These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Markerless Multiple-Gene-Deletion System for Streptococcus mutans  

Microsoft Academic Search

Inactivation or selective modification is essential to elucidate the putative function of a gene. The present study describes an improved Cre-loxP-based method for markerless multiple gene deletion in Streptococcus mutans, the principal etiological agent of dental caries. This modified method uses two mutant loxP sites, which after recombination creates a double-mutant loxP site that is poorly recognized by Cre recombinase,

Anirban Banerjee; Indranil Biswas

2008-01-01

2

Reduced Expression of the Immediate-Early Protein IE0 Enables Efficient Replication of Autographa californica Multiple Nucleopolyhedrovirus in Poorly Permissive Spodoptera littoralis Cells†  

PubMed Central

Infection of Spodoptera littoralis SL2 cells with the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) results in apoptosis and low yields of viral progeny, in contrast to infection with S. littoralis nucleopolyhedrovirus (SlNPV). By cotransfecting SL2 cells with AcMNPV genomic DNA and a cosmid library representing the complete SlNPV genome, we were able to rescue AcMNPV replication and to isolate recombinant virus vAcSL2, which replicated efficiently in SL2 cells. Moreover, vAcSL2 showed enhanced infectivity for S. littoralis larvae compared to AcMNPV. The genome of vAcSL2 carried a 519-bp insert fragment that increased the distance between the TATA element and the transcriptional initiation site (CAGT) of immediate-early gene ie0. This finding correlated with low steady-state levels of IE0 and higher steady-state levels of IE1 (the product of the ie1 gene, a major AcMNPV transactivator, and a multifunctional protein) than of IE0. Mutagenesis of the ie0 promoter locus by insertion of the chloramphenical acetyltransferase (cat) gene yielded a new recombinant AcMNPV with replication properties identical to those of vAcSL2. Thus, the analysis indicated that increasing the steady-state levels of IE1 relative to IE0 should enable AcMNPV replication in SL2 cells. This suggestion was confirmed by constructing a recombinant AcMNPV bearing an extra copy of the ie1 gene under the control of the Drosophila hsp70 promoter. These results suggest that IE0 plays a role in the regulation of AcMNPV infection and show, for the first time, that significant improvement in the ability of AcMNPV to replicate in a poorly permissive cell line and organism can be achieved by increasing the expression of the main multiple functional protein, IE1. PMID:12477858

Lu, Liqun; Du, Quansheng; Chejanovsky, Nor

2003-01-01

3

Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication.  

PubMed

We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication. PMID:11739696

Meier, Jeffery L; Keller, Michael J; McCoy, James J

2002-01-01

4

Requirement of Multiple cis-Acting Elements in the Human Cytomegalovirus Major Immediate-Early Distal Enhancer for Viral Gene Expression and Replication  

PubMed Central

We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer’s orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at ?300 or ?345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication. PMID:11739696

Meier, Jeffery L.; Keller, Michael J.; McCoy, James J.

2002-01-01

5

Interstitial deletion of 11(p11.2p12): A newly described contiguous gene deletion syndrome involving the gene for hereditary multiple exostoses  

SciTech Connect

Individuals with deletions of the proximal portion of the short arm of chromosome 11 share many manifestations including mental retardation, biparietal foramina, minor facial anomalies, and multiple cartilaginous exostoses. The finding of multiple exostoses in these patients is remarkable as the disorder hereditary multiple exostoses, which is inherited in an autosomal dominant manner, has recently been mapped by linkage to three regions, including proximal 11p. We report the clinical and molecular findings in an additional patient with an 11(p11.2p12) deletion. Cytogenetic and molecular analysis demonstrated a de novo, paternally derived deletion for markers which have been shown to be tightly linked to the 11p locus (EXT2). These data support the location of EXT2 within this region and also provide information regarding the ordering of polymorphic markers on 11p. Deletion 11(p11.2p12) is a rare, yet specific, deletion syndrome involving the EXT2 locus, a gene for parietal foramina, and a mental retardation locus, and therefore can be classified as a contiguous gene deletion syndrome. 24 refs., 4 figs., 1 tab.

Potocki, L.; Shaffer, L.G. [Baylor College of Medicine, Houston, TX (United States)] [Baylor College of Medicine, Houston, TX (United States)

1996-03-29

6

Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru  

PubMed Central

The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

2013-01-01

7

Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru.  

PubMed

The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F; Griffing, Sean M; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J; Bacon, David J; Barnwell, John W; Udhayakumar, Venkatachalam

2013-01-01

8

Immediate early genes expressed in chlorovirus infections  

Microsoft Academic Search

Twenty-three chlorovirus genes expressed in host cells as early as 5–10 min postinfection (p.i.), or immediate early, were isolated and characterized. Some showed significant homology with those for transcriptional factors and mRNA-processing proteins including TFIIB, helicases, mRNA capping enzyme, nucleolin, and bean transcription factor. Others code for (i) factors influencing translation such as aminoacyl tRNA synthetases and ribosomal protein, and

Takeru Kawasaki; Masahiro Tanaka; Makoto Fujie; Shoji Usami; Takashi Yamada

2004-01-01

9

Adaptive cyanogenesis clines evolve recurrently through geographical sorting of existing gene deletions.  

PubMed

Identifying the genetic basis of parallel phenotypic evolution provides insight into the process of adaptation and evolutionary constraint. White clover (Trifolium repens) has evolved climate-associated adaptive clines in cyanogenesis (the ability to produce hydrogen cyanide upon tissue damage) in several world regions where it has been introduced. Gene-deletion polymorphisms at the CYP79D15 and Li loci underlie the presence/absence of the cyanogenic phenotype. Both loci have undergone multiple independent gene-deletion events, which are identifiable through molecular signatures in flanking regions. To investigate whether cyanogenesis clines in introduced populations have evolved through the sorting of standing genetic variation or de novo gene deletions, we examined cyanogenesis gene-flanking regions in three world regions. In comparison with native Eurasian populations, we find no evidence for novel gene deletion events in any introduced region, which suggests that these adaptive clines have evolved through the geographical sorting of pre-existing genetic variation. PMID:25146520

Kooyers, N J; Olsen, K M

2014-10-01

10

Immediate early genes expressed in chlorovirus infections.  

PubMed

Twenty-three chlorovirus genes expressed in host cells as early as 5-10 min postinfection (p.i.), or immediate early, were isolated and characterized. Some showed significant homology with those for transcriptional factors and mRNA-processing proteins including TFIIB, helicases, mRNA capping enzyme, nucleolin, and bean transcription factor. Others code for (i) factors influencing translation such as aminoacyl tRNA synthetases and ribosomal protein, and (ii) unknown proteins. Enzymes involved in polysaccharide synthesis were also found. All transcripts of these genes had a poly(A) tail, which decreased in size after 20 min p.i., possibly caused by the shortening by an exonuclease. Often, due to readthrough either from an upstream ORF or into a downstream ORF, a few extra transcripts for each gene appeared after 40 min p.i., suggesting a change in promoter selection and termination accuracy at this point. A typical TATA-box and a common element 5'-ATGACAA were in the promoter region of almost all of the immediate early genes, which may be recognized by host RNA polymerase and transcription factors. PMID:14972549

Kawasaki, Takeru; Tanaka, Masahiro; Fujie, Makoto; Usami, Shoji; Yamada, Takashi

2004-01-01

11

Kaposi's sarcoma-associated herpesvirus immediate early gene activity.  

PubMed

KSHV is the causative agent of three human proliferative disorders: Kaposi s sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. Herpesvirus gene expression and viral replication is a complex, tightly regulated process involving latent, immediate early, early, and late viral gene transcription. The immediate early genes generally code for transcriptional activators and are critical for initiating viral transcription. KSHV encodes for approximately nine immediate early gene products, including ORF50, K8, K9, K3, K5, ORF57, ORF29b, ORF45, and K4.2. This review will address the activities of these proteins and what roles they play in virus replication, evasion of the host immune response, and viral pathogenesis. PMID:15353285

Lacoste, Vincent; de la Fuente, Cynthia; Kashanchi, Fatah; Pumfery, Anne

2004-09-01

12

In Vivo Replication of Recombinant Murine Cytomegalovirus Driven by the Paralogous Major Immediate-Early Promoter Enhancer of Human Cytomegalovirus  

Microsoft Academic Search

Transcription of the major immediate-early (MIE) genes of cytomegaloviruses (CMV) is driven by a strong promoter-enhancer (MIEPE) complex. Transactivator proteins encoded by these MIE genes are essential for productive infection. Accordingly, the MIEPE is a crucial control point, and its regulation by activators and repressors is pertinent to virus replication. Since the MIEPE contains multiple regulatory elements, it was reasonable

NATASCHA K. A. GRZIMEK; JURGEN PODLECH; HANS-PETER STEFFENS; RAFAELA HOLTAPPELS; SUSANNE SCHMALZ; MATTHIAS J. REDDEHASE

1999-01-01

13

Characterization of immediate early genes expressed in chlorovirus infection.  

PubMed

By Southern blot analysis of restriction fragments of a chlorovirus CVK2 genomic contig with probes of RNA expressed immediate early in infection, sixteen genes were specifically found to be expressed in the host cells. These genes include those for aminoacyl-tRNA synthetase, nucleolin, ribosomal protein S5, hyaluronan synthase, TFIID etc. All of these transcripts were polyadenylated and most likely expressed in the host nucleus. The structural characteristics of these genes are discussed in connection with their expression mechanism. The biological importance of the gene products in viral infection are also considered. PMID:12903318

Kawasaki, T; Nishida, K; Fujie, M; Usami, S; Yamada, T

2000-01-01

14

DNA array analysis of interleukin-2-regulated immediate/early genes  

PubMed Central

Background Lymphocyte activation culminates in blastogenesis, cell cycle progression, DNA replication and mitosis. These complex cellular changes are programmed almost simultaneously by multiple ligands and receptors that trigger specific signal transduction pathways and transcription factors. Until now, the discovery of the genes regulated by each ligand/receptor pair has been hampered by the technologies available. Results To identify interleukin-2 (IL-2)-responsive genes, human peripheral blood mononuclear cells (PBMC) were pre-activated with anti-CD3, rested, and restimulated with IL-2 for 4 hr. Gene expression was analyzed using Affymetrix U95Av2 oligonucleotide arrays. To determine the most stringent parameters to score a gene as a bona fide IL-2 target, the expression of 19 known IL-2-regulated genes was examined first. All were induced at least 2-fold, with a difference in fluorescent intensity of ? 100 at p < 0.05. An additional 53 unique genes met these criteria. To determine which of these were immediate/early IL-2 targets in T cells, purified T cells were stimulated with IL-2 for 4 hr in the presence of cycloheximide to prevent secondary gene expression. Of the 72 genes identified in PBMCs, 20 were detected as immediate/early IL-2-regulated genes in purified T cells. In addition, 27 unique genes were IL-2-regulated in T cells but not in PBMCs. Conclusions For a successful reductionist approach to the analysis of gene expression in lymphocyte activation, it is necessary to examine purified cell populations and immediate/early gene expression regulated by each ligand/receptor pair involved. This approach should allow the discovery of genes regulated by all of the ligand/receptor pairs involved in lymphocyte activation. PMID:12459040

Beadling, Carol; Smith, Kendall A

2002-01-01

15

The human cytomegalovirus major immediate-early distal enhancer region is required for efficient viral replication and immediate-early gene expression.  

PubMed

The human cytomegalovirus (HCMV) major immediate-early (MIE) genes, encoding IE1 p72 and IE2 p86, are activated by a complex enhancer region (base positions -65 to -550) that operates in a cell type- and differentiation-dependent manner. The expression of MIE genes is required for HCMV replication. Previous studies analyzing functions of MIE promoter-enhancer segments suggest that the distal enhancer region variably modifies MIE promoter activity, depending on cell type, stimuli, or state of differentiation. To further understand the mechanism by which the MIE promoter is regulated, we constructed and analyzed several different recombinant HCMVs that lack the distal enhancer region (-300 to -582, -640, or -1108). In human fibroblasts, the HCMVs without the distal enhancer replicate normally at high multiplicity of infection (MOI) but replicate poorly at low MOI in comparison to wild-type virus (WT) or HCMVs that lack the neighboring upstream unique region and modulator (-582 or -640 to -1108). The growth aberrancy was normalized after restoring the distal enhancer in a virus lacking this region. For HCMVs without a distal enhancer, the impairment in replication at low MOI corresponds to a deficiency in production of MIE RNAs compared to WT or virus lacking the unique region and modulator. An underproduction of viral US3 RNA was also evident at low MOI. Whether lower production of IE1 p72 and IE2 p86 causes a reduction in expression of the immediate-early (IE) class US3 gene remains to be determined. We conclude that the MIE distal enhancer region possesses a mechanism for augmenting viral IE gene expression and genome replication at low MOI, but this regulatory function is unnecessary at high MOI. PMID:10644329

Meier, J L; Pruessner, J A

2000-02-01

16

The Human Cytomegalovirus Major Immediate-Early Distal Enhancer Region Is Required for Efficient Viral Replication and Immediate-Early Gene Expression  

PubMed Central

The human cytomegalovirus (HCMV) major immediate-early (MIE) genes, encoding IE1 p72 and IE2 p86, are activated by a complex enhancer region (base positions -65 to -550) that operates in a cell type- and differentiation-dependent manner. The expression of MIE genes is required for HCMV replication. Previous studies analyzing functions of MIE promoter-enhancer segments suggest that the distal enhancer region variably modifies MIE promoter activity, depending on cell type, stimuli, or state of differentiation. To further understand the mechanism by which the MIE promoter is regulated, we constructed and analyzed several different recombinant HCMVs that lack the distal enhancer region (-300 to -582, -640, or -1108). In human fibroblasts, the HCMVs without the distal enhancer replicate normally at high multiplicity of infection (MOI) but replicate poorly at low MOI in comparison to wild-type virus (WT) or HCMVs that lack the neighboring upstream unique region and modulator (-582 or -640 to -1108). The growth aberrancy was normalized after restoring the distal enhancer in a virus lacking this region. For HCMVs without a distal enhancer, the impairment in replication at low MOI corresponds to a deficiency in production of MIE RNAs compared to WT or virus lacking the unique region and modulator. An underproduction of viral US3 RNA was also evident at low MOI. Whether lower production of IE1 p72 and IE2 p86 causes a reduction in expression of the immediate-early (IE) class US3 gene remains to be determined. We conclude that the MIE distal enhancer region possesses a mechanism for augmenting viral IE gene expression and genome replication at low MOI, but this regulatory function is unnecessary at high MOI. PMID:10644329

Meier, Jeffery L.; Pruessner, Jonathan A.

2000-01-01

17

Pancreatic function and gene deletion F508 in cystic fibrosis.  

PubMed Central

In view of the possible relation between pancreatic function and cystic fibrosis (CF) gene mutations, a detailed study on Italian patients was performed. Seventy pancreatic insufficient and 48 pancreatic sufficient patients were included after very accurate characterisation of their pancreatic and digestive function, all performed in the same CF centre. The CF gene deletion F508 was tested to define the patients' genotypes. The results confirm that the mutation correlates with pancreatic insufficiency, and is recessive to other, as yet unreported, mutant alleles that determine pancreatic sufficiency. An indication that duodenal bicarbonate output is more severely reduced in the presence of deletion F508 is also presented. The data are discussed in relation to a hypothesis on the primary effects of CF gene deletion F508. PMID:2277379

Borgo, G; Mastella, G; Gasparini, P; Zorzanello, A; Doro, R; Pignatti, P F

1990-01-01

18

Transcriptomic analysis of Chilo iridescent virus immediate early promoter.  

PubMed

Chilo iridescent virus (CIV) is an insect virus belonging to the Iridoviridae. The DNA genome (212,482 base pairs) is entirely sequenced, however very little is known about viral gene regulation, expression and function. The structure and transcriptional regulation of the CIV 012L gene is investigated in this study. Infection of Bombyx mori SPC-BM-36 cells in the presence of Ara-C (inhibits DNA replication) or cycloheximide (inhibits protein synthesis), followed by RT-PCR on isolated total RNA, showed that CIV 012L is transcribed as an immediate-early gene. Detecting the RNA transcript of the CIV 012L early in infection confirmed the data about the temporal class of the gene obtained with the inhibitors. Time course transcription of the gene showed that the transcription starts immediately after infection and reach up to maximum level at 4h p.i. 5' RACE analysis on RNA isolated from CIV-infected BM cells showed that the transcription initiation site is located 30 nucleotides upstream of the translational start codon. To map the limits of the putative promoter of this gene, upstream sequences of various lengths were cloned in front of a firefly luciferase reporter gene. The resulting plasmid constructs were tested in a transfection assay, in which the baculovirus IE-l promoter fused to Renilla luciferase was used as an internal control for transfection efficiency. A gradual reduction in luciferase expression occurred as the deletions extended from -200 to -10, relative to the transcription start site. It is clearly shown that sequences between -20 and -10 relative to the transcription start site have key promoter activity for CIV 012L gene. However this key sequence could not be found at the upstream region of CIV's other potential immediate early genes. PMID:22698875

Dizman, Yesim Akturk; Demirbag, Zihni; Ince, Ikbal Agah; Nalcacioglu, Remziye

2012-08-01

19

Genome-Wide Generation of Yeast Gene Deletion Strains  

PubMed Central

In the year 2001 a collection of yeast strains will be completed that are deleted in the 6000 open reading frames selected as putative genes by the initial bioinformatic analysis of the Saccharomyces cerevisiae genome. The collection was produced by the transatlantic yeast gene deletion project, a collaboration involving researchers in the USA, Canada and Europe. The European effort was part of EUROFAN (European Functional Analysis Network) where some of the strains could feed into various functional analysis nodes dealing with specific areas of cell biology. With approximately 40% of human genes involved in heritable disease having a homologue in yeast and with the use of yeast in various drug discovery strategies, not least due to the dramatic increase in fungal infections, these strains will be valuable in trans-genomic studies and in specialised interest studies in individual laboratories. A detailed analysis of the project by the consortium is in preparation, here we discuss the yeast strains, reported findings and approaches to using this resource. PMID:18628917

Lamb, David C.; Kelly, Steven L.

2001-01-01

20

Negative elongation factor NELF controls transcription of immediate early genes in a stimulus-specific manner  

SciTech Connect

The transcription rate of immediate early genes (IEGs) is controlled directly by transcription elongation factors at the transcription elongation step. Negative elongation factor (NELF) and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) stall RNA polymerase II (pol II) soon after transcription initiation. Upon induction of IEG transcription, DSIF is converted into an accelerator for pol II elongation. To address whether and how NELF as well as DSIF controls overall IEG transcription, its expression was reduced using stable RNA interference in GH4C1 cells. NELF knock-down reduced thyrotropin-releasing hormone (TRH)-induced transcription of the IEGs c-fos, MKP-1, and junB. In contrast, epidermal growth factor (EGF)-induced transcription of these IEGs was unaltered or even slightly increased by NELF knock-down. Thus, stable knock-down of NELF affects IEG transcription stimulation-specifically. Conversely, DSIF knock-down reduced both TRH- and EGF-induced transcription of the three IEGs. Interestingly, TRH-induced activation of the MAP kinase pathway, a pathway essential for transcription of the three IEGs, was down-regulated by NELF knock-down. Thus, stable knock-down of NELF, by modulating intracellular signaling pathways, caused stimulation-specific loss of IEG transcription. These observations indicate that NELF controls overall IEG transcription via multiple mechanisms both directly and indirectly.

Fujita, Toshitsugu; Piuz, Isabelle [Fondation pour Recherches Medicales, University of Geneva, 64 av. de la Roseraie, 1211 Geneva (Switzerland); Schlegel, Werner [Fondation pour Recherches Medicales, University of Geneva, 64 av. de la Roseraie, 1211 Geneva (Switzerland)], E-mail: werner.schlegel@unige.ch

2009-01-15

21

Identification of the immediate-early transcripts of Kaposi's sarcoma-associated herpesvirus.  

PubMed

In the immediate-early phase of reactivation or primary infection, herpesviruses express a small number of genes without requiring prior viral protein synthesis. Immediate-early genes usually encode regulatory proteins critical for the viral life cycle. Kaposi's sarcoma-associated herpesvirus (KSHV) gene transcription in the immediate-early stage of viral reactivation was examined by using a chemical induction combined with a gene expression screening method. RNA transcripts from at least four KSHV genomic loci accumulate when latently infected B-lymphoma cells are induced for reactivation in the presence of an inhibitor of protein synthesis (cycloheximide) and thus represent immediate-early class transcripts. Among them, a 3.6-kb mRNA encodes three putative open reading frames (ORFs), namely, ORF50, K8, and K8.2. ORF50 is a homologue of Rta, a transcription activator encoded by Epstein-Barr virus (EBV). The K8 gene codes for a 237-amino-acid protein with a basic-leucine zipper domain near its C terminus and an acidic domain near its N terminus and which closely resembles the ZEBRA protein of EBV and Jun/Fos family proteins. Other immediate-early mRNAs of KSHV include a 1. 7-kb mRNA encoding ORF45, a 2.0-kb mRNA encoding ORF K4.2, and a 4. 5-kb mRNA. Functional roles of products of these KSHV immediate-early transcripts remain to be studied. PMID:10364304

Zhu, F X; Cusano, T; Yuan, Y

1999-07-01

22

Identification of the Immediate-Early Transcripts of Kaposi’s Sarcoma-Associated Herpesvirus  

PubMed Central

In the immediate-early phase of reactivation or primary infection, herpesviruses express a small number of genes without requiring prior viral protein synthesis. Immediate-early genes usually encode regulatory proteins critical for the viral life cycle. Kaposi’s sarcoma-associated herpesvirus (KSHV) gene transcription in the immediate-early stage of viral reactivation was examined by using a chemical induction combined with a gene expression screening method. RNA transcripts from at least four KSHV genomic loci accumulate when latently infected B-lymphoma cells are induced for reactivation in the presence of an inhibitor of protein synthesis (cycloheximide) and thus represent immediate-early class transcripts. Among them, a 3.6-kb mRNA encodes three putative open reading frames (ORFs), namely, ORF50, K8, and K8.2. ORF50 is a homologue of Rta, a transcription activator encoded by Epstein-Barr virus (EBV). The K8 gene codes for a 237-amino-acid protein with a basic-leucine zipper domain near its C terminus and an acidic domain near its N terminus and which closely resembles the ZEBRA protein of EBV and Jun/Fos family proteins. Other immediate-early mRNAs of KSHV include a 1.7-kb mRNA encoding ORF45, a 2.0-kb mRNA encoding ORF K4.2, and a 4.5-kb mRNA. Functional roles of products of these KSHV immediate-early transcripts remain to be studied. PMID:10364304

Zhu, Fan Xiu; Cusano, Teresa; Yuan, Yan

1999-01-01

23

Extracellular Signal-Regulated Kinase (ERK) Controls Immediate Early Gene Induction on Corticostriatal Stimulation  

Microsoft Academic Search

Activity-dependent changes in neuronal structure and synaptic remodeling depend critically on gene regulation. In an attempt to understand how glutamate receptor stimulation at the mem- brane leads to gene regulation in the nucleus, we traced intra- cellular signaling pathways targeting DNA regulatory elements of immediate early genes (IEGs). For this purpose we used an in vivo electrical stimulation of the

Veronique Sgambato; Monique Rogard; Marie-Jo Besson; Jocelyne Caboche

1998-01-01

24

L1CAM whole gene deletion in a child with L1 syndrome.  

PubMed

L1 syndrome is a group of overlapping, X-linked disorders caused by mutations in L1CAM. Clinical phenotypes within L1 syndrome include X-linked hydrocephalus with stenosis of the aqueduct of sylvius (HSAS); mental retardation, adducted thumbs, shuffling gait, and aphasia (MASA) syndrome; spastic paraplegia type 1; and agenesis of the corpus callosum. Over 200 mutations in L1CAM have been reported; however, only a few large gene deletions have been observed. We report on a 4-month-old male with a de novo whole gene deletion of L1CAM presenting with congenital hydrocephalus, aqueductal stenosis, and adducted thumbs. Initial failure of L1CAM gene sequencing suggested the possibility of a whole gene deletion of L1CAM. Further investigation through chromosome microarray analysis showed a 62Kb deletion encompassing the first exon of the PDZD4 gene and the entire L1CAM gene. Investigations into genotype-phenotype correlations have suggested that mutations leading to truncated or absent L1 protein cause more severe forms of L1 syndrome. Based on the presentation of the proband and other reported patients with whole gene deletions, we provide further evidence that L1CAM whole gene deletions result in L1 syndrome with a severe phenotype, deletions of PDZD4 do not cause additional manifestations, and that X-linked nephrogenic diabetes insipidus reported in a subset of patients with large L1CAM deletions results from the loss of AVPR2. PMID:24668863

Chidsey, Brandalyn A; Baldwin, Erin E; Toydemir, Reha; Ahles, Lauren; Hanson, Heather; Stevenson, David A

2014-06-01

25

Mechanotransduction in Stretched Osteocytes—Temporal Expression of Immediate Early and Other Genes  

Microsoft Academic Search

Osteocytes, dendritic bone cells, transduce signals of mechanical loading that results in bone formation. We have reported in stretched primary osteocytes that the cAMP level, IGF-I and osteocalcin protein levels were elevated (Endocrinology 137:2028, 1996). Here we report that stretching induces the expression of immediate early genes, c-fos and COX-2; inducive cyclooxygenase gene. Compared to c-fos, COX-2 as well as

Akira Kawata; Yuko Mikuni-Takagaki

1998-01-01

26

Phenotypes of major immediate-early gene mutants of mouse cytomegalovirus  

Microsoft Academic Search

Immediate-early (IE) genes are the first genes to be transcribed during the lytic replication cycle of cytomegaloviruses (CMV),\\u000a and encode nonstructural proteins, which are assumed to have mainly regulatory functions. The IE proteins may play important\\u000a roles in the pathogenesis of CMV in vivo, for instance during the establishment of latency and during reactivation. We constructed\\u000a mouse CMV mutants with

Andreas Busche; Ana Angulo; Penelope Kay-Jackson; Peter Ghazal; Martin Messerle

2008-01-01

27

Expression of Zinc Finger Immediate Early Genes in Rat Brain After Permanent Middle Cerebral Artery Occlusion  

Microsoft Academic Search

The prolonged expression of the leucine zipper fos\\/jun immediate early genes (IEG) has been correlated with neuronal death after cerebral ischemia. In this study, the expression of six zinc finger IEG was examined using in situ hybridization in adult rats after middle cerebral artery occlusion (MCAO) with the suture model. NGFI-A, NGFI-B, NGFI-C, egr-2, egr-3, and Nurr1 mRNA were all

Jari Honkaniemi; Bradley A. States; Philip R. Weinstein; Jose Espinoza; Frank R. Sharp

1997-01-01

28

Molecular interpretation of ERK signal duration by immediate early gene products  

Microsoft Academic Search

The duration of intracellular signalling is associated with distinct biological responses, but how cells interpret differences in signal duration are unknown. We show that the immediate early gene product c-Fos functions as a sensor for ERK1 (extracellular-signal-regulated kinase 1) and ERK2 signal duration. When ERK activation is transient, its activity declines before the c-Fos protein accumulates, and under these conditions

Leon O. Murphy; Sallie Smith; Rey-Huei Chen; Diane C. Fingar; John Blenis

2002-01-01

29

Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.  

PubMed

The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. PMID:25281472

Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

2014-12-01

30

A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1  

Microsoft Academic Search

We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the

David Vallenet; Vanina Castelli; Marielle Besnard; Agnès Pinet; Corinne Cruaud; Sumitta Samair; Christophe Lechaplais; Gabor Gyapay; Céline Richez; Maxime Durot; Annett Kreimeyer; François Le Fèvre; Vincent Schächter; Valérie Pezo; Volker Döring; Claude Scarpelli; Claudine Médigue; Georges N Cohen; Philippe Marlière; Marcel Salanoubat; Jean Weissenbach; Véronique de Berardinis

2008-01-01

31

Cohesins Repress Kaposi's Sarcoma-Associated Herpesvirus Immediate Early Gene Transcription during Latency  

PubMed Central

Chromatin-organizing factors such as CTCF and cohesins have been implicated in the control of complex viral regulatory programs. We investigated the role of CTCF and cohesins in the control of the switch from latency to the lytic cycle for Kaposi's sarcoma-associated herpesvirus (KSHV). We found that cohesin subunits but not CTCF are required for the repression of KSHV immediate early gene transcription. Depletion of the cohesin subunits Rad21, SMC1, and SMC3 resulted in lytic cycle gene transcription and viral DNA replication. In contrast, depletion of CTCF failed to induce lytic transcription or DNA replication. Chromatin immunoprecipitation with high-throughput sequencing (ChIP-Seq) revealed that cohesins and CTCF bound to several sites within the immediate early control region for ORF50 and to more distal 5? sites that also regulate the divergently transcribed ORF45-ORF46-ORF47 gene cluster. Rad21 depletion led to a robust increase in ORF45, ORF46, ORF47, and ORF50 transcripts, with similar kinetics to that observed with chemical induction by sodium butyrate. During latency, the chromatin between the ORF45 and ORF50 transcription start sites was enriched in histone H3K4me3, with elevated H3K9ac at the ORF45 promoter and elevated H3K27me3 at the ORF50 promoter. A paused form of RNA polymerase II (Pol II) was loosely associated with the ORF45 promoter region during latency but was converted to an active elongating form upon reactivation induced by Rad21 depletion. Butyrate treatment caused a rapid dissociation of cohesins and loss of CTCF binding at the immediate early gene locus, suggesting that cohesins may be a direct target of butyrate-mediated lytic induction. Our findings implicate cohesins as a major repressor of KSHV lytic gene activation and show that they function coordinately with CTCF to regulate the switch between latent and lytic gene activity. PMID:22740398

Chen, Horng-Shen; Wikramasinghe, Priyankara; Showe, Louise

2012-01-01

32

Cohesins repress Kaposi's sarcoma-associated herpesvirus immediate early gene transcription during latency.  

PubMed

Chromatin-organizing factors such as CTCF and cohesins have been implicated in the control of complex viral regulatory programs. We investigated the role of CTCF and cohesins in the control of the switch from latency to the lytic cycle for Kaposi's sarcoma-associated herpesvirus (KSHV). We found that cohesin subunits but not CTCF are required for the repression of KSHV immediate early gene transcription. Depletion of the cohesin subunits Rad21, SMC1, and SMC3 resulted in lytic cycle gene transcription and viral DNA replication. In contrast, depletion of CTCF failed to induce lytic transcription or DNA replication. Chromatin immunoprecipitation with high-throughput sequencing (ChIP-Seq) revealed that cohesins and CTCF bound to several sites within the immediate early control region for ORF50 and to more distal 5' sites that also regulate the divergently transcribed ORF45-ORF46-ORF47 gene cluster. Rad21 depletion led to a robust increase in ORF45, ORF46, ORF47, and ORF50 transcripts, with similar kinetics to that observed with chemical induction by sodium butyrate. During latency, the chromatin between the ORF45 and ORF50 transcription start sites was enriched in histone H3K4me3, with elevated H3K9ac at the ORF45 promoter and elevated H3K27me3 at the ORF50 promoter. A paused form of RNA polymerase II (Pol II) was loosely associated with the ORF45 promoter region during latency but was converted to an active elongating form upon reactivation induced by Rad21 depletion. Butyrate treatment caused a rapid dissociation of cohesins and loss of CTCF binding at the immediate early gene locus, suggesting that cohesins may be a direct target of butyrate-mediated lytic induction. Our findings implicate cohesins as a major repressor of KSHV lytic gene activation and show that they function coordinately with CTCF to regulate the switch between latent and lytic gene activity. PMID:22740398

Chen, Horng-Shen; Wikramasinghe, Priyankara; Showe, Louise; Lieberman, Paul M

2012-09-01

33

Stress-induced hematopoietic failure in the absence of immediate early response gene X-1 (IEX-1, IER3)  

E-print Network

Expression of the immediate early response gene X-1 (IEX-1, IER3) is diminished significantly in hematopoietic stem cells in a subgroup of patients with early stage myelodysplastic syndromes, but it is not clear whether ...

Ramsey, Haley

34

Pheromone-induced expression of immediate early genes in the mouse vomeronasal sensory system.  

PubMed

Immediate early genes (IEGs) are powerful tools for visualizing activated neurons and extended circuits that are stimulated by sensory input. Several kinds of IEGs (e.g., c-fos, egr-1) have been utilized for detecting activated receptor neurons in the pheromone sensory organ called the vomeronasal organ (VNO), as well as for mapping the neurons within the central nervous system (CNS) excited by pheromones.In this chapter, we describe the procedure for the detection of pheromone-induced neural activation in the VNO and CNS using the c-Fos immunostaining technique. PMID:24014367

Haga-Yamanaka, Sachiko; Touhara, Kazushige

2013-01-01

35

Novelty-Induced Increased Expression of Immediate-Early Genes c-fos and arg 3.1  

E-print Network

Novelty-Induced Increased Expression of Immediate-Early Genes c-fos and arg 3.1 in the Mouse Brain then compared the novelty- induced expression of the two immediate-early genes (IEGs) c-fos and arg 3 to taste novelty increased expression of c-fos and arg 3.1 mRNA in the cingulate cortex and deep layers

Kuhl, Dietmar

36

THOC5 controls 3?end-processing of immediate early genes via interaction with polyadenylation specific factor 100 (CPSF100)  

PubMed Central

Transcription of immediate early genes (IEGs) in response to extrinsic and intrinsic signals is tightly regulated at multiple stages. It is known that untranslated regions of the RNA can play a role in these processes. Here we show that THOC5, a member of the TREX (transcription/export) complex, plays a role in expression of only a subset of constitutively active genes, however transcriptome analysis reveals that more than 90% of IEG were not induced by serum in THOC5 depleted cells. Furthermore, THOC5 depletion does not influence the expression of the most rapidly induced IEGs, e.g. Fos and Jun. One group of THOC5 target genes, including Id1, Id3 and Wnt11 transcripts, were not released from chromatin in THOC5 depleted cells. Genes in another group, including Myc and Smad7 transcripts, were released with shortening of 3?UTR by alternative cleavage, and were spliced but export was impaired in THOC5 depleted cells. By interactome analysis using THOC5 as bait, we show that upon stimulation with serum THOC5 forms a complex with polyadenylation-specific factor 100 (CPSF100). THOC5 is required for recruitment of CPSF100 to 3?UTR of THOC5 target genes. These data suggest the presence of a novel mechanism for the control of IEG response by THOC5 via 3?end-processing. PMID:25274738

Tran, Doan Duy Hai; Saran, Shashank; Williamson, Andrew J.K.; Pierce, Andrew; Dittrich-Breiholz, Oliver; Wiehlmann, Lutz; Koch, Alexandra; Whetton, Anthony D.; Tamura, Teruko

2014-01-01

37

Efficient and simple generation of unmarked gene deletions in Mycobacterium smegmatis.  

PubMed

Genetic research in molecular laboratories relies heavily on directed mutagenesis and gene deletion techniques. In mycobacteria, however, genetic analysis is often hindered by difficulties in the preparation of deletion mutants. Indeed, in comparison to the allelic exchange systems available for the study of other common model organisms, such as Saccharomyces cerevisiae and Escherichia coli, mycobacterial gene disruption systems suffer from low mutant isolation success rates, mostly due to inefficient homologous recombination and a high degree of non-specific recombination. Here, we present a gene deletion system that combines efficient homologous recombination with advanced screening of mutants. This novel methodology allows for gene disruption in three consecutive steps. The first step relies on the use of phage Che9c recombineering proteins for directed insertion into the chromosome of a linear DNA fragment that encodes GFP and confers hygromycin resistance. In the second step, GFP positive and hygromycin resistant colonies are selected, and in the last step, the gfp-hyg cassette is excised from the chromosome, thus resulting in the formation of an unmarked deletion. We provide a detailed gene deletion methodology and demonstrate the use of this genetic system by deleting the prcSBA operon of Mycobacterium smegmatis. PMID:24100088

Shenkerman, Yael; Elharar, Yifat; Vishkautzan, Marina; Gur, Eyal

2014-01-01

38

Cytomegalovirus infects human lymphocytes and monocytes: virus expression is restricted to immediate-early gene products.  

PubMed Central

In this investigation, we studied the ability of human cytomegalovirus to infect peripheral blood mononuclear cells. With monoclonal antibody technology, we demonstrated that cytomegalovirus could infect human lymphocytes of T- and B-cell lineage, natural killer cells, and monocytes. Furthermore, virus expression was limited to the synthesis of immediate-early cytomegalovirus polypeptides. These peripheral blood mononuclear cells did not produce infectious virus, nor were mature virions visualized by electron microscopy. This abortive infection of mononuclear cells was most convincingly shown with stocks of cytomegalovirus that had been recently isolated from infected patients and passaged minimally in fibroblasts. This argues for an increased lymphotropic effect of some isolates of cytomegalovirus, compared to strains of virus that are extensively adapted to growth in fibroblasts. Furthermore, immunocompetent cells that were shown to be abortively infected with cytomegalovirus lost selected differentiated functions. Images PMID:6091137

Rice, G P; Schrier, R D; Oldstone, M B

1984-01-01

39

Social Defeat during Adolescence and Adulthood Differentially Induce BDNF-Regulated Immediate Early Genes  

PubMed Central

Stressful life events generally enhance the vulnerability for the development of human psychopathologies such as anxiety disorders and depression. The incidence rates of adult mental disorders steeply rises during adolescence in parallel with a structural and functional reorganization of the neural circuitry underlying stress reactivity. However, the mechanisms underlying susceptibility to stress and manifestation of mental disorders during adolescence are little understood. We hypothesized that heightened sensitivity to stress during adolescence reflects age-dependent differences in the expression of activity-dependent genes involved in synaptic plasticity. Therefore, we compared the effect of social stress during adolescence with social stress in adulthood on the expression of a panel of genes linked to induction of long-term potentiation (LTP) and brain-derived neurotrophic factor (BDNF) signaling. We show that social defeat during adolescence and adulthood differentially regulates expression of the immediate early genes BDNF, Arc, Carp, and Tieg1, as measured by qPCR in tissue lysates from prefrontal cortex, nucleus accumbens, and hippocampus. In the hippocampus, mRNA levels for all four genes were robustly elevated following social defeat in adolescence, whereas none were induced by defeat in adulthood. The relationship to coping style was also examined using adult reactive and proactive coping rats. Gene expression levels of reactive and proactive animals were similar in the prefrontal cortex and hippocampus. However, a trend toward a differential expression of BDNF and Arc mRNA in the nucleus accumbens was detected. BDNF mRNA was increased in the nucleus accumbens of proactive defeated animals, whereas the expression level in reactive defeated animals was comparable to control animals. The results demonstrate striking differences in immediate early gene expression in response to social defeat in adolescent and adult rats. PMID:22065953

Coppens, Caroline M.; Siripornmongcolchai, Taweeporn; Wibrand, Karin; Alme, Maria Nordheim; Buwalda, Bauke; de Boer, Sietse F.; Koolhaas, Jaap M.; Bramham, Clive R.

2011-01-01

40

Scarless gene deletion in methylotrophic Hansenula polymorpha by using mazF as counter-selectable marker.  

PubMed

With increasing application of Hansenula polymorpha in fundamental research and biotechnology, many more genetic manipulations are required. However, these have been restricted for the finiteness of selectable markers. Here, MazF, a toxin protein from Escherichia coli, was investigated as a counter-selectable marker in H. polymorpha. The lethal effect of MazF on yeast cells suggested that it is a candidate for counter-selection in H. polymorpha. Markerless or scarless gene deletion in H. polymorpha was conducted based on selectable markers cassette mazF-zeoR, in which the zeocin resistance cassette and mazF expression cassette were used as positive and counter-selectable markers, respectively. For markerless deletion, the target region can be replaced by CYC1TT via two-step homologous recombination. For scarless deletion, the innate upstream region (5'UP) of target genes rather than CYC1TT mediates homologous recombination to excise both selectable markers and 5' sequence of target genes. Moreover, scarless deletion can be accomplished by using short homologous arms for the effectiveness of mazF as a counter-selectable marker. The applicability of the strategies in markerless or scarless deletion of PEP4, LEU2, and TRP1 indicates that this study provides easy, time-efficient, and host-independent protocols for single or multiple genetic manipulations in H. polymorpha. PMID:25233001

Song, Panpan; Liu, Sha; Guo, Xuena; Bai, Xuejing; He, Xiuping; Zhang, Borun

2014-09-16

41

Model-guided identification of gene deletion targets for metabolic engineering in Saccharomyces cerevisiae.  

PubMed

Identification of metabolic engineering strategies for rerouting intracellular fluxes towards a desired product is often a challenging task owing to the topological and regulatory complexity of metabolic networks. Genome-scale metabolic models help tackling this complexity through systematic consideration of mass balance and reaction directionality constraints over the entire network. Here, we describe how genome-scale metabolic models can be used for identifying gene deletion targets leading to increased production of the desired product. Vanillin production in Saccharomyces cerevisiae is used as a case study throughout this chapter. PMID:24744040

Brochado, Ana Rita; Patil, Kiran Raosaheb

2014-01-01

42

Specific cytotoxic T lymphocytes recognize the immediate-early transactivator Zta of Epstein-Barr virus.  

PubMed Central

We identified the immediate-early transactivator Zta of Epstein-Barr virus as a target for specific cytotoxic T lymphocytes (CTL). Cells pulsed with overlapping synthetic peptides representing the entire amino acid sequence of Zta proved to be efficient for the in vitro stimulation of Zta-specific CTL in several donors. With peptide-pulsed target cells, we found that CTL from several donors recognize a peptide comprising 15 amino acids. The immune response against this peptide exerted by CTL lines from different donors was found to be restricted by two different molecules of the major histocompatibility complex: HLA-B8 and HLA-Cw6. The latter molecule could for the first time be identified as a restricting element for a CTL response. The epitope of the HLA-B8-restricted CTL could be mapped to an octameric sequence between amino acid positions 190 and 197 of the Zta protein, whereas the minimal epitope of HLA-Cw6-restricted CTL consists of 11 to 15 residues between positions 187 and 201. Thus, the HLA-B8 and HLA-Cw6 epitopes widely overlap but are not completely identical. In vitro stimulation of blood lymphocytes from a panel of HLA-B8-positive or HLA-Cw6-positive virus carriers, using autologous cells pulsed with the Zta peptides comprising the HLA-B8 or HLA-Cw6 epitope, respectively, revealed in both cases that most of these donors developed a Zta-specific cytotoxic activity. These data, as well as the high spread of the major histocompatibility complex molecules HLA-B8 and HLA-Cw6 in most populations, suggest that an efficient CTL response directed against gene products of the immediate-early group of the lytic cycle exists in vivo in a considerable portion of virus carriers. A CTL response against proteins expressed immediately after the switch into the lytic cycle could eliminate lytically activated cells at an early stage and would thus efficiently prevent the production and release of progeny virions. PMID:7609055

Bogedain, C; Wolf, H; Modrow, S; Stuber, G; Jilg, W

1995-01-01

43

Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus  

SciTech Connect

Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

1987-12-01

44

Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning  

ERIC Educational Resources Information Center

Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

Mokin, Maxim; Keifer, Joyce

2005-01-01

45

A Form of Perforant Path LTP Can Occur without ERK1/2 Phosphorylation or Immediate Early Gene Induction  

ERIC Educational Resources Information Center

Stimulation paradigms that induce perforant path long-term potentiation (LTP) initiate phosphorylation of ERK1/2 and induce expression of a variety of immediate early genes (IEGs). These events are thought to be critical components of the mechanism for establishing the changes in synaptic efficacy that endure for hours or longer. Here we show that…

Steward, Oswald; Huang, Fen; Guzowski, John F.

2007-01-01

46

Regulation of Immediate Early Gene Expression and AP1 Binding in the Rat Nucleus Accumbens by Chronic Cocaine  

Microsoft Academic Search

Chronic treatment of rats with cocaine leads to long-term biochemical changes in the nucleus accumbens (NAc), a brain region implicated in mediating the reinforcing effects of cocaine and other drugs of abuse. Immediate early genes (IEGs) and their protein products appear to play an important role in transducing extracellular stimuli into altered patterns of cellular gene expression and, therefore, into

Bruce Hope; Barry Kosofsky; Steven E. Hyman; Eric J. Nestler

1992-01-01

47

TISSUE-PLASMINOGEN ACTIVATOR IS INDUCED AS AN IMMEDIATE-EARLY GENE DURING SEIZURE, KINDLING, AND LONG-TERM POTENTIATION  

EPA Science Inventory

Activity-dependent genes in brain have been identified using differential screening of hippocampal cDNA library from rats exposed to metrazol seizures under conditions of superconduction. Five immediate early genes whose expression is elevated by neural activity were identified. ...

48

Presentation of an Immunodominant Immediate-Early CD8+ T Cell Epitope Resists Human Cytomegalovirus Immunoevasion  

PubMed Central

Control of human cytomegalovirus (HCMV) depends on CD8+ T cell responses that are shaped by an individual's repertoire of MHC molecules. MHC class I presentation is modulated by a set of HCMV-encoded proteins. Here we show that HCMV immunoevasins differentially impair T cell recognition of epitopes from the same viral antigen, immediate-early 1 (IE-1), that are presented by different MHC class I allotypes. In the presence of immunoevasins, HLA-A- and HLA-B-restricted T cell clones were ineffective, but HLA-C*0702-restricted T cell clones recognized and killed infected cells. Resistance of HLA-C*0702 to viral immunoevasins US2 and US11 was mediated by the alpha3 domain and C-terminal region of the HLA heavy chain. In healthy donors, HLA-C*0702-restricted T cells dominated the T cell response to IE-1. The same HLA-C allotype specifically protected infected cells from attack by NK cells that expressed a corresponding HLA-C-specific KIR. Thus, allotype-specific viral immunoevasion allows HCMV to escape control by NK cells and HLA-A- and HLA-B-restricted T cells, while the virus becomes selectively vulnerable to an immunodominant population of HLA-C-restricted T cells. Our work identifies a T cell population that may be of particular efficiency in HCMV-specific immunotherapy. PMID:23717207

Ameres, Stefanie; Mautner, Josef; Schlott, Fabian; Neuenhahn, Michael; Busch, Dirk H.; Plachter, Bodo; Moosmann, Andreas

2013-01-01

49

Cytomegalovirus immediate early genes prevent the inhibitory effect of cyclosporin A on interleukin 2 gene transcription.  

PubMed Central

The use of cyclosporin A (CsA) as an immunosuppressive agent has markedly improved the clinical outcome in solid organ transplantation. However, posttransplantation infection remains a significant problem and may contribute to subsequent organ rejection. In this study the effect of cytomegalovirus (CMV) immediate early (IE) gene products on interleukin 2 (IL-2) gene transcription in the absence and presence of CsA was investigated using a transient transfection system. Jurkat T cells were transfected with plasmids expressing the CMV IE gene products or with a control plasmid. The presence of the CMV IE2 gene product abolished the inhibitory effect of CsA on IL-2 promoter activation and gene transcription. This effect was noted regardless of the time of CsA addition relative to the time of stimulation and was independent of CsA concentration. CsA had no effect on the CMV or the IL-2 receptor promoters. These studies suggest that the CMV IE gene products may play a role in graft rejection after solid organ transplantation. Images PMID:1331182

Geist, L J; Monick, M M; Stinski, M F; Hunninghake, G W

1992-01-01

50

Proto-oncogene Sno expression, alternative isoforms and immediate early serum response.  

PubMed Central

The mouse Sno gene, a Ski proto-oncogene homolog, expresses two isoforms, SnoN and SnoN2 (also called sno -dE3), which differ from each other in a location downstream from the site of alternative splicing previously described in the human SNO gene. SnoN2 is missing a 138 nt coding segment present in mouse SnoN and human SNON . We have cloned and sequenced the human ortholog of mouse SnoN2 , the existence of which was predicted from conservation of the alternative splice donor site that produces the SnoN2 isoform. Mouse SnoN2 and SnoN are expressed throughout embryonic development, in neonatal muscle and in many adult tissues. SnoN2 is the major species in most tissues, but SnoN and SnoN2 are expressed at approximately equal levels in brain. In human tissues, SNON2 is the less abundantly expressed isoform. Expression of mouse SnoN and SnoN2 mRNAs is induced with immediate early kinetics upon serum stimulation of quiescent fibroblasts, even in the presence of the protein synthesis inhibitor cycloheximide, while Ski is not. Interestingly, although both isoforms of Sno are induced, SnoN2 induction is much higher than SnoN . These data are consistent with a role for Sno in the response to proliferation stimuli. PMID:9207045

Pearson-White, S; Crittenden, R

1997-01-01

51

Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice  

PubMed Central

Soluble epoxide hydrolase (sEH), a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs), is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS) female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15–18 month old) and young (3–4 month old) female sEH knockout (sEHKO) mice and wild type (WT) mice were subjected to 45 min middle cerebral artery occlusion (MCAO) with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24 h thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography (OMAG). Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24 h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24 h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice. PMID:25642188

Zuloaga, Kristen L.; Zhang, Wenri; Roese, Natalie E.; Alkayed, Nabil J.

2015-01-01

52

Identification of ocular dominance domains in New World owl monkeys by immediate-early gene expression  

PubMed Central

Ocular dominance columns (ODCs) have been well studied in the striate cortex (V1) of macaques, as well defined arrays of columnar structure that receive inputs from one eye or the other, whereas ODC expression seems more obscure in some New World primate species. ODCs have been identified by means of eye injections of transneuronal transporters and examination of cytochrome oxidase (CO) activity patterns after monocular enucleation. More recently, live-imaging techniques have been used to reveal ODCs. Here, we used the expression of immediate-early genes (IEGs), protooncogene, c-Fos, and zinc finger protein, Zif268, after monocular inactivation (MI) to identify ODCs in V1 of New World owl monkeys. Because IEG expression is more sensitive to activity changes than CO expression, it is capable of revealing activity maps in all layers throughout V1 and demonstrating brief activity changes within a couple of hours. Using IEGs, we not only revealed apparent ODCs in owl monkeys but also discovered a number of unique features of their ODCs. Distinct from those in macaques, these ODCs sometimes bridged to other columns in layer 4 (Brodmann layer 4C ). CO blobs straddled ODC borders in the central visual field, whereas they centered ODC patches in the peripheral visual field. In one case, the ODC pattern continued into V2. Finally, an elevation of IEG expression in layer 4 (4C) was observed along ODC borders after only brief MI. Our data provide insights into the structure and variability of ODCs in primates and revive debate over the functions and development of ODCs. PMID:24591618

Takahata, Toru; Miyashita, Masanobu; Tanaka, Shigeru; Kaas, Jon H.

2014-01-01

53

Identification and expression analysis of leptin-regulated immediate early response and late target genes.  

PubMed Central

Using PC12 cells as an in vitro model system, we have identified a series of transcripts induced through activation of the leptin receptor. On the basis of kinetic studies, two distinct gene sets could be discerned: signal transducer and activator of transciption-3 (STAT-3), suppressor of cytokine signalling-3 (SOCS-3), MT-II (metallothionein-II), the serine/threonine kinase fibroblast-growth-factor-inducible kinase (Fnk) and modulator recognition factor (MRF-1), which are immediate early response genes, and pancreatitis-associated protein I (PAP I), squalene epoxidase, uridine diphosphate glucuronosyltransferase and annexin VIII, which are late induced target genes. At late time points a strong co-stimulation with beta-nerve growth factor or with the adenylate cyclase activator forskolin was observed. To assess the validity of the PC12-cell model system, we examined the effect of leptin administration on the gene transcription of STAT-3, MT-II, Fnk and PAP I in vivo. Leptin treatment of leptin-deficient ob/ob mice increased the STAT-3, SOCS-3, MT-II and Fnk mRNA, and MT-I protein levels in liver, whereas, in jejunum, expression of PAP I mRNA was down-regulated. Furthermore, administration of leptin to starved wild-type mice enhanced the expression of MT-II and Fnk mRNA in liver, but decreased MT-II and PAP I mRNA expression in jejunum. These findings may help to explain the obese phenotype observed in some colonies of MT-I- and MT-II-null mice and/or the observation that leptin protects against tumour-necrosis-factor toxicity in vivo. PMID:10794713

Waelput, W; Verhee, A; Broekaert, D; Eyckerman, S; Vandekerckhove, J; Beattie, J H; Tavernier, J

2000-01-01

54

Inverse regulation of plasticity-related immediate early genes by calcineurin in hippocampal neurons.  

PubMed

In the mammalian hippocampus, changes in the expression of immediate early genes (IEGs) is thought to contribute to long term plastic changes in neurons brought about by learning tasks and high frequency stimulation of synapses. The phosphatase calcineurin has emerged as an important negative regulator of hippocampus-dependent learning and long term potentiation. Here we investigated the possibility that the constraining action of calcineurin on hippocampal plasticity is mediated in part by regulation of gene expression through negative control of transcription factors, such as cAMP-response element (CRE)-binding protein (CREB). We assessed the effect of calcineurin inhibitors on CREB activation by neuronal activity and show that calcineurin activity is in fact required for CREB-mediated gene expression. However, inhibition of calcineurin had disparate effects on the transcriptional induction of CREB-dependent IEGs. We find that the IEG c-fos is unaffected by suppression of calcineurin activity, the plasticity-related genes Egr1/Zif268 and Egr2/Krox-20 are up-regulated, and genes encoding the orphan nuclear hormone receptors Nor1 and Nur77 are down-regulated. We further show that the up-regulation of particular IEGs is probably due to the presence of serum response elements (SREs) in their promoters, because SRE-mediated gene expression is enhanced by calcineurin blockers. Moreover, expression of the c-fos gene, which is unaffected by calcineurin inhibitors, could be down-regulated by mutating the SRE. Conversely, SRE-mediated c-fos induction in the absence of a functional CRE was enhanced by calcineurin inhibitors. Our experiments thus implicate calcineurin as a negative regulator of SRE-dependent neuronal genes. PMID:19270309

Lam, Brian Yee Hong; Zhang, Wenting; Enticknap, Nicola; Haggis, Eleanor; Cader, M Zaeem; Chawla, Sangeeta

2009-05-01

55

Inverse Regulation of Plasticity-related Immediate Early Genes by Calcineurin in Hippocampal Neurons*S?  

PubMed Central

In the mammalian hippocampus, changes in the expression of immediate early genes (IEGs) is thought to contribute to long term plastic changes in neurons brought about by learning tasks and high frequency stimulation of synapses. The phosphatase calcineurin has emerged as an important negative regulator of hippocampus-dependent learning and long term potentiation. Here we investigated the possibility that the constraining action of calcineurin on hippocampal plasticity is mediated in part by regulation of gene expression through negative control of transcription factors, such as cAMP-response element (CRE)-binding protein (CREB). We assessed the effect of calcineurin inhibitors on CREB activation by neuronal activity and show that calcineurin activity is in fact required for CREB-mediated gene expression. However, inhibition of calcineurin had disparate effects on the transcriptional induction of CREB-dependent IEGs. We find that the IEG c-fos is unaffected by suppression of calcineurin activity, the plasticity-related genes Egr1/Zif268 and Egr2/Krox-20 are up-regulated, and genes encoding the orphan nuclear hormone receptors Nor1 and Nur77 are down-regulated. We further show that the up-regulation of particular IEGs is probably due to the presence of serum response elements (SREs) in their promoters, because SRE-mediated gene expression is enhanced by calcineurin blockers. Moreover, expression of the c-fos gene, which is unaffected by calcineurin inhibitors, could be down-regulated by mutating the SRE. Conversely, SRE-mediated c-fos induction in the absence of a functional CRE was enhanced by calcineurin inhibitors. Our experiments thus implicate calcineurin as a negative regulator of SRE-dependent neuronal genes. PMID:19270309

Lam, Brian Yee Hong; Zhang, Wenting; Enticknap, Nicola; Haggis, Eleanor; Cader, M. Zaeem; Chawla, Sangeeta

2009-01-01

56

Activation and Repression of Cellular Immediate Early Genes by Serum Response Factor Cofactors*  

PubMed Central

The induction of expression of many cellular immediate early genes (IEG) involves the transcription factor serum response factor (SRF). Two families of SRF coactivators have also been implicated in IEG induction, the ternary complex factors (TCFs), ELK1, Sap1, and Net, and the myocardin-related factors, MKL1 and MKL2. We found that serum induction of some SRF target genes is preferentially regulated by MKL1/2, whereas others are redundantly activated by both TCFs and MKL1/2. Yet ELK1 can also repress transcription. Binding of ELK1 and MKL1 to SRF has been found to be mutually exclusive in vitro, suggesting that ELK1 could repress expression of IEGs by blocking MKL1 binding. We characterized the in vivo binding of MKL1 and ELK1 to target genes and found an inverse relationship of serum-induced MKL1 binding and serum-decreased ELK1 binding. However, experiments with short hairpin RNA-mediated MKL1/2 depletion and expression of a nuclear MKL1 (N100) variant in stably transfected cells failed to alter ELK1 binding, suggesting that ELK1 binding to target genes is regulated independently of MKL1/2. Nevertheless, we found that short interfering RNA-mediated depletion of TCFs increased target gene expression in cells containing the N100 MKL1 activator, most notably in cells under continuous growth conditions. These results indicate that the TCFs can function both as activators and repressors of target gene expression depending upon the cellular growth conditions. PMID:20466732

Lee, Seung-Min; Vasishtha, Mansi; Prywes, Ron

2010-01-01

57

The dusp1 Immediate Early Gene is Regulated by Natural Stimuli Predominantly in Sensory Input Neurons  

PubMed Central

Many immediate early genes (IEGs) have activity-dependent induction in a subset of brain subdivisions or neuron types. However, none have been reported yet with regulation specific to thalamic-recipient sensory neurons of the telencephalon or in the thalamic sensory input neurons themselves. Here, we report the first such gene, dual specificity phosphatase 1 (dusp1). Dusp1 is an inactivator of mitogen-activated protein kinase (MAPK), and MAPK activates expression of egr1, one of the most commonly studied IEGs, as determined in cultured cells. We found that in the brain of naturally behaving songbirds and other avian species, hearing song, seeing visual stimuli, or performing motor behavior caused high dusp1 upregulation, respectively, in auditory, visual, and somatosensory input cell populations of the thalamus and thalamic-recipient sensory neurons of the telencephalic pallium, whereas high egr1 upregulation occurred only in subsequently connected secondary and tertiary sensory neuronal populations of these same pathways. Motor behavior did not induce high levels of dusp1 expression in the motor-associated areas adjacent to song nuclei, where egr1 is upregulated in response to movement. Our analysis of dusp1 expression in mouse brain suggests similar regulation in the sensory input neurons of the thalamus and thalamic-recipient layer IV and VI neurons of the cortex. These findings suggest that dusp1 has specialized regulation to sensory input neurons of the thalamus and telencephalon; they further suggest that this regulation may serve to attenuate stimulus-induced expression of egr1 and other IEGs, leading to unique molecular properties of forebrain sensory input neurons. PMID:20506480

Horita, Haruhito; Wada, Kazuhiro; Rivas, Miriam V.; Hara, Erina; Jarvis, Erich D.

2010-01-01

58

Requirements for enhanced transgene expression by untranslated sequences from the human cytomegalovirus immediate-early gene.  

PubMed Central

BACKGROUND: The cytomegalovirus immediate early (CMV IE) promoter has been widely used for heterologous expression. Further enhancements of gene expression from this potent promoter may allow for the development of improved gene transfer strategies. We aimed to determine whether inclusion of the first exon (5' untranslated) and first intron of the CMV IE gene would increase heterologous transgene expression in primary target cells and to determine the sequences required for any observed increases. MATERIALS AND METHODS: Comparisons of reporter gene expression were made following transient transfection of vascular smooth muscle cells (VSMCs) with plasmids containing the first exon and intron from the CMV IE gene or deletional mutations. Comparisons were also made using a heterologous promoter (RSV). RESULTS: Gene expression from the CMV IE promoter was increased 5.7-fold in VSMC with the inclusion of the first exon and intron. Similar increases were seen with other target cells and from the heterologous RSV promoter. This increase was associated with an increase in steady-state mRNA. Deletion analyses demonstrated that the enhancement was dependent on the presence of the 5' portion of the first exon while deletion of large segments within the intron was associated with similar levels of expression compared with the parental plasmid. CONCLUSIONS: Inclusion of the first exon and intron from the CMV IE gene increases expression from the CMV IE promoter. This enhancement is seen with the heterologous RSV promoter and is associated with an increase in steady-state mRNA. Deletion analyses suggest that this enhancement is associated with inclusion of sequences within the 5' portion of the first exon and inclusion of an intron. Images Fig. 1 Fig. 3 PMID:9932107

Simari, R. D.; Yang, Z. Y.; Ling, X.; Stephan, D.; Perkins, N. D.; Nabel, G. J.; Nabel, E. G.

1998-01-01

59

Chromosome microarray analysis: a case report of infertile brothers with CATSPER gene deletion.  

PubMed

We present the case of two brothers who were referred to a male infertility clinic for infertility workup. Conventional chromosome analysis and Y chromosome microdeletions did not reveal any genetic alterations. We utilized the chromosome microarray analysis (CMA) to identify novel and common variations associated with this severely impaired spermatogenesis cases. CMA specific results showed a common deletion in the 15q15.3 region that harbors genes like CATSPER2, STRC and PPIP5K1 in both cases (M18 and M19). In addition we identified small duplication in X and 11 chromosomes of M19. This is the first familial case report from India on occurrence of CATSPER gene deletion in human male infertility. PMID:24690399

Jaiswal, Deepika; Singh, Vertika; Dwivedi, U S; Trivedi, Sameer; Singh, Kiran

2014-06-01

60

Requirement of the immediate early gene vesl-1S\\/homer-1a for fear memory formation  

Microsoft Academic Search

BACKGROUND: The formation of long-term memory (LTM) and the late phase of long-term potentiation (L-LTP) depend on macromolecule synthesis, translation, and transcription in neurons. vesl-1S (VASP\\/Ena-related gene upregulated during seizure and LTP, also known as homer-1a) is an LTP-induced immediate early gene. The short form of Vesl (Vesl-1S) is an alternatively spliced isoform of the vesl-1 gene, which also encodes

Naoko Inoue; Harumi Nakao; Rika Migishima; Toshiaki Hino; Minoru Matsui; Fumihiko Hayashi; Kazuki Nakao; Toshiya Manabe; Atsu Aiba; Kaoru Inokuchi

2009-01-01

61

The pnk\\/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene  

Microsoft Academic Search

Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacterio- phage gene products, RNA ligase and polynucleo- tide kinase. This AcMNPV gene has been designated pnk\\/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus

D. Durantel; L. Croizier; M. D. Ayres; G. Croizier; R. D. Possee

1998-01-01

62

Detection of GST1 gene deletion by the polymerase chain reaction and its possible correlation with stomach cancer in Japanese  

Microsoft Academic Search

A homozygous gene deletion at the GST1 locus of genomic DNA isolated from peripheral blood was investigated for its relationship with several types of cancer using the polymerase chain reaction (PCR) technique. DNA samples were prepared from blood obtained from 128 healthy blood donors and 150 patients with cancer or chronic hepatitis. PCR primers were prepared based on the human

Shoji Harada; Shogo Misawa; Takako Nakamura; Naomi Tanaka; Ei Ueno; Mutsumi Nozoe

1992-01-01

63

DEVELOPMENTALBIOLOGY164,383-397(1994) cDCC (Chicken Homologue to a Gene Deleted in Colorectal Carcinoma)  

E-print Network

DEVELOPMENTALBIOLOGY164,383-397(1994) cDCC (Chicken Homologue to a Gene Deleted in Colorectal function of this molecule, we have cloned a chicken homologue to DCC (cDCC) and raised an antibody to DCC. cDCC is a protein of 160 kDa with an expression pattern distinct from those of other immunoglobulin

Chuong, Cheng-Ming

64

Isolated Growth Hormone Deficiency due to GH1 Gene Deletion: Central Nervous System Hypertension during Growth Hormone Treatment  

Microsoft Academic Search

Background: We report the case of a patient with an uncommon association of isolated growth hormone deficiency (IGHD) due to GH1 gene deletion and Chiari malformation type I. The patient presented with intracranial hypertension during recombinant human GH replacement therapy. Methods: GH deficiency (GHD) was diagnosed based on auxiological data and standard biochemical tests. Molecular analysis of the GH1 gene

Sonir R. Antonini; Letícia Faleiros; Hélio R. Machado; Antonio Carlos dos Santos; Margaret de Castro

2007-01-01

65

The 21bp repeat element of the human cytomegalovirus major immediate early enhancer is a negative regulator of gene expression in undifferentiated cells.  

PubMed Central

The major immediate early regulatory region of human cytomegalovirus (HCMV) has a complex set of DNA sites through which both cellular and viral factors coordinately regulate immediate early gene expression. In undifferentiated human teratocarcinoma (T2) cells we have previously shown that major immediate early gene expression is repressed by a differentiation specific nuclear factor MBF1, which binds to the imperfect dyad symmetry located upstream of the enhancer. However, upon differentiation MBF1 decreases resulting in immediate early gene expression. In this study we show, by mobility shift analysis that the same or similar factor(s) also binds to the 21bp repeat of the major immediate early enhancer. Deletion of this 21bp repeat from the immediate early enhancer expression vectors results in increased CAT expression in undifferentiated T2 cells, to levels similar to that in differentiated cells. Consequently, the 21bp repeat of the HCMV enhancer also acts to negatively regulate major immediate early enhancer function in non-permissive cells. Images PMID:1851560

Kothari, S; Baillie, J; Sissons, J G; Sinclair, J H

1991-01-01

66

A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1  

PubMed Central

We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean

2008-01-01

67

A next-generation genetically attenuated Plasmodium falciparum parasite created by triple gene deletion.  

PubMed

Immunization with live-attenuated Plasmodium sporozoites completely protects against malaria infection. Genetic engineering offers a versatile platform to create live-attenuated sporozoite vaccine candidates. We previously generated a genetically attenuated parasite (GAP) by deleting the P52 and P36 genes in the NF54 wild-type (WT) strain of Plasmodium falciparum (Pf p52(-)/p36(-) GAP). Preclinical assessment of p52(-)/p36(-) GAP in a humanized mouse model indicated an early and severe liver stage growth defect. However, human exposure to >200 Pf p52(-)/p36(-) GAP-infected mosquito bites in a safety trial resulted in peripheral parasitemia in one of six volunteers, revealing that this GAP was incompletely attenuated. We have now created a triple gene deleted GAP by additionally removing the SAP1 gene (Pf p52(-)/p36(-)/sap1(-) GAP) and employed flippase (FLP)/flippase recognition target (FRT) recombination for drug selectable marker cassette removal. This next-generation GAP was indistinguishable from WT parasites in blood stage and mosquito stage development. Using an improved humanized mouse model transplanted with human hepatocytes and human red blood cells, we show that despite a high-dose sporozoite challenge, Pf p52(-)/p36(-)/sap1(-) GAP did not transition to blood stage infection and appeared to be completely attenuated. Thus, clinical testing of Pf p52(-)/p36(-)/sap1(-) GAP assessing safety, immunogenicity, and efficacy against sporozoite challenge is warranted. PMID:24827907

Mikolajczak, Sebastian A; Lakshmanan, Viswanathan; Fishbaugher, Matthew; Camargo, Nelly; Harupa, Anke; Kaushansky, Alexis; Douglass, Alyse N; Baldwin, Michael; Healer, Julie; O'Neill, Matthew; Phuong, Thuan; Cowman, Alan; Kappe, Stefan H I

2014-09-01

68

Yatein from Chamaecyparis obtusa suppresses herpes simplex virus type 1 replication in HeLa cells by interruption the immediate-early gene expression.  

PubMed

Inhibitory effects of methanolic extracts from nine Chinese herbs on herpes simplex virus type 1 (HSV-1) replication were studied. By a bioassay-guided fractionation procedure, yatein (C(22)H(23)O(7); M.W.399) was isolated from Chamaecyparis obtusa; yatein significantly suppressed HSV-1 multiplication in HeLa cells without apparent cytotoxicity. To further localize the point in the HSV-1 replication cycle where arrest occurred, a set of key regulatory events leading to the viral multiplication was examined, including viral immediate-early (alpha) and late (gamma) gene expression and DNA replication. Results indicated that levels of glycoprotein B (gB) and gC mRNA expression in HeLa cells were impeded by yatein. Data from polymerase chain reaction showed that replication of HSV-1 DNA in HeLa cells was arrested by yatein. Furthermore, yatein decreased ICP0 and ICP4 gene expression in HeLa cells. Results of an electrophoretic mobility shift assay demonstrated that yatein interrupted the formation of alpha-trans-induction factor/C1/Oct-1/GARAT multiprotein complex. The mechanisms of antiviral action of yatein seem to be mediated, by inhibiting HSV-1 alpha gene expression, including expression of the ICP0 and ICP4 genes, and by arresting HSV-1 DNA synthesis and structural protein expression in HeLa cells. These results suggest that yatein is an antiviral agent against HSV-1 replication. PMID:16540181

Kuo, Yuh-Chi; Kuo, Yueh-Hsiung; Lin, Yuang-Lian; Tsai, Wei-Jern

2006-07-01

69

Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.  

PubMed

Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings. PMID:12767986

Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

2003-06-01

70

Role of the Human Cytomegalovirus Major Immediate-Early Promoter's 19-Base-Pair-Repeat Cyclic AMP-Response Element in Acutely Infected Cells  

PubMed Central

Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings. PMID:12767986

Keller, M. J.; Wheeler, D. G.; Cooper, E.; Meier, J. L.

2003-01-01

71

Medial amygdala lesions modify aggressive behavior and immediate early gene expression in oxytocin and vasopressin neurons during intermale exposure.  

PubMed

The medial amygdala and neuropeptides oxytocin (OXT) and vasopressin (VSP) have been associated aggressive behavior regulation. However, the specific mechanism involved in OXT and VSP modulation in distinct brain regions during hostile intermale aggressive behavior is undetermined. A retrograde tracer mouse model was employed using male C57BL/6 mice injected with rhodamine-conjugated latex microsphere suspensions in the right hypothalamic paraventricular nucleus. Adult male C57BL/6 mice (aged 14-16 weeks) were subjected to resident-intruder testing using juvenile intruder mice (aged 3 weeks) or adult intruder mice (aged 8 weeks). Following exposure, Fos protein expression was increased in the medial amygdala neurons of resident mice receiving the retrograde tracer. Thus, medial amygdala neurons projecting to or localized in the vicinity of the hypothalamic paraventricular nucleus showed immediate early gene (IEG) expression following resident-intruder testing that was considered an indirect marker of activation. Additionally, intermale aggression-related behaviors were inhibited or modified by exposure to juvenile or adult intruders, respectively, in mice that underwent medial amygdala lesioning. Furthermore, Fos protein expression in OXT-positive neurons was attenuated. Thus, ablation of medial amygdala neurons prevented immediate early gene expression in OXT- and VSP-positive neurons in the hypothalamus, bed nucleus of stria terminalis, and medial preoptic area during intermale exposure. These findings indicate that the medial amygdala likely modulates hostile aggressive behavior associated with immediate early gene expression in OXT and VSP neurons in specific brain areas, which may actually be instrumental in beneficial social interaction-related aggressive responses associated with mating, territorial defense, and offspring protection. PMID:23403283

Wang, Yu; He, Zhiyi; Zhao, Chuansheng; Li, Lei

2013-05-15

72

Epigenetic Regulations of Immediate Early Genes Expression Involved in Memory Formation by the Amyloid Precursor Protein of Alzheimer Disease  

PubMed Central

We previously demonstrated that APP epigenetically regulates Egr1 expression both in cultured neurons and in vivo. Since Egr1 is an immediate early gene involved in memory formation, we wondered whether other early genes involved in memory were regulated by APP and we studied molecular mechanisms involved. By comparing prefrontal (PF) cortex from wild type (APP+/+) and APP knockout mice (APP?/?), we observed that APP down regulates expression of four immediate early genes, Egr1, c-Fos, Bdnf and Arc. Down regulation of Egr1, c-Fos and Bdnf transcription resulted from a decreased enrichment of acetylated histone H4 on the corresponding gene promoter. Further characterization of H4 acetylation at Egr1 and c-Fos promoters revealed increased acetylation of H4K5 and H4K12 residues in APP?/? mice. Whereas APP affected Egr1 promoter activity by reducing access of the CREB transcription factor, its effect on c-Fos appeared to depend on increased recruitment of HDAC2 histone deacetylase to the gene promoter. The physiological relevance of the epigenetic regulation of Egr1 and c-Fos gene transcription by APP was further analyzed following exposure of mice to novelty. Although transcription of Egr1 and c-Fos was increased following exposure of APP+/+ mice to novelty, such an induction was not possible in APP?/? mice with a high basal level of expression of these immediate early genes. Altogether, these results demonstrate that APP-mediated regulation of c-Fos and Egr1 by different epigenetic mechanisms is needed for their induction during exposure to novelty. PMID:24919190

Hendrickx, Aurélie; Pierrot, Nathalie; Tasiaux, Bernadette; Schakman, Olivier; Kienlen-Campard, Pascal; De Smet, Charles; Octave, Jean-Noël

2014-01-01

73

An in vitro system for human cytomegalovirus immediate early 2 protein (IE2)-mediated site-dependent repression of transcription and direct binding of IE2 to the major immediate early promoter.  

PubMed Central

In vivo, negative autoregulation of the strong major immediate early promoter (MIEP) of human cytomegalovirus requires the viral immediate early 2 protein (IE2) and a cis element located from position -13 through position -1 relative to the transcription start site. We have established an in vitro transcription system that reproduces the specificity of IE2-mediated negative autoregulation. The carboxyl-terminal 290-amino acid fragment of IE2 was purified as a bacterial fusion protein. Addition of this chimeric protein to the cell-free system specifically repressed transcription from the MIEP containing the wild-type cis-acting repressor element but not from a mutated template in which the cis element had been replaced by heterologous DNA. Control protein and a mutant IE2 fusion protein containing two specific amino acid substitutions in a putative zinc finger motif did not repress the MIEP in vitro. Using conditions defined by this functional assay, we demonstrated by mobility-shift experiments that IE2 binds directly and specifically to DNA bearing the cis-acting repressor element. In addition, IE2 bound to the MIEP in the in vitro transcription reaction mixture. Images PMID:8380646

Macias, M P; Stinski, M F

1993-01-01

74

The psychopharmacology-molecular biology interface: exploring the behavioural roles of dopamine receptor subtypes using targeted gene deletion (‘knockout’)  

Microsoft Academic Search

1.In the absence of selective agonists and antagonists able to discriminate between individual members of the D1-like and D2-like families of dopamine receptor subtypes, functional parcellation has remained problematic.2.‘Knockout’ of these subtypes by targeted gene deletion offers a new approach to evaluating their roles in the regulation of behaviour.3.Like any new technique, ‘knockout’ has associated with it a number of

John L. Waddington; Jeremiah J. Clifford; Fergal N. McNamara; Katsunori Tomiyama; Noriaki Koshikawa; David T. Croke

2001-01-01

75

PYRETHROID INDUCED ALTERATIONS IN TRANSCRIPTION OF CALCIUM RESPONSIVE AND IMMEDIATE EARLY GENES IN VIVO.  

EPA Science Inventory

Multiple molecular targets for pyrethroid insecticides have been evaluated in in vitro preparations, including but not limited to voltage-sensitive sodium channels (VSSCs), voltage-sensitive calcium channels (VSCCs), GABAergic receptors, ATPases and mitochondrial respiratory chai...

76

Recurrent gene deletions and the evolution of adaptive cyanogenesis polymorphisms in white clover (Trifolium repens L.).  

PubMed

Understanding the molecular evolution of genes that underlie intraspecific polymorphisms can provide insights into the process of adaptive evolution. For adaptive polymorphisms characterized by gene presence/absence (P/A) variation, underlying loci commonly show signatures of long-term balancing selection, with gene-presence and gene-absence alleles maintained as two divergent lineages. We examined the molecular evolution of two unlinked P/A polymorphisms that underlie a well-documented adaptive polymorphism for cyanogenesis (hydrogen cyanide release with tissue damage) in white clover. Both cyanogenic and acyanogenic plants occur in this species, and the ecological forces that maintain this chemical defence polymorphism have been studied for several decades. Using a sample of 65 plants, we investigated the molecular evolution of sequences flanking the two underlying cyanogenesis genes: Ac/ac (controlling the presence/absence of cyanogenic glucosides) and Li/li (controlling the presence/absence of their hydrolysing enzyme, linamarase). A combination of genome walking, PCR assays, DNA sequence analysis and Southern blotting was used to test whether these adaptive P/A polymorphisms show evidence of long-term balancing selection, or whether gene-absence alleles have evolved repeatedly through independent deletion events. For both loci, we detect no signatures of balancing selection in the closest flanking genomic sequences. Instead, we find evidence for variation in the size of the deletions characterizing gene-absence alleles. These observations strongly suggest that both of these polymorphisms have been evolving through recurrent gene deletions over time. We discuss the genetic mechanisms that could account for this surprising pattern and the implications of these findings for mechanisms of rapid adaptive evolution in white clover. PMID:22694056

Olsen, Kenneth M; Kooyers, Nicholas J; Small, Linda L

2013-02-01

77

TAR-independent transactivation of the murine cytomegalovirus major immediate-early promoter by the Tat protein.  

PubMed Central

Tat is a transactivator of human immunodeficiency virus type 1 (HIV-1) that stimulates gene expression via an RNA target sequence (TAR) by augmenting transcriptional initiation and/or elongation from the HIV-1 long terminal repeat promoter. Here we show that Tat is able to transactivate the murine cytomegalovirus (MCMV) major immediate-early promoter (MIEP), which lacks sequence similarity with the HIV-1 long terminal repeat TAR element. Surprisingly, deletion of the upstream enhancer region (-610 to -146) of the MCMV MIEP abrogated Tat responsiveness. This result suggests that Tat requires a DNA target for function. Quantitation of RNA and protein indicates that Tat stimulates expression from the MCMV MIEP at both the transcriptional and translational levels. Deletion analysis of the MIEP indicates that there is likely to be interplay between the enhancer region, a sequence upstream of the known enhancer which negatively affects expression, and the Tat protein. Images PMID:8380074

Kim, Y S; Risser, R

1993-01-01

78

Variation of DNA sequence in immediate-early gene of human herpesvirus 6 and variant identification by PCR.  

PubMed Central

The complete nucleotide sequence of one of the immediate-early genes of human herpesvirus 6 variant B was determined and compared with that of variant A reported by Martin et al. (M.D. Martin, J. Nicholas, B. J. Thomson, C. Newman, and R. W. Honess, J. Virol. 65:5381-5390, 1991). While it was reported that two open reading frames exist in this region of variant A, only one open reading frame was found in variant B and the putative coding region of variant B was 2,679 nucleotides long. Furthermore, two additive regions of 108 and 228 bp were found in variant B. Primers covering one of these regions deleted in variant A were synthesized and used for PCR amplification. Twelve isolates from patients were clearly classified into variants A and B by PCR amplification with these primers. All isolates from patients with exanthem subitum were variant B. Images PMID:8150960

Yamamoto, T; Mukai, T; Kondo, K; Yamanishi, K

1994-01-01

79

Characterization of a Replication-Incompetent Pseudorabies Virus Mutant Lacking the Sole Immediate Early Gene IE180  

PubMed Central

ABSTRACT The alphaherpesvirus pseudorabies virus (PRV) encodes a single immediate early gene called IE180. The IE180 protein is a potent transcriptional activator of viral genes involved in DNA replication and RNA transcription. A PRV mutant with both copies of IE180 deleted was constructed 20 years ago (S. Yamada and M. Shimizu, Virology 199:366–375, 1994, doi:10.1006/viro.1994.1134), but propagation of the mutant depended on complementing cell lines that expressed the toxic IE180 protein constitutively. Recently, Oyibo et al. constructed a novel set of PRV IE180 mutants and a stable cell line with inducible IE180 expression (H. Oyibo, P. Znamenskiy, H. V. Oviedo, L. W. Enquist, A. Zador, Front. Neuroanat. 8:86, 2014, doi:10.3389/fnana.2014.00086), which we characterized further here. These mutants failed to replicate new viral genomes, synthesize immediate early, early, or late viral proteins, and assemble infectious virions. The PRV IE180-null mutant did not form plaques in epithelial cell monolayers and could not spread from primary infected neurons to second-order neurons in culture. PRV IE180-null mutants lacked the property of superinfection exclusion. When PRV IE180-null mutants infected cells first, subsequent superinfecting viruses were not blocked in cell entry and formed replication compartments in epithelial cells, fibroblasts, and neurons. Cells infected with PRV IE180-null mutants survived as long as uninfected cells in culture while expressing a fluorescent reporter gene. Transcomplementation with IE180 in epithelial cells restored all mutant phenotypes to wild type. The conditional expression of PRV IE180 protein enables the propagation of replication-incompetent PRV IE180-null mutants and will facilitate construction of long-term single-cell-infecting PRV mutants for precise neural circuit tracing and high-capacity gene delivery vectors. PMID:25389174

Wu, Brendan W.

2014-01-01

80

Cocaine activates Homer1 immediate early gene transcription in the mesocorticolimbic circuit: differential regulation by dopamine and glutamate signaling  

PubMed Central

Homer proteins are intracellular scaffolding proteins that, amongst glutamate receptors, selectively bind to group1 metabotropic glutamate receptors and regulate their trafficking and intracellular signaling. Homer proteins have been implicated in synaptic and behavioral plasticity, including drug-seeking behavior after cocaine treatment. Homer1 gene activation leads to transcription of a variant mRNA (Homer1a) which functions as an immediate early gene. Homer1a competes with the constitutive Homer proteins (Homer1b/c/d, Homer2a/b, Homer3) for binding to group1 metabotropic glutamate and IP3 receptors. Binding of Homer1a to these proteins disrupts their association with the intracellular signaling scaffold and modulates receptor function. In this study, using RT-PCR, activation of Homer1a mRNA transcription in response to acute and repeated administration of cocaine was characterized in prefrontal cortex, nucleus accumbens, and ventral tegmental area, three mesocorticolimbic nuclei of the rat brain. Moreover, the dopaminergic and glutamatergic regulation of Homer1 gene activation by cocaine was investigated. Acute cocaine rapidly and transiently activated transcription of Homer1a mRNA in all three nuclei. However, repeated administration of cocaine was not effective in inducing the Homer1a mRNA transcription after various withdrawal times ranging from two hours to three weeks. The acute cocaine-mediated activation of Homer1 gene was regulated by D1 but not D2 dopamine receptors. The blockade of AMPA or NMDA glutamate receptors did not prevent cocaine-mediated activation of Homer1 gene in the three mesocorticolimbic nuclei. These data indicate that acute administration of cocaine transiently activates Homer1 gene producing the immediate early gene Homer1a mRNA in the three mesocorticolimbic nuclei of the rat brain. Activation of Homer1 gene may contribute to the cocaine-mediated synaptic and behavioral plasticity. PMID:18932227

Ghasemzadeh, M. Behnam; Windham, Lindsay K.; Lake, Russell W.; Acker, Christopher J.; Kalivas, Peter W.

2013-01-01

81

Reactivation of Expression from Quiescent Herpes Simplex Virus Type 1 Genomes in the Absence of Immediate-Early Protein ICP0?  

PubMed Central

Model systems have previously been developed in which herpes simplex virus (HSV) is retained in human fibroblasts in a nonreplicating state known as quiescence. The HSV type 1 (HSV-1) immediate-early (IE) protein ICP0, an important activator of gene expression, reactivates the quiescent genome and promotes the resumption of virus replication. Previous studies reported that infection with ICP0-null HSV-1 mutants fails to reactivate quiescent HSV, even when the mutant itself undergoes productive replication, leading to the hypothesis that quiescent genomes exist in a silent configuration in which they are shielded from trans-acting factors. I reinvestigated these findings, using HSV-1 mutants with lesions in the transcription activators VP16, ICP0, and ICP4 to establish quiescent infection at high efficiency. Superinfection with ICP0-null HSV-1 mutants at a low multiplicity of infection (MOI), so that individual plaques were formed, reactivated expression from the quiescent genome, demonstrating that the requirement for ICP0 is not absolute. The previously reported failure to observe reactivation by ICP0-null mutants was shown to be a consequence of either a low initial MOI or a high superinfecting MOI. Competition between viral genomes at the level of gene expression and virus replication, especially when ICP0 was absent, was demonstrated during reactivation and also during normal infection of human fibroblasts. The results show that the multiplicity-dependent phenotype of ICP0-null mutants limits the efficiency of reactivation at low MOIs and that competition between genomes occurs at high MOIs. The conclusion that quiescent HSV genomes are extensively silenced and intrinsically insensitive to trans-acting factors must be reevaluated. PMID:17715242

Preston, Chris M.

2007-01-01

82

Excision of Unstable Artificial Gene-Specific Inverted Repeats Mediates Scar-Free Gene Deletions in Escherichia coli.  

PubMed

Inverted repeat and palindromic sequences have the propensity to form non-beta cruciform structures during DNA replication, leading to perturbations within the genome or plasmid replicon. In this study, the tolerance of the Escherichia coli genome to inverted repeat sequences from 25 to 1200 bp was investigated. Genomic inverted repeats were readily created via the homologous insertion of an overlap extension PCR product containing a gene-specific region of the genome together with thyA coding sequence, creating inverted repeat sequences of various lengths flanking the thyA selection marker in the resulting genome. Inverted repeat sequences below 100 bp were stably propagated, while those above and up to 1200 bp were found to be transiently unstable under auxotrophic thymine selection. Excision efficiency improves with increases of the inverted repeat until 600-800 bp, indicating that the genomic stability of inverted repeat sequences is due to secondary structure formation. Its effectiveness of creating precise and scar-free gene deletions was further demonstrated by deleting a number of genes in E. coli. The procedure can be readily adapted for sequence integration and point mutations in E. coli genome. It also has the potential for applications on other bacteria for efficient gene deletions. PMID:25427592

Tear, Crystal Jing Ying; Lim, Chanyuen; Zhao, Hua

2015-02-01

83

MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis  

PubMed Central

Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena – Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated neurons. PMID:24659959

Kubík, Št?pán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

2014-01-01

84

Comparative dynamics of MAPK/ERK signalling components and immediate early genes in the hippocampus and amygdala following contextual fear conditioning and retrieval.  

PubMed

Over the past few years multiple studies have attempted to uncover molecular signatures of memory reconsolidation when compared to consolidation. In the present study we used immunocytochemical detection of the MAPK/ERK1/2 pathway, to track activated neuronal circuits in the hippocampus and amygdala recruited during the consolidation and reconsolidation of a contextual fear conditioning (CFC) memory. We report selective differences in magnitude and temporal dynamics of activated ERK1/2 signalling in different subregions of these two structures between the post-training and post-retrieval periods, except in the dentate gyrus, where the patterns of activation were similar. We then focused on this brain area to dissect out the patterns of downstream ERK1/2 signalling components, including the phosphorylation of MSK-1 and histone H3 on ser10, along with the induction of the Immediate Early Genes (IEGs) Arc/Arg3.1, c-Fos and Zif268/Egr1 following CFC training and retrieval. We found that the completion of the nucleosomal response as well as the induction of IEGs shorter during the reconsolidation period as compared to consolidation. Our results shed new light on the cellular mechanisms underlying the consolidation and reconsolidation processes engaged following CFC training and retrieval and further extend the notion that memory reconsolidation is not mechanistically a repetition of consolidation. In addition, we provide evidence that the strength of a previously established CFC memory is characterized by distinct patterns of ERK1/2 activation in different hippocampal and amygdalar subfields upon CFC memory recall. Our results emphasize the differences between consolidation and reconsolidation processes in relation to contextual fear memories. PMID:23389809

Besnard, Antoine; Laroche, Serge; Caboche, Jocelyne

2014-01-01

85

Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory  

ERIC Educational Resources Information Center

No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

Pevzner, Aleksandr; Guzowski, John F.

2015-01-01

86

Expression of Immediate-Early Genes in the Inferior Colliculus and Auditory Cortex in Salicylate-Induced Tinnitus in Rat  

PubMed Central

Tinnitus could be associated with neuronal hyperactivity in the auditory center. As a neuronal activity marker, immediate-early gene (IEG) expression is considered part of a general neuronal response to natural stimuli. Some IEGs, especially the activity-dependent cytoskeletal protein (Arc) and the early growth response gene-1 (Egr-1), appear to be highly correlated with sensory-evoked neuronal activity. We hypothesize, therefore, an increase of Arc and Egr-1 will be observed in a tinnitus model. In our study, we used the gap prepulse inhibition of acoustic startle (GPIAS) paradigm to confirm that salicylate induces tinnitus-like behavior in rats. However, expression of the Arc gene and Egr-1 gene were decreased in the inferior colliculus (IC) and auditory cortex (AC), in contradiction of our hypothesis. Expression of N-methyl D-aspartate receptor subunit 2B (NR2B) was increased and all of these changes returned to normal 14 days after treatment with salicylate ceased. These data revealed long-time administration of salicylate induced tinnitus markedly but reversibly and caused neural plasticity changes in the IC and the AC. Decreased expression of Arc and Egr-1 might be involved with instability of synaptic plasticity in tinnitus. PMID:24704997

Hu, S.S.; Mei, L.; Chen, J.Y.; Huang, Z.W.; Wu, H.

2014-01-01

87

Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation  

NASA Technical Reports Server (NTRS)

Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

1997-01-01

88

Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp  

SciTech Connect

Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter.

Liu Wangjing [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Chang Yunshiang [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Wang Chunghsiung [Department of Entomology, National Taiwan University, Taipei 106, Taiwan (China); Kou, Guang-Hsiung [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China); Lo Chufang [Institute of Zoology, National Taiwan University, Taipei 106, Taiwan (China)]. E-mail: gracelow@ntu.edu.tw

2005-04-10

89

Immediate-early regulatory gene mutants define different stages in the establishment and reactivation of herpes simplex virus latency.  

PubMed Central

Using nonsense and deletion mutants of herpes simplex virus type 1, we investigated the roles of three immediate-early proteins (ICP4, ICP27 and ICP0) in the establishment and reactivation of ganglionic latency in a mouse ocular model. DNA hybridization, superinfection-rescue, and cocultivation techniques provided quantitative data that distinguished between the failure of a virus to establish latency in the ganglion and its failure to reactivate. Null mutants with lesions in the genes for ICP4 and ICP27 did not replicate in the eye or in ganglia and failed to establish reactivatable latent infections. Three ICP0 deletion mutants which could replicate in the eye and ganglia varied in their ability to establish and reactivate from the latent state, demonstrating that ICP0 plays a role both in the establishment and the reactivation of latency. The use of viral mutants and a variety of stage-specific assays allowed us to better define the stages in the establishment and reactivation of herpes simplex virus type 1 latency. Images PMID:2536101

Leib, D A; Coen, D M; Bogard, C L; Hicks, K A; Yager, D R; Knipe, D M; Tyler, K L; Schaffer, P A

1989-01-01

90

A crossroad of microRNAs and immediate early genes (IEGs) encoding oncogenic transcription factors in breast cancer.  

PubMed

Signaling networks are involved in development, as well as in malignancy of the mammary gland. Distinct external stimuli activate intricate signaling cascades, which culminate in the activation of specific transcriptional programs. These signal-specific transcriptional programs are instigated by transcription factors (TFs) encoded by the immediate early genes (IEGs), and they lead to diverse cellular outcomes, including oncogenesis. Hence, regulating the expression of IEGs is of great importance, and involves several complementary transcriptional and posttranscriptional mechanisms, the latter entails also microRNAs (miRNAs). miRNAs are a class of non-coding RNAs, which have been implicated in regulation of various aspects of signaling networks. Through examination of the basic characteristics of miRNA function, we highlight the benefits of using miRNAs as regulators of early TFs and signaling networks. We further focus on the role of miRNAs as regulators of IEGs, which shape the initial steps of signaling-induced transcription. We especially emphasize the role of miRNAs in buffering external noise and maintaining low basal activation of IEGs in the absence of proper stimuli. PMID:22327345

Sas-Chen, Aldema; Avraham, Roi; Yarden, Yosef

2012-03-01

91

Immediate early gene response to hearing song correlates with receptive behavior and depends on dialect in a female songbird.  

PubMed

Stimulus-induced expression of the immediate early gene ZENK (egr-1) in the songbird's auditory forebrain presumably depends on the behavioral significance of the stimulus. Few studies, however, have quantified both the ZENK and behavioral responses to a stimulus in the same individuals. We played conspecific male song of either hatch (local) or foreign dialect to female white-crowned sparrows (Zonotrichia leucophrys oriantha) and quantified both the auditory ZENK response and their behavioral response, which is known to depend on dialect. Birds hearing hatch dialect showed greater ZENK induction in the caudomedial hyperstriatum ventrale and the dorsal portion of the caudomedial neostriatum than birds hearing foreign dialect, supporting previous work showing a relationship between ZENK and salience of the stimulus. In the dorsal portion of the caudomedial neostriatum, ZENK induction was correlated with the amount of non-vocal courtship behavior; however, in the caudomedial hyperstriatum ventrale, ZENK induction was more highly correlated with the females' own vocal behavior and thus may have been partly self-induced. Some females sang and showed a male-like pattern of ZENK induction in their song systems. This study provides the first evidence that the ZENK response in a sensory area to a social stimulus is proportional to the animal's preference for the stimulus. PMID:12879354

Maney, D L; MacDougall-Shackleton, E A; MacDougall-Shackleton, S A; Ball, G F; Hahn, T P

2003-09-01

92

The Carboxy Terminal Region of the Human Cytomegalovirus Immediate Early 1 (IE1) Protein Disrupts Type II Inteferon Signaling  

PubMed Central

Interferons (IFNs) activate the first lines of defense against viruses, and promote innate and adaptive immune responses to viruses. We report that the immediate early 1 (IE1) protein of human cytomegalovirus (HCMV) disrupts signaling by IFN?. The carboxyl-terminal region of IE1 is required for this function. We found no defect in the initial events in IFN? signaling or in nuclear accumulation of signal transducer and activator of transcription 1 (STAT1) in IE1-expressing cells. Moreover, we did not observe an association between disruption of IFN? signaling and nuclear domain 10 (ND10) disruption. However, there is reduced binding of STAT1 homodimers to target gamma activated sequence (GAS) elements in the presence of IE1. Co-immunoprecipitation studies failed to support a direct interaction between IE1 and STAT1, although these studies revealed that the C-terminal region of IE1 was required for interaction with STAT2. Together, these results indicate that IE1 disrupts IFN? signaling by interfering with signaling events in the nucleus through a novel mechanism. PMID:24699362

Raghavan, Bindu; Cook, Charles H.; Trgovcich, Joanne

2014-01-01

93

The carboxy terminal region of the human cytomegalovirus immediate early 1 (IE1) protein disrupts type II inteferon signaling.  

PubMed

Interferons (IFNs) activate the first lines of defense against viruses, and promote innate and adaptive immune responses to viruses. We report that the immediate early 1 (IE1) protein of human cytomegalovirus (HCMV) disrupts signaling by IFN?. The carboxyl-terminal region of IE1 is required for this function. We found no defect in the initial events in IFN? signaling or in nuclear accumulation of signal transducer and activator of transcription 1 (STAT1) in IE1-expressing cells. Moreover, we did not observe an association between disruption of IFN? signaling and nuclear domain 10 (ND10) disruption. However, there is reduced binding of STAT1 homodimers to target gamma activated sequence (GAS) elements in the presence of IE1. Co-immunoprecipitation studies failed to support a direct interaction between IE1 and STAT1, although these studies revealed that the C-terminal region of IE1 was required for interaction with STAT2. Together, these results indicate that IE1 disrupts IFN? signaling by interfering with signaling events in the nucleus through a novel mechanism. PMID:24699362

Raghavan, Bindu; Cook, Charles H; Trgovcich, Joanne

2014-04-01

94

Rotation and immediate-early gene expression in rats treated with the atypical D1 dopamine agonist SKF 83822  

PubMed Central

Classical agonists of the dopamine D1 receptor activate both adenylyl cyclase and phospholipase C (PLC) signaling pathways. As a result, the extent to which these two pathways are essentially involved in various effects produced by D1 receptor agonists is currently uncertain. In the present report we examined the effects of SKF 83822, a dopamine D1 agonist which has been reported to activate adenylyl cyclase, but not PLC, on behavior and immediate early gene (IEG) expression in rats with unilateral 6-hydroxydopamine lesions. SKF 83822 (25-100 ug/kg) induced dose dependent contralateral rotation in these subjects, and, additionally, stimulated strong expression of the IEG products c-Fos, Fra2, Zif/268 and Arc in the deinnervated striatum. All of these effects could be antagonized by pretreatment with the selective D1 dopamine antagonist SCH 23390 (0.5 mg/kg). Although PLC may be involved in many effects mediated through dopamine D1 receptors, these results suggest that direct activation of PLC is not necessary for the induction of either rotation or IEG expression in dopamine depleted rats. PMID:17306871

Wirtshafter, David

2007-01-01

95

Synaptotagmin IV is an immediate early gene induced by depolarization in PC12 cells and in brain.  

PubMed Central

Subtractive library construction and differential screening were used to identify a cDNA for a cell type-specific immediate early gene induced in rat PC12 pheochromocytoma cells. Sequencing identified the protein product of this gene as rat synaptotagmin IV (SytIV). Synaptotagmins are synaptic vesicle proteins thought to play a role in depolarization-induced, calcium-mediated exocytosis and neurotransmitter release. SytIV mRNA accumulation is transiently induced in PC12 cells by potassium depolarization, calcium ionophore, ATP, and forskolin. In contrast, growth factors and phorbol 12-myristate 13-acetate induce little or no SytIV mRNA accumulation. Kainic acid-induced seizures in rats are followed by accumulation of SytIV message in the hippocampus and piriform cortex. The SytIV gene may provide a direct link between depolarization-induced neuronal gene expression and subsequent modulation of synaptic structure and function. Images Fig. 2 Fig. 3 Fig. 4 PMID:7892240

Vician, L; Lim, I K; Ferguson, G; Tocco, G; Baudry, M; Herschman, H R

1995-01-01

96

Low-level laser therapy effectively prevents secondary brain injury induced by immediate early responsive gene X-1 deficiency.  

PubMed

A mild insult to the brain can sometimes trigger secondary brain injury, causing severe postconcussion syndrome, but the underlying mechanism is ill understood. We show here that secondary brain injury occurs consistently in mice lacking immediate early responsive gene X-1 (IEX-1), after a gentle impact to the head, which closely simulates mild traumatic brain injury in humans. The pathologic lesion was characterized by extensive cell death, widespread leukocyte infiltrates, and severe tissue loss. On the contrary, a similar insult did not induce any secondary injury in wild-type mice. Strikingly, noninvasive exposure of the injured head to a low-level laser at 4 hours after injury almost completely prevented the secondary brain injury in IEX-1 knockout mice. The low-level laser therapy (LLLT) suppressed proinflammatory cytokine expression like interleukin (IL)-1? and IL-6 but upregulated TNF-?. Moreover, although lack of IEX-1 compromised ATP synthesis, LLLT elevated its production in injured brain. The protective effect of LLLT may be ascribed to enhanced ATP production and selective modulation of proinflammatory mediators. This new closed head injury model provides an excellent tool to investigate the pathogenesis of secondary brain injury as well as the mechanism underlying the beneficial effect of LLLT. PMID:24849666

Zhang, Qi; Zhou, Chang; Hamblin, Michael R; Wu, Mei X

2014-08-01

97

Cortical synaptic NMDA receptor deficits in ?7 nicotinic acetylcholine receptor gene deletion models: implications for neuropsychiatric diseases.  

PubMed

Microdeletion of the human CHRNA7 gene (?7 nicotinic acetylcholine receptor, nAChR) as well as dysfunction in N-methyl-d-aspartate receptors (NMDARs) have been associated with cortical dysfunction in a broad spectrum of neurodevelopmental and neuropsychiatric disorders including schizophrenia. However, the pathophysiological roles of synaptic vs. extrasynaptic NMDARs and their interactions with ?7 nAChRs in cortical dysfunction remain largely uncharacterized. Using a combination of in vivo and in vitro models, we demonstrate that ?7 nAChR gene deletion leads to specific loss of synaptic NMDARs and their coagonist, d-serine, as well as glutamatergic synaptic deficits in mouse cortex. ?7 nAChR null mice had decreased cortical NMDAR expression and glutamatergic synapse formation during postnatal development. Similar reductions in NMDAR expression and glutamatergic synapse formation were revealed in cortical cultures lacking ?7 nAChRs. Interestingly, synaptic, but not extrasynaptic, NMDAR currents were specifically diminished in cultured cortical pyramidal neurons as well as in acute prefrontal cortical slices of ?7 nAChR null mice. Moreover, d-serine responsive synaptic NMDAR-mediated currents and levels of the d-serine synthetic enzyme serine racemase were both reduced in ?7 nAChR null cortical pyramidal neurons. Our findings thus identify specific loss of synaptic NMDARs and their coagonist, d-serine, as well as glutamatergic synaptic deficits in ?7 nAChR gene deletion models of cortical dysfunction, thereby implicating ?7 nAChR-mediated control of synaptic NMDARs and serine racemase/d-serine pathways in cortical dysfunction underlying many neuropsychiatric and neurodevelopmental disorders, particularly those associated with deletion of human CHRNA7. PMID:24326163

Lin, Hong; Hsu, Fu-Chun; Baumann, Bailey H; Coulter, Douglas A; Lynch, David R

2014-03-01

98

Zinc rescue of Akt2 gene deletion-linked murine cardiac dysfunction and pathological changes is metallothionein-dependent.  

PubMed

We have demonstrated that zinc supplementation provides cardiac protection from diabetes in mice, but its underlying mechanism remains unclear. Since zinc mimics the function of insulin, it may provide benefit to the heart via stimulating Akt-mediated glucose metabolism. Akt2 plays an important role in cardiac glucose metabolism and mice with Akt2 gene deletion (Akt2-KO) exhibit a type 2 diabetes phenotype; therefore, we assumed that no cardiac protection by zinc supplementation from diabetes would be observed in Akt2-KO mice. Surprisingly, despite Akt2 gene deletion, zinc supplementation provided protection against cardiac dysfunction and other pathological changes in Akt2-KO mice, which were accompanied by significant decreases in Akt and GSK-3? phosphorylation. Correspondingly, glycogen synthase phosphorylation and hexokinase II and PGC-1? expression, all involved in the regulation of glucose metabolism, were significantly altered in diabetic hearts, along with a significantly increased expression of Akt negative regulators: PTEN, PTP1B, and TRB3. All these molecular, pathological, and functional changes were significantly prevented by 3-month zinc supplementation. Furthermore, the stimulation of Akt-mediated glucose metabolic kinases or enzymes by zinc treatment was metallothionein-dependent since it could not be observed in metallothionein-knockout mice. These results suggest that zinc preserves cardiac function and structure in Akt2-KO mice presumably due to its insulin mimetic effect on cardiac glucose-metabolism. The cardioprotective effects of zinc are metallothionein-dependent. This is very important since zinc supplementation may be required for patients with Akt2 gene deficiency or insulin resistance. PMID:24819347

Sun, Weixia; Miao, Xiao; Zhou, Shanshan; Zhang, Li; Epstein, Paul N; Mellen, Nicholas; Zheng, Yang; Fu, Yaowen; Wang, Yuehui; Cai, Lu

2014-09-01

99

Targeted intestinal overexpression of the immediate early gene tis7 in transgenic mice increases triglyceride absorption and adiposity.  

PubMed

Following loss of functional small bowel surface area due to surgical resection, the remnant gut undergoes an adaptive response characterized by increased crypt cell proliferation and enhanced villus height and crypt depth, resulting in augmented intestinal nutrient absorptive capacity. Previous studies showed that expression of the immediate early gene tis7 is markedly up-regulated in intestinal enterocytes during the adaptive response. To study its role in the enterocyte, transgenic mice were generated that specifically overexpress TIS7 in the gut. Nucleotides -596 to +21 of the rat liver fatty acid-binding protein promoter were used to direct abundant overexpression of TIS7 into small intestinal upper crypt and villus enterocytes. TIS7 transgenic mice had increased total body adiposity and decreased lean muscle mass compared with normal littermates. Oxygen consumption levels, body weight, surface area, and small bowel weight were decreased. On a high fat diet, transgenic mice exhibited a more rapid and proportionately greater gain in body weight with persistently elevated total body adiposity and increased hepatic fat accumulation. Bolus fat feeding resulted in a greater increase in serum triglyceride levels and an accelerated appearance of enterocytic, lamina propria, and hepatic fat. Changes in fat homeostasis were linked to increased expression of genes involved in enterocytic triglyceride metabolism and changes in growth with decreased insulin-like growth factor-1 expression. Thus, TIS7 overexpression in the intestine altered growth, metabolic rate, adiposity, and intestinal triglyceride absorption. These results suggest that TIS7 is a unique mediator of nutrient absorptive and metabolic adaptation following gut resection. PMID:16085642

Wang, Yuan; Iordanov, Hristo; Swietlicki, Elzbieta A; Wang, Lihua; Fritsch, Christine; Coleman, Trey; Semenkovich, Clay F; Levin, Marc S; Rubin, Deborah C

2005-10-14

100

Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.  

PubMed

Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

2009-04-01

101

Reactivation of the Previously Silenced Cytomegalovirus Major Immediate-Early Promoter in the Mouse Liver: Involvement of NF?B  

PubMed Central

The cytomegalovirus (CMV) major immediate-early promoter/enhancer is active in many cell culture systems and is considered to be one of the strongest promoters in vitro. However, when this promoter was used in in vivo approaches to gene therapy, it was silenced within a few weeks in several organs including the liver. In this study, we demonstrated transcriptional inactivation of the CMV promoter in mouse liver. In contrast to the CMV promoter, a hybrid promoter consisting of a minimal CMV promoter and the enhancer II of hepatitis B virus was active for at least 11 weeks in mouse liver. While investigating the reason for the shutdown of the CMV promoter, we did not find evidence for methylation of adenovirus DNA in the region of transgene insertion, but we could show that the silenced CMV promoter was reactivated after lipopolysaccharide treatment of mice or partial hepatectomy. Both stimuli are known to activate the transcription factor NF?B, which binds to four sites in the CMV promoter/enhancer. We show that expression from the CMV promoter in hepatocyte-derived cell lines in vitro depends on NF?B. In vivo experiments demonstrate that NF?B, which is not present in mouse hepatocytes in vivo, is activated after infection with recombinant adenoviruses and that the time course of NF?B activation parallels that of CMV promoter-dependent expression. Moreover, adenovirus infection of transgenic mice carrying a CMV promoter-driven lacZ gene leads to strong activation of the expression of this gene in the liver. Thus, NF?B is involved in the activation of the CMV promoter in the liver. PMID:9420214

Löser, Peter; Jennings, Gary S.; Strauss, Michael; Sandig, Volker

1998-01-01

102

The three major immediate-early transcripts of bovine herpesvirus 1 arise from two divergent and spliced transcription units.  

PubMed Central

Among 54 transcripts expressed in a temporal cascade during lytic infection with bovine herpesvirus 1, we have previously identified three major immediate-early (IE) RNAs, IER4.2 (4.2 kb), IER2.9 (2.9 kb), and IER1.7 (1.6 to 1.8 kb depending on the virus strain) transcribed from the HindIII C genome region (U. V. Wirth, K. Gunkel, M. Engels, and M. Schwyzer, J. Virol. 63:4882-4889, 1989). Northern (RNA) blot, S1 nuclease protection, and primer extension analysis used in the present study demonstrated that all three IE transcripts were spliced and originated from two divergent transcription units with start sites located in the inverted repeat. Transcription unit 1 encoded two alternative spliced transcripts, IER4.2 and IER2.9, with a common exon 1 located at 0.797 to 0.795 map units (m.u.) and an exon 2 for IER4.2 (0.792 to 0.762 m.u.) in the inverted repeat; exon 2 for IER2.9 (0.754 to 0.738 m.u.) was located in the unique long sequence and transcribed in antisense orientation to latency-related RNA. Transcription unit 2 (0.818 to 0.836 m.u.), further characterized by cDNA cloning, encoded the spliced IER1.7 with three exons in the inverted repeat. Additional minor IE transcripts were interpreted as unspliced precursors and splicing variants. With regard to the number and layout of IE genes, bovine herpesvirus 1 occupies an intermediate position between pseudorabies virus and equine herpesvirus 1 on the one hand and varicella-zoster virus and herpes simplex virus type 1 on the other. Images PMID:1845884

Wirth, U V; Vogt, B; Schwyzer, M

1991-01-01

103

Co-Localization of Immediate Early Genes in Catecholamine Cells after Song Exposure in Female Zebra Finches (Taeniopygia guttata)  

PubMed Central

The physiological state of animals in many taxonomic groups can be modified via social interactions, including simply receiving communication signals from conspecifics. Here, we explore whether the catecholaminergic system of female songbirds responds during social interactions that are limited to song reception. We measured the protein product of an immediate early gene (ZENK) within three catecholaminergic brain regions in song-exposed (N = 11) and silent-exposed (N = 6) female zebra finches (Taeniopygia guttata). ZENK-ir induction was quantified in catecholamine cells as well as within cells of unknown phenotypes in three brain regions that synthesize catecholamines, the ventral tegmental area (VTA), the periaqueductal gray (PAG) and the locus coeruleus (LoC). Our results reveal that there are no significant differences in the overall number of cells expressing ZENK between song-exposed and silent-exposed females. However, when we limited our measurements to catecholamine-containing cells, we show a greater number of catecholamine-containing cells expressing ZENK within the LoC in the song-exposed females as compared to silent-exposed females. Furthermore, we measured five behaviors during the song and silent-exposed period, as behavioral differences between these groups may account for differences in the co-induction of ZENK and TH-ir. Our results reveal that there were no statistically significant differences in the five measured behaviors between song and silent-exposed females. Our study demonstrates that noradrenergic cells within the LoC are involved in the neural architecture underlying sound perception and that cells within the catecholaminergic system are modulated by social interactions, particularly the reception of signals used in animal communication. PMID:22572406

Lynch, Kathleen S.; Diekamp, Bettina; Ball, Gregory F.

2013-01-01

104

Levetiracetam attenuates hippocampal expression of synaptic plasticity-related immediate early and late response genes in amygdala-kindled rats  

PubMed Central

Background The amygdala-kindled rat is a model for human temporal lobe epilepsy and activity-dependent synaptic plasticity. Hippocampal RNA isolated from amygdala-kindled rats at different kindling stages was analyzed to identify kindling-induced genes. Furthermore, effects of the anti-epileptic drug levetiracetam on kindling-induced gene expression were examined. Results Cyclooxygenase-2 (Cox-2), Protocadherin-8 (Pcdh8) and TGF-beta-inducible early response gene-1 (TIEG1) were identified and verified as differentially expressed transcripts in the hippocampus of kindled rats by in situ hybridization and quantitative RT-PCR. In addition, we identified a panel of 16 additional transcripts which included Arc, Egr3/Pilot, Homer1a, Ania-3, MMP9, Narp, c-fos, NGF, BDNF, NT-3, Synaptopodin, Pim1 kinase, TNF-?, RGS2, Egr2/krox-20 and ?-A activin that were differentially expressed in the hippocampus of amygdala-kindled rats. The list consists of many synaptic plasticity-related immediate early genes (IEGs) as well as some late response genes encoding transcription factors, neurotrophic factors and proteins that are known to regulate synaptic remodelling. In the hippocampus, induction of IEG expression was dependent on the afterdischarge (AD) duration. Levetiracetam, 40 mg/kg, suppressed the development of kindling measured as severity of seizures and AD duration. In addition, single animal profiling also showed that levetiracetam attenuated the observed kindling-induced IEG expression; an effect that paralleled the anti-epileptic effect of the drug on AD duration. Conclusions The present study provides mRNA expression data that suggest that levetiracetam attenuates expression of genes known to regulate synaptic remodelling. In the kindled rat, levetiracetam does so by shortening the AD duration thereby reducing the seizure-induced changes in mRNA expression in the hippocampus. PMID:20105316

2010-01-01

105

Contrasting Networks for Recognition Memory and Recency Memory Revealed by Immediate-Early Gene Imaging in the Rat  

PubMed Central

The expression of the immediate-early gene c-fos was used to compare networks of activity associated with recency memory (temporal order memory) and recognition memory. In Experiment 1, rats were first familiarized with sets of objects and then given pairs of different, familiar objects to explore. For the recency test group, each object in a pair was separated by 110 min in the time between their previous presentations. For the recency control test, each object in a pair was separated by less than a 1 min between their prior presentations. Temporal discrimination of the objects correlated with c-fos activity in the recency test group in several sites, including area Te2, the perirhinal cortex, lateral entorhinal cortex, as well as the dentate gyrus, hippocampal fields CA3 and CA1. For both the test and control conditions, network models were derived using structural equation modeling. The recency test model emphasized serial connections from the perirhinal cortex to lateral entorhinal cortex and then to the CA1 subfield. The recency control condition involved more parallel pathways, but again highlighted CA1 within the hippocampus. Both models contrasted with those derived from tests of object recognition (Experiment 2), because stimulus novelty was associated with pathways from the perirhinal cortex to lateral entorhinal cortex that then involved both the dentate gyrus (and CA3) and CA1 in parallel. The present findings implicate CA1 for the processing of familiar stimuli, including recency discriminations, while the dentate gyrus and CA3 pathways are recruited when the perirhinal cortex signals novel stimuli. PMID:24933661

2014-01-01

106

DIFFERENTIAL EFFECTS OF NEONATAL NOREPINEPHRINE LESIONS ON IMMEDIATE EARLY GENE EXPRESSION IN DEVELOPING AND ADULT RAT BRAIN  

PubMed Central

Arc, c-fos and zif268 are immediate early genes (IEGs) important for adult brain plasticity. The current study examines developmental expression of these IEGs and the effect of neonatal noradrenergic lesion on their expression in developing and mature brain. N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP-4), a specific noradrenergic neurotoxin, was administered to rats on postnatal day (PND) 3 and in situ hybridization was used to assay Arc, c-fos and zif268 mRNA on PND 13, 25 and 60. In contrast to decreases in Arc, c-fos and zif268 expression produced by noradrenergic lesions of mature brain, lesions on PND3 yield a strikingly different effect. Neonatal lesions produce increases in c-fos and zif268 expression in specific frontal cortical layers on PND13, while Arc shows no change. These lesions lead to increases in zif268 expression in frontal cortical layers on PND 25, with no changes in c-fos or Arc expression, and on PND60 they produce a significant increase in c-fos expression in hippocampus with no significant changes in Arc or zif268 expression. RX821002, an A2AR antagonist, administered to control PND 60 animals produces elevations of Arc, zif268 and c-fos mRNAs. This response was eliminated in animals lesioned with DSP-4 on PND 3. These data indicate that norepinephrine regulation of IEG expression differs in developing and mature brain and that the loss of developmental norepinephrine leads to abnormally high postnatal IEG expression. Several studies have shown an important role for norepinephrine in brain development, including the regulation of synaptic densities and neuronal morphology. Our data support the idea that norepinephrine plays an important role during CNS development and that changes in noradrenergic signaling during development may have long lasting effects, potentially on learning and memory. PMID:18938224

Sanders, Jeff D.; Happe, H. Kevin; Bylund, David B.; Murrin, L. Charles

2008-01-01

107

The Product of Kaposi's Sarcoma-Associated Herpesvirus Immediate Early Gene K4.2 Regulates Immunoglobulin Secretion and Calcium Homeostasis by Interacting with and Inhibiting pERP1  

PubMed Central

Chaperones are proteins that assist the noncovalent folding and assembly of macromolecular polypeptide chains, ultimately preventing the formation of nonfunctional or potentially toxic protein aggregates. Plasma cell-induced-endoplasmic reticulum (ER)-resident protein 1 (pERP1) is a cellular chaperone that is preferentially expressed in marginal-zone B cells and is highly upregulated during plasma cell differentiation. While initially identified as a dedicated factor for the assembly of secreted IgM, pERP1 has since been implicated in suppressing calcium mobilization, and its expression is misregulated in multiple tumors. A number of herpesvirus immediate early gene products play important roles in the regulation of viral gene expression and/or evasion of host immune responses. Here, we report that the Kaposi's sarcoma-associated herpesvirus (KSHV) immediate early viral gene K4.2 encodes an endoplasmic reticulum-localized protein that interacts with and inhibits pERP1. Consequently, K4.2 expression interfered with immunoglobulin secretion by delaying the kinetics of immunoglobulin assembly and also led to increased responsiveness of B-cell receptor signal transduction by enhancing phosphotyrosine signals and intracellular calcium fluxes. Furthermore, K4.2 expression also appeared to contribute to maximal lytic replication by enhancing viral glycoprotein expression levels and ultimately promoting infectious-virus production. Finally, immunohistochemistry analysis showed that pERP1 expression was readily detected in KSHV-positive cells from multicentric Castleman's disease (MCD) and Kaposi's sarcoma (KS) lesions, suggesting that pERP1 may have potential roles in the KSHV life cycle and malignancy. In conclusion, our data suggest that K4.2 participates in lytic replication by enhancing calcium flux and viral glycoprotein expression, but also by interfering with immunoglobulin assembly to potentially dampen the adaptive immune response. PMID:23986581

Wong, Lai-Yee; Brulois, Kevin; Toth, Zsolt; Inn, Kyung-Soo; Lee, Sun-Hwa; O'Brien, Kathryn; Lee, Hyera; Gao, Shou-Jiang; Cesarman, Ethel; Ensser, Armin

2013-01-01

108

Identification of Additional IE2-p86Responsive cis-Repressive Sequences within the Human Cytomegalovirus Major Immediate Early Gene Promoter  

Microsoft Academic Search

Human cytomegalovirus (HCMV) is a ubiquitous human pathogen that is the leading viral cause of birth defects and also causes significant morbidity and mortality in immunosuppressed individuals. The immediate early (IE) genes, IE1-p72 and IE2-p86, are the first HCMV genes expressed after infection under the control of a strong transcriptional enhancer-promoter, the major IE promoter (MIEP). Gene expression mediated by

Chi-Jung Huang; Jeou-Yuan Chen

2002-01-01

109

Infection of Cells with Human Cytomegalovirus during S Phase Results in a Blockade to Immediate-Early Gene Expression That Can Be Overcome by Inhibition of the Proteasome  

Microsoft Academic Search

Cells infected with human cytomegalovirus (HCMV) after commencing DNA replication do not initiate viral immediate-early (IE) gene expression and divide before arresting. To determine the nature of this blockade, we examined cells that were infected 24 h after release from G0 using immunofluorescence, laser scanning cytometry, and fluorescence-activated cell sorting (FACS) analysis. Approximately 40 to 50% of the cells had

Elizabeth A. Fortunato; Veronica Sanchez; Judy Y. Yen; Deborah H. Spector

2002-01-01

110

Expression of immediate early genes in the hippocampal formation of the black-capped chickadee ( Poecile atricapillus) during a food-hoarding task  

Microsoft Academic Search

Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal

Tom V. Smulders; Timothy J. Devoogd

2000-01-01

111

Differential effects of vocalization type, singer and listener on ZENK immediate early gene response in black-capped chickadees ( Poecile atricapillus)  

Microsoft Academic Search

Here we examined immediate early gene (ZENK) induction to vocalizations in the ascending auditory pathway of black-capped chickadees (Poecile atricapillus) to assess the impact that the sex of the producer and perceiver has on ZENK induction. We manipulated the playback by both the vocal type (song\\/call) and sex of producer (male\\/female), and then presented these stimuli classes to either male

M. T. Avey; R. A. Kanyo; E. L. Irwin; C. B. Sturdy

2008-01-01

112

The Rep68 Protein of Adeno-Associated Virus Type 2 Increases RNA Levels from the Human Cytomegalovirus Major Immediate Early Promoter  

Microsoft Academic Search

The Rep68 and Rep78 proteins of adeno-associated virus type-2 (AAV) are multifunctional DNA binding proteins which are involved in the positive and negative regulation of AAV genes, as well as various cellular and heterologous viral genes. In this study we report that Rep68 enhances expression from the major immediate early promoter (MIEP) of human cytomegalovirus (HCMV). This Rep-mediated enhancement of

Ramani S Wonderling; Sirkka R. M Kyöstiö; Scotty L Walker; Roland A Owens

1997-01-01

113

Social contact elicits immediate-early gene expression in dopaminergic cells of the male prairie vole extended olfactory amygdala.  

PubMed

Male prairie voles (Microtus ochrogaster) are a valuable model in which to study the neurobiology of sociality because, unlike most mammals, they pair bond after mating and display paternal behaviors. Research on the regulation of these social behaviors has highlighted dopamine (DA) neurotransmission in both pair bonding and parenting. We recently described large numbers of dopaminergic cells in the male prairie vole principal nucleus of the bed nucleus of the stria terminalis (pBST) and posterodorsal medial amygdala (MeApd), but such cells were very few in number or absent in the non-monogamous species we examined, including meadow voles. This suggests that DA cells in these sites may be important for sociosexual behaviors in male prairie voles. To gain some insight into the function of these DAergic neurons in male prairie voles, we examined expression of the immediate-early genes (IEGs) Fos and Egr-1 in tyrosine hydroxylase (TH)-immunoreactive (TH-ir) cells of the pBST and MeApd after males interacted or not with one of several social stimuli. We found that IEGs were constitutively expressed in some TH-ir neurons under any social condition, but that IEG expression in these cells decreased after a 3.5-h social isolation. Thirty-minute mating bouts (but not 6- or 24-h bouts) that included ejaculation elicited greater IEG expression in TH-ir cells than did non-ejaculatory mating, interactions with a familiar female sibling, or interactions with pups. Furthermore, Fos expression in TH-ir cells was positively correlated with the display of copulatory, but not parental, behaviors. These effects of mating were not found in other DA-rich sites of the forebrain (including the anteroventral periventricular preoptic area, periventricular anterior hypothalamus, zona incerta, and arcuate nucleus). Thus, activity in DAergic cells of the male prairie vole pBST and MeApd is influenced by their social environment, and may be particularly involved in mating and its consequences, including pair bonding. PMID:19524021

Northcutt, K V; Lonstein, J S

2009-09-29

114

Social contact elicits immediate-early gene expression in dopaminergic cells of the male prairie vole extended olfactory amygdala  

PubMed Central

Male prairie voles (Microtus ochrogaster) are a valuable model in which to study the neurobiology of sociality because, unlike most mammals, they pair bond after mating and display paternal behaviors. Research on the regulation of these social behaviors has highlighted dopamine (DA) neurotransmission in both pair bonding and parenting. We recently described large numbers of dopaminergic cells in the male prairie vole principal nucleus of the bed nucleus of the stria terminalis (pBST) and posterodorsal medial amygdala (MeApd), but such cells were very few in number or absent in the non-monogamous species we examined, including meadow voles. This suggests that DA cells in these sites may be important for sociosexual behaviors in male prairie voles. To gain some insight into the function of these DAergic neurons in male prairie voles, we examined expression of the immediate-early genes (IEGs) Fos and Egr-1 in TH-immunoreactive (TH-ir) cells of the pBST and MeApd after males interacted or not with one of several social stimuli. We found that IEGs were constitutively expressed in some TH-ir neurons under any social condition, and that IEG expression in these cells decreased after a 3.5-hr social isolation. Thirty-min mating bouts (but not 6- or 24-hr bouts) that included ejaculation elicited greater IEG expression in TH-ir cells than did non-ejaculatory mating, interactions with a familiar female sibling, or interactions with pups. Furthermore, Fos expression in TH-ir cells was positively correlated with the display of copulatory, but not parental, behaviors. These effects of mating were not found in other DA-rich sites of the forebrain (including the anteroventral periventricular preoptic area, periventricular anterior hypothalamus, zona incerta, and arcuate nucleus). Thus, activity in DAergic cells of the male prairie vole pBST and MeApd is influenced by their social environment, and may be particularly involved in mating and its consequences, including pair bonding. PMID:19524021

Northcutt, Katharine V.; Lonstein, Joseph S.

2010-01-01

115

Rhomboids of Mycobacteria: Characterization Using an aarA Mutant of Providencia stuartii and Gene Deletion in Mycobacterium smegmatis  

PubMed Central

Background Rhomboids are ubiquitous proteins with unknown roles in mycobacteria. However, bioinformatics suggested putative roles in DNA replication pathways and metabolite transport. Here, mycobacterial rhomboid-encoding genes were characterized; first, using the Providencia stuartii null-rhomboid mutant and then deleted from Mycobacterium smegmatis for additional insight in mycobacteria. Methodology/Principal Findings Using in silico analysis we identified in M. tuberculosis genome the genes encoding two putative rhomboid proteins; Rv0110 (referred to as “rhomboid protease 1”) and Rv1337 (“rhomboid protease 2”). Genes encoding orthologs of these proteins are widely represented in all mycobacterial species. When transformed into P. stuartii null-rhomboid mutant (?aarA), genes encoding mycobacterial orthologs of “rhomboid protease 2” fully restored AarA activity (AarA is the rhomboid protein of P. stuartii). However, most genes encoding mycobacterial “rhomboid protease 1” orthologs did not. Furthermore, upon gene deletion in M. smegmatis, the ?MSMEG_4904 single mutant (which lost the gene encoding MSMEG_4904, orthologous to Rv1337, “rhomboid protease 2”) formed the least biofilms and was also more susceptible to ciprofloxacin and novobiocin, antimicrobials that inhibit DNA gyrase. However, the ?MSMEG_5036 single mutant (which lost the gene encoding MSMEG_5036, orthologous to Rv0110, “rhomboid protease 1”) was not as susceptible. Surprisingly, the double rhomboid mutant ?MSMEG_4904–?MSMEG_5036 (which lost genes encoding both homologs) was also not as susceptible suggesting compensatory effects following deletion of both rhomboid-encoding genes. Indeed, transforming the double mutant with a plasmid encoding MSMEG_5036 produced phenotypes of the ?MSMEG_4904 single mutant (i.e. susceptibility to ciprofloxacin and novobiocin). Conclusions/Significance Mycobacterial rhomboid-encoding genes exhibit differences in complementing aarA whereby it's only genes encoding “rhomboid protease 2” orthologs that fully restore AarA activity. Additionally, gene deletion data suggests inhibition of DNA gyrase by MSMEG_4904; however, the ameliorated effect in the double mutant suggests occurrence of compensatory mechanisms following deletion of genes encoding both rhomboids. PMID:23029216

Kateete, David Patrick; Katabazi, Fred Ashaba; Okeng, Alfred; Okee, Moses; Musinguzi, Conrad; Asiimwe, Benon Byamugisha; Kyobe, Samuel; Asiimwe, Jeniffer; Boom, W. Henry; Joloba, Moses Lutaakome

2012-01-01

116

EAAC1 Gene Deletion Increases Neuronal Death and Blood Brain Barrier Disruption after Transient Cerebral Ischemia in Female Mice  

PubMed Central

EAAC1 is important in modulating brain ischemic tolerance. Mice lacking EAAC1 exhibit increased susceptibility to neuronal oxidative stress in mice after transient cerebral ischemia. EAAC1 was first described as a glutamate transporter but later recognized to also function as a cysteine transporter in neurons. EAAC1-mediated transport of cysteine into neurons contributes to neuronal antioxidant function by providing cysteine substrates for glutathione synthesis. Here we evaluated the effects of EAAC1 gene deletion on hippocampal blood vessel disorganization after transient cerebral ischemia. EAAC1?/? female mice subjected to transient cerebral ischemia by common carotid artery occlusion for 30 min exhibited twice as much hippocampal neuronal death compared to wild-type female mice as well as increased reduction of neuronal glutathione, blood–brain barrier (BBB) disruption and vessel disorganization. Pre-treatment of N-acetyl cysteine, a membrane-permeant cysteine prodrug, increased basal glutathione levels in the EAAC1?/? female mice and reduced ischemic neuronal death, BBB disruption and vessel disorganization. These findings suggest that cysteine uptake by EAAC1 is important for neuronal antioxidant function under ischemic conditions. PMID:25350110

Choi, Bo Young; Kim, Jin Hee; Kim, Hyun Jung; Lee, Bo Eun; Kim, In Yeol; Sohn, Min; Suh, Sang Won

2014-01-01

117

Use of the Meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes  

PubMed Central

The search for new natural products is leading to the isolation of novel actinomycete species, many of which will ultimately require genetic analysis. Some of these isolates will likely exhibit low intrinsic frequencies of homologous recombination and fail to sporulate under laboratory conditions, exacerbating the construction of targeted gene deletions and replacements in genetically uncharacterised strains. To facilitate the genetic manipulation of such species, we have developed an efficient method to generate gene or gene cluster deletions in actinomycetes by homologous recombination that does not introduce any other changes to the targeted organism's genome. We have synthesised a codon optimised I-SceI gene for expression in actinomycetes that results in the production of the yeast I-SceI homing endonuclease which produces double strand breaks at a unique introduced 18 base pair recognition sequence. Only those genomes that undergo homologous recombination survive, providing a powerful selection for recombinants, approximately half of which possess the desired mutant genotype. To demonstrate the efficacy and efficiency of the system, we deleted part of the gene cluster for the red-pigmented undecylprodiginine complex of compounds in Streptomyces coelicolor M1141. We believe that the system we have developed will be broadly applicable across a wide range of actinomycetes. PMID:25403842

Fernández-Martínez, Lorena T.; Bibb, Mervyn J.

2014-01-01

118

Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes.  

PubMed

The search for new natural products is leading to the isolation of novel actinomycete species, many of which will ultimately require genetic analysis. Some of these isolates will likely exhibit low intrinsic frequencies of homologous recombination and fail to sporulate under laboratory conditions, exacerbating the construction of targeted gene deletions and replacements in genetically uncharacterised strains. To facilitate the genetic manipulation of such species, we have developed an efficient method to generate gene or gene cluster deletions in actinomycetes by homologous recombination that does not introduce any other changes to the targeted organism's genome. We have synthesised a codon optimised I-SceI gene for expression in actinomycetes that results in the production of the yeast I-SceI homing endonuclease which produces double strand breaks at a unique introduced 18 base pair recognition sequence. Only those genomes that undergo homologous recombination survive, providing a powerful selection for recombinants, approximately half of which possess the desired mutant genotype. To demonstrate the efficacy and efficiency of the system, we deleted part of the gene cluster for the red-pigmented undecylprodiginine complex of compounds in Streptomyces coelicolor M1141. We believe that the system we have developed will be broadly applicable across a wide range of actinomycetes. PMID:25403842

Fernández-Martínez, Lorena T; Bibb, Mervyn J

2014-01-01

119

Impaired defense mechanism against inflammation, hyperalgesia, and airway hyperreactivity in somatostatin 4 receptor gene-deleted mice.  

PubMed

We have shown that somatostatin released from activated capsaicin-sensitive nociceptive nerve endings during inflammatory processes elicits systemic anti-inflammatory and analgesic effects. With the help of somatostatin receptor subtype 4 gene-deleted mice (sst(4)(-/-)), we provide here several lines of evidence that this receptor has a protective role in a variety of inflammatory disease models; several symptoms are more severe in the sst(4) knockout animals than in their wild-type counterparts. Acute carrageenan-induced paw edema and mechanical hyperalgesia, inflammatory pain in the early phase of adjuvant-evoked chronic arthritis, and oxazolone-induced delayed-type hypersensitivity reaction in the skin are much greater in mice lacking the sst(4) receptor. Airway inflammation and consequent bronchial hyperreactivity elicited by intranasal lipopolysaccharide administration are also markedly enhanced in sst(4) knockouts, including increased perivascular/peribronchial edema, neutrophil/macrophage infiltration, mucus-producing goblet cell hyperplasia, myeloperoxidase activity, and IL-1beta, TNF-alpha, and IFN-gamma expression in the inflamed lung. It is concluded that during these inflammatory conditions the released somatostatin has pronounced counterregulatory effects through sst(4) receptor activation. Thus, this receptor is a promising novel target for developing anti-inflammatory, analgesic, and anti-asthmatic drugs. PMID:19622729

Helyes, Zsuzsanna; Pintér, Erika; Sándor, Katalin; Elekes, Krisztián; Bánvölgyi, Agnes; Keszthelyi, Dániel; Szoke, Eva; Tóth, Dániel M; Sándor, Zoltán; Kereskai, László; Pozsgai, Gábor; Allen, Jeremy P; Emson, Piers C; Markovics, Adrienn; Szolcsányi, János

2009-08-01

120

Rapid Detection of Haptoglobin Gene Deletion in Alkaline-Denatured Blood by Loop-Mediated Isothermal Amplification Reaction  

PubMed Central

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin antibodies. Being homozygous for the haptoglobin gene deletion allele (HPdel) is the only known cause of congenital anhaptoglobinemia, and detection of HPdel before transfusion is important to prevent anaphylactic shock. In this study, we developed a loop-mediated isothermal amplification (LAMP)-based screening for HPdel. Optimal primer sets and temperature for LAMP were selected for HPdel and the 5? region of the HP using genomic DNA as a template. Then, the effects of diluent and boiling on LAMP amplification were examined using whole blood as a template. Blood samples diluted 1:100 with 50 mmol/L NaOH without boiling gave optimal results as well as those diluted 1:2 with water followed by boiling. The results from 100 blood samples were fully concordant with those obtained by real-time PCR methods. Detection of the HPdel allele by LAMP using alkaline-denatured blood samples is rapid, simple, accurate, and cost effective, and is readily applicable in various clinical settings because this method requires only basic instruments. In addition, the simple preparation of blood samples using NaOH saves time and effort for various genetic tests. PMID:21497293

Soejima, Mikiko; Egashira, Kouichi; Kawano, Hiroyuki; Kawaguchi, Atsushi; Sagawa, Kimitaka; Koda, Yoshiro

2011-01-01

121

A de novo complete BRCA1 gene deletion identified in a Spanish woman with early bilateral breast cancer  

PubMed Central

Background Germline mutations in either of the two tumor-suppressor genes, BRCA1 and BRCA2, account for a significant proportion of hereditary breast and ovarian cancer cases. Most of these mutations consist of deletions, insertions, nonsense mutations, and splice variants, however an increasing number of large genomic rearrangements have been identified in these genes. Methods We analysed BRCA1 and BRCA2 genes by direct sequencing and MLPA. We confirmed the results by an alternative MLPA kit and characterized the BRCA1 deletion by Array CGH. Results We describe the first case of a patient with no strong family history of the disease who developed early-onset bilateral breast cancer with a de novo complete BRCA1 gene deletion in the germinal line. The detected deletion started from the region surrounding the VAT1 locus to the beginning of NBR1 gene, including the RND2, ?BRCA1, BRCA1 and NBR2 complete genes. Conclusion This finding supports the large genomic rearrangement screening of BRCA genes in young breast cancer patients without family history, as well as in hereditary breast and ovarian cancer families previously tested negative for other variations. PMID:21989022

2011-01-01

122

Effects of Gene Deletion of the Tissue Inhibitor of the Matrix Metalloproteinase-type 1 (TIMP-1) on Left Ventricular Geometry and Function in Mice  

Microsoft Academic Search

L. Roten, S. Nemoto, J. Simsic, M. L. Coker, V. Rao, S. Baicu, G. Defreyte, P. J. Soloway, M. R. Zile and F. G. Spinale. Effects of Gene Deletion of the Tissue Inhibitor of the Matrix Metalloproteinase-type 1 (TIMP-1) on Left Ventricular Geometry and Function in Mice. Journal of Molecular and Cellular Cardiology (2000) 32, 109–120. Alterations in the expression

Lisa Roten; Shintaro Nemoto; Janet Simsic; Mytsi L Coker; Vijay Rao; Simona Baicu; Gilberto Defreyte; Paul J Soloway; Michael R Zile; Francis G Spinale

2000-01-01

123

Activation of the Epstein-Barr virus DNA polymerase promoter by the BRLF1 immediate-early protein is mediated through USF and E2F.  

PubMed Central

The Epstein-Barr virus (EBV) DNA polymerase (pol) is essential for the replication of viral genomes during productive EBV infection. We have previously reported that the EBV DNA pol promoter, which is TATA-less and constitutively inactive, is activated by a genomic clone expressing both immediate-early viral transactivators, BZLF1Z and BRLF1 (R), in EBV-infected lymphoid cells. Here we demonstrate that R alone is sufficient to activate the pol promoter in EBV-negative B cells. Unlike other early promoters to which the R protein binds directly, its effect on the pol promoter does not appear to involve a direct DNA-binding mechanism. Instead, we found that two cellular transcription factors, an upstream stimulatory factor USF, and a member of the E2F family of proteins, bind directly to the pol promoter at positions -795 to -786 and -186 to -170, respectively, regions previously identified as important for activation of the pol promoter. These two sites contribute to or are essential for transactivation of the pol promoter by R in EBV-noninfected B cells. These data suggest that the R immediate-early protein may activate a key early EBV promoter (pol) through both USF and E2F. PMID:8642684

Liu, C; Sista, N D; Pagano, J S

1996-01-01

124

The promoter of the white spot syndrome virus immediate-early gene WSSV108 is activated by the cellular KLF transcription factor.  

PubMed

A series of deletion and mutation assays of the white spot syndrome virus (WSSV) immediate-early gene WSSV108 promoter showed that a Krüppel-like factor (KLF) binding site located from -504 to -495 (relative to the transcription start site) is important for the overall level of WSSV108 promoter activity. Electrophoretic mobility shift assays further showed that overexpressed recombinant Penaeus monodon KLF (rPmKLF) formed a specific protein-DNA complex with the (32)P-labeled KLF binding site of the WSSV108 promoter, and that higher levels of Litopenaeus vannamei KLF (LvKLF) were expressed in WSSV-infected shrimp. A transactivation assay indicated that the WSSV108 promoter was strongly activated by rPmKLF in a dose-dependent manner. Lastly, we found that specific silencing of LvKLF expression in vivo by dsRNA injection dramatically reduced both WSSV108 expression and WSSV replication. We conclude that shrimp KLF is important for WSSV genome replication and gene expression, and that it binds to the WSSV108 promoter to enhance the expression of this immediate-early gene. PMID:25445906

Liu, Wang-Jing; Lo, Chu-Fang; Kou, Guang-Hsiung; Leu, Jiann-Horng; Lai, Ying-Jang; Chang, Li-Kwan; Chang, Yun-Shiang

2015-03-01

125

Na+ dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies  

PubMed Central

The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na+ dependent Cl?/HCO3? exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na+:HCO3? cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na+:HCO3? cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na+/H+ exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed. PMID:24155723

Christensen, Henriette L.; Nguyen, An T.; Pedersen, Fredrik D.; Damkier, Helle H.

2013-01-01

126

Immediate-early gene transcriptional activation in hippocampus CA1 and CA3 does not accurately reflect rapid, pattern completion-based retrieval of context memory.  

PubMed

No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual representation. Despite differences in behavior, we did not find any difference in CA1 or CA3 IEG activity associated with this rapid recall phase when comparing context preexposed and non-pre-exposed groups. These findings indicate that IEG activation in CA1 and CA3 is not an accurate readout of the neural activity associated with hippocampus-dependent rapid memory retrieval. PMID:25512571

Pevzner, Aleksandr; Guzowski, John F

2014-01-01

127

The Epstein-Barr virus immediate-early promoter BRLF1 can be activated by the cellular Sp1 transcription factor.  

PubMed Central

Disruption of viral latency in Epstein-Barr virus-infected cells is mediated through the activation of the BZLF1 (Z) immediate-early gene product. The Z protein can be derived from either of two promoters: the BZLF1 promoter, which directs transcription of a 1.0-kb mRNA encoding the Z gene product alone, or the upstream BRLF1 promoter, which directs transcription of a 2.8-kb bicistronic mRNA encoding the BRLF1 and BZLF1 immediate-early proteins. In this study we have examined the regulation of the BRLF1 promoter by viral and cellular factors. We found that the BRLF1 promoter is autoregulated by the BRLF1 transactivator through a nonbinding mechanism. We show that the BRLF1 (but not the BZLF1) promoter is highly responsive to the Sp1 transcription factor. Sp1 activation of the BRLF1 promoter is mediated through a consensus Sp1-binding site located from -39 to -44 (relative to the mRNA start site). We demonstrate that the BRLF1 promoter has high constitutive activity in C-33 cells (an epithelial cell line) and that the proximal Sp1-binding site is required for this activity. Despite the ubiquitous presence of Sp1 in many cell types, we found that the BRLF1 promoter has essentially no activity in lymphoid cell lines, suggesting that factors other than Sp1 may negatively regulate the BRLF1 promoter in these cells. Our findings demonstrate that the two potential promoters directing BZLF1 transcription are differentially regulated and that Sp1 can activate the BRLF1 promoter but not the BZLF1 promoter. Images PMID:1331521

Zalani, S; Holley-Guthrie, E A; Gutsch, D E; Kenney, S C

1992-01-01

128

Intranasal application of vasopressin fails to elicit changes in brain immediate early gene expression, neural activity and behavioral performance of rats  

PubMed Central

Intranasal administration has been widely used to investigate effects of the neuropeptides vasopressin and oxytocin on human behaviors and neurological disorders, but exactly what happens when these neuropeptides are administered intranasally is far from clear. In particular, it is not clear whether a physiological significant amount of peptide enters the brain to account for the observed effects. Here, we investigated whether intranasal administration of vasopressin and oxytocin to rats induces expression of the immediate-early gene product Fos in brain areas that are sensitive to centrally administered peptide, whether it alters neuronal activity in the way that centrally administered peptide does, and whether it affects behavior in ways expected from studies of centrally administered peptide. We found that, whereas intracerebroventricular (icv) injection of very low doses of vasopressin or oxytocin increased Fos expression in several distinct brain regions, intranasal administration of large doses of the peptides had no significant effect. In contrast to the effects of vasopressin applied topically to the main olfactory bulb, we saw no changes in the electrical activity of olfactory bulb mitral cells after intranasal vasopressin administration. In addition, vasopressin given intranasally had no significant effects on social recognition or short-term recognition memory. Finally, intranasal infusions of vasopressin had no significant effects on the parameters monitored on the elevated plus maze, a rodent model of anxiety. Our data in rats suggest that, after intranasal administration, significant amounts of vasopressin and oxytocin do not reach areas in the brain at levels sufficient to change immediate early gene expression, neural activity or behavior in the ways described for central administration of the peptides. PMID:23656518

Ludwig, Mike; Tobin, Vicky A.; Callahan, Michael F.; Papadaki, Eirini; Becker, Axel; Engelmann, Mario; Leng, Gareth

2013-01-01

129

Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger  

SciTech Connect

ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and ?alg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

Dai, Ziyu; Aryal, Uma K.; Shukla, Anil K.; Qian, Weijun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

2013-09-25

130

Unmarked gene deletion mutagenesis of kstD, encoding 3-ketosteroid Delta1-dehydrogenase, in Rhodococcus erythropolis SQ1 using sacB as counter-selectable marker.  

PubMed

This paper reports the first method for the construction of unmarked gene deletion mutants in the genus Rhodococcus. Unmarked deletion of the kstD gene, encoding 3-ketosteroid Delta1-dehydrogenase (KSTD1) in Rhodococcus erythropolis SQ1, was achieved using the sacB counter-selection system. Conjugative mobilization of the mutagenic plasmid from Escherichia coli S17-1 to R. erythropolis strain SQ1 was used to avoid its random genomic integration. The kstD gene deletion mutant, designated strain RG1, still possessed about 10% of the KSTD enzyme activity of wild-type and was not affected in its ability to grow on the steroid substrates 4-androstene-3,17-dione (AD) and 9alpha-hydroxy-4-androstene-3,17-dione (9OHAD). Biochemical evidence subsequently was obtained for the presence of a second KSTD enzyme (KSTD2) in R. erythropolis SQ1. UV mutants of strain RG1 unable to grow on AD were isolated. One of these mutants, strain RG1-UV29, had lost all KSTD enzyme activity and was also unable to grow on 9OHAD. It stoichiometrically converted AD into 9OHAD in concentrations as high as 20 g x l(-1). The two KSTD enzymes apparently both function in AD and 9OHAD catabolism. These isoenzymes have been inactivated in strain RG1 (KSTD1 negative) and strain RG1-UV29 (KSTD1 and KSTD2 negative), respectively. PMID:11750802

van der Geize, R; Hessels, G I; van Gerwen, R; van der Meijden, P; Dijkhuizen, L

2001-12-18

131

CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication  

PubMed Central

ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression. PMID:24741094

Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

2014-01-01

132

Human cytomegalovirus-specific CD4(+) T-cell clones recognize cross-reactive peptides from the immediate early 1 protein.  

PubMed

Human cytomegalovirus (HCMV) is a beta-herpes virus that persists in a latent state in immunocompetent individuals. Both CD4(+) and CD8(+) T lymphocytes have been reported to be present at a high frequency in HCMV-seropositive individuals and are involved in the control of infection. How such frequencies are maintained is not completely understood. We have observed that the canonical HLA-DR8 epitope of the immediate early 1 protein (IE1) contained in the IE1 (156--175) sequence shares homologies with an IE1 sequence contained in part in the previously reported HLA-DR3 epitope, IE1 (91-110). We thus wondered whether such homology in a single protein would translate into recognition of the IE1 homolog sequence by HLA-DR8-restricted CD4(+) cells in addition to the canonical epitope. We found that established HLA-DR8-restricted T cell clones are also able to cross-recognize the IE1 (91--110) peptide, as well as a shorter 14-mer, IE1 (91--104). Moreover, the homolog peptide IE1 (91-110) was able to generate, from a seropositive blood donor, new IE1-specific, HLA-DR8-restricted CD4(+) T cell clones that were also cross-reactive. Those findings may provide clues to the formation and regulation of the T-cell repertoire and memory. PMID:16035951

Le Roy, Emmanuelle; Davignon, Jean-Luc

2005-01-01

133

Effects of verapamil on the immediate-early gene expression of bone marrow mesenchymal stem cells stimulated by mechanical strain in vitro  

PubMed Central

Background To study the effects of verapamil on the immediate-early genes (IEGs) expression of bone marrow mesenchymal stem cells (MSCs) stimulated by cyclic mechanical strain, in order to deduce the role of calcium ion channel in the cell signaling responses of MSCs to mechanical strain. Material/Methods MSCs were isolated and cultured, and the passage of 3–6 MSCs were stimulated by mechanical strain and pretreated with or without verapamil. After that, flow cytometry was used to measure the fluorescence intensity of intracellular Ca2+ immediately. The expression of early-response genes/proteins (c-fos, c-jun and c-myc) were examined by RT-PCR, immunohistochemistry and Western blot. Results Intracellular Ca2+ concentration of MSCs significantly changed when stimulated by cyclic strain, and the expression of c-fos, c-jun and c-myc remarkably increased in both mRNA and protein levels, while verapamil pre-treatment partially inhibited these effects (P<0.01). Conclusions The changes of the intracellular calcium concentration of MSCs induced by mechanical strain, dependent on the regulation of calcium channel activation, might play a role in the early response of MSCs to cyclic strain. PMID:23435320

Li, Runguang; Wei, Mingfa; Shao, Jingfan

2013-01-01

134

Mitogen and Stress Activated Kinases Act Co-operatively with CREB during the Induction of Human Cytomegalovirus Immediate-Early Gene Expression from Latency  

PubMed Central

The devastating clinical consequences associated with human cytomegalovirus (HCMV) infection and reactivation underscores the importance of understanding triggers of HCMV reactivation in dendritic cells (DC). Here we show that ERK-mediated reactivation is dependent on the mitogen and stress activated kinase (MSK) family. Furthermore, this MSK mediated response is dependent on CREB binding to the viral major immediate early promoter (MIEP). Specifically, CREB binding to the MIEP provides the target for MSK recruitment. Importantly, MSK mediated phosphorylation of histone H3 is required to promote histone de-methylation and the subsequent exit of HCMV from latency. Taken together, these data suggest that CREB binding to the MIEP is necessary for the recruitment of the kinase activity of MSKs to initiate the chromatin remodelling at the MIEP required for reactivation. Thus the importance of CREB during HCMV reactivation is to promote chromatin modifications conducive for viral gene expression as well as acting as a classical transcription factor. Clearly, specific inhibition of this interaction between CREB and MSKs could provide a strategy for therapeutic intervention. PMID:24945302

Kew, Verity G.; Yuan, Jinxiang; Meier, Jeffery; Reeves, Matthew B.

2014-01-01

135

Fibroblasts from Long-Lived Mutant Mice Show Diminished ERK1/2 Phosphorylation But Exaggerated Induction of Immediate Early Genes  

PubMed Central

Skin-derived fibroblasts from long-lived mutant mice, including the Snell dwarf mice and mice defective in growth hormone receptor (“GHRKO”), are resistant to death induced by oxidative stresses or by UV light, but the molecular mechanism for their stress resistance is unknown. The present study showed that phosphorylation of the stress-activated protein kinases ERK1/2 induced by peroxide, cadmium, or paraquat was attenuated in cells from these mice. Induction of ERK phosphorylation by UV light was not altered in the Snell dwarf cells, and neither JNK nor p38 kinases showed increased phosphorylation in response to any of the stresses tested. Surprisingly, stress-induced elevation of mRNA for certain Immediate Early Genes (egr-1 and fos) was higher in Snell-derived cells than in control cells, despite the evidence of lower ERK phosphorylation. Thus cells from Snell dwarf mice differ from controls in two ways: (a) lower induction of ERK1/2 phosphorylation, and (b) increased expression of some ERK-dependent IEGs. These alterations in kinase pathways may contribute to the resistance of these cells to lethal injury. PMID:19786089

Sun, Liou Y.; Steinbaugh, Michael J.; Masternak, Michal M.; Bartke, Andrzej; Miller, Richard A.

2009-01-01

136

Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)  

NASA Astrophysics Data System (ADS)

Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

Sayaka, Shimomura-Umemura; Ijiri, Kenichi

2006-01-01

137

Expression of immediate early genes in the hippocampal formation of the black-capped chickadee (Poecile atricapillus) during a food-hoarding task.  

PubMed

Black-capped chickadees store food in many different locations in their home range and are able to accurately remember these locations. We measured the number of cells immunopositive for three different Immediate Early Gene products (Fra-1, c-Fos and ZENK) to map neuronal activity in the chickadee Hippocampal Formation (HF) during food storing and retrieval. Fra-1-like immunoreactivity is downregulated in the dorsal HF of both storing and retrieving chickadees compared to controls. In retrieving birds, the number of Fos-like immunoreactive neurons relates to the number of items remembered, while the number of ZENK-like immunoreactive neurons in the HF may be related to the accuracy of cache retrieval. These results imply that the brain might process complex information by recruiting more neurons into the network of active neurons. Thus, our results could help explain why food-hoarding birds have more HF neurons than non-hoarders, and why this number increases in autumn when large numbers of food items are cached. PMID:10996045

Smulders, T V; DeVoogd, T J

2000-09-01

138

Differential effects of vocalization type, singer and listener on ZENK immediate early gene response in black-capped chickadees (Poecile atricapillus).  

PubMed

Here we examined immediate early gene (ZENK) induction to vocalizations in the ascending auditory pathway of black-capped chickadees (Poecile atricapillus) to assess the impact that the sex of the producer and perceiver has on ZENK induction. We manipulated the playback by both the vocal type (song/call) and sex of producer (male/female), and then presented these stimuli classes to either male or female black-capped chickadees. Neural response to the stimulus was quantified by the amount of protein of the IEG ZENK (also known as zif-268, egr-1, ngf-Ia and krox-24) in the caudal medial nidopallium (NCM) and caudomedial mesopallium (CMM). Overall, there was more ZENK induction in CMM and the dorsal parts of the caudal medial nidopallium (NCMd) than in the ventral parts of the caudal medial nidopallium (NCMv) and males had more ZENK induction than females. CMM had the most complex responding of ZENK induction to stimuli such that vocalization type, sex of producer, and sex of perceiver all affected ZENK induction. The silence controls had the least ZENK induction compared to any other group. PMID:18077008

Avey, M T; Kanyo, R A; Irwin, E L; Sturdy, C B

2008-03-17

139

ATM regulates NF-?B-dependent immediate-early genes via RelA Ser 276 phosphorylation coupled to CDK9 promoter recruitment  

PubMed Central

Ataxia-telangiectasia mutated (ATM), a member of the phosphatidylinositol 3 kinase-like kinase family, is a master regulator of the double strand DNA break-repair pathway after genotoxic stress. Here, we found ATM serves as an essential regulator of TNF-induced NF-kB pathway. We observed that TNF exposure of cells rapidly induced DNA double strand breaks and activates ATM. TNF-induced ROS promote nuclear IKK? association with ubiquitin and its complex formation with ATM for nuclear export. Activated cytoplasmic ATM is involved in the selective recruitment of the E3-ubiquitin ligase ?-TrCP to phospho-I?B? proteosomal degradation. Importantly, ATM binds and activates the catalytic subunit of protein kinase A (PKAc), ribosmal S6 kinase that controls RelA Ser 276 phosphorylation. In ATM knockdown cells, TNF-induced RelA Ser 276 phosphorylation is significantly decreased. We further observed decreased binding and recruitment of the transcriptional elongation complex containing cyclin dependent kinase-9 (CDK9; a kinase necessary for triggering transcriptional elongation) to promoters of NF-?B-dependent immediate-early cytokine genes, in ATM knockdown cells. We conclude that ATM is a nuclear damage-response signal modulator of TNF-induced NF-?B activation that plays a key scaffolding role in I?B? degradation and RelA Ser 276 phosphorylation. Our study provides a mechanistic explanation of decreased innate immune response associated with A-T mutation. PMID:24957606

Fang, Ling; Choudhary, Sanjeev; Zhao, Yingxin; Edeh, Chukwudi B; Yang, Chunying; Boldogh, Istvan; Brasier, Allan R.

2014-01-01

140

Co-inheritance of compound heterozygous Hb Constant Spring and a single -alpha(3.7) gene deletion with heterozygous deltabeta thalassaemia: a diagnostic challenge.  

PubMed

Haemoglobin Constant Spring (Hb CS) mutation and single gene deletions are common underlying genetic abnormalities for alpha thalassaemias. Co-inheritance of deletional and non-deletional alpha (alpha) thalassaemias may result in various thalassaemia syndromes. Concomitant co-inheritance with beta (beta) and delta (delta) gene abnormalities would result in improved clinical phenotype. We report here a 33-year-old male patient who was admitted with dengue haemorrhagic fever, with a background history of Grave's disease, incidentally noted to have mild hypochromic microcytic red cell indices. Physical examination revealed no thalassaemic features or hepatosplenomegaly. His full blood picture showed hypochromic microcytic red cells with normal haemoglobin (Hb) level. Quantitation of Hb using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE) revealed raised Hb F, normal Hb A2 and Hb A levels. There was also small peak of Hb CS noted in CE. H inclusions was negative. Kleihauer test was positive with heterocellular distribution of Hb F among the red cells. DNA analysis for alpha globin gene mutations showed a single -alpha(-3.7) deletion and Hb CS mutation. These findings were suggestive of compound heterozygosity of Hb CS and a single -alpha(-3.7) deletion with a concomitant heterozygous deltabeta thalassaemia. Co-inheritance of Hb CS and a single -alpha(-3.7) deletion is expected to result at the very least in a clinical phenotype similar to that of two alpha genes deletion. However we demonstrate here a phenotypic modification of alpha thalassemia presumptively as a result of co-inheritance with deltabeta chain abnormality as suggested by the high Hb F level. PMID:22870600

Azma, Raja Zahratul; Othman, Ainoon; Azman, Norazlina; Alauddin, Hafiza; Ithnin, Azlin; Yusof, Nurasyikin; Razak, Noor Farisah; Sardi, Nor Hidayati; Hussin, Noor Hamidah

2012-06-01

141

Independent effects of song quality and experience with photostimulation on expression of the immediate, early gene ZENK (EGR-1) in the auditory telencephalon of female European starlings  

PubMed Central

Age influences behavioral decisions such as reproductive timing and effort. In photoperiodic species, such age effects may be mediated, in part, by the individual's age-accrued experience with photostimulation. In female European starlings (Sturnus vulgaris) that do not differ in age, experimental manipulation of photostimulation experience (photoexperience) affects hypothalamic, pituitary, and gonadal activity associated with reproductive development. Does photoexperience also affect activity in forebrain regions involved in processing a social cue, the song of males, which can influence mate choice and reproductive timing in females? Female starlings prefer long songs over short songs in a mate-choice context, and, like that in other songbird species, their auditory telencephalon plays a major role in processing these signals. We manipulated the photoexperience of female starlings, photostimulated them, briefly exposed them to either long or short songs, and quantified the expression of the immediate-early gene ZENK (EGR-1) in the caudomedial nidopallium as a measure of activity in the auditory telencephalon. Using an information theoretic approach, we found higher ZENK immunoreactivity in females with prior photostimulation experience than in females experiencing photostimulation for the first time. We also found that long songs elicited greater ZENK immunoreactivity than short song did. We did not find an effect of the interaction between photoexperience and song length, suggesting that photoexperience does not affect forebrain ZENK-responsiveness to song quality. Thus, photoexperience affects activity in an area of the forebrain that processes social signals, an effect that we hypothesize mediates, in part, the effects of age on reproductive decisions in photoperiodic songbirds. PMID:19224564

Sockman, Keith W.; Ball, Gregory F.

2010-01-01

142

Differential Role of Sp100 Isoforms in Interferon-Mediated Repression of Herpes Simplex Virus Type 1 Immediate-Early Protein Expression  

PubMed Central

Nuclear domains called ND10 or PML nuclear bodies contain interferon (IFN)-upregulated proteins like PML and Sp100. Paradoxically, herpes simplex virus 1 (HSV-1) begins its transcriptional cascade at aggregates of ND10-associated proteins, which in turn are destroyed by the HSV-1 immediate-early protein ICP0. While PML is essential in the formation of ND10, the function of Sp100 in the cells' defense against viral infection is unknown. In this study we investigated the potential antiviral effect of IFN-?-induced Sp100. We found that IFN-? treatment leads to a differential accumulation of four Sp100 isoforms in different cell lines. Using an HEK293 cell line derivative, 293-S, producing no detectable amounts of Sp100 even after IFN exposure, we analyzed individual Sp100 isoforms for their effect on HSV-1 infection. Sp100 isoforms B, C, and HMG, but not Sp100A, suppressed ICP0 and ICP4 early after infection. Isoforms B, C, and HMG suppressed expression from the ICP0 promoter in transient transfection, whereas Sp100A enhanced expression. Moreover, Sp100A localized in ND10, whereas the repressive isoforms were either dispersed within the nucleus or, at unphysiologically higher expression levels, formed new aggregates. The repressive activity was dependent on an intact SAND domain, since Sp100B bearing a W655Q mutation in the SAND domain lost this repressive activity and accumulated in ND10. Using RNA interference to knock down the repressive Sp100 isoforms B, C, and HMG, we find that they are an essential part of the IFN-?-mediated suppression of ICP0 expression. These data suggest that repression by the Sp100 isoforms B, C, and HMG takes place outside of ND10 and raise the possibility that viral genomes at Sp100A accumulations are more likely to start their transcription program because of a more permissive local environment. PMID:16873258

Negorev, Dmitri G.; Vladimirova, Olga V.; Ivanov, Alexey; Rauscher, Frank; Maul, Gerd G.

2006-01-01

143

Independent effects of song quality and experience with photostimulation on expression of the immediate, early gene ZENK (EGR-1) in the auditory telencephalon of female European starlings.  

PubMed

Age influences behavioral decisions such as reproductive timing and effort. In photoperiodic species, such age effects may be mediated, in part, by the individual's age-accrued experience with photostimulation. In female European starlings (Sturnus vulgaris) that do not differ in age, experimental manipulation of photostimulation experience (photoexperience) affects hypothalamic, pituitary, and gonadal activity associated with reproductive development. Does photoexperience also affect activity in forebrain regions involved in processing a social cue, the song of males, which can influence mate choice and reproductive timing in females? Female starlings prefer long songs over short songs in a mate-choice context, and, like that in other songbird species, their auditory telencephalon plays a major role in processing these signals. We manipulated the photoexperience of female starlings, photostimulated them, briefly exposed them to either long or short songs, and quantified the expression of the immediate-early gene ZENK (EGR-1) in the caudomedial nidopallium as a measure of activity in the auditory telencephalon. Using an information theoretic approach, we found higher ZENK immunoreactivity in females with prior photostimulation experience than in females experiencing photostimulation for the first time. We also found that long songs elicited greater ZENK immunoreactivity than short songs did. We did not find an effect of the interaction between photoexperience and song length, suggesting that photoexperience does not affect forebrain ZENK-responsiveness to song quality. Thus, photoexperience affects activity in an area of the forebrain that processes social signals, an effect that we hypothesize mediates, in part, the effects of age on reproductive decisions in photoperiodic songbirds. PMID:19224564

Sockman, Keith W; Ball, Gregory F

2009-05-01

144

The Murine Gammaherpesvirus Immediate-Early Rta Synergizes with IRF4, Targeting Expression of the Viral M1 Superantigen to Plasma Cells  

PubMed Central

MHV68 is a murine gammaherpesvirus that infects laboratory mice and thus provides a tractable small animal model for characterizing critical aspects of gammaherpesvirus pathogenesis. Having evolved with their natural host, herpesviruses encode numerous gene products that are involved in modulating host immune responses to facilitate the establishment and maintenance of lifelong chronic infection. One such protein, MHV68 M1, is a secreted protein that has no known homologs, but has been shown to play a critical role in controlling virus reactivation from latently infected macrophages. We have previous demonstrated that M1 drives the activation and expansion of V?4+ CD8+ T cells, which are thought to be involved in controlling MHV68 reactivation through the secretion of interferon gamma. The mechanism of action and regulation of M1 expression are poorly understood. To gain insights into the function of M1, we set out to evaluate the site of expression and transcriptional regulation of the M1 gene. Here, using a recombinant virus expressing a fluorescent protein driven by the M1 gene promoter, we identify plasma cells as the major cell type expressing M1 at the peak of infection in the spleen. In addition, we show that M1 gene transcription is regulated by both the essential viral immediate-early transcriptional activator Rta and cellular interferon regulatory factor 4 (IRF4), which together potently synergize to drive M1 gene expression. Finally, we show that IRF4, a cellular transcription factor essential for plasma cell differentiation, can directly interact with Rta. The latter observation raises the possibility that the interaction of Rta and IRF4 may be involved in regulating a number of viral and cellular genes during MHV68 reactivation linked to plasma cell differentiation. PMID:25101696

O'Flaherty, Brigid M.; Soni, Tanushree; Wakeman, Brian S.; Speck, Samuel H.

2014-01-01

145

The herpes simplex virus immediate-early protein ICP0 affects transcription from the viral genome and infected-cell survival in the absence of ICP4 and ICP27.  

PubMed Central

ICP4, ICP0, and ICP27 are the immediate-early (IE) regulatory proteins of herpes simplex virus that have the greatest effect on viral gene expression and growth. Comparative analysis of viral mutants defective in various subsets of these IE genes should help elucidate how these proteins affect cellular and viral processes. This study focuses on the mutant d97, which is defective for the genes encoding ICP4, ICP0, and ICP27 and expresses the bacterial beta-galactosidase (beta-gal) gene from the ICP0 promoter. Together with the d92 virus (ICP4- ICP27-) and the ICP0-complementing cell line L7, d97 provided a unique opportunity to evaluate ICP0 function in the absence of the regulatory activities specified by ICP4 and ICP27. The pattern of protein synthesis in d97-infected cells was unique relative to other IE gene mutants in that it was similar to that seen in the absence of prior viral protein synthesis, possibly approximating the effect of cellular factors and virion components alone. Inactivation of ICP0 in the absence of ICP4 produced a significant decrease in the levels of the early mRNAs ICP6 and thymidine kinase (tk). There was also a marginal reduction in the levels of the IE ICP22 mRNA, and this was most notable at low multiplicity of infection (MOI). In d97-infected L7 cells, the levels of the viral mRNAs were mostly restored to those observed in infections with d92. Nuclear runoff transcription analysis demonstrated that the presence of ICP0 resulted in an increase in the transcription rates of the analyzed genes. The transcription rates of the early genes were dramatically reduced in the absence of ICP0. At low MOI, the transcription rates of ICP6 and tk were comparable to the rate of transcription of a cellular gene. Relevant to the potential use of d97 as a transfer vector, it was also determined that the absence of ICP0 reduced the cellular toxicity of the virus compared to that of d92. The beta-gal transgene expressed from an IE promoter was detected for up to 14 days postinfection; however, the level of beta-gal expression declined dramatically after 1 day postinfection. In the presence of ICP0, the level of expression of beta-gal was increased; however the infected monolayer was destroyed by 3 days postinfection. Therefore, deletion of ICP0 in the absence of ICP4 and ICP27 reduces toxicity and lowers the level of expression of genes from the viral genome. PMID:9151855

Samaniego, L A; Wu, N; DeLuca, N A

1997-01-01

146

The immediate-early gene product MAD3\\/EDG-3\\/I?B? is an endogenous modulator of fibroblast growth factor-1 (FGF1) dependent human endothelial cell growth  

Microsoft Academic Search

The tumor promoter phorbol 12-myristic 13-acetate inhibits the growth of human endothelial cells and induces the formation of capillary-like, tubular structures. We report the novel growth regulatory function of the immediate-early gene, edg-3, which is identical to the I?B?\\/MAD-3 gene. We employed phosphothioate oligonucleotides (PTO) directed against the translation initiation site of I?B? to inhibit its expression. The antisense I?B?

Timothy Hla; Ann B. Zimrin; Mark Evans; Karin Ballas; Thomas Maciag

1997-01-01

147

Mutational Analysis of Open Reading Frames 62 and 71, Encoding the Varicella-Zoster Virus Immediate-Early Transactivating Protein, IE62, and Effects on Replication In Vitro and in Skin Xenografts in the SCID-hu Mouse In Vivo  

Microsoft Academic Search

The varicella-zoster virus (VZV) genome has unique long (UL) and unique short (US) segments which are flanked by internal repeat (IR) and terminal repeat (TR) sequences. The immediate-early 62 (IE62) protein, encoded by open reading frame 62 (ORF62) and ORF71 in these repeats, is the major VZV transactivating protein. Mutational analyses were done with VZV cosmids generated from parent Oka

Bunji Sato; Hideki Ito; Stewart Hinchliffe; Marvin H. Sommer; Leigh Zerboni; Ann M. Arvin

2003-01-01

148

Potentially harmful advantage to athletes: a putative connection between UGT2B17 gene deletion polymorphism and renal disorders with prolonged use of anabolic androgenic steroids  

PubMed Central

Background and objective With prolonged use of anabolic androgenic steroids (AAS), occasional incidents of renal disorders have been observed. Independently, it has also been established that there are considerable inter-individual and inter-ethnic differences, in particular with reference to the uridine diphosphate-glucuronosyltransferase 2B17 (UGT2B17) gene, in metabolising these compounds. This report postulates the association of deletion polymorphism in the UGT2B17 gene with the occurrence of renal disorders on chronic exposure to AAS. Presentation of the hypothesis The major deactivation and elimination pathway of AASs is through glucuronide conjugation, chiefly catalyzed by the UGT2B17 enzyme, followed by excretion in urine. Excretion of steroids is affected in individuals with a deletion mutation in the UGT2B17 gene. We hypothesize that UGT2B17 deficient individuals are more vulnerable to developing renal disorders with prolonged use of AAS owing to increases in body mass index and possible direct toxic effects of steroids on the kidneys. Elevated serum levels of biologically active steroids due to inadequate elimination can lead to prolonged muscle build up. An increase in body mass index may cause renal injuries due to sustained elevated glomerular pressure and flow rate. Testing the hypothesis In the absence of controlled clinical trials in humans, observational studies can be carried out. Real time PCR with allelic discrimination should be employed to examine the prevalence of different UGT2B17 genotypes in patients with impaired renal function and AAS abuse. In individuals with the UGT2B17 deletion polymorphism, blood tests, biofluid analyses, urinalysis, and hair analyses following the administration of an anabolic steroid can be used to determine the fate of the substance once in the body. Implications of the hypothesis If the hypothesis is upheld, anabolic steroid users with a deletion mutation in the UGT2B17 gene may be exposed to an increased risk of developing renal disorders. In the current detecting - sanctioning anti-doping system, athletes motivated by the potential to evade detection owing to their unique genetic make-up could subject themselves to a serious health consequence. More research on AAS metabolism in the presence of UGT2B17 gene deletion is required. Benefit - harm evaluations in therapeutic use of anabolic steroids should also consider this potential link between UGT2B17 gene deletion polymorphism and renal disorders. PMID:20429943

2010-01-01

149

Temporal and anatomic patterns of immediate-early gene expression in the forebrain of C57BL/6 and DBA/2 mice after morphine administration.  

PubMed

Although morphine was previously reported to produce an instant induction of c-fos in the striatum, our recent studies have demonstrated that the expression of numerous immediate early genes (IEGs) is significantly elevated at delayed time-points (several hours) after morphine administration. To better dissect the time-course of opioid-produced IEG induction, we used in situ hybridization to examine the expression of the IEGs c-fos, zif268 and arc in the mouse forebrain at several time-points after acute morphine injection. To link drug-produced behavioral changes with the activity of specific neuronal complexes, this study was performed comparatively in the C57BL/6 and DBA/2 mouse strains, which differ markedly in their locomotor responses to opioids and opioid reward. Our study demonstrates that morphine produces two episodes of IEG induction, which are separate in time (30min vs. 4-6h) and which have different neuroanatomic distribution. At 30min, one or more IEGs were induced in circumscribed subregions of the dorsal striatum (dStr) and of the nucleus accumbens (NAc) shell, as well as in the lateral septum. The observed inter-strain differences in IEG expression at 30min support earlier proposals that activation of the dorsomedial striatum may mediate morphine-elicited locomotor stimulation (both effects were present only in the C57BL/6 strain). In contrast, NAc shell activation does not appear to be linked to morphine-elicited changes in locomotor behavior. The second IEG induction (of arc and of zif268) was more widespread, involving most of the dStr and the cortex. The second IEG induction peaked earlier in the DBA/2 mice than in the C57BL/6 mice (4h compared with 6h) and displayed no apparent relation to locomotor behavior. This delayed episode of IEG activation, which has largely been overlooked thus far, may contribute to the development of long-term effects of opioids such as tolerance, dependence and/or addiction. PMID:25290009

Zió?kowska, B; Gieryk, A; Solecki, W; Przew?ocki, R

2015-01-22

150

Association of GSTM1 and GSTT1 gene deletions with susceptibility to DNA damage in the pesticide-exposed workers of Punjab.  

PubMed

The main aim of this study was to evaluate genotoxic effects of pesticides in association with glutathione S-transferase (GST) polymorphism. To achieve this aim, DNA damage and the genotypes of the GSTM1 and GSTT1 genes were studied from blood lymphocytes of pesticide-exposed and unexposed (control) agricultural workers of the Punjab region of northwestern India. The blood samples were collected from 40 exposed and 27 unexposed subjects from the Kakrala and Sanour villages of Patiala district. DNA damage was evaluated by using an alkaline comet assay. The analysis of the comets was done through visual scoring and image analysis software (Tritek's CometScore). Damage Index (DI), Damage Frequency (DF) (calculated by visual scoring method), and % DNA in tail (measured by image analysis software) were considered for assessing DNA damage. The DNA extraction from blood cells was done using proteinase K and the phenol-chloroform method, and genotyping of GSTM1 and GSTT1 was done using multiplex PCR. It was found that all the pesticide-exposed subjects showed higher DI, DF, and % DNA in tail in comparison to the controls. The statistical comparison of DNA damage between the exposed group and unexposed group revealed highly significant differences (p < 0.05; Mann-Whitney U-test). In addition, the GSTT1 gene deletion and simultaneous deletions of GSTM1 and GSTT1 genes in increasing DNA damage were observed in the exposed group. PMID:20370484

Abhishek, S; Kaur, N; Kaur, S; Lata, M; Sharma, J K; Sharma, A

2010-01-01

151

Role of the CipA Scaffoldin Protein in Cellulose Solubilization, as Determined by Targeted Gene Deletion and Complementation in Clostridium thermocellum  

PubMed Central

The CipA scaffoldin protein plays a key role in the Clostridium thermocellum cellulosome. Previous studies have revealed that mutants deficient in binding or solubilizing cellulose also exhibit reduced expression of CipA. To confirm that CipA is, in fact, necessary for rapid solubilization of crystalline cellulose, the gene was deleted from the chromosome using targeted gene deletion technologies. The CipA deletion mutant exhibited a 100-fold reduction in cellulose solubilization rate, although it was eventually able to solubilize 80% of the 5 g/liter cellulose initially present. The deletion mutant was complemented by a copy of cipA expressed from a replicating plasmid. In this strain, Avicelase activity was restored, although the rate was 2-fold lower than that in the wild type and the duration of the lag phase was increased. The cipA coding sequence is located at the beginning of a gene cluster containing several other genes thought to be responsible for the structural organization of the cellulosome, including olpB, orf2p, and olpA. Tandem mass spectrometry revealed a 10-fold reduction in the expression of olpB, which may explain the lower growth rate. This deletion experiment adds further evidence that CipA plays a key role in cellulose solubilization by C. thermocellum, and it raises interesting questions about the differential roles of the anchor scaffoldin proteins OlpB, Orf2p, and SdbA. PMID:23204466

Olson, Daniel G.; Giannone, Richard J.; Hettich, Robert L.

2013-01-01

152

Single tube genotyping of CYP2A6 gene deletion based on copy number determination by quantitative real-time PCR.  

PubMed

The CYP2A6*4 allele, characterized as the whole deletion of this gene, is closely associated with nicotine dependence, cancer susceptibility, and drug responsiveness. It has long been a significant challenge for pharmacogenetics scientists to develop a reliable method to detect this molecular variant due to its high homology with its homologous genes CYP2A6 and CYP2A3 in the clinical setting. Here, we introduce a quantitative real-time PCR assay that specifically amplifies CYP2A6 by designing a specific set of primers and the probe, which effectively prevent the amplification of the CYP2A7 and CYP2A13 alleles. CYP2A6 gene copy numbers were normalized to albumin (ALB) which was co-amplified simultaneously in a single-tube duplex reaction and at a setting as the internal reference gene. The established assay was validated with a selection of previously genotyped DNA samples, which harbored none, one or two CYP2A6 gene copies. The results were in complete concordance with previously published data and no overlap between the three groups was observed. Further analysis of a cohort of 120 samples revealed high specificity and sensitivity of this assay as demonstrated by the agreement of determined gene copy numbers in all of the cases. In conclusion, this novel assay allows reliable and sensitive detection of the CYP2A6 gene deletion, which will be useful for pharmacogenetics studies and routine clinical settings. PMID:25446842

Liu, Jin-Hui; Xun, Xiao-Jie; Pang, Cong; Ma, Jun; Zou, Hui; Chen, Chao; Dai, Peng-Gao

2014-12-01

153

Construction of a cytosolic firefly luciferase reporter cassette for use in PCR-mediated gene deletion and fusion in Saccharomyces cerevisiae.  

PubMed

Monitoring promoter response to environmental changes using reporter systems has provided invaluable information regarding cellular state. With the development of in vivo luciferase reporter systems, inexpensive, sensitive and accurate promoter assays have been developed without the variability reported between in vitro samplings. Current luciferase reporter systems, however, are largely inflexible to modifications to the promoter of interest. To overcome problems in flexibility and stability of these expression vectors, we report the creation of a novel vector system which introduces a cytosol-localized Photinus pyralis luciferase [LUC*(-SKL)] capable of one-step, in vivo measurements into a promoter-reporter system via PCR-based gene deletion and fusion. After introduction of the reporter under HUG1 promoter control, cytosolic localization was confirmed by fluorescence microscopy. The dose-response of this novel construct was then compared with that of a similar HUG1?::yEGFP1 promoter-reporter system and shown to give a similar response pattern. PMID:23172625

Ainsworth, W B; Rome, C M; Hjortsø, M A; Benton, M G

2012-12-01

154

Characterization of xylan utilization and discovery of a new endoxylanase in Thermoanaerobacterium saccharolyticum through targeted gene deletions  

SciTech Connect

The economical production of fuels and commodity chemicals from lignocellulose requires the utilization of both the cellulose and hemicellulose fractions. Xylanase enzymes allow greater utilization of hemicellulose while also increasing cellulose hydrolysis. Recent metabolic engineering efforts have resulted in a strain of Thermoanaerobacterium saccharolyticum that can convert C(5) and C(6) sugars, as well as insoluble xylan, into ethanol at high yield. To better understand the process of xylan solubilization in this organism, a series of targeted deletions were constructed in the homoethanologenic T. saccharolyticum strain M0355 to characterize xylan hydrolysis and xylose utilization in this organism. While the deletion of -xylosidase xylD slowed the growth of T. saccharolyticum on birchwood xylan and led to an accumulation of short-chain xylo-oligomers, no other single deletion, including the deletion of the previously characterized endoxylanase XynA, had a phenotype distinct from that of the wild type. This result indicates a multiplicity of xylanase enzymes which facilitate xylan degradation in T. saccharolyticum. Growth on xylan was prevented only when a previously uncharacterized endoxylanase encoded by xynC was also deleted in conjunction with xynA. Sequence analysis of xynC indicates that this enzyme, a low-molecular-weight endoxylanase with homology to glycoside hydrolase family 11 enzymes, is secreted yet untethered to the cell wall. Together, these observations expand our understanding of the enzymatic basis of xylan hydrolysis by T. saccharolyticum.

Podkaminer, Kara K [Thayer School of Engineering at Dartmouth; Guss, Adam M [ORNL; McKenzie, Heather [University of California, Riverside; Hogsett, David [Mascoma Corporation; Lynd, Lee R [Thayer School of Engineering at Dartmouth

2012-01-01

155

Screening of High-Level 4-Hydroxy-2 (or 5)-Ethyl-5 (or 2)-Methyl-3(2H)-Furanone-Producing Strains from a Collection of Gene Deletion Mutants of Saccharomyces cerevisiae.  

PubMed

4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1?) exhibited the maximum HEMF production capacity. Further investigations of the adh1? mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

Uehara, Kenji; Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

2015-01-01

156

Gene alterations involving the CRLF2-JAK pathway and recurrent gene deletions in Down syndrome-associated acute lymphoblastic leukemia in Japan.  

PubMed

In Western countries, gene alterations involving the CRLF2-JAK signaling pathway are identified in approximately 50-60% of patients with Down syndrome-associated acute lymphoblastic leukemia (DS-ALL), and this pathway is considered a potential therapeutic target. The frequency of BTG1 deletions in DS-ALL is controversial. IKZF1 deletions, found in 20-30% of DS-ALL patients, are associated with a poor outcome and EBF1 deletions are very rare (?2%). We analyzed 38 patients to determine the frequencies and clinical implications of CRLF2-JAK pathway genetic alterations and recurrent gene deletions in Japanese DS-ALL patients. We confirmed a high incidence of P2RY8-CRLF2 (29%) and JAK2 mutations (16%), though the frequency of P2RY8-CRLF2 was slightly lower than that in Western countries (?50%). BTG1 deletions were common in our cohort (25%). IKZF1 deletions were detected in 25% of patients and associated with shorter overall survival (OS). EBF1 deletions were found at an unexpectedly high frequency (16%), and at a significantly higher level in P2RY8-CRLF2-positive patients than in P2RY8-CRLF2-negative patients (44% vs. 4%, P=0.015). Deletions of CDKN2A/B and PAX5 were common in P2RY8-CRLF2-negative patients (48 and 39%, respectively) but not in P2RY8-CRLF2-positive patients (11% each). Associations between these genetic alterations and clinical characteristics were not observed except for inferior OS in patients with IKZF1 deletions. These results suggest that differences exist between the genetic profiles of DS-ALL patients in Japan and in Western countries, and that P2RY8-CRLF2 and EBF1 deletions may cooperate in leukemogenesis in a subset of Japanese DS-ALL patients. PMID:25044358

Hanada, Isamu; Terui, Kiminori; Ikeda, Fumika; Toki, Tsutomu; Kanezaki, Rika; Sato, Tomohiko; Kamio, Takuya; Kudo, Ko; Sasaki, Shinya; Takahashi, Yoshihiro; Hayashi, Yasuhide; Inukai, Takeshi; Kojima, Seiji; Koike, Kenichi; Kosaka, Yoshiyuki; Kobayashi, Masao; Imaizumi, Masue; Mitsui, Tetsuo; Hori, Hiroki; Hara, Junichi; Horibe, Keizo; Nagai, Jun-ichi; Goto, Hiroaki; Ito, Etsuro

2014-11-01

157

CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice  

PubMed Central

We have previously shown that deletion of CuZnSOD in mice (Sod1?/? mice) leads to accelerated loss of muscle mass and contractile force during aging. To dissect the relative roles of skeletal muscle and motor neurons in this process, we used a Cre-Lox targeted approach to establish a skeletal muscle-specific Sod1-knockout (mKO) mouse to determine whether muscle-specific CuZnSOD deletion is sufficient to cause muscle atrophy. Surprisingly, mKO mice maintain muscle masses at or above those of wild-type control mice up to 18 mo of age. In contrast, maximum isometric specific force measured in gastrocnemius muscle is significantly reduced in the mKO mice. We found no detectable increases in global measures of oxidative stress or ROS production, no reduction in mitochondrial ATP production, and no induction of adaptive stress responses in muscle from mKO mice. However, Akt-mTOR signaling is elevated and the number of muscle fibers with centrally located nuclei is increased in skeletal muscle from mKO mice, which suggests elevated regenerative pathways. Our data demonstrate that lack of CuZnSOD restricted to skeletal muscle does not lead to muscle atrophy but does cause muscle weakness in adult mice and suggest loss of CuZnSOD may potentiate muscle regenerative pathways.—Zhang, Y., Davis, C., Sakellariou, G.K., Shi, Y., Kayani, A.C., Pulliam, D., Bhattacharya, A., Richardson, A., Jackson, M.J., McArdle, A., Brooks, S.V., Van Remmen, H. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice. PMID:23729587

Zhang, Yiqiang; Davis, Carol; Sakellariou, George K.; Shi, Yun; Kayani, Anna C.; Pulliam, Daniel; Bhattacharya, Arunabh; Richardson, Arlan; Jackson, Malcolm J.; McArdle, Anne; Brooks, Susan V.; Van Remmen, Holly

2013-01-01

158

Differential Functions of Interferon-Upregulated Sp100 Isoforms: Herpes Simplex Virus Type 1 Promoter-Based Immediate-Early Gene Suppression and PML Protection from ICP0-Mediated Degradation?  

PubMed Central

Cells have intrinsic defenses against virus infection, acting before the innate or the adaptive immune response. Preexisting antiviral proteins such as PML, Daxx, and Sp100 are stored in specific nuclear domains (ND10). In herpes simplex virus type 1 (HSV-1), the immediate-early protein ICP0 serves as a counterdefense through degradation of the detrimental protein PML. We asked whether interferon (IFN)-upregulated Sp100 is similarly antagonized by ICP0 in normal human fibroblasts by using a selective-knockdown approach. We find that of the four Sp100 isoforms, the three containing a SAND domain block the transcription of HSV-1 proteins ICP0 and ICP4 at the promoter level and that IFN changes the differential splicing of the Sp100 transcript in favor of the inhibitor Sp100C. At the protein level, ICP0 activity does not lead to the hydrolysis of any of the Sp100 isoforms. The SAND domain-containing isoforms are not general inhibitors of viral promoters, as the activity of the major immediate-early cytomegalovirus promoter is not diminished, whereas the long terminal repeat of a retrovirus, like the ICP0 promoter, is strongly inhibited. Since we could not find a specific promoter region in the ICP0 gene that responds to the SAND domain-containing isoforms, we questioned whether Sp100 could act through other antiviral proteins such as PML. We find that all four Sp100 isoforms stabilize ND10 and protect PML from ICP0-based hydrolysis. Loss of either all PML isoforms or all Sp100 isoforms reduces the opposite constituent ND10 protein, suggesting that various interdependent mechanisms of ND10-based proteins inhibit virus infection at the immediate-early level. PMID:19279115

Negorev, Dmitri G.; Vladimirova, Olga V.; Maul, Gerd G.

2009-01-01

159

Multiplication  

NSDL National Science Digital Library

How sharp are your multiplication skills? Give these great math games a try ! Play Asteroids blaster and test your multiplication skills. How fast can you solve the problem... play a round of Baseball multiplication and see! Multiplication is fun and delicious with Crazy Cones. Help Lemonade Larry determine the correct amount! Test your multiplication skills with Tic Tac Toe! ...

Ms.Roberts

2009-02-24

160

Sleep research in space: expression of immediate early genes in forebrain structures of rats during the nasa neurolab mission (STS-90).  

PubMed

1. Electrophysiological and behavioural observations have shown that changes in the sleep-waking activity occur in astronauts during the space flight. Experiments performed in ground-based experiments have previously shown that the immediate early gene (IEG) c-fos, a marker of neuronal activation, can be used as a molecular correlate of sleep and waking. However, while Fos expression peaks within 2-4 hours after the stimulus and returns to baseline within 6-8 hours, other IEGs as the FRA proteins which are also synthetized soon after their induction, persist in the cell nuclei for longer periods of time, ranging from 1-2 days to weeks. 2. Both Fos and FRA expression were evaluated in several adult albino rats sacrificed at different time points of the space flight, i.e. either at FD2 and FD14, i.e. at launch and about two weeks after launch, respectively, or at R + 1 and R + 13, i.e. at the reentry and about two weeks after landing. The changes in Fos and FRA expression were then compared with those obtained in ground controls. These experiments demonstrate activation of several brain areas which varies during the different phases of the space flight. Due to their different time of persistence, Fos and FRA immunohistochemistry can provide only correlative observations. In particular, FRA expression has been quite helpful to identify the occurrence of short-lasting events such as those related either to stress or to REM-sleep, whose episodes last in the rat only a few min and could hardly be detected by using only Fos expression. 3. Evidence was presented indicating that at FD2 and FD14 Fos-labeled cells were observed in several brain areas in which Fos had been previously identified as being induced by spontaneous or forced waking in ground-based experiments. In contrast to these findings FLT rats sacrificed at R + 1 showed low levels of Fos immunostaining in the cerebral cortex (neocortex) and several forebrain structures such as the hypothalamus and thalamus. Some Fos staining was also present in limbic cortical areas, the septum, and the hippocampus. The main area of the forebrain of FLT rats sacrificed at R + 1, showing an increased expression of Fos, was the central nucleus of the amygdala (CeA) (cf. 127), as well as the noradrenergic locus coeruleus (LC) nucleus (cf. 122). At R + 13 Fos immunostaining was variable among FLT rats. However, none of these rats showed a significant number of Fos-positive cells in CeA. 4. Most of the rats studied for Fos expression were also tested for FRA expression. In particular, a scattered amount of FRA expression occurred at FD14 in different areas of the neocortex and in limbic forebrain regions (such as the cingulate, retrosplenial and entorhinal cortex). It included also the hippocampus, the lateral septum, the caudate/putamen, as well as some hypothalamic regions. At the reentry (R + 1) it was previously shown that a prominent increase in FRA expression occurred in the LC of FLT rats (cf. 122). This finding was associated with an increase in FRA expression which affected not only the nucleus paragigantocellularis lateralis of the medulla, which sends excitatory glutamatergic afferents to the LC (cf. 31 for ref.), but also structures which are known to produce corticotropin-releasing factor (CRF), a neuropeptide which activates the noradrenergic LC neurons during stress. 5. These findings which result from acceleration stress were followed by REMS episodes, which probably occurred after a long period of sleep deprivation following exposure to microgravity. It was previously shown that an increase in Fos and FRA expression occurred at the reentry in some pontine and medullary reticular structures (cf. 128), which are likely to be involved in both the descending (postural atonia) and the ascending manifestations of PS. These findings can be integrated by results of the present experiments showing that at the reentry high levels of FRA expression occurred in the hippocampus and the limbic system, i.e. in structures which are involved in the generalized pattern of EEG desynchroniza

Centini, C; Pompeiano, O

2007-05-01

161

Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger.  

PubMed

Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl ?-1,3-mannosyltransferase (also known as "asparagine-linked glycosylation 3", or ALG3) is involved in early N-linked glycan synthesis and thus is essential for formation of N-linked protein glycosylation. In this study, we examined the effects of alg3 gene deletion (alg3?) on growth, development, pigment production, protein secretion and recombinant Trichoderma reesei cellobiohydrolase (rCel7A) expressed in Aspergillus niger. The alg3? delayed spore germination in liquid cultures of complete medium (CM), potato dextrose (PD), minimal medium (MM) and CM with addition of cAMP (CM+cAMP), and resulted in significant reduction of hyphal growth on CM, potato dextrose agar (PDA), and CM+cAMP and spore production on CM. The alg3? also led to a significant accumulation of red pigment on both liquid and solid CM cultures. The relative abundances of 54 of the total 215 proteins identified in the secretome were significantly altered as a result of alg3?, 63% of which were secreted at higher levels in alg3? strain than the parent. The rCel7A expressed in the alg3? mutant was smaller in size than that expressed in both wild-type and parental strains, but still larger than T. reesei Cel7A. The circular dichroism (CD)-melt scans indicated that change in glycosylation of rCel7A does not appear to impact the secondary structure or folding. Enzyme assays of Cel7A and rCel7A on nanocrystalline cellulose and bleached kraft pulp demonstrated that the rCel7As have improved activities on hydrolyzing the nanocrystalline cellulose. Overall, the results suggest that alg3 is critical for growth, sporulation, pigment production, and protein secretion in A. niger, and demonstrate the feasibility of this alternative approach to evaluate the roles of N-linked glycosylation in glycoprotein secretion and function. PMID:24076077

Dai, Ziyu; Aryal, Uma K; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D; Magnuson, Jon K; Adney, William S; Beckham, Gregg T; Brunecky, Roman; Himmel, Michael E; Decker, Stephen R; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E

2013-12-01

162

Multiplication  

NSDL National Science Digital Library

Here are some fun games to make practicing multiplication fun!!! Before you start the fun... click Multiplication Tables to review what you already know! Can you figure out the Multiplication Hidden Picture... you better know your math skills first or the picture will burst! It\\'s times to have a \\"blast\\"... Blow me away with theMultiplication Tunnel Blaster Now your ready to join the team! Show me ...

Walker, Ms.

2008-03-26

163

Yatein from Chamaecyparis obtusa suppresses herpes simplex virus type 1 replication in HeLa cells by interruption the immediate-early gene expression  

Microsoft Academic Search

Inhibitory effects of methanolic extracts from nine Chinese herbs on herpes simplex virus type 1 (HSV-1) replication were studied. By a bioassay-guided fractionation procedure, yatein (C22H23O7; M.W.399) was isolated from Chamaecyparis obtusa; yatein significantly suppressed HSV-1 multiplication in HeLa cells without apparent cytotoxicity. To further localize the point in the HSV-1 replication cycle where arrest occurred, a set of key

Yuh-Chi Kuo; Yueh-Hsiung Kuo; Yuang-Lian Lin; Wei-Jern Tsai

2006-01-01

164

Reactivation of the Human Cytomegalovirus Major Immediate-Early Regulatory Region and Viral Replication in Embryonal NTera2 Cells: Role of Trichostatin A, Retinoic Acid, and Deletion of the 21-Base-Pair Repeats and Modulator  

PubMed Central

Inactivity of the human cytomegalovirus (HCMV) major immediate-early regulatory region (MIERR), which is composed of promoter, enhancer, unique region, and modulator, is linked to lack of HCMV replication in latently infected cells and in other nonpermissive cell types, including human embryonal NTera2 carcinoma (NT2) cells. I refined the embryonal NT2 cell model to enable characterization of the unknown mechanistic basis for silencing of HCMV MIERR-dependent transcription and viral replication in nonpermissive cells. These infected NT2 cells contain nonreplicating viral genomes with electrophoretic mobility equivalent to a supercoiled, bacterial artificial chromosome of comparable molecular weight. MIERR-dependent transcription is minimal to negligible. Increasing the availability of positive-acting transcription factors by retinoic acid (RA) treatment after infection is largely insufficient in reactivating the MIERR. In contrast, trichostatin A (TSA), a histone deacetylase inhibitor, reactivates MIERR-dependent transcription. Contrary to prior findings produced from transfected MIERR segments, deletion of the 21-bp repeats and modulator from the MIERR in the viral genome does not relieve MIERR silencing. To demonstrate that MIERR silencing likely results from enhancer inactivity, I examined an HCMV with a heterologous MIERR promoter that is enhancer dependent but exempt from IE2 p86-mediated negative autoregulation. This heterologous promoter, like its neighboring native MIERR promoter, exhibits immediate-early transcriptional kinetics in fibroblasts. In embryonal NT2 cells, the heterologous MIERR promoter is transcriptionally inactive. This silence is relieved by TSA but not by RA. Remarkably, TSA-induced reactivation of MIERR-dependent transcription from quiescent viral genomes is followed by release of infectious virus. I conclude that a mechanism of active repression imposes a block to MIERR-dependent transcription and viral replication in embryonal NT2 cells. Because TSA overcomes the block, viral gene silencing may involve histone deacetylase-based modification of viral chromatin, which might account for the covalently closed circular conformation of quiescent HCMV genomes. PMID:11160656

Meier, Jeffery L.

2001-01-01

165

Distal Xq28 microdeletions: clarification of the spectrum of contiguous gene deletions involving ABCD1, BCAP31, and SLC6A8 with a new case and review of the literature.  

PubMed

The contiguous ABCD1/DXS1375E (BCAP31) deletion syndrome (CADDS) is a rare X-linked contiguous gene deletion syndrome with a severe clinical phenotype that includes marked delays, significant growth failure, liver dysfunction, and early death. The X-linked creatine transporter deficiency is a considerably more common and a cause of X-linked intellectual disability; however, multi-exon deletions of the creatine transporter are rare. We report the fifth case of CADDS, who also has a deletion of the X-linked creatine transporter. We also review reported cases of deletions in this region in order to clarify the clinical spectrum of contiguous microdeletions in this region. PMID:25044748

Calhoun, Amy R U L; Raymond, Gerald V

2014-10-01

166

Human herpesvirus 6B immediate-early I protein contains functional HLA-A*02, HLA-A*03, and HLA-B*07 class I restricted CD8(+) T-cell epitopes.  

PubMed

Human herpesvirus 6B (HHV-6B) is a ubiquitous pathogen with frequent reactivation observed in immunocompromised patients such as BM transplant (BMT) recipients. Adoptive immunotherapy is a promising therapeutic avenue for the treatment of opportunistic infections, including herpesviruses. While T-cell immunotherapy can successfully control CMV and EBV reactivations in BMT recipients, such therapy is not available for HHV-6 infections, in part due to a lack of identified protective CD8(+) T-cell epitopes. Our goal was to identify CD8(+) T-cell viral epitopes derived from the HHV-6B immediate-early protein I and presented by common human leukocyte Ag (HLA) class I alleles including HLA-A*02, HLA-A*03, and HLA-B*07. These epitopes were functionally tested for their ability to induce CD8(+) T-cell expansion and kill HHV-6-infected autologous cells. Cross-reactivity of specific HHV-6B-expanded T cells against HHV-6A-infected cells was also confirmed for a conserved epitope presented by HLA-A*02 molecule. Our findings will help push forward the field of adoptive immunotherapy for the treatment and/or the prevention of HHV-6 reactivation in BMT recipients. PMID:25243920

Iampietro, Mathieu; Morissette, Guillaume; Gravel, Annie; Dubuc, Isabelle; Rousseau, Matthieu; Hasan, Aisha; O'Reilly, Richard J; Flamand, Louis

2014-12-01

167

Improved Knockout Methodology Reveals That Frog Virus 3 Mutants Lacking either the 18K Immediate-Early Gene or the Truncated vIF-2? Gene Are Defective for Replication and Growth In Vivo ?  

PubMed Central

To better assess the roles of frog virus 3 (FV3; genus Ranavirus, family Iridoviridae) genes in virulence and immune evasion, we have developed a reliable and efficient method to systematically knock out (KO) putative virulence genes by site-specific integration into the FV3 genome. Our approach utilizes a dual selection marker consisting of the puromycin resistance gene fused in frame with the enhanced green fluorescent protein (EGFP) reporter (Puro-EGFP cassette) under the control of the FV3 immediate-early (IE) 18K promoter. By successive rounds of selection for puromycin resistance and GFP expression, we have successfully constructed three recombinant viruses. In one, a “knock-in” mutant was created by inserting the Puro-EGFP cassette into a noncoding region of the FV3 genome (FV3-Puro/GFP). In the remaining two, KO mutants were constructed by replacement of the truncated viral homolog of eIF-2? (FV3-?vIF-2?) or the 18K IE gene (FV3-?18K) with the Puro-EGFP cassette. The specificity of recombination and the clonality of each mutant were confirmed by PCR, sequencing, and immunofluorescence microscopy. Viral replication of each recombinant in cell culture was similar to that of parental FV3; however, infection in Xenopus laevis tadpoles revealed that FV3-?vIF-2? and FV3-?18K replicated less and resulted in lower mortality than did GFP-FV3 and wild-type FV3. Our results suggest that 18K, which is conserved in all ranaviruses, and the truncated vIF-2? gene contribute to virulence. In addition, our study describes a powerful methodology that lays the foundation for the discovery of potentially new ranaviral genes involved in virulence and immune escape. PMID:21865381

Chen, Guangchun; Ward, Brian M.; Yu, Kwang H.; Chinchar, V. Gregory; Robert, Jacques

2011-01-01

168

The Activator Protein 1 Binding Motifs within the Human Cytomegalovirus Major Immediate-Early Enhancer Are Functionally Redundant and Act in a Cooperative Manner with the NF-?B Sites during Acute Infection ? §  

PubMed Central

Human cytomegalovirus (HCMV) infection causes a rapid induction of c-Fos and c-Jun, the major subunits of activator protein 1 (AP-1), which in turn have been postulated to activate the viral immediate-early (IE) genes. Accordingly, the major IE promoter (MIEP) enhancer, a critical control region for initiating lytic HCMV infection and reactivation from the latent state, contains one well-characterized AP-1 site and a second candidate interaction site. In this study we explored the role of these AP-1 elements in the context of the infection. We first show that the distal candidate AP-1 motif binds c-Fos/c-Jun heterodimers (AP-1 complex) and confers c-Fos/c-Jun-mediated activity to a core promoter. Site-directed mutagenesis studies indicate that both AP-1 response elements are critical for 12-O-tetradecanoylphorbol-13-acetate (TPA)-enhanced MIEP activity in transient-transfection assays. In marked contrast to the results obtained with the isolated promoter, disruption of the AP-1 recognition sites of the MIEP in the context of the infectious HCMV genome has no significant influence on the expression of the MIE protein IE1 or viral replication in different cell types. Moreover, a chimeric murine CMV driven by the HCMV MIEP (hMCMV-ES) with the two AP-1 binding sites mutated is not compromised in virulence, is able to grow and disseminate to different organs of the newborn mice as efficiently as the parental virus, and is competent in reactivation. We show, however, that combined inactivation of the enhancer AP-1 and NF-?B recognition sites leads to an attenuation of the hMCMV-ES in the neonatal murine infection model, not observed when each single element is abolished. Altogether, these results underline the functional redundancy of the MIEP elements, highlighting the plasticity of this region, which probably evolved to ensure maximal transcriptional performance across many diverse environments. PMID:21106746

Isern, Elena; Gustems, Montse; Messerle, Martin; Borst, Eva; Ghazal, Peter; Angulo, Ana

2011-01-01

169

Recruitment of cdk9 to the Immediate-Early Viral Transcriptosomes during Human Cytomegalovirus Infection Requires Efficient Binding to Cyclin T1, a Threshold Level of IE2 86, and Active Transcription?  

PubMed Central

Human cytomegalovirus (HCMV) infection results in the formation of nuclear viral transcriptosomes, which are sites dedicated to viral immediate-early (IE) transcription. At IE times of the infection, viral and cellular factors, including several components of transcription such as cyclin-dependent kinase 9 (cdk9), localize at these sites. To determine the mechanism and requirements of specific recruitment of cdk9 to the viral transcriptosomes, infection in the presence of inhibitor drugs and infection of cell lines expressing exogenous mutant cdk9 were performed. We found that cdk9 localization to the viral transcriptosomes requires de novo protein synthesis. In addition, active transcription is required for recruitment and maintenance of cdk9 at the viral transcriptosomes. In cells infected with a recombinant IE2 HCMV (IE2 86 ?SX virus) in which IE2 gene expression is greatly reduced, cdk9 localization at the transcriptosome is delayed and corresponds to the kinetics of accumulation of the IE2 protein at these sites. Infection in the presence of the cdk9 inhibitors Flavopiridol and DRB (5,6-dichloro-1-?-d-ribofuranosylbenzimidazole) allowed cdk9 localization to the viral transcriptosomes. A kinase-inactive cdk9 (D167N) expressed during the infection also localizes to the viral transcriptosomes, indicating that kinase activity of cdk9 is not a requirement for its localization to the sites of IE transcription. Exogenous expression of additional cdk9 mutants indicates that binding of Brd4 to the cdk9 complex is not required but that efficient binding to cyclin T1 is essential. PMID:19297489

Kapasi, Anokhi J.; Clark, Charles L.; Tran, Karen; Spector, Deborah H.

2009-01-01

170

Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II  

SciTech Connect

Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

Sample, Robert [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Bryan, Locke [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Long, Scott [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Majji, Sai [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Hoskins, Glenn [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Sinning, Allan [Department of Anatomy, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Olivier, Jake [Department of Preventive Medicine, University of Mississippi Medical Center, Jackson, MS 39216 (United States); Chinchar, V. Gregory [Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216 (United States)]. E-mail: vchinchar@microbio.umsmed.edu

2007-02-20

171

Improved knockout methodology reveals that frog virus 3 mutants lacking either the 18K immediate-early gene or the truncated vIF-2alpha gene are defective for replication and growth in vivo.  

PubMed

To better assess the roles of frog virus 3 (FV3; genus Ranavirus, family Iridoviridae) genes in virulence and immune evasion, we have developed a reliable and efficient method to systematically knock out (KO) putative virulence genes by site-specific integration into the FV3 genome. Our approach utilizes a dual selection marker consisting of the puromycin resistance gene fused in frame with the enhanced green fluorescent protein (EGFP) reporter (Puro-EGFP cassette) under the control of the FV3 immediate-early (IE) 18K promoter. By successive rounds of selection for puromycin resistance and GFP expression, we have successfully constructed three recombinant viruses. In one, a "knock-in" mutant was created by inserting the Puro-EGFP cassette into a noncoding region of the FV3 genome (FV3-Puro/GFP). In the remaining two, KO mutants were constructed by replacement of the truncated viral homolog of eIF-2? (FV3-?vIF-2?) or the 18K IE gene (FV3-?18K) with the Puro-EGFP cassette. The specificity of recombination and the clonality of each mutant were confirmed by PCR, sequencing, and immunofluorescence microscopy. Viral replication of each recombinant in cell culture was similar to that of parental FV3; however, infection in Xenopus laevis tadpoles revealed that FV3-?vIF-2? and FV3-?18K replicated less and resulted in lower mortality than did GFP-FV3 and wild-type FV3. Our results suggest that 18K, which is conserved in all ranaviruses, and the truncated vIF-2? gene contribute to virulence. In addition, our study describes a powerful methodology that lays the foundation for the discovery of potentially new ranaviral genes involved in virulence and immune escape. PMID:21865381

Chen, Guangchun; Ward, Brian M; Yu, Kwang H; Chinchar, V Gregory; Robert, Jacques

2011-11-01

172

Mutational analysis of open reading frames 62 and 71, encoding the varicella-zoster virus immediate-early transactivating protein, IE62, and effects on replication in vitro and in skin xenografts in the SCID-hu mouse in vivo.  

PubMed

The varicella-zoster virus (VZV) genome has unique long (U(L)) and unique short (U(S)) segments which are flanked by internal repeat (IR) and terminal repeat (TR) sequences. The immediate-early 62 (IE62) protein, encoded by open reading frame 62 (ORF62) and ORF71 in these repeats, is the major VZV transactivating protein. Mutational analyses were done with VZV cosmids generated from parent Oka (pOka), a low-passage clinical isolate, and repair experiments were done with ORF62 from pOka and vaccine Oka (vOka), which is derived from pOka. Transfections using VZV cosmids from which ORF62, ORF71, or the ORF62/71 gene pair was deleted showed that VZV replication required at least one copy of ORF62. The insertion of ORF62 from pOka or vOka into a nonnative site in U(S) allowed VZV replication in cell culture in vitro, although the plaque size and yields of infectious virus were decreased. Targeted mutations in binding sites reported to affect interaction with IE4 protein and a putative ORF9 protein binding site were not lethal. Single deletions of ORF62 or ORF71 from cosmids permitted recovery of infectious virus, but recombination events repaired the defective repeat region in some progeny viruses, as verified by PCR and Southern hybridization. VZV infectivity in skin xenografts in the SCID-hu model required ORF62 expression; mixtures of single-copy recombinant Oka Delta 62 (rOka Delta 62) or rOka Delta 71 and repaired rOka generated by recombination of the single-copy deletion mutants were detected in some skin implants. Although insertion of ORF62 into the nonnative site permitted replication in cell culture, ORF62 expression from its native site was necessary for cell-cell spread in differentiated human skin tissues in vivo. PMID:12719553

Sato, Bunji; Ito, Hideki; Hinchliffe, Stewart; Sommer, Marvin H; Zerboni, Leigh; Arvin, Ann M

2003-05-01

173

Mutational Analysis of Open Reading Frames 62 and 71, Encoding the Varicella-Zoster Virus Immediate-Early Transactivating Protein, IE62, and Effects on Replication In Vitro and in Skin Xenografts in the SCID-hu Mouse In Vivo  

PubMed Central

The varicella-zoster virus (VZV) genome has unique long (UL) and unique short (US) segments which are flanked by internal repeat (IR) and terminal repeat (TR) sequences. The immediate-early 62 (IE62) protein, encoded by open reading frame 62 (ORF62) and ORF71 in these repeats, is the major VZV transactivating protein. Mutational analyses were done with VZV cosmids generated from parent Oka (pOka), a low-passage clinical isolate, and repair experiments were done with ORF62 from pOka and vaccine Oka (vOka), which is derived from pOka. Transfections using VZV cosmids from which ORF62, ORF71, or the ORF62/71 gene pair was deleted showed that VZV replication required at least one copy of ORF62. The insertion of ORF62 from pOka or vOka into a nonnative site in US allowed VZV replication in cell culture in vitro, although the plaque size and yields of infectious virus were decreased. Targeted mutations in binding sites reported to affect interaction with IE4 protein and a putative ORF9 protein binding site were not lethal. Single deletions of ORF62 or ORF71 from cosmids permitted recovery of infectious virus, but recombination events repaired the defective repeat region in some progeny viruses, as verified by PCR and Southern hybridization. VZV infectivity in skin xenografts in the SCID-hu model required ORF62 expression; mixtures of single-copy recombinant Oka?62 (rOka?62) or rOka?71 and repaired rOka generated by recombination of the single-copy deletion mutants were detected in some skin implants. Although insertion of ORF62 into the nonnative site permitted replication in cell culture, ORF62 expression from its native site was necessary for cell-cell spread in differentiated human skin tissues in vivo. PMID:12719553

Sato, Bunji; Ito, Hideki; Hinchliffe, Stewart; Sommer, Marvin H.; Zerboni, Leigh; Arvin, Ann M.

2003-01-01

174

Genetically Modified Strains of Ralstonia eutropha H16 with ?-Ketothiolase Gene Deletions for Production of Copolyesters with Defined 3-Hydroxyvaleric Acid Contents  

PubMed Central

?-Ketothiolases catalyze the first step of poly(3-hydroxybutyrate) [poly(3HB)] biosynthesis in bacteria by condensation of two acetyl coenzyme A (acetyl-CoA) molecules to acetoacetyl-CoA and also take part in the degradation of fatty acids. During growth on propionate or valerate, Ralstonia eutropha H16 produces the copolymer poly(3-hydroxybutyrate-co-3-hydroxyvalerate) [poly(3HB-co-3HV)]. In R. eutropha, 15 ?-ketothiolase homologues exist. The synthesis of 3-hydroxybutyryl-CoA (3HB-CoA) could be significantly reduced in an 8-fold mutant (Lindenkamp et al., Appl. Environ. Microbiol. 76:5373–5382, 2010). In this study, a 9-fold mutant deficient in nine ?-ketothiolase gene homologues (phaA, bktB, H16_A1713, H16_B1771, H16_A1528, H16_B0381, H16_B1369, H16_A0170, and pcaF) was generated. In order to examine the polyhydroxyalkanoate production capacity when short- or long-chain and even- or odd-chain-length fatty acids were provided as carbon sources, the growth and storage behavior of several mutants from the previous study and the newly generated 9-fold mutant were analyzed. Propionate, valerate, octanoate, undecanoic acid, or oleate was chosen as the sole carbon source. On octanoate, no significant differences in growth or storage behavior were observed between wild-type R. eutropha and the mutants. In contrast, during the growth on oleate of a multiple mutant lacking phaA, bktB, and H16_A0170, diminished poly(3HB) accumulation occurred. Surprisingly, the amount of accumulated poly(3HB) in the multiple mutants grown on gluconate differed; it was much lower than that on oleate. The ?-ketothiolase activity toward acetoacetyl-CoA in H16?phaA and all the multiple mutants remained 10-fold lower than the activity of the wild type, regardless of which carbon source, oleate or gluconate, was employed. During growth on valerate as a sole carbon source, the 9-fold mutant accumulated almost a poly(3-hydroxyvalerate) [poly(3HV)] homopolyester with 99 mol% 3HV constituents. PMID:22636005

Lindenkamp, Nicole; Volodina, Elena

2012-01-01

175

Binding of ICP4, TATA-Binding Protein, and RNA Polymerase II to Herpes Simplex Virus Type 1 Immediate-Early, Early, and Late Promoters in Virus-Infected Cells?  

PubMed Central

The binding of herpes simplex virus type 1 ICP4, TATA-binding protein (TBP), and RNA polymerase II (polII) to the promoter regions of representative immediate-early (IE) (ICP0), early (E) (thymidine kinase [tk]), and late (L) (glycoprotein C [gC]) genes on the viral genome was examined as a function of time postinfection, viral DNA replication, cis-acting sites for TFIID in the tk and gC promoters, and genetic background of ICP4. The binding of TBP and polII to the IE ICP0 promoter was independent of the presence of ICP4, whereas the binding of TBP and polII to the tk and gC promoters occurred only when ICP4 also bound to the promoters, suggesting that the presence of ICP4 at the promoters of E and L genes in virus-infected cells is crucial for the formation of transcription complexes on these promoters. When the TATA box of the tk promoter or the initiator element (INR) of the gC promoter was mutated, a reduction in the amount of TBP and polII binding was observed. However, a reduction in the amount of ICP4 binding to the promoters was also observed, suggesting that the binding of TBP-containing complexes and ICP4 is cooperative. The binding of ICP4, TBP, and polII was also observed on the gC promoter at early times postinfection or when DNA synthesis was inhibited, suggesting that transcription complexes may be formed early on L promoters and that additional events or proteins are required for expression. The ability to form these early complexes on the gC promoter required the DNA-binding domain but in addition required the carboxyl-terminal 524 amino acids of ICP4, which is missing the virus n208. This region was not required to form TBP- and polII-containing complexes on the tk promoter. n208 activates E but not L genes during viral infection. These data suggest that a region of ICP4 may differentiate between forming TBP- and polII-containing complexes on E and L promoters. PMID:18094162

Sampath, Padmavathi; DeLuca, Neal A.

2008-01-01

176

The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein  

SciTech Connect

The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed.

Ahn, Byung Chul [Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, PO Box 33932, Shreveport, LA 71130-3932 (United States); Breitenbach, Jonathan E. [Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, PO Box 33932, Shreveport, LA 71130-3932 (United States); Kim, Seong K. [Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, PO Box 33932, Shreveport, LA 71130-3932 (United States); O'Callaghan, Dennis J. [Center for Molecular and Tumor Virology, Department of Microbiology and Immunology, Louisiana State University Health Sciences Center, 1501 Kings Highway, PO Box 33932, Shreveport, LA 71130-3932 (United States)]. E-mail: docall@lsuhsc.edu

2007-06-20

177

Novel 9q34.11 gene deletions encompassing combinations of four Mendelian disease genes: STXBP1, SPTAN1, ENG, and TOR1A  

PubMed Central

Purpose A number of genes in the 9q34.11 region may be haploinsufficient. However, studies analyzing genotype–phenotype correlations of deletions encompassing multiple dosage-sensitive genes in the region are lacking. Methods We mapped breakpoints of 10 patients with 9q34.11 deletions using high-resolution 9q34-specific array comparative genomic hybridization (CGH) to determine deletion size and gene content. Results The 9q34.11 deletions range in size from 67 kb to 2.8 Mb. Six patients exhibit intellectual disability and share a common deleted region including STXBP1; four manifest variable epilepsy. In five subjects, deletions include SPTAN1, previously associated with early infantile epileptic encephalopathy, infantile spasms, intellectual disability, and hypomyelination. In four patients, the deletion includes endoglin (ENG), causative of hereditary hemorrhagic telangiectasia. Finally, in four patients, deletions involve TOR1A, of which molecular defects lead to early-onset primary dystonia. Ninety-four other RefSeq genes also map to the genomic intervals investigated. Conclusion STXBP1 haploinsufficiency results in progressive encephalopathy characterized by intellectual disability and may be accompanied by epilepsy, movement disorders, and autism. We propose that 9q34.11 genomic deletions involving ENG, TOR1A, STXBP1, and SPTAN1 are responsible for multisystemic vascular dysplasia, early-onset primary dystonia, epilepsy, and intellectual disability, therefore revealing cis-genetic effects leading to complex phenotypes. PMID:22722545

Campbell, Ian M.; Yatsenko, Svetlana A.; Hixson, Patricia; Reimschisel, Tyler; Thomas, Matthew; Wilson, William; Dayal, Usha; Wheless, James W.; Crunk, Amy; Curry, Cynthia; Parkinson, Nicole; Fishman, Leona; Riviello, James J.; Nowaczyk, Malgorzata J.M.; Zeesman, Susan; Rosenfeld, Jill A.; Bejjani, Bassem A.; Shaffer, Lisa G.; Cheung, Sau Wai; Lupski, James R.; Stankiewicz, Pawel; Scaglia, Fernando

2013-01-01

178

Hearing loss is an early consequence of Npc1 gene deletion in the mouse model of Niemann-Pick disease, type C.  

PubMed

Niemann-Pick disease, type C1 (NPC1) is a rare lysosomal lipidosis that is most often the result of biallelic mutations in NPC1, and is characterized by a fatal neurological degeneration. The pathophysiology is complex, and the natural history of the disease is poorly understood. Recent findings from patients with NPC1 and hearing loss suggest that multiple steps along the auditory pathway are affected. The current study was undertaken to determine the auditory phenotype in the Npc1 (nih) mutant mouse model, to extend analyses to histologic evaluation of the inner ear, and to compare our findings to those reported from human patients. Auditory testing revealed a progressive high-frequency hearing loss in Npc1 (-/-) mice that is present as early as postnatal day 20 (P20), well before the onset of overt neurological symptoms, with evidence of abnormalities involving the cochlea, auditory nerve, and brainstem auditory centers. Distortion product otoacoustic emission amplitude and auditory brainstem response latency data provided evidence for a disruption in maturational development of the auditory system in Npc1 (-/-) mice. Anatomical study demonstrated accumulation of lysosomes in neurons, hair cells, and supporting cells of the inner ear in P30 Npc1 (-/-) mice, as well as increased numbers of inclusion bodies, myelin figures, and swollen nerve endings in older (P50-P70) mutant animals. These findings add unique perspective to the pathophysiology of NPC disease and suggest that hearing loss is an early and sensitive marker of disease progression. PMID:24839095

King, Kelly A; Gordon-Salant, Sandra; Pawlowski, Karen S; Taylor, Anna M; Griffith, Andrew J; Houser, Ari; Kurima, Kiyoto; Wassif, Christopher A; Wright, Charles G; Porter, Forbes D; Repa, Joyce J; Brewer, Carmen C

2014-08-01

179

Elucidating timing and function of endothelin-A receptor signaling during craniofacial development using neural crest cell-specific gene deletion and receptor antagonism  

PubMed Central

Cranial neural crest cells (NCCs) play an intimate role in craniofacial development. Multiple signaling cascades participate in patterning cranial NCCs, some of which are regulated by endothelin-A receptor (Ednra) signaling. Ednra?/? embryos die at birth from severe craniofacial defects resulting from disruption of neural crest cell patterning and differentiation. These defects include homeotic transformation of lower jaw structures into upper jaw-like structures, suggesting that some cephalic NCCs alter their “identity” in the absence of Ednra signaling. To elucidate the temporal necessity for Ednra signaling in vivo, we undertook two strategies. We first used a conditional knockout strategy in which mice containing a conditionally targeted Ednra allele (Ednrafl) were bred with mice from the Hand2-Cre and Wnt1-Cre transgenic mouse strains, two strains in which Cre expression occurs at different time periods within cranial NCCs. In our second approach, we used an Ednra-specific antagonist to treat wild type pregnant mice between embryonic days E8.0 and E10.0, a time frame encompassing the early migration and proliferation of cranial NCCs. The combined results suggest that Ednra function is crucial for NCC development between E8.25 and E9.0, a time period encompassing the arrival of NCCs in the arches and/or early post-migratory patterning. After this time period, Ednra signaling is dispensable. Interestingly, middle ear structures are enlarged and malformed in a majority of Ednrafl/fl;Wnt1-Cre embryos, instead resembling structures found in extinct predecessors of mammals. These observations suggest that the advent of Ednra signaling in cranial NCCs may have been a crucial event in the evolution of the mammalian middle ear ossicles. PMID:19185569

Ruest, Louis-Bruno; Clouthier, David E.

2009-01-01

180

Detection of phase-dependent transcriptomic changes and Rubisco-mediated CO2 fixation into poly (3-hydroxybutyrate) under heterotrophic condition in Ralstonia eutropha H16 based on RNA-seq and gene deletion analyses  

PubMed Central

Background Ralstonia eutropha H16 is well known to produce polyhydroxyalkanoates (PHAs), which are potential bio-based biodegradable plastics, in an efficient manner as an energy storage material under unbalanced growth conditions. To obtain further knowledge of PHA biosynthesis, this study performed a quantitative transcriptome analysis based on deep sequencing of the complementary DNA generated from the RNA (RNA-seq) of R. eutropha H16. Results Total RNAs were extracted from R. eutropha cells in growth, PHA production, and stationary phases on fructose. rRNAs in the preparation were removed by repeated treatments with magnetic beads specific to bacterial rRNAs, and then the 36 bp sequences were determined using an Illumina high-throughput sequencer. The RNA-seq results indicated the induction of gene expression for transcription, translation, cell division, peptidoglycan biosynthesis, pilus and flagella assembly, energy conservation, and fatty acid biosynthesis in the growth phase; and the repression trends of genes involved in central metabolisms in the PHA production phase. Interestingly, the transcription of genes for Calvin-Benson-Bassham (CBB) cycle and several genes for ?-oxidation were significantly induced in the PHA production phase even when the cells were grown on fructose. Moreover, incorporation of 13C was observed in poly(3-hydroxybutyrate) synthesized by R. eutropha H16 from fructose in the presence of NaH13CO3, and further gene deletion analyses revealed that both of the two ribulose 1,5-bisphosphate carboxylase (Rubiscos) in CBB cycle were actually functional in CO2 fixation under the heterotrophic condition. Conclusions The results revealed the phase-dependent transcriptomic changes and a CO2 fixation capability under heterotrophic conditions by PHA-producing R. eutropha. PMID:23879744

2013-01-01

181

Frequent gene deletions in potentially malignant oral lesions.  

PubMed Central

Some oral cancers are preceded by premalignant lesions which include leucoplakia and erythroplakia. At present there are no reliable markers to identify lesions that may progress to malignancy. We have analysed 30 potentially malignant oral lesions for deletions at chromosomal regions that harbour tumour-suppressor genes for oral cancer. A total of 16 of 30 cases (53%) showed loss of heterozygosity (LOH) or allele imbalance at TP53, DCC, 3p21.3-22.1 or 3p12.1-13. These genetic alterations were detected in dysplastic lesions but not in histologically normal mucosa and may be early events in the carcinogenic process. A total of 64% of dysplastic lesions that recurred during the study showed LOH or allele imbalance in the initial biopsy and the number of genetic abnormalities increased in the tumours that developed. This type of molecular profiling may help to identify patients with lesions that may recur or acquire additional genetic events and progress to malignancy. Images Figure 2 PMID:8611386

Emilion, G.; Langdon, J. D.; Speight, P.; Partridge, M.

1996-01-01

182

Site-directed mutagenesis and gene deletion using reverse genetics.  

PubMed

Understanding gene function is far easier when tools are available to engineer a bacterial strain lacking a specific gene and phenotypically compare its behavior with the corresponding parental strain. Such mutants could be selected randomly, either by natural selection under particular stress conditions or by random mutagenesis using transposon delivery as described elsewhere in this book. However, with the advent of the genomic era there are now hundreds of bacterial genomes whose sequence is available, and thus, genes can be identified, chosen, and strategies designed to specifically inactivate them. This can be done by using suicide plasmids and is most convenient when the bacterium of interest is easily amenable to genetic manipulation. The method presented here will describe the use of a suicide vector, pKNG101, which allows the selection of a double-recombination event. The first event results in the integration of the pKNG101 derivative carrying the "mutator" fragment onto the chromosome, and could be selected on plates containing appropriate antibiotics. The pKNG101 carries the sacB gene, which induces death when cells are grown on sucrose. Growth on sucrose plates will thus select the second homologous recombination event, which results in removing the plasmid backbone and leaving behind the mutated target gene. This method has been widely used over the last 20 years to inactivate genes in a wide range of gram-negative bacteria and in particular in Pseudomonas aeruginosa. PMID:24818930

Muhl, Daniela; Filloux, Alain

2014-01-01

183

Ornithine Decarboxylase Gene Deletion Mutants of Leishmania donovani*  

E-print Network

of cellular putrescine pools, al- though levels of spermidine were relatively unaffected. Concentrations of trypanothione, a spermidine conju- gate, were also reduced, whereas glutathione concentra- tions were augmented of the naturally occurring poly- amines, putrescine or spermidine, to the culture me- dium. Whereas putrescine

Schnaufer, Achim

184

CHARACTERIZING FUMONISIN BIOSYNTHESIS THROUGH ANALYSIS OF FUM GENE DELETION MUTANTS  

Technology Transfer Automated Retrieval System (TEKTRAN)

Fumonisins are produced by Gibberella moniliformis, a causal agent of maize ear and stalk rot, and pose a health risk to humans and livestock alike. Recently, a fumonisin biosynthetic gene cluster was described in G. moniliformis. The cluster consists of 15 co-regulated genes (FUM1 and FUM6 throug...

185

Glucocerebrosidase 2 gene deletion rescues type 1 Gaucher disease  

PubMed Central

The inherited deficiency of the lysosomal glucocerebrosidase (GBA) due to mutations in the GBA gene results in Gaucher disease (GD). A vast majority of patients present with nonneuronopathic, type 1 GD (GD1). GBA deficiency causes the accumulation of two key sphingolipids, glucosylceramide (GL-1) and glucosylsphingosine (LysoGL-1), classically noted within the lysosomes of mononuclear phagocytes. How metabolites of GL-1 or LysoGL-1 produced by extralysosomal glucocerebrosidase GBA2 contribute to the GD1 pathophysiology is not known. We recently recapitulated hepatosplenomegaly, cytopenia, hypercytokinemia, and the bone-formation defect of human GD1 through conditional deletion of Gba in Mx1–Cre+:GD1 mice. Here we show that the deletion of Gba2 significantly rescues the GD1 clinical phenotype, despite enhanced elevations in GL-1 and LysoGL-1. Most notably, the reduced bone volume and bone formation rate are normalized. These results suggest that metabolism of GL-1 or LysoGL-1 into downstream bioactive lipids is a major contributor to the bone-formation defect. Direct testing revealed a strong inhibition of osteoblast viability by nanomolar concentrations of sphingosine, but not of ceramide. These findings are consistent with toxicity of high circulating sphingosine levels in GD1 patients, which decline upon enzyme-replacement therapy; serum ceramide levels remain unchanged. Together, complementary results from mice and humans affected with GD1 not only pinpoint sphingosine as being an osteoblast toxin, but also set forth Gba2 as a viable therapeutic target for the development of inhibitors to ameliorate certain disabling consequences of GD1. PMID:24639522

Mistry, Pramod K.; Liu, Jun; Sun, Li; Chuang, Wei-Lien; Yuen, Tony; Yang, Ruhua; Lu, Ping; Zhang, Kate; Li, Jianhua; Keutzer, Joan; Stachnik, Agnes; Mennone, Albert; Boyer, James L.; Jain, Dhanpat; Brady, Roscoe O.; New, Maria I.; Zaidi, Mone

2014-01-01

186

Global Gene Deletion Analysis Exploring Yeast Filamentous Growth  

E-print Network

albicans to invade human tissues and evade the immune system. We constructed a genome-wide set of targeted Candida albicans, the capacity to tran- sition between yeast and filamentous growth is correlated deletion con- struct carrying 200 base pairs (bp) of flanking DNA for efficient integration and gene

Gifford, David K.

187

Cre-mediated gene deletion in the mammary gland.  

PubMed Central

To delete genes specifically from mammary tissue using the Cre-lox system, we have established transgenic mice expressing Cre recombinase under control of the WAP gene promoter and the MMTV LTR. Cre activity in these mice was evaluated by three criteria. First, the tissue distribution of Cre mRNA was analyzed. Second, an adenovirus carrying a reporter gene was used to determine expression at the level of single cells. Third, tissue specificity of Cre activity was determined in a mouse strain carrying a reporter gene. In adult MMTV-Cre mice expression of the transgene was confined to striated ductal cells of the salivary gland and mammary epithelial cells in virgin and lactating mice. Expression of WAP-Cre was only detected in alveolar epithelial cells of mammary tissue during lactation. Analysis of transgenic mice carrying both the MMTV-Cre and the reporter transgenes revealed recombination in every tissue. In contrast, recombination mediated by Cre under control of the WAP gene promoter was largely restricted to the mammary gland but occasionally observed in the brain. These results show that transgenic mice with WAP-Cre but not MMTV-Cre can be used as a powerful tool to study gene function in development and tumorigenesis in the mammary gland. PMID:9336464

Wagner, K U; Wall, R J; St-Onge, L; Gruss, P; Wynshaw-Boris, A; Garrett, L; Li, M; Furth, P A; Hennighausen, L

1997-01-01

188

The first korean patient with potocki-shaffer syndrome: a rare cause of multiple exostoses.  

PubMed

Potocki-Shaffer syndrome (PSS, OMIM #601224) is a rare contiguous gene deletion syndrome caused by haploinsufficiency of genes located on the 11p11.2p12. Affected individuals have a number of characteristic features including multiple exostoses, biparietal foramina, abnormalities of genitourinary system, hypotonia, developmental delay, and intellectual disability. We report here on the first Korean case of an 8-yr-old boy with PSS diagnosed by high resolution microarray. Initial evaluation was done at age 6 months because of a history of developmental delay, hypotonia, and dysmorphic face. Coronal craniosynostosis and enlarged parietal foramina were found on skull radiographs. At age 6 yr, he had severe global developmental delay. Multiple exostoses of long bones were detected during a radiological check-up. Based on the clinical and radiological features, PSS was highly suspected. Subsequently, chromosomal microarray analysis identified an 8.6 Mb deletion at 11p11.2 [arr 11p12p11.2 (Chr11:39,204,770-47,791,278)×1]. The patient continued rehabilitation therapy for profound developmental delay. The progression of multiple exostosis has being monitored. This case confirms and extends data on the genetic basis of PSS. In clinical and radiologic aspect, a patient with multiple exostoses accompanying with syndromic features, including craniofacial abnormalities and mental retardation, the diagnosis of PSS should be considered. PMID:25653495

Sohn, Young Bae; Yim, Shin-Young; Cho, Eun-Hae; Kim, Ok-Hwa

2015-02-01

189

The First Korean Patient with Potocki-Shaffer Syndrome: A Rare Cause of Multiple Exostoses  

PubMed Central

Potocki-Shaffer syndrome (PSS, OMIM #601224) is a rare contiguous gene deletion syndrome caused by haploinsufficiency of genes located on the 11p11.2p12. Affected individuals have a number of characteristic features including multiple exostoses, biparietal foramina, abnormalities of genitourinary system, hypotonia, developmental delay, and intellectual disability. We report here on the first Korean case of an 8-yr-old boy with PSS diagnosed by high resolution microarray. Initial evaluation was done at age 6 months because of a history of developmental delay, hypotonia, and dysmorphic face. Coronal craniosynostosis and enlarged parietal foramina were found on skull radiographs. At age 6 yr, he had severe global developmental delay. Multiple exostoses of long bones were detected during a radiological check-up. Based on the clinical and radiological features, PSS was highly suspected. Subsequently, chromosomal microarray analysis identified an 8.6 Mb deletion at 11p11.2 [arr 11p12p11.2 (Chr11:39,204,770-47,791,278)×1]. The patient continued rehabilitation therapy for profound developmental delay. The progression of multiple exostosis has being monitored. This case confirms and extends data on the genetic basis of PSS. In clinical and radiologic aspect, a patient with multiple exostoses accompanying with syndromic features, including craniofacial abnormalities and mental retardation, the diagnosis of PSS should be considered. PMID:25653495

2015-01-01

190

Multiplication 2  

NSDL National Science Digital Library

Try some harder multiplication activities! Missing Factor Meteor Blasting Complete the Missing Step Batter s Up Multiplication Sum Sense Multiplication Challenge a Friend to Grand Prix Multiplication Double Digit Multiplication https://embed.espresso.co.uk/espresso/embed/images/logo_espresso.gif ) no-repeat center center"

Lerdahl, Miss

2010-11-16

191

Multiplication table  

NSDL National Science Digital Library

Help learn First learn go over your Learn The Multiplication table now get some extra help Learn The Multiplication table have fun Learn The multiplication table with games good luck practice test pre test pre test final test ...

Bgross

2011-04-14

192

Multiplication Rocks!!!  

NSDL National Science Digital Library

Let's practice what we've learned about multiplication. Play at least one game in each of the categories. Times Table Practice: Design the Ultimate Fashion Outfit with Math Models Blast the Meteors before they destroy the ship in Meteor Multiplication More Multiplication: Batter's Up in Baseball Multiplication Win $1,000,000 in Who Wants To Be A Millionaire? ...

Peake, Mrs.

2009-04-15

193

Multiplication Maddness!  

NSDL National Science Digital Library

Review your multiplication skills with these fun and exciting games! To excercise your brain, start with a review of your multiplication facts with Matching Multiplication! Step up to the plate and use your best swing! It\\'s time to play Batter s Up Baseball! Battle through the multiplication problems to save the princess. Begin your journey of Castle Quest! ...

Morgan, Ms.

2008-04-03

194

Multiplication Practice  

NSDL National Science Digital Library

Practice Your Multiplication Skills! Watch These Fun Multiplication Videos *Need a review? Watch the Multiplication is Repeated Addition Video Four Legged Zoo I ve Got 6 Ready or Not Here I Come (5s) Twelve Toes Elementary My Dear 2s Figure 8 Lucky 7s Video My Hero Zero Naughty Number 9 Practice your multiplication skills with these fun games: Multiplication Facts Become the king of multiplication with Castle Quest Dish up some ice cream with Crazy Cone Multiplication. Earn disco moves to make a dinosaur dance with Disco Dino. Design your own granny and make her race in a ...

Miss Lerdahl

2010-02-23

195

Parenting Multiples  

MedlinePLUS

... for parents of multiples can help, as can marriage counselors or clergy. It's important that you do ... and from early on it's apparent that their relationship is special. Parenting multiples has its ... reviewed: October 2013 Back

196

Finger Multiplication  

ERIC Educational Resources Information Center

Multiplication facts are difficult to teach. Therefore many researchers have put a great deal of effort into finding multiplication strategies. Sherin and Fuson (2005) provided a good survey paper on the multiplication strategies research area. Kolpas (2002), Rendtorff (1908), Dabell (2001), Musser (1966) and Markarian (2009) proposed the finger…

Simanihuruk, Mudin

2011-01-01

197

Multiplication Mania!  

NSDL National Science Digital Library

Fun games to practice your multiplication facts! Need a refreshing break? Come on over to the lemonade stand...Lemonade Stand At the beach, you can swim, sun, and practice your multiplication facts...Beach Multiplication How fast are you? Click here to...Race the Clock Do you have your spacesuit and astronaut food, are you ready for your...Mission to the Moon ...

Hoeman, Ms.

2008-09-18

198

Lae1 regulates expression of multiple secondary metabolite gene clusters in Fusarium verticillioides.  

PubMed

The filamentous fungus Fusarium verticillioides can cause disease of maize and is capable of producing fumonisins, a family of toxic secondary metabolites linked to esophageal cancer and neural tube defects in humans and lung edema in swine and leukoencephalomalacia in equines. The expression of fumonisin biosynthetic genes is influenced by broad-domain transcription factors (global regulators) and Fum21, a pathway-specific transcription factor. LaeA is a global regulator that in Aspergillus nidulans, affects the expression of multiple secondary metabolite gene clusters by modifying heterochromatin structure. Here, we employed gene deletion analysis to assess the effect of loss of a F. verticillioides laeA orthologue, LAE1, on genome-wide gene expression and secondary metabolite production. Loss of Lae1 resulted in reduced expression of gene clusters responsible for synthesis of the secondary metabolites bikaverin, fumonisins, fusaric acid and fusarins as well as two clusters for which the corresponding secondary metabolite is unknown. Analysis of secondary metabolites revealed that, in contrast to a previously described Fusarium fujikuroi lae1 mutant, bikaverin production is reduced. Fumonisin production is unchanged in the F. verticillioides lae1 mutant. Complementation of the F. verticillioides mutant resulted in increased fumonisin production. PMID:22713715

Butchko, Robert A E; Brown, Daren W; Busman, Mark; Tudzynski, Bettina; Wiemann, Philipp

2012-08-01

199

Multiplication Frenzy!  

NSDL National Science Digital Library

Let's practice multiplication! First, try to win the first place medal in the Fish Race. Then, test your skills by blowing up meteors by getting your multiplication tables right in Meteor Buster. Last, don't let the ants eat your lunch in The Ants Go Marching. ...

Burks, Ms.

2010-01-27

200

Multiple Sclerosis  

MedlinePLUS

Multiple sclerosis (MS) is a nervous system disease that affects your brain and spinal cord. It damages the myelin sheath, the ... and your body, leading to the symptoms of MS. They can include Visual disturbances Muscle weakness Trouble ...

201

Multiple myeloma  

MedlinePLUS

Plasma cell dyscrasia; Plasma cell myeloma; Malignant plasmacytoma; Plasmacytoma of bone; Myeloma - multiple ... myeloma most commonly causes a low red blood cell count ( anemia ), which can lead to fatigue and ...

202

Multiple Myeloma  

MedlinePLUS

... my-a-low-ma) is a kind of cancer in the bone marrow. Bone marrow is the tissue inside the bones where new blood cells are ... to take a very small sample of the tissue inside your bone. This is called a bone marrow aspiration. It can be done in your ... How is multiple myeloma treated? There is currently no cure for multiple myeloma. Treatment includes medicine to relieve ...

203

Sustained transcription of the immediate early gene Arc in the dentate gyrus after spatial exploration.  

PubMed

After spatial exploration in rats, Arc mRNA is expressed in ?2% of dentate gyrus (DG) granule cells, and this proportion of Arc-positive neurons remains stable for ?8 h. This long-term presence of Arc mRNA following behavior is not observed in hippocampal CA1 pyramidal cells. We report here that in rats ?50% of granule cells with cytoplasmic Arc mRNA, induced some hours previously during exploration, also show Arc expression in the nucleus. This suggests that recent transcription can occur long after the exploration behavior that elicited it. To confirm that the delayed nuclear Arc expression was indeed recent transcription, Actinomycin D was administered immediately after exploration. This treatment resulted in inhibition of recent Arc expression both when evaluated shortly after exploratory behavior as well as after longer time intervals. Together, these data demonstrate a unique kinetic profile for Arc transcription in hippocampal granule neurons following behavior that is not observed in other cell types. Among a number of possibilities, this sustained transcription may provide a mechanism that ensures that the synaptic connection weights in the sparse population of granule cells recruited during a given behavioral event are able to be modified. PMID:23345235

Ramirez-Amaya, Victor; Angulo-Perkins, Arafat; Chawla, Monica K; Barnes, Carol A; Rosi, Susanna

2013-01-23

204

Induction of the plasticity-associated immediate early gene Arc by stress and hallucinogens  

E-print Network

whether trophic factor signalling through brain- derived neurotrophic factor (BDNF) contributes induced Arc mRNA levels within the neo- cortex. BDNF infusion into the neocortex led to a robust up was significantly decreased in inducible BDNF knockout mice with an adult-onset, forebrain specific BDNF loss

Vaidya, Vidita

205

Sex Differences in Social Interaction in Rats: Role of the Immediate-Early Gene zif268  

Microsoft Academic Search

Given both the high prevalence of anxiety disorders in women and the fact that little is known about the mechanisms of gender differences in anxiety, our primary aim in this study was to investigate the neurobiological mechanisms underlying sex differences in social anxiety-like behavior in rats. Through the use of zif268 antisense oligodeoxynucleotides (zif ASO), we induced a temporary downregulation

Ashley Stack; Nicole Carrier; David Dietz; Fiona Hollis; Jamie Sorenson; Mohamed Kabbaj

2010-01-01

206

Current aspects of therapeutic reduction mammaplasty for immediate early breast cancer management: An update  

PubMed Central

Breast-conservation surgery (BCS) is established as a safe surgical treatment for most patients with early breast cancer. Recently, advances in oncoplastic techniques are capable of preserving the breast form and quality of life. Although most BCS defects can be managed with primary closure, the aesthetic outcome may be unpredictable. Among technical options, therapeutic reduction mammaplasty (TRM) remains a useful procedure since the BCS defect can be repaired and the preoperative appearance can be improved, resulting in more proportional breasts. As a consequence of rich breast tissue vascularization, the greater part of reduction techniques have based their planning on preserving the pedicle of the nipple-areola complex after tumor removal. Reliable circulation and improvement of a conical shape to the breast are commonly described in TRM reconstructions. With an immediate approach, the surgical process is smooth since both procedures can be carried out in one operative setting. Additionally, it permits wider excision of the tumor, with a superior mean volume of the specimen and potentially reduces the incidence of margin involvement. Regardless of the fact that there is no consensus concerning the best TRM technique, the criteria is determined by the surgeon’s experience, the extent/location of glandular tissue resection and the size of the defect in relation to the size of the remaining breast. The main advantages of the technique utilized should include reproducibility, low interference with the oncological treatment and long-term results. The success of the procedure depends on patient selection, coordinated planning and careful intra-operative management. PMID:24527398

Munhoz, Alexandre Mendonça; Montag, Eduardo; Gemperli, Rolf

2014-01-01

207

Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes  

NASA Technical Reports Server (NTRS)

Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

De Luca, Laurival A Jr; Xu, Zhice; Schoorlemmer, Guus H M.; Thunhorst, Robert L.; Beltz, Terry G.; Menani, Jose V.; Johnson, Alan Kim

2002-01-01

208

Immediate early responses of avian tracheal epithelial cells to infection with highly pathogenic avian influenza  

Technology Transfer Automated Retrieval System (TEKTRAN)

Highly pathogenic (HP) avian influenza viruses (AIV) present an on going threat to the U.S. poultry industry. In order to develop new AIV control strategies it is necessary to understand the underlying mechanism of viral infection. Because the early events of AIV infection can occur on tracheal ep...

209

Immediate Early Transcription Activation by Salicylic Acid via the Cauliflower Mosaic Virus as-1 Element  

Microsoft Academic Search

Transgenic tobacco plants carrying a number of regulatory sequences derived from the cauliflower mosaic virus 35s promoter were tested for their response to treatment with salicylic acid (SA), an endogenous signal involved in plant defense responses. PGlucuronidase (GUS) gene fusions with the full-length (-343 to +8) 35s promoter or the -90 truncation were found to be induced by SA. Time

Xiao-Feng Qin; Loreto Holuigue; Diana M. Horvath; Nam-Hai Chua

1994-01-01

210

Immediate Early Responses of Avian Tracheal Epithelial Cells to Infection with Highly Pathogenic Avian Influenza Virus  

Microsoft Academic Search

Highly pathogenic (HP) avian influenza viruses (AIV) present an ongoing threat to the world poultry industry. In order to develop new AIV control strategies it is necessary to understand the underlying mechanism of viral infection at mucosal respiratory sites. Chicken and duck tracheal epithelial cells systems (TEC) were developed to study early host responses to AIV infection on TEC. Infection

L. Sarmento; M. Pantin-Jackwood; D. R. Kapczynski; D. E. Swayne; C. L. Afonso

2008-01-01

211

Multiplication Madness  

NSDL National Science Digital Library

Get ready for some multplication fun! Test your skills with Go Granny Go!. If you are ready for a challenge, try Jungle Jim goes fishing. Send a knight flying with your knowledge of multiplication facts in Knight Fight! If you are feeling really smart, try Knight Quest. Have some fun with Wack a Mole and Workin Out with Wade! ...

Chase, Ms.

2010-11-12

212

Multiplication Madness!  

NSDL National Science Digital Library

Practice multiplying with these fun math games! Warm up your multiplication skills with Jungle Jim as you help him multiply with the monkeys! Begin with multiplying by 2 and move up. Next, quench your thirst with the Lemonade Game as you help calculate how much money you should get for each cup of lemonade you sell. Use the number keys ...

Schieffer, Miss

2009-04-21

213

Multiple Sclerosis.  

ERIC Educational Resources Information Center

This module on multiple sclerosis is intended for use in inservice or continuing education programs for persons who administer medications in long-term care facilities. Instructor information, including teaching suggestions, and a listing of recommended audiovisual materials and their sources appear first. The module goal and objectives are then…

Plummer, Nancy; Michael, Nancy, Ed.

214

Lattice Multiplication  

NSDL National Science Digital Library

Leonardo Fibonacci's multiplication algorithm arrays the digits of multiplicands along a rectangular lattice. Read an explanation of the technique, see a few worked examples, and watch the method in action with a Java applet. Clicking a little off-center of any digit of a multiplicand (left to increase, right to decrease) instantly changes resulting products and sums throughout the lattice.

Interactive Math Miscellany And Puzzles, Alexander B.

2011-01-01

215

Multiple Pregnancy  

MedlinePLUS Videos and Cool Tools

... be looking for, and will explore the statistics, health and psychological risks to parents, children and siblings, and other issues ... are receiving infertility treatment, which carries a higher risk of multiple pregnancy ... to US health statistics, The twin birth rate has increased by ...

216

Effect of multiple mutations in tricarboxylic acid cycle and one-carbon metabolism pathways on Edwardsiella ictaluri pathogenesis.  

PubMed

Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen causing enteric septicemia of catfish (ESC). We have shown recently that tricarboxylic acid cycle (TCA) and one-carbon (C1) metabolism are involved in E. ictaluri pathogenesis. However, the effect of multiple mutations in these pathways is unknown. Here, we report four novel E. ictaluri mutants carrying double gene mutations in TCA cycle (Ei?mdh?sdhC, Ei?frdA?sdhC), C1 metabolism (Ei?glyA?gcvP), and both TCA and C1 metabolism pathways (Ei?gcvP?sdhC). In-frame gene deletions were constructed by allelic exchange and mutants' virulence and vaccine efficacy were evaluated using in vivo bioluminescence imaging (BLI) as well as end point mortality counts in catfish fingerlings. Results indicated that all the double gene mutants were attenuated compared to wild-type (wt) E. ictaluri. There was a 1.39-fold average reduction in bioluminescence, and hence bacterial numbers, from all the mutants except for Ei?frdA?sdhC at 144 h post-infection. Vaccination with mutants was very effective in protecting channel catfish against subsequent infection with virulent E. ictaluri 93-146 strain. In particular, immersion vaccination resulted in complete protection. Our results provide further evidence on the importance of TCA and C1 metabolism pathways in bacterial pathogenesis. PMID:24418045

Dahal, N; Abdelhamed, H; Lu, J; Karsi, A; Lawrence, M L

2014-02-21

217

Multiple nuclear localization signals mediate nuclear localization of the GATA transcription factor AreA.  

PubMed

The Aspergillus nidulans GATA transcription factor AreA activates transcription of nitrogen metabolic genes in response to nitrogen limitation and is known to accumulate in the nucleus during nitrogen starvation. Sequence analysis of AreA revealed multiple nuclear localization signals (NLSs), five putative classical NLSs conserved in fungal AreA orthologs but not in the Saccharomyces cerevisiae functional orthologs Gln3p and Gat1p, and one putative noncanonical RRX33RXR bipartite NLS within the DNA-binding domain. In order to identify the functional NLSs in AreA, we constructed areA mutants with mutations in individual putative NLSs or combinations of putative NLSs and strains expressing green fluorescent protein (GFP)-AreA NLS fusion genes. Deletion of all five classical NLSs individually or collectively did not affect utilization of nitrogen sources or AreA-dependent gene expression and did not prevent AreA nuclear localization. Mutation of the bipartite NLS conferred the inability to utilize alternative nitrogen sources and abolished AreA-dependent gene expression likely due to effects on DNA binding but did not prevent AreA nuclear localization. Mutation of all six NLSs simultaneously prevented AreA nuclear accumulation. The bipartite NLS alone strongly directed GFP to the nucleus, whereas the classical NLSs collaborated to direct GFP to the nucleus. Therefore, AreA contains multiple conserved NLSs, which show redundancy and together function to mediate nuclear import. The noncanonical bipartite NLS is conserved in GATA factors from Aspergillus, yeast, and mammals, indicating an ancient origin. PMID:24562911

Hunter, Cameron C; Siebert, Kendra S; Downes, Damien J; Wong, Koon Ho; Kreutzberger, Sara D; Fraser, James A; Clarke, David F; Hynes, Michael J; Davis, Meryl A; Todd, Richard B

2014-04-01

218

Multiple Nuclear Localization Signals Mediate Nuclear Localization of the GATA Transcription Factor AreA  

PubMed Central

The Aspergillus nidulans GATA transcription factor AreA activates transcription of nitrogen metabolic genes in response to nitrogen limitation and is known to accumulate in the nucleus during nitrogen starvation. Sequence analysis of AreA revealed multiple nuclear localization signals (NLSs), five putative classical NLSs conserved in fungal AreA orthologs but not in the Saccharomyces cerevisiae functional orthologs Gln3p and Gat1p, and one putative noncanonical RRX33RXR bipartite NLS within the DNA-binding domain. In order to identify the functional NLSs in AreA, we constructed areA mutants with mutations in individual putative NLSs or combinations of putative NLSs and strains expressing green fluorescent protein (GFP)-AreA NLS fusion genes. Deletion of all five classical NLSs individually or collectively did not affect utilization of nitrogen sources or AreA-dependent gene expression and did not prevent AreA nuclear localization. Mutation of the bipartite NLS conferred the inability to utilize alternative nitrogen sources and abolished AreA-dependent gene expression likely due to effects on DNA binding but did not prevent AreA nuclear localization. Mutation of all six NLSs simultaneously prevented AreA nuclear accumulation. The bipartite NLS alone strongly directed GFP to the nucleus, whereas the classical NLSs collaborated to direct GFP to the nucleus. Therefore, AreA contains multiple conserved NLSs, which show redundancy and together function to mediate nuclear import. The noncanonical bipartite NLS is conserved in GATA factors from Aspergillus, yeast, and mammals, indicating an ancient origin. PMID:24562911

Hunter, Cameron C.; Siebert, Kendra S.; Downes, Damien J.; Wong, Koon Ho; Kreutzberger, Sara D.; Fraser, James A.; Clarke, David F.; Hynes, Michael J.; Davis, Meryl A.

2014-01-01

219

Multiples Grid  

NSDL National Science Digital Library

This problem reinforces a learner's understanding of factors and multiples. Students are presented with the hundred grid or parts of the grid where specific numbers have been shaded and must find out which factors have been chosen in order to produce the shading. A link to a spreadsheet which shades the squares according to the chosen factors, can be used by students to check their hypotheses. The Teachers' Notes page offers rationale, suggestions for implementation, discussion questions, and ideas for extension and support.

220

Multiplication Mania!  

NSDL National Science Digital Library

You\\'ve been practicing your multiplication facts, these games will help you develop your skills! First, you will read some stories that may help you remember your 9 X Tables better. Read through these stories and pick your favorite to share with a partner sitting close to you. Click here 9 X Tables Stories With this game, you need to save the mokeys apples so the crocodile wont eat ...

Reeves, Mrs.

2006-11-06

221

Multiple myeloma  

PubMed Central

Multiple myeloma is a clonal plasma cell malignancy that accounts for slightly more than 10% of all hematologic cancers. In this paper, we present a historically focused review of the disease, from the description of the first case in 1844 to the present. The evolution of drug therapy and stem-cell transplantation for the treatment of myeloma, as well as the development of new agents, is discussed. We also provide an update on current concepts of diagnosis and therapy, with an emphasis on how treatments have emerged from a historical perspective after certain important discoveries and the results of experimental studies. PMID:18332230

Rajkumar, S. Vincent

2008-01-01

222

STABILITY OF MULTIPLICATION OPERATORS AND MULTIPLICATION  

E-print Network

STABILITY OF MULTIPLICATION OPERATORS AND MULTIPLICATION SEMIGROUPS FATIH BAYAZIT, RETHA HEYMANN Abstract. We investigate uniform, strong, weak and almost weak stability of multiplication semigroups [13, Section 4] and [16]. Qualitative properties of such semigroups, e.g. various stability concepts

223

Modeling Multiplication with Fractions  

NSDL National Science Digital Library

Students will relate multiplication strategies with fractions through problem solving situations. This lesson connects prior understanding of multiplication and equal groups to multiplication of fractions.

Joseph Ratasky

2012-08-18

224

Unc119 gene deletion partially rescues the GRK1 transport defect of Pde6d-/- cones  

PubMed Central

PrBP/?, encoded by the Pde6d gene, is an isoprenyl-binding protein that regulates trafficking of isoprenylated proteins, such as PDE6 and GRK1, from photoreceptor inner segments to outer segments. Trafficking of PDE6 and GRK1 to photoreceptor outer segments is impeded in Pde6d knockout mice. In Pde6d-/-cones, PDE6 and GRK1 are nearly undetectable and the b-wave amplitudes of photopic ERGs in Pde6d-/- mice are reduced by over 50%. We reported recently that UNC119, a homolog of PrBP/? highly expressed in photoreceptors, functions as an acyl-binding protein and regulates transport of G-proteins in sensory neurons. Since both PrBP/? and UNC119 regulate peripheral protein trafficking in photoreceptors, we generated Pde6d;Unc119 double knockout mice in order to study how PrBP/? and UNC119 may interact. Surprisingly, knockout of Unc119 partially reversed the transport defect of GRK1 in cone photoreceptors caused by deletion of Pde6d, and the b-wave amplitudes of photopic ERGs in the double knockout mice were significantly higher than those in the Pde6d-/- mice. These results suggest that cone transport of isoprenylated and acylated proteins is interdependent. PMID:24664735

Zhang, Houbin; Frederick, Jeanne M.; Baehr, Wolfgang

2014-01-01

225

Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis.  

PubMed

The functions of many open reading frames (ORFs) identified in genome-sequencing projects are unknown. New, whole-genome approaches are required to systematically determine their function. A total of 6925 Saccharomyces cerevisiae strains were constructed, by a high-throughput strategy, each with a precise deletion of one of 2026 ORFs (more than one-third of the ORFs in the genome). Of the deleted ORFs, 17 percent were essential for viability in rich medium. The phenotypes of more than 500 deletion strains were assayed in parallel. Of the deletion strains, 40 percent showed quantitative growth defects in either rich or minimal medium. PMID:10436161

Winzeler, E A; Shoemaker, D D; Astromoff, A; Liang, H; Anderson, K; Andre, B; Bangham, R; Benito, R; Boeke, J D; Bussey, H; Chu, A M; Connelly, C; Davis, K; Dietrich, F; Dow, S W; El Bakkoury, M; Foury, F; Friend, S H; Gentalen, E; Giaever, G; Hegemann, J H; Jones, T; Laub, M; Liao, H; Liebundguth, N; Lockhart, D J; Lucau-Danila, A; Lussier, M; M'Rabet, N; Menard, P; Mittmann, M; Pai, C; Rebischung, C; Revuelta, J L; Riles, L; Roberts, C J; Ross-MacDonald, P; Scherens, B; Snyder, M; Sookhai-Mahadeo, S; Storms, R K; Véronneau, S; Voet, M; Volckaert, G; Ward, T R; Wysocki, R; Yen, G S; Yu, K; Zimmermann, K; Philippsen, P; Johnston, M; Davis, R W

1999-08-01

226

Does gene deletion of AMPA GluA1 phenocopy features of schizoaffective disorder?  

PubMed Central

Glutamatergic dysfunction is strongly implicated in schizophrenia and mood disorders. GluA1 knockout (KO) mice display schizophrenia- and depression-related abnormalities. Here, we asked whether GluA1 KO show mania-related abnormalities. KO were tested for behavior in approach/avoid conflict tests, responses to repeated forced swim exposure, and locomotor responses under stress and after psychostimulant treatment. The effects of rapid dopamine depletion and treatment with lithium or GSK-3? inhibitor on KO locomotor hyperactivity were tested. Results showed that KO exhibited novelty- and stress-induced locomotor hyperactivity, reduced forced swim immobility and alterations in approach/avoid conflict tests. Psychostimulant treatment and dopamine depletion exacerbated KO locomotor hyperactivity. Lithium, but not GSK-3? inhibitor, treatment normalized KO anxiety-related behavior and partially reversed hyperlocomotor behavior, and also reversed elevated prefrontal cortex levels of phospho-MARCKS and phospho-neuromodulin. Collectively, these findings demonstrate mania-related abnormalities in GluA1 KO and, combined with previous findings, suggest this mutant may provide a novel model of features of schizoaffective disorder. PMID:20699120

Fitzgerald, Paul J.; Barkus, Chris; Feyder, Michael; Wiedholz, Lisa M.; Chen, Yi-Chyan; Karlsson, Rose-Marie; Machado-Vieira, Rodrigo; Graybeal, Carolyn; Sharp, Trevor; Zarate, Carlos; Harvey-White, Judith; Du, Jing; Sprengel, Rolf; Gass, Peter; Bannerman, David; Holmes, Andrew

2010-01-01

227

Coexistence of two ?-globin gene deletions in a Chinese girl with ?-thalassemia minor.  

PubMed

This study reports a rare case of ?(41/42,Cap)/?(A) genotype in a girl with ?-thalassemia (?-thal) minor. The 13-month-old Chinese proband suffered anemia, diarrhea, stunted growth and emaciation. The routine polymerase chain reaction-reverse dot-blot (PCR-RDB) test result for ?-thal mutations indicated that she was a compound heterozygote for ?(41/42) and ?(Cap). However, the complete blood cell (CBC) test gave the following results: mean corpuscular volume (MCV) 79.8 fL, mean corpuscular hemoglobin (MCH) 19.9 pg, with a Hb A2 value of 5.66%, suggesting that the proband also was ?-thal minor. The proband's father showed typical microcytic hypochromic anemia characteristics with a decreased MCV and MCH (63.1 fL and 20.9 pg, respectively) and an increased level of Hb A2 (5.60%), while the proband's mother had normal levels of MCV, MCH and Hb A2. The PCR-RDB test result showed her father was also a compound heterozygote for the ?(41/42) (HBB: c.126_129delCTTT) and ?(Cap) (HBB: c.-11_-8delAAAC) mutations and her mother was normal. Finally, DNA sequencing identified that the ?(41/42) and ?(Cap) mutations of the proband were inherited from her father and located on one ?-globin gene, suggesting that the proband's genotype is ?(41/42,Cap)/?(A). PMID:24200214

Huang, Ge; Li, Ping; Li, Yun-Xiong; Ye, Lian-Zhen

2014-01-01

228

Glyoxalase I Gene Deletion Mutants of Leishmania donovani Exhibit Reduced Methylglyoxal Detoxification  

PubMed Central

Background Glyoxalase I is a metalloenzyme of the glyoxalase pathway that plays a central role in eliminating the toxic metabolite methyglyoxal. The protozoan parasite Leishmania donovani possesses a unique trypanothione dependent glyoxalase system. Principal Findings Analysis of the L. donovani GLOI sequence predicted a mitochondrial targeting sequence, suggesting that the enzyme is likely to be targeted to the mitochondria. In order to determine definitively the intracellular localization of GLOI in L. donovani, a full-length GLOI gene was fused to green fluorescent protein (GFP) gene to generate a chimeric construct. Confocal microscopy of L. donovani promastigotes carrying this chimeric construct and immunofluorescence microscopy using anti-GLOI antibodies demonstrated that GLOI is localized in the kinetoplast of the parasite apart from the cytosol. To study the physiological role of GLOI in Leishmania, we first created promastigote mutants heterozygous for GLOI by targeted gene replacement using either hygromycin or neomycin phosphotransferases as selectable markers. Heterozygous mutants of L. donovani display a slower growth rate, have lower glyoxalase I activity and have reduced ability to detoxify methylglyoxal in comparison to the wild-type parasites. Complementation of the heterozygous mutant with an episomal GLOI construct showed the restoration of heterozygous mutant phenotype nearly fully to that of the wild-type. Null mutants were obtained only after GLOI was expressed from an episome in heterozygous mutants. Conclusions We for the first time report localization of GLOI in L. donovani in the kinetoplast. To study the physiological role of GLOI in Leishmania, we have generated GLOI attenuated strains by targeted gene replacement and report that GLOI is likely to be an important gene since GLOI mutants in L. donovani showed altered phenotype. The present data supports that the GLOI plays an essential role in the survival of this pathogenic organism and that inhibition of the enzyme potentiates the toxicity of methylglyoxal. PMID:19710909

Chauhan, Swati C.; Madhubala, Rentala

2009-01-01

229

Identification of a PKP2 gene deletion in a family with arrhythmogenic right ventricular cardiomyopathy.  

PubMed

Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a primary heart muscle disease characterized by progressive myocardial loss, with fibro-fatty replacement, and high frequency of ventricular arrhythmias that can lead to sudden cardiac death. ARVC is a genetically determined disorder, usually caused by point mutations in components of the cardiac desmosome. Conventional mutation screening of ARVC genes fails to detect causative mutations in about 50% of index cases, suggesting a further genetic heterogeneity. We performed a genome-wide linkage study and a copy number variations (CNVs) analysis, using high-density SNP arrays, in an ARVC family showing no mutations in any of the desmosomal genes. The CNVs analysis identified a heterozygous deletion of about 122?kb on chromosome 12p11.21, including the entire plakophilin-2 gene and shared by all affected family members. It was not listed on any of available public CNVs databases and was confirmed by quantitative real-time PCR. This is the first SNP array-based genome-wide study leading to the identification of a CNV segregating with the disease phenotype in an ARVC family. This result underscores the importance of performing additional analysis for possible genomic deletions/duplications in ARVC patients without point mutations in known disease genes. PMID:23486541

Li Mura, Ilena Egle Astrid; Bauce, Barbara; Nava, Andrea; Fanciulli, Manuela; Vazza, Giovanni; Mazzotti, Elisa; Rigato, Ilaria; De Bortoli, Marzia; Beffagna, Giorgia; Lorenzon, Alessandra; Calore, Martina; Dazzo, Emanuela; Nobile, Carlo; Mostacciuolo, Maria Luisa; Corrado, Domenico; Basso, Cristina; Daliento, Luciano; Thiene, Gaetano; Rampazzo, Alessandra

2013-11-01

230

Rare large homozygous CFTR gene deletion in an Iranian patient with cystic fibrosis  

PubMed Central

Cystic fibrosis, a common autosomal recessive genetic disorder among Caucasians, is caused by defects in the transmembrane conductance regulatory (CFTR) gene. The analysis of CFTR gene mutations is useful to better characterize the disease, and for preconceptional screening, prenatal and preimplantation genetic diagnosis. Here we report the results of a genetic analysis in a 16-year-old boy from southwestern Iran diagnosed as having cystic fibrosis in infancy based on gastrointestinal and pulmonary manifestations, with positive sweat chloride tests. He lacked both normal and mutant forms of the fragment corresponding to the ?F508 allele in initial genetic studies. Multiplex ligation-dependent probe amplification-based testing revealed a homozygous deletion spanning exons 4 to 10 of the CFTR gene. We predict an in-frame deletion removing 373 amino acids based on our sequencing results. Determining CFTR gene mutations in patients and their family members would be helpful to prevent the occurrence of new cases, especially in populations in which consanguinity is common. PMID:25133155

Farjadian, Shirin; Moghtaderi, Mozhgan; Zuntini, Roberta; Ferrari, Simona

2014-01-01

231

Partial Gene Deletions of PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies  

PubMed Central

Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal neuropathy that is commonly caused by a reciprocal 1.5?Mb deletion on chromosome 17p11.2, at the site of the peripheral myelin protein 22 (PMP22) gene. Other patients with similar phenotypes have been shown to harbor point mutations or small deletions, although there is some clinical variation across these patients. In this report, we describe a case of HNPP with copy number changes in exon or promoter regions of PMP22. Multiplex ligation-dependent probe analysis revealed an exon 1b deletion in the patient, who had been diagnosed with HNPP in the first decade of life using molecular analysis. PMID:25506001

Cho, Sun-Mi; Kim, Yoonjung; Lee, Sang Guk; Yang, Jin-Young

2014-01-01

232

Identification of a PKP2 gene deletion in a family with arrhythmogenic right ventricular cardiomyopathy  

PubMed Central

Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a primary heart muscle disease characterized by progressive myocardial loss, with fibro-fatty replacement, and high frequency of ventricular arrhythmias that can lead to sudden cardiac death. ARVC is a genetically determined disorder, usually caused by point mutations in components of the cardiac desmosome. Conventional mutation screening of ARVC genes fails to detect causative mutations in about 50% of index cases, suggesting a further genetic heterogeneity. We performed a genome-wide linkage study and a copy number variations (CNVs) analysis, using high?density SNP arrays, in an ARVC family showing no mutations in any of the desmosomal genes. The CNVs analysis identified a heterozygous deletion of about 122?kb on chromosome 12p11.21, including the entire plakophilin-2 gene and shared by all affected family members. It was not listed on any of available public CNVs databases and was confirmed by quantitative real-time PCR. This is the first SNP array-based genome-wide study leading to the identification of a CNV segregating with the disease phenotype in an ARVC family. This result underscores the importance of performing additional analysis for possible genomic deletions/duplications in ARVC patients without point mutations in known disease genes. PMID:23486541

Li Mura, Ilena Egle Astrid; Bauce, Barbara; Nava, Andrea; Fanciulli, Manuela; Vazza, Giovanni; Mazzotti, Elisa; Rigato, Ilaria; De Bortoli, Marzia; Beffagna, Giorgia; Lorenzon, Alessandra; Calore, Martina; Dazzo, Emanuela; Nobile, Carlo; Luisa Mostacciuolo, Maria; Corrado, Domenico; Basso, Cristina; Daliento, Luciano; Thiene, Gaetano; Rampazzo, Alessandra

2013-01-01

233

Development of an Unmarked Gene Deletion System for the Filamentous Fungi Aspergillus niger and Talaromyces versatilis  

PubMed Central

In this article, we present a method to delete genes in filamentous fungi that allows recycling of the selection marker and is efficient in a nonhomologous end-joining (NHEJ)-proficient strain. We exemplify the approach by deletion of the gene encoding the transcriptional regulator XlnR in the fungus Aspergillus niger. To show the efficiency and advantages of the method, we deleted 8 other genes and constructed a double mutant in this species. Moreover, we showed that the same principle also functions in a different genus of filamentous fungus (Talaromyces versatilis, basionym Penicillium funiculosum). This technique will increase the versatility of the toolboxes for genome manipulation of model and industrially relevant fungi. PMID:24682295

Delmas, Stéphane; Llanos, Agustina; Parrou, Jean-Luc; Kokolski, Matthew; Pullan, Steven T.; Shunburne, Lee

2014-01-01

234

Development of an unmarked gene deletion system for the filamentous fungi Aspergillus niger and Talaromyces versatilis.  

PubMed

In this article, we present a method to delete genes in filamentous fungi that allows recycling of the selection marker and is efficient in a nonhomologous end-joining (NHEJ)-proficient strain. We exemplify the approach by deletion of the gene encoding the transcriptional regulator XlnR in the fungus Aspergillus niger. To show the efficiency and advantages of the method, we deleted 8 other genes and constructed a double mutant in this species. Moreover, we showed that the same principle also functions in a different genus of filamentous fungus (Talaromyces versatilis, basionym Penicillium funiculosum). This technique will increase the versatility of the toolboxes for genome manipulation of model and industrially relevant fungi. PMID:24682295

Delmas, Stéphane; Llanos, Agustina; Parrou, Jean-Luc; Kokolski, Matthew; Pullan, Steven T; Shunburne, Lee; Archer, David B

2014-06-01

235

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas  

SciTech Connect

From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF[sub 1] mice irradiated with [sup 60]Co [gamma] rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of [sup 60]Co [gamma] rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from [gamma]-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5[prime] region of the mRb gene.

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1993-01-01

236

Molecular analysis of gene deletion in aniridia-Wilms tumor association  

Microsoft Academic Search

Hybrid clones were produced from the fusion of Chinese hamster cells and human fibroblasts from a patient with the aniridia-Wilms tumor association (AWTA). The DNA from the parental cells and the hybrid clones was screened by Southern blot and DNA hybridization with probes for the human insulin and Ha-ras-1 genes. Two alleles for the Ha-ras-1 gene were shown to exist

Effie E. Michalopoulos; P. J. Bevilacqua; Nancy Stokoe; V. E. Powers; H. F. Willard; W. H. Lewis

1985-01-01

237

Identification of Sites of STAT3 Action in the Female Reproductive Tract through Conditional Gene Deletion  

PubMed Central

The STAT3 transcription factor is a pleiotropic transducer of signalling by hormones, growth factors and cytokines that has been identified in the female reproductive tract from oocytes and granulosa cells of the ovary to uterine epithelial and stromal cells. In the present study we used transgenic models to investigate the importance of STAT3 for reproductive performance in these different tissues. The Cre-LoxP system was used to delete STAT3 in oocytes by crossing Stat3fl/fl with Zp3-cre+ mice, or in ovarian granulosa cells and uterine stroma by crossing with Amhr2-Cre+ mice. Surprisingly, deletion of STAT3 in oocytes had no effect on fertility indicating that the abundance of STAT3 protein in maturing oocytes and fertilized zygotes is not essential to these developmental stages. In Stat3fl/fl;Amhr2-cre+ females impaired fertility was observed through significantly fewer litters and smaller litter size. Ovulation rate, oocyte fertilization and development to blastocyst were unaffected in this line; however, poor recombination efficiency in granulosa cells had yielded no net change in STAT3 protein abundance. In contrast, uteri from these mice showed STAT3 protein depletion selectively from the stomal compartment. A significant reduction in number of viable fetuses on gestational day 18, increased fetal resorptions and disrupted placental morphology were evident causes of the reduced fertility. In conclusion, this study defines an important role for STAT3 in uterine stromal cells during embryo implantation and the development of a functional placenta. PMID:24983622

Robker, Rebecca L.; Watson, Laura N.; Robertson, Sarah A.; Dunning, Kylie R.; McLaughlin, Eileen A.; Russell, Darryl L.

2014-01-01

238

A mutation in the human phospholamban gene, deleting arginine 14, results in lethal, hereditary cardiomyopathy  

Microsoft Academic Search

The sarcoplasmic reticulum Ca2+-cycling proteins are key regulators of cardiac contractility, and alterations in sarcoplasmic reticulum Ca2+-cycling properties have been shown to be causal of familial cardiomyopathies. Through genetic screening of dilated cardiomyopathy patients, we identified a previously uncharacterized deletion of arginine 14 (PLN-R14Del) in the coding region of the phospholamban (PLN) gene in a large family with hereditary heart

Kobra Haghighi; Fotis Kolokathis; Anthony O. Gramolini; Jason R. Waggoner; Luke Pater; Roy A. Lynch; Guo-Chang Fan; Dimitris Tsiapras; Rohan R. Parekh; Gerald W. Dorn II; David H. Maclennan; Dimitrios Th. Kremastinos; Evangelia G. Kranias

2006-01-01

239

PAX3 gene deletion detected by microarray analysis in a girl with hearing loss  

PubMed Central

Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16?year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862?kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype. PMID:24839464

2014-01-01

240

A Partial Gene Deletion of SLC45A2 Causes Oculocutaneous Albinism in Doberman Pinscher Dogs  

PubMed Central

The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4?77,062,968–77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

Winkler, Paige A.; Gornik, Kara R.; Ramsey, David T.; Dubielzig, Richard R.; Venta, Patrick J.; Petersen-Jones, Simon M.; Bartoe, Joshua T.

2014-01-01

241

5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)  

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

242

Norrie disease resulting from a gene deletion: clinical features and DNA studies.  

PubMed Central

We describe a family in which two boys with Norrie disease have a deletion of the DXS7 locus. The deletion does not extend as far distally as the OTC or DXS84 loci. A full clinical description of the patients is given to help establish the range of manifestations of Norrie disease. There is no evidence of any other X linked disease in our patients. Images PMID:3162283

Donnai, D; Mountford, R C; Read, A P

1988-01-01

243

Severe osteopathia striata with cranial sclerosis in a female case with whole WTX gene deletion.  

PubMed

Osteopathia striata with cranial sclerosis (OSCS) is caused by truncating mutations or deletions in the X linked gene, WTX, and is characterized by sclerotic striations of the metaphyses and diaphyses of long bones, pelvis, and scapula, along with craniofacial hyperostosis. Females typically manifest with craniofacial dysmorphisms including macrocephaly, hypertelorism, depressed nasal bridge, and hypoplastic maxilla, often have cleft palate, and less often extra skeletal anomalies. Here we report on a sporadic female patient with OSCS born at 33 weeks, with coarse facies, an abnormal head shape, cleft palate, pyloric stenosis, a small VSD, and laryngotracheomalacia sufficiently severe to require tracheostomy placement. Characteristic radiologic findings were apparent on skeletal survey and cranial CT. At age 5, she showed mild delays in neurodevelopmental milestones. A deletion of WTX and the adjacent gene ASB12 was detected via MLPA and there was no skewing of the X-chromosome inactivation pattern (58:42). Neurodevelopmental delays can manifest in females with OSCS and deletions at the WTX locus, but deletion of the ASB12 gene in this case suggests it is unlikely to contribute to the pathogenesis of this complication. Implication of ASB12 in the patient's other unique features such as laryngotracheomalacia and pyloric stenosis is also unlikely. This case illustrates an early presentation of severe OSCS in a female without skewing of the X-chromosome inactivation pattern, emphasizing the variable expressivity of this disorder. PMID:23401208

Herman, Sean B; Holman, Sarah K; Robertson, Stephen P; Davidson, Lynn; Taragin, Benjamin; Samanich, Joy

2013-03-01

244

Enhanced Hydrogen Production in Escherichia coli Through Chemical Mutagenesis, Gene Deletion, and Transposon Mutagenesis  

E-print Network

, 6-bisphosphate by aldolase enzyme (Figure 2-2). The second stage involves the cleavage of six-carbon fructose to form two three-carbon molecules. In the last stage, ATP generation occurs; two molecules of pyruvate are released. Pyruvate... Aldolase Glyceraldehyde 3-phosphate dehydrogenase Phosphoglycerate kinase Phosphoglycerate mutase Enolase Pyruvate kinase Hyd-3 + FdhF First stage Second stage Third stage ATP ADP ATP ADP ADP ATP Pi, NAD+ ATP ADP ATP 9 Figure 2...

Garzon Sanabria, Andrea Juliana

2011-08-08

245

Increased antidepressant sensitivity after prefrontal cortex glucocorticoid receptor gene deletion in mice.  

PubMed

Our laboratory has previously shown that antidepressants regulate glucocorticoid receptor (GR) expression in the prefrontal cortex (PFC). To determine if PFC GR are involved in antidepressant effects on behavior or hypothalamic-pituitary-adrenocortical (HPA) axis activity, we treated floxed GR male mice with saline or 15 or 30mg/kg/d imipramine after PFC injection of adeno-associated virus 2/9 vectors transducing expression of Cre recombinase, to knock-down GR (PFC-GRKD), or green fluorescent protein (PFC-GFP), to serve as a control. The pattern of virally transduced GR deletion, common to all imipramine treatment groups, included the infralimbic, prelimbic, and medial anterior cingulate cortex at its largest extent, but was confined to the prelimbic and anterior cingulate cortex at its smallest extent. PFC GR knock-down increased behavioral sensitivity to imipramine, with imipramine-treated PFC-GRKD but not PFC-GFP mice exhibiting significant decreases in depression-like immobility during forced swim. PFC GR deletion did not alter general locomotor activity. The 30mg/kg dose of imipramine increased plasma corticosterone levels immediately after a 5-min forced swim, but PFC GR knock-down had no significant effect on plasma corticosterone under these experimental conditions. We conclude that PFC GR knock-down, likely limited to the medial prelimbic and anterior cingulate cortices, can increase behavioral sensitivity to antidepressants. These findings indicate a novel role for PFC GR in influencing antidepressant response. PMID:25447332

Hussain, Rifat J; Jacobson, Lauren

2015-01-01

246

A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.  

PubMed

The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4?77,062,968-77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

Winkler, Paige A; Gornik, Kara R; Ramsey, David T; Dubielzig, Richard R; Venta, Patrick J; Petersen-Jones, Simon M; Bartoe, Joshua T

2014-01-01

247

Left-sided cryptorchidism in mice with Wilms' tumour 1 gene deletion in gubernaculum testis.  

PubMed

A significant number of patients with germline mutations in the Wilms' tumour 1 (WT1) gene, a transcriptional factor essential for early renal and gonadal development, display cryptorchidism or non-scrotal testis position. We show here that WT1 is expressed during development in the mouse gubernacular ligament connecting the testis to the abdominal wall. Conditional inactivation of Wt1 in the gubernaculum (GU-WT1KO animals) resulted in abnormal differentiation of the gubernacula during development and, in about 40% of adult males, unilateral, always left-sided, cryptorchidism. At birth the right testis was positioned above the processus vaginalis and eventually moved into the developing scrotal pouch. In affected mutants the left testis was displaced from the normal position and the left processus vaginalis failed to form. The analysis of testicular descent at different stages of postnatal development suggests that unilateral cryptorchidism might be caused by asymmetry in the positions of the abdominal organs providing a higher degree of mobility for the left testis. Spermatogenesis in GU-WT1KO animals was blocked in cryptorchid testes located in a high pararenal position, but was maintained in testes located in a low abdominal position. Conditional inactivation of both Wt1 and androgen receptor (Ar) genes in the gubernaculum led to a bilateral asymmetrical cryptorchidism in all mutant males, with the left testis again located higher than the right one. The malformations induced by WT1 and AR deficiency in the gubernaculum and processus vaginalis, in combination with mechanical constraints on testis descent, determine the final position of the testes. In summary, our data indicate that WT1 is directly involved in gubernaculum differentiation. Taken together, the results of the study underline the complex nature of testicular descent, with an involvement in this process of several genetic factors and developmental events. PMID:23288785

Kaftanovskaya, Elena M; Neukirchner, Giselle; Huff, Vicki; Agoulnik, Alexander I

2013-05-01

248

Left-sided cryptorchidism in mice with Wilms Tumour 1 gene deletion in gubernaculum testis  

PubMed Central

A significant number of patients with germline mutations in the Wilms tumour 1 (WT1) gene, a transcriptional factor essential for early renal and gonadal development, displays cryptorchidism or non-scrotal testis position. We show here that WT1 is expressed during development in the mouse gubernacular ligament connecting the testis to the abdominal wall. Conditional inactivation of Wt1 in the gubernaculum (GU-WT1KO animals) resulted in abnormal differentiation of the gubernacula during development and in about 40 % adult males, unilateral, always left-sided, cryptorchidism. At birth the right testis was positioned above the processus vaginalis and eventually moved into the developing scrotal pouch. In affected mutants the left testis was displaced from the normal position and the left processus vaginalis failed to form. The analysis of testicular descent at different stages of postnatal development suggests that the unilateral cryptorchidism might be caused by the asymmetry in the position of abdominal organs providing a higher degree of mobility for the left testis. Spermatogenesis in GU-WT1KO animals was blocked in cryptorchid testes located in a high pararenal position but was maintained in testes located in a low abdominal position. Conditional inactivation of both Wt1 and androgen receptor (Ar) genes in gubernaculum led to a bilateral asymmetrical cryptorchidism in all mutant males with the left testis again located higher than the right one. The malformations induced by WT1 and AR deficiency in gubernaculum and processus vaginalis, in combination with mechanical constraints on testis descent, determine the final position of the testes. In summary, our data indicate that WT1 is directly involved in gubernaculum differentiation. Taken together the results of the study underline the complex nature of testicular descent with an involvement in this process of several genetic factors and developmental events. PMID:23288785

Kaftanovskaya, Elena M.; Neukirchner, Giselle; Huff, Vicki; Agoulnik, Alexander I.

2013-01-01

249

Detection of 98% of DMD\\/BMD gene deletions by polymerase chain reaction  

Microsoft Academic Search

We describe oligonucleotide primer sequences that can be used to amplify eight exons plus the muscle promoter of the dystrophin gene in a single multiplex polymerase chain reaction (PCR). When used in conjunction with an existing primer set, these two multiplex reactions detect about 98% of deletions in patients with Duchenne or Becker muscular dystrophy (DMD, BMD). Furthermore, these primers

Alan H. Beggs; Michel Koenig; Frederick M. Boyce; Louis M. Kunkel

1990-01-01

250

The original shaker-with-syndactylism mutation (sy) is a contiguous gene deletion syndrome.  

PubMed

Tests for allelism among mice with four different mutant alleles at the shaker-with-syndactylism locus on mouse Chromosome (Chr) 18 provide evidence that the original radiation-induced mutation, sy, is a deletion including at least two genes associated with distinct phenotypes. Mice homozygous for sy have syndactylous feet and other skeletal malformations, are deaf, and exhibit abnormal behavior characteristic of vestibular dysfunction. Two less severe spontaneous mutations, shown to be allelic with sy, cause syndactylism when homozygous (hence named fused phalanges, sy(fp) and sy(fp-2J)), but do not affect hearing and behavior. Here we describe a third spontaneous mutation allelic with sy that does not affect foot morphology (hence named no syndactylism, sy(ns)), but that does cause deafness and balance defects when homozygous. Complementation test results indicate that sy(fp) and sy(fp-2J) are alleles of the same gene, but that sy(ns) is an allele of a different gene. The original sy mutation, therefore, includes both of the genes defined by these three spontaneous mutations. Typing of DNA markers in sy/sy mice revealed a deletion of approximately 1 cM in the sy region of Chr 18, including D18Mit52, D18Mit124, D18Mit181, and D18Mit205. The genetic relationships described here will aid in positional cloning efforts to identify the genes responsible for the disparate phenotypes associated with the sy locus. PMID:9799839

Johnson, K R; Cook, S A; Zheng, Q Y

1998-11-01

251

Become a Multiplication Wizard!  

NSDL National Science Digital Library

Practice all levels of basic multiplication facts. Are you a math magician? Practice how speedy you can be in Be A Math Magician!. Dress up and race granny in Granny Multiplication Race to make her go faster, answer the problems correctly. Multiplication that makes your mouth water. Multiplication Ice Cream Cones ...

Ms. Robinson

2010-01-27

252

Highly Divergent Strains of Porcine Reproductive and Respiratory Syndrome Virus Incorporate Multiple Isoforms of Nonstructural Protein 2 into Virions  

PubMed Central

Viral structural proteins form the critical intermediary between viral infection cycles within and between hosts, function to initiate entry, participate in immediate early viral replication steps, and are major targets for the host adaptive immune response. We report the identification of nonstructural protein 2 (nsp2) as a novel structural component of the porcine reproductive and respiratory syndrome virus (PRRSV) particle. A set of custom ?-nsp2 antibodies targeting conserved epitopes within four distinct regions of nsp2 (the PLP2 protease domain [OTU], the hypervariable domain [HV], the putative transmembrane domain [TM], and the C-terminal region [C]) were obtained commercially and validated in PRRSV-infected cells. Highly purified cell-free virions of several PRRSV strains were isolated through multiple rounds of differential density gradient centrifugation and analyzed by immunoelectron microscopy (IEM) and Western blot assays using the ?-nsp2 antibodies. Purified viral preparations were found to contain pleomorphic, predominantly spherical virions of uniform size (57.9 nm ± 8.1 nm diameter; n = 50), consistent with the expected size of PRRSV particles. Analysis by IEM indicated the presence of nsp2 associated with the viral particle of diverse strains of PRRSV. Western blot analysis confirmed the presence of nsp2 in purified viral samples and revealed that multiple nsp2 isoforms were associated with the virion. Finally, a recombinant PRRSV genome containing a myc-tagged nsp2 was used to generate purified virus, and these particles were also shown to harbor myc-tagged nsp2 isoforms. Together, these data identify nsp2 as a virion-associated structural PRRSV protein and reveal that nsp2 exists in or on viral particles as multiple isoforms. PMID:24089566

Kappes, Matthew A.; Miller, Cathy L.

2013-01-01

253

Characterization of baculovirus Autographa californica multiple nuclear polyhedrosis virus infection in mammalian cells  

SciTech Connect

The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is used as a vector in many gene therapy studies. Wild-type AcMNPV infects many mammalian cell types in vitro, but does not replicate. We investigated the dynamics of AcMNPV genomic DNA in infected mammalian cells and used flow cytometric analysis to demonstrate that recombinant baculovirus containing a cytomegalovirus immediate early promoter/enhancer with green fluorescent protein (GFP) expressed high levels of GFP in Huh-7 cells, but not B16, Raw264.7, or YAC-1 cells. The addition of butyrate, a deacetylase inhibitor, markedly enhanced the percentage of GFP-expressing Huh-7 and B16 cells, but not Raw264.7 and YAC-1 cells. The addition of 5-aza-2'-deoxycytidine, a DNA methylation inhibitor, had no enhancing effect. Polymerase chain reaction analysis using AcMNPV-gp64-specific primers indicated that AcMNPV infected not only Huh-7 and B16 cells, but also Raw264.7 and YAC-1 cells in vitro. The genomic DNA was detected in Huh-7 and B16 cells 96 h after infection. Genomic AcMNPV DNA in YAC-1 cells was not transported to the nucleus. Luciferase assay indicated that AcMNPV p35 gene mRNA and p35 promoter activity were clearly expressed only in Huh-7 and B16 cells. These results suggest that viral genomic DNA expression is restricted by different host cell factors, such as degradation, deacetylation, and inhibition of nuclear transport, depending on the mammalian cell type.

Kitajima, Masayuki [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Departments of Immunology and Pediatrics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana Chuo-ku, Chiba 260-8670 (Japan); Hamazaki, Hiroyuki [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Miyano-Kurosaki, Naoko [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan); Takaku, Hiroshi [Department of Life and Environmental Sciences, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan) and High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016 (Japan)]. E-mail: hiroshi.takaku@it-chiba.ac.jp

2006-05-05

254

Elk-1 a Transcription Factor with Multiple Facets in the Brain  

PubMed Central

The ternary complex factor (TCF) Elk-1 is a transcription factor that regulates immediate early gene (IEG) expression via the serum response element (SRE) DNA consensus site. Elk-1 is associated with a dimer of serum response factor (SRF) at the SRE site, and its phosphorylation occurs at specific residues in response to mitogen-activated protein kinases (MAPKs), including c-Jun-N terminal kinase (JNK), p38/MAPK, and extracellular-signal regulated kinase (ERK). This phosphorylation event is critical for triggering SRE-dependent transcription. Although MAPKs are fundamental actors for the instatement and maintenance of memory, and much investigation of their downstream signaling partners have been conducted, no data yet clearly implicate Elk-1 in these processes. This is partly due to the complexity of Elk-1 sub-cellular localization, and hence functions, within neurons. Elk-1 is present in its resting state in the cytoplasm, where it colocalizes with mitochondrial proteins or microtubules. In this particular sub-cellular compartment, overexpression of Elk-1 is toxic for neuronal cells. When phosphorylated by the MAPK/ERK, Elk-1 translocates to the nucleus where it is implicated in regulating chromatin remodeling, SRE-dependent transcription, and neuronal differentiation. Another post-translational modification is the conjugation to SUMO (Small Ubiquitin-like MOdifier), which relocalizes Elk-1 in the cytoplasm. Thus, Elk-1 plays a dual role in neuronal functions: pro-apoptotic within the cytoplasm, and pro-differentiation within the nucleus. To address the role of Elk-1 in the brain, one must be aware of its multiple facets, and design molecular tools that will shut down Elk-1 expression, trafficking, or activation, in specific neuronal compartments. We summarize in this review the known molecular functions of Elk-1, its regulation in neuronal cells, and present evidence of its possible implication in model systems of synaptic plasticity, learning, but also in neurodegenerative diseases. PMID:21441990

Besnard, Antoine; Galan-Rodriguez, Beatriz; Vanhoutte, Peter; Caboche, Jocelyne

2011-01-01

255

Murine Gammaherpesvirus 68 Open Reading Frame 45 Plays an Essential Role during the Immediate-Early Phase of Viral Replication  

Microsoft Academic Search

Murine gammaherpesvirus 68 (MHV-68) has been developed as a model for the human gammaherpesviruses Epstein-Barr virus and human herpesvirus 8\\/Kaposi's sarcoma-associated herpesvirus (HHV-8\\/KSHV), which are associated with several types of human diseases. Open reading frame 45 (ORF45) is conserved among the members of the Gammaherpesvirinae subfamily and has been suggested to be a virion tegument protein. The repression of ORF45

Qingmei Jia; Vasili Chernishof; Eric Bortz; Ian Mchardy; Ting-Ting Wu; Hsiang-I Liao; Ren Sun

2005-01-01

256

Murine gammaherpesvirus 68 open reading frame 45 plays an essential role during the immediate-early phase of viral replication.  

PubMed

Murine gammaherpesvirus 68 (MHV-68) has been developed as a model for the human gammaherpesviruses Epstein-Barr virus and human herpesvirus 8/Kaposi's sarcoma-associated herpesvirus (HHV-8/KSHV), which are associated with several types of human diseases. Open reading frame 45 (ORF45) is conserved among the members of the Gammaherpesvirinae subfamily and has been suggested to be a virion tegument protein. The repression of ORF45 expression by small interfering RNAs inhibits MHV-68 viral replication. However, the gene product of MHV-68 ORF45 and its function have not yet been well characterized. In this report, we show that MHV-68 ORF45 is a phosphorylated nuclear protein. We constructed an ORF45-null MHV-68 mutant virus (45STOP) by the insertion of translation termination codons into the portion of the gene encoding the N terminus of ORF45. We demonstrated that the ORF45 protein is essential for viral gene expression immediately after the viral genome enters the nucleus. These defects in viral replication were rescued by providing ORF45 in trans or in an ORF45-null revertant (45STOP.R) virus. Using a transcomplementation assay, we showed that the function of ORF45 in viral replication is conserved with that of its KSHV homologue. Finally, we found that the C-terminal 23 amino acids that are highly conserved among the Gammaherpesvirinae subfamily are critical for the function of ORF45 in viral replication. PMID:15795297

Jia, Qingmei; Chernishof, Vasili; Bortz, Eric; Mchardy, Ian; Wu, Ting-Ting; Liao, Hsiang-I; Sun, Ren

2005-04-01

257

Calcium Influx via the NMDA Receptor Induces Immediate Early Gene Transcription by a MAP Kinase\\/ERK-Dependent Mechanism  

Microsoft Academic Search

The regulation of gene expression by neurotransmitters is likely to play a key role in neuroplasticity both during development and in the adult animal. Therefore, it is important to determine the mechanisms of neuronal gene regulation to understand fully the mechanisms of learning, memory, and other long-term adaptive changes in neurons. The neurotransmitter glutamate stimulates rapid and transient induction of

Zhengui Xia; Henryk Dudek; Cindy K. Miranti; Michael E. Greenberg

1996-01-01

258

Efficient transcription of the Epstein-Barr virus immediate-early BZLF1 and BRLF1 genes requires protein synthesis.  

PubMed Central

The Epstein-Barr virus BRLF1 and BZLF1 genes appear to be the first viral genes transcribed upon induction of the Epstein-Barr virus lytic cycle. Both gene products activate transcription of other viral genes, thereby initiating the lytic cascade. Among the viral antigens expressed upon induction of the lytic cycle, the product of the BZLF1 gene is unique in its ability to disrupt viral latency; thus, expression of this gene is both necessary and sufficient for triggering the viral lytic cascade. Moreover, transcription initiation from both the BRLF1 and BZLF1 promoters can be activated by the BZLF1 gene product. The latter results suggest a two-step model for induction of the viral lytic cycle in which the initial signal leads to low-level transcription of the BZLF1 gene, followed by upregulation of transcription by the BZLF1 gene product. In this report we demonstrate that efficient transcription from the BRLF1 and BZLF1 promoters after anti-immunoglobulin induction of the lytic cycle, in a synchronous induction system, is dependent on de novo protein synthesis. These data support the two-step induction model in which synthesis of BZLF1 protein is required to activate expression of the BRLF1 and BZLF1 genes. Images PMID:1658397

Flemington, E K; Goldfeld, A E; Speck, S H

1991-01-01

259

Group 2 coronaviruses prevent immediate early interferon induction by protection of viral RNA from host cell recognition  

SciTech Connect

Many viruses encode antagonists to prevent interferon (IFN) induction. Infection of fibroblasts with the murine hepatitis coronavirus (MHV) and SARS-coronavirus (SARS-CoV) did not result in nuclear translocation of interferon-regulatory factor 3 (IRF3), a key transcription factor involved in IFN induction, and induction of IFN mRNA transcription. Furthermore, MHV and SARS-CoV infection could not prevent IFN induction by poly (I:C) or Sendai virus, suggesting that these CoVs do not inactivate IRF3-mediated transcription regulation, but apparently prevent detection of replicative RNA by cellular sensory molecules. Our data indicate that shielding of viral RNA to host cell sensors might be the main general mechanism for coronaviruses to prevent IFN induction.

Versteeg, Gijs A. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Bredenbeek, Peter J. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Worm, Sjoerd H.E. van den [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands); Spaan, Willy J.M. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, LUMC E4-P, P.O. Box 9600, 2300 RC Leiden (Netherlands)]. E-mail: w.j.m.spaan@lumc.nl

2007-04-25

260

Multiple-Ring Digital Communication Network  

NASA Technical Reports Server (NTRS)

Optical-fiber digital communication network to support data-acquisition and control functions of electric-power-distribution networks. Optical-fiber links of communication network follow power-distribution routes. Since fiber crosses open power switches, communication network includes multiple interconnected loops with occasional spurs. At each intersection node is needed. Nodes of communication network include power-distribution substations and power-controlling units. In addition to serving data acquisition and control functions, each node acts as repeater, passing on messages to next node(s). Multiple-ring communication network operates on new AbNET protocol and features fiber-optic communication.

Kirkham, Harold

1992-01-01

261

Multiple sclerosis - discharge  

MedlinePLUS

MS - discharge ... Your doctor has told you that you have multiple sclerosis. This disease affects the brain and spinal cord ( ... bladder is not working correctly. Some people with multiple sclerosis need to use a urinary catheter . This is ...

262

Multiplication as Replication  

NSDL National Science Digital Library

Students build tables and use patterns as an introduction to multiplication. They are encouraged to use multiplication by 10 or 100 for larger values as the beginnings of commutativity and distribution are introduced.

Wnet

2008-10-07

263

Jalyn's Multiplication Mania!  

NSDL National Science Digital Library

Multiplication Games For My Favorite Gillenwater Jalyn Will Love Serving Aliens Lunch! Ms. Gillenwater Will Have Fun With Multiplication In Murbia! When Jalyn Plays This Game She Will Go Bananas! Buy A Pet From Gillenwater s Pet Shop! ...

Huey, Mr.

2011-10-11

264

MAXIMUM MULTIPLE ATTENUATION  

Microsoft Academic Search

Recently Common Depth Point Stacking has become the general rule for seismic evaluation. Stack shooting is carried out to enhance the' primary event as well as to attenuate the multiple. Actual multiple attenuation can only take place providing the multiple event is stacked out of phase. Such out of stacking can only take place providing there is an increase of

W. HRYHOR

265

The role of the PI3K-Akt signal transduction pathway in Autographa californica multiple nucleopolyhedrovirus infection of Spodoptera frugiperda cells  

SciTech Connect

Many viruses activate the phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway, thereby modulating diverse downstream signaling pathways associated with antiapoptosis, proliferation, cell cycling, protein synthesis and glucose metabolism, in order to augment their replication. To date, the role of the PI3K-Akt pathway in Baculovirus replication has not been defined. In the present study, we demonstrate that infection of Sf9 cells with Autographa californica multiple nucleopolyhedrovirus (AcMNPV) elevated cellular Akt phosphorylation at 1 h post-infection. The maximum Akt phosphorylation occurred at 6 h post-infection and remained unchanged until 18 h post-infection. The PI3K-specific inhibitor, LY294002, suppressed Akt phosphorylation in a dose-dependent manner, suggesting that AcMNPV-induced Akt phosphorylation is PI3K-dependent. The inhibition of PI3K-Akt activation by LY294002 significantly reduced the viral yield, including a reduction in budded viruses and occlusion bodies. The virus production was reduced only when the inhibitor was added within 24 h of infection, implying that activation of PI3K occurred early in infection. Correspondingly, both viral DNA replication and late (VP39) and very late (POLH) viral protein expression were impaired by LY294002 treatment; LY294002 had no effect on immediate-early (IE1) and early-late (GP64) protein expression. These results demonstrate that the PI3K-Akt pathway is required for efficient Baculovirus replication.

Xiao Wei; Yang Yi; Weng Qingbei; Lin Tiehao; Yuan Meijin [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China); Yang Kai, E-mail: yangkai@mail.sysu.edu.c [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China); Pang Yi [State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275 (China)

2009-08-15

266

Fun with Multiplication Facts  

NSDL National Science Digital Library

We are going to practice our multiplication facts by having fun in the jungle! Drummin Up Our Multiplication Facts will help Jungle Jim as he beats his drums to learn his facts After you have helped Jungle Jim with his drums, join Jungle Jim and the Monkeys of Monamona while Swinging with Fact Families Memorize Multiplication Facts for extra practice after you have helped Jungle Jim! ...

Shields, Ms.

2007-10-25

267

Multiple antenna technologies  

E-print Network

Multiple antenna technologies have received high attention in the last few decades for their capabilities to improve the overall system performance. Multiple-input multiple-output systems include a variety of techniques capable of not only increase the reliability of the communication but also impressively boost the channel capacity. In addition, smart antenna systems can increase the link quality and lead to appreciable interference reduction.

Mohaisen, Manar; Chang, KyungHi

2009-01-01

268

Multiplication is Fun!  

NSDL National Science Digital Library

Let's play some multiplication games! If asked to pick a fact family or a leve, pick the one you are most comfortable with first then go to the harder one. Penguin Jump Click on the ice cube that has the answer to the multiplication problem at the bottom. Snagger s Pond For this game, first you will pick a Fact Family 0-5, 2-9, 3-12. Then answer the Multiplication fact. Let s Multiply! Select a level, then answer the multiplication facts by clicking on the ice cream ...

Miss Gross

2010-10-09

269

Genome duplications within the Xenopodinae do not increase the multiplicity of antimicrobial peptides in Silurana paratropicalis and Xenopus andrei skin secretions.  

PubMed

A putative genome duplication event within the Silurana lineage has given rise to the tetraploid frog S. paratropicalis and a second polyploidization within the Xenopus lineage has produced the octoploid frog X. andrei. Peptidomic analysis of norepinephrine-stimulated skin secretions of S. paratropicalis and X. andrei led to identification of multiple peptides with growth-inhibitory activity against Escherichia coli and Staphylococcus aureus. Structural characterization demonstrated that the S. paratropicalis components comprised three peptides belonging to the caerulein-precursor fragment family (CPF-SP1, -SP2 and -SP3), two peptides from the xenopsin-precursor fragment family (XPF-SP1 and -SP2), and one peptide orthologous to peptide glycine-leucine-amide (PGLa-SP1). The CPF peptides showed potent, broad-spectrum antimicrobial activity. The X. andrei components comprised two peptides from the magainin family, (magainin-AN1 and -AN2), two from the XPF family (XPF-AN1 and -AN2), two from the PGLa family(PGLa-AN1 and -AN2), and one caerulein-precursor fragment (CPF-AN1).The primary structures of these peptides indicate a close phylogenetic relationship between X. andrei and the octoploid frog X. amieti. Under the same experimental conditions, seven orthologous antimicrobial peptides were previously isolated from the diploid frog S. tropicalis, nine from the tetraploid frog X. borealis, and five from the tetraploid frog X. clivii. The data indicate, therefore, that nonfunctionalization (gene deletion) has been the most common fate of duplicated antimicrobial peptide genes following polyploidization events in the Silurana and Xenopus lineages. PMID:21498136

Mechkarska, Milena; Eman, Ahmed; Coquet, Laurent; Jérôme, Leprince; Jouenne, Thierry; Vaudry, Hubert; King, Jay D; Takada, Koji; Conlon, J Michael

2011-06-01

270

Multiple density layered insulator  

DOEpatents

A multiple density layered insulator for use with a laser is disclosed wh provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation.

Alger, Terry W. (Tracy, CA)

1994-01-01

271

Constraining Multiple Grammars  

ERIC Educational Resources Information Center

This article offers the author's commentary on the Multiple Grammars (MG) language acquisition theory proposed by Luiz Amaral and Tom Roeper in the present issue. Multiple Grammars advances the claim that optionality is a constitutive characteristic of any one grammar, with interlanguage grammars being perhaps the clearest examples of a…

Hopp, Holger

2014-01-01

272

Detection by multiple trellises  

Microsoft Academic Search

In this paper, we present a novel pragmatic ap- proach, referred to as detection by multiple trellises, to perform trellis-based detection over realistic channels. More precisely, we consider channels with unknown parameters and apply the concept of detection by multiple trellises to forward-backward (FB) algorithms. The key idea of our approach consists, first, of properly quantizing the channel parameters and,

Michele Franceschini; Gian Luigi Ferrari; Riccardo Raheli

2009-01-01

273

Multiple Sclerosis Foundation  

MedlinePLUS

... iConquerMS initiative offers introductory webinar 1/27/2015 Multiple Sclerosis Coalition backs data-gathering bill 1/26/2015 ... Events View All Fundraising Events » 07 "Rocking Out Multiple Sclerosis" Concert feat. Nolan Neal in Copperhill, TN more ...

274

Combination of Multiple Searches  

Microsoft Academic Search

The TREC-3 project at Virginia Tech focused on methods for combining the evidence from multiple retrieval runs and queries to improve retrieval performance over any single retrieval method or query. The largest improvements result from the combination of retrieval paradigms rather than from the use of multiple similar queries.

Joseph A. Shaw; Edward A. Fox

1994-01-01

275

Multiple scattering technique lidar  

NASA Technical Reports Server (NTRS)

The Bernouilli-Ricatti equation is based on the single scattering description of the lidar backscatter return. In practice, especially in low visibility conditions, the effects of multiple scattering can be significant. Instead of considering these multiple scattering effects as a nuisance, we propose here to use them to help resolve the problems of having to assume a backscatter-to-extinction relation and specifying a boundary value for a position far remote from the lidar station. To this end, we have built a four-field-of-view lidar receiver to measure the multiple scattering contributions. The system has been described in a number of publications that also discuss preliminary results illustrating the multiple scattering effects for various environmental conditions. Reported here are recent advances made in the development of a method of inverting the multiple scattering data for the determination of the aerosol scattering coefficient.

Bissonnette, Luc R.

1992-01-01

276

Effects of Early or Overexpression of the Autographa californica Multiple Nucleopolyhedrovirus orf94 (ODV-e25) on Virus Replication.  

PubMed

odv-e25(e25) is one of the core genes of baculoviruses. To investigate how it functions in the replication cycle of a baculovirus, a number of Autographa californica multiple nucleopolyhedrovirus recombinants with e25 under control of the promoter of immediate early gene ie1, or the promoter of the very late hyperexpressed gene p10, were constructed using a bacmid system, and the effects of early expression or overexpression of e25 on replication of the virus were evaluated. Microscopy and titration assays demonstrated that bacmids with e25 under control of ie1 promoter were unable to produce budded viruses; and that the recombinant viruses with e25 under control of p10 promoter generated budded virus normally, but formation of occlusion bodies were dramatically reduced and delayed in the infected cells. Electron microscopy showed that there were no mature virions or intact nucleocapsids present in the cells transfected with a recombinant bacmid with e25 under control of ie1 promoter. Quantitative real-time PCR analysis demonstrated that alteration of the e25 promoter did not affect viral DNA synthesis. The reporter gene expression from the promoter of the major capsid protein gene vp39 was reduced 63% by early expression of e25. Confocal microscopy revealed that E25 was predominantly localized in nuclei by 24 hours post infection with wild-type virus, but it remained in the cytoplasm in the cells transfected with a recombinant bacmid with e25 under control of the ie1 promoter, suggesting that the transport of E25 into nuclei was regulated in a specific and strict time dependent manner. PMID:23825525

Luo, Xiao-Chun; Wang, Shan-Shan; Zhang, Jie; Qian, Duo-Duo; Wang, Si-Min; Li, Lu-Lin

2013-01-01

277

Multiple sclerosis: symptomatic treatment.  

PubMed

Reports of new therapeutic agents designed to suppress inflammatory processes in multiple sclerosis have excited much interest but, thus far, have had little influence on symptoms, disability and handicap in patients. The clinical application of recent advances in physical, pharmacological and surgical approaches to management will, at least in the medium-term future, therefore offer significantly greater opportunities for improving the quality of life of patients with multiple sclerosis. Here, symptomatic treatment of the whole range of difficulties encountered by patients with multiple sclerosis is reviewed in the context of the multidisciplinary strategy crucial to an optimal outcome. PMID:8865021

Thompson, A J

1996-08-01

278

Caring for Multiples  

MedlinePLUS

... NICU families. Mothering Multiples: Breastfeeding and Caring for Twins or More, by Karen Kerkhoff Gromada (La Leche League International, 1999). Mothers of Super Twins (MOST) A support network of families who have ...

279

Multiplication Series: Number Arrays  

NSDL National Science Digital Library

This one-page article describes and illustrates how arrays can be used to represent many number concepts, including building multiplication facts, commutativity, parity (odd/even), and exploring factors, prime numbers, and square numbers.

280

Multiple Myeloma Symptoms  

MedlinePLUS

... Stem Cell Transplants Allogeneic Stem Cell Transplants Autologous Stem Cell Transplants Bisphosphonates Radiation Therapy Surgery Alternative Therapies Treatment by Stage Treatment FAQs Clinical Trials Multiple Myeloma Cure Treatment Center Finder Speak to an MMRF nurse ...

281

Matrix Multiplication with CUDA  

NSDL National Science Digital Library

This module teaches matrix multiplication in the context of enumerating paths in a graph and the basics of programming in CUDA. It emphasizes the power of using shared memory when programming on GPGPU architectures.

Hochberg, Rob

282

Fertility Treatment and Multiples  

MedlinePLUS Videos and Cool Tools

... opportunities Advocacy in government For health professionals General health information I have personal experience with: Prematurity NICU experience Birth Defects High-risk pregnancy Loss Infertility Multiples None Of Above March ...

283

Multiple Principal Investigators  

Cancer.gov

Below is information to learn about NIH definitions, policies, and awards available to apply for support using the Multiple Principal Investigator (PI) model that supports team science. Answers to FAQs are included.

284

Mobile multiple access study  

NASA Technical Reports Server (NTRS)

Multiple access techniques (FDMA, CDMA, TDMA) for the mobile user and attempts to identify the current best technique are discussed. Traffic loading is considered as well as voice and data modulation and spacecraft and system design. Emphasis is placed on developing mobile terminal cost estimates for the selected design. In addition, design examples are presented for the alternative techniques of multiple access in order to compare with the selected technique.

1977-01-01

285

Cannabinoids and Multiple Sclerosis  

Microsoft Academic Search

This review discusses clinical and preclinical evidence that supports the use of cannabinoid receptor agonists for the management\\u000a of multiple sclerosis. In addition, it considers preclinical findings that suggest that as well as ameliorating signs and\\u000a symptoms of multiple sclerosis, cannabinoid CB1 and\\/or CB2 receptor activation may suppress some of the pathological changes that give rise to these signs and

Roger G. Pertwee

2007-01-01

286

Multiplicities of dihedral discriminants  

Microsoft Academic Search

Given the discriminant {d_k} of a quadratic field k, the number of cyclic relative extensions N\\\\vert k of fixed odd prime degree p with dihedral absolute Galois group of order 2p, which share a common conductor f, is called the multiplicity of the dihedral discriminant {d_N} = {f^{2(p - 1)}}d_k^p . In this paper, general formulas for multiplicities of dihedral

Daniel C. Mayer

1992-01-01

287

Angiogenesis and Multiple Myeloma  

Microsoft Academic Search

The bone marrow microenvironment in multiple myeloma is characterized by an increased microvessel density. The production\\u000a of pro-angiogenic molecules is increased and the production of angiogenic inhibitors is suppressed, leading to an “angiogenic\\u000a switch”. Here we present an overview of the role of angiogenesis in multiple myeloma, the pro-angiogenic factors produced\\u000a by myeloma cells and the microenvironment, and the mechanisms

Nicola Giuliani; Paola Storti; Marina Bolzoni; Benedetta Dalla Palma; Sabrina Bonomini

288

Multiple Indicators, Multiple Causes Measurement Error Models  

PubMed Central

Multiple Indicators, Multiple Causes Models (MIMIC) are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times however when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are: (1) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model, (2) to develop likelihood based estimation methods for the MIMIC ME model, (3) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

Tekwe, Carmen D.; Carter, Randy L.; Cullings, Harry M.; Carroll, Raymond J.

2014-01-01

289

Multiple indicators, multiple causes measurement error models.  

PubMed

Multiple indicators, multiple causes (MIMIC) models are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times, however, when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are as follows: (i) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model; (ii) to develop likelihood-based estimation methods for the MIMIC ME model; and (iii) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

Tekwe, Carmen D; Carter, Randy L; Cullings, Harry M; Carroll, Raymond J

2014-11-10

290

Multiple Birth and Cut Algorithm for Multiple Object Detection  

E-print Network

Multiple Birth and Cut Algorithm for Multiple Object Detection Ahmed Gamal-Eldin, Xavier Descombes.zerubia}@inria.fr Abstract--In this paper, we describe a new optimization method which we call Multiple Birth and Cut (MBC). It combines the recently developed Multiple Birth and Death (MBD) algorithm and the Graph-Cut algorithm. MBD

Boyer, Edmond

291

Multiple Meaning Words  

NSDL National Science Digital Library

In this lesson, students will explore the concept that many words have multiple meaning. The students will be engaged in activities where they will use reference materials to look up the various definitions of the words and identify their parts of speech, as well as understand how the meaning of the words change depending on the context of the sentence. Students will compose sentences for words with multiple meanings, as well as write a riddle where both definitions of the word will help the reader solve the riddle. Students will work independently, as well as with their peers, in order gain a better understanding of multiple meaning words and how to identify their correct meanings using reference materials and context clues.

2013-01-28

292

Col2CreERT2, A MOUSE MODEL FOR A CHONDROCYTE-SPECIFIC AND INDUCIBLE GENE DELETION  

PubMed Central

In 2007 and 2008, we published two articles reporting a tamoxifen (TM)-inducible, chondrocyte-specific gene-targeting mouse model in which the expression of CreERT2 is driven by the type II collagen promoter (Col2CreERT2). The fusion protein is specifically expressed and translocated into the nucleus upon TM administration, which in turn triggers gene recombination. Since then, this animal model has become a powerful tool to study the molecular mechanism of skeletal development and degenerative cartilage diseases, including knee joint osteoarthritis (OA), temporomandibular joint (TMJ) OA, and intervertebral disc (IVD) degeneration. In this review article, we summarise the application of Col2CreERT2 mice and discuss the potential usage of this animal model in a broad spectrum of cartilage development and molecular pathology studies. PMID:25340803

Chen, M.; Li, S.; Xie, W.; Wang, B.; Chen, D.

2014-01-01

293

Col2CreER(T2), a mouse model for a chondrocyte-specific and inducible gene deletion.  

PubMed

In 2007 and 2008, we published two articles reporting a tamoxifen (TM)-inducible, chondrocyte-specific gene-targeting mouse model in which the expression of CreER(T2) is driven by the type II collagen promoter (Col2CreER(T2)). The fusion protein is specifically expressed and translocated into the nucleus upon TM administration, which in turn triggers gene recombination. Since then, this animal model has become a powerful tool to study the molecular mechanism of skeletal development and degenerative cartilage diseases, including knee joint osteoarthritis (OA), temporomandibular joint (TMJ) OA, and intervertebral disc (IVD) degeneration. In this review article, we summarise the application of Col2CreER(T2) mice and discuss the potential usage of this animal model in a broad spectrum of cartilage development and molecular pathology studies. PMID:25340803

Chen, M; Li, S; Xie, W; Wang, B; Chen, D

2014-01-01

294

Nontoxic Strains of Cyanobacteria Are the Result of Major Gene Deletion Events Induced by a Transposable Element  

PubMed Central

Blooms that are formed by cyanobacteria consist of toxic and nontoxic strains. The mechanisms that result in the occurrence of nontoxic strains are enigmatic. All the nontoxic strains of the filamentous cyanobacterium Planktothrix that were isolated from 9 European countries were found to have lost 90% of a large microcystin synthetase (mcy) gene cluster that encoded the synthesis of the toxic peptide microcystin (MC). Those strains still contain the flanking regions of the mcy gene cluster along with remnants of the transposable elements that are found in between. The majority of the strains still contain a gene coding for a distinct thioesterase type II (mcyT), which is putatively involved in MC synthesis. The insertional inactivation of mcyT in an MC-producing strain resulted in the reduction of MC synthesis by 94?±?2% (1 standard deviation). Nontoxic strains that occur in shallow lakes throughout Europe form a monophyletic lineage. A second lineage consists of strains that contain the mcy gene cluster but differ in their photosynthetic pigment composition, which is due to the occurrence of strains that contain phycocyanin or large amounts of phycoerythrin in addition to phycocyanin. Strains containing phycoerythrin typically occur in deep-stratified lakes. The rare occurrence of gene cluster deletion, paired with the evolutionary diversification of the lineages of strains that lost or still contain the mcy gene cluster, needs to be invoked in order to explain the absence or dominance of toxic cyanobacteria in various habitats. PMID:18502770

Christiansen, Guntram; Molitor, Carole; Philmus, Benjamin

2008-01-01

295

Gene Deletion Mutants Reveal a Role for Semaphorin Receptors of the Plexin-B Family in Mechanisms Underlying Corticogenesis ?  

PubMed Central

Semaphorins and their receptors, plexins, are emerging as key regulators of various aspects of neural and nonneural development. Semaphorin 4D (Sema4D) and B-type plexins demonstrate distinct expression patterns over critical time windows during the development of the murine neocortex. Here, analysis of mice genetically lacking plexin-B1 or plexin-B2 revealed the significance of Sema4D-plexin-B signaling in cortical development. Deficiency of plexin-B2 resulted in abnormal cortical layering and defective migration and differentiation of several subtypes of cortical neurons, including Cajal-Retzius cells, GABAergic interneurons, and principal cells in vivo. In contrast, a lack of plexin-B1 did not impact on cortical development in vivo. In various ex vivo assays on embryonic forebrain, Sema4D enhanced the radial and tangential migration of developing neurons in a plexin-B2-dependent manner. These results suggest that Sema4D-plexin-B2 interactions regulate mechanisms underlying cell specification, differentiation, and migration during corticogenesis. PMID:19948886

Hirschberg, A.; Deng, S.; Korostylev, A.; Paldy, E.; Costa, M. R.; Worzfeld, T.; Vodrazka, P.; Wizenmann, A.; Götz, M.; Offermanns, S.; Kuner, R.

2010-01-01

296

Activation of inflammasomes in podocyte injury of mice on the high fat diet: Effects of ASC gene deletion and silencing.  

PubMed

Inflammasome, an intracellular inflammatory machinery, has been reported to be involved in a variety of chronic degenerative diseases such as atherosclerosis, autoinflammatory diseases and Alzheimer's disease. The present study hypothesized that the formation and activation of inflammasomes associated with apoptosis associated speck-like protein (ASC) are an important initiating mechanism resulting in obesity-associated podocyte injury and consequent glomerular sclerosis. To test this hypothesis, Asc gene knockout (Asc(-/-)), wild type (Asc(+/+)) and intrarenal Asc shRNA-transfected wild type (Asc shRNA) mice were fed a high fat diet (HFD) or normal diet (ND) for 12 weeks to produce obesity and associated glomerular injury. Western blot and RT-PCR analyses demonstrated that renal tissue Asc expression was lacking in Asc(-/-) mice or substantially reduced in Asc shRNA transfected mice compared to Asc(+/+) mice. Confocal microscopic and co-immunoprecipitation analysis showed that the HFD enhanced the formation of inflammasome associated with Asc in podocytes as shown by colocalization of Asc with Nod-like receptor protein 3 (Nalp3). This inflammasome complex aggregation was not observed in Asc(-/-) and local Asc shRNA-transfected mice. The caspase-1 activity, IL-1? production and glomerular damage index (GDI) were also significantly attenuated in Asc(-/-) and Asc shRNA-transfected mice fed the HFD. This decreased GDI in Asc(-/-) and Asc shRNA transfected mice on the HFD was accompanied by attenuated proteinuria, albuminuria, foot process effacement of podocytes and loss of podocyte slit diaphragm molecules. In conclusion, activation and formation of inflammasomes in podocytes are importantly implicated in the development of obesity-associated glomerular injury. PMID:24508291

Boini, Krishna M; Xia, Min; Abais, Justin M; Li, Guangbi; Pitzer, Ashley L; Gehr, Todd W B; Zhang, Yang; Li, Pin-Lan

2014-05-01

297

Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB  

SciTech Connect

The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT, accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.

Lin, Hui [ORNL] [ORNL; Hurt, Jr., Richard Ashley [ORNL; Johs, Alexander [ORNL] [ORNL; Parks, Jerry M [ORNL] [ORNL; Morrell-Falvey, Jennifer L [ORNL] [ORNL; Liang, Liyuan [ORNL] [ORNL; Elias, Dwayne A [ORNL] [ORNL; Gu, Baohua [ORNL] [ORNL

2014-01-01

298

In ovo vaccination of commercial broilers with a glycoprotein J gene-deleted strain of infectious laryngotracheitis virus.  

PubMed

Conventional live attenuated vaccines have been used as the main tool worldwide for the control of infectious laryngotracheitis. However, their suboptimal attenuation combined with poor mass administration practices allowed chicken embryo origin vaccine-derived isolates to circulate in the field, regain virulence, and be the cause of continuous outbreaks of the disease. Previous studies indicated that stable attenuation of infectious laryngotracheitis virus (ILTV) can be achieved by the deletion of individual viral genes that are not essential for viral replication in vitro. One of these genes is the glycoprotein J (gJ) gene. Its deletion provided significant attenuation to virulent ILTV strains from Europe and the United States. The objective of this study was to construct an attenuated gJ-deleted ILTV strain and evaluate its safety and efficacy for in ovo (IO) administration of commercial broilers. A novel gJ-deleted virus (N(delta)gJ) was constructed, and a 10(3) median tissue culture infective dose administered at 18 days of embryo age was considered safe because it did not affect hatchability or survivability of chickens during the first week posthatch. Broilers vaccinated IO and IO + eye drop at 14 days of age presented a significant reduction in clinical signs and reduction of virus loads after challenge, as compared with the nonvaccinated challenged group of chickens. Therefore, this study presents initial proof that the N(delta)gJ strain is a potential ILTV live-attenuated vaccine candidate suitable for IO vaccination of commercial broilers. PMID:23901771

Mashchenko, Anna; Riblet, Sylva M; Zavala, Guillermo; García, Maricarmen

2013-06-01

299

Vaccination with a live multi-gene deletion strain protects horses against virulent challenge with Streptococcus equi.  

PubMed

Strangles, caused by Streptococcus equi subspecies equi (S. equi) is one of the most frequently diagnosed infectious diseases of horses and there remains a significant need to develop new preventative vaccines. We generated a live vaccine strain of S. equi containing deletions in six genes: sagA, hasA, aroB, pyrC, seM and recA, which was administered to nine Welsh mountain ponies via the intramuscular route. Four vaccinated ponies developed adverse reactions following the first vaccination from which the live vaccine strain was isolated. Two of these ponies were withdrawn from the study and seven ponies received a second vaccination, one of which then developed an adverse reaction. Nine control ponies injected with culture media alone developed no adverse reactions. Following challenge with a virulent strain of S. equi, none of the seven vaccinated ponies had developed clinical signs of strangles eleven days post-challenge, compared to six of nine control ponies over the same period (P=0.0114). A lymph node abscess was identified in one of the seven vaccinated ponies at post-mortem examination, whilst all nine control ponies had at least one lymph node abscess (P=0.0009). Three of the six vaccinated ponies that were protected from strangles had not developed an adverse reaction following vaccination, suggesting that a better understanding of the pro-inflammatory responses to S. equi could lead to the development of a live attenuated vaccine against strangles that is safe for administration via intramuscular injection. PMID:25597942

Robinson, Carl; Heather, Zoe; Slater, Josh; Potts, Nicola; Steward, Karen F; Maskell, Duncan J; Fontaine, Michael C; Lee, Jeong-Jin; Smith, Ken; Waller, Andrew S

2015-02-25

300

Evaluation of a modified-live, gene deletion mutant pseudorabies virus vaccine for field use in swine  

E-print Network

or intranasal exposure of 1 suscept1ble swine to virulent PRV, virus repl1cation occurs in the upper respiratory system. At 18 hours post exposure, virus can be isolated from the olfactory epithel1um. At 24 hours after exposure, 2 PRV can be isolated from...

Lawhorn, Donald Bruce

1989-01-01

301

?2?-1 Gene Deletion Affects Somatosensory Neuron Function and Delays Mechanical Hypersensitivity in Response to Peripheral Nerve Damage  

PubMed Central

The ?2?-1 subunit of voltage-gated calcium channels is upregulated after sensory nerve injury and is also the therapeutic target of gabapentinoid drugs. It is therefore likely to play a key role in the development of neuropathic pain. In this study, we have examined mice in which ?2?-1 gene expression is disrupted, to determine whether ?2?-1 is involved in various modalities of nociception, and for the development of behavioral hypersensitivity after partial sciatic nerve ligation (PSNL). We find that naive ?2?-1?/? mice show a marked behavioral deficit in mechanical and cold sensitivity, but no change in thermal nociception threshold. The lower mechanical sensitivity is mirrored by a reduced in vivo electrophysiological response of dorsal horn wide dynamic range neurons. The CaV2.2 level is reduced in brain and spinal cord synaptosomes from ?2?-1?/? mice, and ?2?-1?/? DRG neurons exhibit lower calcium channel current density. Furthermore, a significantly smaller number of DRG neurons respond to the TRPM8 agonist menthol. After PSNL, ?2?-1?/? mice show delayed mechanical hypersensitivity, which only develops at 11 d after surgery, whereas in wild-type littermates it is maximal at the earliest time point measured (3 d). There is no compensatory upregulation of ?2?-2 or ?2?-3 after PSNL in ?2?-1?/? mice, and other transcripts, including neuropeptide Y and activating transcription factor-3, are upregulated normally. Furthermore, the ability of pregabalin to alleviate mechanical hypersensitivity is lost in PSNL ?2?-1?/? mice. Thus, ?2?-1 is essential for rapid development of mechanical hypersensitivity in a nerve injury model of neuropathic pain. PMID:24133248

Patel, Ryan; Bauer, Claudia S.; Nieto-Rostro, Manuela; Margas, Wojciech; Ferron, Laurent; Chaggar, Kanchan; Crews, Kasumi; Ramirez, Juan D.; Bennett, David L. H.; Schwartz, Arnold; Dickenson, Anthony H.

2013-01-01

302

Genomic profiling in Down syndrome acute lymphoblastic leukemia identifies histone gene deletions associated with altered methylation profiles.  

PubMed

Patients with Down syndrome (DS) and acute lymphoblastic leukemia (ALL) have distinct clinical and biological features. Whereas most DS-ALL cases lack the sentinel cytogenetic lesions that guide risk assignment in childhood ALL, JAK2 mutations and CRLF2 overexpression are highly enriched. To further characterize the unique biology of DS-ALL, we performed genome-wide profiling of 58 DS-ALL and 68 non-DS (NDS) ALL cases by DNA copy number, loss of heterozygosity, gene expression and methylation analyses. We report a novel deletion within the 6p22 histone gene cluster as significantly more frequent in DS-ALL, occurring in 11 DS (22%) and only 2 NDS cases (3.1%) (Fisher's exact P=0.002). Homozygous deletions yielded significantly lower histone expression levels, and were associated with higher methylation levels, distinct spatial localization of methylated promoters and enrichment of highly methylated genes for specific pathways and transcription factor-binding motifs. Gene expression profiling demonstrated heterogeneity of DS-ALL cases overall, with supervised analysis defining a 45-transcript signature associated with CRLF2 overexpression. Further characterization of pathways associated with histone deletions may identify opportunities for novel targeted interventions. PMID:21647151

Loudin, M G; Wang, J; Leung, H-C Eastwood; Gurusiddappa, S; Meyer, J; Condos, G; Morrison, D; Tsimelzon, A; Devidas, M; Heerema, N A; Carroll, A J; Plon, S E; Hunger, S P; Basso, G; Pession, A; Bhojwani, D; Carroll, W L; Rabin, K R

2011-10-01

303

New CYP2A6 gene deletion and conversion variants in a population of Black African descent  

PubMed Central

Aims Cytochrome P450 2A6 (CYP2A6) is a human enzyme best known for metabolizing nicotine and nitrosamine precarcinogens. Our aim was to discover and characterize new CYP2A6 alleles in a population of Black African descent. Materials & Methods We used cloning, sequencing, and genotyping of genomic DNA to discover new variants, and in vivo nicotine pharmacokinetic phenotyping to characterize the functional effect of the new alleles. Results Four new CYP2A6 alleles, CYP2A6*4G,*4H,*1B4, and *1L, were discovered and characterized in a population of Black African descent. The two new deletion alleles, CYP2A6*4G and *4H, are distinguished by different crossover junctions at 7.9kb and 7.8kb downstream of the CYP2A6 +1ATG start site, respectively; their combined allele frequency is 1.6%. The new gene conversion alleles, CYP2A6*1B4 and CYP2A6*1L, contain 27bp and 10bp of CYP2A7 sequence in the CYP2A6 3?–flanking region, respectively; their combined allele frequency is 7.3%. CYP2A6*4 appears to associate with lower CYP2A6 activity in vivo, while CYP2A6*1L does not; however, CYP2A6*1L confounds genotyping assays that use the 2A6R3 and 2A6R4 primers. Conclusions As new variants are discovered, the relationships between CYP2A6 genotype, nicotine metabolism, smoking behaviors, and tobacco-related cancer risk will be further clarified. PMID:20136358

2010-01-01

304

Oculo-facio-cardio-dental (OFCD) syndrome: The first Italian case of BCOR and co-occurring OTC gene deletion.  

PubMed

Oculo-facio-cardio-dental (OFCD) syndrome is a rare genetic disorder affecting ocular, facial, dental and cardiac systems. The syndrome is an X-linked dominant trait and it might be lethal in males. This syndrome is usually caused by mutations in the BCL6 interacting co-repressor gene (BCOR). We described a female child with mild phenotype of oculo-facio-cardio-dental syndrome. Array-comparative genomic hybridization (a-CGH) analysis revealed a de novo heterozygous deletion in the Xp11.4 region of approximately 2.3Mb, involving BCOR and ornithine carbamoyl-transferase (OTC) genes. The deletion observed was subsequently confirmed by real time PCR. In this study we report a first case with co-occurrence of BCOR and OTC genes completely deleted in OFCD syndrome. PMID:25620158

Di Stefano, C; Lombardo, B; Fabbricatore, C; Munno, C; Caliendo, I; Gallo, F; Pastore, L

2015-04-01

305

Correlations between long inverted repeat (LIR) features, deletion size and distance from breakpoint in human gross gene deletions  

PubMed Central

Long inverted repeats (LIRs) have been shown to induce genomic deletions in yeast. In this study, LIRs were investigated within ±10?kb spanning each breakpoint from 109 human gross deletions, using Inverted Repeat Finder (IRF) software. LIR number was significantly higher at the breakpoint regions, than in control segments (P < 0.001). In addition, it was found that strong correlation between 5? and 3? LIR numbers, suggesting contribution to DNA sequence evolution (r = 0.85, P < 0.001). 138 LIR features at ±3?kb breakpoints in 89 (81%) of 109 gross deletions were evaluated. Significant correlations were found between distance from breakpoint and loop length (r = ?0.18, P < 0.05) and stem length (r = ?0.18, P < 0.05), suggesting DNA strands are potentially broken in locations closer to bigger LIRs. In addition, bigger loops cause larger deletions (r = 0.19, P < 0.05). Moreover, loop length (r = 0.29, P < 0.02) and identity between stem copies (r = 0.30, P < 0.05) of 3? LIRs were more important in larger deletions. Consequently, DNA breaks may form via LIR-induced cruciform structure during replication. DNA ends may be later repaired by non-homologous end-joining (NHEJ), with following deletion. PMID:25657065

Aygun, Nevim

2015-01-01

306

CONSTRUCTION AND CHARACTERIZATION OF PTA GENE DELETED MUTANT OF C CLOSTRIDIUM TYROBUTYRICUM FOR BUTYRIC ACID FERMENTATION. (R829479C016)  

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

307

CD36 gene deletion reduces fat preference and intake but not post-oral fat conditioning in mice.  

PubMed

Several findings suggest the existence of a "fatty" taste, and the CD36 fatty acid translocase is a candidate taste receptor. The present study compared fat preference and acceptance in CD36 knockout (KO) and wild-type (WT) mice using nutritive (triglyceride and fatty acid) and nonnutritive (Sefa Soyate oil) emulsions. In two-bottle tests (24 h/day) naive KO mice, unlike WT mice, displayed little or no preference for dilute soybean oil, linoleic acid, or Sefa Soyate emulsions. At high concentrations (2.5-20%), KO mice developed significant soybean oil preferences, although they consumed less oil than WT mice. The postoral actions of fat likely conditioned these preferences. KO mice, like WT mice, learned to prefer a flavored solution paired with intragastric soybean oil infusions. These findings support CD36 mediation of a gustatory component to fat preference but demonstrate that it is not essential for fat-conditioned flavor preferences. The finding that oil-naive KO mice failed to prefer a nonnutritive oil, assumed to provide texture rather than taste cues, requires explanation. Finally, CD36 deletion decreased fat consumption and enhanced the ability of the mice to compensate for the calories provided by their optional fat intake. PMID:17804586

Sclafani, A; Ackroff, K; Abumrad, N A

2007-11-01

308

First description of ABCB4 gene deletions in familial low phospholipid-associated cholelithiasis and oral contraceptives-induced cholestasis  

PubMed Central

The wide clinical spectrum of the ABCB4 gene (ATP-binding cassette subfamily B member 4) deficiency syndromes in humans includes low phospholipid-associated cholelithiasis (LPAC), intrahepatic cholestasis of pregnancy (ICP), oral contraceptives-induced cholestasis (CIC), and progressive familial intrahepatic cholestasis type 3 (PFIC3). No ABCB4 mutations are found in a significant proportion of patients with these syndromes. In the present study, 102 unrelated adult patients with LPAC (43 patients) or CIC/ICP (59 patients) were screened for ABCB4 mutations using DNA sequencing. Heterozygous ABCB4 point or short insertion/deletion mutations were found in 37% (16/43) of the LPAC patients and in 27% (16/59) of the ICP/CIC patients. High-resolution gene dosage methodologies were used in the 70 negative patients. Here, we describe for the first time ABCB4 partial or complete heterozygous deletions in 7% (3/43) of the LPAC patients, and in 2% (1/59) of the ICP/CIC patients. Our observations urge to systematically test patients with LPAC, ICP/CIC, and also children with PFIC3 for the presence of ABCB4 deletions using molecular tools allowing detection of gross rearrangements. In clinical practice, a comprehensive ABCB4 alteration-screening algorithm will permit the use of ABCB4 genotyping to confirm the diagnosis of LPAC or ICP/CIC, and allow familial testing. An early diagnosis of these biliary diseases may be beneficial because of the preventive effect of ursodeoxycholic acid on biliary complications. Further comparative studies of patients with well-characterized genotypes (including deletions) and phenotypes will help determine whether ABCB4 mutation types influence clinical outcomes. PMID:21989363

Pasmant, Eric; Goussard, Philippe; Baranes, Laetitia; Laurendeau, Ingrid; Quentin, Samuel; Ponsot, Philippe; Consigny, Yann; Farges, Olivier; Condat, Bertrand; Vidaud, Dominique; Vidaud, Michel; Chen, Jian-Min; Parfait, Béatrice

2012-01-01

309

First description of ABCB4 gene deletions in familial low phospholipid-associated cholelithiasis and oral contraceptives-induced cholestasis.  

PubMed

The wide clinical spectrum of the ABCB4 gene (ATP-binding cassette subfamily B member 4) deficiency syndromes in humans includes low phospholipid-associated cholelithiasis (LPAC), intrahepatic cholestasis of pregnancy (ICP), oral contraceptives-induced cholestasis (CIC), and progressive familial intrahepatic cholestasis type 3 (PFIC3). No ABCB4 mutations are found in a significant proportion of patients with these syndromes. In the present study, 102 unrelated adult patients with LPAC (43 patients) or CIC/ICP (59 patients) were screened for ABCB4 mutations using DNA sequencing. Heterozygous ABCB4 point or short insertion/deletion mutations were found in 37% (16/43) of the LPAC patients and in 27% (16/59) of the ICP/CIC patients. High-resolution gene dosage methodologies were used in the 70 negative patients. Here, we describe for the first time ABCB4 partial or complete heterozygous deletions in 7% (3/43) of the LPAC patients, and in 2% (1/59) of the ICP/CIC patients. Our observations urge to systematically test patients with LPAC, ICP/CIC, and also children with PFIC3 for the presence of ABCB4 deletions using molecular tools allowing detection of gross rearrangements. In clinical practice, a comprehensive ABCB4 alteration-screening algorithm will permit the use of ABCB4 genotyping to confirm the diagnosis of LPAC or ICP/CIC, and allow familial testing. An early diagnosis of these biliary diseases may be beneficial because of the preventive effect of ursodeoxycholic acid on biliary complications. Further comparative studies of patients with well-characterized genotypes (including deletions) and phenotypes will help determine whether ABCB4 mutation types influence clinical outcomes. PMID:21989363

Pasmant, Eric; Goussard, Philippe; Baranes, Laetitia; Laurendeau, Ingrid; Quentin, Samuel; Ponsot, Philippe; Consigny, Yann; Farges, Olivier; Condat, Bertrand; Vidaud, Dominique; Vidaud, Michel; Chen, Jian-Min; Parfait, Béatrice

2012-03-01

310

Correlations between long inverted repeat (LIR) features, deletion size and distance from breakpoint in human gross gene deletions.  

PubMed

Long inverted repeats (LIRs) have been shown to induce genomic deletions in yeast. In this study, LIRs were investigated within ±10?kb spanning each breakpoint from 109 human gross deletions, using Inverted Repeat Finder (IRF) software. LIR number was significantly higher at the breakpoint regions, than in control segments (P < 0.001). In addition, it was found that strong correlation between 5' and 3' LIR numbers, suggesting contribution to DNA sequence evolution (r = 0.85, P < 0.001). 138 LIR features at ±3?kb breakpoints in 89 (81%) of 109 gross deletions were evaluated. Significant correlations were found between distance from breakpoint and loop length (r = -0.18, P < 0.05) and stem length (r = -0.18, P < 0.05), suggesting DNA strands are potentially broken in locations closer to bigger LIRs. In addition, bigger loops cause larger deletions (r = 0.19, P < 0.05). Moreover, loop length (r = 0.29, P < 0.02) and identity between stem copies (r = 0.30, P < 0.05) of 3' LIRs were more important in larger deletions. Consequently, DNA breaks may form via LIR-induced cruciform structure during replication. DNA ends may be later repaired by non-homologous end-joining (NHEJ), with following deletion. PMID:25657065

Aygun, Nevim

2015-01-01

311

Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation  

Microsoft Academic Search

Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially

Gloria Lee; Annie Lo; Sarah A. Short; Tosti J. Mankelow; Frances Spring; Stephen F. Parsons; Narla Mohandas; David J. Anstee; Joel Anne Chasis

2006-01-01

312

The effect of polyphosphate kinase gene deletion on polyhydroxyalkanoate accumulation and carbon metabolism in Pseudomonas putida?KT2440.  

PubMed

The primary enzyme involved in polyphosphate (polyP) synthesis, polyP kinase (ppk), has been deleted in Pseudomonas putida KT2440. This has resulted in a threefold to sixfold reduction in polyhydroxyalkanoate (PHA) accumulation compared with the wild type under conditions of nitrogen limitation, with either temperature or oxidative (H2O2) stress, when grown on glucose. The accumulation of PHA by ?ppk mutant was the same as the wild type under nitrogen-limiting growth conditions. There was no difference in polyP levels between wild-type and ?ppk strains under all growth conditions tested. In the ?ppk mutant proteome, polyP kinase (PPK) was undetectable, but up-regulation of the polyp-associated proteins polyP adenosine triphosphate (ATP)/nicotinamide adenine dinucleotide (NAD) kinase (PpnK), a putative polyP adenosine monophosphate (AMP) phosphotransferase (PP_1752), and exopolyphosphatase was observed. ?ppk strain exhibited significantly retarded growth with glycerol as carbon and energy source (42 h of lag period compared with 24 h in wild-type strain) but similar growth to the wild-type strain with glucose. Analysis of gene transcription revealed downregulation of glycerol kinase and the glycerol facilitator respectively. Glycerol kinase protein expression was also downregulated in the ?ppk mutant. The deletion of ppk did not affect motility but reduced biofilm formation. Thus, the knockout of the ppk gene has resulted in a number of phenotypic changes to the mutant without affecting polyP accumulation. PMID:24115625

Casey, William T; Nikodinovic-Runic, Jasmina; Fonseca Garcia, Pilar; Guzik, Maciej W; McGrath, John W; Quinn, John P; Cagney, Gerard; Prieto, Maria Auxiliadora; O'Connor, Kevin E

2013-10-01

313

Multiple sort flow cytometer  

DOEpatents

A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane.

Van den Engh, Ger (Seattle, WA); Esposito, Richard J. (Seattle, WA)

1996-01-01

314

Multiple sort flow cytometer  

DOEpatents

A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane. 8 figs.

Engh, G. van den; Esposito, R.J.

1996-01-09

315

Factor-multiple Chains  

NSDL National Science Digital Library

This problem offers opportunities for students to reinforce their understanding of factors and multiples and provides them the chance to justify their solutions. The goal is for the students to create number chains of four whole numbers that can range from 2 to 100 and each consecutive number is a multiple of the previous number. The Teachers' Notes page offers suggestions for implementation, key discussion questions, ideas for extension and support, and a link to a spreadsheet for students to experiment with placing numbers in specific boxes in the chain.

2007-04-01

316

Multiple Rankine topping cycles  

SciTech Connect

The efficiency of a Rankine cycle is primarily determined by the temperatures of heat addition and rejection. However, no working fluid has been identified which will operate in a Rankine cycle over an extremely wide temperature range. Multiple Rankine topping cycles offer a technique for achieving high thermal efficiencies in power plants by allowing the use of several working fluids. This paper gives a history of Rankine topping cycles, presents an analysis for the calculation of the overall efficiency of a three-module multiple Rankine cycle, and presents results from a case study for a sodium-mercury-water cycle.

McWhirter, J.D. [Argonne National Lab., Idaho Falls, ID (United States). Engineering Div.]|[Idaho State Univ., Pocatello, ID (United States). Coll. of Engineering

1995-07-01

317

Comparison of multiple DNA vaccines for protection against cytomegalovirus infection in BALB/c mice  

PubMed Central

Background Human cytomegalovirus (HCMV) causes serious HCMV-related diseases in immunocompromised people. Vaccination is the most effective measure to control infection with the pathogen, yet no vaccine has been licensed till now. We performed a head-to-head comparison of the protective abilities of multiple DNA vaccines in murine model of murine cytomegalovirus (MCMV) infection. Methods Five DNA vaccines were constructed. Four encoding MCMV proteins gp34 (m04), p65 (M84), DNA helicase (M105), and immediate-early 1 protein pp89 (IE-1) , respectively, which were reported to induce CD8+ T cell responses, were compared with the one expressing gB (M55), the neutralizing antibody target antigen, for immune protection in BALB/c mice. Mice were immunized with these DNA vaccines 1 to 4 times via intramuscular injection followed by electroporation, and were subsequently infected with a lethal dose (3?×?LD50) of highly virulent SG-MCMV. Specific antibodies and IFN-? secreting splenocytes were detected by immunoblotting and ELISPOT, respectively. Protective abilities in mice provided by the vaccines were evaluated by residual virus titers in organs, survival rate and weight loss. Results These DNA vaccines, especially m04, M84 and IE-1, could effectively reduce the virus loads in salivary glands and spleens of mice, but they couldn’t completely clear the residual virus. Survival rates of 100% in mice after a lethal dose of MCMV infection could be reached by more than one dose of M84 vaccine or two doses of m04 or IE-1 vaccine. Immunization with M55 or M105 DNA at four doses offered mice only 62.5% survival rate after the lethal challenge. Conclusions The study demonstrated that DNA vaccines could effectively afford mice protection against infection with a highly virulent MCMV and that the protection offered by induced CD8+ T cell immunity might be superior to that by gB-specific antibodies. These results are valuable references for development and application of HCMV vaccines. PMID:24898886

2014-01-01

318

IMMUNOLOGY OF MULTIPLE SCLEROSIS  

Microsoft Academic Search

Ke yW ords autoimmunity, autoimmune mechanisms, neuroimmunology, demyelinating dieseases, EAE ? Abstract Multiple sclerosis (MS) develops in young adults with a complex pre- disposing genetic trait and probably requires an inciting environmental insult such as a viral infection to trigger the disease. The activation of CD4+ autoreactive T cells and their differentiation into a Th1 phenotype is a crucial event

Mireia Sospedra; Roland Martin

2005-01-01

319

Automatic multiple applicator electrophoresis  

NASA Technical Reports Server (NTRS)

Easy-to-use, economical device permits electrophoresis on all known supporting media. System includes automatic multiple-sample applicator, sample holder, and electrophoresis apparatus. System has potential applicability to fields of taxonomy, immunology, and genetics. Apparatus is also used for electrofocusing.

Grunbaum, B. W.

1977-01-01

320

Nutrition and multiple gestation.  

PubMed

Multiple pregnancy represents a state of magnified nutritional requirements, resulting in a greater nutrient drain on maternal resources and an accelerated depletion of nutritional reserves. The accelerated starvation which occurs in pregnancy is exaggerated with a multiple gestation, particularly during the second half of pregnancy, with more rapid depletion of glycogen stores and resultant metabolism of fat between meals and during an overnight fast. A reduced glucose stream from mother to fetus results in slower fetal growth, smaller birth size, as well as a higher risk of preterm labor and preterm birth. For this reason, diet therapy with a diabetic regimen of 20% of calories from protein, 40% of calories from carbohydrate, and 40% of calories from fat may be particularly useful. Iron-deficiency anemia has also been linked to preterm delivery and other adverse pregnancy outcomes. Mobilization of maternal iron stores, in addition to an adequate amount and pattern of gestational weight gain (including BMI-specific weight gain goals by 20 and 28 weeks gestation), has been associated with significantly better fetal growth and longer gestations in twin pregnancies. Supplementation with calcium, magnesium, and zinc, as well as multivitamins and essential fatty acids may also reduce pregnancy complications and improve postnatal health for infants born from a multiple gestation. Diet therapy for women pregnant with multiples is an important component of effective prenatal care. PMID:16360494

Luke, Barbara

2005-10-01

321

Simplifying Algebraic Expressions: Multiplication  

NSDL National Science Digital Library

This learning object from Wisc-Online covers simplifying algebraic expressions using multiplication. The unit's activities include defining the terminology associated with algebraic operations, using the fundamental laws of algebra to simplify those expressions, removing the symbols of grouping and changing the signs of the appropriate terms to simplify expressions. Practice questions are also included.

Blohowiak, Chad; Jensen, Douglas; Reed, Allen

2011-02-01

322

Reasoning About Multiplication & Division  

NSDL National Science Digital Library

This 7-minute video features Drew Crandall working with his third grade class to develop concepts involving properties of operations and the relationship between multiplication and division. His approach allows students to learn from each other, to construct and revise their own meaning, and to develop communication skills. A downloadable transcript of the video is available (doc).

2013-01-01

323

Multiple Grammars and MOGUL  

ERIC Educational Resources Information Center

Optionality is a central phenomenon in second language acquisition (SLA), for which any adequate theory must account. Amaral and Roeper (this issue; henceforth A&R) offer an appealing approach to it, using Roeper's Multiple Grammars Theory, which was created with first language in mind but which extends very naturally to SLA. They include…

Truscott, John

2014-01-01

324

?Teriflunomide for multiple sclerosis.  

PubMed

?Teriflunomide (Aubagio-Genzyme Therapeutics), the main metabolite of the disease-modifying anti-rheumatic drug leflunomide,1 is an immunomodulatory agent with anti-inflammatory properties.2 It is a new oral treatment licensed for adults with relapsing-remitting multiple sclerosis. Here we discuss the evidence for its effectiveness and safety, and consider its place in therapy. PMID:25012149

2014-07-01

325

Multiple Penile Schwannomas  

PubMed Central

The occurrence of penile schwannoma is very rare. A 41-year-old man presented with multiple penile tumors and pain on erection. The largest tumor causing pain was excised. Pathology was characteristic of benign schwannoma. We recommend that penile schwannomas be excised if the tumors cause pain or are malignant. PMID:17406168

Liu, Wayne Young; Chao-Hsiang, Chang; Tseng, Gaun-Chin

2006-01-01

326

Multiple Intelligences: A Collection.  

ERIC Educational Resources Information Center

As a concise resource for Howard Gardner's theory of multiple intelligences and its implications for schooling around the world, this collection is designed for educators, parents, and others interested in education. The first section discusses Gardner and his background, and the second section expounds his theory. The third section explores the…

Fogarty, Robin, Ed.; Bellanca, James, Ed.

327

Multiple DNB events  

Microsoft Academic Search

The phenomenon of multiple DNB events in rod bundle heat transfer tests, referring to the occurrence of departure from nucleate boiling (DNB) on more than one heating rod or at more than one location on one heating rod, is examined. This phenomenon is characterized by the deterioration of heat transfer due to the transition from nucleate boiling to film boiling

A. N. Nahavandi; C. F. Fighetti; D. G. Reddy; T. C. L. Poon

1981-01-01

328

What about multiple intelligence?  

Microsoft Academic Search

Gardner (1983) produced a multiple intelligence theory to question the previous generalised measurements for intelligence. He challenged these earlier theories of intelligence by producing a theory in which a group of intelligences could be identified in order to be more specific in the assessment of an individual's ability. Gardner proposed the following intelligences: verbal; mathematical; musical accomplishment; spatially analysing the

Jack K. Garlovsky

329

Multiple Rankine topping cycles  

Microsoft Academic Search

The efficiency of a Rankine cycle is primarily determined by the temperatures of heat addition and rejection. However, no working fluid has been identified which will operate in a Rankine cycle over an extremely wide temperature range. Multiple Rankine topping cycles offer a technique for achieving high thermal efficiencies in power plants by allowing the use of several working fluids.

McWhirter

1995-01-01

330

Multiple Slit Diffraction Model  

NSDL National Science Digital Library

The EJS Multiple Slit Diffraction model allows the user to simulate Fraunhofer diffraction through single or multiple slits. The user can modify the number of slits, the slit width, the slit separation and the wavelength of the incident light. The scale of the diffraction pattern can also be changed and a plot of the light intensity can be toggled on and off with a checkbox. A basic theoretical introduction to diffraction is included. The Multiple Slit Diffraction Model was created using the Easy Java Simulations (Ejs) modeling tool. It is distributed as a ready-to-run (compiled) Java archive. Double clicking the ejs_ntnu_optics_MultipleSlitDiffraction.jar file will run the program if Java is installed. Ejs is a part of the Open Source Physics Project and is designed to make it easier to access, modify, and generate computer models. Additional Open Source Physics programs for quantum mechanics are available. They can be found by searching ComPADRE for Open Source Physics, OSP, or EJS.

Hwang, Fu-Kwun

2008-11-22

331

Involvement of two type 2C protein phosphatases BcPtc1 and BcPtc3 in the regulation of multiple stress tolerance and virulence of Botrytis cinerea.  

PubMed

Type 2C Ser/Thr phosphatases (PP2Cs) are involved in various cellular processes in many eukaryotes, but little has been known about their functions in filamentous fungi. Botrytis cinerea contains four putative PP2C genes, named BcPTC1, -3, -5, and -6. Biological functions of these genes were analysed by gene deletion and complementation. While no phenotypes aberrant from the wild type were observed with mutants of BcPTC5 and BcPTC6, mutants of BcPTC1 and BcPTC3 had reduced hyphal growth, increased conidiation, and impaired sclerotium development. Additionally, BcPTC1 and BcPTC3 mutants exhibited increased sensitivity to osmotic and oxidative stresses, and to cell wall degrading enzymes. Both mutants exhibited dramatically decreased virulence on host plant tissues. All of the defects were restored by genetic complementation of the mutants with wild-type BcPTC1 and BcPTC3 respectively. Different from what is known in Saccharomyces cerevisiae, BcPtc3, but not BcPtc1, negatively regulates phosphorylation of BcSak1 (the homologue of S. cerevisiae Hog1) in B. cinerea, although both BcPTC1 and BcPTC3 were able to rescue the growth defects of a yeast PTC1 deletion mutant under various stress conditions. These results demonstrated that BcPtc1 and BcPtc3 play important roles in the regulation of multiple stress tolerance and virulence of B. cinerea. PMID:23601355

Yang, Qianqian; Jiang, Jinhua; Mayr, Christiane; Hahn, Matthias; Ma, Zhonghua

2013-10-01

332

Core Multiplication in Childhood  

PubMed Central

A dedicated, non-symbolic, system yielding imprecise representations of large quantities (Approximate Number System, or ANS) has been shown to support arithmetic calculations of addition and subtraction. In the present study, 5–7-year-old children without formal schooling in multiplication and division were given a task requiring a scalar transformation of large approximate numerosities, presented as arrays of objects. In different conditions, the required calculation was doubling, quadrupling, or increasing by a fractional factor (2.5). In all conditions, participants were able to represent the outcome of the transformation at above-chance levels, even on the earliest training trials. Their performance could not be explained by processes of repeated addition, and it showed the critical ratio signature of the ANS. These findings provide evidence for an untrained, intuitive process of calculating multiplicative numerical relationships, providing a further foundation for formal arithmetic instruction. PMID:20537618

McCrink, Koleen; Spelke, Elizabeth S.

2011-01-01

333

Fatigue in multiple sclerosis  

Microsoft Academic Search

Fatigue is among the most common, yet least understood, symptoms of multiple sclerosis (MS) [1·]. It can profoundly disrupt\\u000a the occupational and social functioning of patients, and is recognized as a criterion for MS disability by the Social Security\\u000a Administration. Most approaches to fatigue assessment can be classified as either self-report scales or performance-based\\u000a measures of motor or cognitive output.

Lauren B. Krupp; Christopher Christodoulou

2001-01-01

334

Multiple Miniature Avionic Displays  

NASA Technical Reports Server (NTRS)

A display screen for displaying multiple sets of information is provided. In one embodiment, an aviation display screen includes a main window and a plurality of miniature windows. The main window is adapted to illustrate one set of information. Each miniature window is adapted to display a set of avionic information. The avionic display is further adapted to toggle a select set of avionic information in one of the miniature windows into the main window.

Rye, Jeffrey M. (Inventor); Dorneich, Michael C. (Inventor); Gannon, Aaron J. (Inventor)

2008-01-01

335

Multiple Primary Cancer Monograph  

Cancer.gov

To identify groups of cancer survivors that are at increased risk for multiple primary cancers, Radiation Epidemiology Branch (REB) investigators led a collaborative effort to provide the first comprehensive population-based analysis of the risk of subsequent cancer in the U.S. The 500-page monograph utilized data from nine cancer registries participating in the Surveillance, Epidemiology, and End Results (SEER) Program from 1973 to 2000.

336

Universality of particle multiplicities  

SciTech Connect

We discuss the scaling properties and universality aspects of the rapidity and multiplicity distributions of particles produced in high energy hadronic and e{sup +}e{sup {minus}} interactions. This paper is based on material presented in three lectures on pomeron phenomenology, which included a review of traditional soft pomeron physics and selected topics on hard diffraction processes probing the structure function of the pomeron.

Goulianos, K. [Fermi National Accelerator Lab., Batavia, IL (United States)]|[Rockefeller Univ., New York, NY (United States)

1994-09-01

337

Multiple System Atrophy  

Microsoft Academic Search

Multiple system atrophy (MSA) is a sporadic neurodegenerative disorder characterized clinically by various combinations of\\u000a parkinsonian, autonomic, cerebellar, or pyramidal symptoms and signs and pathologically by cell loss, gliosis, and glial cytoplasmic\\u000a inclusions in several brain and spinal cord structures. The term MSA was introduced in 1969, however cases of MSA were previously\\u000a reported under the rubrics of striatonigral degeneration,

Felix Geser; Gregor K. Wenning

338

Multiple Stressors and Disturbances  

Microsoft Academic Search

\\u000a Marine communities are increasingly affected by numerous stressors that act as agents of physical and biological disturbance\\u000a through a combination of natural and human-induced impacts. These include storms, sedimentation, temperature changes, pollution,\\u000a eutrophication, over-harvesting, damage to habitats, arrival of invasive species and climate change. Here I discuss how multiple\\u000a stressors alter assemblages on rocky reefs through direct impacts on organisms

David R. Schiel

339

Multiple Coin Toss Model  

NSDL National Science Digital Library

The Ejs Multiple Coin Toss model displays the result of the flipping of N coins. The result of each set of coin flips is shown by the image of the pennies on the screen and the complete results of the tossing experiment is shown on a graph of the cumulative probability of heads. The number of coins flipped, N, and change the "fairness" of the coin by setting the probability of a "heads" result, p, can be set via text boxes. You can modify this simulation if you have Ejs installed by right-clicking within the plot and selecting âOpen Ejs Modelâ from the pop-up menu item. Ejs Multiple Coin Toss model was created using the Easy Java Simulations (Ejs) modeling tool. It is distributed as a ready-to-run (compiled) Java archive. Double clicking the ejs_MultipleCoinToss.jar file will run the program if Java is installed. Ejs is a part of the Open Source Physics Project and is designed to make it easier to access, modify, and generate computer models. Additional Ejs models for classical mechanics are available. They can be found by searching ComPADRE for Open Source Physics, OSP, or Ejs.

Christian, Wolfgang; Belloni, Mario

2008-11-15

340

Multiple Core Galaxies  

NASA Technical Reports Server (NTRS)

Nuclei of galaxies often show complicated density structures and perplexing kinematic signatures. In the past we have reported numerical experiments indicating a natural tendency for galaxies to show nuclei offset with respect to nearby isophotes and for the nucleus to have a radial velocity different from the galaxy's systemic velocity. Other experiments show normal mode oscillations in galaxies with large amplitudes. These oscillations do not damp appreciably over a Hubble time. The common thread running through all these is that galaxies often show evidence of ringing, bouncing, or sloshing around in unexpected ways, even though they have not been disturbed by any external event. Recent observational evidence shows yet another phenomenon indicating the dynamical complexity of central regions of galaxies: multiple cores (M31, Markarian 315 and 463 for example). These systems can hardly be static. We noted long-lived multiple core systems in galaxies in numerical experiments some years ago, and we have more recently followed up with a series of experiments on multiple core galaxies, starting with two cores. The relevant parameters are the energy in the orbiting clumps, their relative.masses, the (local) strength of the potential well representing the parent galaxy, and the number of cores. We have studied the dependence of the merger rates and the nature of the final merger product on these parameters. Individual cores survive much longer in stronger background potentials. Cores can survive for a substantial fraction of a Hubble time if they travel on reasonable orbits.

Miller, R.H.; Morrison, David (Technical Monitor)

1994-01-01

341

Multiple Identity Enactments and Multiple Personality Disorder: A Sociocognitive Perspective  

Microsoft Academic Search

People who enact multiple identities behave as if they possess 2 or more selves, each with its own characteristic moods, memories, and behavioral repertoire. Under different names, this phenomenon occurs in many cultures: in North American culture, it is frequently labeled multiple personality disorder (MPD). This article reviews experimental, cross-cultural, historical, and clinical findings concerning multiplicity and examines the implications

Nicholas P. Spanos

1994-01-01

342

Factorial Invariance in Multiple Populations: A Multiple Testing Procedure  

ERIC Educational Resources Information Center

A multiple testing method for examining factorial invariance for latent constructs evaluated by multiple indicators in distinct populations is outlined. The procedure is based on the false discovery rate concept and multiple individual restriction tests and resolves general limitations of a popular factorial invariance testing approach. The…

Raykov, Tenko; Marcoulides, George A.; Millsap, Roger E.

2013-01-01

343

Energy efficient multiple antenna communication  

E-print Network

We consider a multiple-input, multiple-output (MIMO) wideband Rayleigh block fading channel where the channel state is unknown at the transmitter and receiver and there is only an average input power constraint. We compute ...

Ray, Siddharth, 1979-

2006-01-01

344

Genetic Amniocentesis in Multiple Pregnancy  

Microsoft Academic Search

Objectives: Second-trimester genetic amniocentesis is the most frequently used invasive prenatal diagnostic technique. Several reports have been published about the effect of genetic amniocentesis on fetal loss in multiple pregnancies over the past two decades. Here we analyze our experience with genetic amniocentesis in multiple pregnancies over the past 10 years. Methods: Details of 184 multiple pregnancies were processed in

Csaba Papp; Artúr Beke; Zoltán Bán; Zoltán Papp

2004-01-01

345

Multiple Cystic Lung Disease  

PubMed Central

A lung cyst is an air-filled lucent structure surrounded by a thin wall. The presence of multiple intrapulmonary cysts is defined as cystic lung disease. Although cystic lung disease is rare, incidental detection has increased significantly in recent years by screening using computed tomography. There are many conditions that can mimic lung cysts and cause cystic lung disease. Clinical, radiographic, and histologic findings are all necessary for a proper diagnosis, and multidisciplinary approaches are frequently required. The aim of this report is to review the causes and characteristics of cystic lung disease to better understand and improve treatment. PMID:23579924

Yoo, Chul-Gyu

2013-01-01

346

[Spasticity in multiple sclerosis].  

PubMed

Already in 1860, the great neurologist Charcot described the symptom spasticity in patients affected by "sclerose en plaque". Spasticity is one of the most common symptoms of multiple sclerosis MS). The consequences of spasticity are very disadvantages because it hinders the functional mobility and overburden disability. Moreover, in the later stages of MS spasticity may be complicated by seating problems, pressure sores, fibrous contractures and poor perineal hygiene. In this article, the therapeutical management of MS spasticity, in all its components (pharmacological, rehabilitative, surgical) is reviewed. PMID:15354762

Pappalardo, A; Patti, F; Reggio, A; Guglielmino, A; Mangiameli, S

2004-04-01

347

Immunology of multiple sclerosis  

Microsoft Academic Search

Multiple sclerosis (MS) is an autoimmune disease of the central nervous system (CNS) leading to demyelination, axonal damage,\\u000a and progressive neurologic disability. The development of MS is influenced by environmental factors, particularly the Epstein-Barr\\u000a virus (EBV), and genetic factors, which include specific HLA types, particularly DRB1*1501-DQA1*0102-DQB1*0602, and a predisposition\\u000a to autoimmunity in general. MS patients have increased circulating T-cell and

Michael P. Pender; Judith M. Greer

2007-01-01

348

Multiplication Tables - Matching Cards  

NSDL National Science Digital Library

This interactive Flash version of the familiar Concentration game ("pelmanism" in the UK) helps a single user practice multiplication facts while developing memory and concentration skills. The player can choose an array of 16, 20, or 24 cards, which appear face down. The goal is to flip two cards at a time to match all the pairs of factors with their products as efficiently as possible. A scoring feature discourages random guessing. Users can choose to work with factors in three ranges: 2x-10x, 2x-21x, or 11x-21x. Printable versions of the game cards are available to download.

2001-03-01

349

Multiple apocrine hidrocystomas.  

PubMed

A 83-year-old woman presented with a 7-year history of translucent papules that were scattered diffusely over her nose, peri-orbital region, and cheeks. These lesions were exacerbated by heat and exercise. Histopathologic examination of a biopsy specimen from the cheek showed a thin-walled cyst lined by a flattened bi-layered epithelium that exhibited decapitation secretion in the upper part of the epidermis. A diagnosis of multiple apocrine hidrocystomas was made based on the clinical and histopathologic findings, and the patient is currently considering treatment options. These include electrodesiccation, excision, trichloracetic acid, carbon-dioxide laser, and 1450-nm diode laser. PMID:18627748

Anandasabapathy, Niroshana; Soldano, Anthony C

2008-01-01

350

Embryonic loss in iatrogenic multiples.  

PubMed

Spontaneous reduction of multiple gestational sacs occurs less often in pregnancies conceived as a result of ovulation induction and assisted reproductive technology compared with spontaneously conceived multiple pregnancies. Whereas most spontaneous multiple pregnancies are twin gestations, a higher proportion of multiple pregnancies that result from ovulation induction and assisted reproductive technology are triplet and higher-order gestations. Recent evidence, described in this article, indicates that although twin and higher-order multiple gestations found on initial ultrasound subsequently may undergo spontaneous reduction to singletons or twins, there may be important consequences for the outcome of the surviving fetus or fetuses. PMID:15644286

Dickey, Richard P

2005-03-01

351

Multiple capillary biochemical analyzer  

DOEpatents

A multiple capillary analyzer allows detection of light from multiple capillaries with a reduced number of interfaces through which light must pass in detecting light emitted from a sample being analyzed, using a modified sheath flow cuvette. A linear or rectangular array of capillaries is introduced into a rectangular flow chamber. Sheath fluid draws individual sample streams through the cuvette. The capillaries are closely and evenly spaced and held by a transparent retainer in a fixed position in relation to an optical detection system. Collimated sample excitation radiation is applied simultaneously across the ends of the capillaries in the retainer. Light emitted from the excited sample is detected by the optical detection system. The retainer is provided by a transparent chamber having inward slanting end walls. The capillaries are wedged into the chamber. One sideways dimension of the chamber is equal to the diameter of the capillaries and one end to end dimension varies from, at the top of the chamber, slightly greater than the sum of the diameters of the capillaries to, at the bottom of the chamber, slightly smaller than the sum of the diameters of the capillaries. The optical system utilizes optic fibres to deliver light to individual photodetectors, one for each capillary tube. A filter or wavelength division demultiplexer may be used for isolating fluorescence at particular bands.

Dovichi, Norman J. (Edmonton, CA); Zhang, Jian Z. (Edmonton, CA)

1995-01-01

352

Bayes multiple decision functions.  

PubMed

This paper deals with the problem of simultaneously making many (M) binary decisions based on one realization of a random data matrix X. M is typically large and X will usually have M rows associated with each of the M decisions to make, but for each row the data may be low dimensional. Such problems arise in many practical areas such as the biological and medical sciences, where the available dataset is from microarrays or other high-throughput technology and with the goal being to decide which among of many genes are relevant with respect to some phenotype of interest; in the engineering and reliability sciences; in astronomy; in education; and in business. A Bayesian decision-theoretic approach to this problem is implemented with the overall loss function being a cost-weighted linear combination of Type I and Type II loss functions. The class of loss functions considered allows for use of the false discovery rate (FDR), false nondiscovery rate (FNR), and missed discovery rate (MDR) in assessing the quality of decision. Through this Bayesian paradigm, the Bayes multiple decision function (BMDF) is derived and an efficient algorithm to obtain the optimal Bayes action is described. In contrast to many works in the literature where the rows of the matrix X are assumed to be stochastically independent, we allow a dependent data structure with the associations obtained through a class of frailty-induced Archimedean copulas. In particular, non-Gaussian dependent data structure, which is typical with failure-time data, can be entertained. The numerical implementation of the determination of the Bayes optimal action is facilitated through sequential Monte Carlo techniques. The theory developed could also be extended to the problem of multiple hypotheses testing, multiple classification and prediction, and high-dimensional variable selection. The proposed procedure is illustrated for the simple versus simple hypotheses setting and for the composite hypotheses setting through simulation studies. The procedure is also applied to a subset of a microarray data set from a colon cancer study. PMID:25414762

Wu, Wensong; Peña, Edsel A

2013-01-01

353

Multiple Differential Aperture Microscopy  

SciTech Connect

Differential-aperture X-ray microscopy (DAXM) is a powerful approach to 3D tomography with particular relevance to X-ray microdiffraction. With DAXM, scattering from submicron volumes can be resolved. However, the method is intrinsically a scanning technique where every resolved volume element (voxel) requires at least one area-detector readout. Previous applications of DAXM have used a single wire for knife-edge step profiling. Here, we demonstrate a way to accelerate DAXM measurements using multiple wires. A proof-of-principle experiment with a three-wire prototype showed that the speed of measurements can be tripled, but careful calibrations of wires will be required to maintain the spatial accuracy. In addition, related possibilities for accelerating measurements are briefly discussed.

Chung, Jin-Seok [ORNL; Isa, Saliman Anavami [ORNL; Greene, Virgil [ORNL; Broadwater, Ombreyan Q [ORNL; Liu, W. [Argonne National Laboratory (ANL); Ice, Gene E [ORNL

2007-01-01

354

Multiple layer insulation cover  

DOEpatents

A multiple layer insulation cover for preventing heat loss in, for example, a greenhouse, is disclosed. The cover is comprised of spaced layers of thin foil covered fabric separated from each other by air spaces. The spacing is accomplished by the inflation of spaced air bladders which are integrally formed in the cover and to which the layers of the cover are secured. The bladders are inflated after the cover has been deployed in its intended use to separate the layers of the foil material. The sizes of the material layers are selected to compensate for sagging across the width of the cover so that the desired spacing is uniformly maintained when the cover has been deployed. The bladders are deflated as the cover is stored thereby expediting the storage process and reducing the amount of storage space required.

Farrell, James J. (Livingston Manor, NY); Donohoe, Anthony J. (Ovid, NY)

1981-11-03

355

Pomalidomide for multiple myeloma.  

PubMed

Once characterized by a very poor outcome, multiple myeloma (MM) now has a significantly prolonged survival, with major improvements allowed by the use of 'novel agents': proteasome inhibitors (first-in-class bortezomib) and immunomodulatory compounds (IMiDs; first-in-class thalidomide and lenalidomide). However, the vast majority - if not all - of patients with MM ultimately end up being refractory to all existing drugs, including these efficient novel agents. There is a clear unmet medical need in this situation, which warrants the development of the next generation of proteasome inhibitors and IMiDs, as well as new drug classes. This drug profile focuses on pomalidomide, the next generation IMiD, recently approved by the US FDA and the EMA for patients with relapsed or refractory MM who have received at least two prior therapies, including lenalidomide and bortezomib, and have demonstrated disease progression on their last therapy. PMID:25265911

Fouquet, Guillemette; Bories, Claire; Guidez, Stéphanie; Renaud, Loïc; Herbaux, Charles; Javed, Sahir; Facon, Thierry; Leleu, Xavier

2014-12-01

356

Mixed Mode Matrix Multiplication  

SciTech Connect

In modern clustering environments where the memory hierarchy has many layers (distributed memory, shared memory layer, cache,...), an important question is how to fully utilize all available resources and identify the most dominant layer in certain computations. When combining algorithms on all layers together, what would be the best method to get the best performance out of all the resources we have? Mixed mode programming model that uses thread programming on the shared memory layer and message passing programming on the distributed memory layer is a method that many researchers are using to utilize the memory resources. In this paper, they take an algorithmic approach that uses matrix multiplication as a tool to show how cache algorithms affect the performance of both shared memory and distributed memory algorithms. They show that with good underlying cache algorithm, overall performance is stable. When underlying cache algorithm is bad, superlinear speedup may occur, and an increasing number of threads may also improve performance.

Meng-Shiou Wu; Srinivas Aluru; Ricky A. Kendall

2004-09-30

357

Multiplicative representations of integers  

Microsoft Academic Search

Lehh ? 2, and let ?=(B\\u000a 1, …,B\\u000a \\u000a h\\u000a ), whereB\\u000a \\u000a 1\\u000a ? N={1, 2, 3, …} fori=1, …,h. Denote by g?(n) the number of representations ofn in the formn=b\\u000a 1 …b\\u000a \\u000a h\\u000a , whereb\\u000a \\u000a i\\u000a ?B\\u000a \\u000a i\\u000a . If v (n) > 0 for alln >n\\u000a 0, then ? is anasymptotic multiplicative system of order h. The setB is

Melvyn B. Nathanson; ABSI RACI

1987-01-01

358

Dancing with Multiple Partners  

NSDL National Science Digital Library

Transmembrane proteins, such as G protein-coupled receptors (GPCRs) and integrins, activate intracellular signaling pathways through interactions with downstream binding partners. Woodside discusses two examples in which GPCRs and integrins interact in a noncompeting manner with more than one partner. The specific GPCR described is the thrombin receptor, in experiments where G protein peptides selectively block signaling through a particular G protein that does not appear to inhibit coupling of the receptor to other G proteins. The second system described is the ?IIb?3 integrin and its activation of the nonreceptor tyrosine kinase Syk. Syk appeared capable of interacting with both the integrin and intracellular domains of immune response receptors, because binding of Syk to the integrin was not inhibited by peptides based on the Syk binding site in immune response receptors. Thus, multiple, noncompeting binding partners add to the complexity of signal transduction outputs from a single receptor complex.

Darren G. Woodside (Texas Biotechnology Corporation; REV)

2002-03-19

359

MULTIPLE GALAXY COLLISIONS  

NASA Technical Reports Server (NTRS)

Here is a sampling of 15 ultraluminous infrared galaxies viewed by NASA's Hubble Space Telescope. Hubble's sharp vision reveals more complexity within these galaxies, which astronomers are interpreting as evidence of a multiple-galaxy pileup. These images, taken by the Wide Field and Planetary Camera 2, are part of a three-year study of 123 galaxies within 3 billion light-years of Earth. The study was conducted in 1996, 1997, and 1999. False colors were assigned to these photos to enhance fine details within these coalescing galaxies. Credits: NASA, Kirk Borne (Raytheon and NASA Goddard Space Flight Center, Greenbelt, Md.), Luis Colina (Instituto de Fisica de Cantabria, Spain), and Howard Bushouse and Ray Lucas (Space Telescope Science Institute, Baltimore, Md.)

2002-01-01

360

Multiple primary cutaneous plasmacytoma.  

PubMed

A 66-year-old Japanese man presented with a painless skin tumor in his left axillae which had been present for several years without receiving any medical treatment. The tumor enlarged and lesions appeared on several areas on his body within a few months of April 2012 (Fig. 1). Histopathological examination of a skin biopsy specimen taken from a right inguinal tumor showed a dense infiltrate of atypical plasmacytoid cells in the dermis and subcutis (Fig. 2). The epidermis and papillary dermis were not involved. Immunohistological analysis revealed that the tumor cells were negative for T- and B-cell surface markers CD3, CD4, CD8, CD20, CD56, CD79, and HLA-DR (Fig. 3), as well as the mature plasma cell and plasma neoplasm marker, CD138 (Fig. 3), but were positive for IgG, IgG ? light chain, bcl-2 and multiple myeloma oncogene-1 (MUM-1) (Fig. 4). Laboratory investigation revealed a small amount of Bence-Jones protein in the urine and elevated serum levels of total protein (10.5 g/dL), creatinine (1.4 mg/dL), calcium (1.4 mg/dL), immunoglobulin G (5720 mg/dL), and ?2 microglobulin (8.1 mg/dL). Chest and abdominal computed tomography showed multiple subcutaneous masses; however, other organs were unaffected. Histopathological examination of a bone marrow biopsy specimen showed no abnormalities. The diagnosis of primary cutaneous plasmacytoma (PCP) was made based on the International Myeloma Working Group criteria (1). The patient was treated with bortezomib and combined vincristine, doxorubicin, and dexamethasone therapy. The tumors initially responded to therapy by decreasing in size and temporarily disappearing. Several months later, the subcutaneous tumors reappeared and enlarged, and the patient subsequently died from bleeding from a tumor in the abdomen 14 months after initial presentation. Extramedullar plasmacytoma (EMP) is a plasma cell tumor that arises outside the bone marrow and may occur in the upper respiratory tract, gastrointestinal tract, and central nervous system, but cutaneous involvement is rare (1). PCPs constitute approximately 2-4% of EMP (2). A prognostic difference between the solitary and multiple forms of the disease has been highlighted by some clinicians who pointed out that the latter runs a more aggressive course and has a relatively high mortality rate, as was seen in our patient (3). PCP cells usually express CD79a, CD38, and CD138, but are negative for CD20 and leukocyte common antigen. Monotypic expression of IgG light chains is usually present (3). In our case, tests were negative for CD79 and CD138, but positive for MUM-1, bcl-2, and IgG light chain. Bcl-2 is member of a family of signaling molecules with proapoptotic and anti-apoptotic activities (4). Located in the mitochondrial membrane, bcl-2 prevents cell death by inhibiting adapter molecules involved in the activation of caspases in the intrinsic pathway. Overexpression of bcl-2 is found in most human tumor types, and is associated with prolonged tumor cell survival, an aggressive clinical course, drug resistance, and a decreased survival rate (5). Tumor expression of bcl-2 and the presence of multiple tumors in the present case were associated with a poor prognosis. PMID:25580795

Maejima, Hideki; Katsuoka, Kensei; Togano, Tomiteru

2014-12-01

361

Multiple asteroid rendezvous missions  

NASA Technical Reports Server (NTRS)

Asteroid missions, centered on multiple asteroid rendezvous missions to main belt asteroids, are discussed and the required solar electric propulsion for these missions as well as the current performance estimates are examined. A brief statistical analysis involving asteroid availability transfer requirements and propulsion system capabilities is given, leading to a prediction that 5 to 8 asteroids can be encountered with a single launch. Measurement techniques include visual imaging, radio tracking, magnetometry, and in the case of landers, seismometry. The spacecraft will be propelled by a solar electric system with a power level of 25 kW to 40 kW and tour possibilities for 13 different asteroids have been developed. Preliminary estimates of asteroid triaxiality are made to calculate the effect of close orbits.

Bender, D. F.; Friedlander, A. L.

1979-01-01

362

Multiple Sclerosis in Children  

PubMed Central

Multiple sclerosis (MS) is the most important immune-mediated demyelinated disease of human which is typically the disease of young adults. A total of 4% to 5% of MS population are pediatric. Pediatric MS is defined as the appearance of MS before the age of sixteen. About 80% of the pediatric cases and nearly all adolescent onset patients present with attacks typical to adult MS. Approximately 97% to 99% of the affected children have relapsing-remitting MS, while 85% to 95% of the adults experience such condition. MS in children is associated with more frequent and severe relapses. Treatment is the same as adults. We aimed to review the epidemiology, etiology, clinical manifestations, and treatment of MS in children. PMID:24665290

INALOO, Soroor; HAGHBIN, Saideh

2013-01-01

363

IRON IN MULTIPLE MYELOMA  

PubMed Central

Multiple myeloma is a non-curable B cell malignancy in which iron metabolism plays an important role. Patients with this disorder almost universally suffer from a clinically significant anemia, which is often symptomatic, and which is due to impaired iron utilization. Recent studies indicate that the proximal cause of dysregulated iron metabolism and anemia in these patients is cytokine-induced upregulation of hepcidin expression. Malignant myeloma cells are dependent on an increased influx of iron and therapeutic efforts are being made to target this requirement. The studies detailing the characteristics and biochemical abnormalities in iron metabolism causing anemia and the initial attempts to target iron therapeutically are described in this review. PMID:23879589

VanderWall, Kristina; Daniels-Wells, Tracy R; Penichet, Manuel; Lichtenstein, Alan

2013-01-01

364

Stochastically ordered multiple regression  

PubMed Central

In various application areas, prior information is available about the direction of the effects of multiple predictors on the conditional response distribution. For example, in epidemiology studies of potentially adverse exposures and continuous health responses, one can typically assume a priori that increasing the level of an exposure does not lead to an improvement in the health response. Such an assumption can be formalized through a stochastic ordering assumption in each of the exposures, leading to a potentially large improvement in efficiency in nonparametric modeling of the conditional response distribution. This article proposes a Bayesian nonparametric approach to this problem based on characterizing the conditional response density as a Gaussian mixture, with the locations of the Gaussian means varying flexibly with predictors subject to minimal constraints to ensure stochastic ordering. Theoretical properties are considered and Markov chain Monte Carlo methods are developed for posterior computation. The methods are illustrated using simulation examples and a reproductive epidemiology application. PMID:20150656

Bornkamp, Björn; Ickstadt, Katja; Dunson, David

2010-01-01

365

Treatment of multiple sclerosis.  

PubMed

Multiple Sclerosis (MS) is a chronic inflammatory demyelinating disease of the central nervous system, with highly variable clinical course that most typically exhibits a relapsing-remitting pattern. Neuroimaging, pathological findings and response to available therapies are also not uniform. It commonly affects young adults and is usually characterized in the early years by acute relapses followed by partial or complete remission; in later years progressive and irreversible disability develops. The clinical course of MS is defined as relapsing-remitting (RRMS), primary progressive (PPMS), progressive relapsing (PRMS) and secondary progressive (SPMS). The treatment of RRMS is based on the use of immunosuppressive and immune-modulating therapy. Immunosuppressive agents have been used in multiple sclerosis for decades. Intravenous methylprednisolone is currently the treatment of choice for the relapses. The currently approved treatments for MS are disease-modifying agents, which only reduce the attack rate and delay progression in some patients and are believed to be effective only for the inflammatory component of the disease. Immunomodulating and immunosuppressive treatments are directed against the inflammatory process and are only partially effective. In RRMS, positive effects on disease activity have slowed disability progression, but in PPMS the same degree of effect of immunotherapies on relapses and active MRI lesions had little or no effects on the progression of disability. This partial failure could be explained by mechanisms of axonal damage at least partially independent from acute or chronic inflammation. This suggests that there is a need for better use of available treatments and the necessity of alternative new therapeutic options to stop disease progression and improve recovery mechanisms. The practicing neurologist must understand the MS spectrum and evaluate patient-specific factors to determine the best strategy for therapy. PMID:19601814

Anlar, Omer

2009-06-01

366

Multiple neurilemomas. A case report.  

PubMed

Multiple neurilemomas in diverse locations of the body developed in a 53-year-old woman. The patient had multiple neurilemomas which occurred in the thoracic spine, lumbar spine, retroperitoneal sympathetic chain, sacral nerve root, femoral nerve, both sciatic nerves, radial nerve, and ulnar nerve without evidence of Von Recklinghausen's disease. This is the first well documented report on multiple neurilemomas with whole body distribution. PMID:9917714

Shin, K H; Moon, S H; Suh, J S; Jahng, J S

1998-12-01

367

Disability in multiple sclerosis  

PubMed Central

Objective: To create a reference table of disability outcomes in multiple sclerosis (MS) that would enable patients to rank their disability relative to others' with similar disease duration and to develop a cost-effective research tool for comparing MS severity across patient populations and time periods. Methods: The North American Research Committee on Multiple Sclerosis (NARCOMS) Registry collects disability data from patients with MS on a validated, 9-point Patient-Determined Disease Steps (PDDS) scale. We compiled the Disability Expectancy Table, which displays cumulative frequencies of PDDS scores for each year of disease duration, from 0 to 45 years. We also tabulated disease duration–adjusted mean ranks of PDDS scores, referred to as Patient-derived MS Severity Scores (P-MSSS). Results: The cohort consisted of 27,918 NARCOMS enrollees, 72.7% of whom were female and 90.1% of whom were white. Mean age at symptom onset was 30.1 ± 10.1 years, and age at enrollment was 47.1 ± 11.0 years. The Disability Expectancy Table and P-MSSS afford a detailed overview of disability outcomes in a large MS cohort over a 45-year period. In the first year of disease, 15% of patients reported need of ambulatory aid, and 4% needed bilateral assistance or worse; after 45 years of disease, 76% of patients required ambulatory aid, and 52% bilateral assistance or worse. Proportion of patients who reported minimal or no interference in daily activities (PDDS ? 1) declined from 63% in the first year to 8% after 45 years of disease. Conclusion: The Disability Expectancy Table allows individual patients to determine how their disability ranks relative to NARCOMS enrollees with the same disease duration. P-MSSS may be used to compare disability across patient populations and to track disease progression in patient cohorts. P-MSSS does not require a formal neurologic examination and may therefore find wide applicability as a practical and cost-effective outcome measure in epidemiologic studies. PMID:23427319

Chamot, Eric; Salter, Amber R.; Cutter, Gary R.; Bacon, Tamar E.; Herbert, Joseph

2013-01-01

368

Multiple trellis coded modulation  

NASA Technical Reports Server (NTRS)

A technique for designing trellis codes to minimize bit error performance for a fading channel. The invention provides a criteria which may be used in the design of such codes which is significantly different from that used for average white Gaussian noise channels. The method of multiple trellis coded modulation of the present invention comprises the steps of: (a) coding b bits of input data into s intermediate outputs; (b) grouping said s intermediate outputs into k groups of s.sub.i intermediate outputs each where the summation of all s.sub.i,s is equal to s and k is equal to at least 2; (c) mapping each of said k groups of intermediate outputs into one of a plurality of symbols in accordance with a plurality of modulation schemes, one for each group such that the first group is mapped in accordance with a first modulation scheme and the second group is mapped in accordance with a second modulation scheme; and (d) outputting each of said symbols to provide k output symbols for each b bits of input data.

Simon, Marvin K. (Inventor); Divsalar, Dariush (Inventor)

1990-01-01

369

Visualizing Multiple Quantile Plots.  

PubMed

Multiple-quantile plots provide a powerful graphical method for comparing the distributions of two or more populations. This article develops a method of visualizing triple-quantile plots and their associated confidence tubes, thus extending the notion of a quantile-quantile (QQ) plot to three dimensions. More specifically, we consider three independent one-dimensional random samples with corresponding quantile functions Q 1, Q 2, and Q 3. The triple-quantile (QQQ) plot is then defined as the three-dimensional curve Q(p) = (Q 1(p), Q 2(p), Q 3(p)), where 0 < p < 1. The empirical likelihood method is used to derive simultaneous distribution-free confidence tubes for Q. We apply our method to an economic case study of strike durations and to an epidemiological study involving the comparison of cholesterol levels among three populations. These data as well as the Mathematica code for computation of the tubes are available in the online supplementary materials. PMID:24465124

Boon, Marko A A; Einmahl, John H J; McKeague, Ian W

2013-03-01

370

Apoptosis of Multiple Myeloma  

PubMed Central

Multiple myeloma (MM) is a malignancy of terminally differentiated plasma cells. MM cells localize to the bone marrow, where cell adhesion–mediated autocrine or paracrine activation of various cytokines, such as interleukin 6, insulin-like growth factor 1, and interferon ?, results in their accumulation mainly because of loss of critical apoptotic controls. Resistance to apoptosis, a genetically regulated cell death process, may play a critical role in both pathogenesis and resistance to treatment of MM. Abnormalities in regulation and execution of apoptosis can contribute to tumor initiation, progression, as well as to tumor resistance to various therapeutic agents. Apoptosis is executed via 2 main pathways that lead to activation of caspases: the death receptor (extrinsic) pathway and the mitochondrial (intrinsic) pathway. Ionizing radiation and chemotherapeutic agents act primarily through the intrinsic pathway, in which mitochondria play the central role. Various therapeutic modalities that are effective in MM modulate levels of the proapoptotic and antiapoptotic Bcl-2 family of proteins and of inhibitors of apoptosis, expression of which is primarily regulated by p53, nuclear factor ?B, and STAT (signal transducers and activators of transcription) factors. This review focuses on the key concepts and some of the most recent studies of signaling pathways regulated in MM and summarizes what is known about the clinical role of these pathways. PMID:15540896

Oancea, Marcela; Mani, Aruna; Hussein, Mohamad A; Almasan, Alexandru

2005-01-01

371

Immunopathogenesis of multiple sclerosis  

PubMed Central

Multiple sclerosis (MS) is a suspected autoimmune disease in which myelin-specific CD4+ and CD8+ T cells enter the central nervous system (CNS) and initiate an inflammatory response directed against myelin and other components of the CNS. Acute MS exacerbations are believed be the result of active inflammation, and progression of disability is generally believed to reflect accumulation of damage to the CNS, particularly axonal damage. Over the last several years, the pathophysiology of MS is being appreciated to be much more complex, and it appears that the development of the MS plaque involves a large number of cell populations, including CD8+ T lymphocytes, B cells, and Th17 cells (a population of helper T cells that secrete the inflammatory cytokine IL-17). The axonal transection and degeneration that is thought to represent the basis for progressive MS is now recognized to begin early in the disease process and to continue in the progressive forms of the disease. Molecules important for limiting aberrant neural connections in the CNS have been identified, which suppress axonal sprouting and regeneration of transected axons within the CNS. Pathways have also been identified that prevent remyelination of the MS lesion by oligodendrocyte precursors. Novel neuroimaging methodologies and potential biomarkers are being developed to monitor various aspects of the disease process in MS. As we identify the pathways responsible for the clinical phenomena of MS, we will be able to develop new therapeutic strategies for this disabling illness of young adults. PMID:20182567

Racke, Michael K.

2009-01-01

372

Sphingolipids in multiple sclerosis  

PubMed Central

Multiple sclerosis (MS) is a chronic autoimmune demyelinating disease of the CNS. Oligodendrocytes, the myelin forming cells of the central nervous system (CNS), are target cells in MS. Although the etiology of MS is poorly known, new insights suggest oligodendrocyte apoptosis as one of the critical events followed by glial activation and infiltration of lymphocytes and macrophages. A major breakthrough in delineation of the mechanism of cell death, perivascular cuffing and glial activation came from elucidation of the sphingolipid signal transduction pathway. The sphingolipid signal transduction pathway induces apoptosis, differentiation, proliferation, and growth arrest depending upon cell and receptor types, and downstream targets. Sphingomyelin, a major component of myelin membrane formed by mature oligodendrocytes, is abundant in the CNS and ceramide, its primary catabolic product released by activation of either neutral or acidic sphingomyelinase, serves as a potential lipid second messenger or mediator molecule modulating diverse cellular signaling pathways. Similarly, under certain conditions, sphingosine produced from ceramide by ceramidase is phosphorylated by sphingosine kinases to sphingosine-1 phosphate, another potent second messenger molecule. Both ceramide and sphingosine-1 phosphate regulate life and death of many cell types including brain cells and participate in pathogenic processes of MS. In this review, we have made an honest attempt to compile recent findings made by others and us relating to the role of sphingolipids in the disease process of MS. PMID:20607622

Jana, Arundhati; Pahan, Kalipada

2010-01-01

373

Multiple stage railgun  

DOEpatents

A multiple stage magnetic railgun accelerator (10) for accelerating a projectile (15) by movement of a plasma arc (13) along the rails (11,12). The railgun (10) is divided into a plurality of successive rail stages (10a-n) which are sequentially energized by separate energy sources (14a-n) as the projectile (15) moves through the bore (17) of the railgun (10). Propagation of energy from an energized rail stage back towards the breech end (29) of the railgun (10) can be prevented by connection of the energy sources (14a-n) to the rails (11,12) through isolation diodes (34a-n). Propagation of energy from an energized rail stage back towards the breech end of the railgun can also be prevented by dividing the rails (11,12) into electrically isolated rail sections (11a-n, 12a-n). In such case means (55a-n) are used to extinguish the arc at the end of each energized stage and a fuse (31) or laser device (61) is used to initiate a new plasma arc in the next energized rail stage.

Hawke, Ronald S. (Livermore, CA); Scudder, Jonathan K. (Pleasanton, CA); Aaland, Kristian (Livermore, CA)

1982-01-01

374

PET in Multiple Sclerosis.  

PubMed

PET is a powerful in vivo functional imaging tool for investigating healthy and diseased brain. It provides noninvasive quantification of selected biological targets that could help build understanding of complex central nervous system disorders such as multiple sclerosis (MS). To date, in MS, PET could only offer complementary support to MRI studies because MRI has still a profound role in monitoring the clinical course of MS. However, recent developments in PET imaging offer the potential to assess the MS brain in vivo in a way that MRI is limited. PET in MS could be used for the investigation of underlying pathophysiology of neuroinflammation, neuronal dysfunction, and demyelination, and remyelination. Quantitative measures of molecular targets with PET could also have future uses in clinical trials of drug development. However, the use of PET is still limited because of the high costs of cyclotrons and radiochemical laboratories. Once these limitations are bypassed alongside advances in research, PET could help in the clinical practice of MS by providing a useful imaging tool for the accurate diagnosis, monitoring of clinical progression, and planning of treatment. PMID:24561681

Niccolini, Flavia; Su, Paul; Politis, Marios

2015-01-01

375

Performance of multiple pulse multiple delay modulated UWB signals in a multiple access indoor wireless channel  

Microsoft Academic Search

In this paper, the performance of a two user UWB multiple access (UWB-MA) system based on multiple-pulse multiple-delay (MPMD) modulation scheme in an indoor wireless channel is evaluated by computer simulations. The indoor multipart propagation channel model used in this study is based on the modified statistical Saleh-Valenzuela model proposed by Foerester and Li from Intel. The simulation results indicate

Faranak Nekoogar; Farid Dowla

2003-01-01

376

Multiple Intelligences Centers and Projects.  

ERIC Educational Resources Information Center

Based upon Gardner's theory of multiple intelligences, this book guides elementary school teachers through the process of using classroom learning centers and projects by providing choices for students. The guide is divided into two sections, providing the theoretical background and information on how to develop multiple intelligences learning…

Chapman, Carolyn; Freeman, Lynn

377

Bent Bonds and Multiple Bonds.  

ERIC Educational Resources Information Center

Considers carbon-carbon multiple bonds in terms of Pauling's bent bond model, which allows direct calculation of double and triple bonds from the length of a CC single bond. Lengths of these multiple bonds are estimated from direct measurements on "bent-bond" models constructed of plastic tubing and standard kits. (CS)

Robinson, Edward A.; Gillespie, Ronald J.

1980-01-01

378

Fourier transform multiple quantum NMR  

Microsoft Academic Search

The motivation for detecting multiple quantum transitions by a Fourier transform experiment is reviewed and an experimental approach to high resolution multiple quantum spectra in dipolar systems along with results on some protonated liquid crystal systems are described. A simple operator formalism for the essential features of the time development is presented and some applications in progress are discussed. A

G. Drobny; A. Pines; S. Sinton; D. Weitekamp; D. Wemmer

1978-01-01

379

Multiple phases of protien gels  

Microsoft Academic Search

A multiple phase transition was observed in gels made by covalently cross-linking proteins in either native or denatured state. The enzymatic activity of the gels prepared from native alpha-chymotrypsin was determined for each of the multiple phases. The reversibility of the swelling degrees and the enzymatic reaction rates upon phase transition suggests that the protein is at a free energy

Masahiko Annaka; Toyoichi Tanaka

1994-01-01

380

Symptomatic therapy in multiple sclerosis  

PubMed Central

Multiple sclerosis is the most common disabling neurological disease of young adults. The ability to impact the quality of life of patients with multiple sclerosis should not only incorporate therapies that are disease modifying, but should also include a course of action for the global multidisciplinary management focused on quality of life and functional capabilities. PMID:21694806

Frohman, Teresa C.; Castro, Wanda; Shah, Anjali; Courtney, Ardith; Ortstadt, Jeffrey; Davis, Scott L.; Logan, Diana; Abraham, Thomas; Abraham, Jaspreet; Remington, Gina; Treadaway, Katherine; Graves, Donna; Hart, John; Stuve, Olaf; Lemack, Gary; Greenberg, Benjamin; Frohman, Elliot M.

2011-01-01

381

Undecidability of Multiplicative Subexponential Logic  

E-print Network

Undecidability of Multiplicative Subexponential Logic Kaustuv Chaudhuri INRIA, France kaustuv.chaudhuri@inria.fr [Presented at LINEARITY 2014, July 13, 2014] Abstract Subexponential logic is a variant of linear logic show that classical propositional multiplicative linear logic extended with one unrestricted and two

Paris-Sud XI, Université de

382

HPV16 E2 is an immediate early marker of viral infection, preceding E7 expression in precursor structures of cervical carcinoma.  

PubMed

The viral E2 gene product plays a crucial role in the human papillomavirus (HPV) vegetative cycle by regulating both transcription and replication of the viral genome. E2 is a transcriptional repressor of the E6 and E7 viral oncogenes for HPV types 16 and 18, which are involved in cervical cancers. Using new polyclonal antibodies against the HPV16 E2 protein, we showed that E2 is expressed at various precursor stages of cervical carcinoma by immunohistochemistry on paraffin-embedded clinical samples. E2 was found to be highly expressed in the nuclei and cytoplasm of cells forming the intermediate and upper layers of cervical intraepithelial neoplasia (CIN). We could show that the expressions of E2 and p16(INK4a) (surrogate marker for oncogenic E7 expression) were exclusive in most of the cases, thus implying that E2 is not expressed together with high levels of E7. Moreover, we found that E2 is expressed in a subset of columnar cells adjacent to the CIN. We could show that expression of E2 is topologically distinct from the proliferation markers p63 and Ki67, whereas it coincides with the expression of cytokeratin K13, a marker of squamous cell differentiation. Expression of E2 also topologically coincides with episomal amplification of viral genomes in the upper layers of CIN1. These in vivo data thus validate previous assumptions of the crucial role of E2 in the early steps of HPV infection and of its negative link with expression of the viral E6 and E7 oncogenes. PMID:20530671

Xue, Yuezhen; Bellanger, Sophie; Zhang, Wenying; Lim, Diana; Low, Jeffrey; Lunny, Declan; Thierry, Françoise

2010-07-01

383

Modelling Negative Feedback Networks for Activating Transcription Factor 3 Predicts a Dominant Role for miRNAs in Immediate Early Gene Regulation  

PubMed Central

Activating transcription factor 3 (Atf3) is rapidly and transiently upregulated in numerous systems, and is associated with various disease states. Atf3 is required for negative feedback regulation of other genes, but is itself subject to negative feedback regulation possibly by autorepression. In cardiomyocytes, Atf3 and Egr1 mRNAs are upregulated via ERK1/2 signalling and Atf3 suppresses Egr1 expression. We previously developed a mathematical model for the Atf3-Egr1 system. Here, we adjusted and extended the model to explore mechanisms of Atf3 feedback regulation. Introduction of an autorepressive loop for Atf3 tuned down its expression and inhibition of Egr1 was lost, demonstrating that negative feedback regulation of Atf3 by Atf3 itself is implausible in this context. Experimentally, signals downstream from ERK1/2 suppress Atf3 expression. Mathematical modelling indicated that this cannot occur by phosphorylation of pre-existing inhibitory transcriptional regulators because the time delay is too short. De novo synthesis of an inhibitory transcription factor (ITF) with a high affinity for the Atf3 promoter could suppress Atf3 expression, but (as with the Atf3 autorepression loop) inhibition of Egr1 was lost. Developing the model to include newly-synthesised miRNAs very efficiently terminated Atf3 protein expression and, with a 4-fold increase in the rate of degradation of mRNA from the mRNA/miRNA complex, profiles for Atf3 mRNA, Atf3 protein and Egr1 mRNA approximated to the experimental data. Combining the ITF model with that of the miRNA did not improve the profiles suggesting that miRNAs are likely to play a dominant role in switching off Atf3 expression post-induction. PMID:24811474

Tindall, Marcus J.; Clerk, Angela

2014-01-01

384

Inhibition of S-Phase Cyclin-Dependent Kinase Activity Blocks Expression of Epstein-Barr Virus Immediate-Early and Early Genes, Preventing Viral Lytic Replication  

Microsoft Academic Search

The induction of lytic replication of the Epstein-Barr virus (EBV) completely arrests cell cycle progression, in spite of elevation of S-phase cyclin-dependent kinase (CDK) activity, thereby causing accumulation of hyperphosphorylated forms of retinoblastoma (Rb) protein (A. Kudoh, M. Fujita, T. Kiyono, K. Kuzushima, Y. Sugaya, S. Izuta, Y. Nishiyama, and T. Tsurumi, J. Virol. 77:851-861, 2003). Thus, the EBV lytic

Ayumi Kudoh; Tohru Daikoku; Yutaka Sugaya; Hiroki Isomura; Masatoshi Fujita; Tohru Kiyono; Yukihiro Nishiyama; Tatsuya Tsurumi

2004-01-01

385

Comparison of the expression of two immediate early gene proteins, FosB and Fos in the rat preoptic area, hypothalamus and brainstem during pregnancy, parturition and lactation  

Microsoft Academic Search

Medial preoptic area (MPA), supraoptic nucleus (SON), magnocellular (MaPVN) and parvocellular (PaPVN) paraventricular hypothalamic nuclei, and mesencephalic lateral tegmentum (MLT) are involved in maternal behavior, parturition and lactation. This study investigated the FosB and Fos immunoreactivity in these regions of virgin, pregnant, parturient, lactating, and lactating-arrested rats. The patterns of FosB and Fos expression were compared between the sections taken

Shi-Hua Lin; Seiji Miyata; Wurong Weng; Wataru Matsunaga; Jun Ichikawa; Kishio Furuya; Toshihiro Nakashima; Toshikazu Kiyohara

1998-01-01

386

The Immediate-Early Gene Product Egr1 Regulates the Human Interleukin2 Receptor b-Chain Promoter through Noncanonical Egr and Sp1 Binding Sites  

Microsoft Academic Search

The interleukin-2 IL-2 receptor b-chain (IL-2Rb) is an essential component of the receptors for IL-2 and IL-15. Although IL-2Rb is constitutively expressed by lymphocytes, its expression can be further induced by a number of stimuli, including phorbol 12-myristate 13-acetate (PMA). We have now characterized factors that bind to an enhancer region located between nucleotides 2170 and 2139 of the human

JIAN-XIN LIN; WARREN J. LEONARD

1997-01-01

387

An Indole Alkaloid from a Tribal Folklore Inhibits Immediate Early Event in HSV-2 Infected Cells with Therapeutic Efficacy in Vaginally Infected Mice  

PubMed Central

Herpes genitalis, caused by HSV-2, is an incurable genital ulcerative disease transmitted by sexual intercourse. The virus establishes life-long latency in sacral root ganglia and reported to have synergistic relationship with HIV-1 transmission. Till date no effective vaccine is available, while the existing therapy frequently yielded drug resistance, toxicity and treatment failure. Thus, there is a pressing need for non-nucleotide antiviral agent from traditional source. Based on ethnomedicinal use we have isolated a compound 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole (HM) from the traditional herb Ophiorrhiza nicobarica Balkr, and evaluated its efficacy on isolates of HSV-2 in vitro and in vivo. The cytotoxicity (CC50), effective concentrations (EC50) and the mode of action of HM was determined by MTT, plaque reduction, time-of-addition, immunofluorescence (IFA), Western blot, qRT-PCR, EMSA, supershift and co-immunoprecipitation assays; while the in vivo toxicity and efficacy was evaluated in BALB/c mice. The results revealed that HM possesses significant anti-HSV-2 activity with EC50 of 1.1-2.8 µg/ml, and selectivity index of >20. The time kinetics and IFA demonstrated that HM dose dependently inhibited 50-99% of HSV-2 infection at 1.5-5.0 µg/ml at 2-4 h post-infection. Further, HM was unable to inhibit viral attachment or penetration and had no synergistic interaction with acyclovir. Moreover, Western blot and qRT-PCR assays demonstrated that HM suppressed viral IE gene expression, while the EMSA and co-immunoprecipitation studies showed that HM interfered with the recruitment of LSD-1 by HCF-1. The in vivo studies revealed that HM at its virucidal concentration was nontoxic and reduced virus yield in the brain of HSV-2 infected mice in a concentration dependent manner, compared to vaginal tissues. Thus, our results suggest that HM can serve as a prototype to develop non-nucleotide antiviral lead targeting the viral IE transcription for the management of HSV-2 infections. PMID:24167591

Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh Chandra; Mondal, Supriya; Chandra, Nidhi S.; Nandi, Suman; Sharon, Ashoke; Sarkar, Mamta Chawla; Chakrabarti, Sekhar; Chattopadhyay, Debprasad

2013-01-01

388

Long-delayed expression of the immediate early gene arc/arg3.1 refines neuronal circuits to perpetuate fear memory.  

PubMed

Fear memories typically persist for long time periods, and persistent fear memories contribute to post-traumatic stress disorder. However, little is known about the cellular and synaptic mechanisms that perpetuate long-term memories. Here, we find that mouse hippocampal CA1 neurons exhibit biphasic Arc (also known as Arg3.1) elevations after fear experience and that the late Arc expression regulates the perpetuation of fear memoires. An early Arc increase returned to the baseline after 6 h, followed by a second Arc increase after 12 h in the same neuronal subpopulation; these elevations occurred via distinct mechanisms. Antisense-induced blockade of late Arc expression disrupted memory persistence but not formation. Moreover, prolonged fear memories were associated with the delayed, specific elimination of dendritic spines and the reactivation of neuronal ensembles formed during fear experience, both of which required late Arc expression. We propose that late Arc expression refines functional circuits in a delayed fashion to prolong fear memory. PMID:25589774

Nakayama, Daisuke; Iwata, Hirokazu; Teshirogi, Chie; Ikegaya, Yuji; Matsuki, Norio; Nomura, Hiroshi

2015-01-14

389

SOX7 is an immediate-early target of VegT and regulates Nodal-related gene expression in Xenopus.  

PubMed

In zebrafish, the divergent F-type SOX casanova acts downstream of Nodal signaling to specify endoderm. While no casanova orthologs have been identified in tetrapods, the F-type SOX, SOX7, is supplied maternally in Xenopus (Fawcett and Klymkowsky, 2004. GER 4, 29). Subsequent RT-PCR and section-based in situ hybridization analyses indicate that SOX7 mRNA is localized to the vegetal region of the blastula-stage embryo. Overexpression and maternal depletion studies reveal that the T-box transcription factor VegT, which initiates mesoendodermal differentiation, directly regulates SOX7 expression. SOX7, but not SOX17 (another F-type SOX), binds to sites within the Xnr5 promoter and SOX7, but not SOX17, induces expression of the Nodal-related genes Xnr1, Xnr2, Xnr4, Xnr5, and Xnr6, the homeodomain transcription factor Mixer, and the endodermal marker SOX17beta; both SOX7 and SOX17 induce expression of the pan-endodermal marker endodermin. SOX7's induction of Xnr expression in animal caps is independent of Mixer and Nodal signaling. In animal caps, VegT's ability to induce Mixer and Edd appears to depend upon SOX7 activity. Whole embryo experiments suggests that vegetal factors partially compensate for the absence of SOX7. Based on the antagonistic effects of SOX7 and SOX3 (Zhang et al., 2004. Dev. Biol. 273, 23) and their common binding sites in the Xnr5 promoter, we propose a model in which competitive interactions between these two proteins are involved in refining the domain of endodermal differentiation. PMID:15680368

Zhang, Chi; Basta, Tamara; Fawcett, Shana R; Klymkowsky, M W

2005-02-15

390

Dephosphorylation-induced ubiquitination and degradation of FMRP in dendrites: a role in immediate early mGluR-stimulated translation  

PubMed Central

Fragile X Syndrome is caused by the loss of FMRP, which represses and reversibly regulates the translation of a subset of mRNAs in dendrites. Protein synthesis can be rapidly stimulated by mGluR-induced and PP2A-mediated dephosphorylation of FMRP, which is coupled to the dissociation of FMRP and target mRNAs from miRISC complexes. Here, we report the rapid ubiquitination and UPS mediated degradation of FMRP in dendrites upon DHPG stimulation in cultured rat neurons. Using inhibitors to PP2A and FMRP phosphomutants, degradation of FMRP was observed to depend on its prior dephosphorylation. Translational induction of an FMRP target, PSD-95 mRNA, required both PP2A and UPS. Thus, control of FMRP levels at the synapse by dephosphorylation-induced and UPS mediated degradation provides a mode to regulate protein synthesis. PMID:22357842

Nalavadi, Vijayalaxmi C.; Muddashetty, Ravi S.; Gross, Christina; Bassell, Gary J.

2012-01-01

391

Heat-induced expression of the immediate-early gene IER5 and its involvement in the proliferation of heat-shocked cells.  

PubMed

The serum-inducible and growth factor-inducible gene IER5 encodes a protein that acts as a regulator of cell proliferation. Expression of IER5 is also induced by treatment of cells with ionizing radiation and anticancer agents. In this study, we demonstrate the expression and function of IER5 in heat-shocked cells. Heat treatment causes robust expression of IER5 in a heat shock factor (HSF)1-dependent manner. HSF1 is the master transcriptional regulator of chaperone genes, and the IER5 promoter contains the binding sequence for HSF1 and is bound by heat-activated HSF1. Proteotoxic stressors, such as celastrol and MG132, are known to activate HSF1, and are potent inducers of HSF1 binding and IER5 expression. Overexpression of IER5 leads to upregulation of chaperone gene expression and to an increase in refolding of heat-denatured proteins. Cells expressing IER5 efficiently recover viability after heat challenge. These observations suggest that HSF1-mediated IER5 expression is involved in the expression of chaperone genes and in recovery from thermal stress. PMID:25355627

Ishikawa, Yukio; Sakurai, Hiroshi

2014-10-30

392

c-JUN-like immunoreactivity in the CNS of the adult rat: basal and transynaptically induced expression of an immediate-early gene.  

PubMed

An immunocytochemical study of dorsal root ganglia, spinal cord and medulla oblongata was performed with antisera against the c-jun proto-oncogene encoded protein. The c-JUN-like immunoreactivity was restricted to the cell nucleus. In the CNS of untreated rats a basal c-JUN-like immunoreactivity was present in the nuclei of two types of neurons: motor and autonomic. Labelled nuclei could be seen in many motoneurons of the ventral horn of the entire length of spinal cord and the lower medulla oblongata, as well as in the area of the nucleus hypoglossus, the dorsal motor nucleus of nucleus vagus, nucleus ambiguus, nucleus facialis, nucleus abducens and motor nucleus of nucleus trigeminus. Additionally, labelled nuclei were found in the preganglionic sympathetic and preganglionic parasympathetic cells of the nucleus intermediolateralis and nucleus intercalatus in the spinal cord. In the medulla oblongata we found a cluster of cells with c-JUN-like immunoreactivity in an area between the dorsomedial part of the oral nucleus spinalis trigeminalis and the lateral border of the knee of facial nerve. Additionally, a second cluster of c-JUN-like immunoreactivity cells was visible between the ventromedial part of the oral nucleus spinalis trigeminalis and the lateral border of the rostral nucleus facialis. Examination of the characteristics of all cell groups with a basal c-JUN-like immunoreactivity in the spinal cord and lower brainstem revealed an overlapping distribution with cholinergic cell groups. Basal c-JUN-like immunoreactivity was also seen in the dorsal root ganglion cells. We examined the factors which can effect the expression of the c-JUN protein. Maximal expression of c-JUN-like immunoreactivity was observed after electrical stimulation of primary afferents. Stimulation of sciatic nerve at a strength sufficient to recruit A delta- and C-fibres produced c-JUN-like immunoreactivity in many nuclei of the ipsilateral dorsal horn of the lumbar spinal cord. c-JUN-like immunoreactivity was first detectable at 30 min following the end of stimulation, reached a maximum after 1 h, remained unchanged for another 1 h and declined to the basal level after 16 h. The distribution of c-JUN-like immunoreactivity in the lumbar cord coincided with the region of termination of sciatic nociceptive afferents. Contralateral c-JUN-like immunoreactivity appeared after 4 h. After noxious mechanical stimulation of the plantar hindpaw c-JUN-like immunoreactivity occurred in the spinal area of termination of nociceptive afferents of the tibial nerve. Noxious stimulation did not provoke additional c-JUN-like immunoreactivity in dorsal root ganglia.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:1908067

Herdegen, T; Leah, J D; Manisali, A; Bravo, R; Zimmermann, M

1991-01-01

393

A dynamic model of gene expression in monocytes reveals differences in immediate/early response genes between adult and neonatal cells  

PubMed Central

Neonatal monocytes display immaturity of numerous functions compared with adult cells. Gene expression arrays provide a promising tool for elucidating mechanisms underlying neonatal immune function. We used a well-established microarray to analyze differences between LPS-stimulated human cord blood and adult monocytes to create dynamic models for interactions to elucidate observed deficiencies in neonatal immune responses. We identified 168 genes that were differentially expressed between adult and cord monocytes after 45 min incubation with LPS. Of these genes, 95% (159 of 167) were over-expressed in adult relative to cord monocytes. Differentially expressed genes could be sorted into nine groups according to their kinetics of activation. Functional modelling suggested differences between adult and cord blood in the regulation of apoptosis, a finding confirmed using annexin binding assays. We conclude that kinetic studies of gene expression reveal potentially important differences in gene expression dynamics that may provide insight into neonatal innate immunity. PMID:17306030

Lawrence, Shelley; Tang, Yuhong; Frank, M Barton; Dozmorov, Igor; Jiang, Kaiyu; Chen, Yanmin; Cadwell, Craig; Turner, Sean; Centola, Michael; Jarvis, James N

2007-01-01

394

On Multiple-Layered Vortices  

NASA Technical Reports Server (NTRS)

As part of an ongoing effort to find ways to make vortex flow fields decompose more quickly, photographs and observations are presented of vortex flow fields that indicate the presence of multiple layers of fluid rotating about a common axis. A survey of the literature indicates that multiple-layered vortices form in waterspouts, tornadoes and lift-generated vortices of aircraft. An explanation for the appearance of multiple-layered structures in vortices is suggested. The observations and data presented are intended to improve the understanding of the formation and persistence of vortex flow fields.

Rossow, Vernon J.

2011-01-01

395

Proton interactions with high multiplicity  

SciTech Connect

Project Thermalization is aimed to study the proton-proton interaction with high multiplicity of secondary particles. The region of high multiplicity is especially actual at present. We expect the manifestation of the secondary particle collective behavior at this region. The experimentally measured topological cross section was corrected for apparatus acceptance and detection efficiency. These data are in good agreement with gluon dominance model. The comparison with other models is also done and shows no essential deviations. There is evidence that Bose-Einstein condensation can formed at high total multiplicity region.

Kokoulina, E. S., E-mail: kokoulin@sunse.jinr.ru; Nikitin, V. A.; Petukhov, Y. P. [LHEP, JINR (Russian Federation); Kutov, A. Ya. [Department of Mathematics Komi SC UrD RAS (Russian Federation)

2012-06-15

396

Multiple Sclerosis and Vitamin D  

MedlinePLUS

... vitamin D Andrew J. Solomon, MD WHAT IS VITAMIN D AND WHY IS IT IMPORTANT IN MS? ... e100 Neurology Andrew J. Solomon Multiple sclerosis and vitamin D This information is current as of October ...

397

MULTIPLE SCALES FOR SUSTAINABLE RESULTS  

EPA Science Inventory

This session will highlight recent research that incorporates the use of multiple scales and innovative environmental accounting to better inform decisions that affect sustainability, resilience, and vulnerability at all scales. Effective decision-making involves assessment at mu...

398

Lung Multiple Primary Rules Matrix  

Cancer.gov

Lung Multiple Primary Rules – Matrix C340-C349 (Excludes lymphoma and leukemia M9590 – 9989 and Kaposi sarcoma M9140) * Prepare one abstract. Use the histology coding rules to assign the appropriate histology code. ** Prepare two or more abstracts.

399

Let's Practice Multiplication and Division!  

NSDL National Science Digital Library

Use the games below to improve your multiplication and division skills. Today, we are going to play some fun games that help us get better at multiplication and division. Follow the directions below: 1. Choose one of the following games. If you are a boy, you may wish to play with the catapult in Flight of the Knight. If you are a girl, you could ...

Aycock, Miss

2009-04-15

400

A Semantics of Multiple Inheritance  

Microsoft Academic Search

this paper is to present a clean semantics of multiple inheritance and to show that, in the context of strongly-typed, statically-scoped languages, a sound typechecking algorithm exists. Multiple inheritance is also interpreted in a broad sense: instead of being limited to objects, it is extended in a natural way to union types and to higher-order functional types. This constitutes a

Luca Cardelli

1988-01-01

401

[Borderline forms of multiple sclerosis].  

PubMed

Multiple sclerosis (MS) has been described for more than a century, but its cause remains unknown and no simple diagnostic marker is available. Therefore, it is not surprising that numerous articles were written on closely related diseases, borderline forms of multiple sclerosis. Different forms have been distinguished: a clinical form of MS (Devic's neuromyelitis optica), pathological forms (Balo, Schilder, Maburg), forms associated with MS (peripheral neuropathy, autoantibodies) and closely related disorders (acute disseminated encephalomyelitis). PMID:11787357

Fontaine, B

2001-09-01

402

Multiple oncocytomas and renal carcinoma  

SciTech Connect

Renal oncocytoma, although rare, is being diagnosed more frequently, and criteria to differentiate it from other tumors have been described. Multiple oncocytomas have been reported, but an association between multiple oncocytomas and renal carcinoma in the same kidney has not been described. The authors report a case with two oncocytomas and a renal carcinoma in the right kidney as well as a right adrenal adenoma.

Velasquez, G.; Glass, T.A.; D'Souza, V.J.; Formanek, A.G.

1984-01-01

403

Omnidirectional Video Capturing, Multiple People Tracking and  

E-print Network

. . . . . . . . . . . . . . . . . . . . . . . 11 4 Multiple Face Recognition 12 4.1 Preprocessing . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20 5.2 Multiple face recognition . . . . . . . . . . . . . . . . . . . . . . . . 20 5.3 Multiple CAMEO (Camera Assisted Meeting Event Observer), a hardware/software component to record and monitor

De la Torre, Fernando

404

Combining Multiple Indicators to Determine Conservation Status  

E-print Network

Combining Multiple Indicators to Determine Conservation Status Based on Expert Preferences of Resource Management (Planning) Title of Project: Combining multiple indicators to determine conservation on using multiple indicators, and most methods for combining indicators either assume that all indicators

405

Modularization to Support Multiple Brand Platforms  

E-print Network

Methods to determine acceptable architecture for multiple platforms supporting multiple brands must represent both platform cost saving commonization as well as revenue enhancing brand distinctions. Functional architecting ...

Agus, Sudjianto

2001-09-09

406

Convergence characteristics of the multiple input, multiple output LMS algorithm  

NASA Technical Reports Server (NTRS)

The convergence characteristics of the multiple input, multiple output LMS algorithm, as applied to active noise and vibration control systems, are examined. The mean square error during the convergence process, as well as the final converged value, are examined analytically and in computer simulation. It is shown that the ratio of number of error sensors to number of control sources has a significant influence upon both the converging and converged value of the mean square error. Other active control system variables, such as the inherent time delays and structural/acoustic transfer functions, are also shown to have a significant influence upon the convergence process.

Snyder, Scott D.; Hansen, Colin H.; Clark, Robert L.

1992-01-01

407

Pyrochemical neutron multiplicity counter design  

SciTech Connect

Pyrochemical process materials are difficult to measure using conventional neutron counting methods because of significant self- multiplication and variable ({alpha},n) reaction rates. Multiplicity counters measure the first three moments of the neutron multiplicity distribution and thus make it possible to determine sample mass even when multiplication and ({alpha},n) rate are unknown. A new multiplicity counter suitable for inplant measurement of pyrochemical process materials has been designed using Monte Carlo simulations. The goals were to produce a counter that has high neutron detection efficiency, low die-away time, a flat spatial efficiency profile, and is insensitive to the neutron energy spectrum. Monte Carlo calculations were performed for several prototype models consisting of four rings of 71-cm active length {sup 3}He tubes in a polyethylene body. The cadmium-lined sample well is 25 cm in diameter to accommodate a wide variety of inplant sample containers. The counter can be free-standing or in-line without mechanical modification. The calculations were performed to determine the above design criteria for several configurations of tube spacing, cadmium liners, and sample height. Calculations were also performed for distributed sample sources to understand the integrated effects of variable neutron spectra on the counter. 5 refs., 8 figs., 1 tab.

Langner, D.G.; Ensslin, N.; Krick, M.S.

1990-01-01

408

Childbirth Education for Multiple Pregnancy  

PubMed Central

Women with a multiple pregnancy have unique learning needs in preparing for birth. This paper explores the issues relevant to women with a multiple pregnancy to support a positive birth experience. One of the foundations of childbirth education and nursing care is to provide the individual woman and her family with knowledge regarding the birth process, what to expect, and how to cope with labor and birth. Education also focuses on caring for the newborns after birth and how to manage in the early days at home. However, traditional childbirth education classes, which meet in a series of evenings or Saturdays, may not meet the needs of women with a multiple pregnancy. In addition, because of the differences in care that exist for women with a multiple pregnancy, new paradigms for childbirth education are needed to meet the learning needs of these families. The purpose of this paper is to provide information to the childbirth educator on the differences in care women with a multiple pregnancy can expect and to suggest strategies to meet the childbirth education needs of these families. PMID:17273430

Montgomery, Kristen S.; Cubera, Sabrina; Belcher, Christie; Patrick, David; Funderburk, Heather; Melton, Christa; Fastenau, Michelle

2005-01-01

409

Constraining multiple systems with GAIA  

NASA Astrophysics Data System (ADS)

GAIA will provide observations of some multiple asteroid and dwarf systems. These observations are a way to determine and improve the quantification of dynamical parameters, such as the masses and the gravity fields, in these multiple systems. Here we investigate this problem in the cases of Pluto's and Eugenia's system. We simulate observations reproducing an approximate planning of the GAIA observations for both systems, as well as the New Horizons observations of Pluto. We have developed a numerical model reproducing the specific behavior of multiple asteroid system around the Sun and fit it to the simulated observations using least-square method, giving the uncertainties on the fitted parameters. We found that GAIA will improve significantly the precision of Pluto's and Charon's mass, as well as Petit Prince's orbital elements and Eugenia's polar oblateness.

Beauvalet, L.; Lainey, V.; Arlot, J.-E.; Bancelin, D.; Binzel, R. P.; Marchis, F.

2012-12-01

410

Subpixel resolution from multiple images  

NASA Technical Reports Server (NTRS)

Multiple images taken from similar locations and under similar lighting conditions contain similar, but not identical, information. Slight differences in instrument orientation and position produces mismatches between the projected pixel grids. These mismatches ensure that any point on the ground is sampled differently in each image. If all the images can be registered with respect to each other to a small fraction of a pixel accuracy, then the information from the multiple images can be combined to increase linear resolution by roughly the square root of the number of images. In addition, the gray-scale resolution of the composite image is also improved. We describe methods for multiple image registration and combination, and discuss some of the problems encountered in developing and extending them. We display test results with 8:1 resolution enhancement, and Viking Orbiter imagery with 2:1 and 4:1 enhancements.

Cheeseman, Peter; Kanefsky, Rob; Stutz, John; Kraft, Richard

1994-01-01

411

Multiple Imputation Strategies for Multiple Group Structural Equation Models  

ERIC Educational Resources Information Center

Although structural equation modeling software packages use maximum likelihood estimation by default, there are situations where one might prefer to use multiple imputation to handle missing data rather than maximum likelihood estimation (e.g., when incorporating auxiliary variables). The selection of variables is one of the nuances associated…

Enders, Craig K.; Gottschall, Amanda C.

2011-01-01

412

Goiter and Multiple Food Allergies  

PubMed Central

Severe iodine deficiency results in impaired thyroid hormone synthesis and thyroid enlargement. In the United States, adequate iodine intake is a concern for women of childbearing age and pregnant women. Beyond this high risk group iodine deficiency is not considered to be a significant problem. This case report describes a 12-year-old male with severe iodine deficiency disorder (IDD) resulting from restricted dietary intake due to multiple food allergies. We describe iodine replacement for this patient and continued monitoring for iodine sufficiency. Children with multiple food allergies, in particular those with restrictions to iodized salt and seafood, should be considered high risk for severe iodine deficiency. PMID:19956702

Leniszewski, Stefanie; Mauseth, Richard

2009-01-01

413

Topics in multiple hypotheses testing  

E-print Network

procedures. The B-H procedure controls the error rate for all values of m0 without using any information in the data about m0. Often, the power of the multiple hypothesis testing method, E(S/m1), decreases when the number of hypotheses tested, m, increases...(Q(?)) is the density quantile function (Parzen 1979). In multiple hypotheses testing, there exist p-values p1,? ? ? ,pm with distribution function G. Let ui = i/m and Yi = m(p(i) - p(i-1)). Then Y1,? ? ? ,Ym are approx- imately independent, and Yi is approximately...

Qian, Yi

2007-04-25

414

Multiple order common path spectrometer  

NASA Technical Reports Server (NTRS)

The present invention relates to a dispersive spectrometer. The spectrometer allows detection of multiple orders of light on a single focal plane array by splitting the orders spatially using a dichroic assembly. A conventional dispersion mechanism such as a defraction grating disperses the light spectrally. As a result, multiple wavelength orders can be imaged on a single focal plane array of limited spectral extent, doubling (or more) the number of spectral channels as compared to a conventional spectrometer. In addition, this is achieved in a common path device.

Newbury, Amy B. (Inventor)

2010-01-01

415

Suicide using multiple crossbow arrows.  

PubMed

We report the case of a 44-year-old man who committed suicide using multiple crossbow arrows. The first arrow that he fired went between the left eye and nose and passed into a frontal lobe of the brain with no exit wound. He fired a second arrow that entered the palate and went through the brain but did not exit the skull. To the best of our knowledge, no cases of suicide using multiple crossbow arrows have previously been reported. PMID:8166108

Opeskin, K; Burke, M

1994-03-01

416

Immunotherapy strategies in multiple myeloma.  

PubMed

Multiple myeloma (MM) is a B-cell malignancy characterized by the clonal proliferation of malignant plasma cells in the bone marrow and the development of osteolytic bone lesions. MM has emerged as a paradigm within the cancers for the success of drug discovery and translational medicine. This article discusses immunotherapy as an encouraging option for the goal of inducing effective and long-lasting therapeutic outcome. Divided into two distinct approaches, passive or active, immunotherapy, which targets tumor-associated antigens has shown promising results in multiple preclinical and clinical studies. PMID:25212890

Bae, Jooeun; Munshi, Nikhil C; Anderson, Kenneth C

2014-10-01

417

Multiple Spontaneous Simultaneous Intracerebral Hemorrhages  

PubMed Central

Simultaneous occurrence of intracerebral hemorrhage (ICH) in different arterial territories is an uncommon event. We report on two cases of multiple spontaneous simultaneous ICH for which we could find no specific cause. A 73-year-old man, with no related medical history, was admitted to the hospital with simultaneous bithalamic ICH, and subsequently died of recurrent pneumonia. Second patient was a 60-year-old man who presented with simultaneous ICH in the pons and thalamus; he died of recurrent bleeding. We review the possible pathological mechanisms, clinical and radiologic features of simultaneous multiple ICH. PMID:25045650

Seo, Jin-Suk; Nam, Taek-Kyun; Kwon, Jeong-Taik

2014-01-01

418

Multiple resonant railgun power supply  

DOEpatents

A multiple repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. A plurality of serially connected paired parallel rails are powered by similar power supplies. Each supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles. The multiple serial operation permits relatively small energy components to deliver overall relatively large amounts of energy to the projectiles being propelled.

Honig, Emanuel M. (Los Alamos, NM); Nunnally, William C. (Los Alamos, NM)

1988-01-01

419

Multiple resonant railgun power supply  

DOEpatents

A multiple repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. A plurality of serially connected paired parallel rails are powered by similar power supplies. Each supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles. The multiple serial operation permits relatively small energy components to deliver overall relatively large amounts of energy to the projectiles being propelled.

Honig, E.M.; Nunnally, W.C.

1985-06-19

420

Management of multiple impacted teeth.  

PubMed

An impacted or missing permanent tooth can add significant complications to an otherwise straightforward case. When multiple impacted teeth are present, the case complexity increases further. Developing a treatment sequence, determining appropriate anchorage, and planning and executing sound biomechanics can be a challenge. The following case report illustrates a patient with three retained primary teeth and three impacted permanent canines. After careful treatment planning and extraction of multiple primary teeth;, followed by attempted guided eruption of impacted teeth, the patient finished with a significantly improved functional and aesthetic result. PMID:22557915

Bansal, Nidhi; Valiathan, Ashima; Bansal, Kshitij; Parkar, Farhan

2012-01-01

421

SPSS Tutorial for Multiple Comparisons  

NSDL National Science Digital Library

Authored by Laura Little of the University of Washington, this tutorial exposes students to conducting multiple comparisons in SPSS. This html based tutorial provides extensive screen shots and an example data set. Topics covered in the tutorial include: one way ANOVA, preplanned contrasts, Bonferroni, Post Hoc Tukey's HSD, and Scheffe's multiple contrasts. This is a great example of how to use statistical tools such as SPSS in a psychological statistics course. Little does excellent work in providing a step by step approach to learning these methods.

Little, Laura

2009-03-11

422

Development of a Multimorbidity Illness Perceptions Scale (MULTIPleS)  

PubMed Central

Background Illness perceptions are beliefs about the cause, nature and management of illness, which enable patients to make sense of their conditions. These perceptions can predict adjustment and quality of life in patients with single conditions. However, multimorbidity (i.e. patients with multiple long-term conditions) is increasingly prevalent and a key challenge for future health care delivery. The objective of this research was to develop a valid and reliable measure of illness perceptions for multimorbid patients. Methods Candidate items were derived from previous qualitative research with multimorbid patients. Questionnaires were posted to 1500 patients with two or more exemplar long-term conditions (depression, diabetes, osteoarthritis, coronary heart disease and chronic obstructive pulmonary disease). Data were analysed using factor analysis and Rasch analysis. Rasch analysis is a modern psychometric technique for deriving unidimensional and intervally-scaled questionnaires. Results Questionnaires from 490 eligible patients (32.6% response) were returned. Exploratory factor analysis revealed five potential subscales ‘Emotional representations’, ‘Treatment burden’, ‘Prioritising conditions’, ‘Causal links’ and ‘Activity limitations’. Rasch analysis led to further item reduction and the generation of a summary scale comprising of items from all scales. All scales were unidimensional and free from differential item functioning or local independence of items. All scales were reliable, but for each subscale there were a number of patients who scored at the floor of the scale. Conclusions The MULTIPleS measure consists of five individual subscales and a 22-item summary scale that measures the perceived impact of multimorbidity. All scales showed good fit to the Rasch model and preliminary evidence of reliability and validity. A number of patients scored at floor of each subscale, which may reflect variation in the perception of multimorbidity. The MULTIPleS measure will facilitate research into the impact of illness perceptions on adjustment, clinical outcomes, quality of life, and costs in patients with multimorbidity. PMID:24376504

Gibbons, Chris J.; Kenning, Cassandra; Coventry, Peter A.; Bee, Penny; Bundy, Christine; Fisher, Louise; Bower, Peter

2013-01-01

423

On the Time Required to Perform Multiplication  

Microsoft Academic Search

The time required to perform multiplication is investigated. A lower bound on the time required to perform multiplication, as well as multiplication modulo N, is derived and it is shown that these lower bounds can be approached. Then a lower bound on the amount of time required to perform the most significant part of multiplication (⌞xy\\/N⌟) is derived.

Shmuel Winograd; Yorktown Heights

1967-01-01

424

Matrix multiplication via arithmetic progressions  

Microsoft Academic Search

We present a new method for accelerating matrix multiplication asymptotically. This work builds on recent ideas of Volker Strassen, by using a basic trilinear form which is not a matrix product. We make novel use of the Salem-Spencer Theorem, which gives a fairly dense set of integers with no three-term arithmetic progression. Our resulting matrix exponent is 2.376.

Don Coppersmith; Shmuel Winograd

1987-01-01

425

Multiple Stars in the Field  

NASA Astrophysics Data System (ADS)

When examining the statistics of multiple stars in the field, especially coming from visual binary star point of view, several problems present themselves. First, and most importantly, is distinguishing between physical multiples and optical pairs. Establishing physicality is not a simple "binary" response as there are degrees of certainty. We discuss some of the reasons for caring about non-physical pairs, as well as the tools for establishing or more correctly identifying apparent kinematic properties which hopefully result in dynamic solutions. The Washington Double Star Catalog, the Visual Orbit Catalog, and the US Naval Observatory speckle program are used as examples in many of these cases. The magnum opus for a global characterization of these systems is the Washington Multiplicity Catalog (WMC). Selected as a catalog and a method to "develop a simple, unambiguous, flexible, and computer friendly designation scheme for stellar companions (including planets)" at a multi-commission meeting in Manchester (GA24). This was re-affirmed at Special Session 3 in Sydney (GA25) by Commissions 5, 8, 26, 42, 45 and the Working Group on Interferometry when a sample (1/2 hour band) WMC was produced. An all-sky WMC is in progress the binary sources utilized in its construction and the implications resulting from it with regards to multiple stars in the field are discussed.

Mason, Brian D.; Hartkopf, William I.

426

Interoperability of multiple autonomous databases  

Microsoft Academic Search

Database systems were a solution to the problem of shared access to heterogeneous files created by multiple autonomous applications in a centralized environment. To make data usage easier, the files were replaced by a globally integrated database. To a large extent, the idea was successful, and many databases are now accessible through local and long-haul networks. Unavoidably, users now need

Witold Litwin; Leo Mark; Nick Roussopoulos

1990-01-01

427

Corticial lesions in multiple sclerosis  

Microsoft Academic Search

Summary Although previous studies have shown that the lesions of multiple sclerosis may involve the cerebral cortex, there is little published research on the prevalence and distribution of such lesions. Using neuropathological techniques and MRI, a series of studies has been undertaken in order to assess this, in particular to identify their relationship to cortical veins. A serial MRI study

D. Kidd; F. Barkhof; R. McConnell; P. R. Algra; I. V. Allen; T. Revesz

1999-01-01

428

Fashion, Paper Dolls and Multiplicatives  

ERIC Educational Resources Information Center

The multiplicative principle is the tool allowing the counting of groups that can be described by a sequence of events. An event is a subset of sample space, i.e. a collection of possible outcomes, which may be equal to or smaller than the sample space as a whole. It is important that students understand this basic principle early on and know how…

Ura, Suzana Kaori; Stein-Barana, Alzira C. M.; Munhoz, Deisy P.

2011-01-01

429

Dimensions of Multiple Personality Disorder  

Microsoft Academic Search

Research on multiple personality disorder (MPD) has burgeoned, and large-scale investigations indicate that a typical MPD patient is a woman, a victim of childhood abuse (especially sexual abuse), a person whose symptoms meet criteria for other psychiatric disorders, and a person who would employ many psychological defenses. Treatment approaches have frequently included hypnotherapy, which requires skill and caution.

John B. Murray

1994-01-01

430

Multiple Choice Questions for Groundwater  

NSDL National Science Digital Library

This online quiz was written by Dr. John C. Butler at the University of Houston for 100-level geology students. There are 44 multiple choice questions and 8 fill in the blank questions, Topics include groundwater resources, the water cycle, karst features, the water table and parts of an aquifer. Answers are linked directly from the quiz page.

John C. Butler

431

Characteristics of Multiple Comparison Procedures.  

ERIC Educational Resources Information Center

Multiple comparison procedures (MCPs), in the context of analysis of variance, are becoming more popular than the overall F tests. An attempt is made to clarify confusion among the different MCPs by systematically comparing and contrasting the procedures in terms of their purposes, restrictions, robustness to assumptions, and other special…

Yusuf, Mian Muhammad; And Others

432

Venom therapy in multiple sclerosis  

Microsoft Academic Search

To date many people with multiple sclerosis (MS) seek complementary and alternative medicines (CAM) to treat their symptoms as an adjunct to conventionally used therapies. Among the common CAM therapies, there is a renewed interest in the therapeutic potential of venoms in MS. The efficacy of this therapeutic method remains unclear. However, venom-based therapy using bee, snakes and scorpions venom

Abbas Mirshafiey

2007-01-01

433

Development of multiple media documents  

Microsoft Academic Search

Development of documents in multiple media involves activities in three different fields, the technical, the discoursive and the procedural. The major development problems of artifact complexity, cognitive processes, design basis and working context are located where these fields overlap. Pending the emergence of a unified approach to design, any method must allow for development at the three levels of discourse

Stephen J. Morris; Anthony Finkelstein

1993-01-01

434

Childhood Multiple Sclerosis: A Review  

ERIC Educational Resources Information Center

Multiple sclerosis (MS) is an autoimmune demyelinating disorder of the central nervous system (CNS) that is increasingly recognized as a disease that affects children. Similar to adult-onset MS, children present with visual and sensory complaints, as well as weakness, spasticity, and ataxia. A lumbar puncture can be helpful in diagnosing MS when…

Waldman, Amy; O'Connor, Erin; Tennekoon, Gihan

2006-01-01

435

Bacterial toxins and Multiple Sclerosis  

Microsoft Academic Search

The primary pathogenetic mechanism responsible for the distinctive demyelinating lesions in the Central Nervous System (CNS) in Multiple Sclerosis (MS), first described in remarkable detail by Charcot more than 170 years ago, remains one of the most baffling conundrums in medicine. A possible role for bacterial cell molecules and transportable proteins in the pathogenesis of MS is reviewed. The ability

Frederick Gay

2007-01-01

436

Fungible Weights in Multiple Regression  

ERIC Educational Resources Information Center

Every set of alternate weights (i.e., nonleast squares weights) in a multiple regression analysis with three or more predictors is associated with an infinite class of weights. All members of a given class can be deemed "fungible" because they yield identical "SSE" (sum of squared errors) and R[superscript 2] values. Equations for generating…