder affecting ocular, facial, dental and cardiac systems. The syndrome is an X-linked dominant trait and it might be lethal in males. This syndrome is usually caused by mutations in the BCL6 interacting co-repressor gene (BCOR). We described a female child with mild phenotype of oculo-facio-cardio-dental syndrome. Array-comparative genomic hybridization (a-CGH) analysis revealed a de novo heterozygous deletion in the Xp11.4 region of approximately 2.3Mb, involving BCOR and ornithine carbamoyl-transferase (OTC) genes. The deletion observed was subsequently confirmed by real time PCR. In this study we report a first case with co-occurrence of BCOR and OTC genes completely deleted in OFCD syndrome. PMID:25620158

Di Stefano, C; Lombardo, B; Fabbricatore, C; Munno, C; Caliendo, I; Gallo, F; Pastore, L

2015-04-01

406

CONSTRUCTION AND CHARACTERIZATION OF PTA GENE DELETED MUTANT OF C CLOSTRIDIUM TYROBUTYRICUM FOR BUTYRIC ACID FERMENTATION. (R829479C016)  

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

407

Activation of inflammasomes in podocyte injury of mice on the high fat diet: Effects of ASC gene deletion and silencing.  

PubMed

Inflammasome, an intracellular inflammatory machinery, has been reported to be involved in a variety of chronic degenerative diseases such as atherosclerosis, autoinflammatory diseases and Alzheimer's disease. The present study hypothesized that the formation and activation of inflammasomes associated with apoptosis associated speck-like protein (ASC) are an important initiating mechanism resulting in obesity-associated podocyte injury and consequent glomerular sclerosis. To test this hypothesis, Asc gene knockout (Asc(-/-)), wild type (Asc(+/+)) and intrarenal Asc shRNA-transfected wild type (Asc shRNA) mice were fed a high fat diet (HFD) or normal diet (ND) for 12 weeks to produce obesity and associated glomerular injury. Western blot and RT-PCR analyses demonstrated that renal tissue Asc expression was lacking in Asc(-/-) mice or substantially reduced in Asc shRNA transfected mice compared to Asc(+/+) mice. Confocal microscopic and co-immunoprecipitation analysis showed that the HFD enhanced the formation of inflammasome associated with Asc in podocytes as shown by colocalization of Asc with Nod-like receptor protein 3 (Nalp3). This inflammasome complex aggregation was not observed in Asc(-/-) and local Asc shRNA-transfected mice. The caspase-1 activity, IL-1? production and glomerular damage index (GDI) were also significantly attenuated in Asc(-/-) and Asc shRNA-transfected mice fed the HFD. This decreased GDI in Asc(-/-) and Asc shRNA transfected mice on the HFD was accompanied by attenuated proteinuria, albuminuria, foot process effacement of podocytes and loss of podocyte slit diaphragm molecules. In conclusion, activation and formation of inflammasomes in podocytes are importantly implicated in the development of obesity-associated glomerular injury. PMID:24508291

Boini, Krishna M; Xia, Min; Abais, Justin M; Li, Guangbi; Pitzer, Ashley L; Gehr, Todd W B; Zhang, Yang; Li, Pin-Lan

2014-05-01

408

CD36 gene deletion reduces fat preference and intake but not post-oral fat conditioning in mice.  

PubMed

Several findings suggest the existence of a "fatty" taste, and the CD36 fatty acid translocase is a candidate taste receptor. The present study compared fat preference and acceptance in CD36 knockout (KO) and wild-type (WT) mice using nutritive (triglyceride and fatty acid) and nonnutritive (Sefa Soyate oil) emulsions. In two-bottle tests (24 h/day) naive KO mice, unlike WT mice, displayed little or no preference for dilute soybean oil, linoleic acid, or Sefa Soyate emulsions. At high concentrations (2.5-20%), KO mice developed significant soybean oil preferences, although they consumed less oil than WT mice. The postoral actions of fat likely conditioned these preferences. KO mice, like WT mice, learned to prefer a flavored solution paired with intragastric soybean oil infusions. These findings support CD36 mediation of a gustatory component to fat preference but demonstrate that it is not essential for fat-conditioned flavor preferences. The finding that oil-naive KO mice failed to prefer a nonnutritive oil, assumed to provide texture rather than taste cues, requires explanation. Finally, CD36 deletion decreased fat consumption and enhanced the ability of the mice to compensate for the calories provided by their optional fat intake. PMID:17804586

Sclafani, A; Ackroff, K; Abumrad, N A

2007-11-01

409

Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation  

SciTech Connect

Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially mediates island attachments. To test this, we generated ICAM-4 knockout mice and developed quantitative, live cell techniques for harvesting intact islands and for reforming islands in vitro. We observed a 47 percent decrease in islands reconstituted from ICAM-4 null marrow compared to wild type. We also found a striking decrease in islands formed in vivo in knockout mice. Further, peptides that block ICAM-4 alpha V adhesion produced a 53-57 percent decrease in reconstituted islands, strongly suggesting that ICAM-4 binding to macrophage alpha V functions in island integrity. Importantly, we documented that alpha V integrin is expressed in macrophages isolated from erythro blastic islands. Collectively, these data provide convincing evidence that ICAM-4 is critical in erythroblastic island formation via ICAM-4/alpha V adhesion and also demonstrate that the novel experimental strategies we developed will be valuable in exploring molecular mechanisms of erythroblastic island formation and their functional role in regulating erythropoiesis.

Lee, Gloria; Lo, Annie; Short, Sarah A.; Mankelow, Tosti J.; Spring, Frances; Parsons, Stephen F.; Mohandas, Narla; Anstee, David J.; Chasis, Joel Anne

2006-02-15

410

Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB  

SciTech Connect

The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT, accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.

Lin, Hui [ORNL] [ORNL; Hurt, Jr., Richard Ashley [ORNL; Johs, Alexander [ORNL] [ORNL; Parks, Jerry M [ORNL] [ORNL; Morrell-Falvey, Jennifer L [ORNL] [ORNL; Liang, Liyuan [ORNL] [ORNL; Elias, Dwayne A [ORNL] [ORNL; Gu, Baohua [ORNL] [ORNL

2014-01-01

411

Exploiting gene deletion fitness effects in yeast to understand the modular architecture of protein complexes under different growth conditions  

E-print Network

of glucose. Those isoforms cover key ele- ments of the respiratory pathway: the Pyruvate dehydro- genase complex, which transforms pyruvate into Acetyl CoA, the 2-oxoglutarate dehydrogenase complex, an enzyme of the tricarboxylic acid cycle, the Cytochrome bc... required in amino-acid rich media), while for all isoforms of the 20S core particle of the proteasome, which repre- sents the main character in the protein degradation machinery, both core (i.e. different alpha- and beta-type subunits) and attachment...

Pache, Roland A; Babu, M Madan; Aloy, Patrick

2009-07-18

412

Expression Analysis and Protein Localization of the Human HPC1\\/Syntaxin 1A, a Gene Deleted in Williams Syndrome  

Microsoft Academic Search

The HPC-1\\/syntaxin 1A (STX1A) gene maps to the Williams syndrome (WS) commonly deleted region on chromosome 7q11.23 and encodes a protein implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. To assess the potential role of STX1A in the WS phenotype, we carried out expression studies at the RNA and protein levels, in fetal and adult human

A. Botta; F. Sangiuolo; L. Calza; L. Giardino; S. Potenza; G. Novelli; B. Dallapiccola

1999-01-01

413

Aquaporin-4 regulates extracellular space volume dynamics during high-frequency synaptic stimulation: a gene deletion study in mouse hippocampus.  

PubMed

Little is known about the physiological roles of aquaporin-4 (AQP4) in the central nervous system. AQP4 water channels are concentrated in endfeet membranes of astrocytes but also localize to the fine astrocytic processes that abut central synapses. Based on its pattern of expression, we predicted that AQP4 could be involved in controlling water fluxes and changes in extracellular space (ECS) volume that are associated with activation of excitatory pathways. Here, we show that deletion of Aqp4 accentuated the shrinkage of the ECS that occurred in the mouse hippocampal CA1 region during activation of Schaffer collateral/commissural fibers. This effect was found in the stratum radiatum (where perisynaptic astrocytic processes abound) but not in the pyramidal cell layer (where astrocytic processes constitute but a minor volume fraction). For both genotypes the ECS shrinkage was most pronounced in the pyramidal cell layer. Our data attribute a physiological role to AQP4 and indicate that this water channel regulates extracellular volume dynamics in the mammalian brain. PMID:22419561

Haj-Yasein, Nadia Nabil; Jensen, Vidar; Østby, Ivar; Omholt, Stig W; Voipio, Juha; Kaila, Kai; Ottersen, Ole P; Hvalby, Øivind; Nagelhus, Erlend A

2012-05-01

414

Fusion PCR-targeted tylCV gene deletion of Streptomyces fradiae for producing desmycosin, the direct precursor of tilmicosin  

Microsoft Academic Search

Tilmicosin is a semisynthetic macrolide antibiotic derived from tylosin. The disruption of tylCV gene from tylosin producer—Streptomyces fradiae would result in the accumulation of desmycosin, the direct precursor of tilmicosin. TylCV gene disruption cassette was constructed by fusion PCR. The tylCV replacement strain of S. fradiae was obtained through intergeneric conjugation between S. fradiae and E. coli. The antibiotic resistance

Yong Min; Heping Lv; Yinghua Zheng

2007-01-01

415

Orthopoxvirus Genes for Kelch-like Proteins: II. Construction of Cowpox Virus Variants with Targeted Gene Deletions  

Microsoft Academic Search

Integrative plasmids p?C, p?D, and p?G were designed to contain a selective marker beyond the region of homology to virus DNA and to allow construction of recombinant cowpox viruses (CPV) that lack C18L, D11L, or G3L coding for kelch-like proteins. CPV mutants lacking one (C18L, D11L, or G3L), two (D11L\\/G3L or C18L\\/D11L), or three (D11L\\/G3L\\/C18L, that is, all) kelch-like protein

I. V. Kolosova; S. V. Seregin; G. V. Kochneva; E. I. Ryabchikova; E. V. Bessmel'tseva; I. N. Babkina; T. E. Solenova; I. V. Babkin; S. N. Shchelkunov

2003-01-01

416

Constitutional von Hippel-Lindau (VHL) Gene Deletions Detected in VHL Families by Fluorescence in Situ Hybridization1  

Microsoft Academic Search

von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited cancer syndrome predisposing to a variety of tumor types that include retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas, pancreatic cysts and tumors, pheochromo- cytomas, endolymphatic sac tumors, and epididymal cystadenomas (W. M. Linehan et al., J. Am. Med. Assoc., 273: 564 -570, 1995; E. A. Maher and

Svetlana D. Pack; Berton Zbar; Evgenia Pak; David O. Ault; Jeffrey S. Humphrey; Thu Pham; Kathy Hurley; Robert J. Weil; Won-Sang Park; Igor Kuzmin; Catherine Stolle; Gladys Glenn; Lance A. Liotta; Michael I. Lerman; Richard D. Klausner; W. Marston Linehan; Zhengping Zhuang

417

A Tailored galK Counterselection System for Efficient Markerless Gene Deletion and Chromosomal Tagging in Magnetospirillum gryphiswaldense  

PubMed Central

Magnetotactic bacteria have emerged as excellent model systems to study bacterial cell biology, biomineralization, vesicle formation, and protein targeting because of their ability to synthesize single-domain magnetite crystals within unique organelles (magnetosomes). However, only few species are amenable to genetic manipulation, and the limited methods for site-specific mutagenesis are tedious and time-consuming. Here, we report the adaptation and application of a fast and convenient technique for markerless chromosomal manipulation of Magnetospirillum gryphiswaldense using a single antibiotic resistance cassette and galK-based counterselection for marker recycling. We demonstrate the potential of this technique by genomic excision of the phbCAB operon, encoding enzymes for polyhydroxyalkanoate (PHA) synthesis, followed by chromosomal fusion of magnetosome-associated proteins to fluorescent proteins. Because of the absence of interfering PHA particles, these engineered strains are particularly suitable for microscopic analyses of cell biology and magnetosome biosynthesis. PMID:24814778

Raschdorf, Oliver; Plitzko, Jürgen M.; Schüler, Dirk

2014-01-01

418

Homologous recombination of a flanking repeat gene cluster is a mechanism for a common contiguous gene deletion syndrome.  

PubMed

Smith-Magenis syndrome (SMS), caused by del(17)p11.2, represents one of the most frequently observed human microdeletion syndromes. We have identified three copies of a low-copy-number repeat (SMS-REPs) located within and flanking the SMS common deletion region and show that SMS-REP represents a repeated gene cluster. We have isolated a corresponding cDNA clone that identifies a novel junction fragment from 29 unrelated SMS patients and a different-sized junction fragment from a patient with dup(17)p11.2. Our results suggest that homologous recombination of a flanking repeat gene cluster is a mechanism for this common microdeletion syndrome. PMID:9326934

Chen, K S; Manian, P; Koeuth, T; Potocki, L; Zhao, Q; Chinault, A C; Lee, C C; Lupski, J R

1997-10-01

419

The NPHP1 Gene Deletion Associated with Juvenile Nephronophthisis Is Present in a Subset of Individuals with Joubert Syndrome  

PubMed Central

Joubert syndrome (JS) is an autosomal recessive multisystem disease characterized by cerebellar vermis hypoplasia with prominent superior cerebellar peduncles (the “molar tooth sign” [MTS] on axial magnetic resonance imaging), mental retardation, hypotonia, irregular breathing pattern, and eye-movement abnormalities. Some individuals with JS have retinal dystrophy and/or progressive renal failure characterized by nephronophthisis (NPHP). Thus far, no mutations in the known NPHP genes, particularly the homozygous deletion of NPHP1 at 2q13, have been identified in subjects with JS. A cohort of 25 subjects with JS and either renal and/or retinal complications and 2 subjects with only juvenile NPHP were screened for mutations in the NPHP1 gene by standard methods. Two siblings affected with a mild form of JS were found to have a homozygous deletion of the NPHP1 gene identical, by mapping, to that in subjects with NPHP alone. A control subject with NPHP and with a homozygous NPHP1 deletion was also identified, retrospectively, as having a mild MTS and borderline intelligence. The NPHP1 deletion represents the first molecular defect associated with JS in a subset of mildly affected subjects. Cerebellar malformations consistent with the MTS may be relatively common in patients with juvenile NPHP without classic symptoms of JS. PMID:15138899

Parisi, Melissa A.; Bennett, Craig L.; Eckert, Melissa L.; Dobyns, William B.; Gleeson, Joseph G.; Shaw, Dennis W. W.; McDonald, Ruth; Eddy, Allison; Chance, Phillip F.; Glass, Ian A.

2004-01-01

420

Comparison of interval timing behaviour in mice following dorsal or ventral hippocampal lesions with mice having ?-opioid receptor gene deletion  

PubMed Central

Mice with cytotoxic lesions of the dorsal hippocampus (DH) underestimated 15 s and 45 s target durations in a bi-peak procedure as evidenced by proportional leftward shifts of the peak functions that emerged during training as a result of decreases in both ‘start’ and ‘stop’ times. In contrast, mice with lesions of the ventral hippocampus (VH) displayed rightward shifts that were immediately present and were largely limited to increases in the ‘stop’ time for the 45 s target duration. Moreover, the effects of the DH lesions were congruent with the scalar property of interval timing in that the 15 s and 45 s functions superimposed when plotted on a relative timescale, whereas the effects of the VH lesions violated the scalar property. Mice with DH lesions also showed enhanced reversal learning in comparison to control and VH lesioned mice. These results are compared with the timing distortions observed in mice lacking ?-opioid receptors (Oprd1?/?) which were similar to mice with DH lesions. Taken together, these results suggest a balance between hippocampal–striatal interactions for interval timing and demonstrate possible functional dissociations along the septotemporal axis of the hippocampus in terms of motivation, timed response thresholds and encoding in temporal memory. PMID:24446500

Yin, Bin; Meck, Warren H.

2014-01-01

421

Vaccination with a live multi-gene deletion strain protects horses against virulent challenge with Streptococcus equi.  

PubMed

Strangles, caused by Streptococcus equi subspecies equi (S. equi) is one of the most frequently diagnosed infectious diseases of horses and there remains a significant need to develop new preventative vaccines. We generated a live vaccine strain of S. equi containing deletions in six genes: sagA, hasA, aroB, pyrC, seM and recA, which was administered to nine Welsh mountain ponies via the intramuscular route. Four vaccinated ponies developed adverse reactions following the first vaccination from which the live vaccine strain was isolated. Two of these ponies were withdrawn from the study and seven ponies received a second vaccination, one of which then developed an adverse reaction. Nine control ponies injected with culture media alone developed no adverse reactions. Following challenge with a virulent strain of S. equi, none of the seven vaccinated ponies had developed clinical signs of strangles eleven days post-challenge, compared to six of nine control ponies over the same period (P=0.0114). A lymph node abscess was identified in one of the seven vaccinated ponies at post-mortem examination, whilst all nine control ponies had at least one lymph node abscess (P=0.0009). Three of the six vaccinated ponies that were protected from strangles had not developed an adverse reaction following vaccination, suggesting that a better understanding of the pro-inflammatory responses to S. equi could lead to the development of a live attenuated vaccine against strangles that is safe for administration via intramuscular injection. PMID:25597942

Robinson, Carl; Heather, Zoe; Slater, Josh; Potts, Nicola; Steward, Karen F; Maskell, Duncan J; Fontaine, Michael C; Lee, Jeong-Jin; Smith, Ken; Waller, Andrew S

2015-02-25

422

Fluid reabsorption in proximal convoluted tubules of mice with gene deletions of claudin-2 and/or aquaporin1  

PubMed Central

Deletions of claudin-2 (Cldn2) and aquaporin1 (AQP1) reduce proximal fluid reabsorption (PFR) by about 30% and 50%, respectively. Experiments were done to replicate these observations and to determine in AQP1/claudin-2 double knockout mice (DKO) if the effects of deletions of these established water pores are additive. PFR was determined in inactin/ketamine-anesthetized mice by free-flow micropuncture using single-nephron I125-iothalamate (io) clearance. Animal means of PFR [% of glomerular filtration rate (GFR)] derived from TF/Piothalamate ratios in 12 mice in each of four groups [wild type (WT), Cldn2?/?, AQP1?/?, and DKO) were 45.8 ± 0.85 (51 tubules), 35.4 ± 1 (54 tubules; P < 0.01 vs. WT), 36.8 ± 1 (63 tubules; P < 0.05 vs. WT), and 33.9 ± 1.4 (69 tubules; P < 0.01 vs. WT). Kidney and single-nephron GFRs (SNGFR) were significantly reduced in all mutant strains. The direct relationship between PFR and SNGFR was maintained in mutant mice, but the slope of this relationship was reduced in the absence of Cldn2 and/or AQP1. Transtubular osmotic pressure differences were not different between WT and Cldn2?/? mice, but markedly increased in DKO. In conclusion, the deletion of Cldn2, AQP1, or of both Cldn2 and AQP1 reduces PFR by 22.7%, 19.6%, and 26%, respectively. Our data are consistent with an up to 25% paracellular contribution to PFR. The reduced osmotic water permeability caused by absence of AQP1 augments luminal hypotonicity. Aided by a fall in filtered load, the capacity of non-AQP1-dependent transcellular reabsorption is sufficient to maintain PFR without AQP1 and claudin-2 at 75% of control. PMID:24049145

Huang, Yuning; Mizel, Diane

2013-01-01

423

?2?-1 Gene Deletion Affects Somatosensory Neuron Function and Delays Mechanical Hypersensitivity in Response to Peripheral Nerve Damage  

PubMed Central

The ?2?-1 subunit of voltage-gated calcium channels is upregulated after sensory nerve injury and is also the therapeutic target of gabapentinoid drugs. It is therefore likely to play a key role in the development of neuropathic pain. In this study, we have examined mice in which ?2?-1 gene expression is disrupted, to determine whether ?2?-1 is involved in various modalities of nociception, and for the development of behavioral hypersensitivity after partial sciatic nerve ligation (PSNL). We find that naive ?2?-1?/? mice show a marked behavioral deficit in mechanical and cold sensitivity, but no change in thermal nociception threshold. The lower mechanical sensitivity is mirrored by a reduced in vivo electrophysiological response of dorsal horn wide dynamic range neurons. The CaV2.2 level is reduced in brain and spinal cord synaptosomes from ?2?-1?/? mice, and ?2?-1?/? DRG neurons exhibit lower calcium channel current density. Furthermore, a significantly smaller number of DRG neurons respond to the TRPM8 agonist menthol. After PSNL, ?2?-1?/? mice show delayed mechanical hypersensitivity, which only develops at 11 d after surgery, whereas in wild-type littermates it is maximal at the earliest time point measured (3 d). There is no compensatory upregulation of ?2?-2 or ?2?-3 after PSNL in ?2?-1?/? mice, and other transcripts, including neuropeptide Y and activating transcription factor-3, are upregulated normally. Furthermore, the ability of pregabalin to alleviate mechanical hypersensitivity is lost in PSNL ?2?-1?/? mice. Thus, ?2?-1 is essential for rapid development of mechanical hypersensitivity in a nerve injury model of neuropathic pain. PMID:24133248

Patel, Ryan; Bauer, Claudia S.; Nieto-Rostro, Manuela; Margas, Wojciech; Ferron, Laurent; Chaggar, Kanchan; Crews, Kasumi; Ramirez, Juan D.; Bennett, David L. H.; Schwartz, Arnold; Dickenson, Anthony H.

2013-01-01

424

GJB1 \\/Connexin 32 whole gene deletions in patients with X-linked Charcot–Marie–Tooth disease  

Microsoft Academic Search

The X-linked form of Charcot–Marie–Tooth disease (CMTX) is the second most common form of this genetically heterogeneous inherited\\u000a peripheral neuropathy. CMT1X is caused by mutations in the GJB1 gene. Most of the mutations causative for CMT1X are missense mutations. In addition, a few disease causative nonsense mutations\\u000a and frameshift deletions that lead to truncated forms of the protein have also

Claudia Gonzaga-Jauregui; Feng Zhang; Charles F. Towne; Sat Dev Batish; James R. Lupski

2010-01-01

425

Comparison of multiple DNA vaccines for protection against cytomegalovirus infection in BALB/c mice  

PubMed Central

Background Human cytomegalovirus (HCMV) causes serious HCMV-related diseases in immunocompromised people. Vaccination is the most effective measure to control infection with the pathogen, yet no vaccine has been licensed till now. We performed a head-to-head comparison of the protective abilities of multiple DNA vaccines in murine model of murine cytomegalovirus (MCMV) infection. Methods Five DNA vaccines were constructed. Four encoding MCMV proteins gp34 (m04), p65 (M84), DNA helicase (M105), and immediate-early 1 protein pp89 (IE-1) , respectively, which were reported to induce CD8+ T cell responses, were compared with the one expressing gB (M55), the neutralizing antibody target antigen, for immune