Science.gov

Sample records for multiple immediate-early gene-deleted

  1. Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector

    SciTech Connect

    Watanabe, Daisuke; Brockman, Mark A.; Ndung'u, Thumbi; Mathews, Lydia; Lucas, William T.; Murphy, Cynthia G.; Felber, Barbara K.; Pavlakis, George N.; Deluca, Neal A.; Knipe, David M. . E-mail: david_knipe@hms.harvard.edu

    2007-01-20

    Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV gene products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli {beta}-galactosidase induced durable {beta}-gal-specific IgG and CD8{sup +} T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes.

  2. Efficient and simple generation of multiple unmarked gene deletions in Mycobacterium smegmatis

    PubMed Central

    Mao, Xu-Jian; Yan, Mei-Yi; Zhu, Hui; Guo, Xiao-Peng; Sun, Yi-Cheng

    2016-01-01

    Research on mycobacterial genetics relies heavily on techniques for directed gene mutation, but genetic studies are often hampered by the difficulty of generating gene deletions in mycobacteria. We developed an efficient and improved deletion system, described here in detail, which can be used to construct multiple unmarked recombinants in mycobacteria. We tested this system by using it to sequentially delete four pairs of toxin-antitoxin genes in Mycobacterium smegmatis. PMID:26972108

  3. Construction and application of an efficient multiple-gene-deletion system in Corynebacterium glutamicum.

    PubMed

    Hu, Jinyu; Tan, Yanzhen; Li, Yanyan; Hu, Xiaoqing; Xu, Daqing; Wang, Xiaoyuan

    2013-11-01

    Gene deletion techniques are important for modifying Corynebacterium glutamicum, the bacterium for industrial production of amino acids. In this study, a novel multiple-gene-deletion system for C. glutamicum was developed. The system is composed of three plasmids pDTW109, pDTW201 and pDTW202. pDTW109 is a temperature-sensitive vector which harbors a cat gene under the tacM promoter, a cre gene under the tac promoter, an origin oriE for replicating in Escherichia coli, and another origin rep(TS) for replicating in C. glutamicum only at low temperatures; it has high transformation efficiency in C. glutamicum and can be easily eliminated by growing at 37°C. pDTW201 and pDTW202 carry loxp-flanked or mutant lox-flanked kan, respectively. This deletion system combines homologous recombination and Cre/lox site-specific recombination, could efficiently delete the aceE gene from the chromosome of C. glutamicum ATCC13032, ATCC13869 or ATCC14067, respectively, and could also delete both genes of aceE and ilvA from the chromosome of C. glutamicum ATCC14067. The system is simple and efficient, and can be easily implemented for multiple-gene-deletion in C. glutamicum. PMID:23856168

  4. Assessment of the Toxicity of CuO Nanoparticles by Using Saccharomyces cerevisiae Mutants with Multiple Genes Deleted

    PubMed Central

    Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao

    2015-01-01

    To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

  5. Assessment of the toxicity of CuO nanoparticles by using Saccharomyces cerevisiae mutants with multiple genes deleted.

    PubMed

    Bao, Shaopan; Lu, Qicong; Fang, Tao; Dai, Heping; Zhang, Chao

    2015-12-01

    To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

  6. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

    PubMed Central

    Suzuki, Yo; Stam, Jason; Novotny, Mark; Yachie, Nozomu; Lasken, Roger S.; Roth, Frederick P.

    2012-01-01

    Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative. In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated. Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction. The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci—either Green Monster GMToolkit-a or GMToolkit-α at the

  7. The green monster process for the generation of yeast strains carrying multiple gene deletions.

    PubMed

    Suzuki, Yo; Stam, Jason; Novotny, Mark; Yachie, Nozomu; Lasken, Roger S; Roth, Frederick P

    2012-01-01

    Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition(1,2). There are examples where many genes need to be deleted to unmask hidden gene functions(3,4). Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative. In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker(5,6,7,8,9,10). However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated. Here we describe the Green Monster method for routinely engineering multiple deletions in yeast(11). In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction. The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci-either Green Monster GMToolkit-a or GMToolkit

  8. Zinc transporter 3 (ZnT3) gene deletion reduces spinal cord white matter damage and motor deficits in a murine MOG-induced multiple sclerosis model.

    PubMed

    Choi, Bo Young; Kim, In Yeol; Kim, Jin Hee; Kho, A Ra; Lee, Song Hee; Lee, Bo Eun; Sohn, Min; Koh, Jae-Young; Suh, Sang Won

    2016-10-01

    The present study aimed to evaluate the role of zinc transporter 3 (ZnT3) on multiple sclerosis (MS) pathogenesis. Experimental autoimmune encephalomyelitis (EAE), a disease model of multiple sclerosis, was induced by immunization with myelin oligodendrocyte glycoprotein (MOG35-55) in female mice. Three weeks after the initial immunization, demyelination, immune cell infiltration and blood brain barrier (BBB) disruption in the spinal cord were analyzed. Clinical signs of EAE first appeared on day 11 and reached a peak level on day 19 after the initial immunization. ZnT3 gene deletion profoundly reduced the daily clinical score of EAE. The ZnT3 gene deletion-mediated inhibition of the clinical course of EAE was accompanied by suppression of inflammation and demyelination in the spinal cord. The motor deficit accompanying neuropathological changes associated with EAE were mild in ZnT3 gene deletion mice. This reduction in motor deficit was accompanied by coincident reductions in demyelination and infiltration of encephalitogenic immune cells including CD4+ T cells, CD8+ T cells, CD20+ B cells and F4/80+ microglia in the spinal cord. These results demonstrate that ZnT3 gene deletion inhibits the clinical features and neuropathological changes associated with EAE. ZnT3 gene deletion also remarkably inhibited formation of EAE-associated aberrant synaptic zinc patches, matrix metalloproteinases-9 (MMP-9) activation and BBB disruption. Therefore, amelioration of EAE-induced clinical and neuropathological changes by ZnT3 gene deletion suggests that vesicular zinc may be involved in several steps of MS pathogenesis. PMID:27370228

  9. Analysis of the CYP21A2 gene with intergenic recombination and multiple gene deletions in the RCCX module.

    PubMed

    Chang, Shwu-Fen; Lee, Hsien-Hsiung

    2011-01-01

    The most frequent bimodular RCCX module of the RP1-C4A-CYP21A1P-TNXA-RP2-C4B-CYP21A2-TNXB gene sequence is located on chromosome 6p21.3. To determine RCCX alterations, we used the polymerase chain reaction (PCR) product containing the tenascin B (TNXB) and CYP21A2 genes with TaqI digestion and Southern blot analysis with AseI and NdeI endonuclease digestion of genomic DNA from congenital adrenal hyperplasia patients with common mutations resulting from an intergenic conversion of CYP21A1P, such as an I2 splice, I172N, V281L, F306-L307insT, Q318X, and R356W, and dual mutations of I236N/V237E in the CYP21A2 gene. The results showed that a 3.7-kb fragment of the CYP21A2 gene was detected in each case, and 21.6- and 11.3-kb DNA fragments were found in the RCCX region by a Southern blot analysis with these corresponding mutations. However, the IVS2-12A/C- > G (I2 splice) haplotype in combination with the 707-714delGAGACTAC (without the P30L mutation) mutation produced a 3.2-kb TaqI fragment in the PCR product analysis and a specific 9.3-kb fragment by the Southern blot method. Therefore, we concluded that the rearrangement in the RCCX region resulting from processing of either an intergenic recombination or multiple gene deletions can be identified by the PCR analysis and Southern blot method based on a fragment-distinguishing configuration without a family study. PMID:21117955

  10. Interstitial deletion of 11(p11.2p12): A newly described contiguous gene deletion syndrome involving the gene for hereditary multiple exostoses

    SciTech Connect

    Potocki, L.; Shaffer, L.G.

    1996-03-29

    Individuals with deletions of the proximal portion of the short arm of chromosome 11 share many manifestations including mental retardation, biparietal foramina, minor facial anomalies, and multiple cartilaginous exostoses. The finding of multiple exostoses in these patients is remarkable as the disorder hereditary multiple exostoses, which is inherited in an autosomal dominant manner, has recently been mapped by linkage to three regions, including proximal 11p. We report the clinical and molecular findings in an additional patient with an 11(p11.2p12) deletion. Cytogenetic and molecular analysis demonstrated a de novo, paternally derived deletion for markers which have been shown to be tightly linked to the 11p locus (EXT2). These data support the location of EXT2 within this region and also provide information regarding the ordering of polymorphic markers on 11p. Deletion 11(p11.2p12) is a rare, yet specific, deletion syndrome involving the EXT2 locus, a gene for parietal foramina, and a mental retardation locus, and therefore can be classified as a contiguous gene deletion syndrome. 24 refs., 4 figs., 1 tab.

  11. Serum Leukocyte Immunoglobulin-Like Receptor A3 (LILRA3) Is Increased in Patients with Multiple Sclerosis and Is a Strong Independent Indicator of Disease Severity; 6.7kbp LILRA3 Gene Deletion Is Not Associated with Diseases Susceptibility

    PubMed Central

    An, Hongyan; Lim, Chai; Guillemin, Gilles J.; Vollmer-Conna, Ute; Rawlinson, William; Bryant, Katherine; Tedla, Nicodemus

    2016-01-01

    Leukocyte immunoglobulin-like receptor A3 (LILRA3) is a soluble immune regulatory molecule primarily expressed by monocytes and macrophages. A homozygous 6.7kbp LILRA3 gene deletion that removes the first seven of its eight exons is predicted to lead to lack of LILRA3 protein, although this has not been experimentally confirmed. Moreover, there are conflicting results with regards to the link between the LILRA3 homozygous genetic deletion and susceptibility to multiple sclerosis (MS) in different European populations. The aim of this study was to investigate whether LILRA3 gene deletion is associated with MS susceptibility in a North American cohort of European ancestry and assess if serum LILRA3 protein level is a marker of clinical subtype and/or disease severity in MS. A total of 456 patients with MS and 99 unrelated healthy controls were genotyped for the 6.7kbp LILRA3 gene deletion and levels of LILRA3 protein in sera determined by in-house sandwich ELISA. We showed that LILRA3 gene deletion was not associated with MS susceptibility and did not affect the age of disease onset, clinical subtype or disease severity. However, we discovered for the first time that homozygous LILRA3 gene deletion results in lack of production of LILRA3 protein. Importantly, LILRA3 protein level was significantly increased in sera of patients with MS when compared with control subjects, particularly in more severe type primary progressive MS. Multiple regression analysis showed that LILRA3 level in serum was one of the strongest independent markers of disease severity in MS, which potentially can be used as a diagnostic marker. PMID:26871720

  12. IAP gene deletion and conditional knockout models.

    PubMed

    Silke, John; Vaux, David L

    2015-03-01

    Gene deletion studies have helped reveal the unique and overlapping roles played by IAP proteins. Crossing IAP mutant mice has helped unravel the complex feed-back regulatory circuits in which cIAP1, cIAP2 and XIAP allow innate defensive responses to microbial pathogens, without the development of auto-inflammatory syndromes. Deletion of genes for Survivin and its homologs in yeasts, invertebrates and mammals has shown that it functions differently, as it is not a regulator of innate immunity or apoptosis, but acts together with INCENP, aurora kinase B and Borealin to allow chromosome segregation during mitosis. PMID:25545814

  13. Group II Intron-Anchored Gene Deletion in Clostridium

    PubMed Central

    Jia, Kaizhi; Zhu, Yan; Zhang, Yanping; Li, Yin

    2011-01-01

    Clostridium plays an important role in commercial and medical use, for which targeted gene deletion is difficult. We proposed an intron-anchored gene deletion approach for Clostridium, which combines the advantage of the group II intron “ClosTron” system and homologous recombination. In this approach, an intron carrying a fragment homologous to upstream or downstream of the target site was first inserted into the genome by retrotransposition, followed by homologous recombination, resulting in gene deletion. A functional unknown operon CAC1493–1494 located in the chromosome, and an operon ctfAB located in the megaplasmid of C. acetobutylicum DSM1731 were successfully deleted by using this approach, without leaving antibiotic marker in the genome. We therefore propose this approach can be used for targeted gene deletion in Clostridium. This approach might also be applicable for gene deletion in other bacterial species if group II intron retrotransposition system is established. PMID:21304965

  14. Conditional IL-2 Gene Deletion: Consequences for T Cell Proliferation

    PubMed Central

    Popmihajlov, Zoran; Xu, Dong; Morgan, Heather; Milligan, Zoie; Smith, Kendall A.

    2012-01-01

    To explore the role of interleukin-2 (IL-2) in T cell proliferation, and to circumvent the IL-2 deficiency autoimmune syndrome of conventional il2 gene deletion, mice were created to allow conditional il2 gene deletion when treated with the estrogen analog, tamoxifen (TAM) as adults. Splenocytes from four different mouse strains, C57Bl/6 wild type (WT), conventional IL-2(−/−), TAM-treated Cre recombinase-negative (Cre−)/IL2fl/fl, and Cre recombinase-positive (Cre+)/IL2fl/fl, were activated with anti-CD3 and anti-CD28, and monitored for CD4+ and CD8+ T cell lymphocyte blastogenesis, aerobic glycolysis, BrdU incorporation into newly synthesized DNA, and CFSE dye dilution to monitor cell division. IL-2 production was monitored by quantitative ELISA and multiple additional cytokines were monitored by quantitative protein-bead arrays. Splenocytes from conventional IL-2(−/−) and TAM-treated Cre+ mice resulted in undetectable IL-2 production by ELISA, so that both strains were IL-2-deficient. As monitored by flow cytometry, activated CD4+ and CD8+ T cells from WT, Cre+, and Cre− mice all underwent blastogenesis, whereas far fewer cells from conventional IL-2(−/−) mice did so. By comparison, only cells from IL-2 sufficient WT and Cre− mice switched to aerobic glycolysis as evidenced by a drop in media pH. Blastogenesis was mirrored by BrdU incorporation and CFSE dye dilution by CD4+ and CD8+ T cells from WT, Cre+, and Cre− mice, which were all equivalent, while proliferation of cells from conventional IL-2(−/−) mice was compromised. Splenocytes from IL-2 deficient conventional IL-2(−/−) mice produced low or undetectable other γc-chain cytokines (IL-4, IL-7, IL-9, IL-13, IL-15, and IL-21), whereas production of these γc-chain cytokines from IL-2-deficient conditional IL-2(−/−) Cre+ mice were comparable with WT and Cre− mice. These results indicate that CD4+ and CD8+ T cell blastogenesis cannot be attributable to IL-2 alone, but a switch

  15. Using Immediate-Early Genes to Map Hippocampal Subregional Functions

    ERIC Educational Resources Information Center

    Kubik, Stepan; Miyashita, Teiko; Guzowski, John F.

    2007-01-01

    Different functions have been suggested for the hippocampus and its subdivisions along both transversal and longitudinal axes. Expression of immediate-early genes (IEGs) has been used to map specific functions onto neuronal activity in different areas of the brain including the hippocampus (IEG imaging). Here we review IEG studies on hippocampal…

  16. Efficient sequential repetitive gene deletions in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing ß-recombinase acting on si...

  17. Structure of the immediate early gene of canine herpesvirus.

    PubMed

    Miyoshi, M; Takiguchi, M; Yasuda, J; Hashimoto, A; Takada, A; Okazaki, K; Kida, H

    1999-01-01

    The nucleotide sequence of the immediate early (IE) gene of canine herpesvirus was determined. This gene was located in the inverted repeat regions, encoding a polypeptide of 1,383 amino acids. The predicted amino acid sequence was most closely related to that of the feline herpesvirus 1 IE protein among those of other alphaherpesviruses. DNA binding and transcriptional activation domains were found in the IE protein. A spliced region of the IE gene transcript was determined in its 5' non-coding region. PMID:10470264

  18. Immunological evasion of immediate-early varicella zoster virus proteins.

    PubMed

    Meysman, Pieter; Fedorov, Dmitry; Van Tendeloo, Viggo; Ogunjimi, Benson; Laukens, Kris

    2016-07-01

    The varicella zoster virus (VZV) causes the childhood disease commonly known as chickenpox and can later in life reactivate as herpes zoster. The adaptive immune system is known to play an important role in suppressing VZV reactivation. A central aspect of this system is the presentation of VZV-derived peptides by the major histocompatibility complex (MHC) proteins. Here, we investigate if key VZV proteins have evolved their amino acid sequence to avoid presentation by MHC based on predictive models of MHC-peptide affinity. This study shows that the immediate-early proteins of all characterized VZV strains are profoundly depleted for high-affinity MHC-I-restricted epitopes. The same depletion can be found in its closest animal analog, the simian varicella virus. Further orthology analysis towards other herpes viruses suggests that the protein amino acid frequency is one of the primary drivers of targeted epitope depletion. PMID:27020058

  19. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  20. Influence of Isoflurane on Immediate-Early Gene Expression

    PubMed Central

    Bunting, Kristopher M.; Nalloor, Rebecca I.; Vazdarjanova, Almira

    2016-01-01

    Background: Anterograde amnesia is a hallmark effect of volatile anesthetics. Isoflurane is known to affect both the translation and transcription of plasticity-associated genes required for normal memory formation in many brain regions. What is not known is whether isoflurane anesthesia prevents the initiation of transcription or whether it halts transcription already in progress. We tested the hypothesis that general anesthesia with isoflurane prevents learning-induced initiation of transcription of several memory-associated immediate-early genes (IEGs) correlated with amnesia; we also assessed whether it stops transcription initiated prior to anesthetic administration. Methods: Using a Tone Fear Conditioning paradigm, rats were trained to associate a tone with foot-shock. Animals received either no anesthesia, anesthesia immediately after training, or anesthesia before, during, and after training. Animals were either sacrificed after training or tested 24 h later for long-term memory. Using Cellular Compartment Analysis of Temporal Activity by Fluorescence in situ Hybridization (catFISH), we examined the percentage of neurons expressing the IEGs Arc/Arg3.1 and Zif268/Egr1/Ngfi-A/Krox-24 in the dorsal hippocampus, primary somatosensory cortex, and primary auditory cortex. Results: On a cellular level, isoflurane administered at high doses (general anesthesia) prevented initiation of transcription, but did not stop transcription of Arc and Zif268 mRNA initiated prior to anesthesia. On a behavioral level, the same level of isoflurane anesthesia produced anterograde amnesia for fear conditioning when administered before and during training, but did not produce retrograde amnesia when administered immediately after training. Conclusion: General anesthesia with isoflurane prevents initiation of learning-related transcription but does not stop ongoing transcription of two plasticity-related IEGs, Arc and Zif268, a pattern of disruption that parallels the effects of

  1. Molecular basis of human growth hormone gene deletions.

    PubMed Central

    Vnencak-Jones, C L; Phillips, J A; Chen, E Y; Seeburg, P H

    1988-01-01

    Crossover sites resulting from unequal recombination within the human growth hormone (GH) gene cluster that cause GH1 gene deletions and isolated GH deficiency type 1A were localized in nine patients. In eight unrelated subjects homozygous for 6.7-kilobase (kb) deletions, the breakpoints are within two blocks of highly homologous DNA sequences that lie 5' and 3' to the GH1 gene. In seven of these eight cases, the breakpoints map within a 1250-base-pair (bp) region composed of 300-bp Alu sequences of 86% homology and flanking non-Alu sequences that are 600 and 300 bp in length and are of 96% and 88% homology, respectively. In the eighth patient, the breakpoints are 5' to these Alu repeats and are most likely within a 700-bp region of 96% homologous DNA sequences. In the ninth patient homozygous for a 7.6-kb deletion, the breakpoints are contained within a 29-bp perfect repeat lying 5' to GH1 and the human chorionic somatomammotropin pseudogene (CSHP1). Together, these results indicate that the presence of highly homologous DNA sequences flanking GH1 predispose to recurrent unequal recombinational events presumably through chromosomal misalignment. Images PMID:2840669

  2. Tetranectin gene deletion induces Parkinson's disease by enhancing neuronal apoptosis.

    PubMed

    Chen, Zhifeng; Wang, Ersong; Hu, Rong; Sun, Yu; Zhang, Lei; Jiang, Jue; Zhang, Ying; Jiang, Hong

    Parkinson's disease (PD) is a chronic neurodegenerative disorder characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNpc). We previously identified tetranectin (TET) as a potential biomarker for PD whose expression is downregulated in the cerebrospinal fluid of PD patients. In the present study, we investigate the role of TET in neurodegeneration in vitro and in vivo. Our results showed that siRNA knockdown of TET decreased cell viability and the number of tyrosine hydroxylase (TH) positive cells, whereas it increased caspase-3 activity and the Bax/Bcl-2 ratio in cultured primary dopaminergic neurons. Overexpression of TET protected dopaminergic neurons against neuronal apoptosis in 1-methyl-4-phenylpyridinium cell culture model in vitro. In TET knockdown mouse model of PD, TET gene deletion decreased the number of TH positive cells in the SNpc, induced apoptosis via the p53/Bax pathway, and significantly impaired the motor behavior of transgenic mice. The findings suggest that TET plays a neuroprotective role via reducing neuron apoptosis and could be a valuable biomarker or potential therapeutic target for the treatment of patients with PD. PMID:26597345

  3. Pseudomonas putida KT2440 markerless gene deletion using a combination of λ Red recombineering and Cre/loxP site-specific recombination.

    PubMed

    Luo, Xi; Yang, Yunwen; Ling, Wen; Zhuang, Hao; Li, Qin; Shang, Guangdong

    2016-02-01

    Pseudomonas putida KT2440 is a saprophytic, environmental microorganism that plays important roles in the biodegradation of environmental toxic compounds and production of polymers, chemicals and secondary metabolites. Gene deletion of KT2440 usually involves cloning of the flanking homologous fragments of the gene of interest into a suicide vector followed by transferring into KT2440 via triparental conjugation. Selection and counterselection steps are then employed to generate gene deletion mutant. However, these methods are tedious and are not suitable for the manipulation of multiple genes simultaneously. Herein, a two-step, markerless gene deletion method is presented. First, homologous armsflanked loxP-neo-loxP was knocked-in to replace the gene of interest, then the kanamycin resistance marker is removed by Cre recombinase catalyzed site-specific recombination. Both two-plasmid and one-plasmid gene systems were established. MekR/PmekA regulated gene expression system was found to be suitable for tight Cre expression in one-plasmid deletion system. The straightforward, time saving and highly efficient markerless gene deletion strategy has the potential to facilitate the genetics and functional genomics study of P. putida KT2440. PMID:26802072

  4. Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR.

    PubMed

    Ge, Xiuchun; Xu, Ping

    2012-01-01

    Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria (1,2). Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse

  5. Sub-optimal phenotypes of double-knockout mutants of Escherichia coli depend on the order of gene deletions.

    PubMed

    Gawand, Pratish; Said Abukar, Fatumina; Venayak, Naveen; Partow, Siavash; Motter, Adilson E; Mahadevan, Radhakrishnan

    2015-08-01

    Metabolic networks are characterized by multiple redundant reactions that do not have a clear biological function. The redundancies in the metabolic networks are implicated in adaptation to random mutations and survival under different environmental conditions. Reactions that are not active under wild-type growth conditions, but get transiently activated after a mutation event such as gene deletion are known as latent reactions. Characterization of multiple-gene knockout mutants can identify the physiological roles of latent reactions. In this study, we characterized double-gene deletion mutants of E. coli with the aim of investigating the sub-optimal physiology of the mutants and the possible roles of latent reactions. Specifically, we investigated the effects of the deletion of the glyoxylate-shunt gene aceA (encoding a latent reaction enzyme, isocitrate lyase) on the growth characteristics of the mutant E. coli Δpgi. The deletion of aceA reduced the growth rate of E. coli Δpgi, indicating that the activation of the glyoxylate shunt plays an important role in adaptation of the mutant E. coli Δpgi when no other latent reactions are concurrently inactivated. We also investigated the effect of the order of the gene deletions on the growth rates and substrate uptake rates of the double-gene deletion mutants. The results indicate that the order in which genes are deleted determines the phenotype of the mutants during the sub-optimal growth phase. To elucidate the mechanism behind the difference between the observed phenotypes, we carried out transcriptomic analysis and constraint-based modeling of the mutants. Transcriptomic analysis showed differential expression of the gene aceK (encoding the protein isocitrate dehydrogenase kinase) involved in controlling the isocitrate flux through the TCA cycle and the glyoxylate shunt. Higher acetate production in the E. coli ΔaceA1 Δpgi2 mutant was consistent with the increased aceK expression, which limits the TCA cycle

  6. Negative elongation factor NELF controls transcription of immediate early genes in a stimulus-specific manner

    SciTech Connect

    Fujita, Toshitsugu; Piuz, Isabelle; Schlegel, Werner

    2009-01-15

    The transcription rate of immediate early genes (IEGs) is controlled directly by transcription elongation factors at the transcription elongation step. Negative elongation factor (NELF) and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) stall RNA polymerase II (pol II) soon after transcription initiation. Upon induction of IEG transcription, DSIF is converted into an accelerator for pol II elongation. To address whether and how NELF as well as DSIF controls overall IEG transcription, its expression was reduced using stable RNA interference in GH4C1 cells. NELF knock-down reduced thyrotropin-releasing hormone (TRH)-induced transcription of the IEGs c-fos, MKP-1, and junB. In contrast, epidermal growth factor (EGF)-induced transcription of these IEGs was unaltered or even slightly increased by NELF knock-down. Thus, stable knock-down of NELF affects IEG transcription stimulation-specifically. Conversely, DSIF knock-down reduced both TRH- and EGF-induced transcription of the three IEGs. Interestingly, TRH-induced activation of the MAP kinase pathway, a pathway essential for transcription of the three IEGs, was down-regulated by NELF knock-down. Thus, stable knock-down of NELF, by modulating intracellular signaling pathways, caused stimulation-specific loss of IEG transcription. These observations indicate that NELF controls overall IEG transcription via multiple mechanisms both directly and indirectly.

  7. Attenuation of serum inducibility of immediate early genes by oncoproteins in tyrosine kinase signaling pathways.

    PubMed Central

    Yu, C L; Prochownik, E V; Imperiale, M J; Jove, R

    1993-01-01

    Immediate early genes involved in controlling cell proliferation are rapidly and transiently induced following stimulation of susceptible cells with serum. To study how oncoproteins regulate immediate early genes, we examined serum inducibility of these genes in cells transformed by various oncoproteins. We found that induction of the immediate early gene, c-fos, by serum stimulation was markedly attenuated in four independent cell lines stably transformed by the v-Src tyrosine kinase. Cells chronically transformed by other oncoproteins implicated in tyrosine kinase signaling pathways, including v-Sis, v-Ras, and v-Raf, showed the same pattern of attenuation. In contrast, serum inducibility of c-fos was not attenuated in cells transformed by simian virus 40, which is thought to transform cells through a different pathway. Cell cycle analyses showed that proliferation of these transformed cell lines could be arrested effectively in 0.1% serum, demonstrating that the attenuation was not simply due to continuous cycling of transformed cells after serum deprivation. Moreover, serum inducibility of other immediate early genes, including c-jun, junB, egr-1, and NGFI-B, also was strikingly attenuated by these same oncoproteins. Nuclear run-on transcription assays established that this attenuation of serum inducibility occurred at the transcriptional level. Finally, flow cytometric analysis demonstrated that serum-starved v-Src-transformed cells were viable and able to progress into S phase of the cell cycle after serum stimulation, even though the induction of immediate early genes was greatly attenuated in these cells. Our results suggest that activation of immediate early genes is repressed by chronic stimulation of tyrosine kinase signaling pathways in transformed cells. Images PMID:8384301

  8. Acute Megakaryoblastic Leukemia with Myelodysplasia-related Changes Associated with ATM Gene Deletion.

    PubMed

    Ureshino, Hiroshi; Tanabe, Momoka; Kurogi, Kazuya; Miyahara, Masaharu; Kimura, Shinya

    2016-01-01

    Ataxia telangiectasia mutated (ATM) is a tumor suppressor gene, and its somatic inactivation plays a role in the pathogenesis of lymphoid malignancies. However, the role of ATM in patients with myeloid malignancies is still unknown. We herein report a case of acute megakaryoblastic leukemia (AMKL) with ATM gene deletion. An 84-year-old Japanese woman presenting with a pale face and pancytopenia was admitted to our institution and diagnosed to have AMKL with ATM gene deletion. She was treated with intravenous azacitidine. The azacitidine treatment was effective for approximately 1 year. Somatic inactivation of the ATM gene may therefore be involved in the pathogenesis of AMKL. PMID:27301517

  9. Fine specificity of cellular immune responses in humans to human cytomegalovirus immediate-early 1 protein.

    PubMed Central

    Alp, N J; Allport, T D; Van Zanten, J; Rodgers, B; Sissons, J G; Borysiewicz, L K

    1991-01-01

    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known about responses against this protein by CD4+ T cells, which may be important as direct effector cells or helper cells for antibody and CD8+ responses. Proliferative-T-cell responses to HCMV IE1 were studied in normal seropositive subjects. Peripheral blood mononuclear cells from 85% of seropositive subjects proliferated in response to HCMV from infected fibroblasts, and of these, 73% responded to recombinant baculovirus IE1. Responding cells were predominantly CD3+ CD4+. IE1 antigen preparations, including baculovirus recombinant protein, transfected rat cell nuclei, and synthetic peptides, induced IE1-specific T-cell lines which cross-reacted between the preparations. The fine specificity of these IE1-specific T-cell lines was studied by using overlapping synthetic peptides encompassing the entire sequence of the IE1 protein. The regions of the IE1 molecule recognized were identified and these varied between individuals, possibly reflecting differences in major histocompatibility complex (MHC) class II haplotype. In one subject, the peptide specificities of proliferative and MHC class I-restricted cytotoxic determinants on IE1 were spatially distinct. Thus, no single immunodominant T-cell determinant within HCMV IE1 was identified, suggesting that multiple peptides or a region of the 72-kDa IE1 protein would be required to induce specific T-cell responses in humans. PMID:1714519

  10. Ethological concepts revisited: immediate early gene induction in response to sexual stimuli in birds.

    PubMed

    Ball, G F; Balthazar, J

    2001-05-01

    Courtship behaviors were interpreted by ethologists as being examples of 'sign stimuli' that would act as 'releasers' of stereotypic species-typical behaviors in conspecifics. A key component of the sign stimulus concept is that some form of stimulus filtering occurs that is responsible for the marked selective behavioral responsiveness. Studies of immediate early gene induction in the avian brain in response to conspecific stimuli associated with courtship and mating reveal that such gene induction is highly selective. In male Japanese quail (Coturnix japonica), studies of the immediate early gene c-fos or zenk have been conducted in birds engaging in both appetitive and consummatory aspects of male sexual behavior. High induction of immediate early genes occurs in hypothalamic and limbic areas such as the medial preoptic nucleus, bed nucleus striae terminalis and parts of the archistriatum in birds who had copulated and/or who had expressed a learned social proximity response, reflecting appetitive sexual behavior. Immediate early gene expression was also increased in telencephalic areas such as the hyperstriatum ventrale that presumably plays a role in the integration of sensory cues related to female recognition. In European starlings, studies of zenk induction have been conducted in females who hear male-typical courtship song. Clayton and Mello had shown that zenk is induced in the auditory telencephalon of canaries and zebra finches at high levels specifically in response to conspecific song. Immediate early genes such as fos and zenk are also expressed in song control nuclei specifically in association with song production. In starlings it was found that song was effective in rapidly inducing zenk expression in the auditory telencephalon in males and in females in the breeding as well as in the non-breeding season. Thus, the expression is not greater in females who use song to choose mates or during the breeding season when females are choosing mates

  11. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  12. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii.

    PubMed

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin; Choi, Chul Hee; Han, Kyudong

    2015-05-15

    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  13. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

    2015-01-01

    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  14. Dissecting the phenotypes of Dravet syndrome by gene deletion.

    PubMed

    Rubinstein, Moran; Han, Sung; Tai, Chao; Westenbroek, Ruth E; Hunker, Avery; Scheuer, Todd; Catterall, William A

    2015-08-01

    Neurological and psychiatric syndromes often have multiple disease traits, yet it is unknown how such multi-faceted deficits arise from single mutations. Haploinsufficiency of the voltage-gated sodium channel Nav1.1 causes Dravet syndrome, an intractable childhood-onset epilepsy with hyperactivity, cognitive deficit, autistic-like behaviours, and premature death. Deletion of Nav1.1 channels selectively impairs excitability of GABAergic interneurons. We studied mice having selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons. In brain slices, these deletions cause increased threshold for action potential generation, impaired action potential firing in trains, and reduced amplification of postsynaptic potentials in those interneurons. Selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons increases susceptibility to thermally-induced seizures, which are strikingly prolonged when Nav1.1 is deleted in both interneuron types. Mice with global haploinsufficiency of Nav1.1 display autistic-like behaviours, hyperactivity and cognitive impairment. Haploinsufficiency of Nav1.1 in parvalbumin-expressing interneurons causes autistic-like behaviours, but not hyperactivity, whereas haploinsufficiency in somatostatin-expressing interneurons causes hyperactivity without autistic-like behaviours. Heterozygous deletion in both interneuron types is required to impair long-term spatial memory in context-dependent fear conditioning, without affecting short-term spatial learning or memory. Thus, the multi-faceted phenotypes of Dravet syndrome can be genetically dissected, revealing synergy in causing epilepsy, premature death and deficits in long-term spatial memory, but interneuron-specific effects on hyperactivity and autistic-like behaviours. These results show that multiple disease traits can arise from similar functional deficits in specific interneuron types. PMID:26017580

  15. Dissecting the phenotypes of Dravet syndrome by gene deletion

    PubMed Central

    Rubinstein, Moran; Han, Sung; Tai, Chao; Westenbroek, Ruth E.; Hunker, Avery; Scheuer, Todd

    2015-01-01

    Neurological and psychiatric syndromes often have multiple disease traits, yet it is unknown how such multi-faceted deficits arise from single mutations. Haploinsufficiency of the voltage-gated sodium channel Nav1.1 causes Dravet syndrome, an intractable childhood-onset epilepsy with hyperactivity, cognitive deficit, autistic-like behaviours, and premature death. Deletion of Nav1.1 channels selectively impairs excitability of GABAergic interneurons. We studied mice having selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons. In brain slices, these deletions cause increased threshold for action potential generation, impaired action potential firing in trains, and reduced amplification of postsynaptic potentials in those interneurons. Selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons increases susceptibility to thermally-induced seizures, which are strikingly prolonged when Nav1.1 is deleted in both interneuron types. Mice with global haploinsufficiency of Nav1.1 display autistic-like behaviours, hyperactivity and cognitive impairment. Haploinsufficiency of Nav1.1 in parvalbumin-expressing interneurons causes autistic-like behaviours, but not hyperactivity, whereas haploinsufficiency in somatostatin-expressing interneurons causes hyperactivity without autistic-like behaviours. Heterozygous deletion in both interneuron types is required to impair long-term spatial memory in context-dependent fear conditioning, without affecting short-term spatial learning or memory. Thus, the multi-faceted phenotypes of Dravet syndrome can be genetically dissected, revealing synergy in causing epilepsy, premature death and deficits in long-term spatial memory, but interneuron-specific effects on hyperactivity and autistic-like behaviours. These results show that multiple disease traits can arise from similar functional deficits in specific interneuron types. PMID:26017580

  16. Gene expression profiling in spleens of deoxynivalenol-exposed mice: immediate early genes as primary targets.

    PubMed

    Kinser, Shawn; Jia, Qunshan; Li, Maioxing; Laughter, Ashley; Cornwell, Paul; Corton, J Christopher; Pestka, James

    2004-09-24

    signaling, were increased, while Jun kinase 2 (JNK2) was decreased. Taken together, data suggest that DON upregulated the expression of multiple immediate early genes, many of which are likely to contribute to the complex immunological effects reported for this and other trichothecenes. PMID:15371230

  17. Physical and functional interactions between herpes simplex virus immediate-early proteins ICP4 and ICP27.

    PubMed Central

    Panagiotidis, C A; Lium, E K; Silverstein, S J

    1997-01-01

    The ordered expression of herpes simplex virus type 1 (HSV-1) genes, during the course of a productive infection, requires the action of the virus immediate-early regulatory proteins. Using a protein interaction assay, we demonstrate specific in vitro protein-protein interactions between ICP4 and ICP27, two immediate-early proteins of HSV-1 that are essential for virus replication. We map multiple points of contact between these proteins. Furthermore, by coimmunoprecipitation experiments, we demonstrate the following. (i) ICP4-ICP27 complexes are present in extracts from HSV-1 infected cells. (ii) ICP27 binds preferentially to less modified forms of ICP4, a protein that is extensively modified posttranslationally. We also demonstrate, by performing electrophoretic mobility shift assays and supershifts with monoclonal antibodies to ICP4 or ICP27, that both proteins are present in a DNA-protein complex with a noncanonical ICP4 binding site present in the HSV thymidine kinase (TK) gene. ICP4, in extracts from cells infected with ICP27-deficient viruses, is impaired in its ability to form complexes with the TK site but not with the canonical site from the alpha4 gene. However, ICP4 is able to form complexes with the TK probe, in the absence of ICP27, when overproduced in mammalian cells or expressed in bacteria. These data suggest that the inability of ICP4 from infected cell extracts to bind the TK probe in the absence of ICP27 does not reflect a requirement for the physical presence of ICP27 in the complex. Rather, they imply that ICP27 is likely to modulate the DNA binding activity of ICP4 by affecting its posttranslational modification status. Therefore, we propose that ICP27, in addition to its established role as a posttranscriptional regulator of virus gene expression, may also modulate transcription either through direct or indirect interactions with HSV regulatory regions, or through its ability to modulate the DNA binding activity of ICP4. PMID:8995681

  18. Expression of immediate early genes after treatment of human astrocytoma cells with radiation and taxol

    SciTech Connect

    Gubits, R.M.; Geard, C.R.; Schiff, P.B.

    1993-10-20

    The promising chemotherapeutic agent, taxol, has been shown to sensitize the G18 line of human astrocytoma cells to ionizing radiation. The present studies were performed to identify specific changes in gene expression associated with this altered sensitivity. The products of immediate early genes, which are induced transiently in cells in response to a variety of treatments, including growth factors, neurotransmitters, and irradiation with UV light or X rays, are thought to initiate a cascade of genetic responses to alterations in cellular environment. The present results demonstrate a dramatic attenuation in one immediate early gene response in association with a treatment that enhances radiosensitivity in a refractory human brain tumor line. 22 refs., 5 figs., 1 tab.

  19. Mullerian Duct Cyst Causing Bladder Outlet Obstruction in a Patient with HNF-1β Gene Deletion

    PubMed Central

    Honore, Matthew; Fowler, Ross; Kiosoglous, Anthony J.

    2016-01-01

    A 24-year-old male was referred to a tertiary hospital for a possible prostatic abscess. The patient went into acute urinary retention. Transurethral drainage was performed. MRI pelvis three days post-operatively identified the prostatic cystic structure as a müllerian duct cyst. Several other phenotypical features were noted on examination as well as findings on investigations. From these diagnosis of hepatocyte nuclear factor-1β (HNF-1β) gene deletion was made. PMID:27390584

  20. Effects of G-gene Deletion and Replacement on Rabies Virus Vector Gene Expression

    PubMed Central

    Sato, Sho; Ohara, Shinya; Tsutsui, Ken-Ichiro; Iijima, Toshio

    2015-01-01

    The glycoprotein-gene (G gene) -deleted rabies virus (RV) vector is a powerful tool to examine the function and structure of neural circuits. We previously reported that the deletion of the G gene enhances the transgene expression level of the RV vector. However, the mechanism of this enhancement remains to be clarified. We presume that there are two possible factors for this enhancement. The first factor is the glycoprotein of RV, which shows cytotoxicity; thus, may cause a dysfunction in the translation process of infected cells. The second possible factor is the enhanced expression of the L gene, which encodes viral RNA polymerase. In the RV, it is known that the gene expression level is altered depending on the position of the gene. Since G-gene deletion displaces the L gene in the genome, the expression of the L gene and viral transcription may be enhanced. In this study, we compared the transgene expression level and viral transcription of three recombinant RV vectors. The effect of glycoprotein was examined by comparing the viral gene expression of G-gene-intact RV and G-gene-replaced RV. Despite the fact that the L-gene transcription level of these two RV vectors was similar, the G-gene-replaced RV vector showed higher viral transcription and transgene expression level than the G-gene-intact RV vector. To examine the effect of the position of the L gene, we compared the viral gene expression of the G-gene-deleted RV and G-gene-replaced RV. The G-gene-deleted RV vector showed higher L-gene transcription, viral transcription, and transgene expression level than the G-gene-replaced RV vector. These results indicate that G-gene deletion enhances the transgene expression level through at least two factors, the absence of glycoprotein and enhancement of L-gene expression. These findings enable investigators to design a useful viral vector that shows a controlled desirable transgene expression level in applications. PMID:26023771

  1. Pheromone-induced expression of immediate early genes in the mouse vomeronasal sensory system.

    PubMed

    Haga-Yamanaka, Sachiko; Touhara, Kazushige

    2013-01-01

    Immediate early genes (IEGs) are powerful tools for visualizing activated neurons and extended circuits that are stimulated by sensory input. Several kinds of IEGs (e.g., c-fos, egr-1) have been utilized for detecting activated receptor neurons in the pheromone sensory organ called the vomeronasal organ (VNO), as well as for mapping the neurons within the central nervous system (CNS) excited by pheromones.In this chapter, we describe the procedure for the detection of pheromone-induced neural activation in the VNO and CNS using the c-Fos immunostaining technique. PMID:24014367

  2. A UL47 Gene Deletion Mutant of Bovine Herpesvirus Type 1 Exhibits Impaired Growth in Cell Culture and Lack of Virulence in Cattle▿ †

    PubMed Central

    Lobanov, Vladislav A.; Maher-Sturgess, Sheryl L.; Snider, Marlene G.; Lawman, Zoe; Babiuk, Lorne A.; van Drunen Littel-van den Hurk, Sylvia

    2010-01-01

    Tegument protein VP8 encoded by the UL47 gene of bovine herpesvirus type 1 (BHV-1) is the most abundant constituent of mature virions. In the present report, we describe the characterization of UL47 gene-deleted BHV-1 in cultured cells and its natural host. The UL47 deletion mutant exhibited reduced plaque size and more than 100-fold decrease in intracellular and extracellular viral titers in cultured cells. Ultrastructural observations of infected cells showed normal maturation of BHV-1 virions in the absence of VP8. There was no evidence for a change in immediate-early gene activator function of VP16 in the UL47 deletion mutant virus-infected cells, since bovine ICP4 mRNA and protein levels were similar to those in the wild-type and revertant virus-infected cells throughout the course of infection. Whereas VP16, glycoprotein C (gC), gB, and VP5 were expressed to wild-type levels in the UL47 deletion mutant-infected cells, the gD and VP22 protein levels were significantly reduced. The reduction in gD protein was associated with increased turnover of the protein. Furthermore, some of the analyzed early and late proteins were expressed with earlier kinetics in the absence of VP8. Extracellular virions of the UL47 deletion mutant contained reduced amounts of gD, gB, gC, and VP22 but similar amounts of VP16 compared to those of wild-type or revertant virus particles. In addition, the UL47 gene product was indispensable for BHV-1 replication in vivo, since no clinical manifestations or viral shedding were detected in the UL47 deletion mutant-infected calves, and the virus failed to induce significant levels of humoral and cellular immunity. PMID:19864376

  3. Expression of cyr61, a growth factor-inducible immediate-early gene.

    PubMed Central

    O'Brien, T P; Yang, G P; Sanders, L; Lau, L F

    1990-01-01

    A set of immediate-early genes that are rapidly activated by serum or purified platelet-derived growth factor in mouse 3T3 fibroblasts has been previously identified. Among these genes, several are related to known or putative transcription factors and growth factors, supporting the notion that some of these genes encode regulatory molecules important to cell growth. We show here that a member of this set of genes, cyr61 (originally identified by its cDNA 3CH61), encodes a 379-amino-acid polypeptide rich in cysteine residues. cyr61 can be induced through protein kinase C-dependent and -independent pathways. Unlike many immediate-early genes that are transiently expressed, the cyr61 mRNA is accumulated from the G0/G1 transition through mid-G1. This expression pattern is due to persistent transcription, while the mRNA is rapidly turned over during the G0/G1 transition and in mid-G1 at the same rate. In logarithmically growing cells, the cyr61 mRNA level is constant throughout the cell cycle. Cyr61 contains an N-terminal secretory signal sequence; however, it is not detected in the culture medium by immunoprecipitation. Cyr61 is synthesized maximally at 1 to 2 h after serum stimulation and has a short half-life within the cell. Images PMID:2355916

  4. Gene deletion strategy to examine the involvement of the two chondroitin lyases in Flavobacterium columnare virulence.

    PubMed

    Li, Nan; Qin, Ting; Zhang, Xiao Lin; Huang, Bei; Liu, Zhi Xin; Xie, Hai Xia; Zhang, Jin; McBride, Mark J; Nie, Pin

    2015-11-01

    Flavobacterium columnare is an important bacterial pathogen of freshwater fish that causes high mortality of infected fish and heavy economic losses in aquaculture. The pathogenesis of this bacterium is poorly understood, in part due to the lack of efficient methods for genetic manipulation. In this study, a gene deletion strategy was developed and used to determine the relationship between the production of chondroitin lyases and virulence. The F. johnsoniae ompA promoter (PompA) was fused to sacB to construct a counterselectable marker for F. columnare. F. columnare carrying PompA-sacB failed to grow on media containing 10% sucrose. A suicide vector carrying PompA-sacB was constructed, and a gene deletion strategy was developed. Using this approach, the chondroitin lyase-encoding genes, cslA and cslB, were deleted. The ΔcslA and ΔcslB mutants were both partially deficient in digestion of chondroitin sulfate A, whereas a double mutant (ΔcslA ΔcslB) was completely deficient in chondroitin lyase activity. Cells of F. columnare wild-type strain G4 and of the chondroitin lyase-deficient ΔcslA ΔcslB mutant exhibited similar levels of virulence toward grass carp in single-strain infections. Coinfections, however, revealed a competitive advantage for the wild type over the chondroitin lyase mutant. The results indicate that chondroitin lyases are not essential virulence factors of F. columnare but may contribute to the ability of the pathogen to compete and cause disease in natural infections. The gene deletion method developed in this study may be employed to investigate the virulence factors of this bacterium and may have wide application in many other members of the phylum Bacteroidetes. PMID:26253667

  5. Model-guided identification of gene deletion targets for metabolic engineering in Saccharomyces cerevisiae.

    PubMed

    Brochado, Ana Rita; Patil, Kiran Raosaheb

    2014-01-01

    Identification of metabolic engineering strategies for rerouting intracellular fluxes towards a desired product is often a challenging task owing to the topological and regulatory complexity of metabolic networks. Genome-scale metabolic models help tackling this complexity through systematic consideration of mass balance and reaction directionality constraints over the entire network. Here, we describe how genome-scale metabolic models can be used for identifying gene deletion targets leading to increased production of the desired product. Vanillin production in Saccharomyces cerevisiae is used as a case study throughout this chapter. PMID:24744040

  6. PDX1, a cellular homeoprotein, binds to and regulates the activity of human cytomegalovirus immediate early promoter.

    PubMed

    Chao, Sheng-Hao; Harada, Josephine N; Hyndman, Francie; Gao, Xiaoqi; Nelson, Christian G; Chanda, Sumit K; Caldwell, Jeremy S

    2004-04-16

    Cellular homeoproteins have been shown to regulate the transcription of several viruses, including herpes simplex viruses, human papillomaviruses, and mouse mammary tumor viruses. Previous studies investigating the anti-viral mechanisms of several cyclin-dependent kinase inhibitors showed that the homeoproteins, pre B-cell leukemia transcription factor 1 (PBX1) and PBX-regulating protein-1 (PREP1), function as transcriptional activators of Moloney murine leukemia virus. Here, we examined the involvement of cellular homeoproteins in regulating the activity of the human cytomegalovirus immediate early (CMV IE) promoter. We identified a 45-bp element located at position -593 to -549 upstream of the transcription start site of the CMV IE gene, which contains multiple putative homeoprotein binding motifs. Gel shift assays demonstrated the physical association between a homeodomain protein, pancreatic-duodenal homeobox factor-1 (PDX1) and the 45-bp cytomegalovirus (CMV) region. We further determined that PDX1 represses the CMV IE promoter activity in 293 cells. Overexpression of PDX1 resulted in a decrease in transcription of the CMV IE gene. Conversely, blocking PDX1 protein synthesis and mutating the PDX1 binding sites enhanced CMV IE-dependent transcription. Collectively, our results represent the first work demonstrating that a cellular homeoprotein, PDX1, may be a repressor involved in regulation of human CMV gene expression. PMID:14764605

  7. A Diverse Repertoire of CD4 T Cells Targets the Immediate-Early 1 Protein of Human Cytomegalovirus

    PubMed Central

    Ameres, Stefanie; Liang, Xiaoling; Wiesner, Martina; Mautner, Josef; Moosmann, Andreas

    2015-01-01

    T-cell responses to the immediate-early 1 (IE-1) protein of human cytomegalovirus (HCMV) are associated with protection from viral disease. Thus, IE-1 is a promising target for immunotherapy. CD8 T-cell responses to IE-1 are generally strong. In contrast, CD4 T-cell responses to IE-1 were described to be comparatively infrequent or undetectable in HCMV carriers, and information on their target epitopes and their function has been limited. To analyze the repertoire of IE-1-specific CD4 T cells, we expanded them from healthy donors with autologous IE-1-expressing mini-Epstein–Barr virus-transformed B-cell lines and established IE-1-specific CD4 T-cell clones. Clones from seven out of seven HCMV-positive donors recognized endogenously processed IE-1 epitopes restricted through HLA-DR, DQ, or DP. Three to seven IE-1 epitopes were recognized per donor. Cumulatively, about 27 different HLA/peptide class II complexes were recognized by 117 IE-1-specific clones. Our results suggest that a highly diversified repertoire of IE-1-specific CD4 T cells targeting multiple epitopes is usually present in healthy HCMV carriers. Therefore, multiepitope approaches to immunomonitoring and immunotherapy will make optimal use of this potentially important class of HCMV-specific effector cells. PMID:26635812

  8. Satb1 Ablation Alters Temporal Expression of Immediate Early Genes and Reduces Dendritic Spine Density during Postnatal Brain Development

    PubMed Central

    Balamotis, Michael A.; Tamberg, Nele; Woo, Young Jae; Li, Jingchuan; Davy, Brian

    2012-01-01

    Complex behaviors, such as learning and memory, are associated with rapid changes in gene expression of neurons and subsequent formation of new synaptic connections. However, how external signals are processed to drive specific changes in gene expression is largely unknown. We found that the genome organizer protein Satb1 is highly expressed in mature neurons, primarily in the cerebral cortex, dentate hilus, and amygdala. In Satb1-null mice, cortical layer morphology was normal. However, in postnatal Satb1-null cortical pyramidal neurons, we found a substantial decrease in the density of dendritic spines, which play critical roles in synaptic transmission and plasticity. Further, we found that in the cerebral cortex, Satb1 binds to genomic loci of multiple immediate early genes (IEGs) (Fos, Fosb, Egr1, Egr2, Arc, and Bdnf) and other key neuronal genes, many of which have been implicated in synaptic plasticity. Loss of Satb1 resulted in greatly alters timing and expression levels of these IEGs during early postnatal cerebral cortical development and also upon stimulation in cortical organotypic cultures. These data indicate that Satb1 is required for proper temporal dynamics of IEG expression. Based on these findings, we propose that Satb1 plays a critical role in cortical neurons to facilitate neuronal plasticity. PMID:22064485

  9. DNA methylation and gene deletion analysis of brain metastases in melanoma patients identifies mutually exclusive molecular alterations

    PubMed Central

    Marzese, Diego M.; Scolyer, Richard A.; Roqué, Maria; Vargas-Roig, Laura M.; Huynh, Jamie L.; Wilmott, James S.; Murali, Rajmohan; Buckland, Michael E.; Barkhoudarian, Garni; Thompson, John F.; Morton, Donald L.; Kelly, Daniel F.; Hoon, Dave S. B.

    2014-01-01

    Background The brain is a common target of metastases for melanoma patients. Little is known about the genetic and epigenetic alterations in melanoma brain metastases (MBMs). Unraveling these molecular alterations is a key step in understanding their aggressive nature and identifying novel therapeutic targets. Methods Genome-wide DNA methylation analyses of MBMs (n = 15) and normal brain tissues (n = 91) and simultaneous multigene DNA methylation and gene deletion analyses of metastatic melanoma tissues (99 MBMs and 43 extracranial metastases) were performed. BRAF and NRAS mutations were evaluated in MBMs by targeted sequencing. Results MBMs showed significant epigenetic heterogeneity. RARB, RASSF1, ESR1, APC, PTEN, and CDH13 genes were frequently hypermethylated. Deletions were frequently detected in the CDKN2A/B locus. Of MBMs, 46.1% and 28.8% had BRAF and NRAS missense mutations, respectively. Compared with lung and liver metastases, MBMs exhibited higher frequency of CDH13 hypermethylation and CDKN2A/B locus deletion. Mutual exclusivity between hypermethylated genes and CDKN2A/B locus deletion identified 2 clinically relevant molecular subtypes of MBMs. CDKN2A/B deletions were associated with multiple MBMs and frequently hypermethylated genes with shorter time to brain metastasis. Conclusions Melanoma cells that colonize the brain harbor numerous genetically and epigenetically altered genes. This study presents an integrated genomic and epigenomic analysis that reveals MBM-specific molecular alterations and mutually exclusive molecular subtypes. PMID:24968695

  10. Immediate Early and Early Lytic Cycle Proteins Are Frequent Targets of the Epstein-Barr Virus–induced Cytotoxic T Cell Response

    PubMed Central

    Steven, N.M.; Annels, N.E.; Kumar, A.; Leese, A.M.; Kurilla, M.G.; Rickinson, A.B.

    1997-01-01

    Epstein-Barr virus (EBV), a human γ-herpesvirus, can establish both nonproductive (latent) and productive (lytic) infections. Although the CD8+ cytotoxic T lymphocyte (CTL) response to latently infected cells is well characterized, very little is known about T cell controls over lytic infection; this imbalance in our understanding belies the importance of virus-replicative lesions in several aspects of EBV disease pathogenesis. The present work shows that the primary CD8+ CTL response to EBV in infectious mononucleosis patients contains multiple lytic antigen-specific reactivities at levels at least as high as those seen against latent antigens; similar reactivities are also detectable in CTL memory. Clonal analysis revealed individual responses to the two immediate early proteins BZLF1 and BRLF1, and to three (BMLF1, BMRF1, and BALF2) of the six early proteins tested. In several cases, the peptide epitope and HLA-restricting determinant recognized by these CTLs has been defined, one unusual feature being the number of responses restricted through HLA-C alleles. The work strongly suggests that EBVreplicative lesions are subject to direct CTL control in vivo and that immediate early and early proteins are frequently the immunodominant targets. This contrasts with findings in α- and β-herpesvirus systems (herpes simplex, cytomegalovirus) where viral interference with the antigen-processing pathway during lytic infection renders immediate early and early proteins much less immunogenic. The unique capacity of γ-herpesvirus to amplify the viral load in vivo through a latent growth-transforming infection may have rendered these agents less dependent upon viral replication as a means of successfully colonizing their hosts. PMID:9151898

  11. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    SciTech Connect

    Zhang, Y.; Woloschak, G.E.

    1997-08-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF{sub 1} male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P < 0.05) higher percentage of mRb deletions in lung adenocarcinomas from mice exposed to 60 once-weekly {gamma}-ray doses than those from mice receiving 24 once-weekly {gamma}-ray doses at low doses and low dose rates; however, the percentage was not significantly different (P > 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose {gamma} irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed.

  12. Targeted gene deletion in Candida parapsilosis demonstrates the role of secreted lipase in virulence

    PubMed Central

    Gácser, Attila; Trofa, David; Schäfer, Wilhelm; Nosanchuk, Joshua D.

    2007-01-01

    Candida parapsilosis is a major cause of human disease, yet little is known about the pathogen’s virulence. We have developed an efficient gene deletion system for C. parapsilosis based on the repeated use of the dominant nourseothricin resistance marker (caSAT1) and its subsequent deletion by FLP-mediated, site-specific recombination. Using this technique, we deleted the lipase locus in the C. parapsilosis genome consisting of adjacent genes CpLIP1 and CpLIP2. Additionally we reconstructed the CpLIP2 gene, which restored lipase activity. Lipolytic activity was absent in the null mutants, whereas the WT, heterozygous, and reconstructed mutants showed similar lipase production. Biofilm formation was inhibited with lipase-negative mutants and their growth was significantly reduced in lipid-rich media. The knockout mutants were more efficiently ingested and killed by J774.16 and RAW 264.7 macrophage-like cells. Additionally, the lipase-negative mutants were significantly less virulent in infection models that involve inoculation of reconstituted human oral epithelium or murine intraperitoneal challenge. These studies represent what we believe to be the first targeted disruption of a gene in C. parapsilosis and show that C. parapsilosis–secreted lipase is involved in disease pathogenesis. This efficient system for targeted gene deletion holds great promise for rapidly enhancing our knowledge of the biology and virulence of this increasingly common invasive fungal pathogen. PMID:17853941

  13. Constitutional and mosaic large NF1 gene deletions in neurofibromatosis type 1.

    PubMed Central

    Rasmussen, S A; Colman, S D; Ho, V T; Abernathy, C R; Arn, P H; Weiss, L; Schwartz, C; Saul, R A; Wallace, M R

    1998-01-01

    A set of neurofibromatosis type 1 (NF1) patients was screened for large NF1 gene deletions by comparing patient and parent genotypes at 10 intragenic polymorphic loci. Of 67 patient/parent sets (47 new mutation patients and 20 familial cases), five (7.5%) showed loss of heterozygosity (LOH), indicative of NF1 gene deletion. These five patients did not have severe NF1 manifestations, mental retardation, or dysmorphic features, in contrast to previous reports of large NF1 deletions. All five deletions were de novo and occurred on the maternal chromosome. However, two patients showed partial LOH, consistent with somatic mosaicism for the deletion, suggesting that mosaicism may be more frequent in NF1 than previously recognised (and may have bearing on clinical severity). We suggest that large NF1 deletions (1) are not always associated with unusual clinical features, (2) tend to occur more frequently on maternal alleles, and (3) are an important mechanism for constitutional and somatic mutations in NF1 patients. Images PMID:9643287

  14. The immediate early gene of canine herpesvirus is transcribed through early and late phases.

    PubMed

    Miyoshi, Masahiro; Okazaki, Katsunori; Takiguchi, Mitsuyoshi; Kida, Hiroshi; Hashimoto, Akira

    2002-07-01

    The immediate early (IE) gene of canine herpesvirus (CHV), homologue of the infected cell protein 4 (ICP4) gene of herpes simplex virus 1, is transcribed as a 4.9kb mRNA during IE phase. The IE gene was further transcribed as a 4.8kb mRNA through early (E) and late (L) phases of productive infection. Transcription of the 4.8kb mRNA initiated from downstream of the TATA box in an intron which was spliced out during IE phase. The reverse transcription-polymerase chain reaction revealed that the IE promoter was turned off during L phase at a permissive temperature. We, thus, propose to redesignate the IE gene of CHV as CICP4 gene. PMID:12185320

  15. A requirement for the immediate early gene zif268 in reconsolidation of recognition memory after retrieval.

    PubMed

    Bozon, Bruno; Davis, Sabrina; Laroche, Serge

    2003-11-13

    Recent research has revived interest in the possibility that previously consolidated memories need to reconsolidate when recalled to return to accessible long-term memory. Evidence suggests that both consolidation and reconsolidation of certain types of memory require protein synthesis, but whether similar molecular mechanisms are involved remains unclear. Here, we explore whether zif268, an activity-dependent inducible immediate early gene (IEG) required for consolidation of new memories, is also recruited for reconsolidation of recognition memory following reactivation. We show that when a consolidated memory for objects is recalled, zif268 mutant mice are impaired in further long-term but not short-term recognition memory. The impairment is specific to reactivation with the previously memorized objects in the relevant context, occurs in delayed recall, and does not recover over several days. These findings indicate that IEG-mediated transcriptional regulation in neurons is one common molecular mechanism for the storage of newly formed and reactivated recognition memories. PMID:14622575

  16. Central Renin Injections: Effects on Drinking and Expression of Immediate Early Genes

    NASA Technical Reports Server (NTRS)

    Xu, Zhice; Johnson, Alan Kim

    1998-01-01

    This study investigated the drinking response and the expression of Fos- and Egr-1-immunoreactivity (Fos-ir, Egr-1-ir) in the brain induced by endogenous angiotensin generated by intracerebroventricular (i.c.v.) injection of renin. Renin induced Fos-ir in the subformical organ (SFO), median preoptic (MnPO), supraoptic and paraventricular nuclei (SON and PVN), area postrema (AP), nuclei of the solitary tract (NTS) and lateral parabrachial nuclei (LPBN). Renin-induced Egr-1-ir exhibited a similar pattern of distribution as that observed for Fos-ir. The dose of i.c.v. renin that induced expression of immediate early gene (IEG) product immunoreactivity also produced vigorous drinking. When renin-injected rats were pretreated with captopril, an angiotensin converting enzyme inhibitor, drinking was blocked. With the same captopril pretreatment, both Fos- and Egr-1-ir in the SFO, MnPO, SON, PVN, AP and LPBN were also significantly reduced.

  17. Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice

    PubMed Central

    Zuloaga, Kristen L.; Zhang, Wenri; Roese, Natalie E.; Alkayed, Nabil J.

    2015-01-01

    Soluble epoxide hydrolase (sEH), a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs), is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS) female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15–18 month old) and young (3–4 month old) female sEH knockout (sEHKO) mice and wild type (WT) mice were subjected to 45 min middle cerebral artery occlusion (MCAO) with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24 h thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography (OMAG). Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24 h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24 h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice. PMID:25642188

  18. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  19. A novel adipose-specific gene deletion model demonstrates potential pitfalls of existing methods.

    PubMed

    Mullican, Shannon E; Tomaru, Takuya; Gaddis, Christine A; Peed, Lindsey C; Sundaram, Anand; Lazar, Mitchell A

    2013-01-01

    Adipose-specific gene deletion in mice is crucial in determining gene function in adipocyte homeostasis and the development of obesity. We noted 100% mortality when the Hdac3 gene was conditionally deleted using Fabp4-Cre mice, the most commonly used model of adipose-targeted Cre recombinase. However, this surprising result was not reproduced using other models of adipose targeting of Cre, including a novel Retn-Cre mouse. These findings underscore the need for caution when interpreting data obtained using Fabp4-Cre mice and should encourage the use of additional or alternative adipose-targeting Cre mouse models before drawing conclusions about in vivo adipocyte-specific functions. PMID:23192980

  20. Immunogenic response induced by wzm and wzt gene deletion mutants from Brucella abortus S19.

    PubMed

    Wang, Xiu-Ran; Yan, Guang-Mou; Zhang, Rui; Lang, Xu-Long; Yang, Yan-Ling; Li, Xiao-Yan; Chen, Si; Qian, Jing; Wang, Xing-Long

    2014-02-01

    Brucellosis is an infectious disease affecting humans and animals worldwide. Effective methods of control include inducing immunity in animals by vaccination and elimination. Brucella abortus S19 is one of the popular vaccines for control of cattle brucellosis, as it has low virulence. In this paper, allelic exchange plasmids of wzm and wzt genes were constructed and partially knocked out to evaluate the effects on the induction of immunity to Brucella abortus S19 mutants. Cytokine secretion in vitro, INF-γ induction in vivo and antibody dynamics were evaluated. These data suggested that the immunity-eliciting ability of the wzm and wzt gene deletion mutants was similar, although reduced compared with the S19 strain. The results demonstrated that the wzt gene may be more important in the regulation of the induction of immunity than the wzm gene. PMID:24247358

  1. Three new isolates of porcine respiratory coronavirus with various pathogenicities and spike (S) gene deletions.

    PubMed Central

    Vaughn, E M; Halbur, P G; Paul, P S

    1994-01-01

    Three new isolates of porcine respiratory coronavirus (PRCV) were isolated and partially characterized. These PRCV isolates showed a selective tropism for respiratory tissue and were antigenically related to transmissible gastroenteritis virus. PCR amplification of the 5' half of the spike (S) genes of the three PRCV isolates indicated that a large deletion, characteristic of PRCV, was present. By using cDNA probes specific for the transmissible gastroenteritis virus S gene, the PCR products were shown to be specific in a Southern blot. The three new PRCV isolates were shown to vary in S gene deletion size. In a separate study, these isolates have also been shown to vary in pathogenicity. These new PRCV isolates should serve as important tools in gaining a better understanding of the pathogenesis of coronavirus infections. Images PMID:7929779

  2. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System

    PubMed Central

    Min, Kyunghun; Ichikawa, Yuichi

    2016-01-01

    ABSTRACT Clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated gene 9 (CRISPR-Cas9) systems are used for a wide array of genome-editing applications in organisms ranging from fungi to plants and animals. Recently, a CRISPR-Cas9 system has been developed for the diploid fungal pathogen Candida albicans; the system accelerates genetic manipulation dramatically [V. K. Vyas, M. I. Barrasa, and G. R. Fink, Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. We show here that the CRISPR-Cas9 genetic elements can function transiently, without stable integration into the genome, to enable the introduction of a gene deletion construct. We describe a transient CRISPR-Cas9 system for efficient gene deletion in C. albicans. Our observations suggest that there are two mechanisms that lead to homozygous deletions: (i) independent recombination of transforming DNA into each allele and (ii) recombination of transforming DNA into one allele, followed by gene conversion of the second allele. Our approach will streamline gene function analysis in C. albicans, and our results indicate that DNA can function transiently after transformation of this organism. IMPORTANCE The fungus Candida albicans is a major pathogen. Genetic analysis of this organism has revealed determinants of pathogenicity, drug resistance, and other unique biological features, as well as the identities of prospective drug targets. The creation of targeted mutations has been greatly accelerated recently through the implementation of CRISPR genome-editing technology by Vyas et al. [Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. In this study, we find that CRISPR elements can be expressed from genes that are present only transiently, and we develop a transient CRISPR system that further accelerates C. albicans genetic manipulation. PMID:27340698

  3. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area.

    PubMed

    Wu, Hao; Xu, Feng-Lei; Yin, Yong; Da, Peng; You, Xiao-Dong; Xu, Hui-Min; Tang, Yan

    2015-08-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate-early genes (IEGs) was reported to correlate with neuronal activity, in particular activity-regulated cytoskeleton-associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N-methyl D-aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post-cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  4. Mapping of Brain Activity by Automated Volume Analysis of Immediate Early Genes.

    PubMed

    Renier, Nicolas; Adams, Eliza L; Kirst, Christoph; Wu, Zhuhao; Azevedo, Ricardo; Kohl, Johannes; Autry, Anita E; Kadiri, Lolahon; Umadevi Venkataraju, Kannan; Zhou, Yu; Wang, Victoria X; Tang, Cheuk Y; Olsen, Olav; Dulac, Catherine; Osten, Pavel; Tessier-Lavigne, Marc

    2016-06-16

    Understanding how neural information is processed in physiological and pathological states would benefit from precise detection, localization, and quantification of the activity of all neurons across the entire brain, which has not, to date, been achieved in the mammalian brain. We introduce a pipeline for high-speed acquisition of brain activity at cellular resolution through profiling immediate early gene expression using immunostaining and light-sheet fluorescence imaging, followed by automated mapping and analysis of activity by an open-source software program we term ClearMap. We validate the pipeline first by analysis of brain regions activated in response to haloperidol. Next, we report new cortical regions downstream of whisker-evoked sensory processing during active exploration. Last, we combine activity mapping with axon tracing to uncover new brain regions differentially activated during parenting behavior. This pipeline is widely applicable to different experimental paradigms, including animal species for which transgenic activity reporters are not readily available. PMID:27238021

  5. Role of Immediate-Early Genes in Synaptic Plasticity and Neuronal Ensembles Underlying the Memory Trace

    PubMed Central

    Minatohara, Keiichiro; Akiyoshi, Mika; Okuno, Hiroyuki

    2016-01-01

    In the brain, neuronal gene expression is dynamically changed in response to neuronal activity. In particular, the expression of immediate-early genes (IEGs) such as egr-1, c-fos, and Arc is rapidly and selectively upregulated in subsets of neurons in specific brain regions associated with learning and memory formation. IEG expression has therefore been widely used as a molecular marker for neuronal populations that undergo plastic changes underlying formation of long-term memory. In recent years, optogenetic and pharmacogenetic studies of neurons expressing c-fos or Arc have revealed that, during learning, IEG-positive neurons encode and store information that is required for memory recall, suggesting that they may be involved in formation of the memory trace. However, despite accumulating evidence for the role of IEGs in synaptic plasticity, the molecular and cellular mechanisms associated with this process remain unclear. In this review, we first summarize recent literature concerning the role of IEG-expressing neuronal ensembles in organizing the memory trace. We then focus on the physiological significance of IEGs, especially Arc, in synaptic plasticity, and describe our hypotheses about the importance of Arc expression in various types of input-specific circuit reorganization. Finally, we offer perspectives on Arc function that would unveil the role of IEG-expressing neurons in the formation of memory traces in the hippocampus and other brain areas. PMID:26778955

  6. Modeling the Kinetics of a Memory-Associated Immediate Early Gene's Compartmental Expression After Sensory Experience

    NASA Astrophysics Data System (ADS)

    Willats, Adam; Ivanova, Tamara; Prinz, Astrid; Liu, Robert

    2015-03-01

    Immediate Early Genes (IEGs) are rapidly and transiently transcribed in neurons after a sensory experience. Some of these genes act as effector IEGs, which mediate specific effects on cellular function. Arc is one such effector IEG that is essential for synaptic plasticity and memory consolidation in hippocampus and cortex. The expression of Arc in neurons has previously been examined using an imaging method known as Compartmental Analysis of Temporal Fluorescent In-Situ Hybridization. Previous work found that the time course of Arc expression within the nuclear and perinuclear cytoplasmic compartments of a neuron is altered by prior sensory experience. We explore a simple model of the kinetics of IEG transcription and nuclear export, with the aim of eventually uncovering possible mechanisms for how experience alters expression kinetics. Thus far, we characterize our compartmental model using phase-plane analysis and validate it against several IEG expression data sets, including one where prior experience with vocalizing mice alters the time course of call-induced Arc expression in the auditory cortex of a listening mouse. Our model provides a framework to explore why Arc expression may change depending on a receiver's past sound experience and internal state. Adam Willats was supported by NIH Training Grant 5T90DA032466. This research was also supported by NIDCD R01 DC8343.

  7. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area

    PubMed Central

    WU, HAO; XU, FENG-LEI; YIN, YONG; DA, PENG; YOU, XIAO-DONG; XU, HUI-MIN; TANG, YAN

    2015-01-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate-early genes (IEGs) was reported to correlate with neuronal activity, in particular activity-regulated cytoskeleton-associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N-methyl D-aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post-cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  8. TISSUE-PLASMINOGEN ACTIVATOR IS INDUCED AS AN IMMEDIATE-EARLY GENE DURING SEIZURE, KINDLING, AND LONG-TERM POTENTIATION

    EPA Science Inventory

    Activity-dependent genes in brain have been identified using differential screening of hippocampal cDNA library from rats exposed to metrazol seizures under conditions of superconduction. Five immediate early genes whose expression is elevated by neural activity were identified. ...

  9. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  10. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  11. A Form of Perforant Path LTP Can Occur without ERK1/2 Phosphorylation or Immediate Early Gene Induction

    ERIC Educational Resources Information Center

    Steward, Oswald; Huang, Fen; Guzowski, John F.

    2007-01-01

    Stimulation paradigms that induce perforant path long-term potentiation (LTP) initiate phosphorylation of ERK1/2 and induce expression of a variety of immediate early genes (IEGs). These events are thought to be critical components of the mechanism for establishing the changes in synaptic efficacy that endure for hours or longer. Here we show that…

  12. Impact of UGT2B17 Gene Deletion on the Pharmacokinetics of 17-Hydroexemestane in Healthy Volunteers.

    PubMed

    Chen, Shanly M; Atchley, Daniel H; Murphy, Michael A; Gurley, Bill J; Kamdem, Landry K

    2016-07-01

    Exemestane is an aromatase inhibitor drug used for the treatment of hormone-dependent breast cancer. 17-Hydroexemestane, the major and biologically active metabolite of exemestane in humans, is eliminated via glucuronidation by the polymorphic UGT2B17 phase II drug-metabolizing enzyme. Previous microsomal studies have shown that UGT2B17 gene deletion affects the intrinsic hepatic clearances of 17-hydroexemestane in vitro. In this open-label study we set out to assess the effect of UGT2B17 gene deletion on the pharmacokinetics of 17-hydroexemestane in healthy female volunteers with and without UGT2B17. To achieve this goal, 14 healthy postmenopausal women (8 carriers of the homozygous UGT2B17 wild-type allele and 6 carriers of the homozygous UGT2B17 gene-deletion allele) were enrolled and invited to receive a single 25-mg oral dose of exemestane. Pharmacokinetics was assessed over 72 hours postdosing. Our results showed that there were statistically significant differences in plasma 17-hydroexemestane AUC0-∞ (P = .0007) and urine 17-hydroexemestane C24h (P = .001) between UGT2B17 genotype groups. Our data suggest that UGT2B17 gene deletion influences 17-hydroexemestane pharmacokinetics in humans. PMID:26608382

  13. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  14. Structural organization, expression, and functional characterization of the murine cytomegalovirus immediate-early gene 3.

    PubMed Central

    Messerle, M; Bühler, B; Keil, G M; Koszinowski, U H

    1992-01-01

    We have previously defined ie3 as a coding region located downstream of the ie1 gene which gives rise to a 2.75-kb immediate-early (IE) transcript. Here we describe the structural organization of the ie3 gene, the amino acid sequence of the gene product, and some of the functional properties of the protein. The 2.75-kb ie3 mRNA is generated by splicing and is composed of four exons. The first three exons, of 300, 111, and 191 nucleotides (nt), are shared with the ie1 mRNA and are spliced to exon 5, which is located downstream of the fourth exon used by the ie1 mRNA. Exon 5 starts 28 nt downstream of the 3' end of the ie1 mRNA and has a length of 1,701 nt. The IE3 protein contains 611 amino acids, the first 99 of which are shared with the ie1 product pp89. The IE3 protein expressed at IE times has a relative mobility of 88 kDa in gels, and a mobility shift to 90 kDa during the early phase is indicative of posttranslational modification. Sequence comparison reveals significant homology of the exon 5-encoded amino acid sequence with the respective sequence of UL 122, a component of the IE1-IE2 complex of human cytomegalovirus (HCMV). This homology is also apparent at the functional level. The IE3 protein is a strong transcriptional activator of the murine cytomegalovirus (MCMV) e1 promoter and shows an autoregulatory function by repression of the MCMV ie1/ie3 promoter. The high degree of conservation between the MCMV ie3 and HCMV IE2 genes and their products with regard to gene structure, amino acid sequence, and protein functions suggests that these genes play a comparable role in the transcriptional control of the two cytomegaloviruses. Images PMID:1309246

  15. Mapping memory function in the medial temporal lobe with the immediate-early gene Arc.

    PubMed

    Sauvage, Magdalena M; Nakamura, Nozomu H; Beer, Zachery

    2013-10-01

    For the past two decades an increasing number of studies have underlined the crucial role of the immediate - early gene Arc in plasticity processes thought to sustain memory function. Because of the high spatial and temporal resolution of this technique, the detection of Arc products appears to have become a new standard for the mapping of cognitive processes. To date, most Arc studies have focused on identifying the contribution of the hippocampal subfields CA1 and CA3 to spatial processes. In contrast, few have investigated their role in non-spatial memory, or the role of other medial temporal lobe (MTL) areas in spatial and non-spatial memory. This short review describes recent studies focusing on these issues. After a brief overview of Arc's functions, we report a set of studies that put to the test some well-accepted theories in recognition memory. First, we describe data indicating that the parahippocampal areas may not be strictly segregated into spatial and non-spatial streams, as originally described. Second, we report findings revealing a functional segregation along the dorsoventral axis in CA1, but not in CA3. Finally, we bring evidence for a segregation of CA3 along the proximodistal axis and discuss the involvement of a proximal CA3-distal CA1 network during non-spatial memory. In summary, 'Arc imaging' appears to be a powerful tool to identify neural substrates of cognitive processes, not only in the hippocampus but also in the remaining of the MTL. Moreover, because of its fundamental role in synaptic processes, it offers a rare and exciting opportunity to further bridge plasticity processes and memory function. PMID:23648768

  16. The immediate early gene Egr3 mediates adaptation to stress and novelty

    PubMed Central

    Gallitano-Mendel1, Amelia; Izumi, Yukitoshi; Tokuda, Kazuhiro; Zorumski, Charles F.; Howell, Maureen P.; Muglia, Louis J.; Wozniak, David F.; Milbrandt, Jeffrey

    2007-01-01

    Stress and exploration of novel environments induce neural expression of immediate early gene transcription factors (IEG-TFs). However, as yet no IEG-TF has been shown to be required for the normal biological or behavioral responses to these stimuli. Here we show that mice deficient for the IEG-TF early growth response gene (Egr) 3, display accentuated behavioral responses to the mild stress of handling paralleled by increased release of the stress hormone corticosterone. Egr3−/− mice also display abnormal responses to novelty, including heightened reactivity to novel environments and failure to habituate to social cues or startling acoustic stimuli. In a Y-maze spontaneous alternation task, they perform fewer sequential arm entries than controls, suggesting defects in immediate memory. Because stress and novelty stimulate hippocampal long-term depression (LTD), and because abnormalities in habituation to novelty and Y-maze performance have been associated with LTD deficits, we examined this form of synaptic plasticity in Egr3−/− mice. We found that Egr3−/− mice fail to establish hippocampal LTD in response to low frequency stimulation and exhibit dysfunction of an ifenprodil-sensitive (NR1/NR2B) NMDA receptor subclass. LTP induction was not altered. The NR2B-dependent dysfunction does not result from transcriptional regulation of this subunit by Egr3, because NR2B mRNA levels did not differ in the hippocampi of Egr3−/− and control mice. These findings are the first demonstration of the requirement for an IEG-TF in mediating the response to stress and novelty, and in the establishment of LTD. PMID:17692471

  17. Maturation of coordinated immediate early gene expression by cocaine during adolescence.

    PubMed

    Caster, J M; Kuhn, C M

    2009-04-21

    Adolescence may be a critical period for drug addiction. Young adolescent male rats have greater locomotor responses than adults after acute low dose cocaine administration. Further, repeated cocaine administration produces as much or more conditioned place preference but reduced locomotor sensitization in adolescents compared to adults. Acute activation of neurons by cocaine induces long-term changes in behavior by activating transcriptional complexes. The purpose of the present study was to correlate cocaine-induced locomotor activity with neuronal activation in subregions of the striatum and cortex by acute cocaine in young adolescent (postnatal (PN) 28) and adult (PN 65) male rats by measuring the induction of the plasticity-associated immediate early genes (IEGs) c-fos and zif268 using in situ hybridization. Animals were treated with saline, low (10 mg/kg), or high (40 mg/kg) dose cocaine in locomotor activity chambers and killed 30 min later. Low dose cocaine induced more locomotor activity and striatal c-fos expression in adolescents than adults whereas high dose cocaine induced more locomotor activity, striatal c-fos, and striatal zif268 expression in adults. Locomotor activity correlated with the expression of both genes in adults but correlated with striatal c-fos only in adolescents. Finally, there was a significant correlation between the expression of c-fos and zif268 in the adult striatum but not in adolescents. Our results suggest that the coordinated expression of transcription factors by cocaine continues to develop during adolescence. The immature regulation of transcription factors by cocaine could explain why adolescents show unique sensitivity to specific long-term behavioral alterations following cocaine treatment. PMID:19245875

  18. Impact of UGT2B17 gene deletion on the steroid profile of an athlete.

    PubMed

    Martín-Escudero, Pilar; Muñoz-Guerra, Jesús; Del Prado, Nayade; Galindo Canales, Mercedes; Fuentes Ferrer, Manuel; Vargas, Soledad; Soldevilla, Ana B; Serrano-Garde, Ester; Miguel-Tobal, Francisco; Maestro de Las Casas, Marisa; Fernandez-Pérez, Cristina

    2015-12-01

    The measurement of the testosterone to epitestosterone ratio (T/E ratio) in urine is often used as a marker for testosterone administration in the doping control field. This study examines the frequencies of the different expression forms of the UGT2B17 gene, and assesses their effects on this marker in volunteer subjects. The sample for this descriptive study was composed of male and female athletes aged between 16 and 55 years old who practiced different sports disciplines. All participants underwent a sports-medical physical examination, and subsequently provided 10 urine samples consecutively over a period of 48 h. The dependent variable examined was T/E and the main independent variable was the UGT2B17 gene polymorphism. During 1 year, 1410 urine samples were obtained from 141 athletes. The frequencies of the three genotypes were as follows: wt homozygotes (ins/ins) 48.2% (n = 68), mutant homozygotes (del/del) 12.1% (n = 17), and heterozygotes (ins/del) 39.7% (n = 56). Genotype distributions varied significantly (P < 0.001) according to ethnicity, 80% of Asian subjects being homozygous for the gene deletion (del/del) compared to 6.9% of Caucasian subjects. A multivariate analysis adjusted for genotype, age, sex, and sports discipline revealed that athletes with the del/del polymorphism showed a significantly lower mean T/E than heterozygotes (ins/del). In contrast, homozygous athletes for the gene insertion (ins/ins) showed higher mean T/E ratios than heterozygotes (ins/del). UGT2B17 gene deletion has a strong influence on the T/E ratio in urine, which is the most efficient indicator of testosterone prohormone misuse. Others factors studied seem not to have such an impact. The genotyping of UGT2B17 is an important source of information for understanding steroid profiling in the doping control field; therefore it is suggested that it be included in the Athletes Biological Passport. PMID:26668303

  19. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1

    PubMed Central

    de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean

    2008-01-01

    We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

  20. Protective effect of myostatin gene deletion on aging-related muscle metabolic decline.

    PubMed

    Chabi, B; Pauly, M; Carillon, J; Carnac, G; Favier, F B; Fouret, G; Bonafos, B; Vanterpool, F; Vernus, B; Coudray, C; Feillet-Coudray, C; Bonnieu, A; Lacan, D; Koechlin-Ramonatxo, C

    2016-06-01

    While myostatin gene deletion is a promising therapy to fight muscle loss during aging, this approach induces also skeletal muscle metabolic changes such as mitochondrial deficits, redox alteration and increased fatigability. In the present study, we evaluated the effects of aging on these features in aged wild-type (WT) and mstn knockout (KO) mice. Moreover, to determine whether an enriched-antioxidant diet may be useful to prevent age-related disorders, we orally administered to the two genotypes a melon concentrate rich in superoxide dismutase for 12 weeks. We reported that mitochondrial functional abnormalities persisted (decreased state 3 and 4 of respiration; p<0.05) in skeletal muscle from aged KO mice; however, differences with WT mice were attenuated at old age in line with reduced difference on running endurance between the two genotypes. Interestingly, we showed an increase in glutathione levels, associated with lower lipid peroxidation levels in KO muscle. Enriched antioxidant diet reduced the aging-related negative effects on maximal aerobic velocity and running limit time (p<0.05) in both groups, with systemic adaptations on body weight. The redox status and the hypertrophic phenotype appeared to be beneficial to KO mice, mitigating the effect of aging on the skeletal muscle metabolic remodeling. PMID:26944368

  1. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9.

    PubMed

    Carroll, Kelli J; Makarewich, Catherine A; McAnally, John; Anderson, Douglas M; Zentilin, Lorena; Liu, Ning; Giacca, Mauro; Bassel-Duby, Rhonda; Olson, Eric N

    2016-01-12

    Clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)9 genomic editing has revolutionized the generation of mutant animals by simplifying the creation of null alleles in virtually any organism. However, most current approaches with this method require zygote injection, making it difficult to assess the adult, tissue-specific functions of genes that are widely expressed or which cause embryonic lethality when mutated. Here, we describe the generation of cardiac-specific Cas9 transgenic mice, which express high levels of Cas9 in the heart, but display no overt defects. In proof-of-concept experiments, we used Adeno-Associated Virus 9 (AAV9) to deliver single-guide RNA (sgRNA) that targets the Myh6 locus exclusively in cardiomyocytes. Intraperitoneal injection of postnatal cardiac-Cas9 transgenic mice with AAV9 encoding sgRNA against Myh6 resulted in robust editing of the Myh6 locus. These mice displayed severe cardiomyopathy and loss of cardiac function, with elevation of several markers of heart failure, confirming the effectiveness of this method of adult cardiac gene deletion. Mice with cardiac-specific expression of Cas9 provide a tool that will allow rapid and accurate deletion of genes following a single injection of AAV9-sgRNAs, thereby circumventing embryonic lethality. This method will be useful for disease modeling and provides a means of rapidly editing genes of interest in the heart. PMID:26719419

  2. Underlying Mechanisms of Memory Deficits Induced by Etomidate Anesthesia in Aged Rat Model: Critical Role of Immediate Early Genes

    PubMed Central

    Li, Xu; Lu, Fen; Li, Wei; Xu, Jun; Sun, Xiao-Jing; Qin, Ling-Zhi; Zhang, Qian-Lin; Yao, Yong; Yu, Qing-Kai; Liang, Xin-Liang

    2016-01-01

    Background: Etomidate (R-1-[1-ethylphenyl] imidazole-5-ethyl ester) is a widely used anesthetic drug that had been reported to contribute to cognitive deficits after general surgery. However, its underlying mechanisms have not been fully elucidated. In this study, we aimed to explore the neurobiological mechanisms of cognitive impairments that caused by etomidate. Methods: A total of 30 Sprague-Dawley rats were used and divided into two groups randomly to receive a single injection of etomidate or vehicle. Then, the rats’ spatial memory ability and neuronal survival were evaluated using the Morris water maze test and Nissl staining, respectively. Furthermore, we analyzed levels of oxidative stress, as well as cyclic adenosine 3’,5’-monophosphate response element-binding (CREB) protein phosphorylation and immediate early gene (IEG, including Arc, c-fos, and Egr1) expression levels using Western blot analysis. Results: Compared with vehicle-treated rats, the etomidate-treated rats displayed impaired spatial learning (day 4: 27.26 ± 5.33 s vs. 35.52 ± 3.88 s, t = 2.988, P = 0.0068; day 5: 15.84 ± 4.02 s vs. 30.67 ± 4.23 s, t = 3.013, P = 0.0057; day 6: 9.47 ± 2.35 s vs. 25.66 ± 4.16 s, t = 3.567, P = 0.0036) and memory ability (crossing times: 4.40 ± 1.18 vs. 2.06 ± 0.80, t = 2.896, P = 0.0072; duration: 34.00 ± 4.24 s vs. 18.07 ± 4.79 s, t = 3.023, P = 0.0053; total swimming distance: 40.73 ± 3.45 cm vs. 27.40 ± 6.56 cm, t = 2.798, P = 0.0086) but no neuronal death. Furthermore, etomidate did not cause oxidative stress or deficits in CREB phosphorylation. The levels of multiple IEGs (Arc: vehicle treated rats 100%, etomidate treated rats 86%, t = 2.876, P = 0.0086; c-fos: Vehicle treated rats 100%, etomidate treated rats 72%, t = 2.996, P = 0.0076; Egr1: Vehicle treated rats 100%, etomidate treated rats 58%, t = 3.011, P = 0.0057) were significantly reduced in hippocampi of etomidate-treated rats. Conclusion: Our data suggested that etomidate might

  3. The 6-Aminoquinolone WC5 Inhibits Human Cytomegalovirus Replication at an Early Stage by Interfering with the Transactivating Activity of Viral Immediate-Early 2 Protein ▿ †

    PubMed Central

    Loregian, Arianna; Mercorelli, Beatrice; Muratore, Giulia; Sinigalia, Elisa; Pagni, Silvana; Massari, Serena; Gribaudo, Giorgio; Gatto, Barbara; Palumbo, Manlio; Tabarrini, Oriana; Cecchetti, Violetta; Palù, Giorgio

    2010-01-01

    WC5 is a 6-aminoquinolone that potently inhibits the replication of human cytomegalovirus (HCMV) but has no activity, or significantly less activity, against other herpesviruses. Here we investigated the nature of its specific anti-HCMV activity. Structure-activity relationship studies on a small series of analogues showed that WC5 possesses the most suitable pattern of substitutions around the quinolone scaffold to give potent and selective anti-HCMV activity. Studies performed to identify the possible target of WC5 indicated that it prevents viral DNA synthesis but does not significantly affect DNA polymerase activity. In yield reduction experiments with different multiplicities of infection, the anti-HCMV activity of WC5 appeared to be highly dependent on the viral inoculum, suggesting that WC5 may act at an initial stage of virus replication. Consistently, time-of-addition and time-of-removal studies demonstrated that WC5 affects a phase of the HCMV replicative cycle that precedes viral DNA synthesis. Experiments to monitor the effects of the compound on virus attachment and entry showed that it does not inhibit either process. Evaluation of viral mRNA and protein expression revealed that WC5 targets an event of the HCMV replicative cycle that follows the transcription and translation of immediate-early genes and precedes those of early and late genes. In cell-based assays to test the effects of WC5 on the transactivating activity of the HCMV immediate-early 2 (IE2) protein, WC5 markedly interfered with IE2-mediated transactivation of viral early promoters. Finally, WC5 combined with ganciclovir in checkerboard experiments exhibited highly synergistic activity. These findings suggest that WC5 deserves further investigation as a candidate anti-HCMV drug with a novel mechanism of action. PMID:20194695

  4. Varicella-zoster virus open reading frame 4 encodes an immediate-early protein with posttranscriptional regulatory properties.

    PubMed Central

    Defechereux, P; Debrus, S; Baudoux, L; Rentier, B; Piette, J

    1997-01-01

    Varicella-zoster virus (VZV) encodes four putative immediate-early proteins based on sequence homology with herpes simplex virus type 1: the products of ORF4, -61, -62, and -63. Until now, only two VZV proteins have been described as being truly expressed with immediate-early kinetics (IE62 and IE63). The ORF4-encoded protein can stimulate gene expression either alone or in synergy with the major regulatory protein IE62. Making use of a sequential combination of transcription and protein synthesis inhibitors (actinomycin D and cycloheximide, respectively), we demonstrated the immediate-early nature of the ORF4 gene product, which can thus be named IE4. The fact that IE4 is expressed with kinetics similar to that of IE62 further underlines the possible cooperation between these two VZV proteins in gene expression. Analysis of the IE4-mediated autologous or heterologous viral gene expression at the mRNA levels clearly indicated that IE4 may have several mechanisms of action. Activation of the two VZV genes tested could occur partly by a posttranscriptional mechanism, since increases in chloramphenicol acetyltransferase (CAT) mRNA levels do not account for the stimulation of CAT activity. On the other hand, stimulation of the human immunodeficiency virus type 1 long terminal repeat- or the cytomegalovirus promoter-associated CAT activity is correlated with an increase in the corresponding CAT mRNA. PMID:9261438

  5. Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells.

    PubMed Central

    Chapman, B S; Thayer, R M; Vincent, K A; Haigwood, N L

    1991-01-01

    A 2.4 kb fragment of hCMV (Towne strain), containing the 5' end of the major immediate-early gene, has been cloned, sequenced, and used to construct a series of mammalian cell expression plasmids. The effects of regulatory regions present on this fragment were assessed using human glycoproteins as reporter molecules. We compared secreted levels of Factor VIII, t-PA, and HIV-1 envelope glycoproteins in cells transfected with plasmids in which intron A of the immediate-early gene was present or absent. Secretion of several glycoproteins was significantly higher when cells were transfected with intron A-containing plasmids. Mutation of three basepairs in the strong nuclear factor 1 (NF1) binding site in intron A led to reduced transient expression levels, but not to the level observed in the absence of intron A. Reduced expression from NF1 mutant plasmids was roughly correlated with reduced binding in vitro of NF1 proteins to a synthetic oligonucleotide containing the mutation. The evidence indicates that sequences in intron A positively regulate expression from the hCMV immediate-early enhancer/promoter in transformed monkey kidney cells. Images PMID:1650459

  6. Protein Kinase Cδ Blocks Immediate-Early Gene Expression in Senescent Cells by Inactivating Serum Response Factor

    PubMed Central

    Wheaton, Keith; Riabowol, Karl

    2004-01-01

    Fibroblasts lose the ability to replicate in response to growth factors and become unable to express growth-associated immediate-early genes, including c-fos and egr-1, as they become senescent. The serum response factor (SRF), a major transcriptional activator of immediate-early gene promoters, loses the ability to bind to the serum response element (SRE) and becomes hyperphosphorylated in senescent cells. We identify protein kinase C delta (PKCδ) as the kinase responsible for inactivation of SRF both in vitro and endogenously in senescent cells. This is due to a higher level of PKCδ activity as cells age, production of the PKCδ catalytic fragment, and its nuclear localization in senescent but not in low-passage-number cells. The phosphorylation of T160 of SRF by PKCδ in vitro and in vivo led to loss of SRF DNA binding activity. Both the PKCδ inhibitor rottlerin and ectopic expression of a dominant negative form of PKCδ independently restored SRE-dependent transcription and immediate-early gene expression in senescent cells. Modulation of PKCδ activity in vivo with rottlerin or bistratene A altered senescent- and young-cell morphology, respectively. These observations support the idea that the coordinate transcriptional inhibition of several growth-associated genes by PKCδ contributes to the senescent phenotype. PMID:15282327

  7. Gene Deletion by Fluorescence-Reported Allelic Exchange Mutagenesis in Chlamydia trachomatis

    PubMed Central

    Mueller, Konrad E.; Wolf, Katerina

    2016-01-01

    ABSTRACT Although progress in Chlamydia genetics has been rapid, genomic modification has previously been limited to point mutations and group II intron insertions which truncate protein products. The bacterium has thus far been intractable to gene deletion or more-complex genomic integrations such as allelic exchange. Herein, we present a novel suicide vector dependent on inducible expression of a chlamydial gene that renders Chlamydia trachomatis fully genetically tractable and permits rapid reverse genetics by fluorescence-reported allelic exchange mutagenesis (FRAEM). We describe the first available system of targeting chlamydial genes for deletion or allelic exchange as well as curing plasmids from C. trachomatis serovar L2. Furthermore, this approach permits the monitoring of mutagenesis by fluorescence microscopy without disturbing bacterial growth, a significant asset when manipulating obligate intracellular organisms. As proof of principle, trpA was successfully deleted and replaced with a sequence encoding both green fluorescent protein (GFP) and β-lactamase. The trpA-deficient strain was unable to grow in indole-containing medium, and this phenotype was reversed by complementation with trpA expressed in trans. To assess reproducibility at alternate sites, FRAEM was repeated for genes encoding type III secretion effectors CTL0063, CTL0064, and CTL0065. In all four cases, stable mutants were recovered one passage after the observation of transformants, and allelic exchange was limited to the specific target gene, as confirmed by whole-genome sequencing. Deleted sequences were not detected by quantitative real-time PCR (qPCR) from isogenic mutant populations. We demonstrate that utilization of the chlamydial suicide vector with FRAEM renders C. trachomatis highly amenable to versatile and efficient genetic manipulation. PMID:26787828

  8. TRPV1 gene deletion exacerbates inflammation and atypical cardiac remodeling after myocardial infarction

    PubMed Central

    Huang, Wei; Rubinstein, Jack; Prieto, Alejandro R.; Thang, Loc Vinh; Wang, Donna H.

    2009-01-01

    The transient receptor potential vanilloid (TRPV1) channels expressed in sensory afferent fibers innervating the heart may be activated by proton or endovanilloids released during myocardial ischemia (MI), leading to angina. Although our previous in vitro data indicate that TRPV1 activation may preserve cardiac function after ischemia-reperfusion (I/R) injury, the underlying mechanisms are largely unknown. To test the hypothesis that TRPV1 modulates inflammatory and early remodeling processes to prevent cardiac functional deterioration after myocardial infarction, TRPV1-null mutant (TRPV1-/-) and wild-type (WT) mice were subjected to left anterior descending coronary ligation or sham operation. The infarct size was greater in TRPV1-/- than in WT mice (P < 0.001) 3 days after MI, and the mortality rate was higher in TRPV1-/- than in WT mice (P < 0.05) 7 days after MI. The levels of plasma cardiac troponin I; cytokines including TNF-α, IL-1β, and IL-6; chemokines including MCP-1 and MIP-2; infiltration of inflammatory cells including neutrophil, macrophage, and myofibroblast; as well as collagen contents were greater in TRPV1-/- than in WT mice (P < 0.05) in the infarct area on day 3 and 7 after MI. Changes in left ventricular (LV) geometry led to increased end-systolic and -diastolic diameters and reduced contractile function in TRPV1-/- compared to WT mice. These data show that TRPV1 gene deletion results in excessive inflammation, disproportional LV remodeling, and deteriorated cardiac function after MI, indicating that TRPV1 may prevent infarct expansion and cardiac injury by inhibiting inflammation and abnormal tissue remodeling. PMID:19114647

  9. Gene Deletion of nos2 Protects Against Manganese-Induced Neurological Dysfunction in Juvenile Mice

    PubMed Central

    Streifel, Karin M.; Moreno, Julie A.; Hanneman, William H.; Legare, Marie E.; Tjalkens, Ronald B.

    2012-01-01

    The mechanisms underlying cognitive and neurobehavioral abnormalities associated with childhood exposure to manganese (Mn) are not well understood but may be influenced by neuroinflammatory activation of microglia and astrocytes that results in nitrosative stress due to expression of inducible nitric oxide synthase (iNOS/NOS2). We therefore postulated that gene deletion of NOS2 would protect against the neurotoxic effects of Mn in vivo and in vitro. Juvenile NOS2 knockout (NOS2−/−) mice were orally exposed to 50 mg/kg of MnCl2 by intragastric gavage from days 21 to 34 postnatal. Results indicate that NOS2−/− mice exposed to Mn were protected against neurobehavioral alterations, despite histopathological activation of astrocytes and microglia in Mn-treated mice in both genotypes. NOS2−/− mice had decreased Mn-induced formation of 3-nitrotyrosine protein adducts within neurons in the basal ganglia that correlated with protection against Mn-induced neurobehavioral defects. Primary striatal astrocytes from wildtype mice caused apoptosis in cocultured striatal neurons following treatment with MnCl2 and tumor necrosis factor-α, whereas NOS2−/− astrocytes failed to cause any increase in markers of apoptosis in striatal neurons. Additionally, scavenging nitric oxide (NO) with 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (PTIO) prevented the ability of Mn- and cytokine-treated wildtype astrocytes to cause apoptosis in cocultured striatal neurons. These data demonstrate that NO plays a crucial role in Mn-induced neurological dysfunction in juvenile mice and that NOS2 expression in activated glia is an important mediator of neuroinflammatory injury during Mn exposure. PMID:22174044

  10. OMP gene deletion results in an alteration in odorant-induced mucosal activity patterns.

    PubMed

    Youngentob, S L; Kent, P F; Margolis, F L

    2003-12-01

    Previous behavioral work, using a complex five-odorant identification task, demonstrated that olfactory marker protein (OMP) is critically involved in odor processing to the extent that its loss results in an alteration in odorant quality perception. Exactly how the lack of OMP exerts its influence on the perception of odorant quality is unknown. However, there is considerable neurophysiological evidence that different odorants produce different spatiotemporal patterns of neural activity at the level of the mucosa and that these patterns predict the psychophysically determined perceptual relationship among odorants. In this respect, OMP gene deletion is known to result in a constellation of physiologic defects (i.e., marked reduction in the electroolfactogram (EOG) and altered response and recovery kinetics) that would be expected to alter the odorant-induced spatiotemporal activity patterns that are characteristic of different odorants. This, in turn, would be expected to alter the spatiotemporal patterning of information that results from the mucosal projection onto the bulb, thereby changing odorant quality perception. To test the hypothesis that odorant-induced mucosal activity patterns are altered in mice lacking the gene for OMP, we optically recorded the fluorescent changes in response to odorant stimulation from both the septum and turbinates of both OMP-null and control mice using a voltage-sensitive dye (di-4-ANEPPS Molecular Probes, Eugene, OR) and a Dalsa 120 x 120, 12-bit CCD camera. To maintain continuity with the previous behavioral work, the odorants 2-propanol, citral, carvone, ethylacetoacetate, and propyl acetate were again used. Each odorant was randomly presented to each mucosal surface in a Latin-Square design. The results of this study demonstrated that, for both mouse strains, there do indeed exist different spatiotemporal activity patterns for different odorants. More importantly, however, these patterns significantly differed between OMP

  11. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  12. Construction of Recombinant Mouse IgG1 Antibody Directed Against Varicella Zoster Virus Immediate Early Protein 63

    PubMed Central

    MUELLER, NIKLAUS H.; GRAF, LAURIE L.; SHEARER, ANDREW J.; OWENS, GREGORY P.; GILDEN, DONALD H.; COHRS, RANDALL J.

    2010-01-01

    Five varicella zoster virus (VZV) genes are known to be transcribed in latently infected human ganglia. Transcripts from VZV gene 63, which encodes an immediate early (IE) protein, are the most prevalent and abundant. To obtain a reagent that might facilitate studies of the role of the IE63 protein in latency and reactivation, we selected an IE63-specific Fab fragment from a phage library and used it to prepare a recombinant mouse IgG1 antibody that detects IE63 and functions in Western blot, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), and immunofluorescence assays. PMID:18294070

  13. Identification and characterization of an Egr ortholog as a neural immediate early gene in the European honeybee (Apis mellifera L.).

    PubMed

    Ugajin, Atsushi; Kunieda, Takekazu; Kubo, Takeo

    2013-10-01

    To date, there are only few reports of immediate early genes (IEGs) available in insects. Aiming at identifying a conserved IEG in insects, we characterized an Egr homolog of the honeybee (AmEgr: Apis mellifera Egr). AmEgr was transiently induced in whole worker brains after seizure induction. In situ hybridization for AmEgr indicated that neural activity of a certain mushroom body (a higher brain center) neuron subtype, which is the same as that we previously identified using another non-coding IEG, termed kakusei, is more enhanced in forager brains. These findings suggest that Egr can be utilized as an IEG in insects. PMID:23994532

  14. PYRETHROID INDUCED ALTERATIONS IN TRANSCRIPTION OF CALCIUM RESPONSIVE AND IMMEDIATE EARLY GENES IN VIVO.

    EPA Science Inventory

    Multiple molecular targets for pyrethroid insecticides have been evaluated in in vitro preparations, including but not limited to voltage-sensitive sodium channels (VSSCs), voltage-sensitive calcium channels (VSCCs), GABAergic receptors, ATPases and mitochondrial respiratory chai...

  15. The superantigen-homologous viral immediate-early gene ie14/vsag in herpesvirus saimiri-transformed human T cells.

    PubMed Central

    Knappe, A; Hiller, C; Thurau, M; Wittmann, S; Hofmann, H; Fleckenstein, B; Fickenscher, H

    1997-01-01

    Herpesvirus saimiri C488 transforms human T lymphocytes to stable growth in culture. The growth-transformed human T cells harbor the viral genome in a nonintegrated episomal form without production of virus particles. In these cells, virus gene expression was previously found to be confined to the transforming genes stpC and tip. In order to analyze virus gene expression in more detail, we applied a subtractive hybridization technique and compared stimulated virus-transformed cells with uninfected parental T cells of the same donor. A number of known T-cell activation genes were isolated. Viral stpC/tip cDNAs were enriched after subtraction. In addition, the viral immediate-early, superantigen-homologous gene ie14/vsag was represented by numerous cDNA clones that comprised the entire spliced transcript. Whereas a weak basal expression of ie14/vsag was detected by reverse transcription-PCR only, the phorbol ester-induced transcripts were readily shown by Northern blotting. ie14/vsag, which before had been classified as a major immediate-early gene of herpesvirus saimiri, is localized within a highly conserved region with extensive homologies to the cellular genome. Mutant viruses without the ie14/vsag gene are replication competent and fully capable of transforming human and marmoset T cells. Since ie14/vsag is transiently expressed after stimulation, it may increase T-cell proliferation in an activation-dependent and superantigen-like but apparently Vbeta-independent way. PMID:9371569

  16. The Immediate Early Gene Product EGR1 and Polycomb Group Proteins Interact in Epigenetic Programming during Chondrogenesis

    PubMed Central

    Caron, Marjolein M. J.; Prickaerts, Peggy; Rofel, Celine; Dahlmans, Vivian E. H.; Surtel, Don A. M.; Paulis, Yvette; Schweizer, Finja; Welting, Tim J. M.; Eijssen, Lars M.; Voncken, Jan Willem

    2013-01-01

    Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3) blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis. PMID:23483971

  17. An Adenovirus Type 5 Mutant with the Preterminal Protein Gene Deleted Efficiently Provides Helper Functions for the Production of Recombinant Adeno-Associated Virus

    PubMed Central

    Maxwell, Ian H.; Maxwell, Francoise; Schaack, Jerome

    1998-01-01

    Production of recombinant adeno-associated virus (rAAV) requires helper functions that have routinely been provided by infection of the producer cells with adenovirus. Complete removal and/or inactivation of progeny adenovirus, present in such rAAV preparations, presents significant difficulty. Here, we report that an adenovirus type 5 (Ad5) mutant with the preterminal protein (pTP) gene deleted can provide helper function for the growth of rAAV. At high multiplicity, Ad5dl308ΔpTP was as efficient as the phenotypically wild-type Ad5dl309 in permitting growth of rAAV. Use of Ad5dl308ΔpTP, which is incapable of replication in the absence of complementation for pTP, as a helper avoids the need to remove contaminating adenovirus infectious activity by heat inactivation or by purification. Comparison of the transducing ability of rAAV generated with either Ad5dl308ΔpTP or Ad5dl309 as a helper demonstrated that the heat inactivation protocol generally used does not remove all of the helper Ad5dl309 function. PMID:9733887

  18. Diverse fission yeast genes required for responding to oxidative and metal stress: Comparative analysis of glutathione-related and other defense gene deletions.

    PubMed

    Pluskal, Tomáš; Sajiki, Kenichi; Becker, Joanne; Takeda, Kojiro; Yanagida, Mitsuhiro

    2016-06-01

    Living organisms have evolved multiple sophisticated mechanisms to deal with reactive oxygen species. We constructed a collection of twelve single-gene deletion strains of the fission yeast Schizosaccharomyces pombe designed for the study of oxidative and heavy metal stress responses. This collection contains deletions of biosynthetic enzymes of glutathione (Δgcs1 and Δgsa1), phytochelatin (Δpcs2), ubiquinone (Δabc1) and ergothioneine (Δegt1), as well as catalase (Δctt1), thioredoxins (Δtrx1 and Δtrx2), Cu/Zn- and Mn- superoxide dismutases (SODs; Δsod1 and Δsod2), sulfiredoxin (Δsrx1) and sulfide-quinone oxidoreductase (Δhmt2). First, we employed metabolomic analysis to examine the mutants of the glutathione biosynthetic pathway. We found that ophthalmic acid was produced by the same enzymes as glutathione in S. pombe. The identical genetic background of the strains allowed us to assess the severity of the individual gene knockouts by treating the deletion strains with oxidative agents. Among other results, we found that glutathione deletion strains were not particularly sensitive to peroxide or superoxide, but highly sensitive to cadmium stress. Our results show the astonishing diversity in cellular adaptation mechanisms to various types of oxidative and metal stress and provide a useful tool for further research into stress responses. PMID:27005325

  19. THOC5 controls 3′end-processing of immediate early genes via interaction with polyadenylation specific factor 100 (CPSF100)

    PubMed Central

    Tran, Doan Duy Hai; Saran, Shashank; Williamson, Andrew J.K.; Pierce, Andrew; Dittrich-Breiholz, Oliver; Wiehlmann, Lutz; Koch, Alexandra; Whetton, Anthony D.; Tamura, Teruko

    2014-01-01

    Transcription of immediate early genes (IEGs) in response to extrinsic and intrinsic signals is tightly regulated at multiple stages. It is known that untranslated regions of the RNA can play a role in these processes. Here we show that THOC5, a member of the TREX (transcription/export) complex, plays a role in expression of only a subset of constitutively active genes, however transcriptome analysis reveals that more than 90% of IEG were not induced by serum in THOC5 depleted cells. Furthermore, THOC5 depletion does not influence the expression of the most rapidly induced IEGs, e.g. Fos and Jun. One group of THOC5 target genes, including Id1, Id3 and Wnt11 transcripts, were not released from chromatin in THOC5 depleted cells. Genes in another group, including Myc and Smad7 transcripts, were released with shortening of 3′UTR by alternative cleavage, and were spliced but export was impaired in THOC5 depleted cells. By interactome analysis using THOC5 as bait, we show that upon stimulation with serum THOC5 forms a complex with polyadenylation-specific factor 100 (CPSF100). THOC5 is required for recruitment of CPSF100 to 3′UTR of THOC5 target genes. These data suggest the presence of a novel mechanism for the control of IEG response by THOC5 via 3′end-processing. PMID:25274738

  20. Improving freeze-tolerance of baker's yeast through seamless gene deletion of NTH1 and PUT1.

    PubMed

    Dong, Jian; Chen, Didi; Wang, Guanglu; Zhang, Cuiying; Du, Liping; Liu, Shanshan; Zhao, Yu; Xiao, Dongguang

    2016-06-01

    Baker's yeast strains with freeze-tolerance are highly desirable to maintain high leavening ability after freezing. Enhanced intracellular concentration of trehalose and proline in yeast is linked with freeze-tolerance. In this study, we constructed baker's yeast with enhanced freeze-tolerance by simultaneous deletion of the neutral trehalase-encoded gene NTH1 and the proline oxidase-encoded gene PUT1. We first used the two-step integration-based seamless gene deletion method to separately delete NTH1 and PUT1 in haploid yeast. Subsequently, through two rounds of hybridization and sporulation-based allelic exchange and colony PCR-mediated tetrad analysis, we obtained strains with restored URA3 and deletion of NTH1 and/or PUT1. The resulting strain showed higher cell survival and dough-leavening ability after freezing compared to the wild-type strain due to enhanced accumulation of trehalose and/or proline. Moreover, mutant with simultaneous deletion of NTH1 and PUT1 exhibits the highest relative dough-leavening ability after freezing compared to mutants with single-gene deletion perhaps due to elevated levels of both trehalose and proline. These results verified that it is applicable to construct frozen dough baker's yeast using the method proposed in this paper. PMID:26965428

  1. Robust Parameter Identification to Perform the Modeling of pta and poxB Genes Deletion Effect on Escherichia Coli.

    PubMed

    Guerrero-Torres, V; Rios-Lozano, M; Badillo-Corona, J A; Chairez, I; Garibay-Orijel, C

    2016-08-01

    The aim of this study was to design a robust parameter identification algorithm to characterize the effect of gene deletion on Escherichia coli (E. coli) MG1655. Two genes (pta and poxB) in the competitive pathways were deleted from this microorganism to inhibit pyruvate consumption. This condition deviated the E. coli metabolism toward the Krebs cycle. As a consequence, the biomass, substrate (glucose), lactic, and acetate acids as well as ethanol concentrations were modified. A hybrid model was proposed to consider the effect of gene deletion on the metabolism of E. coli. The model parameters were estimated by the application of a least mean square method based on the instrument variable technique. To evaluate the parametric identifier method, a set of robust exact differentiators, based on the super-twisting algorithm, was implemented. The hybrid model was successfully characterized by the parameters obtained from experimental information of E. coli MG1655. The significant difference between parameters obtained with wild-type strain and the modified (with deleted genes) justifies the application of the parametric identification algorithm. This characterization can be used to optimize the production of different byproducts of commercial interest. PMID:27093969

  2. Glycosylation defects and virulence phenotypes of Leishmania mexicana phosphomannomutase and dolicholphosphate-mannose synthase gene deletion mutants.

    PubMed

    Garami, A; Mehlert, A; Ilg, T

    2001-12-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophosphoglycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glycoinositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana the gene encoding the enzyme phosphomannomutase (PMM) and the previously described dolicholphosphate-Man synthase gene (DPMS) that are involved in Man activation. Surprisingly, gene deletion experiments resulted in viable parasite lines lacking the respective open reading frames (DeltaPMM and DeltaDPMS), a result against expectation and in contrast to the lethal phenotype observed in gene deletion experiments with fungi. L. mexicana DeltaDPMS exhibits a selective defect in LPG, protein GPI anchor, and GIPL biosynthesis, but despite the absence of these structures, which have been implicated in parasite virulence and viability, the mutant remains infectious to macrophages and mice. By contrast, L. mexicana DeltaPMM are largely devoid of all known Man-containing glycoconjugates and are unable to establish an infection in mouse macrophages or the living animal. Our results define Man activation leading to GDP-Man as a virulence pathway in Leishmania. PMID:11689705

  3. A requirement for the immediate early gene Zif268 in the expression of late LTP and long-term memories.

    PubMed

    Jones, M W; Errington, M L; French, P J; Fine, A; Bliss, T V; Garel, S; Charnay, P; Bozon, B; Laroche, S; Davis, S

    2001-03-01

    The induction of long-term potentiation (LTP) in the dentate gyrus of the hippocampus is associated with a rapid and robust transcription of the immediate early gene Zif268. We used a mutant mouse with a targeted disruption of Zif268 to ask whether this gene, which encodes a zinc finger transcription factor, is required for the maintenance of late LTP and for the expression of long-term memory. We show that whereas mutant mice exhibit early LTP in the dentate gyrus, late LTP is absent when measured 24 and 48 hours after tetanus in the freely moving animal. In both spatial and non-spatial learning tasks, short-term memory remained intact, whereas performance was impaired in tests requiring long-term memory. Thus, Zif268 is essential for the transition from short- to long-term synaptic plasticity and for the expression of long-term memories. PMID:11224546

  4. Pattern of cerebrospinal immediate early gene c-fos expression in an ovine model of non-accidental head injury.

    PubMed

    Finnie, J W; Blumbergs, P C; Manavis, J; Vink, R

    2013-12-01

    Expression of the immediate early gene, c-fos, was examined in a large animal model of non-accidental head injury ("shaken baby syndrome"). Lambs were used because they have a relatively large gyrencephalic brain and weak neck muscles resembling a human infant. Neonatal lambs were manually shaken in a manner similar to that believed to occur with most abused human infants, but there was no head impact. The most striking c-fos expression was in meningothelial cells of the cranial cervical spinal cord and, to a lesser degree, in hemispheric, cerebellar, and brainstem meninges. Vascular endothelial cells also frequently showed c-fos immunopositivity in the meninges and hemispheric white matter. It was hypothesised that this c-fos immunoreactivity was due to mechanical stress induced by shaking, with differential movement of different craniospinal components. PMID:24035422

  5. Characterization of a Replication-Incompetent Pseudorabies Virus Mutant Lacking the Sole Immediate Early Gene IE180

    PubMed Central

    Wu, Brendan W.

    2014-01-01

    ABSTRACT The alphaherpesvirus pseudorabies virus (PRV) encodes a single immediate early gene called IE180. The IE180 protein is a potent transcriptional activator of viral genes involved in DNA replication and RNA transcription. A PRV mutant with both copies of IE180 deleted was constructed 20 years ago (S. Yamada and M. Shimizu, Virology 199:366–375, 1994, doi:10.1006/viro.1994.1134), but propagation of the mutant depended on complementing cell lines that expressed the toxic IE180 protein constitutively. Recently, Oyibo et al. constructed a novel set of PRV IE180 mutants and a stable cell line with inducible IE180 expression (H. Oyibo, P. Znamenskiy, H. V. Oviedo, L. W. Enquist, A. Zador, Front. Neuroanat. 8:86, 2014, doi:10.3389/fnana.2014.00086), which we characterized further here. These mutants failed to replicate new viral genomes, synthesize immediate early, early, or late viral proteins, and assemble infectious virions. The PRV IE180-null mutant did not form plaques in epithelial cell monolayers and could not spread from primary infected neurons to second-order neurons in culture. PRV IE180-null mutants lacked the property of superinfection exclusion. When PRV IE180-null mutants infected cells first, subsequent superinfecting viruses were not blocked in cell entry and formed replication compartments in epithelial cells, fibroblasts, and neurons. Cells infected with PRV IE180-null mutants survived as long as uninfected cells in culture while expressing a fluorescent reporter gene. Transcomplementation with IE180 in epithelial cells restored all mutant phenotypes to wild type. The conditional expression of PRV IE180 protein enables the propagation of replication-incompetent PRV IE180-null mutants and will facilitate construction of long-term single-cell-infecting PRV mutants for precise neural circuit tracing and high-capacity gene delivery vectors. PMID:25389174

  6. Heterologous protection in pigs induced by a plasmid-cured and crp gene-deleted Salmonella choleraesuis live vaccine.

    PubMed

    Chu, Chun-Yen; Wang, Shiang-Yiu; Chen, Zeng-Weng; Chien, Maw-Sheng; Huang, Ji-Ping; Chen, Jen-Jin; Hong, Li-Shian; Shiau, Ai-Li; Tsai, Jeng-Liang; Wu, Chao-Liang

    2007-10-10

    In this study, we exploited a crp (cAMP receptor protein) gene-deleted, virulence plasmid-cured Salmonella choleraesuis mutant with decreased carbon source utilization, designated S.C.-Deltacrp/vpl(-), as a live vaccine strain. Normal weight gain with no clinical signs was observed in pigs immunized with high doses of S.C.-Deltacrp/vpl(-) live vaccine. Vaccination in pregnant sows induced high maternal antibodies, which could prevent piglets from Salmonella infection. Moreover, serial transmission of the vaccine strain in piglets produced no evidence of reversion to virulence. Furthermore, the peripheral blood mononuclear cells from immunized piglets also developed Salmonella specific T-cell proliferative response in vitro. Our results indicate that immunogenic antigens in S.C.-Deltacrp/vpl(-) can induce adequate immunity to protect pigs against challenge with a heterologous virulent strain. Thus, this mutant holds promise for the development of a new live S. choleraesuis vaccine. PMID:17825957

  7. Time Course of Immediate Early Gene Protein Expression in the Spinal Cord following Conditioning Stimulation of the Sciatic Nerve in Rats

    PubMed Central

    Bojovic, Ognjen; Panja, Debabrata; Bittins, Margarethe; Bramham, Clive R.; Tjølsen, Arne

    2015-01-01

    Long-term potentiation induced by conditioning electrical stimulation of afferent fibers is a widely studied form of synaptic plasticity in the brain and the spinal cord. In the spinal cord dorsal horn, long-term potentiation is induced by a series of high-frequency trains applied to primary afferent fibers. Conditioning stimulation (CS) of sciatic nerve primary afferent fibers also induces expression of immediate early gene proteins in the lumbar spinal cord. However, the time course of immediate early gene expression and the rostral-caudal distribution of expression in the spinal cord have not been systematically studied. Here, we examined the effects of sciatic nerve conditioning stimulation (10 stimulus trains, 0.5 ms stimuli, 7.2 mA, 100 Hz, train duration 2 s, 8 s intervals between trains) on cellular expression of immediate early genes, Arc, c-Fos and Zif268, in anesthetized rats. Immunohistochemical analysis was performed on sagittal sections obtained from Th13- L5 segments of the spinal cord at 1, 2, 3, 6 and 12 h post-CS. Strikingly, all immediate early genes exhibited a monophasic increase in expression with peak increases detected in dorsal horn neurons at 2 hours post-CS. Regional analysis showed peak increases at the location between the L3 and L4 spinal segments. Both Arc, c-Fos and Zif268 remained significantly elevated at 2 hours, followed by a sharp decrease in immediate early gene expression between 2 and 3 hours post-CS. Colocalization analysis performed at 2 hours post-CS showed that all c-Fos and Zif268 neurons were positive for Arc, while 30% and 43% of Arc positive neurons were positive for c-Fos and Zif268, respectively. The present study identifies the spinal cord level and time course of immediate early gene (IEGP) expression of relevance for analysis of IEGPs function in neuronal plasticity and nociception. PMID:25860146

  8. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis.

    PubMed

    Kubík, Stěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena - Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  9. Herpes simplex virus type 1 ICP0 regulates expression of immediate-early, early, and late genes in productively infected cells.

    PubMed Central

    Cai, W; Schaffer, P A

    1992-01-01

    The herpes simplex virus type 1 protein, ICP0, can activate expression of all kinetic classes of viral promoters in transient expression assays. To examine the role of ICP0 in the regulation of viral gene expression during productive infection, we characterized the wild-type virus, an ICP0 null mutant (7134), and several ICP0 nonsense mutant viruses with regard to virus replication and protein synthesis in Vero cells. Relative to wild-type virus, 7134 was severely deficient in viral growth and protein synthesis at low multiplicities of infection but exhibited a nearly wild-type phenotype at high multiplicities. The phenotypes of the ICP0 nonsense mutants were intermediate between those of the wild-type virus and 7134 in that the more ICP0-coding sequence expressed by a given nonsense mutant, the more wild type-like was its phenotype. The location of the ICP0 domain responsible for transactivation during productive infection was confirmed to be within the N-terminal portion of the protein, as previously shown in transient expression assays. Immunoprecipitation and immunofluorescence tests were used to detect low-level expression of selected immediate-early (IE), early (E), and late (L) proteins by mutant and wild-type viruses following low-multiplicity infection. The 7134 deletion mutant and several nonsense mutants expressed markedly reduced levels of E and L proteins but wild-type levels of the IE protein, ICP4. Because the latency-associated transcripts (LATs) are specified by the strand opposite that which encodes ICP0, the ICP0 deletion and nonsense mutants are by definition ICP0-LAT double mutants. The ability of a LAT- ICP0+ mutant to replicate as efficiently as wild-type virus at low multiplicities and the ability of ICP0-expressing 0-28 cells to complement the defects of the mutants in E and L protein synthesis indicates that the phenotypes of the mutants are caused by mutations in ICP0 and not the LATs. Thus, we conclude that ICP0 up-regulates E and L but

  10. Activation of immediate-early response gene c-Fos protein in the rat paralimbic cortices after myocardial infarction

    PubMed Central

    Ahn, Ji Yun; Tae, Hyun-Jin; Cho, Jeong-Hwi; Kim, In Hye; Ahn, Ji Hyeon; Park, Joon Ha; Kim, Dong Won; Cho, Jun Hwi; Won, Moo-Ho; Hong, Seongkweon; Lee, Jae-Chul; Seo, Jeong Yeol

    2015-01-01

    c-Fos is a good biological marker for detecting the pathogenesis of central nervous system disorders. Few studies are reported on the change in myocardial infarction-induced c-Fos expression in the paralimbic regions. Thus, in this study, we investigated the changes in c-Fos expression in the rat cingulate and piriform cortices after myocardial infarction. Neuronal degeneration in cingulate and piriform cortices after myocardial infarction was detected using cresyl violet staining, NeuN immunohistochemistry and Fluoro-Jade B histofluorescence staining. c-Fos-immunoreactive cells were observed in cingulate and piriform cortices at 3 days after myocardial infarction and peaked at 7 and 14 days after myocardial infarction. But they were hardly observed at 56 days after myocardial infarction. The chronological change of c-Fos expression determined by western blot analysis was basically the same as that of c-Fos immunoreactivity. These results indicate that myocardial infarction can cause the chronological change of immediate-early response gene c-Fos protein expression, which might be associated with the neural activity induced by myocardial infarction. PMID:26487852

  11. Calcium-dependent immediate-early gene induction in lymphocytes is negatively regulated by p21Ha-ras.

    PubMed Central

    Chen, C Y; Forman, L W; Faller, D V

    1996-01-01

    The induction of immediate-early (IE) response genes, such as egr-1, c-fos, and c-jun, occurs rapidly after the activation of T lymphocytes. The process of activation involves calcium mobilization, activation of protein kinase C (PKC), and phosphorylation of tyrosine kinases. p21(ras), a guanine nucleotide binding factor, mediates T-cell signal transduction through PKC-dependent and PKC-independent pathways. The involvement of p21(ras) in the regulation of calcium-dependent signals has been suggested through analysis of its role in the activation of NF-AT. We have investigated the inductions of the IE genes in response to calcium signals in Jurkat cells (in the presence of activated p21(ras)) and their correlated consequences. The expression of activated p21(ras) negatively regulated the induction of IE genes by calcium ionophore. This inhibition of calcium-activated IE gene induction was reversed by treatment with cyclosporin A, suggesting the involvement of calcineurin in this regulation. A later result of inhibition of this activation pathway by p21(ras) was down-regulation of the activity of the transcription factor AP-1 and subsequent coordinate reductions in IL-2 gene expression and protein production. These results suggest that p2l(ras) is an essential mediator in generating not only positive but also negative modulatory mechanisms controlling the competence of T cells in response to inductive stimulations. PMID:8887687

  12. Changes in neurotransmitter levels and expression of immediate early genes in brain of mice infected with Neospora caninum

    PubMed Central

    Ihara, Fumiaki; Nishimura, Maki; Muroi, Yoshikage; Furuoka, Hidefumi; Yokoyama, Naoaki; Nishikawa, Yoshifumi

    2016-01-01

    Neospora caninum is an obligate intracellular parasite that causes neurological disorders in dogs and cattle. The majority of host animals are asymptomatic at the chronic stage of infection. However, it remains unclear whether cerebral function is normal in asymptomatic animals. In this study, mice were infected with N. caninum (strain Nc-1) and their brains were examined to understand changes in cerebral function at the chronic stage of infection. Mice infected with N. caninum showed impaired locomotor activity, but no differences in clinical symptoms were observed. In the brains of infected mice, parasites were distributed throughout the brain and histological lesions were observed everywhere except for the cerebellum. Expression levels of proinflammatory cytokines, interferon-gamma and tumour necrosis factor-alpha, were highly upregulated in several brain regions of infected mice. Additionally, the level of neurotransmitters glutamate, glycine, gamma-aminobutyric acid, dopamine and 5-hydroxytryptamine, were altered in infected mice compared with those of uninfected mice. Interestingly, the expression levels of immediately early genes, c-Fos and Arc, in the brain of infected mice were lower than those of in uninfected mice. Our findings may provide insight into neurological disorders associated with N. caninum infection. PMID:26971577

  13. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    SciTech Connect

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang . E-mail: gracelow@ntu.edu.tw

    2005-04-10

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter.

  14. Investigation of the dynamics of the viral immediate-early protein 1 in different conformations and oligomerization states.

    PubMed

    Stump, Joachim D; Sticht, Heinrich

    2016-05-01

    The viral immediate-early protein 1 (IE1) is crucial for efficient replication of cytomegalovirus (CMV). A recent crystal structure of the IE1 protein from rhesus CMV revealed that the protein exhibits a novel fold and crystallizes in two slightly different dimeric arrangements. Molecular dynamics simulations and energetic analyses performed in this study show that both dimers are stable and allowed us to identify a common set of five residues that appear particularly important for dimer formation. These residues are distributed over the entire dimer interface and do not form a typical hot spot for protein interactions. In addition, the dimer interface of IE1 proved to include a high portion of hydrophilic interactions pointing toward the transient nature of dimer formation. Characterization of monomeric and dimeric IE1 revealed three sequentially discontinuous dynamic domains that exhibit correlated motion within the domain and are simultaneously anti-correlated to the adjacent domains. The hinge motions observed between the dynamic domains increase the shape complementarity to the coiled-coil region of tripartite motif proteins, suggesting that the detected dynamics of IE1 might be physiologically important by enabling a better interaction with its cellular target molecules. PMID:26104474

  15. How necessary is the activation of the immediate early gene zif268 in synaptic plasticity and learning?

    PubMed

    Davis, Sabrina; Bozon, Bruno; Laroche, Serge

    2003-06-16

    The immediate early genes (IEGs) are activated rapidly and transiently in response to a multitude of stimuli. The zif268 belongs to a category of regulatory IEGs that activate downstream target genes and is considered to be a triggering mechanism to activate the genomic response in neurons. Several studies have shown that zif268 mRNA is upregulated during different forms of associative learning, and following tetanic stimulation that induces long-lasting LTP. To date, there is a general consensus that zif268 activation may constitute a critical mechanism for the encoding of long-lasting memories, however this is based on relatively few studies. Given the fact that zif268 can be activated by a number of different types of stimuli, it becomes important to determine exactly how it may be implicated in memory. Examination of the current literature suggests that zif268 is necessary in the processing of several types of memory, however, it is not entirely clear what aspects of memory zif268 may be implicated in. Here, we review the existing literature and emphasise that understanding the signalling pathways that lead to activation of the IEGs and the downstream targets of these genes will advance our understanding of how functional activation of zif268 may be implicated in processing long-term memories. PMID:12798262

  16. Decreased approach behavior and nucleus accumbens immediate early gene expression in response to Parkinsonian ultrasonic vocalizations in rats.

    PubMed

    Pultorak, Joshua D; Kelm-Nelson, Cynthia A; Holt, Lauren R; Blue, Katherine V; Ciucci, Michelle R; Johnson, Aaron M

    2016-08-01

    Many individuals with Parkinson disease (PD) have difficulty producing normal speech and voice, resulting in problems with interpersonal communication and reduced quality of life. Translational animal models of communicative dysfunction have been developed to assess disease pathology. However, it is unknown whether acoustic feature changes associated with vocal production deficits in these animal models lead to compromised communication. In rodents, male ultrasonic vocalizations (USVs) have a well-established role in functional inter-sexual communication. To test whether acoustic deficits in USVs observed in a PTEN-induced putative kinase 1 (PINK1) knockout (KO) PD rat model compromise communication, we presented recordings of male PINK1 KO USVs and normal wild-type (WT) USVs to female rat listeners. We measured approached behavior and immediate early gene expression (c-Fos) in brain regions implicated in auditory processing and sexual motivation. Our results suggest that females show reduced approach in response to PINK1 KO USVs compared with WT. Moreover, females exposed to PINK1 KO USVs had lower c-Fos immunolabeling in the nucleus accumbens, a region implicated in sexual motivation. These results are the first to demonstrate that vocalization deficits in a rat PD model result in compromised communication. Thus, the PINK1 KO PD model may be valuable for assessing treatments aimed at restoring vocal communicative function. PMID:26313334

  17. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  18. Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors

    PubMed Central

    Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

  19. Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation

    NASA Technical Reports Server (NTRS)

    Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

    1997-01-01

    Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

  20. Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory

    ERIC Educational Resources Information Center

    Pevzner, Aleksandr; Guzowski, John F.

    2015-01-01

    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

  1. Physical interaction between the herpes simplex virus type 1 immediate-early regulatory proteins ICP0 and ICP4.

    PubMed Central

    Yao, F; Schaffer, P A

    1994-01-01

    The herpes simplex virus type 1 immediate-early protein ICP0 enhances expression of a spectrum of viral genes alone and synergistically with ICP4. To test whether ICP0 and ICP4 interact physically, we performed far-Western blotting analysis of proteins from mock-, wild-type-, and ICP4 mutant virus-infected cells with in vitro-synthesized [35S]Met-labeled ICP0 and ICP4 as probes. The ICP4 and ICP0 polypeptides synthesized in vitro exhibited molecular weights similar to those of their counterparts in herpes simplex virus type 1-infected cells, and the in vitro-synthesized ICP4 was able to bind to a probe containing the ICP4 consensus binding site. Far-Western blotting experiments demonstrated that ICP0 interacts directly and specifically with ICP4 and with itself. To further define the interaction between ICP0 and ICP4, we generated a set of glutathione S-transferase (GST)-ICP0 fusion proteins that contain GST and either ICP0 N-terminal amino acids 1 to 244 or 1 to 394 or C-terminal amino acids 395 to 616 or 395 to 775. Using GST-ICP0 fusion protein affinity chromatography and in vitro-synthesized [35S]Met-labeled ICP0 and ICP4, ICP4 was shown to interact preferentially with the fusion protein containing ICP0 C-terminal amino acids 395 to 775, whereas ICP0 interacted efficiently with both the N-terminal GST-ICP0 fusion proteins and the C-terminal GST-ICP0 fusion proteins containing amino acids 395 to 775. Fusion protein affinity chromatography also demonstrated that the C-terminal 235 amino acid residues of ICP4 are important for efficient interaction with ICP0. Collectively, these results reveal a direct and specific physical interaction between ICP0 and ICP4. Images PMID:7966607

  2. Identification of Cellular Proteins that Interact with Human Cytomegalovirus Immediate-Early Protein 1 by Protein Array Assay

    PubMed Central

    Puerta Martínez, Francisco; Tang, Qiyi

    2013-01-01

    Human cytomegalovirus (HCMV) gene expression during infection is characterized as a sequential process including immediate-early (IE), early (E), and late (L)-stage gene expression. The most abundantly expressed gene at the IE stage of infection is the major IE (MIE) gene that produces IE1 and IE2. IE1 has been the focus of study because it is an important protein, not only for viral gene expression but also for viral replication. It is believed that IE1 plays important roles in viral gene regulation by interacting with cellular proteins. In the current study, we performed protein array assays and identified 83 cellular proteins that interact with IE1. Among them, seven are RNA-binding proteins that are important in RNA processing; more than half are nuclear proteins that are involved in gene regulations. Tumorigenesis-related proteins are also found to interact with IE1, implying that the role of IE1 in tumorigenesis might need to be reevaluated. Unexpectedly, cytoplasmic proteins, such as Golgi autoantigen and GGA1 (both related to the Golgi trafficking protein), are also found to be associated with IE1. We also employed a coimmunoprecipitation assay to test the interactions of IE1 and some of the proteins identified in the protein array assays and confirmed that the results from the protein array assays are reliable. Many of the proteins identified by the protein array assay have not been previously reported. Therefore, the functions of the IE1-protein interactions need to be further explored in the future. PMID:24385082

  3. Experience affects immediate early gene expression in response to conspecific call notes in black-capped chickadees (Poecile atricapillus).

    PubMed

    Hahn, Allison H; Guillette, Lauren M; Lee, Daniel; McMillan, Neil; Hoang, John; Sturdy, Christopher B

    2015-01-01

    Black-capped chickadees (Poecile atricapillus) produce numerous vocalizations, including the acoustically complex chick-a-dee call that is composed of A, B, C, and D notes. D notes are longer in duration and lower in frequency than the other note types and contain information regarding flock and species identification. Adult wild-caught black-capped chickadees have been shown to have similar amounts of immediate early gene (IEG) expression following playback of vocalizations with harmonic-like acoustic structure, similar to D notes. Here we examined how different environmental experiences affect IEG response to conspecific D notes. We hand-reared black-capped chickadees under three conditions: (1) with adult conspecifics, (2) with adult heterospecific mountain chickadees, and (3) without adults. We presented all hand-reared birds and a control group of field-reared black-capped chickadees, with conspecific D notes and quantified IEG expression in the caudomedial mesopallium (CMM) and caudomedial nidopallium (NCM). We found that field-reared birds that heard normal D notes had a similar neural response as a group of field-reared birds that heard playback of reversed D notes. Field-reared birds that heard normal D notes also had a similar neural response as birds reared with adult conspecifics. Birds reared without adults had a significantly reduced IEG response, whereas the IEG expression in birds reared with heterospecifics was at intermediate levels between birds reared with conspecifics and birds reared without adults. Although acoustic characteristics have been shown to drive IEG expression, our results demonstrate that experience with adults or normal adult vocalizations is also an important factor. PMID:25813748

  4. Small-molecule inhibitors of ERK-mediated immediate early gene expression and proliferation of melanoma cells expressing mutated BRaf

    PubMed Central

    Samadani, Ramin; Zhang, Jun; Brophy, Amanda; Oashi, Taiji; Priyakumar, U. Deva; Raman, E. Prabhu; St John, Franz J.; Jung, Kwan-Young; Fletcher, Steven; Pozharski, Edwin; MacKerell, Alexander D.; Shapiro, Paul

    2015-01-01

    Constitutive activation of the extracellular-signal-regulated kinases 1 and 2 (ERK1/2) are central to regulating the proliferation and survival of many cancer cells. The current inhibitors of ERK1/2 target ATP binding or the catalytic site and are therefore limited in their utility for elucidating the complex biological roles of ERK1/2 through its phosphorylation and regulation of over 100 substrate proteins. To overcome this limitation, a combination of computational and experimental methods was used to identify low-molecular-mass inhibitors that are intended to target ERK1/2 substrate-docking domains and selectively interfere with ERK1/2 regulation of substrate proteins. In the present study, we report the identification and characterization of compounds with a thienyl benzenesulfonate scaffold that were designed to inhibit ERK1/2 substrates containing an F-site or DEF (docking site for ERK, FXF) motif. Experimental evidence shows the compounds inhibit the expression of F-site containing immediate early genes (IEGs) of the Fos family, including c-Fos and Fra1, and transcriptional regulation of the activator protein-1 (AP-1) complex. Moreover, this class of compounds selectively induces apoptosis in melanoma cells containing mutated BRaf and constitutively active ERK1/2 signalling, including melanoma cells that are inherently resistant to clinically relevant kinase inhibitors. These findings represent the identification and initial characterization of a novel class of compounds that inhibit ERK1/2 signalling functions and their potential utility for elucidating ERK1/2 and other signalling events that control the growth and survival of cancer cells containing elevated ERK1/2 activity. PMID:25695333

  5. Contrasting Networks for Recognition Memory and Recency Memory Revealed by Immediate-Early Gene Imaging in the Rat

    PubMed Central

    2014-01-01

    The expression of the immediate-early gene c-fos was used to compare networks of activity associated with recency memory (temporal order memory) and recognition memory. In Experiment 1, rats were first familiarized with sets of objects and then given pairs of different, familiar objects to explore. For the recency test group, each object in a pair was separated by 110 min in the time between their previous presentations. For the recency control test, each object in a pair was separated by less than a 1 min between their prior presentations. Temporal discrimination of the objects correlated with c-fos activity in the recency test group in several sites, including area Te2, the perirhinal cortex, lateral entorhinal cortex, as well as the dentate gyrus, hippocampal fields CA3 and CA1. For both the test and control conditions, network models were derived using structural equation modeling. The recency test model emphasized serial connections from the perirhinal cortex to lateral entorhinal cortex and then to the CA1 subfield. The recency control condition involved more parallel pathways, but again highlighted CA1 within the hippocampus. Both models contrasted with those derived from tests of object recognition (Experiment 2), because stimulus novelty was associated with pathways from the perirhinal cortex to lateral entorhinal cortex that then involved both the dentate gyrus (and CA3) and CA1 in parallel. The present findings implicate CA1 for the processing of familiar stimuli, including recency discriminations, while the dentate gyrus and CA3 pathways are recruited when the perirhinal cortex signals novel stimuli. PMID:24933661

  6. Distinct mechanisms for induction and tolerance regulate the immediate early genes encoding interleukin 1β and tumor necrosis factor α.

    PubMed

    Adamik, Juraj; Wang, Kent Z Q; Unlu, Sebnem; Su, An-Jey A; Tannahill, Gillian M; Galson, Deborah L; O'Neill, Luke A; Auron, Philip E

    2013-01-01

    Interleukin-1β and Tumor Necrosis Factor α play related, but distinct, roles in immunity and disease. Our study revealed major mechanistic distinctions in the Toll-like receptor (TLR) signaling-dependent induction for the rapidly expressed genes (IL1B and TNF) coding for these two cytokines. Prior to induction, TNF exhibited pre-bound TATA Binding Protein (TBP) and paused RNA Polymerase II (Pol II), hallmarks of poised immediate-early (IE) genes. In contrast, unstimulated IL1B displayed very low levels of both TBP and paused Pol II, requiring the lineage-specific Spi-1/PU.1 (Spi1) transcription factor as an anchor for induction-dependent interaction with two TLR-activated transcription factors, C/EBPβ and NF-κB. Activation and DNA binding of these two pre-expressed factors resulted in de novo recruitment of TBP and Pol II to IL1B in concert with a permissive state for elongation mediated by the recruitment of elongation factor P-TEFb. This Spi1-dependent mechanism for IL1B transcription, which is unique for a rapidly-induced/poised IE gene, was more dependent upon P-TEFb than was the case for the TNF gene. Furthermore, the dependence on phosphoinositide 3-kinase for P-TEFb recruitment to IL1B paralleled a greater sensitivity to the metabolic state of the cell and a lower sensitivity to the phenomenon of endotoxin tolerance than was evident for TNF. Such differences in induction mechanisms argue against the prevailing paradigm that all IE genes possess paused Pol II and may further delineate the specific roles played by each of these rapidly expressed immune modulators. PMID:23936458

  7. Immediate early gene expression reveals interactions between social and nicotine rewards on brain activity in adolescent male rats.

    PubMed

    Bastle, Ryan M; Peartree, Natalie A; Goenaga, Julianna; Hatch, Kayla N; Henricks, Angela; Scott, Samantha; Hood, Lauren E; Neisewander, Janet L

    2016-10-15

    Smoking initiation predominantly occurs during adolescence, often in the presence of peers. Therefore, understanding the neural mechanisms underlying the rewarding effects of nicotine and social stimuli is vital. Using the conditioned place preference (CPP) procedure, we measured immediate early gene (IEG) expression in animals following exposure either to a reward-conditioned environment or to the unconditioned stimuli (US). Adolescent, male rats were assigned to the following CPP US conditions: (1) Saline+Isolated, (2) Nicotine+Isolated, (3) Saline+Social, or (4) Nicotine+Social. For Experiment 1, brain tissue was collected 90min following the CPP expression test and processed for Fos immunohistochemistry. We found that rats conditioned with nicotine with or without a social partner exhibited CPP; however, we found no group differences in Fos expression in any brain region analyzed, with the exception of the nucleus accumbens core that exhibited a social-induced attenuation in Fos expression. For Experiment 2, brain tissue was collected 90min following US exposure during the last conditioning session. We found social reward-induced increases in IEG expression in striatal and amydalar subregions. In contrast, nicotine reduced IEG expression in prefrontal and striatal subregions. Reward interactions were also found in the dorsolateral striatum, basolateral amygdala, and ventral tegmental area where nicotine alone attenuated IEG expression and social reward reversed this effect. These results suggest that in general social rewards enhance, whereas nicotine attenuates, activation of mesocorticolimbic regions; however, the rewards given together interact to enhance activation in some regions. The findings contribute to knowledge of how a social environment influences nicotine effects. PMID:27435419

  8. Downregulation of immediate-early genes linking to suppression of neuronal plasticity in rats after 28-day exposure to glycidol

    SciTech Connect

    Akane, Hirotoshi; Saito, Fumiyo; Shiraki, Ayako; Takeyoshi, Masahiro; Imatanaka, Nobuya; Itahashi, Megu; Murakami, Tomoaki; Shibutani, Makoto

    2014-09-01

    We previously found that the 28-day oral toxicity study of glycidol at 200 mg/kg/day in rats resulted in axonopathy in both the central and peripheral nervous systems and aberrations in the late-stage of hippocampal neurogenesis targeting the process of neurite extension. To capture the neuronal parameters in response to glycidol toxicity, these animals were subjected to region-specific global gene expression profiling in four regions of cerebral and cerebellar architectures, followed by immunohistochemical analysis of selected gene products. Expression changes of genes related to axonogenesis and synaptic transmission were observed in the hippocampal dentate gyrus, cingulate cortex and cerebellar vermis at 200 mg/kg showing downregulation in most genes. In the corpus callosum, genes related to growth, survival and functions of glial cells fluctuated their expression. Immunohistochemically, neurons expressing gene products of immediate-early genes, i.e., Arc, Fos and Jun, decreased in their number in the dentate granule cell layer, cingulate cortex and cerebellar vermis. We also applied immunohistochemical analysis in rat offspring after developmental exposure to glycidol through maternal drinking water. The results revealed increases of Arc{sup +} neurons at 1000 ppm and Fos{sup +} neurons at ≥ 300 ppm in the dentate granule cell layer of offspring only at the adult stage. These results suggest that glycidol suppressed neuronal plasticity in the brain after 28-day exposure to young adult animals, in contrast to the operation of restoration mechanism to increase neuronal plasticity at the adult stage in response to aberrations in neurogenesis after developmental exposure. - Highlights: • Neuronal toxicity parameters after 28-day glycidol treatment were examined in rats. • Region-specific global gene expression profiling was conducted in brain regions. • Cortical tissues downregulated genes on axonogenesis and synaptic transmission. • Cortical tissues

  9. Small-molecule inhibitors of ERK-mediated immediate early gene expression and proliferation of melanoma cells expressing mutated BRaf.

    PubMed

    Samadani, Ramin; Zhang, Jun; Brophy, Amanda; Oashi, Taiji; Priyakumar, U Deva; Raman, E Prabhu; St John, Franz J; Jung, Kwan-Young; Fletcher, Steven; Pozharski, Edwin; MacKerell, Alexander D; Shapiro, Paul

    2015-05-01

    Constitutive activation of the extracellular-signal-regulated kinases 1 and 2 (ERK1/2) are central to regulating the proliferation and survival of many cancer cells. The current inhibitors of ERK1/2 target ATP binding or the catalytic site and are therefore limited in their utility for elucidating the complex biological roles of ERK1/2 through its phosphorylation and regulation of over 100 substrate proteins. To overcome this limitation, a combination of computational and experimental methods was used to identify low-molecular-mass inhibitors that are intended to target ERK1/2 substrate-docking domains and selectively interfere with ERK1/2 regulation of substrate proteins. In the present study, we report the identification and characterization of compounds with a thienyl benzenesulfonate scaffold that were designed to inhibit ERK1/2 substrates containing an F-site or DEF (docking site for ERK, FXF) motif. Experimental evidence shows the compounds inhibit the expression of F-site containing immediate early genes (IEGs) of the Fos family, including c-Fos and Fra1, and transcriptional regulation of the activator protein-1 (AP-1) complex. Moreover, this class of compounds selectively induces apoptosis in melanoma cells containing mutated BRaf and constitutively active ERK1/2 signalling, including melanoma cells that are inherently resistant to clinically relevant kinase inhibitors. These findings represent the identification and initial characterization of a novel class of compounds that inhibit ERK1/2 signalling functions and their potential utility for elucidating ERK1/2 and other signalling events that control the growth and survival of cancer cells containing elevated ERK1/2 activity. PMID:25695333

  10. Topographical evaluation of behavioural phenotype in a line of mice with targeted gene deletion of the D2 dopamine receptor.

    PubMed

    Clifford, J J; Usiello, A; Vallone, D; Kinsella, A; Borrelli, E; Waddington, J L

    2000-01-28

    The phenotype of spontaneous and dopamine D2-like agonist-induced behaviour was assessed topographically in a line of mice with targeted gene deletion of the D1 receptor. An ethologically-based, rapid time-sampling behavioural check-list technique was used to resolve and quantify all behaviours in the natural repertoire of the mouse. Relative to wildtypes [D2+/+], D2-null [D2-/-] mice evidenced over a 1 h period of initial exploration modest but significant reductions in locomotion, grooming, rearing free and rearing to wall; rearing seated, sniffing, sifting and stillness were not altered. Individual elements of behaviour habituated similarly over a 6 h period for both genotypes. The dose-dependent induction of stereotyped sniffing and ponderous locomotion by the D2-like agonist RU 24213 (0.1-12.5 mg/kg) in wildtypes was essentially absent in D2-null mice. The ethogram of spontaneous behaviour in D2-null mice was characterised by only modest reductions in, and topographical shifts between, certain individual elements of behaviour. Essential abolition of D2-like agonist responsivity in D2-null mice vis-à-vis considerable preservation of spontaneous behavioural topography suggests compensatory processes subsequent to developmental absence of the D2 receptor that are able to sustain function under naturalistic, tonic conditions but not during phasic challenge. PMID:10698004

  11. The Contribution of Whole Gene Deletions and Large Rearrangements to the Mutation Spectrum in Inherited Tumor Predisposing Syndromes.

    PubMed

    Smith, Miriam J; Urquhart, Jill E; Harkness, Elaine F; Miles, Emma K; Bowers, Naomi L; Byers, Helen J; Bulman, Michael; Gokhale, Carolyn; Wallace, Andrew J; Newman, William G; Evans, D Gareth

    2016-03-01

    Heterozygous whole gene deletions (WGDs), and intragenic microdeletions, account for a significant proportion of mutations underlying cancer predisposition syndromes. We analyzed the frequency and genotype-phenotype correlations of microdeletions in 12 genes (BRCA1, BRCA2, TP53, MSH2, MLH1, MSH6, PMS2, NF1, NF2, APC, PTCH1, and VHL) representing seven tumor predisposition syndromes in 5,897 individuals (2,611 families) from our center. Overall, microdeletions accounted for 14% of identified mutations. As expected, smaller deletions or duplications were more common (12%) than WGDs (2.2%). Where a WGD was identified in the germline in NF2, the mechanism of somatic second hit was not deletion, as previously described for NF1. For neurofibromatosis type 1 and 2, we compared the mechanism of germline deletion. Unlike NF1, where three specific deletion sizes account for most germline WGDs, NF2 deletion breakpoints were different across seven samples tested. One of these deletions was 3.93 Mb and conferred a severe phenotype, thus refining the region for a potential NF2 modifier gene to a 2.04-Mb region on chromosome 22. The milder phenotype of NF2 WGDs may be due to the apparent absence of chromosome 22 loss as the second hit. These observations of WGD phenotypes will be helpful for interpreting incidental findings from microarray analysis and next-generation sequencing. PMID:26615784

  12. Gene deleted live attenuated Leishmania vaccine candidates against visceral leishmaniasis elicit pro-inflammatory cytokines response in human PBMCs.

    PubMed

    Avishek, Kumar; Kaushal, Himanshu; Gannavaram, Sreenivas; Dey, Ranadhir; Selvapandiyan, Angamuthu; Ramesh, V; Negi, Narender Singh; Dubey, Uma S; Nakhasi, Hira L; Salotra, Poonam

    2016-01-01

    Currently no effective vaccine is available for human visceral leishmaniasis(VL) caused by Leishmania donovani. Previously, we showed that centrin1 and p27gene deleted live attenuated Leishmania parasites (LdCen1(-/-) and Ldp27(-/-)) are safe, immunogenic and protective in animal models. Here, to assess the correlates of protection, we evaluated immune responses induced by LdCen1(-/-) and Ldp27(-/-) in human blood samples obtained from healthy, healed VL (HVL), post kala-azar dermal leishmaniasis(PKDL) and VL subjects. Both parasites infected human macrophages, as effectively as the wild type parasites. Further, LdCen1(-/-) and Ldp27(-/-) strongly stimulated production of pro-inflammatory cytokines including, IL-12, IFN-γ, TNF-α, IL-2, IL-6 and IL-17 in the PBMCs obtained from individuals with a prior exposure to Leishmania (HVL and PKDL). There was no significant stimulation of anti-inflammatory cytokines (IL-4 and IL-10). Induction of Th1 biased immune responses was supported by a remarkable increase in IFN-γ secreting CD4(+) and CD8(+) T cells and IL-17 secreting CD4(+) cells in PBMCs from HVL cases with no increase in IL-10 secreting T cells. Hence, LdCen1(-/-) and Ldp27(-/-) are promising as live vaccine candidates against VL since they elicit strong protective immune response in human PBMCs from HVL, similar to the wild type parasite infection, mimicking a naturally acquired protection following cure. PMID:27624408

  13. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector.

    PubMed

    Murlidharan, Giridhar; Sakamoto, Kensuke; Rao, Lavanya; Corriher, Travis; Wang, Dan; Gao, Guangping; Sullivan, Patrick; Asokan, Aravind

    2016-01-01

    Gene therapy using recombinant adeno-associated viral (AAV) vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9), which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137) in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities. PMID:27434683

  14. Analysis of Noncanonical Calcium-Dependent Protein Kinases in Toxoplasma gondii by Targeted Gene Deletion Using CRISPR/Cas9.

    PubMed

    Long, Shaojun; Wang, Qiuling; Sibley, L David

    2016-05-01

    Calcium-dependent protein kinases (CDPKs) are expanded in apicomplexan parasites, especially in Toxoplasma gondii where 14 separate genes encoding these enzymes are found. Although previous studies have shown that several CDPKs play a role in controlling invasion, egress, and cell division in T. gondii, the roles of most of these genes are unexplored. Here we developed a more efficient method for gene disruption using CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated protein 9) that was modified to completely delete large, multiexonic genes from the genome and to allow serial replacement by recycling of the selectable marker using Cre-loxP. Using this system, we generated a total of 24 mutants in type 1 and 2 genetic backgrounds to ascertain the functions of noncanonical CDPKs. Remarkably, although we were able to confirm the essentiality of CDPK1 and CDPK7, the majority of CDPKs had no discernible phenotype for growth in vitro or infection in the mouse model. The exception to this was CDPK6, loss of which leads to reduced plaquing, fitness defect in a competition assay, and reduced tissue cyst formation in chronically infected mice. Our findings highlight the utility of CRISPR/Cas9 for rapid serial gene deletion and also suggest that additional models are needed to reveal the functions of many genes in T. gondii. PMID:26755159

  15. Macrophage Inhibitory Cytokine-1 (MIC-1/GDF15) Gene Deletion Promotes Cancer Growth in TRAMP Prostate Cancer Prone Mice

    PubMed Central

    Husaini, Yasmin; Lockwood, Glen P.; Nguyen, Trung V.; Tsai, Vicky Wang-Wei; Mohammad, Mohammad G.; Russell, Pamela J.; Brown, David A.; Breit, Samuel N.

    2015-01-01

    The divergent TGF-β superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15), is overexpressed by most cancers, including prostate cancer (PCa). Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-). On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+). Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1) had metastases than TRAMPMIC+/+ mice (p<0.0001). We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread. PMID:25695521

  16. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  17. Macrophage inhibitory cytokine-1 (MIC-1/GDF15) gene deletion promotes cancer growth in TRAMP prostate cancer prone mice.

    PubMed

    Husaini, Yasmin; Lockwood, Glen P; Nguyen, Trung V; Tsai, Vicky Wang-Wei; Mohammad, Mohammad G; Russell, Pamela J; Brown, David A; Breit, Samuel N

    2015-01-01

    The divergent TGF-β superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15), is overexpressed by most cancers, including prostate cancer (PCa). Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-). On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+). Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1) had metastases than TRAMPMIC+/+ mice (p<0.0001). We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread. PMID:25695521

  18. Characterization of DNA binding properties of the immediate-early gene product of equine herpesvirus type 1.

    PubMed

    Kim, S K; Smith, R H; O'Callaghan, D J

    1995-10-20

    The equine herpesvirus type 1 (EHV-1) immediate-early (IE) gene encodes a phosphoprotein that is essential for the activation of transcription from viral early and late promoters and that regulates the transcription from its own promoter. Employment of EHV-1 IE promoter DNA probes and glutathione S-transferase fusion proteins harboring truncated portions of the IE gene product in gel shift assays, super shift assays with anti-IE monoclonal antibodies, and DNase I footprinting analyses revealed: (1) amino acid residues 422 to 597 within the 1487-amino-acid IE protein are sufficient for sequence-specific DNA binding; (2) the IE protein binds to EHV-1 DNA at sequences from -11 to +14 that overlap the transcription initiation site (+1); (3) the conserved pentanucleotide 5'-ATCGT-3' in the IE promoter located at nucleotides (nt) -6 to -2, relative to the transcription initiation site (+1), is critical for IE protein binding; (4) a weak binding site for the IE protein is also present at nt -92 to -82 of the IE gene within the sequence (-86)ATCGA(-82) in which four of the five nt in the consensus binding sequence are conserved; (5) the IE protein binds to sequences in EHV-1 early and late promoters that contain a degenerate version of the consensus sequence 5'-ATCGT-3'; and (6) mutation of the C or G nt in the pentanucleotide 5'-ATCGT-3' prevents sequence-specific binding of the IE protein, whereas mutation of each of the other three nt only reduces binding. These results suggest that the IE protein can recognize the sites which differ slightly from the proposed consensus sequence. Overall, these findings suggest that formation of a specific complex between an IE protein and its own gene promoter may be a common mechanism used by Alphaherpesvirinae to autoregulate transcription of an essential IE gene. In addition, the finding that the DNA binding domain of the IE protein maps within amino acids 422 to 597, a domain conserved in the IR2 early protein that is a truncated

  19. Type I Interferon Released by Myeloid Dendritic Cells Reversibly Impairs Cytomegalovirus Replication by Inhibiting Immediate Early Gene Expression

    PubMed Central

    Holzki, Julia Katharina; Dağ, Franziska; Dekhtiarenko, Iryna; Rand, Ulfert; Casalegno-Garduño, Rosaely; Trittel, Stephanie; May, Tobias; Riese, Peggy

    2015-01-01

    ABSTRACT Cytomegalovirus (CMV) is a ubiquitous beta-herpesvirus whose reactivation from latency is a major cause of morbidity and mortality in immunocompromised hosts. Mouse CMV (MCMV) is a well-established model virus to study virus-host interactions. We showed in this study that the CD8-independent antiviral function of myeloid dendritic cells (mDC) is biologically relevant for the inhibition of MCMV replication in vivo and in vitro. In vivo ablation of CD11c+ DC resulted in higher viral titers and increased susceptibility to MCMV infection in the first 3 days postinfection. We developed in vitro coculture systems in which we cocultivated MCMV-infected endothelial cells or fibroblasts with T cell subsets and/or dendritic cells. While CD8 T cells failed to control MCMV replication, bone marrow-derived mDC reduced viral titers by a factor of up to 10,000. Contact of mDC with the infected endothelial cells was crucial for their antiviral activity. Soluble factors secreted by the mDC blocked MCMV replication at the level of immediate early (IE) gene expression, yet the viral lytic cycle reinitiated once the mDC were removed from the cells. On the other hand, the mDC did not impair MCMV replication in cells deficient for the interferon (IFN) alpha/beta receptor (IFNAR), arguing that type I interferons were critical for viral control by mDC. In light of our recent observation that type I IFN is sufficient for the induction of latency immediately upon infection, our results imply that IFN secreted by mDC may play an important role in the establishment of CMV latency. IMPORTANCE Numerous studies have focused on the infection of DC with cytomegaloviruses and on the establishment of latency within them. However, almost all of these studies have relied on the infection of DC monocultures in vitro, whereas DC are just one among many cell types present in an infection site in vivo. To mimic this aspect of the in vivo situation, we cocultured DC with infected endothelial cells

  20. Possible involvement of hippocampal immediate-early genes in contextual fear memory deficit induced by cranial irradiation.

    PubMed

    Son, Yeonghoon; Kang, Sohi; Kim, Jinwook; Lee, Sueun; Kim, Jong-Choon; Kim, Sung-Ho; Kim, Joong-Sun; Jo, Sung-Kee; Jung, Uhee; Youn, BuHyun; Shin, Taekyun; Yang, Miyoung; Moon, Changjong

    2016-09-01

    Cranial irradiation can trigger adverse effects on brain functions, including cognitive ability. However, the cellular and molecular mechanisms underlying radiation-induced cognitive impairments remain still unknown. Immediate-early genes (IEGs) are implicated in neuronal plasticity and the related functions (i.e., memory formation) in the hippocampus. The present study quantitatively assessed changes in the mRNA and protein levels of the learning-induced IEGs, including Arc, c-fos, and zif268, in the mouse hippocampus after cranial irradiation using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) and immunohistochemistry, respectively. Mice (male, 8-week-old C57BL/6) received whole-brain irradiation with 0 or 10Gy of gamma-ray and, 2weeks later, contextual fear conditioning (CFC) was used to induce IEGs. In the CFC task, mice evaluated 2weeks after irradiation exhibited significant memory deficits compared with sham (0Gy)-irradiated controls. The levels of mRNA encoding IEGs were significantly upregulated in the hippocampus 10 and 30min after CFC training. The mRNA levels in the irradiated hippocampi were significantly lower than those in the sham-irradiated controls. The IEG protein levels were significantly increased in all hippocampal regions, including the hippocampal dentate gyrus, cornu ammonis (CA)1, and CA3, after CFC training. The CFC-induced upregulation of Arc and c-fos in 10Gy-irradiated hippocampi was significantly lower than that in sham-irradiated controls, although there were no significant differences in the protein levels of the learning-induced zif268 between sham-irradiated and 10Gy-irradiated hippocampi. Thus, cranial irradiation with 10Gy of gamma-ray impairs the induction of hippocampal IEGs (particularly Arc and c-fos) via behavioral contextual fear memory, and this disturbance may be associated with the memory deficits evident in mice after cranial irradiation, possibly through the dysregulation of neuronal

  1. Immediate early gene expression in the vestibular nuclei and related vegetative areas in rats during space flight.

    PubMed

    Pompeiano, O; d'Ascanio, P; Centini, C; Pompeiano, M; Cirelli, C; Tononi, G

    2001-01-01

    Changes in neuronal activity resulting in somatic and vegetative deficits occur during different space flight conditions. Immediate early genes (IEGs: c-fos and Fos-related antigen [FRA]) are useful indicators of changes in neuronal activity and plasticity. They are induced within minutes of several extracellular stimulations, while the corresponding proteins persist for hours (Fos) or days (FRAs). Changes in IEG expression are likely to contribute to adaptation to microgravity and readaptation to the terrestrial environment. During the NASA Neurolab Mission (STS-90), changes in IEG expression were studied in adult male albino rats (Fisher 344) sacrificed at flight day (FD) 2 (24 h after launch), FD14 and at similar time points after re-entry (R + 1, 24 h after re-entry, and R + 13). These time points were chosen to maximize the probability of detecting changes in IEG expression related to changes in gravitational fields occurring during the mission, e.g. (i) increase in gravitational force from 1 to 3 g during the launch, before reaching about 0 g at FD2; (ii) adaptation to 0 g at FD14; (iii) increase in gravity from 0 to approximately 1.5-1.8 g before reaching 1 g at R + 1; and (iv) readaptation to 1 g at R + 13. Fos- and FRA-positive cells were identified in the brainstem of flight rats and ground-based controls using immunocytochemistry. With respect to control rats, the number of labeled cells increased in flight animals in the medial and spinal vestibular nuclei (but not in the lateral vestibular nucleus) at FD2, decreased at FD14, greatly increased at R + 1 and returned to baseline levels at R + 13. Similar changes in IEG expression were also observed in the nucleus of the solitary tract, the area postrema and the central nucleus of the amygdala. In particular, in these vegetative areas the number of Fos-positive cells decreased in flight rats with respect to controls at FD14, i.e. after exposure to 0 g, but significantly increased at R + 1, i.e. after

  2. pNEB193-derived suicide plasmids for gene deletion and protein expression in the methane-producing archaeon, Methanosarcina acetivorans.

    PubMed

    Shea, Mitchell T; Walter, Mary E; Duszenko, Nikolas; Ducluzeau, Anne-Lise; Aldridge, Jared; King, Shannon K; Buan, Nicole R

    2016-01-01

    Gene deletion and protein expression are cornerstone procedures for studying metabolism in any organism, including methane-producing archaea (methanogens). Methanogens produce coenzymes and cofactors not found in most bacteria, therefore it is sometimes necessary to express and purify methanogen proteins from the natural host. Protein expression in the native organism is also useful when studying post-translational modifications and their effect on gene expression or enzyme activity. We have created several new suicide plasmids to complement existing genetic tools for use in the methanogen, Methanosarcina acetivorans. The new plasmids are derived from the commercially available Escherichia coli plasmid, pNEB193, and cannot replicate autonomously in methanogens. The designed plasmids facilitate markerless gene deletion, gene transcription, protein expression, and purification of proteins with cleavable affinity tags from the methanogen, M. acetivorans. PMID:26876941

  3. The product of Kaposi's sarcoma-associated herpesvirus immediate early gene K4.2 regulates immunoglobulin secretion and calcium homeostasis by interacting with and inhibiting pERP1.

    PubMed

    Wong, Lai-Yee; Brulois, Kevin; Toth, Zsolt; Inn, Kyung-Soo; Lee, Sun-Hwa; O'Brien, Kathryn; Lee, Hyera; Gao, Shou-Jiang; Cesarman, Ethel; Ensser, Armin; Jung, Jae U

    2013-11-01

    Chaperones are proteins that assist the noncovalent folding and assembly of macromolecular polypeptide chains, ultimately preventing the formation of nonfunctional or potentially toxic protein aggregates. Plasma cell-induced-endoplasmic reticulum (ER)-resident protein 1 (pERP1) is a cellular chaperone that is preferentially expressed in marginal-zone B cells and is highly upregulated during plasma cell differentiation. While initially identified as a dedicated factor for the assembly of secreted IgM, pERP1 has since been implicated in suppressing calcium mobilization, and its expression is misregulated in multiple tumors. A number of herpesvirus immediate early gene products play important roles in the regulation of viral gene expression and/or evasion of host immune responses. Here, we report that the Kaposi's sarcoma-associated herpesvirus (KSHV) immediate early viral gene K4.2 encodes an endoplasmic reticulum-localized protein that interacts with and inhibits pERP1. Consequently, K4.2 expression interfered with immunoglobulin secretion by delaying the kinetics of immunoglobulin assembly and also led to increased responsiveness of B-cell receptor signal transduction by enhancing phosphotyrosine signals and intracellular calcium fluxes. Furthermore, K4.2 expression also appeared to contribute to maximal lytic replication by enhancing viral glycoprotein expression levels and ultimately promoting infectious-virus production. Finally, immunohistochemistry analysis showed that pERP1 expression was readily detected in KSHV-positive cells from multicentric Castleman's disease (MCD) and Kaposi's sarcoma (KS) lesions, suggesting that pERP1 may have potential roles in the KSHV life cycle and malignancy. In conclusion, our data suggest that K4.2 participates in lytic replication by enhancing calcium flux and viral glycoprotein expression, but also by interfering with immunoglobulin assembly to potentially dampen the adaptive immune response. PMID:23986581

  4. Novel Comparative Pattern Count Analysis Reveals a Chronic Ethanol-Induced Dynamic Shift in Immediate Early NF-κB Genome-wide Promoter Binding During Liver Regeneration

    PubMed Central

    Kuttippurathu, Lakshmi; Patra, Biswanath; Hoek, Jan B; Vadigepalli, Rajanikanth

    2016-01-01

    Liver regeneration after partial hepatectomy is a clinically important process that is impaired by adaptation to chronic alcohol intake. We focused on the initial time points following partial hepatectomy (PHx) to analyze genome-wide binding activity of NF-κB, a key immediate early regulator. We investigated the effect of chronic alcohol intake on immediate early NF-κB genome-wide localization, in the adapted state as well as in response to partial hepatectomy, using chromatin immunoprecipitation followed by promoter microarray analysis. We found many ethanol-specific NF-κB binding target promoters in the ethanol-adapted state, corresponding to regulation of biosynthetic processes, oxidation-reduction and apoptosis. Partial hepatectomy induced a diet-independent shift in NF-κB binding loci relative to the transcription start sites. We employed a novel pattern count analysis to exhaustively enumerate and compare the number of promoters corresponding to the temporal binding patterns in ethanol and pair-fed control groups. The highest pattern count corresponded to promoters with NF-κB binding exclusively in the ethanol group at 1h post PHx. This set was associated with regulation of cell death, response to oxidative stress, histone modification, mitochondrial function, and metabolic processes. Integration with the global gene expression profiles to identify putative transcriptional consequences of NF-κB binding patterns revealed that several of ethanol-specific 1h binding targets showed ethanol-specific differential expression through 6h post PHx. Motif analysis yielded co-incident binding loci for STAT3, AP-1, CREB, C/EBP-β, PPAR-γ and C/EBP-α, likely participating in co-regulatory modules with NF-κB in shaping the immediate early response to PHx. We conclude that adaptation to chronic ethanol intake disrupts the NF-κB promoter binding landscape with consequences for the immediate early gene regulatory response to the acute challenge of PHx. PMID:26847025

  5. Inhibition of the FACT Complex Reduces Transcription from the Human Cytomegalovirus Major Immediate Early Promoter in Models of Lytic and Latent Replication.

    PubMed

    O'Connor, Christine M; Nukui, Masatoshi; Gurova, Katerina V; Murphy, Eain A

    2016-04-01

    The successful colonization of the majority of the population by human cytomegalovirus is a direct result of the virus's ability to establish and, more specifically, reactivate from latency. The underlying cellular factors involved in viral reactivation remain unknown. Here, we show that the host complexfacilitateschromatintranscription (FACT) binds to the major immediate early promoter (MIEP) and that inhibition of this complex reduces MIEP transactivation, thus inhibiting viral reactivation. PMID:26865717

  6. C-fos and egr-1 immediate-early gene induction by cocaine and cocaethylene in rat brain: a comparative study.

    PubMed

    Thiriet, N; Aunis, D; Zwiller, J

    2000-09-01

    The induction of immediate-early genes can now be considered as a tool to study neuronal activation in different brain structures. These genes, which are rapidly and transiently induced in response to diverse extracellular stimulation, coordinate alterations in gene expression underlying neuronal plasticity. Using in situ hybridization, we found that acute i.p. cocaine (20 mg/kg) injection produced a strong expression of egr-1 and c-fos genes in the nucleus accumbens, caudate-putamen, and frontal cortex in the rat. Cocaethylene is an active metabolite of cocaine that is formed when cocaine is consumed together with ethyl alcohol. Injection of cocaethylene at a dose equivalent to cocaine induced the expression of the two immediate-early genes in the same brain structures, but to a lesser extent. A high dose of ethanol increased egr-1 and c-fos expression in the frontal cortex and in the lateral part of the caudate-putamen. Since cocaine is known to potently inhibit both dopamine and serotonin transporters, whereas cocaethylene only inhibits the dopamine transporter, our results strongly suggest that the serotonergic system participates in the mode of action of cocaine in its ability to trigger immediate-early gene transcription. PMID:11085307

  7. Bovine Herpes Virus 1 Major Immediate Early Transcription Unit 1 (IETU-1) Uses Alternative Promoters to Transcribe BICP0 and BICP4 Transcripts.

    PubMed

    Pokhriyal, Mayank; Verma, O P; Ratta, Barkha; Kumar, Ajay; Saxena, Meeta; Sharma, Bhaskar

    2016-04-01

    Immediate early (IE) genes are transcribed immediately after infection in BHV1 from two different immediate early transcription units. It is reported that the immediate early transcription unit I (IE TU1) of Bovine herpesvirus 1 (BHV1) transcribes two proteins BICP0 and BICP4 from a single promoter by alternative splicing but with identical 5'UTR. We found that the transcripts of BICP0 and BICP4 have different 5'UTRs. The bioinformatics analysis shows two similar spatially arranged TATA less promoter for the two transcripts. The bioinformatics analysis also showed a similar promoter for the IE TU2 which transcribes BICP22. The data strongly suggest that BICP0 and BICP4 are transcribed from two different promoters. The transcript produced by each promoter is spliced specifically as opposed to what has been reported earlier. The BICP0 and BICP4 also show different levels of expression. The expression level of BICP4 continuously declines after attaining a peak level at 1 h, while BICP0 shows biphasic expression supporting the earlier observation that it is expressed from two different promoters. PMID:26719189

  8. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  9. RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia of latently infected mice

    SciTech Connect

    Deatly, A.M.; Spivack, J.G.; Lavi, E.; Fraser, N.W.

    1987-05-01

    Transcription of the type 1 herpes simplex virus (HSV-1) genome in trigeminal ganglia of latently infected mice was studied using in situ hybridization. Probes representative of each temporal gene class were used to determine the regions of the genome that encode the transcripts present in latently infected cells. Probes encoding HSV-1 sequences of the five immediate early genes and representative early (thymidine kinase), early-late (major capsid protein), and late (glycoprotein C) genes were used in these experiments. Of the probes tested, only those encoding the immediate early gene product infected-cell polypeptide (ICP) 0 hybridized to RNA in latently infected tissues. Probes containing the other immediate early genes (ICP4, ICP22, ICP27, and ICP47) and the representative early, early-late, and late genes did not hybridize. Two probes covering approx. = 30% of the HSV-1 genome and encoding over 20 early and late transcripts also did not hybridize to RNA in latently infected tissues. These results, with probes spanning > 60% of the HSV-1 genome, suggest that transcription of the HSV-1 genome is restricted to one region in latently infected mouse trigeminal ganglia.

  10. Paradoxical effects of prodynorphin gene deletion on basal and cocaine-evoked dopaminergic neurotransmission in the nucleus accumbens.

    PubMed

    Chefer, V I; Shippenberg, T S

    2006-01-01

    Quantitative and conventional microdialysis were used to investigate the effects of constitutive deletion of the prodynorphin gene on basal dopamine (DA) dynamics in the nucleus accumbens (NAc) and the responsiveness of DA neurons to an acute cocaine challenge. Saline- and cocaine-evoked locomotor activity were also assessed. Quantitative microdialysis revealed that basal extracellular DA levels were decreased, while the DA extraction fraction, an indirect measure of DA uptake, was unchanged in dynorphin (DYN) knockout (KO) mice. The ability of cocaine to increase NAc DA levels was reduced in KO. Similarly, cocaine-evoked locomotor activity was decreased in KO. The selective kappa opioid receptor agonist U-69593 decreased NAc dialysate DA levels in wildtype mice and this effect was enhanced in KO. Administration of the selective kappa opioid receptor (KOPr) antagonist nor-binaltorphimine to KO mice attenuated the decrease in cocaine-induced DA levels. However, it was ineffective in altering the decreased locomotor response to cocaine. These studies demonstrate that constitutive deletion of prodynorphin is associated with a reduction of extracellular NAc DA levels and a decreased responsiveness to acute cocaine. Data regarding the effects of U-69593 and nor-binaltorphimine in KO suggest that the kappa opioid receptor is up-regulated as a consequence of prodynorphin gene deletion and that this adaptation underlies the decrease in basal DA dynamics and cocaine-evoked DA levels observed in DYN KO mice. These findings suggest that the phenotype of DYN KO mice is not solely due to loss of endogenous opioid peptide but also reflects developmental compensations that occur at the level of the opioid receptor. PMID:16420432

  11. Soluble epoxide hydrolase inhibition and gene deletion are protective against myocardial ischemia-reperfusion injury in vivo.

    PubMed

    Motoki, Atsuko; Merkel, Matthias J; Packwood, William H; Cao, Zhiping; Liu, Lijuan; Iliff, Jeffrey; Alkayed, Nabil J; Van Winkle, Donna M

    2008-11-01

    Soluble epoxide hydrolase (sEH) metabolizes epoxyeicosatrienoic acids (EETs) to dihydroxyeicosatrienoic acids. EETs are formed from arachidonic acid during myocardial ischemia and play a protective role against ischemic cell death. Deletion of sEH has been shown to be protective against myocardial ischemia in the isolated heart preparation. We tested the hypothesis that sEH inactivation by targeted gene deletion or pharmacological inhibition reduces infarct size (I) after regional myocardial ischemia-reperfusion injury in vivo. Male C57BL\\6J wild-type or sEH knockout mice were subjected to 40 min of left coronary artery (LCA) occlusion and 2 h of reperfusion. Wild-type mice were injected intraperitoneally with 12-(3-adamantan-1-yl-ureido)-dodecanoic acid butyl ester (AUDA-BE), a sEH inhibitor, 30 min before LCA occlusion or during ischemia 10 min before reperfusion. 14,15-EET, the main substrate for sEH, was administered intravenously 15 min before LCA occlusion or during ischemia 5 min before reperfusion. The EET antagonist 14,15-epoxyeicosa-5(Z)-enoic acid (EEZE) was given intravenously 15 min before reperfusion. Area at risk (AAR) and I were assessed using fluorescent microspheres and triphenyltetrazolium chloride, and I was expressed as I/AAR. I was significantly reduced in animals treated with AUDA-BE or 14,15-EET, independent of the time of administration. The cardioprotective effect of AUDA-BE was abolished by the EET antagonist 14,15-EEZE. Immunohistochemistry revealed abundant sEH protein expression in left ventricular tissue. Strategies to increase 14,15-EET, including sEH inactivation, may represent a novel therapeutic approach for cardioprotection against myocardial ischemia-reperfusion injury. PMID:18835921

  12. Tph2 gene deletion enhances amphetamine-induced hypermotility: effect of 5-HT restoration and role of striatal noradrenaline release.

    PubMed

    Carli, Mirjana; Kostoula, Chrysaugi; Sacchetti, Giuseppina; Mainolfi, Pierangela; Anastasia, Alessia; Villani, Claudia; Invernizzi, Roberto William

    2015-11-01

    Variants of tryptophan hydroxylase-2 (Tph2), the gene encoding enzyme responsible for the synthesis of brain serotonin (5-HT), have been associated with neuropsychiatric disorders, substance abuse and addiction. This study assessed the effect of Tph2 gene deletion on motor behavior and found that motor activity induced by 2.5 and 5 mg/kg amphetamine was enhanced in Tph2(-/-) mice. Using the in vivo microdialysis technique we found that the ability of amphetamine to stimulate noradrenaline (NA) release in the striatum was reduced by about 50% in Tph2(-/-) mice while the release of dopamine (DA) was not affected. Tph2 deletion did not affect the release of NA and DA in the prefrontal cortex. The role of endogenous 5-HT in enhancing the effect of amphetamine was confirmed showing that treatment with the 5-HT precursor 5-hydroxytryptophan (10 mg/kg) restored tissue and extracellular levels of brain 5-HT and the effects of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. Treatment with the NA precursor dihydroxyphenylserine (400 mg/kg) was sufficient to restore the effect of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. These findings indicate that amphetamine-induced hyperactivity is attenuated by endogenous 5-HT through the inhibition of striatal NA release. Tph2(-/-) mice may be a useful preclinical model to assess the role of 5-HT-dependent mechanisms in the action of psychostimulants. Acute sensitivity to the motor effects of amphetamine has been associated to increased risk of psychostimulant abuse. Here, we show that deletion of Tph2, the gene responsible for brain 5-HT synthesis, enhances the motor effect of amphetamine in mice through the inhibition of striatal NA release. This suggests that Tph2(-/-) mice is a useful preclinical model to assess the role of 5-HT-dependent mechanisms in psychostimulants action. Tph2, tryptophan hydroxylase-2. PMID:26259827

  13. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice

    PubMed Central

    Esteva-Font, Cristina; Jin, Byung-Ju; Verkman, A. S.

    2014-01-01

    Aquaporin 1 (AQP1) is a plasma membrane water-transporting protein expressed strongly in tumor microvascular endothelia. We previously reported impaired angiogenesis in implanted tumors in AQP1-deficient mice and reduced migration of AQP1-deficient endothelial cells in vitro. Here, we investigated the consequences of AQP1 deficiency in mice that spontaneously develop well-differentiated, luminal-type breast adenomas with lung metastases [mouse mammary tumor virus-driven polyoma virus middle T oncogene (MMTV-PyVT)]. AQP1+/+ MMTV-PyVT mice developed large breast tumors with total tumor mass 3.5 ± 0.5 g and volume 265 ± 36 mm3 (se, 11 mice) at age 98 d. Tumor mass (1.6±0.2 g) and volume (131±15 mm3, 12 mice) were greatly reduced in AQP1−/− MMTV-PyVT mice (P<0.005). CD31 immunofluorescence showed abnormal microvascular anatomy in tumors of AQP1−/− MMTV-PyVT mice, with reduced vessel density. HIF-1α expression was increased in tumors in AQP1−/− MMTV-PyVT mice. The number of lung metastases (5±1/mouse) was much lower than in AQP1+/+ MMTV-PyVT mice (31±8/mouse, P<0.005). These results implicate AQP1 as an important determinant of tumor angiogenesis and, hence, as a potential drug target for adjuvant therapy of solid tumors.—Esteva-Font, C., Jin, B.-J., Verkman, A. S. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice. PMID:24334548

  14. Cystathionine-Gamma-Lyase Gene Deletion Protects Mice against Inflammation and Liver Sieve Injury following Polymicrobial Sepsis

    PubMed Central

    Gaddam, Ravinder Reddy; Fraser, Robin; Badiei, Alireza; Chambers, Stephen; Cogger, Victoria C; Le Couteur, David G; Ishii, Isao; Bhatia, Madhav

    2016-01-01

    Background Hydrogen sulfide (H2S), produced by the activity of cystathionine-gamma-lyase (CSE), is a key mediator of inflammation in sepsis. The liver sinusoidal endothelial cells (LSECs) are important target and mediator of sepsis. The aim of this study was to investigate the role of CSE-derived H2S on inflammation and LSECs fenestrae in caecal-ligation and puncture (CLP)-induced sepsis using CSE KO mice. Methods Sepsis was induced by CLP, and mice (C57BL/6J, male) were sacrificed after 8 hours. Liver, lung, and blood were collected and processed to measure CSE expression, H2S synthesis, MPO activity, NF-κB p65, ERK1/2, and cytokines/chemokines levels. Diameter, frequency, porosity and gap area of the liver sieve were calculated from scanning electron micrographs of the LSECs. Results An increased CSE expression and H2S synthesizing activity in the liver and lung of wild-type mice following CLP-induced sepsis. This was associated with an increased liver and lung MPO activity, and increased liver and lung and plasma levels of the pro-inflammatory cytokines TNF-α, IL-6, and IL-1β, and the chemokines MCP-1 and MIP-2α. Conversely, CSE KO mice had less liver and lung injury and reduced inflammation following CLP-induced sepsis as evidenced by decreased levels of H2S synthesizing activity, MPO activity, and pro-inflammatory cytokines/chemokines production. Extracellular-regulated kinase (ERK1/2) and nuclear factor-κB p65 (NF-κB) became significantly activated after the CLP in WT mice but not in CSE KO mice. In addition, CLP-induced damage to the LSECs, as indicated by increased defenestration and gaps formation in the LSECs compared to WT sham control. CSE KO mice showed decreased defenestration and gaps formation following sepsis. Conclusions Mice with CSE (an H2S synthesising enzyme) gene deletion are less susceptible to CLP-induced sepsis and associated inflammatory response through ERK1/2-NF-κB p65 pathway as evidenced by reduced inflammation, tissue damage

  15. Na+ dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    PubMed Central

    Christensen, Henriette L.; Nguyen, An T.; Pedersen, Fredrik D.; Damkier, Helle H.

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na+ dependent Cl−/HCO3− exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na+:HCO3− cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na+:HCO3− cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na+/H+ exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed. PMID:24155723

  16. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity

    PubMed Central

    Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

    2012-01-01

    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

  17. Bacterial Infection of endometrial stromal cells influences bovine herpersvirus 4 immediate early gene activation: a new insight into bacterial and viral interaction for uterine disease

    PubMed Central

    Donofrio, Gaetano; Ravanetti, Lara; Cavirani, Sandro; Herath, Shan; Capocefalo, Antonio; Sheldon, Iain Martin

    2009-01-01

    Experimental infection with the gammaherpesvirus Bovine herpesvirus 4 (BoHV-4) rarely establishes disease, yet BoHV-4 is commonly associated with uterine disease in cattle. Uterine disease involves co-infection with bacteria such as Escherichia coli, which stimulate the production of prostaglandin E2 (PGE2) by endometrial cells. BoHV-4 replication depends on Immediate Early 2 (IE2) gene transactivation, and in the present study, PGE2, E. coli or its lipopolysaccharide (LPS), up-regulated the IE2 gene promoter in uterine cells. Bacterial co-infection is important for BoHV-4 uterine disease. PMID:18577555

  18. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides

    PubMed Central

    2014-01-01

    Background Rhodosporidium toruloides is a β-carotenoid accumulating, oleaginous yeast that has great biotechnological potential. The lack of reliable and efficient genetic manipulation tools have been a major hurdle blocking its adoption as a biotechnology platform. Results We report for the first time the development of a highly efficient targeted gene deletion method in R. toruloides ATCC 10657 via Agrobacterium tumefaciens-mediated transformation. To further improve targeting frequency, the KU70 and KU80 homologs in R. toruloides were isolated and characterized in detail. A KU70-deficient mutant (∆ku70e) generated with the hygromycin selection cassette removed by the Cre-loxP recombination system showed a dramatically improved targeted gene deletion frequency, with over 90% of the transformants being true knockouts when homology sequence length of at least 1 kb was used. Successful gene targeting could be made with homologous flanking sequences as short as 100 bp in the ∆ku70e strain. KU70 deficiency did not perturb cell growth although an elevated sensitivity to DNA mutagenic agents was observed. Compared to the other well-known oleaginous yeast, Yarrowia lipolytica, R. toruloides KU70/KU80 genes contain much higher density of introns and are the most GC-rich KU70/KU80 genes reported. Conclusions The KU70-deficient mutant generated herein was effective in improving gene deletion frequency and allowed shorter homology sequences to be used for gene targeting. It retained the key oleaginous and fast growing features of R. toruloides. The strain should facilitate both fundamental and applied studies in this important yeast, with the approaches taken here likely to be applicable in other species in subphylum Pucciniomycotina. PMID:25188820

  19. HBV polymerase overexpression due to large core gene deletion enhances hepatoma cell growth by binding inhibition of microRNA-100

    PubMed Central

    Huang, Ya-Hui; Tseng, Ying-Hsin; Lin, Wey-Ran; Hung, George; Chen, Tse-Ching; Wang, Tong-Hong; Lee, Wei-Chen; Yeh, Chau-Ting

    2016-01-01

    Different types of hepatitis B virus (HBV) core gene deletion mutants were identified in chronic hepatitis B patients. However, their clinical roles in different stages of natural chronic HBV infection remained unclear. To address this issue, HBV core genes were sequenced in three gender- and age-matched patient groups diagnosed as chronic hepatitis, cirrhosis and hepatocellular carcinoma (HCC), respectively. Functional analysis of the identified mutants was performed. A novel type of large-fragment core gene deletion (LFCD) was identified exclusively in HCC patients and significantly associated with unfavorable postoperative survival. The presence of LFCDs resulted in generation of precore-polymerase fusion protein or brought the polymerase reading frame under direct control of HBV precore/core promoter, leading to its over-expression. Enhanced cell proliferation and increased tumorigenicity in nude mice were found in hepatoma cells expressing LFCDs. Because of the epsilon-binding ability of HBV polymerase, we hypothesized that the over-expressed polymerase carrying aberrant amino-terminal sequence could bind to cellular microRNAs. Screening of a panel of microRNAs revealed physical association of a precore-polymerase fusion protein with microRNA-100. A binding inhibition effect on microRNA-100 by the precore-polymerase fusion protein with up-regulation of its target, polo-like kinase 1 (PLK1), was discovered. The binding inhibition and growth promoting effects could be reversed by overexpressing microRNA-100. Together, HCC patients carrying hepatitis B large-fragment core gene deletion mutants had an unfavorable postoperative prognosis. The growth promoting effect was partly due to polymerase overexpression, leading to binding inhibition of microRNA-100 and up-regulation of PLK1. PMID:26824500

  20. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    SciTech Connect

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  1. Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

    PubMed

    Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

    2016-06-01

    Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model. PMID:27354540

  2. Investigation of TBX1 gene deletion in Iranian children with 22q11.2 deletion syndrome: correlation with conotruncal heart defects

    PubMed Central

    Ganji, Hamid; Salehi, Mansoor; Sedghi, Maryam; Abdali, Hossein; Nouri, Nayereh; Sadri, Leyli; Hosseinzadeh, Majid; Vakili, Bahareh; Lotfi, Mahdi

    2013-01-01

    Background DiGeorge syndrome (DGS) is the result of a microdeletion in chromosome 22q11.2 in over 90% of cases. DGS is the second most frequent syndrome after Down syndrome and has an incidence of 1/4000 births. Unequal crossover between low-copy repeats, on the proximal part of the long arm of chromosome 22, usually results in a 3 Mb deletion in one of the chromosome 22 and a reciprocal and similarly sized duplication on the other one. Several studies have indicated that TBX1 (T-box 1) haploinsufficiency is responsible for many of the phenotypic traits of 22q11.2 deletion syndrome. Conotruncal heart defects (CTDs) are present in 75–85% of patients with 22q11.2 deletion syndrome in Western countries. Methods Among 78 patients fulfilling the criteria for DGS diagnosed by the fluorescence in situ hybridisation test, 24 had 22q11.2 deletion. Screening for TBX1 gene deletion was performed by multiplex ligation-dependent probe amplification (MLPA). Results Our results revealed that of 24 patients with TBX1 gene deletion, 12 had CTDs while 12 did not show any heart defects. Conclusions Our findings indicate that other genes or gene interactions may play a role in penetrance or the severity of heart disease among patients with DGS. PMID:27326128

  3. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein

  4. Hippocampus and medial striatum dissociation during goal navigation by geometry or features in the domestic chick: An immediate early gene study.

    PubMed

    Mayer, Uwe; Pecchia, Tommaso; Bingman, Verner Peter; Flore, Michele; Vallortigara, Giorgio

    2016-01-01

    We employed a standard reference memory task to study the involvement of the hippocampal formation (HF) of domestic chicks that used the boundary geometry of a test environment to orient to and locate a reward. Using the immediate early gene product c-Fos as a neuronal activity marker, we found enhanced HF activation in chicks that learned to locate rewarded corners using the shape of a rectangular arena compared to chicks trained to solve the task by discriminating local features in a square-shaped arena. We also analyzed neuronal activity in the medial part of the medial striatum (mMSt). Surprisingly, in mMSt we observed a reverse pattern, with higher activity in the chicks that were trained to locate the goal by local features. Our results identify two seemingly parallel, memory systems in chicks, with HF central to the processing of spatial-geometrical information and mMSt important in supporting local feature discrimination. PMID:26135386

  5. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  6. Human T-lymphotropic virus tax activates human cytomegalovirus major-immediate early promoter and improves production of recombinant proteins in HEK293 cells.

    PubMed

    Lwa, Teng Rhui; Lee, Jialing; Ng, Chew Har; Lew, Qiao Jing; Hia, Hui Ching; Chao, Sheng-Hao

    2011-01-01

    The human cytomegalovirus (CMV) major immediate-early (MIE) promoter is widely used in mammalian cells for production of recombinant proteins. It is of great interest to further enhance protein production driven by the CMV promoter. Here, we report that the Tax protein of human T-lymphotropic virus stimulates the transgene expression under the control of CMV MIE promoter in HEK293 cells. At least threefold increases in transient production of recombinant proteins, including luciferase and two biopharmaceutical proteins (erythropoietin and interferon-γ), were detected. Furthermore, cyclic adenosine monophosphate (AMP)-response element binding protein 2 (CREB2) was identified as a cellular cofactor, which might be responsible for Tax transactivation of the CMV MIE promoter. Our results not only demonstrate the potential use of this novel expression strategy for improvement of recombinant protein production in HEK293 cells but also provide the molecular mechanism for Tax-mediated activation of CMV MIE promoter. PMID:21425252

  7. Immediate-early gene transcriptional activation in hippocampus CA1 and CA3 does not accurately reflect rapid, pattern completion-based retrieval of context memory

    PubMed Central

    Pevzner, Aleksandr

    2015-01-01

    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual representation. Despite differences in behavior, we did not find any difference in CA1 or CA3 IEG activity associated with this rapid recall phase when comparing context preexposed and non-pre-exposed groups. These findings indicate that IEG activation in CA1 and CA3 is not an accurate readout of the neural activity associated with hippocampus-dependent rapid memory retrieval. PMID:25512571

  8. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    SciTech Connect

    Kenney, S.; Kamine, J.; Markovitz, D.; Fenrick, R.; Pagano, J.

    1988-03-01

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses.

  9. Intranasal application of vasopressin fails to elicit changes in brain immediate early gene expression, neural activity and behavioral performance of rats

    PubMed Central

    Ludwig, Mike; Tobin, Vicky A.; Callahan, Michael F.; Papadaki, Eirini; Becker, Axel; Engelmann, Mario; Leng, Gareth

    2013-01-01

    Intranasal administration has been widely used to investigate effects of the neuropeptides vasopressin and oxytocin on human behaviors and neurological disorders, but exactly what happens when these neuropeptides are administered intranasally is far from clear. In particular, it is not clear whether a physiological significant amount of peptide enters the brain to account for the observed effects. Here, we investigated whether intranasal administration of vasopressin and oxytocin to rats induces expression of the immediate-early gene product Fos in brain areas that are sensitive to centrally administered peptide, whether it alters neuronal activity in the way that centrally administered peptide does, and whether it affects behavior in ways expected from studies of centrally administered peptide. We found that, whereas intracerebroventricular (icv) injection of very low doses of vasopressin or oxytocin increased Fos expression in several distinct brain regions, intranasal administration of large doses of the peptides had no significant effect. In contrast to the effects of vasopressin applied topically to the main olfactory bulb, we saw no changes in the electrical activity of olfactory bulb mitral cells after intranasal vasopressin administration. In addition, vasopressin given intranasally had no significant effects on social recognition or short-term recognition memory. Finally, intranasal infusions of vasopressin had no significant effects on the parameters monitored on the elevated plus maze, a rodent model of anxiety. Our data in rats suggest that, after intranasal administration, significant amounts of vasopressin and oxytocin do not reach areas in the brain at levels sufficient to change immediate early gene expression, neural activity or behavior in the ways described for central administration of the peptides. PMID:23656518

  10. Human cytomegalovirus pp65- and immediate early 1 antigen-specific HLA class I-restricted cytotoxic T cell responses induced by cross-presentation of viral antigens.

    PubMed

    Tabi, Z; Moutaftsi, M; Borysiewicz, L K

    2001-05-01

    Dendritic cells (DCs) play a pivotal role in the development of anti-viral CD8(+) CTL responses. This is straightforward if they are directly infected with virus, but is less clear in response to viruses that cannot productively infect DCS: Human CMV (HCMV) shows strain-specific cell tropism: fibroblast (Fb)-adapted laboratory strains (AD169) and recent clinical isolates do not infect DCs, whereas endothelial cell-adapted strains (TB40/E) result in productive lytic DC infection. However, we show here that uninfected DCs induce CD8(+) T cell cytotoxicity and IFN-gamma production against HCMV pp65 and immediate early 1 Ags following in vitro coculture with HCMV-AD169-infected Fbs, regardless of the HLA type of these FBS: CD8(+) T cell stimulation was inhibited by pretreatment of DCs with cytochalasin B or brefeldin A, indicating a phagosome/endosome to cytosol pathway. HCMV-infected Fbs were not apoptotic as measured by annexin V binding, and induction of apoptosis of infected Fbs in vitro did not augment CTL induction by DCs, suggesting a mechanism other than apoptosis in the initiation of cross-presentation. Furthermore, HCMV-infected Fbs provided a maturation signal for immature DCs during coculture, as evidenced by increased CD83 and HLA class II expression. Cross-presentation of HCMV Ags by host DCs enables these professional APCs to bypass some of the evasion mechanisms HCMV has developed to avoid T cell recognition. It may also serve to explain the presence of immediate early 1 Ag-specific CTLs in the face of pp65-induced inhibition of Ag presentation at the level of the infected cell. PMID:11313411

  11. Co-inheritance of compound heterozygous Hb Constant Spring and a single -alpha(3.7) gene deletion with heterozygous deltabeta thalassaemia: a diagnostic challenge.

    PubMed

    Azma, Raja Zahratul; Othman, Ainoon; Azman, Norazlina; Alauddin, Hafiza; Ithnin, Azlin; Yusof, Nurasyikin; Razak, Noor Farisah; Sardi, Nor Hidayati; Hussin, Noor Hamidah

    2012-06-01

    Haemoglobin Constant Spring (Hb CS) mutation and single gene deletions are common underlying genetic abnormalities for alpha thalassaemias. Co-inheritance of deletional and non-deletional alpha (alpha) thalassaemias may result in various thalassaemia syndromes. Concomitant co-inheritance with beta (beta) and delta (delta) gene abnormalities would result in improved clinical phenotype. We report here a 33-year-old male patient who was admitted with dengue haemorrhagic fever, with a background history of Grave's disease, incidentally noted to have mild hypochromic microcytic red cell indices. Physical examination revealed no thalassaemic features or hepatosplenomegaly. His full blood picture showed hypochromic microcytic red cells with normal haemoglobin (Hb) level. Quantitation of Hb using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE) revealed raised Hb F, normal Hb A2 and Hb A levels. There was also small peak of Hb CS noted in CE. H inclusions was negative. Kleihauer test was positive with heterocellular distribution of Hb F among the red cells. DNA analysis for alpha globin gene mutations showed a single -alpha(-3.7) deletion and Hb CS mutation. These findings were suggestive of compound heterozygosity of Hb CS and a single -alpha(-3.7) deletion with a concomitant heterozygous deltabeta thalassaemia. Co-inheritance of Hb CS and a single -alpha(-3.7) deletion is expected to result at the very least in a clinical phenotype similar to that of two alpha genes deletion. However we demonstrate here a phenotypic modification of alpha thalassemia presumptively as a result of co-inheritance with deltabeta chain abnormality as suggested by the high Hb F level. PMID:22870600

  12. A new reporter mouse cytomegalovirus reveals maintained immediate-early gene expression but poor virus replication in cycling liver sinusoidal endothelial cells

    PubMed Central

    2013-01-01

    Background The MCMV major immediate early promoter/enhancer (MIEP) is a bidirectional promoter that drives the expression of the three immediate early viral genes, namely ie1, ie2 and ie3. The regulation of their expression is intensively studied, but still incompletely understood. Methods We constructed a reporter MCMV, (MCMV-MIEPr) expressing YFP and tdTomato under the control of the MIEP as proxies of ie1 and ie2, respectively. Moreover, we generated a liver sinusoidal endothelial cell line (LSEC-uniLT) where cycling is dependent on doxycycline. We used these novel tools to study the kinetics of MIEP-driven gene expression in the context of infection and at the single cell level by flow cytometry and by live imaging of proliferating and G0-arrested cells. Results MCMV replicated to higher titers in G0-arrested LSEC, and cycling cells showed less cytopathic effect or YFP and tdTomato expression at 5 days post infection. In the first 24 h post infection, however, there was no difference in MIEP activity in cycling or G0-arrested cells, although we could observe different profiles of MIEP gene expression in different cell types, like LSECs, fibroblasts or macrophages. We monitored infected LSEC-uniLT in G0 by time lapse microscopy over five days and noticed that most cells survived infection for at least 96 h, arguing that quick lysis of infected cells could not account for the spread of the virus. Interestingly, we noticed a strong correlation between the ratio of median YFP and tdTomato expression and length of survival of infected cells. Conclusion By means of our newly developed genetic tools, we showed that the expression pattern of MCMV IE1 and IE2 genes differs between macrophages, endothelial cells and fibroblasts. Substantial and cell-cycle independent differences in the ie1 and ie2 transcription could also be observed within individual cells of the same population, and marked ie2 gene expression was associated with longer survival of the infected cells

  13. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  14. Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress

    PubMed Central

    Jensen, Sheila I.; Lennen, Rebecca M.; Herrgård, Markus J.; Nielsen, Alex T.

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains in which four to seven genes were deleted in E. coli W and E. coli K-12. The growth rate of an E. coli K-12 quintuple deletion strain was significantly improved in the presence of high concentrations of acetate and NaCl. In conclusion, we have generated a method that enables efficient and simultaneous deletion of multiple genes in several E. coli variants. The method enables deletion of up to seven genes in as little as seven days. PMID:26643270

  15. The immediate early gene Arc is associated with behavioral resilience to stress exposure in an animal model of posttraumatic stress disorder.

    PubMed

    Kozlovsky, Nitsan; Matar, Michael A; Kaplan, Zeev; Kotler, Moshe; Zohar, Joseph; Cohen, Hagit

    2008-02-01

    Mechanisms involved in adaptative and maladaptive changes in neural plasticity and synaptic efficacy in various brain areas are pivotal to understanding the physiology of the response to stress and the pathophysiology of posttraumatic stress disorder (PTSD). Activity-regulated cytoskeletal-associated protein (Arc) is an effector immediate early gene (IEG) which has direct effects on intracellular homeostatic functions. Increased expression of Arc has been associated with increased neuronal activity and with consolidation of long-term memory. It may thus play an important role in mediating experience-induced reorganization and/or development of synaptic connections. This study sought to characterize the pattern of expression of mRNA for the Arc gene in selected brain areas of test subjects classified according to their individual pattern of behavioral response to a stressor, correlated with circulating levels of corticosterone (as a physiological marker of stress response). The hippocampal CA1 and CA3 subregions of individuals whose behavior was minimally or partially disrupted in response to predator scent stress demonstrated significantly increased levels of mRNA for Arc, compared to unexposed controls. The group whose behavior was severely disrupted demonstrated no such upregulation. Consistent with the hypothesis that the Arc gene has a promoting effect on neuronal function and/or structural changes, the lack of Arc expression in the behaviorally and physiologically more severely affected individuals raises the possibility that Arc may be associated with resilience and/or recovery after stress exposure. PMID:17611082

  16. Activation of stress-activated MAP protein kinases up-regulates expression of transgenes driven by the cytomegalovirus immediate/early promoter.

    PubMed Central

    Bruening, W; Giasson, B; Mushynski, W; Durham, H D

    1998-01-01

    The immediate/early promoter/enhancer of cytomegalovirus (CMV promoter) is one of the most commonly used promoters for expression of transgenes in eukaryotic cells. In practice, the CMV promoter is often thought of as a constitutively active unregulated promoter. However, we have observed that transcription from the CMV promoter can be up-regulated by a variety of environmental stresses. Many forms of cellular stress stimulate MAP kinase signalling pathways, resulting in activation of stress-activated protein kinases [SAPKs, also called Jun N-terminal kinases (JNKs)] and p38 kinases. We have found that the same conditions that lead to activation of SAPK/JNKs and p38 kinases can also dramatically increase expression from the CMV promoter. Inhibitors of p38 kinases abolished basal transcription from the CMV promoter and completely blocked stress-induced up-regulation of the CMV promoter. Overexpression of a dominant negative JNK kinase had no effect on basal transcription, but significantly reduced up-regulation caused by stress. These results have grave implications for use of the CMV promoter. If the CMV promoter can be up-regulated by cellular stresses, inadvertent activation of the stress kinase pathways may complicate, if not invalidate, the interpretation of a wide range of experiments. PMID:9421504

  17. Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)

    NASA Astrophysics Data System (ADS)

    Sayaka, Shimomura-Umemura; Ijiri, Kenichi

    2006-01-01

    Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

  18. Isolation rearing attenuates social interaction-induced expression of immediate early gene protein products in the medial prefrontal cortex of male and female rats

    PubMed Central

    Wall, Vanessa L.; Fischer, Eva K.; Bland, Sondra T.

    2013-01-01

    Early life adversity and stress in humans has been related to a number of psychological disorders including anxiety, depression, and addiction. The present study used isolation rearing, a well-characterized animal model of early life adversity, to examine its effects on social behavior and immediate early gene (IEG) expression produced by exposure to a novel social experience. Male and female rats were housed in same-sex groups or in isolation for 4 weeks beginning at weaning and were tested during late adolescence. The protein products of the IEGs c-fos and Arc, as well as the neurotrophic factor BDNF were assessed in medial prefrontal cortex (mPFC) subregions (anterior cingulate, prelimbic and infralimbic) using immunohistochemistry. Aggressive and non-aggressive behaviors during novel social exposure were also assessed. Exposure to a novel conspecific produced increases in Arc and c-fos activation in the mPFC of group reared animals in a sex- and subregion-dependent fashion compared to no social exposure controls, but this increase was blunted or absent in isolated animals. Isolates engaged in more social interactions and more aggressive behavior than group reared rats. Sex differences in some behaviors as well as in Arc and BDNF expression were observed. These results indicate that isolation rearing alters IEG activation in the mPFC produced by exposure to a novel conspecific, in addition to changing social behavior, and that these effects depend in part on sex. PMID:22982514

  19. The herpes simplex virus type 1 immediate-early protein ICP0 is necessary for the efficient establishment of latent infection.

    PubMed

    Wilcox, C L; Smith, R L; Everett, R D; Mysofski, D

    1997-09-01

    The immediate-early protein ICP0 of herpes simplex virus type 1 (HSV-1) is not essential for viral replication. However, ICP0 is important for efficient viral replication during the productive infection and for reactivation of latent HSV-1 in vivo. The in vitro model of HSV-1 latency in dorsal root ganglia neurons was used to examine the role of ICP0 in the individual steps that could lead to the appearance of a decreased reactivation phenotype of ICP0 mutant viruses. After establishment of latent infections in the neuronal cultures, induction of reactivation by nerve growth factor (NGF) deprivation resulted in the production of infectious virus with delayed kinetics and a burst size that was significantly decreased for the ICP0 mutants compared with wild-type HSV-1. The efficiency of establishment of latency with the ICP0 mutants was similarly decreased at least 10-fold, as measured by three criteria: (i) the percentage of neurons expressing the major latency-associated transcript during the latent infection, (ii) the amount of viral DNA detected in the neuronal cultures, and (iii) the percentage of neurons expressing ICP4 immunoreactivity after the induction of reactivation. The most striking finding was that ICP0 supplied by an adenovirus vector significantly restored the ability of an ICP0 mutant to establish latency and reactivation. These results strongly indicate a critical role for ICP0 in the establishment of the latent HSV-1 infection in the in vitro neuronal model. PMID:9261402

  20. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell. PMID:26143921

  1. The Epstein-Barr Virus Immediate-Early Gene Product, BRLF1, Interacts with the Retinoblastoma Protein during the Viral Lytic Cycle

    PubMed Central

    Zacny, Valerie L.; Wilson, Julie; Pagano, Joseph S.

    1998-01-01

    Retinoblastoma protein (Rb) is a key regulator of cellular proliferation, controlling entry into G1/S in the cell cycle, largely through its action in binding the cellular transcription factor E2F, which activates genes important in DNA synthesis. Small DNA tumor viruses encode gene products which can functionally inactivate Rb, promoting cellular proliferation and viral DNA synthesis. In this study, the Epstein-Barr virus (EBV) immediate-early lytic gene product, BRLF1 (R), is shown to bind Rb in vivo, shortly after induction of the viral lytic cycle in EBV-infected Akata cells. Furthermore, the temporal kinetics of R-Rb interaction correlate with displacement of E2F1 from Rb. Mapping of the domains required for the interaction of R and Rb proteins reveals that R binds specifically to the N terminus of Rb, outside the Rb pocket, and that the first 200 amino acids of R are required for this interaction. The interaction of R and Rb may initiate cell cycle progression and facilitate viral DNA synthesis during lytic replication. PMID:9733844

  2. Dynamic shifts in corticostriatal expression patterns of the immediate early genes Homer 1a and Zif268 during early and late phases of instrumental training.

    PubMed

    Hernandez, Pepe J; Schiltz, Craig A; Kelley, Ann E

    2006-01-01

    Adaptive motor actions require prior knowledge of instrumental contingencies. With practice, these actions can become highly automatic in nature. However, the molecular and anatomical substrates mediating these related forms of learning are not understood. In the present study, we used in situ hybridization to measure the mRNA levels of two immediate early genes (IEGs) in an instrumental paradigm where rats learned to lever-press for food. We report that after three training sessions, Homer 1a and Zif268 (an effector and regulatory IEG, respectively) were significantly induced within an extensive corticostriatal network relative to untrained controls. With extended training (23 sessions), however, a shift in the expression patterns of the two genes was evident. Expression of Homer 1a (official symbol Homer1) decreased significantly in frontal and cingulate cortices, whereas striatal expression was generally maintained. Interestingly, Homer 1a expression markedly increased with extensive training in the ventrolateral region of the striatum (VLS) relative to early learners, suggesting that plasticity in the VLS is required for the efficient production of the learned behavior or in habit formation. Zif268 (official symbol Egr1) expression generally decreased with extensive training; however, these changes were not significant. These results demonstrate for the first time, on a molecular level, a dynamic shift in the contribution of corticostriatal systems mediating the early acquisition and consolidation of goal-directed responses to those engaged after extensive training. PMID:17015857

  3. Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

    PubMed

    Mukilan, Murugan; Ragu Varman, Durairaj; Sudhakar, Sivasubramaniam; Rajan, Koilmani Emmanuvel

    2015-04-01

    The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C. sphinx. However, the infusion of AS-ODN post-training did not cause a deficit in memory formation. Furthermore, the inhibition of miR-132 reduced the olfactory training-induced expression of IEGs and post synaptic density protein-95 (PSD-95) in the OB. Additionally, we show that miR-132 regulates the activation of calcium/calmodulin-dependent protein kinase-II (CaMKII) and cAMP response element binding protein (CREB), possibly through miR-148a. These data suggest that olfactory training induces the expression of miR-132 and IEGs, which in turn activates post-synaptic proteins that regulate olfactory memory formation. PMID:25725166

  4. Regulated transcription of the immediate-early gene Zif268: mechanisms and gene dosage-dependent function in synaptic plasticity and memory formation.

    PubMed

    Bozon, Bruno; Davis, Sabrina; Laroche, Serge

    2002-01-01

    The immediate-early gene Zif268 is a member of the Egr family of inducible transcription factors. Data from gene expression studies have suggested that this gene may play a critical role in initial triggering of the genetic machinery that has long been considered a necessary mechanism for maintenance of the later phases of LTP and also for the consolidation or stabilization of long-lasting memories. Until recently, however, the data supporting this assumption have been based primarily on circumstantial evidence, with no direct evidence to suggest that Zif268 is required for long-lasting synaptic plasticity and memory. In this report, we review our own data using Zif268 mutant mice; we show that although the early phase of dentate gyrus LTP is normal in these mice, the later phases are not present, and the ability of the mice to maintain learned information over a 24-h period is deficient. In addition, we present new information showing a task-dependent gene dosage effect in Zif268 heterozygous mice. We show that spatial learning is particularly sensitive to reduced levels of Zif268, as one-half of the complement of Zif268 in heterozygous mice is insufficient to maintain spatial long-term memories. PMID:12440572

  5. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  6. Replication origins and a sequence involved in coordinate induction of the immediate-early gene family are conserved in an intergenic region of herpes simplex virus.

    PubMed Central

    Whitton, J L; Clements, J B

    1984-01-01

    We have determined the structure of the 5' portion of herpes simplex virus type 2 (HSF-2) immediate-early (IE) mRNA-3 and have obtained the DNA sequence specifying the N terminus of its encoded polypeptide, Vmw182, its untranslated leader and the intergenic region between IEmRNAs-3 & 4/5. Comparison of the HSV-2 intergenic sequences with the HSV-1 equivalent region identifies several conserved regions: (1) an AT-rich element with core consensus TAATGARAT which is likely to be the 'activator' sequence through which coordinate induction of the IE gene family is mediated. (2) GC-rich and GA-rich tracts, found in a wide variety of eukaryotic promoters, which vary in position and orientation between HSV-2 and HSV-1 and which represent modulators of transcription. (3) TATA homologies present 15-25 base pairs (bp) upstream of mRNA 5' termini. (4) a 137bp direct repeat in HSV-2 which contains sequence almost identical to the HSV-1 replication origin. Images PMID:6322134

  7. Transcriptional activation and repression by Fos are independent functions: the C terminus represses immediate-early gene expression via CArG elements.

    PubMed

    Gius, D; Cao, X M; Rauscher, F J; Cohen, D R; Curran, T; Sukhatme, V P

    1990-08-01

    The Fos-Jun complex has been shown to activate transcription through the regulatory element known as the AP-1 binding site. We show that Fos down regulates several immediate-early genes (c-fos, Egr-1, and Egr-2) after mitogenic stimulation. Specifically, we demonstrate that the target for this repression is a sequence of the form CC(A/T)6GG, also known as a CArG box. Whereas Fos bound to the AP-1 site through a domain rich in basic amino acids and associated with Jun via a leucine zipper interaction, mutant Fos proteins lacking these structures were still capable of causing repression. Furthermore, Jun neither enhanced nor inhibited down regulation by Fos. Critical residues required for repression are located within the C-terminal 27 amino acids of c-Fos, since v-Fos and C-terminal truncations of c-Fos did not down regulate. In addition, transfer of 180 c-Fos C-terminal amino acids to Jun conferred upon it the ability to repress. Finally, Fra-1, a Fos-related protein which has striking similarity to Fos in its C-terminal 40 amino acids, also down regulated Egr-1 expression. Thus, Fos is a transcriptional regulator that can activate or repress gene expression by way of two separate functional domains that act on distinct regulatory elements. PMID:2115122

  8. The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

    PubMed Central

    Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

    2010-01-01

    The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

  9. Characterization of Xylan Utilization and Discovery of a New Endoxylanase in Thermoanaerobacterium saccharolyticum through Targeted Gene Deletions

    PubMed Central

    Podkaminer, Kara K.; Guss, Adam M.; Trajano, Heather L.; Hogsett, David A.

    2012-01-01

    The economical production of fuels and commodity chemicals from lignocellulose requires the utilization of both the cellulose and hemicellulose fractions. Xylanase enzymes allow greater utilization of hemicellulose while also increasing cellulose hydrolysis. Recent metabolic engineering efforts have resulted in a strain of Thermoanaerobacterium saccharolyticum that can convert C5 and C6 sugars, as well as insoluble xylan, into ethanol at high yield. To better understand the process of xylan solubilization in this organism, a series of targeted deletions were constructed in the homoethanologenic T. saccharolyticum strain M0355 to characterize xylan hydrolysis and xylose utilization in this organism. While the deletion of β-xylosidase xylD slowed the growth of T. saccharolyticum on birchwood xylan and led to an accumulation of short-chain xylo-oligomers, no other single deletion, including the deletion of the previously characterized endoxylanase XynA, had a phenotype distinct from that of the wild type. This result indicates a multiplicity of xylanase enzymes which facilitate xylan degradation in T. saccharolyticum. Growth on xylan was prevented only when a previously uncharacterized endoxylanase encoded by xynC was also deleted in conjunction with xynA. Sequence analysis of xynC indicates that this enzyme, a low-molecular-weight endoxylanase with homology to glycoside hydrolase family 11 enzymes, is secreted yet untethered to the cell wall. Together, these observations expand our understanding of the enzymatic basis of xylan hydrolysis by T. saccharolyticum. PMID:23023741

  10. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system.

    PubMed

    Song, Yuning; Yuan, Lin; Wang, Yong; Chen, Mao; Deng, Jichao; Lv, Qingyan; Sui, Tingting; Li, Zhanjun; Lai, Liangxue

    2016-08-01

    The CRISPR RNA-guided Cas9 nuclease gene-targeting system has been extensively used to edit the genome of several organisms. However, most mutations reported to date have been are indels, resulting in multiple mutations and numerous alleles in targeted genes. In the present study, a large deletion of 105 kb in the TYR (tyrosinase) gene was generated in rabbit via a dual sgRNA-directed CRISPR/Cas9 system. The typical symptoms of albinism accompanied significantly decreased expression of TYR in the TYR knockout rabbits. Furthermore, the same genotype and albinism phenotype were found in the F1 generation, suggesting that large-fragment deletions can be efficiently transmitted to the germline and stably inherited in offspring. Taken together, our data demonstrate that mono and biallelic large deletions can be achieved using the dual sgRNA-directed CRISPR/Cas9 system. This system produces no mosaic mutations or off-target effects, making it an efficient tool for large-fragment deletions in rabbit and other organisms. PMID:26817461

  11. Characterization of xylan utilization and discovery of a new endoxylanase in Thermoanaerobacterium saccharolyticum through targeted gene deletions

    SciTech Connect

    Podkaminer, Kara K; Guss, Adam M; McKenzie, Heather; Hogsett, David; Lynd, Lee R

    2012-01-01

    The economical production of fuels and commodity chemicals from lignocellulose requires the utilization of both the cellulose and hemicellulose fractions. Xylanase enzymes allow greater utilization of hemicellulose while also increasing cellulose hydrolysis. Recent metabolic engineering efforts have resulted in a strain of Thermoanaerobacterium saccharolyticum that can convert C(5) and C(6) sugars, as well as insoluble xylan, into ethanol at high yield. To better understand the process of xylan solubilization in this organism, a series of targeted deletions were constructed in the homoethanologenic T. saccharolyticum strain M0355 to characterize xylan hydrolysis and xylose utilization in this organism. While the deletion of -xylosidase xylD slowed the growth of T. saccharolyticum on birchwood xylan and led to an accumulation of short-chain xylo-oligomers, no other single deletion, including the deletion of the previously characterized endoxylanase XynA, had a phenotype distinct from that of the wild type. This result indicates a multiplicity of xylanase enzymes which facilitate xylan degradation in T. saccharolyticum. Growth on xylan was prevented only when a previously uncharacterized endoxylanase encoded by xynC was also deleted in conjunction with xynA. Sequence analysis of xynC indicates that this enzyme, a low-molecular-weight endoxylanase with homology to glycoside hydrolase family 11 enzymes, is secreted yet untethered to the cell wall. Together, these observations expand our understanding of the enzymatic basis of xylan hydrolysis by T. saccharolyticum.

  12. Single tube genotyping of CYP2A6 gene deletion based on copy number determination by quantitative real-time PCR.

    PubMed

    Liu, Jin-hui; Xun, Xiao-jie; Pang, Cong; Ma, Jun; Zou, Hui; Chen, Chao; Dai, Peng-gao

    2014-12-01

    The CYP2A6*4 allele, characterized as the whole deletion of this gene, is closely associated with nicotine dependence, cancer susceptibility, and drug responsiveness. It has long been a significant challenge for pharmacogenetics scientists to develop a reliable method to detect this molecular variant due to its high homology with its homologous genes CYP2A6 and CYP2A3 in the clinical setting. Here, we introduce a quantitative real-time PCR assay that specifically amplifies CYP2A6 by designing a specific set of primers and the probe, which effectively prevent the amplification of the CYP2A7 and CYP2A13 alleles. CYP2A6 gene copy numbers were normalized to albumin (ALB) which was co-amplified simultaneously in a single-tube duplex reaction and at a setting as the internal reference gene. The established assay was validated with a selection of previously genotyped DNA samples, which harbored none, one or two CYP2A6 gene copies. The results were in complete concordance with previously published data and no overlap between the three groups was observed. Further analysis of a cohort of 120 samples revealed high specificity and sensitivity of this assay as demonstrated by the agreement of determined gene copy numbers in all of the cases. In conclusion, this novel assay allows reliable and sensitive detection of the CYP2A6 gene deletion, which will be useful for pharmacogenetics studies and routine clinical settings. PMID:25446842

  13. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice.

    PubMed

    Silva-Valenzuela, Cecilia A; Molina-Quiroz, Roberto C; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A; McClelland, Michael

    2015-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented Kan(R), SGD-K, or antisense-oriented Cam(R), SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems. PMID:26779130

  14. Conditional gene deletion with DiCre demonstrates an essential role for CRK3 in L eishmania mexicana cell cycle regulation

    PubMed Central

    Duncan, Samuel M.; Myburgh, Elmarie; Philipon, Cintia; Brown, Elaine; Meissner, Markus; Brewer, James

    2016-01-01

    Summary Leishmania mexicana has a large family of cyclin‐dependent kinases (CDKs) that reflect the complex interplay between cell cycle and life cycle progression. Evidence from previous studies indicated that Cdc2‐related kinase 3 (CRK3) in complex with the cyclin CYC6 is a functional homologue of the major cell cycle regulator CDK1, yet definitive genetic evidence for an essential role in parasite proliferation is lacking. To address this, we have implemented an inducible gene deletion system based on a dimerised Cre recombinase (diCre) to target CRK3 and elucidate its role in the cell cycle of L. mexicana. Induction of diCre activity in promastigotes with rapamycin resulted in efficient deletion of floxed CRK3, resulting in G2/M growth arrest. Co‐expression of a CRK3 transgene during rapamycin‐induced deletion of CRK3 resulted in complementation of growth, whereas expression of an active site CRK3 T178E mutant did not, showing that protein kinase activity is crucial for CRK3 function. Inducible deletion of CRK3 in stationary phase promastigotes resulted in attenuated growth in mice, thereby confirming CRK3 as a useful therapeutic target and diCre as a valuable new tool for analyzing essential genes in Leishmania. PMID:26991545

  15. Third case of 8q23.3-q24.13 deletion in a patient with Langer-Giedion syndrome phenotype without TRPS1 gene deletion.

    PubMed

    Pereza, Nina; Severinski, Srećko; Ostojić, Saša; Volk, Marija; Maver, Aleš; Dekanić, Kristina Baraba; Kapović, Miljenko; Peterlin, Borut

    2012-03-01

    Langer-Giedion syndrome (LGS) is a contiguous gene syndrome caused by a hemizygous deletion on chromosome 8q23.3-q24.11 involving TRPS1 and EXT1 genes. We report on a girl with LGS phenotype and a 7.5 Mb interstitial deletion at chromosome 8q23.3-q24.13. Array-comparative genomic hybridization (a-CGH) revealed a deletion encompassing only the EXT1 and not the TRPS1 gene. Even though the deletion of TRPS1 and EXT1 genes is responsible for craniofacial and skeletal features of LGS, there have been previous reports of patients with LGS phenotype and 8q24 deletions leaving the TRPS1 gene intact. To our knowledge, this is the third such case. Our patient differs from previously reported LGS patients without TRPS1 gene deletion in that she has the typical LGS facial dysmorphism and skeletal abnormalities. However, the girl is of normal height and has only a mild developmental delay. Additionally, she has dyslalia and premature adrenarche classified as Tanner stage 3 premature pubarche which have not yet been described as features of LGS. We examine the molecular breakpoints and phenotypes of our patient and previously reported cases. PMID:22315192

  16. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice

    PubMed Central

    Silva-Valenzuela, Cecilia A.; Molina-Quiroz, Roberto C.; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M.; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A.; McClelland, Michael

    2016-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented KanR, SGD-K, or antisense-oriented CamR, SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems. PMID:26779130

  17. The time course of systems consolidation of spatial memory from recent to remote retention: A comparison of the Immediate Early Genes Zif268, c-Fos and Arc.

    PubMed

    Barry, Daniel N; Coogan, Andrew N; Commins, Sean

    2016-02-01

    Systems consolidation is a process involving the stabilisation of memory traces in the neocortex over time. The medial prefrontal cortex becomes increasingly important during the retrieval of older memories, however the timescale of its involvement is unclear, and the contribution of other neocortical brain regions to remote memory have received little attention. The Immediate Early Genes (IEGs) Zif268, c-Fos and Arc have been utilised as markers of neural activity during spatial memory retrieval, however the lack of a direct comparison between them hinders the interpretation of results. To address these questions, we examined the expression of Zif268, Arc and c-Fos protein in the medial prefrontal cortex, as well as the hippocampus, and the entorhinal, perirhinal, retrosplenial and parietal cortices of male Wistar rats following a probe trial of the Morris water maze either one day, seven days, 14 days or 30 days after acquisition. Activity of the medial prefrontal cortex during retrieval, as measured by all three IEGs, increased in correspondence with the age of the memory, reaching significance between 14 and 30 days. Similar increases in c-Fos and Arc were observed over the course of consolidation in other neocortical and parahippocampal areas, however this pattern was not observed with Zif268. Activity of the hippocampus remained largely unchanged across retention intervals. These findings suggest that systems consolidation of spatial memory takes at least two weeks, are consistent with an ongoing role for the hippocampus in the retrieval of spatial memory, and suggest that c-Fos and Arc may be a more sensitive measure of neural activity in response to behavioural tasks than Zif268. PMID:26748021

  18. Role of immediate early protein ICP27 in the differential sensitivity of herpes simplex viruses 1 and 2 to leptomycin B.

    PubMed

    Park, Donglim; Lengyel, Joy; Rice, Stephen A

    2013-08-01

    Leptomycin B (LMB) is a highly specific inhibitor of CRM1, a cellular karyopherin-β that transports nuclear export signal-containing proteins from the nucleus to the cytoplasm. Previous work has shown that LMB blocks herpes simplex virus 1 (HSV-1) replication in Vero cells and that certain mutations in viral immediate early protein ICP27 can confer LMB resistance. However, little is known of the molecular mechanisms involved. Here we report that HSV-2, a close relative of HSV-1, is naturally resistant to LMB. To see whether the ICP27 gene determines this phenotypic difference, we generated an HSV-1 mutant that expresses the HSV-2 ICP27 instead of the HSV-1 protein. This recombinant was fully sensitive to LMB, indicating that one or more other viral genes must be important in determining HSV-2's LMB-resistant phenotype. In additional work, we report several findings that shed light on how HSV-1 ICP27 mutations can confer LMB resistance. First, we show that LMB treatment of HSV-1-infected cells leads to suppression of late viral protein synthesis and a block to progeny virion release. Second, we identify a novel type of ICP27 mutation that can confer LMB resistance, that being the addition of a 100-residue amino-terminal affinity purification tag. Third, by studying infections where both LMB-sensitive and LMB-resistant forms of ICP27 are present, we show that HSV-1's sensitivity to LMB is dominant to its resistance. Together, our results suggest a model in which the N-terminal portion of ICP27 mediates a nonessential activity that interferes with HSV-1 replication when CRM1 is inactive. We suggest that LMB resistance mutations weaken or abrogate this activity. PMID:23740995

  19. Prenatal exposure to moderate levels of ethanol alters social behavior in adult rats: Relationship to structural plasticity and immediate early gene expression in frontal cortex

    PubMed Central

    Hamilton, Derek A.; Akers, Katherine G.; Rice, James P.; Johnson, Travis E.; Candelaria-Cook, Felicha T.; Maes, Levi I.; Rosenberg, Martina; Valenzuela, C. Fernando; Savage, Daniel D.

    2009-01-01

    The goals of the present study were to characterize the effects of prenatal exposure to moderate levels of ethanol on adult social behavior, and to evaluate fetal-ethanol-related effects on dendritic morphology, structural plasticity and activity-related immediate early gene (IEG) expression in the agranular insular (AID) and prelimbic (Cg3) regions of frontal cortex. Baseline fetal-ethanol-related alterations in social behavior were limited to reductions in social investigation in males. Repeated experience with novel cage-mates resulted in comparable increases in wrestling and social investigation among saccharin- and ethanol-exposed females, whereas social behavioral effects among males were more evident in ethanol-exposed animals. Male ethanol-exposed rats also displayed profound increases in wrestling when social interaction was motivated by 24 hours of isolation. Baseline decreases in dendritic length and spine density in AID were observed in ethanol-exposed rats that were always housed with the same cage-mate. Modest experience-related decreases in dendritic length and spine density in AID were observed in saccharin-exposed rats housed with various cage-mates. In contrast, fetal-ethanol-exposed rats displayed experience-related increases in dendritic length in AID, and no experience-related changes in spine density. The only effect observed in Cg3 was a baseline increase in basilar dendritic length among male ethanol-exposed rats. Robust increases in activity-related IEG expression in AID (c-fos and Arc) and Cg3 (c-fos) were observed following social interaction in saccharin-exposed rats, however, activity-related increases in IEG expression were not observed in fetal-ethanol-exposed rats in either region. The results indicate that deficits in social behavior are among the long-lasting behavioral consequences of moderate ethanol exposure during brain development, and implicate AID, and to a lesser degree Cg3, in fetal-ethanol-related social behavior

  20. The murine gammaherpesvirus immediate-early Rta synergizes with IRF4, targeting expression of the viral M1 superantigen to plasma cells.

    PubMed

    O'Flaherty, Brigid M; Soni, Tanushree; Wakeman, Brian S; Speck, Samuel H

    2014-08-01

    MHV68 is a murine gammaherpesvirus that infects laboratory mice and thus provides a tractable small animal model for characterizing critical aspects of gammaherpesvirus pathogenesis. Having evolved with their natural host, herpesviruses encode numerous gene products that are involved in modulating host immune responses to facilitate the establishment and maintenance of lifelong chronic infection. One such protein, MHV68 M1, is a secreted protein that has no known homologs, but has been shown to play a critical role in controlling virus reactivation from latently infected macrophages. We have previous demonstrated that M1 drives the activation and expansion of Vβ4+ CD8+ T cells, which are thought to be involved in controlling MHV68 reactivation through the secretion of interferon gamma. The mechanism of action and regulation of M1 expression are poorly understood. To gain insights into the function of M1, we set out to evaluate the site of expression and transcriptional regulation of the M1 gene. Here, using a recombinant virus expressing a fluorescent protein driven by the M1 gene promoter, we identify plasma cells as the major cell type expressing M1 at the peak of infection in the spleen. In addition, we show that M1 gene transcription is regulated by both the essential viral immediate-early transcriptional activator Rta and cellular interferon regulatory factor 4 (IRF4), which together potently synergize to drive M1 gene expression. Finally, we show that IRF4, a cellular transcription factor essential for plasma cell differentiation, can directly interact with Rta. The latter observation raises the possibility that the interaction of Rta and IRF4 may be involved in regulating a number of viral and cellular genes during MHV68 reactivation linked to plasma cell differentiation. PMID:25101696

  1. Gene expression profiling in a mouse model of infantile neuronal ceroid lipofuscinosis reveals upregulation of immediate early genes and mediators of the inflammatory response

    PubMed Central

    Qiao, Xingwen; Lu, Jui-Yun; Hofmann, Sandra L

    2007-01-01

    Background The infantile form of neuronal ceroid lipofuscinosis (also known as infantile Batten disease) is caused by hereditary deficiency of a lysosomal enzyme, palmitoyl-protein thioesterase-1 (PPT1), and is characterized by severe cortical degeneration with blindness and cognitive and motor dysfunction. The PPT1-deficient knockout mouse recapitulates the key features of the disorder, including seizures and death by 7–9 months of age. In the current study, we compared gene expression profiles of whole brain from PPT1 knockout and normal mice at 3, 5 and 8 months of age to identify temporal changes in molecular pathways implicated in disease pathogenesis. Results A total of 267 genes were significantly (approximately 2-fold) up- or downregulated over the course of the disease. Immediate early genes (Arc, Cyr61, c-fos, jun-b, btg2, NR4A1) were among the first genes upregulated during the presymptomatic period whereas immune response genes dominated at later time points. Chemokine ligands and protease inhibitors were among the most transcriptionally responsive genes. Neuronal survival factors (IGF-1 and CNTF) and a negative regulator of neuronal apoptosis (DAP kinase-1) were upregulated late in the course of the disease. Few genes were downregulated; these included the α2 subunit of the GABA-A receptor, a component of cortical and hippocampal neurons, and Hes5, a transcription factor important in neuronal differentiation. Conclusion A molecular description of gene expression changes occurring in the brain throughout the course of neuronal ceroid lipofuscinosis suggests distinct phases of disease progression, provides clues to potential markers of disease activity, and points to new targets for therapy. PMID:18021406

  2. Identification of domains within the human cytomegalovirus major immediate-early 86-kilodalton protein and the retinoblastoma protein required for physical and functional interaction with each other.

    PubMed Central

    Fortunato, E A; Sommer, M H; Yoder, K; Spector, D H

    1997-01-01

    The human cytomegalovirus major immediate-early 86-kDa protein (IE2 86) plays an important role in the trans activation and regulation of HCMV gene expression. Previously, we demonstrated that IE2 86 contains three regions (amino acids [aa] 86 to 135, 136 to 290, and 291 to 364) that can independently bind to in vitro-translated Rb when IE2 86 is produced as a glutathione S-transferase fusion protein (M. H. Sommer, A. L. Scully, and D. H. Spector, J. Virol. 68:6223-6231, 1994). In this report, we have elucidated the regions of Rb involved in binding to IE2 86 and have further analyzed the functional nature of the interaction between these two proteins. We find that two domains on Rb, the A/B pocket and the carboxy terminus, can each independently form a complex with IE2 86. In functional assays, we demonstrate that IE2 86 and another IE protein, IE1 72, can counter the enlarged flat cell phenotype, but not the G1/S block, which results from expression of wild-type Rb in the human osteosarcoma cell line Saos-2. Mutational analysis reveals that there are two domains on IE2 86 that can independently affect Rb function. One region (aa 241 to 369) includes the major Rb-binding domain, while the second maps to the amino-terminal region (aa 1 to 85) common to both IE2 86 and IE1 72. These data show that Rb and IE2 86 physically and functionally interact with each other via at least two separate domains and provide further support for the hypothesis that IE2 86 may exert its pleiotropic effects through the formation of multimeric protein complexes. PMID:9343168

  3. Cocaine reverses the naltrexone-induced reduction in operant ethanol self-administration: the effects on immediate-early gene expression in the rat prefrontal cortex.

    PubMed

    Echeverry-Alzate, Víctor; Tuda-Arízcun, María; Bühler, Kora-Mareen; Santos, Ángel; Giné, Elena; Olmos, Pedro; Gorriti, Miguel Ángel; Huertas, Evelio; Rodríguez de Fonseca, Fernando; López-Moreno, Jose Antonio

    2012-11-01

    Naltrexone is a clinically approved medication for alcoholism. We aimed to investigate the effectiveness of naltrexone co-administered with cocaine and the association of these substances with immediate-early gene expression in the rat prefrontal cortex. We used chronic operant ethanol self-administration and oral treatments prescribed for alcoholism and available in pharmacies to maximise the predictive validity in humans. We performed real-time PCR analysis to determine gene expression levels in the prefrontal cortex. Only the highest dose of naltrexone (1, 3, and 10 mg/kg, p.o.) reduced the response to ethanol. Cocaine increased ethanol self-administration in a dose-dependent manner (2.5, 10, 20 mg/kg, i.p.) and reversed the naltrexone-induced reduction. Naltrexone failed to prevent the cocaine-induced increase in locomotor activity observed in these animals. Chronic self-administration of ethanol reduced the expression of the C-fos gene 4- to 12-fold and increased expression of the COX-2 (up to 4-fold) and Homer1a genes in the rat prefrontal cortex. Chronic ethanol self-administration is prevented by naltrexone, but cocaine fully reverses this effect. This result suggests that cocaine may overcome naltrexone's effectiveness as a treatment for alcoholism. The ethanol-induced reduction in C-fos gene expression in the prefrontal cortex reveals an abnormal activity of these neurons, which may be relevant in the compulsive consumption of ethanol, the control of reward-related areas and the behavioural phenotype of ethanol addiction. PMID:22749946

  4. Motor-Coordination-Dependent Learning, More than Others, Is Impaired in Transgenic Mice Expressing Pseudorabies Virus Immediate-Early Protein IE180

    PubMed Central

    López-Ramos, Juan C.; Tomioka, Yukiko; Morimatsu, Masami; Yamamoto, Sayo; Ozaki, Kinuyo; Ono, Etsuro; Delgado-García, José M.

    2010-01-01

    The cerebellum in transgenic mice expressing pseudorabies virus immediate-early protein IE180 (TgIE96) was substantially diminished in size, and its histoarchitecture was severely disorganized, resulting in severe ataxia. TgIE96 mice can therefore be used as an experimental model to study the involvement of cerebellar circuits in different learning tasks. The performance of three-month-old TgIE96 mice was studied in various behavioral tests, including associative learning (classical eyeblink conditioning), object recognition, spatial orientation (water maze), startle response and prepulse inhibition, and passive avoidance, and compared with that of wild-type mice. Wild-type and TgIE96 mice presented similar reflexively evoked eyeblinks, and acquired classical conditioned eyelid responses with similar learning curves for both trace and delay conditioning paradigms. The two groups of mice also had similar performances during the object recognition test. However, they showed significant differences for the other three tests included in this study. Although both groups of animals were capable of swimming, TgIE96 mice failed to learn the water maze task during the allowed time. The startle response to a severe tone was similar in both control and TgIE96 mice, but the latter were unable to produce a significant prepulse inhibition. TgIE96 mice also presented evident deficits for the proper accomplishment of a passive avoidance test. These results suggest that the cerebellum is not indispensable for the performance of classical eyeblink conditioning and for object recognition tasks, but seems to be necessary for the proper performance of water maze, prepulse inhibition, and passive avoidance tests. PMID:20711341

  5. Stressor and glucocorticoid-dependent induction of the immediate early gene kruppel-like factor 9: implications for neural development and plasticity.

    PubMed

    Bonett, Ronald M; Hu, Fang; Bagamasbad, Pia; Denver, Robert J

    2009-04-01

    Krüppel-like factor 9 (KLF9) is a thyroid hormone-induced, immediate early gene implicated in neural development in vertebrates. We analyzed stressor and glucocorticoid (GC)-dependent regulation of KLF9 expression in the brain of the frog Xenopus laevis, and investigated a possible role for KLF9 in neuronal differentiation. Exposure to shaking/confinement stressor increased plasma corticosterone (CORT) concentration, and KLF9 immunoreactivity in several brain regions, which included the medial amygdala and bed nucleus of the stria terminalis, anterior preoptic area (homologous to the mammalian paraventricular nucleus), and optic tectum (homologous to the mammalian superior colliculus). The stressor-induced KLF9 mRNA expression in the brain was blocked by pretreatment with the GC receptor antagonist RU486, or mimicked by injection of CORT. Treatment with CORT also caused a rapid and dose-dependent increase in KLF9 mRNA in X. laevis XTC-2 cells that was resistant to inhibition of protein synthesis. The action of CORT on KLF9 expression in XTC-2 cells was blocked by RU486, but not by the mineralocorticoid receptor antagonist spironolactone. To test for functional consequences of up-regulation of KLF9, we introduced a KLF9 expression plasmid into living tadpole brain by electroporation-mediated gene transfer. Forced expression of KLF9 in tadpole brain caused an increase in Golgi-stained cells, reflective of neuronal differentiation/maturation. Our results support that KLF9 is a direct, GC receptor target gene that is induced by stress, and functions as an intermediary in the actions of GCs on brain gene expression and neuronal structure. PMID:19036875

  6. Effects of human cytomegalovirus major immediate-early proteins in controlling the cell cycle and inhibiting apoptosis: studies with ts13 cells.

    PubMed

    Lukac, D M; Alwine, J C

    1999-04-01

    The major immediate-early (MIE) gene of human cytomegalovirus (HCMV) encodes several MIE proteins (MIEPs) produced as a result of alternative splicing and polyadenylation of the primary transcript. Previously we demonstrated that the HCMV MIEPs expressed from the entire MIE gene could rescue the temperature-sensitive (ts) transcriptional defect in the ts13 cell line. This defect is caused by a ts mutation in TAFII250, the 250-kDa TATA binding protein-associated factor (TAF). These and other data suggested that the MIEPs perform a TAF-like function in complex with the basal transcription factor TFIID. In addition to the transcriptional defect, the ts mutation in ts13 cells results in a defect in cell cycle progression which ultimately leads to apoptosis. Since all of these defects can be rescued by wild-type TAFII250, we asked whether the MIEPs could rescue the cell cycle defect and/or affect the progression to apoptosis. We have found that the MIEPs, expressed from the entire MIE gene, do not rescue the cell cycle block in ts13 cells grown at the nonpermissive temperature. However, despite the maintenance of the cell cycle block, the ts13 cells which express the MIEPs are resistant to apoptosis. MIEP mutants, which have previously been shown to be defective in rescuing the ts transcriptional defect, maintained the ability to inhibit apoptosis. Hence, the MIEP functions which affect transcription appear to be separable from the functions which inhibit apoptosis. We discuss these data in the light of the HCMV life cycle and the possibility that the MIEPs promote cellular transformation by a "hit-and-run" mechanism. PMID:10074130

  7. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity.

    PubMed

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks. PMID:26137459

  8. Contrasting role of phospholipase C-{gamma}1 in the expression of immediate early genes induced by epidermal or platelet-derived growth factors

    SciTech Connect

    Liao Hongjun; Santos, Josue de los; Carpenter, Graham . E-mail: graham.carpenter@vanderbilt.edu

    2006-04-01

    While significant progress has been achieved in identifying the signal transduction elements that operate downstream of activated receptor tyrosine kinases, it remains unclear how different receptors utilize these signaling elements to achieve a common response. This study compares the capacity of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) to elicit the induction of immediate early gene (IEG) mRNAs in the presence or absence of phospholipase C-{gamma}1 (PLC-{gamma}1). The results show that while PDGF induction of nearly all IEG mRNAs is abrogated in plcg1 null cells, EGF induction of the same genes is variable in the null cells and exhibits three distinct responses. Five IEG mRNAs (Nup475, Cyr61, TF, Gly, TS7) are completely inducible by EGF in the presence or absence of PLC-{gamma}1, while three others (JE, KC, FIC) exhibit a stringent requirement for the presence of PLC-{gamma}1. The third type of response is exhibited by c-fos and COX-2. While these mRNAs are completely induced by EGF in the absence of PLC-{gamma}1, the time course of their accumulation is significantly delayed. No IEG was identified as completely inducible by EGF and PDGF in the absence of PLC-{gamma}1. Electrophoretic mobility shift assays (EMSA) demonstrate that PLC-{gamma}1 is necessary for nuclear extracts from PDGF-treated cells, but not EGF-treated cells, to interact with probes for AP-1 or NF-{kappa}B.

  9. Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T cells.

    PubMed Central

    Yu-Lee, L Y; Hrachovy, J A; Stevens, A M; Schwarz, L A

    1990-01-01

    The pituitary peptide hormone prolactin (Prl) is a potent inducer of Nb2 T lymphoma cell proliferation. To analyze the early genetic response to the mitogenic signals of Prl, a cDNA library was constructed from Nb2 T cells stimulated for 4 h with Prl and the protein synthesis inhibitor cycloheximide. Of 26 distinct clones isolated by differential screening, one clone, designated c25, exhibited extremely rapid but transient kinetics of induction by Prl and superinduction by Prl plus cycloheximide. Run-on transcription analysis indicated that c25 gene transcription was induced greater than 20-fold within 30 to 60 min of Prl stimulation. Surprisingly, DNA sequence analysis of c25 cDNA revealed that this Prl-inducible early-response gene is the rat homolog of the mouse transcription factor interferon-regulatory factor 1 (IRF-1), sharing 91% coding sequence similarity with mouse IRF-1. At the protein level, rat IRF-1 shares 97% and 92% homology with mouse IRF-1 and human IRF-1, respectively, suggesting that this molecule has been functionally conserved throughout evolution. Our studies show that the gene for IRF-1 is an immediate-early gene in Prl-stimulated T cells, which suggests that IRF-1 is a multifunctional molecule. In addition to its role in regulating growth-inhibitory interferon genes, IRF-1 may, therefore, also play a stimulatory role in cell proliferation. The gene for IRF-1 is one of the earliest genes known to be transcriptionally regulated by Prl. Images PMID:2342469

  10. BZLF1, an Epstein-Barr virus immediate-early protein, induces p65 nuclear translocation while inhibiting p65 transcriptional function

    SciTech Connect

    Morrison, Thomas E.; Kenney, Shannon C. . E-mail: shann@med.unc.edu

    2004-10-25

    We have previously demonstrated that the Epstein-Barr virus immediate-early BZLF1 protein interacts with, and is inhibited by, the NF-{kappa}B family member p65. However, the effects of BZLF1 on NF-{kappa}B activity have not been intensively studied. Here we show that BZLF1 inhibits p65-dependent gene expression. BZLF1 inhibited the ability of IL-1, as well as transfected p65, to activate the expression of two different NF-{kappa}B-responsive genes, ICAM-1 and I{kappa}B-{alpha}. BZLF1 also reduced the constitutive level of I{kappa}B-{alpha} protein in HeLa and A549 cells, and increased the amount of nuclear NF-{kappa}B to a similar extent as tumor necrosis factor-alpha (TNF-{alpha}) treatment. In spite of this BZLF1-associated increase in the nuclear form of NF-{kappa}B, BZLF1 did not induce binding of NF-{kappa}B to NF-{kappa}B responsive promoters (as determined by chromatin immunoprecipitation assay) in vivo, although TNF-{alpha} treatment induced NF-{kappa}B binding as expected. Overexpression of p65 dramatically inhibited the lytic replication cycle of EBV in 293-EBV cells, confirming that NF-{kappa}B also inhibits BZLF1 transcriptional function. Our results are consistent with a model in which BZLF1 inhibits the transcriptional function of p65, resulting in decreased transcription of I{kappa}B-{alpha}, decreased expression of I{kappa}B-{alpha} protein, and subsequent translocation of NF-{kappa}B to the nucleus. This nuclear translocation of NF-{kappa}B may promote viral latency by negatively regulating BZLF1 transcriptional activity. In situations where p65 activity is limiting in comparison to BZLF1, the ability of BZLF1 to inhibit p65 transcriptional function may protect the virus from the host immune system during the lytic form of infection.

  11. Improved cell survival by the reduction of immediate-early gene expression in replication-defective mutants of herpes simplex virus type 1 but not by mutation of the virion host shutoff function.

    PubMed Central

    Johnson, P A; Wang, M J; Friedmann, T

    1994-01-01

    Derivatives of herpes simplex virus type 1 (HSV-1) have elicited considerable interest as gene transfer vectors because of their ability to infect a wide range of cell types efficiently, including fully differentiated neurons. However, it has been found that infection of many types of cell with vectors derived from replication-defective mutants of HSV-1 is associated with cytopathic effects (CPE). We have previously shown that viral gene expression played an important role in the induction of CPE caused by an HSV-1 mutant deleted for the essential immediate-early gene 3 (IE 3) (P.A. Johnson, A. Miyanohara, F. Levine, T. Cahill, and T. Friedmann, J. Virol. 66:2952-2965, 1992). We have investigated which viral genes might be responsible for CPE by comparing the ability of each of the individual genes expressed by an IE 3 deletion mutant during a nonproductive infection to inhibit biochemical transformation after cotransfection of BHK or CV-1 cells with a selectable marker gene. Transfection of IE genes 1,2, and 4 individually all caused a marked inhibition of colony formation, while transfection of IE 5 and the large subunit of ribonucleotide reductase had little effect. These results suggested that it would be necessary to mutate or reduce the expression of nearly all HSV-1 IE genes to reduce virus-induced CPE. Therefore, we have used VP16 mutants, which are unable to transinduce IE gene expression (C. I. Ace, T. A. McKee, J. M. Ryan, J. M. Cameron, and C. M. Preston, J. Virol. 63:2260-2269, 1989), to derive two replication-defective strains: 14H delta 3, which is deleted for both copies of IE 3, and in 1850 delta 42, which has a deletion in the essential early gene UL42. The IE 3-VP16 double mutant, 14H delta 3, is significantly less toxic than a single IE 3 deletion mutant over a range of multiplicities of infection, as measured in a cell-killing assay, and has an enhanced ability to persist in infected cells in a biologically retrievable form. In contrast, the UL

  12. Temporal and anatomic patterns of immediate-early gene expression in the forebrain of C57BL/6 and DBA/2 mice after morphine administration.

    PubMed

    Ziółkowska, B; Gieryk, A; Solecki, W; Przewłocki, R

    2015-01-22

    Although morphine was previously reported to produce an instant induction of c-fos in the striatum, our recent studies have demonstrated that the expression of numerous immediate early genes (IEGs) is significantly elevated at delayed time-points (several hours) after morphine administration. To better dissect the time-course of opioid-produced IEG induction, we used in situ hybridization to examine the expression of the IEGs c-fos, zif268 and arc in the mouse forebrain at several time-points after acute morphine injection. To link drug-produced behavioral changes with the activity of specific neuronal complexes, this study was performed comparatively in the C57BL/6 and DBA/2 mouse strains, which differ markedly in their locomotor responses to opioids and opioid reward. Our study demonstrates that morphine produces two episodes of IEG induction, which are separate in time (30 min vs. 4-6 h) and which have different neuroanatomic distribution. At 30 min, one or more IEGs were induced in circumscribed subregions of the dorsal striatum (dStr) and of the nucleus accumbens (NAc) shell, as well as in the lateral septum. The observed inter-strain differences in IEG expression at 30 min support earlier proposals that activation of the dorsomedial striatum may mediate morphine-elicited locomotor stimulation (both effects were present only in the C57BL/6 strain). In contrast, NAc shell activation does not appear to be linked to morphine-elicited changes in locomotor behavior. The second IEG induction (of arc and of zif268) was more widespread, involving most of the dStr and the cortex. The second IEG induction peaked earlier in the DBA/2 mice than in the C57BL/6 mice (4 h compared with 6 h) and displayed no apparent relation to locomotor behavior. This delayed episode of IEG activation, which has largely been overlooked thus far, may contribute to the development of long-term effects of opioids such as tolerance, dependence and/or addiction. PMID:25290009

  13. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection.

    PubMed

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  14. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection

    PubMed Central

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  15. Herpes simplex virus mutants defective in the virion-associated shutoff of host polypeptide synthesis and exhibiting abnormal synthesis of alpha (immediate early) viral polypeptides.

    PubMed Central

    Read, G S; Frenkel, N

    1983-01-01

    Six mutants isolated from herpes simplex virus type 1 were judged to be defective with respect to the virion-associated function acting to rapidly shut off host polypeptide synthesis in herpes simplex virus-infected cells. The mutants were capable of proper entry into the cells, but, unlike the parent wild-type virus, they failed to shut off host polypeptide syntehsis in the presence of actinomycin D. They were consequently designated as virion-associated host shutoff (vhs) mutants. In the presence of actinomycin D, three of the mutants, vhs1, -2, and -3, failed to shut off the host at both 34 and 39 degrees C, whereas vhs4, -5, and -6 exhibited a temperature-dependent vhs phenotype. Since the mutants were capable of growth at 34 degrees C, it appeared that the vhs function was not essential for virus replication in cultured cells. Temperature-shift experiments performed with the vhs4 mutant showed that an active vhs function was required throughout the shutoff process and that, once established, the translational shutoff could not be reversed. In the absence of actinomycin D, the mutants induced a generalized, secondary shutoff of host translation, which required the synthesis of beta (early) or gamma (late) viral polypeptide(s). The vhs mutants appeared to be defective also with respect to post-transcriptional shutoff of alpha (immediate early) viral gene expression, since (i) cells infected with mutant viruses overproduced alpha viral polypeptides, (ii) there was an increased functional stability of alpha mRNA in the vhs1 mutant virus-infected cells, and (iii) superinfection of vhs1-infected cells with wild-type virus, in the presence of actinomycin D, resulted in a more pronounced shutoff of alpha polypeptide synthesis from preformed alpha mRNA than equivalent superinfection with vhs1 virus. The data suggest that the synthesis of alpha polypeptides in wild-type virus infections is subject to a negative post-transcriptional control involving viral gene product

  16. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  17. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response.

    PubMed

    Harwardt, Thomas; Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C; Nevels, Michael; Paulus, Christina

    2016-07-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  18. Screening of High-Level 4-Hydroxy-2 (or 5)-Ethyl-5 (or 2)-Methyl-3(2H)-Furanone-Producing Strains from a Collection of Gene Deletion Mutants of Saccharomyces cerevisiae

    PubMed Central

    Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

    2014-01-01

    4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1Δ) exhibited the maximum HEMF production capacity. Further investigations of the adh1Δ mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

  19. Screening of high-level 4-hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone-producing strains from a collection of gene deletion mutants of Saccharomyces cerevisiae.

    PubMed

    Uehara, Kenji; Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

    2015-01-01

    4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1Δ) exhibited the maximum HEMF production capacity. Further investigations of the adh1Δ mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

  20. Prolonged gene expression and cell survival after infection by a herpes simplex virus mutant defective in the immediate-early genes encoding ICP4, ICP27, and ICP22.

    PubMed Central

    Wu, N; Watkins, S C; Schaffer, P A; DeLuca, N A

    1996-01-01

    Very early in infection, herpes simplex virus (HSV) expresses four immediate-early (IE) regulatory proteins, ICP4, ICP0, ICP22, and ICP27. The systematic inactivation of sets of the IE proteins in cis, and the subsequent phenotypic analysis of the resulting mutants, should provide insights into how these proteins function in the HSV life cycle and also into the specific macromolecular events that are altered or perturbed in cells infected with virus strains blocked very early in infection. This approach may also provide a rational basis to assess the efficacy and safety of HSV mutants for use in gene transfer experiments. In this study, we generated and examined the phenotype of an HSV mutant simultaneously mutated in the ICP4, ICP27, and ICP22 genes of HSV. Unlike mutants deficient in ICP4 (d120), ICP4 and ICP27 (d92), and ICP4 and ICP22 (d96), mutants defective in ICP4, ICP27, and ICP22 (d95) were visually much less toxic to Vero and human embryonic lung cells. Cells infected with d95 at a multiplicity of infection of 10 PFU per cell retained a relatively normal morphology and expressed genes from the viral and cellular genomes for at least 3 days postinfection. The other mutant backgrounds were too toxic to allow examination of gene expression past 1 day postinfection. However, when cell survival was measured by the capacity of the infected cells to form colonies, d95 inhibited colony formation similarly to d92. This apparent paradox was reconciled by the observation that host cell DNA synthesis was inhibited in cells infected with d120, d92, d96, and d95. In addition, all of the mutants exhibited pronounced and distinctive alterations in nuclear morphology, as determined by electron microscopy. The appearance of d95-infected cells deviated from that of uninfected cells in that large circular structures formed in the nucleus. d95-infected cells abundantly expressed ICP0, which accumulated in fine punctate structures in the nucleus at early times postinfection

  1. The herpes simplex virus immediate-early protein ICP0 affects transcription from the viral genome and infected-cell survival in the absence of ICP4 and ICP27.

    PubMed Central

    Samaniego, L A; Wu, N; DeLuca, N A

    1997-01-01

    ICP4, ICP0, and ICP27 are the immediate-early (IE) regulatory proteins of herpes simplex virus that have the greatest effect on viral gene expression and growth. Comparative analysis of viral mutants defective in various subsets of these IE genes should help elucidate how these proteins affect cellular and viral processes. This study focuses on the mutant d97, which is defective for the genes encoding ICP4, ICP0, and ICP27 and expresses the bacterial beta-galactosidase (beta-gal) gene from the ICP0 promoter. Together with the d92 virus (ICP4- ICP27-) and the ICP0-complementing cell line L7, d97 provided a unique opportunity to evaluate ICP0 function in the absence of the regulatory activities specified by ICP4 and ICP27. The pattern of protein synthesis in d97-infected cells was unique relative to other IE gene mutants in that it was similar to that seen in the absence of prior viral protein synthesis, possibly approximating the effect of cellular factors and virion components alone. Inactivation of ICP0 in the absence of ICP4 produced a significant decrease in the levels of the early mRNAs ICP6 and thymidine kinase (tk). There was also a marginal reduction in the levels of the IE ICP22 mRNA, and this was most notable at low multiplicity of infection (MOI). In d97-infected L7 cells, the levels of the viral mRNAs were mostly restored to those observed in infections with d92. Nuclear runoff transcription analysis demonstrated that the presence of ICP0 resulted in an increase in the transcription rates of the analyzed genes. The transcription rates of the early genes were dramatically reduced in the absence of ICP0. At low MOI, the transcription rates of ICP6 and tk were comparable to the rate of transcription of a cellular gene. Relevant to the potential use of d97 as a transfer vector, it was also determined that the absence of ICP0 reduced the cellular toxicity of the virus compared to that of d92. The beta-gal transgene expressed from an IE promoter was detected

  2. CDKN2 Gene Deletion as Poor Prognosis Predictor Involved in the Progression of Adult B-Lineage Acute Lymphoblastic Leukemia Patients

    PubMed Central

    Xu, Na; Li, Yu-ling; Zhou, Xuan; Cao, Rui; Li, Huan; Lu, Qi-si; Li, Lin; Lu, Zi-yuan; Huang, Ji-xian; Sun, Jing; Liu, Qi-fa; Du, Qing-feng; Liu, Xiao-li

    2015-01-01

    Deletion of cyclin-dependent kinase inhibitor 2A/B (CDKN2A/B) is well known in many hematologic malignancies, but only few reports have investigated this deletion effect on clinical prognosis. This study performed analysis of the CDKN2 deletion in 215 adult B- lineage acute lymphoblastic leukemia (B-ALL) patients, and related cytogenetic prognostic factors (BCR/ABL; E2A/PBXl; TEL/AML1; Mixed Lineage Leukemia (MLL) rearrangement; MYC, Immunoglobulin heavy locus (IGH) translocation). The prevalence of CDKN2 deletions in all study populations was 28.4%. There is no difference between patients with CDKN2 deletion and wild-type patients in sex, age, white blood cells (WBC) count, BM blast percentage, extra infiltration and induction complete remission (CR) rate. Analysis in relapse patients revealed that the distribution of CDKN2 deletion is higher in relapse patients (44.6%) than all patients (28.4%, P=0.006). Deletion of CDKN2 was significantly associated with poor outcomes including decreased overall survival (OS) (P<0.001), lower disease free-survival (DFS) (P<0.001), and increased cumulative incidence of relapse (P=0.002); Also, CDKN2 deletion was strongly associated with IGH translocation (P=0.021); and had an adverse effect on patients with BCR-ABL fusion gene or with MLL rearrangement. Patients with CDKN2 gene deletion benefited from allogenic hematopoietic stem cell transplantation (Allo-HSCT). Deletion of CDKN2 gene was commonly observed through leukemia progression and was poor prognostic marker in long-term outcomes. PMID:26516359

  3. Oncolytic Adenoviral Mutants with E1B19K Gene Deletions Enhance Gemcitabine-induced Apoptosis in Pancreatic Carcinoma Cells and Anti-Tumor Efficacy In vivo

    PubMed Central

    Leitner, Stephan; Sweeney, Katrina; Öberg, Daniel; Davies, Derek; Miranda, Enrique; Lemoine, Nick R.; Halldén, Gunnel

    2010-01-01

    Purpose Pancreatic adenocarcinoma is a rapidly progressive malignancy that is highly resistant to current chemotherapeutic modalities and almost uniformly fatal.We show that a novel targeting strategy combining oncolytic adenoviral mutants with the standard cytotoxic treatment, gemcitabine, can markedly improve the anticancer potency. Experimental Design Adenoviral mutants with the E1B19K gene deleted with and without E3B gene expression (AdΔE1B19K and dl337 mutants, respectively) were assessed for synergistic interactions in combination with gemcitabine. Cell viability, mechanism of cell death, and antitumor efficacy in vivo were determined in the pancreatic carcinoma cells PT45 and Suit2, normal human bronchial epithelial cells, and in PT45 xenografts. Results The ΔE1B19K-deleted mutants synergized with gemcitabine to selectively kill cultured pancreatic cancer cells and xenografts in vivo with no effect in normal cells. The corresponding wild-type virus (Ad5) stimulated drug-induced cell killing to a lesser degree. Gemcitabine blocked replication of all viruses despite the enhanced cell killing activity due to gemcitabine-induced delay in G1/S-cell cycle progression, with repression of cyclin E and cdc25A, which was not abrogated by viral E1A-expression. Synergistic cell death occurred through enhancement of gemcitabine-induced apoptosis in the presence of both AdΔE1B19K and dl337 mutants, shown by increased cell membrane fragmentation, caspase-3 activation, and mitochondrial dysfunction. Conclusions Our data suggest that oncolytic mutants lacking the antiapoptotic E1B19K gene can improve efficacy of DNA-damaging drugs such as gemcitabine through convergence on cellular apoptosis pathways.These findings imply that less toxic doses than currently practicedin the clinic could efficiently target pancreatic adenocarcinomas when combined with adenoviral mutants. PMID:19223497

  4. From Whole Gene Deletion to Point Mutations of EP300-Positive Rubinstein-Taybi Patients: New Insights into the Mutational Spectrum and Peculiar Clinical Hallmarks.

    PubMed

    Negri, Gloria; Magini, Pamela; Milani, Donatella; Colapietro, Patrizia; Rusconi, Daniela; Scarano, Emanuela; Bonati, Maria Teresa; Priolo, Manuela; Crippa, Milena; Mazzanti, Laura; Wischmeijer, Anita; Tamburrino, Federica; Pippucci, Tommaso; Finelli, Palma; Larizza, Lidia; Gervasini, Cristina

    2016-02-01

    Rubinstein-Taybi syndrome (RSTS) is a rare congenital neurodevelopmental disorder characterized by growth deficiency, skeletal abnormalities, dysmorphic features, and intellectual disability. Causative mutations in CREBBP and EP300 genes have been identified in ∼55% and ∼8% of affected individuals. To date, only 28 EP300 alterations in 29 RSTS clinically described patients have been reported. EP300 analysis of 22 CREBBP-negative RSTS patients from our cohort led us to identify six novel mutations: a 376-kb deletion depleting EP300 gene; an exons 17-19 deletion (c.(3141+1_3142-1)_(3590+1_3591-1)del/p.(Ile1047Serfs*30)); two stop mutations, (c.3829A>T/p.(Lys1277*) and c.4585C>T/p.(Arg1529*)); a splicing mutation (c.1878-12A>G/p.(Ala627Glnfs*11)), and a duplication (c.4640dupA/p.(Asn1547Lysfs*3)). All EP300-mutated individuals show a mild RSTS phenotype and peculiar findings including maternal gestosis, skin manifestation, especially nevi or keloids, back malformations, and a behavior predisposing to anxiety. Furthermore, the patient carrying the complete EP300 deletion does not show a markedly severe clinical picture, even if a more composite phenotype was noticed. By characterizing six novel EP300-mutated patients, this study provides further insights into the EP300-specific clinical presentation and expands the mutational repertoire including the first case of a whole gene deletion. These new data will enhance EP300-mutated cases identification highlighting distinctive features and will improve the clinical practice allowing a better genotype-phenotype correlation. PMID:26486927

  5. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice

    PubMed Central

    Zhang, Yiqiang; Davis, Carol; Sakellariou, George K.; Shi, Yun; Kayani, Anna C.; Pulliam, Daniel; Bhattacharya, Arunabh; Richardson, Arlan; Jackson, Malcolm J.; McArdle, Anne; Brooks, Susan V.; Van Remmen, Holly

    2013-01-01

    We have previously shown that deletion of CuZnSOD in mice (Sod1−/− mice) leads to accelerated loss of muscle mass and contractile force during aging. To dissect the relative roles of skeletal muscle and motor neurons in this process, we used a Cre-Lox targeted approach to establish a skeletal muscle-specific Sod1-knockout (mKO) mouse to determine whether muscle-specific CuZnSOD deletion is sufficient to cause muscle atrophy. Surprisingly, mKO mice maintain muscle masses at or above those of wild-type control mice up to 18 mo of age. In contrast, maximum isometric specific force measured in gastrocnemius muscle is significantly reduced in the mKO mice. We found no detectable increases in global measures of oxidative stress or ROS production, no reduction in mitochondrial ATP production, and no induction of adaptive stress responses in muscle from mKO mice. However, Akt-mTOR signaling is elevated and the number of muscle fibers with centrally located nuclei is increased in skeletal muscle from mKO mice, which suggests elevated regenerative pathways. Our data demonstrate that lack of CuZnSOD restricted to skeletal muscle does not lead to muscle atrophy but does cause muscle weakness in adult mice and suggest loss of CuZnSOD may potentiate muscle regenerative pathways.—Zhang, Y., Davis, C., Sakellariou, G.K., Shi, Y., Kayani, A.C., Pulliam, D., Bhattacharya, A., Richardson, A., Jackson, M.J., McArdle, A., Brooks, S.V., Van Remmen, H. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice. PMID:23729587

  6. Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India

    PubMed Central

    Bharti, Praveen Kumar; Chandel, Himanshu Singh; Ahmad, Amreen; Krishna, Sri; Udhayakumar, Venkatachalam; Singh, Neeru

    2016-01-01

    Background Plasmodium falciparum encoded histidine rich protein (HRP2) based malaria rapid diagnostic tests (RDTs) are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions. Methods This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR. Results Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521) and 1.8% (27/1521) of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0–25% (2.4, 95% CI; 1.6–3.3). The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0–8% (1.6, 95% CI; 1.0–2.4). Conclusion This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs. PMID:27518538

  7. Co-ordinate regulation of herpes simplex virus gene expression is mediated by the functional interaction of two immediate early gene products.

    PubMed

    Gelman, I H; Silverstein, S

    1986-10-01

    At early times after infection with herpes simplex virus, transcription from beta-promoters is initiated only in the presence of a functional 174,000 Mr phosphoprotein (ICP4), encoded by an immediate early (alpha) gene (IE4). A transient expression assay was used to analyze the requirement for two (ICP4 and ICP0) of the five alpha-gene products in the transcriptional regulation of model alpha and beta-gene promoters. These studies reveal that cells cotransfected with plasmids containing the alpha-gene sequences for infected cell proteins (ICPs) 4 and 0 and a thymidine kinase (TK, a beta-gene) gene or the thymidine kinase promoter fused to a chloramphenicol acetyltransferase (CAT) cassette accumulate 10 to 20-fold more RNA or exhibit 10 to 20-fold more CAT activity than cells cotransfected with a plasmid encoding either alpha-gene protein and a thymidine kinase indicator gene. Functional ICP4 is required for enhanced transcriptional activation in the transient expression assay system. It is also required for the uniform dispersal of ICP0 throughout the nucleus as shown by immunofluorescence staining analysis of transfected cells. Two alpha-promoter-CAT fusions were used as targets to study what effects ICP4, ICP0 and Vmw65 (the virion-associated alpha-gene transactivator) have on expression from alpha-promoters that contain all of the sequences that confer alpha-gene regulation, or only the core sequence governing basal level expression. We conclude that ICP4 can activate alpha-gene expression from the core sequence and, depending on its abundance, activate or repress expression from a promoter containing the sequences required for alpha-gene regulation. Independent of these alpha-regulatory sequences cotransfection with low levels of sequences encoding both ICP0 and ICP4 activate expression. At higher ratios of effector (both ICP4 and ICP0) the target accumulation of CAT activity decreases. Although a ts allele of IE4 (cloned from the mutant virus tsK) does not

  8. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger.

    PubMed

    Dai, Ziyu; Aryal, Uma K; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D; Magnuson, Jon K; Adney, William S; Beckham, Gregg T; Brunecky, Roman; Himmel, Michael E; Decker, Stephen R; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E

    2013-12-01

    Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl α-1,3-mannosyltransferase (also known as "asparagine-linked glycosylation 3", or ALG3) is involved in early N-linked glycan synthesis and thus is essential for formation of N-linked protein glycosylation. In this study, we examined the effects of alg3 gene deletion (alg3Δ) on growth, development, pigment production, protein secretion and recombinant Trichoderma reesei cellobiohydrolase (rCel7A) expressed in Aspergillus niger. The alg3Δ delayed spore germination in liquid cultures of complete medium (CM), potato dextrose (PD), minimal medium (MM) and CM with addition of cAMP (CM+cAMP), and resulted in significant reduction of hyphal growth on CM, potato dextrose agar (PDA), and CM+cAMP and spore production on CM. The alg3Δ also led to a significant accumulation of red pigment on both liquid and solid CM cultures. The relative abundances of 54 of the total 215 proteins identified in the secretome were significantly altered as a result of alg3Δ, 63% of which were secreted at higher levels in alg3Δ strain than the parent. The rCel7A expressed in the alg3Δ mutant was smaller in size than that expressed in both wild-type and parental strains, but still larger than T. reesei Cel7A. The circular dichroism (CD)-melt scans indicated that change in glycosylation of rCel7A does not appear to impact the secondary structure or folding. Enzyme assays of Cel7A and rCel7A on nanocrystalline cellulose and bleached kraft pulp demonstrated that the rCel7As have improved activities on hydrolyzing the nanocrystalline cellulose. Overall, the results suggest that alg3 is critical for growth, sporulation, pigment production, and protein secretion in A. niger, and demonstrate the feasibility of this alternative approach to evaluate the roles of N-linked glycosylation in glycoprotein secretion and function. PMID:24076077

  9. A Suitable Streptomycin-Resistant Mutant for Constructing Unmarked In-Frame Gene Deletions Using rpsL as a Counter-Selection Marker

    PubMed Central

    Tsai, Yu-Kuo; Liou, Ci-Hong; Lin, Jung-Chung; Ma, Ling; Fung, Chang-Phone; Chang, Feng-Yee; Siu, L. Kristopher

    2014-01-01

    The streptomycin counter-selection system is a useful tool for constructing unmarked in-frame gene deletions, which is a fundamental approach to study bacteria and their pathogenicity at the molecular level. A prerequisite for this system is acquiring a streptomycin-resistant strain due to rpsL mutations, which encodes the ribosomal protein S12. However, in this study no streptomycin resistance was found to be caused by rpsL mutations in all 127 clinical strains of Klebsiella pneumoniae isolated from liver abscess patients. By screening 107 spontaneous mutants of streptomycin resistance from a clinical strain of K. pneumoniae, nucleotide substitution or insertion located within the rpsL was detected in each of these strains. Thirteen different mutants with varied S12 proteins were obtained, including nine streptomycin-dependent mutants. The virulence of all four streptomycin-resistant mutants was further evaluated. Compared with the parental strain, the K42N, K42T and K87R mutants showed a reduction in growth rate, and the K42N and K42T mutants became susceptible to normal human serum. In the mice LD50 (the bacterial dose that caused 50% death) assay, the K42N and K42T mutants were ∼1,000-fold less lethal (∼2×105 CFU) and the K87R mutant was ∼50-fold less lethal (∼1×104 CFU) than the parental strain (∼2×102 CFU). A K42R mutant showed non-observable effects on the above assays, while this mutant exhibited a small cost (P<0.01) in an in vitro growth competition experiment. In summary, most of the K. pneumoniae strains with streptomycin resistance caused by rpsL mutations are less virulent than their parental strain in the absence of streptomycin. The K42R mutant showed similar pathogenicity to its parental strain and should be one of the best choices when using rpsL as a counter-selection marker. PMID:25268958

  10. Platelet-derived growth factor induction of the immediate-early gene MCP-1 is mediated by NF-kappaB and a 90-kDa phosphoprotein coactivator.

    PubMed

    Freter, R R; Alberta, J A; Hwang, G Y; Wrentmore, A L; Stiles, C D

    1996-07-19

    A broad panel of agents including serum, interleukin-1, double-stranded RNA, and platelet-derived growth factor (PDGF) stimulate transcription of the "slow" immediate-early gene MCP-1. These disparate inducers act through a tight cluster of regulatory elements in the distal 5'-flanking sequences of the MCP-1 gene. We describe a 22-base element in this cluster which, in single copy, confers PDGF-inducibility to a tagged MCP-1 reporter gene. In mobility shift assays, the element binds a PDGF-activated form of NF-kappaB, and a 90-kDa protein (p90) which binds constitutively. Antibody supershift and UV cross-linking experiments indicate that the PDGF-activated NF-kappaB species is a Rel A homodimer. The DNA binding form of p90 is a nuclear-restricted serine/threonine phosphoprotein. Mutagenesis of the 22-base element shows that the NF-kappaB and p90 binding sites overlap, but binding of the two species is mutually independent. Both sites, however, are required for optimum PDGF induction of MCP-1. Therefore, p90 appears to be a coactivator with NF-kappaB in PDGF-mediated induction of MCP-1. PMID:8663287

  11. Herpes simplex virus induces the marked up-regulation of the zinc finger transcriptional factor INSM1, which modulates the expression and localization of the immediate early protein ICP0

    PubMed Central

    2011-01-01

    Background Herpes simplex viruses (HSVs) rapidly shut off macromolecular synthesis in host cells. In contrast, global microarray analyses have shown that HSV infection markedly up-regulates a number of host cell genes that may play important roles in HSV-host cell interactions. To understand the regulatory mechanisms involved, we initiated studies focusing on the zinc finger transcription factor insulinoma-associated 1 (INSM1), a host cell protein markedly up-regulated by HSV infection. Results INSM1 gene expression in HSV-1-infected normal human epidermal keratinocytes increased at least 400-fold 9 h after infection; INSM1 promoter activity was also markedly stimulated. Expression and subcellular localization of the immediate early HSV protein ICP0 was affected by INSM1 expression, and chromatin immunoprecipitation (ChIP) assays revealed binding of INSM1 to the ICP0 promoter. Moreover, the role of INSM1 in HSV-1 infection was further clarified by inhibition of HSV-1 replication by INSM1-specific siRNA. Conclusions The results suggest that INSM1 up-regulation plays a positive role in HSV-1 replication, probably by binding to the ICP0 promoter. PMID:21609490

  12. Analysis of DNA sequences which regulate the transcription of herpes simplex virus immediate early gene 3: DNA sequences required for enhancer-like activity and response to trans-activation by a virion polypeptide.

    PubMed Central

    Bzik, D J; Preston, C M

    1986-01-01

    The far upstream region of herpes simplex virus (HSV) immediate early (IE) gene 3 has previously been shown to increase gene expression in an enhancer-like manner, and to contain sequences which respond to stimulation of transcription by a virion polypeptide, Vmw65. To analyse the specific DNA sequences which mediate these functions, sequential deletions from each end of the far upstream region were made. The effects of the deletions on transcription in the absence or presence of the Vmw65 were measured by use of a transient expression assay. The enhancer-like activity was due to three separable elements, whereas two additional DNA regions were involved in the response to Vmw65. One of the responding elements corresponded to an AT-rich consensus (TAATGARATTC, where R = purine) present in all IE gene far upstream regions, and the other was a GA-rich sequence also present in IE genes 2 and 4/5. The TAATGARATTC element could mediate responsiveness to Vmw65 but it was fully active only in the presence of the GA-rich element. The GA-rich element was unable to confer a strong response alone but could activate an otherwise nonfunctional homologue of TAATGARATTC. PMID:3003700

  13. Analysis of DNA sequences which regulate the transcription of herpes simplex virus immediate early gene 3: DNA sequences required for enhancer-like activity and response to trans-activation by a virion polypeptide.

    PubMed

    Bzik, D J; Preston, C M

    1986-01-24

    The far upstream region of herpes simplex virus (HSV) immediate early (IE) gene 3 has previously been shown to increase gene expression in an enhancer-like manner, and to contain sequences which respond to stimulation of transcription by a virion polypeptide, Vmw65. To analyse the specific DNA sequences which mediate these functions, sequential deletions from each end of the far upstream region were made. The effects of the deletions on transcription in the absence or presence of the Vmw65 were measured by use of a transient expression assay. The enhancer-like activity was due to three separable elements, whereas two additional DNA regions were involved in the response to Vmw65. One of the responding elements corresponded to an AT-rich consensus (TAATGARATTC, where R = purine) present in all IE gene far upstream regions, and the other was a GA-rich sequence also present in IE genes 2 and 4/5. The TAATGARATTC element could mediate responsiveness to Vmw65 but it was fully active only in the presence of the GA-rich element. The GA-rich element was unable to confer a strong response alone but could activate an otherwise nonfunctional homologue of TAATGARATTC. PMID:3003700

  14. Expression of the immediate early IE180 protein under the control of the hTERT and CEA tumor-specific promoters in recombinant pseudorabies viruses: Effects of IE180 protein on promoter activity and apoptosis induction.

    PubMed

    Lerma, L; Alcalá, S; Piñero, C; Torres, M; Martin, B; Lim, F; Sainz, B; Tabarés, E

    2016-01-15

    Since the pseudorabies virus (PRV) genome encodes for a single immediate-early protein, IE180, we reasoned that this strong transactivating protein could represent a key regulatory switch that could be genetically manipulated in order to alter its tropism towards cancer cells. We therefore initiated studies to test whether the human telomerase reverse transcriptase (hTERT) and carcinoembryonic antigen (CEA) tumor promoters could functionally replace the IE180 promoter. We show that both promoters can functionally substitute the IE180 promoter in plasmid constructs and recombinant viruses, and observed that IE180 differentially auto-regulated each promoter tested, with PRV IE180 negatively regulating the hTERT promoter but positively hyper-activating the CEA promoter. Interestingly, we also observed that the recombinant PRV-TER and PRV-CEA viruses preferentially replicated in diverse cancer cell lines compared to control non-cancer cells, and the PRV-CEA was capable of additionally inducing a profound apoptotic phenotype which we correlated to the overexpression of IE180. PMID:26590793

  15. Binding of the human cytomegalovirus 80-kDa immediate-early protein (IE2) to minor groove A/T-rich sequences bounded by CG dinucleotides is regulated by protein oligomerization and phosphorylation.

    PubMed

    Waheed, I; Chiou, C J; Ahn, J H; Hayward, G S

    1998-12-01

    The 80-kDa immediate-early regulatory protein IE2 of human cytomegalovirus (HCMV) functions as an essential positive transactivator of downstream viral promoters, but it also specifically down-regulates transcription from the major immediate-early promoter through a 14-bp DNA target motif known as the cis-repression signal (CRS) located at the transcription start site. The IE2 protein purified from bacteria as a fusion product of either staphylococcal Protein A/IE2(290-579) or glutathione-S-transferase (GST)/IE2(346-579) bound specifically to a [32P]-labeled CRS oligonucleotide probe in an in vitro electrophoretic mobility shift assay (EMSA). In contrast, no direct interaction with the CRS probes could be detected with IE2 wild-type protein in extracts from infected or transfected mammalian cells or when synthesized by in vitro translation. However, in vitro phosphorylation of GST/IE2(346-579) by incubation with either the catalytic subunit of protein kinase A (PKA) or a HeLa cell nuclear extract strongly inhibited its DNA-binding activity. This process required ATP hydrolysis and could be reversed by subsequent incubation with bacterial alkaline phosphatase. Importantly, dephosphorylation of the constitutively expressed native IE2 protein present in a nuclear extract from the U373(A45) cell line unmasked a specific CRS DNA-binding activity that could be supershifted with anti-IE2 monoclonal antibody (mAb). A series of high-molecular-weight hetero-oligomeric DNA-bound structures of intermediate mobility were formed in EMSA assays when a mixture of staphylococcal Protein A/IE2 and GST/IE2 was coincubated with the CRS probe. Coincubation with a DNA-binding negative but dimerization-competent GST/IE2 deletion mutant competitively inhibited DNA-binding by staphylococcal Protein A/IE2, whereas coincubation with a GST/IE2 deletion mutant that lacked the ability to both dimerize and bind to DNA failed to influence the mobility of the DNA-bound staphylococcal Protein A/IE2

  16. Control of Murine Cytomegalovirus in the Lungs: Relative but Not Absolute Immunodominance of the Immediate-Early 1 Nonapeptide during the Antiviral Cytolytic T-Lymphocyte Response in Pulmonary Infiltrates

    PubMed Central

    Holtappels, Rafaela; Podlech, Jürgen; Geginat, Gernot; Steffens, Hans-Peter; Thomas, Doris; Reddehase, Matthias J.

    1998-01-01

    The lungs are a major organ site of cytomegalovirus (CMV) infection, pathogenesis, and latency. Interstitial CMV pneumonia represents a critical manifestation of CMV disease, in particular in recipients of bone marrow transplantation (BMT). We have employed a murine model for studying the immune response to CMV in the lungs in the specific scenario of immune reconstitution after syngeneic BMT. Control of pulmonary infection was associated with a vigorous infiltration of the lungs, which was characterized by a preferential recruitment and massive expansion of the CD8 subset of α/β T cells. The infiltrate provided a microenvironment in which the CD8 T cells differentiated into mature effector cells, that is, into functionally active cytolytic T lymphocytes (CTL). This gave us the opportunity for an ex vivo testing of the antigen specificities of CTL present at a relevant organ site of viral pathogenesis. The contribution of the previously identified immediate-early 1 (IE1) nonapeptide of murine CMV was evaluated by comparison with the CD3ɛ-redirected cytolytic activity used as a measure of the overall CTL response in the lungs. The IE1 peptide was detected by pulmonary CTL, but it accounted for a minor part of the response. Interestingly, no additional viral or virus-induced antigenic peptides were detectable among naturally processed peptides derived from infected lungs, even though infected fibroblasts were recognized in a major histocompatibility complex-restricted manner. We conclude that the antiviral pulmonary immune response is a collaborative function that involves many antigenic peptides, among which the IE1 peptide is immunodominant in a relative sense. PMID:9696814

  17. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II

    SciTech Connect

    Sample, Robert; Bryan, Locke; Long, Scott; Majji, Sai; Hoskins, Glenn; Sinning, Allan; Olivier, Jake; Chinchar, V. Gregory . E-mail: vchinchar@microbio.umsmed.edu

    2007-02-20

    Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

  18. Profiling of the toxicity mechanisms of coated and uncoated silver nanoparticles to yeast Saccharomyces cerevisiae BY4741 using a set of its 9 single-gene deletion mutants defective in oxidative stress response, cell wall or membrane integrity and endocytosis.

    PubMed

    Käosaar, Sandra; Kahru, Anne; Mantecca, Paride; Kasemets, Kaja

    2016-09-01

    The widespread use of nanosilver in various antibacterial, antifungal, and antiviral products warrants the studies of the toxicity pathways of nanosilver-enabled materials toward microbes and viruses. We profiled the toxicity mechanisms of uncoated, casein-coated, and polyvinylpyrrolidone-coated silver nanoparticles (AgNPs) using Saccharomyces cerevisiae wild-type (wt) and its 9 single-gene deletion mutants defective in oxidative stress (OS) defense, cell wall/membrane integrity, and endocytosis. The 48-h growth inhibition assay in organic-rich growth medium and 24-h cell viability assay in deionized (DI) water were applied whereas AgNO3, H2O2, and SDS served as positive controls. Both coated AgNPs (primary size 8-12nm) were significantly more toxic than the uncoated (~85nm) AgNPs. All studied AgNPs were ~30 times more toxic if exposed to yeast cells in DI water than in the rich growth medium: the IC50 based on nominal concentration of AgNPs in the growth inhibition test ranged from 77 to 576mg Ag/L and in the cell viability test from 2.7 to 18.7mg Ag/L, respectively. Confocal microscopy showed that wt but not endocytosis mutant (end3Δ) internalized AgNPs. Comparison of toxicity patterns of wt and mutant strains defective in OS defense and membrane integrity revealed that the toxicity of the studied AgNPs to S. cerevisiae was not caused by the OS or cell wall/membrane permeabilization. PMID:27260961

  19. Transforming Growth Factor Beta 1 Stimulates Expression of the Epstein-Barr Virus BZLF1 Immediate-Early Gene Product ZEBRA by an Indirect Mechanism Which Requires the MAPK Kinase Pathway

    PubMed Central

    Fahmi, Hassan; Cochet, Chantal; Hmama, Zakariae; Opolon, Paule; Joab, Irene

    2000-01-01

    Disruption of Epstein-Barr virus (EBV) latency is mediated by ZEBRA, the protein product of the immediate-early EBV gene, BZLF1. In vitro, phorbol 12-myristate 13-acetate (PMA), a potent activator of protein kinase C (PKC), induces reactivation of EBV. However, the physiological stimuli responsible for the disruption of viral latency are not well characterized. Transforming growth factor beta 1 (TGF-β1) has also been shown to trigger the reactivation of EBV in Burkitt lymphoma cell lines; however, the effect of TGF-β1 on ZEBRA expression has not been reported. To further understand this phenomenon, we have investigated the effect of TGF-β1 on ZEBRA expression. Our results indicate that the treatment of different EBV-positive Burkitt's lymphoma cell lines with TGF-β1 induces a time-dependent activation of BZLF1 transcription with a corresponding increase in the production of the protein ZEBRA. TGF-β1 has been shown to exert its effects through a wide range of intracellular routes; in the present study, we have explored these pathways. Transient expression of Smad proteins on their own had no effect on ZEBRA expression. A specific inhibitor of p38 mitogen-activated protein kinase (MAPK), SB203580, did not affect TGF-β1-induced ZEBRA expression, whereas treatment with the MAPK/ERK kinase inhibitors, PD98059 and U0126, dramatically decreased this induction. This suggests that TGF-β1 effect on BZLF1 expression requires the MAPK pathway. However, in Raji and B95-8 cells additional routes can be used, as (i) the inhibition of ZEBRA induction by PD98059 or U0126 was incomplete, whereas these inhibitors completely abolished PMA-induced ZEBRA expression, (ii) TGF-β1 induction of ZEBRA expression occurs in PKC-depleted cells, (iii) in Raji and in B95-8 cells, the effect of TGF-β1 and PMA are additive. Transient transfection of the EBV-negative B-cell line DG75 with a BZLF1 promoter-fusion construct (Zp-CAT) showed that under conditions where the BZLF1 promoter is

  20. The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

    SciTech Connect

    Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O'Callaghan, Dennis J. . E-mail: docall@lsuhsc.edu

    2007-06-20

    The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed.

  1. mdv1-miR-M7-5p, located in the newly identified first intron of the latency-associated transcript of Marek's disease virus, targets the immediate-early genes ICP4 and ICP27.

    PubMed

    Strassheim, S; Stik, G; Rasschaert, D; Laurent, S

    2012-08-01

    Marek's disease virus serotype 1 (MDV-1) is an oncogenic alphaherpesvirus causing fatal T-cell lymphoma in chickens. MDV latency is characterized by the production of latency-associated transcripts (LATs), a family of non-protein-coding spliced RNAs. A cluster of four microRNAs (cluster mdv1-miR-M8-M10) was identified, but not formally mapped, at the predicted LAT 5' end. We established a LAT cDNA library from latently MDV-infected cell line MSB-1. We identified 22 highly variable LATs, which were due to the extensive alternative splicing of a total of 14 introns. RACE PCR confirmed the predicted 3' end and allowed identification of the 5' end, 400 nt upstream of the previously predicted LAT end. The LATs share their transcription start site with the microRNA-expressing transcript described previously, localizing the microRNAs to the first LAT intron and identifying the LATs as the primary transcripts of the microRNAs. We identified MDV immediate-early (IE) genes ICP4 and ICP27 as putative targets of mdv1-miR-M7-5p, the third microRNA of the cluster mdv1-miR-M8-M10. Endogenously expressed mdv1-miR-M7-5p in MSB-1 cells reduced luciferase activity significantly when microRNA-responsive elements from ICP4 or ICP27 were cloned in the 3' UTR of the firefly luciferase gene. ICP27 protein levels were decreased by 70 % when the mdv1-miR-M7-5p precursor was co-expressed with an ICP27 expression plasmid. Additionally, we showed a negative correlation between the decreased expression of mdv1-miR-M7-5p and an increase in ICP27 expression during virus reactivation. Our results suggest that, by targeting two IE genes, MDV microRNAs produced from LAT transcripts may contribute to establish and/or maintain latency. PMID:22513387

  2. Two distinct upstream regulatory domains containing multicopy cellular transcription factor binding sites provide basal repression and inducible enhancer characteristics to the immediate-early IES (US3) promoter from human cytomegalovirus.

    PubMed

    Chan, Y J; Tseng, W P; Hayward, G S

    1996-08-01

    The US3 gene of human cytomegalovirus (HCMV) is expressed at immediate-early (IE) times in permissive HF cells, but not in nonpermissive rodent cells, and encodes several proteins that have been reported to have regulatory characteristics, although they are dispensable for growth in cell culture. Both spliced and unspliced forms of US3 IE transcripts are associated with the second of only two known large and complex upstream enhancer domains within the 229-kb HCMV genome, which we refer to as the IES cis-acting control region. Only the 260-bp proximal segment (from -313 to -55) of the 600-bp IES control domain, which contains multicopy NF-kappaB binding sites, proved to be necessary to transfer both high basal expression plus phorbol ester- and okadaic acid-inducible characteristics to heterologous promoters in transient assays in U-937 and K-562 cells. However, the IES control region contains a distinctive 280-bp distal domain, characterized by the presence of seven interspersed repeats of a 10-bp TGTCGCGACA palindromic consensus motif that encompasses a NruI site. This far upstream Nru repeat region (from -596 to -314) imparted up to 20-fold down-regulation effects onto strong basal heterologous promoters as well as onto the IES enhancer plus minimal promoter region in both U-937 and K-562 cells. Functional Nru repressor elements (NREs) could not be generated by multimerizing either the palindromic (P) Nru motifs alone or adjacent degenerate interrupted (I Nru motifs alone. However, multimerized forms of the combined P plus I elements reconstituted the full 20-fold cis-acting down-regulation phenotype of the intact NRE domain. The P and I forms of the Nru elements each bound independently and specifically to related cellular DNA-binding factors to form differently migrating A or B complexes, respectively, whereas the combined P plus I elements bound cooperatively to both the A and B complexes with high affinity. Interestingly, nuclear extracts from U-937, K-562

  3. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    SciTech Connect

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither a TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.

  4. Distinct cardioprotective mechanisms of immediate, early and delayed ischaemic postconditioning.

    PubMed

    Barsukevich, Veronika; Basalay, Marina; Sanchez, Jenifer; Mrochek, Alexander; Whittle, John; Ackland, Gareth L; Gourine, Alexander V; Gourine, Andrey

    2015-01-01

    Cardioprotection against ischaemia/reperfusion injury in mice can be achieved by delayed ischaemic postconditioning (IPost) applied as late as 30 min after the onset of reperfusion. We determined the efficacy of delayed IPost in a rat model of myocardial infarction (MI) and investigated potential underlying mechanisms of this phenomenon. Rats were subjected to 20, 30 or 45 min of coronary artery occlusion followed by 120 min of reperfusion (I/R). Immediate and early IPost included six cycles of I/R (10/10 s) applied 10 s or 10 min after reperfusion onset. In the second series of experiments, the rats were subjected to 30 min of coronary occlusion followed by IPost applied 10 s, 10, 30, 45 or 60 min after the onset of reperfusion. Immediate and early IPost (applied 10 s or 10 min of reperfusion) established cardioprotection only when applied after a period of myocardial ischaemia lasting 30 min. Delayed IPost applied after 30 or 45 min of reperfusion reduced infarct sizes by 36 and 41 %, respectively (both P < 0.01). IPost applied 60 min after reperfusion onset was ineffective. Inhibition of RISK pathway (administration of ERK1/2 inhibitor PD-98059 or PI3K inhibitor LY-294002) abolished cardioprotection established by immediate IPost but had no effect on cardioprotection conferred by early IPost. Blockade of SAFE pathway using JAK/STAT inhibitor AG490 had no effect on the immediate or early IPost cardioprotection. Blockade of mitochondrial KATP (mitoKATP) channels (with 5-Hydroxydecanoate) abolished cardioprotection achieved by immediate and early IPost, but had no effect on cardioprotection when IPost was applied 30 or 45 min into the reperfusion period. Immediate IPost increased phosphorylation of PI3K-AKT and ERK1/2. Early or delayed IPost had no effect on phosphorylation of PI3K-AKT, ERK1/2 or STAT3. These data show that in the rat model, delayed IPost confers significant cardioprotection even if applied 45 min after onset of reperfusion. Cardioprotection induced by immediate and early postconditioning involves recruitment of RISK pathway and/or mitoKATP channels, while delayed postconditioning appears to rely on a different mechanism. PMID:25449894

  5. SHC2 gene copy number in multiple system atrophy (MSA)

    PubMed Central

    Ferguson, Marcus C.; Garland, Emily M.; Hedges, Lora; Womack-Nunley, Bethany; Hamid, Rizwan; Phillips, John A.; Shibao, Cyndya A.; Raj, Satish R.; Biaggioni, Italo; Robertson, David

    2013-01-01

    Purpose Multiple system atrophy (MSA) is a sporadic, late onset, rapidly-progressing neurodegenerative disorder, which is characterized by autonomic failure, together with parkinsonian, cerebellar, and pyramidal motor symptoms. The pathologic hallmark is the glial cytoplasmic inclusion with alpha-synuclein aggregates. MSA is thus an alpha synucleinopathy. Recently, Sasaki et al. reported that heterozygosity for copy number loss of Src homology 2 domain containing-transforming protein 2 (SHC2) genes (heterozygous SHC2 gene deletions) occurred in DNAs from many Japanese individuals with MSA. Because background copy number variation (CNV) can be distinct in different human populations, we assessed SHC2 allele copy number in DNAs from a US cohort of individuals with MSA, to determine the contribution of SHC2 gene copy number variation in an American cohort followed at a US referral center for MSA. Our cohort included 105 carefully phenotyped individuals with MSA. Methods We studied 105 well characterized patients with MSA and 5 control subjects with reduced SHC2 gene copy number. We used two TaqMan Gene Copy Number Assays, to determine the copy number of two segments of the SHC2 gene that are separated by 27 Kb. Results Assay results of DNAs from all of our 105 subjects with MSA showed two copies of both segments of their SHC2 genes. Conclusion Our results indicate that SHC2 gene deletions underlie few, if any, cases of well characterized MSA in the US population. This is in contrast to the Japanese experience reported by Sasaki et al., likely reflecting heterogeneity of the disease in different genetic backgrounds. PMID:24170347

  6. Trehalose-related Gene Deletions in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a widespread corn pathogen that causes root, stalk and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Our goal is to assess the feasibility of exploiting trehalose metabolism as a target for F. verticillioides...

  7. CHARACTERIZING FUMONISIN BIOSYNTHESIS THROUGH ANALYSIS OF FUM GENE DELETION MUTANTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fumonisins are produced by Gibberella moniliformis, a causal agent of maize ear and stalk rot, and pose a health risk to humans and livestock alike. Recently, a fumonisin biosynthetic gene cluster was described in G. moniliformis. The cluster consists of 15 co-regulated genes (FUM1 and FUM6 throug...

  8. Site-directed mutagenesis and gene deletion using reverse genetics.

    PubMed

    Muhl, Daniela; Filloux, Alain

    2014-01-01

    Understanding gene function is far easier when tools are available to engineer a bacterial strain lacking a specific gene and phenotypically compare its behavior with the corresponding parental strain. Such mutants could be selected randomly, either by natural selection under particular stress conditions or by random mutagenesis using transposon delivery as described elsewhere in this book. However, with the advent of the genomic era there are now hundreds of bacterial genomes whose sequence is available, and thus, genes can be identified, chosen, and strategies designed to specifically inactivate them. This can be done by using suicide plasmids and is most convenient when the bacterium of interest is easily amenable to genetic manipulation. The method presented here will describe the use of a suicide vector, pKNG101, which allows the selection of a double-recombination event. The first event results in the integration of the pKNG101 derivative carrying the "mutator" fragment onto the chromosome, and could be selected on plates containing appropriate antibiotics. The pKNG101 carries the sacB gene, which induces death when cells are grown on sucrose. Growth on sucrose plates will thus select the second homologous recombination event, which results in removing the plasmid backbone and leaving behind the mutated target gene. This method has been widely used over the last 20 years to inactivate genes in a wide range of gram-negative bacteria and in particular in Pseudomonas aeruginosa. PMID:24818930

  9. CaMK4 Gene Deletion Induces Hypertension

    PubMed Central

    Santulli, Gaetano; Cipolletta, Ersilia; Sorriento, Daniela; Del Giudice, Carmine; Anastasio, Antonio; Monaco, Sara; Maione, Angela Serena; Condorelli, Gianluigi; Puca, Annibale; Trimarco, Bruno; Illario, Maddalena; Iaccarino, Guido

    2012-01-01

    Background The expression of calcium/calmodulin-dependent kinase IV (CaMKIV) was hitherto thought to be confined to the nervous system. However, a recent genome-wide analysis indicated an association between hypertension and a single-nucleotide polymorphism (rs10491334) of the human CaMKIV gene (CaMK4), which suggests a role for this kinase in the regulation of vascular tone. Methods and Results To directly assess the role of CaMKIV in hypertension, we characterized the cardiovascular phenotype of CaMK4−/− mice. They displayed a typical hypertensive phenotype, including high blood pressure levels, cardiac hypertrophy, vascular and kidney damage, and reduced tolerance to chronic ischemia and myocardial infarction compared with wild-type littermates. Interestingly, in vitro experiments showed the ability of this kinase to activate endothelial nitric oxide synthase. Eventually, in a population study, we found that the rs10491334 variant associates with a reduction in the expression levels of CaMKIV in lymphocytes from hypertensive patients. Conclusions Taken together, our results provide evidence that CaMKIV plays a pivotal role in blood pressure regulation through the control of endothelial nitric oxide synthase activity. (J Am Heart Assoc. 2012;1:e001081 doi: 10.1161/JAHA.112.001081.) PMID:23130158

  10. Trehalose-related gene deletions in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a widespread corn pathogen that causes root, stalk, and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Our goal is to assess the feasibility of exploiting trehalose metabolism as a target for F. verticillioide...

  11. Gene Deletion and Functional Analysis of Fusarium verticillioides Trehalose Metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a species of fungus that causes stalk, ear, and kernel rot of corn and produces fumonisins, a group of mycotoxins that have dangerous health effects. We have observed previously that the intracellular concentration of trehalose, a disaccharide involved in resistance to st...

  12. Multiple replication origins with diverse control mechanisms in Haloarcula hispanica

    PubMed Central

    Wu, Zhenfang; Liu, Jingfang; Yang, Haibo; Liu, Hailong; Xiang, Hua

    2014-01-01

    The use of multiple replication origins in archaea is not well understood. In particular, little is known about their specific control mechanisms. Here, we investigated the active replication origins in the three replicons of a halophilic archaeon, Haloarcula hispanica, by extensive gene deletion, DNA mutation and genome-wide marker frequency analyses. We revealed that individual origins are specifically dependent on their co-located cdc6 genes, and a single active origin/cdc6 pairing is essential and sufficient for each replicon. Notably, we demonstrated that the activities of oriC1 and oriC2, the two origins on the main chromosome, are differently controlled. A G-rich inverted repeat located in the internal region between the two inverted origin recognition boxes (ORBs) plays as an enhancer for oriC1, whereas the replication initiation at oriC2 is negatively regulated by an ORB-rich region located downstream of oriC2-cdc6E, likely via Cdc6E-titrating. The oriC2 placed on a plasmid is incompatible with the wild-type (but not the ΔoriC2) host strain, further indicating that strict control of the oriC2 activity is important for the cell. This is the first report revealing diverse control mechanisms of origins in haloarchaea, which has provided novel insights into the use and coordination of multiple replication origins in the domain of Archaea. PMID:24271389

  13. Multiple Sclerosis

    MedlinePlus

    Multiple sclerosis (MS) is a nervous system disease that affects your brain and spinal cord. It damages the ... attacks healthy cells in your body by mistake. Multiple sclerosis affects women more than men. It often begins ...

  14. Multiple Pregnancy

    MedlinePlus

    ... is called multiple pregnancy . If more than one egg is released during the menstrual cycle and each ... fraternal twins (or more). When a single fertilized egg splits, it results in multiple identical embryos. This ...

  15. Multiple myeloma

    MedlinePlus

    Plasma cell dyscrasia; Plasma cell myeloma; Malignant plasmacytoma; Plasmacytoma of bone; Myeloma - multiple ... Multiple myeloma most commonly causes: Low red blood cell count ( anemia ), which can lead to fatigue and ...

  16. Finger Multiplication

    ERIC Educational Resources Information Center

    Simanihuruk, Mudin

    2011-01-01

    Multiplication facts are difficult to teach. Therefore many researchers have put a great deal of effort into finding multiplication strategies. Sherin and Fuson (2005) provided a good survey paper on the multiplication strategies research area. Kolpas (2002), Rendtorff (1908), Dabell (2001), Musser (1966) and Markarian (2009) proposed the finger…

  17. Multiple Sclerosis

    MedlinePlus

    ... Awards Enhancing Diversity Find People About NINDS NINDS Multiple Sclerosis Information Page Condensed from Multiple Sclerosis: Hope Through ... en Español Additional resources from MedlinePlus What is Multiple Sclerosis? An unpredictable disease of the central nervous system, ...

  18. Multiplicity Counting

    SciTech Connect

    Geist, William H.

    2015-12-01

    This set of slides begins by giving background and a review of neutron counting; three attributes of a verification item are discussed: 240Pueff mass; α, the ratio of (α,n) neutrons to spontaneous fission neutrons; and leakage multiplication. It then takes up neutron detector systems – theory & concepts (coincidence counting, moderation, die-away time); detector systems – some important details (deadtime, corrections); introduction to multiplicity counting; multiplicity electronics and example distributions; singles, doubles, and triples from measured multiplicity distributions; and the point model: multiplicity mathematics.

  19. Multiple myeloma

    PubMed Central

    2010-01-01

    Abstract Advances in the imaging and treatment of multiple myeloma have occurred over the past decade. This article summarises the current status and highlights how an understanding of both is necessary for optimum management. PMID:20159661

  20. Multiple Sclerosis

    MedlinePlus

    Multiple sclerosis (MS) is a nervous system disease that affects your brain and spinal cord. It damages the myelin sheath, the ... and your body, leading to the symptoms of MS. They can include Visual disturbances Muscle weakness Trouble ...

  1. Multiple myeloma

    MedlinePlus

    Plasma cell dyscrasia; Plasma cell myeloma; Malignant plasmacytoma; Plasmacytoma of bone; Myeloma - multiple ... myeloma most commonly causes a low red blood cell count ( anemia ), which can lead to fatigue and ...

  2. Multiple myeloma.

    PubMed

    Raab, Marc S; Podar, Klaus; Breitkreutz, Iris; Richardson, Paul G; Anderson, Kenneth C

    2009-07-25

    Multiple myeloma is characterised by clonal proliferation of malignant plasma cells, and mounting evidence indicates that the bone marrow microenvironment of tumour cells has a pivotal role in myeloma pathogenesis. This knowledge has already expanded treatment options for patients with multiple myeloma. Prototypic drugs thalidomide, bortezomib, and lenalidomide have each been approved for the treatment of this disease by targeting both multiple myeloma cells and the bone marrow microenvironment. Although benefit was first shown in relapsed and refractory disease, improved overall response, duration of response, and progression-free and overall survival can be achieved when these drugs are part of first-line regimens. This treatment framework promises to improve outcome not only for patients with multiple myeloma, but also with other haematological malignancies and solid tumours. PMID:19541364

  3. Multiple Sclerosis

    PubMed Central

    Hashimoto, S.A.; Jiwa, Theresa I.

    1991-01-01

    Successful management of patients with multiple sclerosis depends upon the involvement of the family physician. All contacts with either a multiple sclerosis clinic or a neurologist should be made at the instigation of the family practitioner. Constant contact with the family physician ensures that the individual receives proper care. While specialty care is needed for many of the symptoms, psychosocial problems are dealt with best by the individual's own family physician. PMID:21229090

  4. [Multiple meningiomas].

    PubMed

    Terrier, L-M; François, P

    2016-06-01

    Multiple meningiomas (MMs) or meningiomatosis are defined by the presence of at least 2 lesions that appear simultaneously or not, at different intracranial locations, without the association of neurofibromatosis. They present 1-9 % of meningiomas with a female predominance. The occurrence of multiple meningiomas is not clear. There are 2 main hypotheses for their development, one that supports the independent evolution of these tumors and the other, completely opposite, that suggests the propagation of tumor cells of a unique clone transformation, through cerebrospinal fluid. NF2 gene mutation is an important intrinsic risk factor in the etiology of multiple meningiomas and some exogenous risk factors have been suspected but only ionizing radiation exposure has been proven. These tumors can grow anywhere in the skull but they are more frequently observed in supratentorial locations. Their histologic types are similar to unique meningiomas of psammomatous, fibroblastic, meningothelial or transitional type and in most cases are benign tumors. The prognosis of these tumors is eventually good and does not differ from the unique tumors except for the cases of radiation-induced multiple meningiomas, in the context of NF2 or when diagnosed in children where the outcome is less favorable. Each meningioma lesion should be dealt with individually and their multiple character should not justify their resection at all costs. PMID:27234913

  5. Multiple Sclerosis.

    ERIC Educational Resources Information Center

    Plummer, Nancy; Michael, Nancy, Ed.

    This module on multiple sclerosis is intended for use in inservice or continuing education programs for persons who administer medications in long-term care facilities. Instructor information, including teaching suggestions, and a listing of recommended audiovisual materials and their sources appear first. The module goal and objectives are then…

  6. Finger Multiplication

    ERIC Educational Resources Information Center

    Holmes, Bill

    2010-01-01

    The author has been prompted to write this article about finger multiplication for a number of reasons. Firstly there are a number of related articles in past issues of "Mathematics Teaching" ("MT") which have connections to this algorithm. Secondly, very few of his primary teaching students and professional colleagues appear to be aware of the…

  7. CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae

    PubMed Central

    Mans, Robert; van Rossum, Harmen M.; Wijsman, Melanie; Backx, Antoon; Kuijpers, Niels G.A.; van den Broek, Marcel; Daran-Lapujade, Pascale; Pronk, Jack T.; van Maris, Antonius J.A.; Daran, Jean-Marc G.

    2015-01-01

    A variety of techniques for strain engineering in Saccharomyces cerevisiae have recently been developed. However, especially when multiple genetic manipulations are required, strain construction is still a time-consuming process. This study describes new CRISPR/Cas9-based approaches for easy, fast strain construction in yeast and explores their potential for simultaneous introduction of multiple genetic modifications. An open-source tool (http://yeastriction.tnw.tudelft.nl) is presented for identification of suitable Cas9 target sites in S. cerevisiae strains. A transformation strategy, using in vivo assembly of a guideRNA plasmid and subsequent genetic modification, was successfully implemented with high accuracies. An alternative strategy, using in vitro assembled plasmids containing two gRNAs, was used to simultaneously introduce up to six genetic modifications in a single transformation step with high efficiencies. Where previous studies mainly focused on the use of CRISPR/Cas9 for gene inactivation, we demonstrate the versatility of CRISPR/Cas9-based engineering of yeast by achieving simultaneous integration of a multigene construct combined with gene deletion and the simultaneous introduction of two single-nucleotide mutations at different loci. Sets of standardized plasmids, as well as the web-based Yeastriction target-sequence identifier and primer-design tool, are made available to the yeast research community to facilitate fast, standardized and efficient application of the CRISPR/Cas9 system. PMID:25743786

  8. Multiple myeloma

    PubMed Central

    Rajkumar, S. Vincent

    2008-01-01

    Multiple myeloma is a clonal plasma cell malignancy that accounts for slightly more than 10% of all hematologic cancers. In this paper, we present a historically focused review of the disease, from the description of the first case in 1844 to the present. The evolution of drug therapy and stem-cell transplantation for the treatment of myeloma, as well as the development of new agents, is discussed. We also provide an update on current concepts of diagnosis and therapy, with an emphasis on how treatments have emerged from a historical perspective after certain important discoveries and the results of experimental studies. PMID:18332230

  9. Multiple sclerosis.

    PubMed

    Files, Daniel Kane; Jausurawong, Tani; Katrajian, Ruba; Danoff, Robert

    2015-06-01

    Multiple sclerosis (MS) is a chronic, debilitating disease that can have devastating effects. Presentation varies widely in symptoms, pace, and progression. In addition to a thorough history and physical examination, diagnostic tools required to diagnose MS and exclude other diagnoses include MRI, evoked potential testing, and cerebrospinal fluid analysis. Although the disease is not curable presently, quality of life can be improved by minimizing the frequency and severity of disease burden. Disease modification, symptom management, preservation of function, and treatment of psychosocial issues are paramount to enhance the quality of life for the patient affected with MS. PMID:25979578

  10. [Multiple apheresis].

    PubMed

    Coffe, C

    2007-05-01

    Multiple apheresis makes it possible to obtain at least two labile blood components from a single donor using a cell separator. It can be either multicomponent apheresis leading to the preparation of at least two different blood component types or red blood cell apheresis providing two identical red blood cell concentrates. These techniques available in addition to whole blood donation, are modifying collection strategies in many Etablissements Français du Sang and will contribute to improve stock logistics in the future. In areas with insufficient stock, these procedures will help achieve blood component self-sufficiency. The author first describes the principle underlying different--current or future--techniques as well as their advantages and drawbacks. He finally addresses the potential impact of these processes on the evolution of blood collection and the advantages to be gained. PMID:17521944

  11. Photovoltaic multiplicities

    NASA Astrophysics Data System (ADS)

    Queisser, Hans J.

    1997-04-01

    A multicell solar energy converter, produced in 1959/60 at the Shockley Transistor Corporation, is reviewed. The feasibility of this device, one of the first involving principles of Si integrated circuits, was demonstrated in anticipation of large-area Si sheets, to be pulled from Si/Pb binary melts. Secondly, the generation of multiple carrier pairs by absorption of merely one photon is discussed. Experiments on high-quality Si solar cells demonstrated this effect, which relies on inverse Auger generation. In principle, much higher maximal conversion efficiencies would be possible; novel criteria for materials optimization result. The new challenge of the inverse band structure problem arises. Finally, multistage optical transitions via deep centers in solar cells are briefly appraised.

  12. Knockout of ERK1 enhances cocaine-evoked immediate early gene expression and behavioral plasticity.

    PubMed

    Ferguson, Susan M; Fasano, Stefania; Yang, Pengwei; Brambilla, Riccardo; Robinson, Terry E

    2006-12-01

    The ability of cocaine to produce lasting neural adaptations in mesocorticolimbic brain regions is thought to promote drug seeking and facilitate addiction in humans. The Ras-controlled Raf-MEK-ERK protein kinase signaling cascade has been implicated in the behavioral and neurobiological actions of cocaine in animals. However, these pharmacological studies have not been able to determine the specific role of the two predominant isoforms of ERK (ERK1 and ERK2) in these processes. We report here that deletion of the ERK1 isoform, which leads to increased ERK2 stimulus-dependent signaling, facilitates the development of cocaine-induced psychomotor sensitization and the acquisition of a cocaine conditioned place preference. Conversely, pharmacological blockade of ERK signaling attenuates the development of psychomotor sensitization to cocaine. Finally, cocaine-evoked gene expression in mesocorticolimbic brain regions is potentiated in ERK1-deficient mice. Thus, alterations in ERK signaling influence both the neurobiological impact of cocaine and its ability to produce enduring forms of drug experience-dependent behavioral plasticity. Our results suggest that enhanced ERK2 signaling following repeated drug exposure may facilitate the development of forms of cocaine-induced plasticity that contribute to addiction. PMID:16407894

  13. LSD1 modulates stress-evoked transcription of immediate early genes and emotional behavior.

    PubMed

    Rusconi, Francesco; Grillo, Barbara; Ponzoni, Luisa; Bassani, Silvia; Toffolo, Emanuela; Paganini, Leda; Mallei, Alessandra; Braida, Daniela; Passafaro, Maria; Popoli, Maurizio; Sala, Mariaelvina; Battaglioli, Elena

    2016-03-29

    Behavioral changes in response to stressful stimuli can be controlled via adaptive epigenetic changes in neuronal gene expression. Here we indicate a role for the transcriptional corepressor Lysine-Specific Demethylase 1 (LSD1) and its dominant-negative splicing isoform neuroLSD1, in the modulation of emotional behavior. In mouse hippocampus, we show that LSD1 and neuroLSD1 can interact with transcription factor serum response factor (SRF) and set the chromatin state of SRF-targeted genes early growth response 1 (egr1) and c-fos Deletion or reduction of neuro LSD1 in mutant mice translates into decreased levels of activating histone marks at egr1 and c-fos promoters, dampening their psychosocial stress-induced transcription and resulting in low anxiety-like behavior. Administration of suberoylanilide hydroxamine to neuroLSD1(KO)mice reactivates egr1 and c-fos transcription and restores the behavioral phenotype. These findings indicate that LSD1 is a molecular transducer of stressful stimuli as well as a stress-response modifier. Indeed, LSD1 expression itself is increased acutely at both the transcriptional and splicing levels by psychosocial stress, suggesting that LSD1 is involved in the adaptive response to stress. PMID:26976584

  14. Sustained transcription of the immediate early gene Arc in the dentate gyrus after spatial exploration.

    PubMed

    Ramirez-Amaya, Victor; Angulo-Perkins, Arafat; Chawla, Monica K; Barnes, Carol A; Rosi, Susanna

    2013-01-23

    After spatial exploration in rats, Arc mRNA is expressed in ∼2% of dentate gyrus (DG) granule cells, and this proportion of Arc-positive neurons remains stable for ∼8 h. This long-term presence of Arc mRNA following behavior is not observed in hippocampal CA1 pyramidal cells. We report here that in rats ∼50% of granule cells with cytoplasmic Arc mRNA, induced some hours previously during exploration, also show Arc expression in the nucleus. This suggests that recent transcription can occur long after the exploration behavior that elicited it. To confirm that the delayed nuclear Arc expression was indeed recent transcription, Actinomycin D was administered immediately after exploration. This treatment resulted in inhibition of recent Arc expression both when evaluated shortly after exploratory behavior as well as after longer time intervals. Together, these data demonstrate a unique kinetic profile for Arc transcription in hippocampal granule neurons following behavior that is not observed in other cell types. Among a number of possibilities, this sustained transcription may provide a mechanism that ensures that the synaptic connection weights in the sparse population of granule cells recruited during a given behavioral event are able to be modified. PMID:23345235

  15. Immediate early responses of avian tracheal epithelial cells to infection with highly pathogenic avian influenza

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Highly pathogenic (HP) avian influenza viruses (AIV) present an on going threat to the U.S. poultry industry. In order to develop new AIV control strategies it is necessary to understand the underlying mechanism of viral infection. Because the early events of AIV infection can occur on tracheal ep...

  16. Immediate early responses of avian tracheal epithelial cells to infection with highly pathogenic avian invluenza virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Highly pathogenic (HP) avian influenza viruses (AIV) present an ongoing threat to the world poultry industry. In order to develop new AIV control strategies it is necessary to understand the underlying mechanism of viral infection at mucosal respiratory sites. Chicken and duck tracheal epithelial ...

  17. LSD1 modulates stress-evoked transcription of immediate early genes and emotional behavior

    PubMed Central

    Rusconi, Francesco; Grillo, Barbara; Ponzoni, Luisa; Bassani, Silvia; Toffolo, Emanuela; Paganini, Leda; Mallei, Alessandra; Braida, Daniela; Passafaro, Maria; Popoli, Maurizio; Sala, Mariaelvina; Battaglioli, Elena

    2016-01-01

    Behavioral changes in response to stressful stimuli can be controlled via adaptive epigenetic changes in neuronal gene expression. Here we indicate a role for the transcriptional corepressor Lysine-Specific Demethylase 1 (LSD1) and its dominant-negative splicing isoform neuroLSD1, in the modulation of emotional behavior. In mouse hippocampus, we show that LSD1 and neuroLSD1 can interact with transcription factor serum response factor (SRF) and set the chromatin state of SRF-targeted genes early growth response 1 (egr1) and c-fos. Deletion or reduction of neuroLSD1 in mutant mice translates into decreased levels of activating histone marks at egr1 and c-fos promoters, dampening their psychosocial stress-induced transcription and resulting in low anxiety-like behavior. Administration of suberoylanilide hydroxamine to neuroLSD1KO mice reactivates egr1 and c-fos transcription and restores the behavioral phenotype. These findings indicate that LSD1 is a molecular transducer of stressful stimuli as well as a stress-response modifier. Indeed, LSD1 expression itself is increased acutely at both the transcriptional and splicing levels by psychosocial stress, suggesting that LSD1 is involved in the adaptive response to stress. PMID:26976584

  18. Prenylation differentially inhibits insulin-dependent immediate early gene mRNA expression.

    PubMed

    Franklin, J Lee; Amsler, Maggie O; Messina, Joseph L

    2016-06-01

    Increased activity of prenyl transferases is observed in pathological states of insulin resistance, diabetes, and obesity. Thus, functional inhibitors of farnesyl transferase (FTase) and geranylgeranyl transferase (GGTase) may be promising therapeutic treatments. We previously identified insulin responsive genes from a rat H4IIE hepatoma cell cDNA library, including β-actin, EGR1, Pip92, c-fos, and Hsp60. In the present study, we investigated whether acute treatment with FTase and GGTase inhibitors would alter insulin responsive gene initiation and/or elongation rates. We observed differential regulation of insulin responsive gene expression, suggesting a differential sensitivity of these genes to one or both of the specific protein prenylation inhibitors. PMID:27086854

  19. Rodent cell transformation and immediate early gene expression following 60-Hz magnetic field exposure.

    PubMed Central

    Balcer-Kubiczek, E K; Zhang, X F; Harrison, G H; McCready, W A; Shi, Z M; Han, L H; Abraham, J M; Ampey, L L; Meltzer, S J; Jacobs, M C; Davis, C C

    1996-01-01

    Some epidemiological studies suggest that exposure to power frequency magnetic fields (MFs) may be associated with an elevated risk of human cancer, but the experimental database remains limited and controversial. We investigated the hypothesis that 60-Hz MF action at the cellular level produces changes in gene expression that can result in neoplastic transformation. Twenty-four hour 200 microT continuous MF exposure produced negative results in two standard transformation systems (Syrian hamster embryo cells and C3H/10T1/2 murine fibroblasts) with or without postexposure to a chemical promoter. This prompted a reexamination of previously reported MF-induced changes in gene expression in human HL60 cells. Extensive testing using both coded and uncoded analyses was negative for an MF effect. Using the same exposure conditions as in the transformation studies, no MF-induced changes in ornithine decarboxylase expression were observed in C3H/10T1/2 cells, casting doubt on a promotional role of MF for the tested cells and experimental conditions. Images Figure 1. Figure 2. A Figure 2. B Figure 2. C Figure 2. D Figure 3. A Figure 3. B Figure 4. Figure 5. A Figure 5. B Figure 5. C Figure 5. D Figure 5. E Figure 6. A Figure 6. B Figure 6. C Figure 6. D Figure 6. E Figure 7. Figure 8. A Figure 8. B Figure 8. C Figure 9. Figure 10. A Figure 10. B PMID:8959408

  20. Immediate, Early, and Conventional Implant Placement in a Patient with History of Periodontitis

    PubMed Central

    Lanza, Alessandro; Scognamiglio, Fabio; Femiano, Felice; Lanza, Michele

    2015-01-01

    The aim of this paper is to describe a case of implant-prosthetic rehabilitation in a patient with periodontitis, focusing on the different timing of implant placement. After initial periodontal treatment, teeth with advanced mobility degree and severe bone resorption were extracted. At different healing time oral implants were placed in a prosthetic-guided position. After osseointegration period the implants were loaded and the results at one year of follow-up are presented. PMID:25949833

  1. Water deprivation-induced sodium appetite: humoral and cardiovascular mediators and immediate early genes

    NASA Technical Reports Server (NTRS)

    De Luca, Laurival A Jr; Xu, Zhice; Schoorlemmer, Guus H M.; Thunhorst, Robert L.; Beltz, Terry G.; Menani, Jose V.; Johnson, Alan Kim

    2002-01-01

    Adult rats deprived of water for 24-30 h were allowed to rehydrate by ingesting only water for 1-2 h. Rats were then given access to both water and 1.8% NaCl. This procedure induced a sodium appetite defined by the operational criteria of a significant increase in 1.8% NaCl intake (3.8 +/- 0.8 ml/2 h; n = 6). Expression of Fos (as assessed by immunohistochemistry) was increased in the organum vasculosum of the lamina terminalis (OVLT), median preoptic nucleus (MnPO), subfornical organ (SFO), and supraoptic nucleus (SON) after water deprivation. After rehydration with water but before consumption of 1.8% NaCl, Fos expression in the SON disappeared and was partially reduced in the OVLT and MnPO. However, Fos expression did not change in the SFO. Water deprivation also 1) increased plasma renin activity (PRA), osmolality, and plasma Na+; 2) decreased blood volume; and 3) reduced total body Na+; but 4) did not alter arterial blood pressure. Rehydration with water alone caused only plasma osmolality and plasma Na+ concentration to revert to euhydrated levels. The changes in Fos expression and PRA are consistent with a proposed role for ANG II in the control of the sodium appetite produced by water deprivation followed by rehydration with only water.

  2. Pretransplant immediately early-1-specific T cell responses provide protection for CMV infection after kidney transplantation.

    PubMed

    Bestard, O; Lucia, M; Crespo, E; Van Liempt, B; Palacio, D; Melilli, E; Torras, J; Llaudó, I; Cerezo, G; Taco, O; Gil-Vernet, S; Grinyó, J M; Cruzado, J M

    2013-07-01

    Cytomegalovirus (CMV) infection is still a major complication after kidney transplantation. Although cytotoxic CMV-specific T cells play a crucial role controlling CMV survival and replication, current pretransplant risk assessment for CMV infection is only based on donor/recipient (IgG)-serostatus. Here, we evaluated the usefulness of monitoring pre- and 6-month CMV-specific T cell responses against two dominant CMV antigens (IE-1 and pp65) and a CMV lysate, using an IFN-γ Elispot, for predicting the advent of CMV infection in two cohorts of 137 kidney transplant recipients either receiving routine prophylaxis (n = 39) or preemptive treatment (n = 98). Incidence of CMV antigenemia/disease within the prophylaxis and preemptive group was 28%/20% and 22%/12%, respectively. Patients developing CMV infection showed significantly lower anti-IE-1-specific T cell responses than those that did not in both groups (p < 0.05). In a ROC curve analysis, low pretransplant anti-IE-1-specific T cell responses predicted the risk of both primary and late-onset CMV infection with high sensitivity and specificity (AUC > 0.70). Furthermore, when using most sensitive and specific Elispot cut-off values, a higher than 80% and 90% sensitivity and negative predictive value was obtained, respectively. Monitoring IE-1-specific T cell responses before transplantation may be useful for predicting posttransplant risk of CMV infection, thus potentially guiding decision-making regarding CMV preventive treatment. PMID:23711167

  3. Multiple myeloma.

    PubMed

    Röllig, Christoph; Knop, Stefan; Bornhäuser, Martin

    2015-05-30

    Multiple myeloma is a malignant disease characterised by proliferation of clonal plasma cells in the bone marrow and typically accompanied by the secretion of monoclonal immunoglobulins that are detectable in the serum or urine. Increased understanding of the microenvironmental interactions between malignant plasma cells and the bone marrow niche, and their role in disease progression and acquisition of therapy resistance, has helped the development of novel therapeutic drugs for use in combination with cytostatic therapy. Together with autologous stem cell transplantation and advances in supportive care, the use of novel drugs such as proteasome inhibitors and immunomodulatory drugs has increased response rates and survival substantially in the past several years. Present clinical research focuses on the balance between treatment efficacy and quality of life, the optimum sequencing of treatment options, the question of long-term remission and potential cure by multimodal treatment, the pre-emptive treatment of high-risk smouldering myeloma, and the role of maintenance. Upcoming results of ongoing clinical trials, together with a pipeline of promising new treatments, raise the hope for continuous improvements in the prognosis of patients with myeloma in the future. PMID:25540889

  4. Multiple sclerosis.

    PubMed

    Filippi, Massimo; Preziosa, Paolo; Rocca, Maria A

    2016-01-01

    Due to its sensitivity to the different multiple sclerosis (MS)-related abnormalities, magnetic resonance imaging (MRI) has become an established tool to diagnose MS and to monitor its evolution. MRI has been included in the diagnostic workup of patients with clinically isolated syndromes suggestive of MS, and ad hoc criteria have been proposed and are regularly updated. In patients with definite MS, the ability of conventional MRI techniques to explain patients' clinical status and progression of disability is still suboptimal. Several advanced MRI-based technologies have been applied to estimate overall MS burden in the different phases of the disease. Their use has allowed the heterogeneity of MS pathology in focal lesions, normal-appearing white matter and gray matter to be graded in vivo. Recently, additional features of MS pathology, including macrophage infiltration and abnormal iron deposition, have become quantifiable. All of this, combined with functional imaging techniques, is improving our understanding of the mechanisms associated with MS evolution. In the near future, the use of ultrahigh-field systems is likely to provide additional insight into disease pathophysiology. However, the utility of advanced MRI techniques in clinical trial monitoring and in assessing individual patients' response to treatment still needs to be assessed. PMID:27432676

  5. Multiple osteochondromas

    PubMed Central

    Bovée, Judith VMG

    2008-01-01

    Multiple osteochondromas (MO) is characterised by development of two or more cartilage capped bony outgrowths (osteochondromas) of the long bones. The prevalence is estimated at 1:50,000, and it seems to be higher in males (male-to-female ratio 1.5:1). Osteochondromas develop and increase in size in the first decade of life, ceasing to grow when the growth plates close at puberty. They are pedunculated or sessile (broad base) and can vary widely in size. The number of osteochondromas may vary significantly within and between families, the mean number of locations is 15–18. The majority are asymptomatic and located in bones that develop from cartilage, especially the long bones of the extremities, predominantly around the knee. The facial bones are not affected. Osteochondromas may cause pain, functional problems and deformities, especially of the forearm, that may be reason for surgical removal. The most important complication is malignant transformation of osteochondroma towards secondary peripheral chondrosarcoma, which is estimated to occur in 0.5–5%. MO is an autosomal dominant disorder and is genetically heterogeneous. In almost 90% of MO patients germline mutations in the tumour suppressor genes EXT1 or EXT2 are found. The EXT genes encode glycosyltransferases, catalyzing heparan sulphate polymerization. The diagnosis is based on radiological and clinical documentation, supplemented with, if available, histological evaluation of osteochondromas. If the exact mutation is known antenatal diagnosis is technically possible. MO should be distinguished from metachondromatosis, dysplasia epiphysealis hemimelica and Ollier disease. Osteochondromas are benign lesions and do not affect life expectancy. Management includes removal of osteochondromas when they give complaints. Removed osteochondromas should be examined for malignant transformation towards secondary peripheral chondrosarcoma. Patients should be well instructed and regular follow-up for early detection

  6. Multiple effects of protein phosphatase 2A on nutrient-induced signalling in the yeast Saccharomyces cerevisiae.

    PubMed

    Sugajska, E; Swiatek, W; Zabrocki, P; Geyskens, I; Thevelein, J M; Zolnierowicz, S; Wera, S

    2001-05-01

    The trehalose-degrading enzyme trehalase is activated upon addition of glucose to derepressed cells or in response to nitrogen source addition to nitrogen-starved glucose-repressed yeast (Saccharomyces cerevisiae) cells. Trehalase activation is mediated by phosphorylation. Inactivation involves dephosphorylation, as trehalase protein levels do not change upon multiple activation/inactivation cycles. Purified trehalase can be inactivated by incubation with protein phosphatase 2A (PP2A) in vitro. To test whether PP2A was involved in trehalase inactivation in vivo, we overexpressed the yeast PP2A isoform Pph22. Unexpectedly, the moderate (approximately threefold) overexpression of Pph22 that we obtained increased basal trehalase activity and rendered this activity unresponsive to the addition of glucose or a nitrogen source. Concomitant with higher basal trehalase activity, cells overexpressing Pph22 did not store trehalose efficiently and were heat sensitive. After the addition of glucose or of a nitrogen source to starved cells, Pph22-overexpressing cells showed a delayed exit from stationary phase, a delayed induction of ribosomal gene expression and constitutive repression of stress-regulated element-controlled genes. Deletion of the SCH9 gene encoding a protein kinase involved in nutrient-induced signal transduction restored glucose-induced trehalase activation in Pph22-overexpressing cells. Taken together, our results indicate that yeast PP2A overexpression leads to the activation of nutrient-induced signal transduction pathways in the absence of nutrients. PMID:11401708

  7. Engineering multiple U7snRNA constructs to induce single and multiexon-skipping for Duchenne muscular dystrophy.

    PubMed

    Goyenvalle, Aurélie; Wright, Jordan; Babbs, Arran; Wilkins, Vivienne; Garcia, Luis; Davies, Kay E

    2012-06-01

    Duchenne muscular dystrophy (DMD) is a fatal muscle wasting disorder caused by mutations in the dystrophin gene. Antisense-mediated exon skipping is one of the most promising approaches for the treatment of DMD but still faces personalized medicine challenges as different mutations found in DMD patients require skipping of different exons. However, 70% of DMD patients harbor dystrophin gene deletions in a mutation-rich area or "hot-spot" in the central genomic region. In this study, we have developed 11 different U7 small-nuclear RNA, to shuttle antisense sequences designed to mask key elements involved in the splicing of exons 45 to 55. We demonstrate that these constructs induce efficient exon skipping both in vitro in DMD patients' myoblasts and in vivo in human DMD (hDMD) mice and that they can be combined into a single vector to achieve a multi skipping of at least 3 exons. These very encouraging results provide proof of principle that efficient multiexon-skipping can be achieved using adeno-associated viral (AAV) vectors encoding multiple U7 small-nuclear RNAs (U7snRNAs), offering therefore very promising tools for clinical treatment of DMD. PMID:22354379

  8. Improved Detection of Germline Mutations in Korean VHL Patients by Multiple Ligation-dependent Probe Amplification Analysis

    PubMed Central

    Cho, Hyun-Jung; Ki, Chang-Seok

    2009-01-01

    von Hippel-Lindau (VHL) disease is an autosomal dominant inherited tumor syndrome characterized by the development of tumors in the eye, brain, spinal cord, inner ear, adrenal gland, pancreas, kidney, and epididymis, associated with germline mutations in the VHL gene. We used sequentially sequencing method and multiple ligation-dependent probe amplification (MLPA) analysis and detected germline mutations in the VHL in 15/15 (100%) of VHL patients fulfilling the clinical criteria. Of the 15 distinct mutations detected, large deletions were detected in 5/15 (33.3%) patients, including 4/15 (26.7%) partial deletions and 1/15 (6.6%) deletion of the entire VHL gene by MLPA and the remainder were point mutations detected by sequencing method, of which five mutations were novel. Using MLPA analysis, we detected large deletions including both partial deletions and complete gene deletion, which has not been reported in Korean VHL patients. In conclusion, sequential application of sequencing method and MLPA analysis might make possible to identify germline mutations in most patients with VHL. PMID:19270817

  9. Multiple Nuclear Localization Signals Mediate Nuclear Localization of the GATA Transcription Factor AreA

    PubMed Central

    Hunter, Cameron C.; Siebert, Kendra S.; Downes, Damien J.; Wong, Koon Ho; Kreutzberger, Sara D.; Fraser, James A.; Clarke, David F.; Hynes, Michael J.; Davis, Meryl A.

    2014-01-01

    The Aspergillus nidulans GATA transcription factor AreA activates transcription of nitrogen metabolic genes in response to nitrogen limitation and is known to accumulate in the nucleus during nitrogen starvation. Sequence analysis of AreA revealed multiple nuclear localization signals (NLSs), five putative classical NLSs conserved in fungal AreA orthologs but not in the Saccharomyces cerevisiae functional orthologs Gln3p and Gat1p, and one putative noncanonical RRX33RXR bipartite NLS within the DNA-binding domain. In order to identify the functional NLSs in AreA, we constructed areA mutants with mutations in individual putative NLSs or combinations of putative NLSs and strains expressing green fluorescent protein (GFP)-AreA NLS fusion genes. Deletion of all five classical NLSs individually or collectively did not affect utilization of nitrogen sources or AreA-dependent gene expression and did not prevent AreA nuclear localization. Mutation of the bipartite NLS conferred the inability to utilize alternative nitrogen sources and abolished AreA-dependent gene expression likely due to effects on DNA binding but did not prevent AreA nuclear localization. Mutation of all six NLSs simultaneously prevented AreA nuclear accumulation. The bipartite NLS alone strongly directed GFP to the nucleus, whereas the classical NLSs collaborated to direct GFP to the nucleus. Therefore, AreA contains multiple conserved NLSs, which show redundancy and together function to mediate nuclear import. The noncanonical bipartite NLS is conserved in GATA factors from Aspergillus, yeast, and mammals, indicating an ancient origin. PMID:24562911

  10. Screening of point mutations by multiple SSCP analysis in the dystrophin gene

    SciTech Connect

    Lasa, A.; Baiget, M.; Gallano, P.

    1994-09-01

    Duchenne muscular dystrophy (DMD) is a lethal, X-linked neuromuscular disorder. The population frequency of DMD is one in approximately 3500 boys, of which one third is thought to be a new mutant. The DMD gene is the largest known to date, spanning over 2,3 Mb in band Xp21.2; 79 exons are transcribed into a 14 Kb mRNA coding for a protein of 427 kD which has been named dystrophin. It has been shown that about 65% of affected boys have a gene deletion with a wide variation in localization and size. The remaining affected individuals who have no detectable deletions or duplications would probably carry more subtle mutations that are difficult to detect. These mutations occur in several different exons and seem to be unique to single patients. Their identification represents a formidable goal because of the large size and complexity of the dystrophin gene. SSCP is a very efficient method for the detection of point mutations if the parameters that affect the separation of the strands are optimized for a particular DNA fragment. The multiple SSCP allows the simultaneous study of several exons, and implies the use of different conditions because no single set of conditions will be optimal for all fragments. Seventy-eight DMD patients with no deletion or duplication in the dystrophin gene were selected for the multiple SSCP analysis. Genomic DNA from these patients was amplified using the primers described for the diagnosis procedure (muscle promoter and exons 3, 8, 12, 16, 17, 19, 32, 45, 48 and 51). We have observed different mobility shifts in bands corresponding to exons 8, 12, 43 and 51. In exons 17 and 45, altered electrophoretic patterns were found in different samples identifying polymorphisms already described.

  11. Multiple System Atrophy

    MedlinePlus

    ... Enhancing Diversity Find People About NINDS NINDS Multiple System Atrophy Information Page Condensed from Multiple System Atrophy ... Trials Organizations Publicaciones en Español What is Multiple System Atrophy? Multiple system atrophy (MSA) is a progressive ...

  12. Multiple overlapping homologies between two rheumatoid antigens and immunosuppressive viruses.

    PubMed Central

    Douvas, A; Sobelman, S

    1991-01-01

    Amino acid (aa) sequence homologies between viruses and autoimmune nuclear antigens are suggestive of viral involvement in disorders such as systemic lupus erythematosus (SLE) and scleroderma. We analyzed the frequency of exact homologies of greater than or equal to 5 aa between 61 viral proteins (19,827 aa), 8 nuclear antigens (3813 aa), and 41 control proteins (11,743 aa). Both pentamer and hexamer homologies between control proteins and viruses are unexpectedly abundant, with hexamer matches occurring in 1 of 3 control proteins (or once every 769 aa). However, 2 nuclear antigens, the SLE-associated 70-kDa antigen and the scleroderma-associated CENP-B protein, are highly unusual in containing multiple homologies to a group of synergizing immunosuppressive viruses. Two viruses, herpes simplex virus 1 (HSV-1) and human immunodeficiency virus 1 (HIV-1), contain sequences exactly duplicated at 15 sites in the 70-kDa antigen and at 10 sites in CENP-B protein. The immediate-early (IE) protein of HSV-1, which activates HIV-1 regulatory functions, contains three homologies to the 70-kDa antigen (two hexamers and a pentamer) and two to CENP-B (a hexamer and pentamer). There are four homologies (including a hexamer) common to the 70-kDa antigen and Epstein-Barr virus, and three homologies (including two hexamers) common to CENP-B and cytomegalovirus. The majority of homologies in both nuclear antigens are clustered in highly charged C-terminal domains containing epitopes for human autoantibodies. Furthermore, most homologies have a contiguous or overlapping distribution, thereby creating a high density of potential epitopes. In addition to the exact homologies tabulated, motifs of matching sequences are repeated frequently in these domains. Our analysis suggests that coexpression of heterologous viruses having common immunosuppressive functions may generate autoantibodies cross-reacting with certain nuclear proteins. PMID:1712488

  13. A glycoprotein E gene-deleted bovine herpesvirus 1 as a candidate vaccine strain

    PubMed Central

    Weiss, M.; Brum, M.C.S.; Anziliero, D.; Weiblen, R.; Flores, E.F.

    2015-01-01

    A bovine herpesvirus 1 (BoHV-1) defective in glycoprotein E (gE) was constructed from a Brazilian genital BoHV-1 isolate, by replacing the full gE coding region with the green fluorescent protein (GFP) gene for selection. Upon co-transfection of MDBK cells with genomic viral DNA plus the GFP-bearing gE-deletion plasmid, three fluorescent recombinant clones were obtained out of approximately 5000 viral plaques. Deletion of the gE gene and the presence of the GFP marker in the genome of recombinant viruses were confirmed by PCR. Despite forming smaller plaques, the BoHV-1△gE recombinants replicated in MDBK cells with similar kinetics and to similar titers to that of the parental virus (SV56/90), demonstrating that the gE deletion had no deleterious effects on replication efficacy in vitro. Thirteen calves inoculated intramuscularly with BoHV-1△gE developed virus neutralizing antibodies at day 42 post-infection (titers from 2 to 16), demonstrating the ability of the recombinant to replicate and to induce a serological response in vivo. Furthermore, the serological response induced by recombinant BoHV-1△gE could be differentiated from that induced by wild-type BoHV-1 by the use of an anti-gE antibody ELISA kit. Taken together, these results indicated the potential application of recombinant BoHV-1 △gE in vaccine formulations to prevent the losses caused by BoHV-1 infections while allowing for differentiation of vaccinated from naturally infected animals. PMID:26200229

  14. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  15. Partial gene deletion in LEC rat: An animal model for Wilson disease

    SciTech Connect

    Wu, J.; Forbes, J.R.; Cox, D.W.

    1994-09-01

    Wilson disease is an inherited disorder of copper transport in which incorporation of copper into ceruloplasmin and excretion of copper into bile are greatly reduced. Copper accumulates to a toxic level in the liver and also in the brain and kidney, causing a spectrum of hepatic and neurological abnormalities. We have recently cloned the gene for Wilson disease (designated ATP7B), which encodes a putative copper-transporting P-type ATPase. The inbred mutant Long-Evans Cinnamon (LEC) rat strain shows similarity to Wilson disease in many clinical and biochemical features. We have cloned cDNAs for the rat homologue (Atp7b) of the human Wilson disease gene (ATP7B) and have shown that the two genes have {approximately}82% identity at the amino acid sequence level. Rat cDNA sequences were used to identify a partial deletion in the Atp7b gene in the LEC rat. The deletion removes at least 750 bp of the coding region at the 3{prime} end, which includes the crucial ATP binding domain and extends downstream of the gene. The proximal breakpoint has been precisely localized at the cDNA level. Our results provide convincing evidence that the LEC rat is an animal model for Wilson disease. This model will be important for studying liver pathophysiology, for developing therapy for Wilson disease, and for studying the pathway of copper transport and its possible interaction with other heavy metals.

  16. Revelation of molecular basis for chromium toxicity by phenotypes of Saccharomyces cerevisiae gene deletion mutants.

    PubMed

    Johnson, Adam J; Veljanoski, Filip; O'Doherty, Patrick J; Zaman, Mohammad S; Petersingham, Gayani; Bailey, Trevor D; Münch, Gerald; Kersaitis, Cindy; Wu, Ming J

    2016-05-01

    Chromium toxicity is increasingly relevant to living organisms such as humans, due to the environmental contamination of chromium and the application of stainless steel-based medical devices like hip prostheses. Despite the investigations in past years, the molecular details for chromium toxicity remain to be delineated. In this study, we seek to gain insights into the molecular aspects of chromium toxicity by screening a genome-wide deletion set of individual genes in Saccharomyces cerevisiae against hexavalent chromium [Cr(vi)] using chromium trioxide. From the primary data collected in this study, two lists of deletion mutants in response to Cr(vi) exposure were obtained, one for the sensitive phenotype and the other for the resistant phenotype. The functional analysis of the genes corresponding to the sensitive mutants reveals the key features of Cr(vi) toxicity, which include genotoxicity, protein damage, disruption of energy and sulfur metabolisms. DNA repair, ubiquitination-mediated protein degradation, iron homeostasis and growth attenuation are the intrinsic facets of the cell's detoxification mechanisms. Protein kinase CK2 is, for the first time, found to be involved in regulating chromium toxicity by reducing the uptake of Cr(vi). Taken together, the findings provide meaningful details into the basic understanding of chromium toxicity in terms of its uptake, modes of action, cellular detoxification and molecular regulatory mechanisms. PMID:27146641

  17. Partial Gene Deletions of PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies

    PubMed Central

    Cho, Sun-Mi; Kim, Yoonjung; Lee, Sang Guk; Yang, Jin-Young

    2014-01-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal neuropathy that is commonly caused by a reciprocal 1.5 Mb deletion on chromosome 17p11.2, at the site of the peripheral myelin protein 22 (PMP22) gene. Other patients with similar phenotypes have been shown to harbor point mutations or small deletions, although there is some clinical variation across these patients. In this report, we describe a case of HNPP with copy number changes in exon or promoter regions of PMP22. Multiplex ligation-dependent probe analysis revealed an exon 1b deletion in the patient, who had been diagnosed with HNPP in the first decade of life using molecular analysis. PMID:25506001

  18. Partial Gene Deletions of PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies.

    PubMed

    Cho, Sun-Mi; Hong, Bo Young; Kim, Yoonjung; Lee, Sang Guk; Yang, Jin-Young; Kim, Juwon; Lee, Kyung-A

    2014-01-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal neuropathy that is commonly caused by a reciprocal 1.5 Mb deletion on chromosome 17p11.2, at the site of the peripheral myelin protein 22 (PMP22) gene. Other patients with similar phenotypes have been shown to harbor point mutations or small deletions, although there is some clinical variation across these patients. In this report, we describe a case of HNPP with copy number changes in exon or promoter regions of PMP22. Multiplex ligation-dependent probe analysis revealed an exon 1b deletion in the patient, who had been diagnosed with HNPP in the first decade of life using molecular analysis. PMID:25506001

  19. PAX3 gene deletion detected by microarray analysis in a girl with hearing loss.

    PubMed

    Drozniewska, Malgorzata; Haus, Olga

    2014-01-01

    Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16 year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862 kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype. PMID:24839464

  20. Construction and evaluation of live attenuated myxoma virus vaccines with targeted virulence gene deletions.

    PubMed

    Adams, Mathew M; van Leeuwen, Barbara H; Kerr, Peter J

    2008-10-29

    Three deletion mutant viruses were constructed as potential vaccines against myxomatosis using the naturally attenuated Uriarra strain of myxoma virus. The viruses had the M007 (encodes a secreted gamma-interferon receptor homologue), M010 (encodes an epidermal growth factor homologue) and M011 (encodes an inhibitor of apoptosis in T lymphocytes) genes insertionally inactivated as either DeltaM007, DeltaM010/M011 or DeltaM007/M010/M011. All three viruses induced high serum antibody titres. Rabbits immunized with these deletion mutants were protected from lethal challenge. However, immunization of adult rabbits with DeltaM007 or DeltaM010/M011 was associated with mild clinical signs that would make these viruses unacceptable as vaccines. The triple gene knock-out virus (DeltaM007/M010/M011) termed Ur-TKO was very well tolerated by adult and juvenile rabbits. The low pathogenicity of Ur-TKO was confirmed by pathogenesis studies in domestic and wild rabbits. PMID:18789367

  1. FOXP2 gene deletion and infant feeding difficulties: a case report

    PubMed Central

    Zimmerman, Emily; Maron, Jill L.

    2016-01-01

    Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech–language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression. PMID:27148578

  2. Olfactory marker protein (OMP) gene deletion causes altered physiological activity of olfactory sensory neurons.

    PubMed Central

    Buiakova, O I; Baker, H; Scott, J W; Farbman, A; Kream, R; Grillo, M; Franzen, L; Richman, M; Davis, L M; Abbondanzo, S; Stewart, C L; Margolis, F L

    1996-01-01

    Olfactory marker protein (OMP) is an abundant, phylogentically conserved, cytoplasmic protein of unknown function expressed almost exclusively in mature olfactory sensory neurons. To address its function, we generated OMP-deficient mice by gene targeting in embryonic stem cells. We report that these OMP-null mice are compromised in their ability to respond to odor stimull, providing insight to OMP function. The maximal electroolfactogram response of the olfactory neuroepithelium to several odorants was 20-40% smaller in the mutants compared with controls. In addition, the onset and recovery kinetics following isoamyl acetate stimulation are prolonged in the null mice. Furthermore, the ability of the mutants to respond to the second odor pulse of a pair is impaired, over a range of concentrations, compared with controls. These results imply that neural activity directed toward the olfactory bulb is also reduced. The bulbar phenotype observed in the OMP-null mouse is consistent with this hypothesis. Bulbar activity of tyrosine hydroxylase, the rate limiting enzyme of catecholamine biosynthesis, and content of the neuropeptide cholecystokinin are reduced by 65% and 50%, respectively. This similarity to postsynaptic changes in gene expression induced by peripheral olfactory deafferentation or naris blockade confirms that functional neural activity is reduced in both the olfactory neuroepithelium and the olfactory nerve projection to the bulb in the OMP-null mouse. These observations provide strong support for the conclusion that OMP is a novel modulatory component of the odor detection/signal transduction cascade. Images Fig. 1 Fig. 2 PMID:8790421

  3. Olfactory marker protein (OMP) gene deletion causes altered physiological activity of olfactory sensory neurons.

    PubMed

    Buiakova, O I; Baker, H; Scott, J W; Farbman, A; Kream, R; Grillo, M; Franzen, L; Richman, M; Davis, L M; Abbondanzo, S; Stewart, C L; Margolis, F L

    1996-09-01

    Olfactory marker protein (OMP) is an abundant, phylogentically conserved, cytoplasmic protein of unknown function expressed almost exclusively in mature olfactory sensory neurons. To address its function, we generated OMP-deficient mice by gene targeting in embryonic stem cells. We report that these OMP-null mice are compromised in their ability to respond to odor stimull, providing insight to OMP function. The maximal electroolfactogram response of the olfactory neuroepithelium to several odorants was 20-40% smaller in the mutants compared with controls. In addition, the onset and recovery kinetics following isoamyl acetate stimulation are prolonged in the null mice. Furthermore, the ability of the mutants to respond to the second odor pulse of a pair is impaired, over a range of concentrations, compared with controls. These results imply that neural activity directed toward the olfactory bulb is also reduced. The bulbar phenotype observed in the OMP-null mouse is consistent with this hypothesis. Bulbar activity of tyrosine hydroxylase, the rate limiting enzyme of catecholamine biosynthesis, and content of the neuropeptide cholecystokinin are reduced by 65% and 50%, respectively. This similarity to postsynaptic changes in gene expression induced by peripheral olfactory deafferentation or naris blockade confirms that functional neural activity is reduced in both the olfactory neuroepithelium and the olfactory nerve projection to the bulb in the OMP-null mouse. These observations provide strong support for the conclusion that OMP is a novel modulatory component of the odor detection/signal transduction cascade. PMID:8790421

  4. FOXP2 gene deletion and infant feeding difficulties: a case report.

    PubMed

    Zimmerman, Emily; Maron, Jill L

    2016-01-01

    Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech-language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression. PMID:27148578

  5. T cell receptor gene deletion circles identify recent thymic emigrants in the peripheral T cell pool

    PubMed Central

    Kong, Fan-kun; Chen, Chen-lo H.; Six, Adrien; Hockett, Richard D.; Cooper, Max D.

    1999-01-01

    Progenitor cells undergo T cell receptor (TCR) gene rearrangements during their intrathymic differentiation to become T cells. Rearrangements of the variable (V), diversity (D), and joining (J) segments of the TCR genes result in deletion of the intervening chromosomal DNA and the formation of circular episomes as a byproduct. Detection of these extrachromosomal excision circles in T cells located in the peripheral lymphoid tissues has been viewed as evidence for the existence of extrathymic T cell generation. Because all of the T cells in chickens apparently are generated in the thymus, we have employed this avian model to determine the fate of the V(D)J deletion circles. In normal animals we identified TCR Vγ-Jγ and Vβ-Dβ deletion circles in the blood, spleen, and intestines, as well as in the thymus. Thymectomy resulted in the gradual loss of these DNA deletion circles in all of the peripheral lymphoid tissues. A quantitative PCR analysis of Vγ1-Jγ1 and Vβ1-Dβ deletion circles in splenic γδ and Vβ1+ αβ T cells indicated that their numbers progressively decline after thymectomy with a half-life of approximately 2 weeks. Although TCR deletion circles therefore cannot be regarded as reliable indicators of in situ V(D)J rearrangement, measuring their levels in peripheral T cell samples can provide a valuable index of newly generated T cells entering the T cell pool. PMID:9990059

  6. Prevalence of the Prefoldin Subunit 5 Gene Deletion in Canine Mammary Tumors

    PubMed Central

    Bornemann-Kolatzki, Kirsten; Neumann, Stephan; Escobar, Hugo Murua; Nolte, Ingo; Hammer, Susanne Conradine; Hewicker-Trautwein, Marion; Junginger, Johannes; Kaup, Franz-Josef; Brenig, Bertram; Schütz, Ekkehard

    2015-01-01

    Background A somatic deletion at the proximal end of canine chromosome 27 (CFA27) was recently reported in 50% of malignant mammary tumors. This region harbours the tumor suppressor gene prefoldin subunit 5 (PFDN5) and the deletion correlated with a higher Ki-67 score. PFDN5 has been described to repress c-MYC and is, therefore, a candidate tumor-suppressor and cancer-driver gene in canine mammary cancer. Aim of this study was to confirm the recurrent deletion in a larger number of tumors. Methods Droplet digital PCR for PFDN5 was performed in DNA from 102 malignant, 40 benign mammary tumors/dysplasias, 11 non-neoplastic mammary tissues and each corresponding genomic DNA from leukocytes. The copy number of PFDN5 was normalized to a reference amplicon on canine chromosome 32 (CFA32). Z-scores were calculated, based on Gaussian distributed normalized PFDN5 copy numbers of the leukocyte DNA. Z-scores ≤ -3.0 in tissue were considered as being indicative of the PFDN5 deletion and called as such. The Ki-67 proliferation index was assessed in a subset of 79 tissue samples by immunohistochemistry. Results The deletion was confirmed in 24% of all malignant tumors, detected in only 7.5% of the benign tumors and was not present in any normal mammary tissue sample. The subgroup of solid carcinomas (n = 9) showed the highest frequency of the deletion (67%) and those malignomas without microscopical high fraction of benign tissue (n = 71) had a 32% frequency (p<0.01 vs. benign samples). The Ki-67 score was found to be significantly higher (p<0.05) in the PFDN5-deleted group compared to malignant tumors without the deletion. Conclusions A somatic deletion of the PFDN5 gene is recurrently present in canine mammary cancer, supporting a potential role in carcinogenesis. The association of this deletion with higher Ki-67 indicates an increased proliferation rate and thus a link to tumor aggressiveness can be hypothesized. The confirmation of earlier results warrants further studies on PFDN5 as cancer-driver gene. PMID:26132936

  7. Relatively low proportion of dystrophin gene deletions in Israeli Duchenne and Becker muscular dystrophy patients.

    PubMed

    Shomrat, R; Gluck, E; Legum, C; Shiloh, Y

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these to exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. PMID:8160727

  8. Proteomics and bioinformatics analysis of mouse hypothalamic neurogenesis with or without EPHX2 gene deletion

    PubMed Central

    Zhong, Lijun; Zhou, Juntuo; Wang, Dawei; Zou, Xiajuan; Lou, Yaxin; Liu, Dan; Yang, Bin; Zhu, Yi; Li, Xiaoxia

    2015-01-01

    The aim of this study was to identify differently expressed proteins in the presence and absence of EPHX2 gene in mouse hypothalamus using proteomics profiling and bioinformatics analysis. This study was performed on 3 wild type (WT) and 3 EPHX2 gene global knockout (KO) mice (EPHX2 -/-). Using the nano- electrospray ionization (ESI)-LC-MS/MS detector, we identified 31 over-expressed proteins in WT mouse hypothalamus compared to the KO counterparts. Gene Ontology (GO) annotation in terms of the protein-protein interaction network indicated that cellular metabolic process, protein metabolic process, signaling transduction and protein post-translation biological processes involved in EPHX2 -/- regulatory network. In addition, signaling pathway enrichment analysis also highlighted chronic neurodegenerative diseases and some other signaling pathways, such as TGF-beta signaling pathway, T cell receptor signaling pathway, ErbB signaling pathway, Neurotrophin signaling pathway and MAPK signaling pathway, were strongly coupled with EPHX2 gene knockout. Further studies into the molecular functions of EPHX2 gene in hypothalamus will help to provide new perspective in neurogenesis. PMID:26722453

  9. A new single gene deletion on 2q34: ERBB4 is associated with intellectual disability.

    PubMed

    Kasnauskiene, Jurate; Ciuladaite, Zivile; Preiksaitiene, Egle; Utkus, Algirdas; Peciulyte, Agnė; Kučinskas, Vaidutis

    2013-06-01

    We report on a 15-year-old patient with hyperactivity, intellectual disability and severe speech developmental delay. An array CGH analysis revealed de novo 2q34 deletion, 958 kb in size, involving a single protein coding gene ERBB4 (position 212,505,294-213,463,152; NCBI build 36). The ERBB4 gene is important in numerous neurobiological processes in both the developing and the adult brain. The NRG1-ERBB4 signaling pathway has been recently implicated in the pathophysiology of schizophrenia and epilepsy. Many risk haplotypes were identified in several studies across different populations. The severe clinical consequences in our patient demonstrate that the haploinsufficiency of ERBB4 is crucial for intellectual and cognitive function. These observations are compatible with previously reported results. PMID:23633123

  10. Compensatory evolution for a gene deletion is not limited to its immediate functional network

    PubMed Central

    Harcombe, WR; Springman, R; Bull, JJ

    2009-01-01

    Background Genetic disruption of an important phenotype should favor compensatory mutations that restore the phenotype. If the genetic basis of the phenotype is modular, with a network of interacting genes whose functions are specific to that phenotype, compensatory mutations are expected among the genes of the affected network. This perspective was tested in the bacteriophage T3 using a genome deleted of its DNA ligase gene, disrupting DNA metabolism. Results In two replicate, long-term adaptations, phage compensatory evolution accommodated the low ligase level provided by the host without reinventing its own ligase. In both lines, fitness increased substantially but remained well below that of the intact genome. Each line accumulated over a dozen compensating mutations during long-term adaptation, and as expected, many of the compensatory changes were within the DNA metabolism network. However, several compensatory changes were outside the network and defy any role in DNA metabolism or biochemical connection to the disruption. In one line, these extra-network changes were essential to the recovery. The genes experiencing compensatory changes were moderately conserved between T3 and its relative T7 (25% diverged), but the involvement of extra-network changes was greater in T3. Conclusion Compensatory evolution was only partly limited to the known functionally interacting partners of the deleted gene. Thus gene interactions contributing to fitness were more extensive than suggested by the functional properties currently ascribed to the genes. Compensatory evolution offers an easy method of discovering genome interactions among specific elements that does not rest on an a priori knowledge of those elements or their interactions. PMID:19445716

  11. Impact of rli87 gene deletion on response of Listeria monocytogenes to environmental stress.

    PubMed

    Kun, Xie; Qingling, Meng; Qiao, Jun; Yelong, Peng; Tianli, Liu; Cheng, Chen; Yu, Ma; Zhengxiang, Hu; Xuepeng, Cai; Chuangfu, Chen

    2014-10-01

    Listeria monocytogenes (LM) is a zoonotic pathogen that widely adapts to various environments. Recent studies have found that noncoding RNAs (ncRNAs) play regulatory roles in LM responses to environmental stress. To understand the role of ncRNA rli87 in the response regulation, a rli87 deletion strain LM-Δrli87 was constructed by homologous recombination and tested for stress responses to high temperature, low temperature, high osmotic pressure, alcohol, acidity, alkaline and oxidative environments, along with LM EGD-e strain (control). The results showed that compared with LM EGD-e, LM-Δrli87 grew faster (P < 0.05) at low temperature (30 °C), high temperature (42 °C), and in alkaline condition (pH = 9), similarly (P > 0.05) in acidic and high osmatic pressure (10% NaCl) conditions. When cultured in medium containing 3.8% ethanol, the growth was not significantly different between the two strains (P > 0.05). When cultured at pH 9, they had similar growth rates in the first 5 h (P > 0.05), but the rates were significantly different after 6 h (P < 0.05). The expression of rsbV, rsbW, hpt, clpP, and ctsR was upregulated in LM-∆rli87 compared with LM EGD-e at pH 9, indicating that the rli87 gene regulated the expression of the five genes in alkaline environment. Our results suggest that the rli87 gene has an important regulatory role in LM's response to temperature (30 and 42 °C), alkaline stresses. PMID:25091276

  12. Gene Deletions Resulting in Increased Nitrogen Release by Azotobacter vinelandii: Application of a Novel Nitrogen Biosensor

    PubMed Central

    Eberhart, Lauren J.; Ohlert, Janet M.; Knutson, Carolann M.; Plunkett, Mary H.

    2015-01-01

    Azotobacter vinelandii is a widely studied model diazotrophic (nitrogen-fixing) bacterium and also an obligate aerobe, differentiating it from many other diazotrophs that require environments low in oxygen for the function of the nitrogenase. As a free-living bacterium, A. vinelandii has evolved enzymes and transporters to minimize the loss of fixed nitrogen to the surrounding environment. In this study, we pursued efforts to target specific enzymes and further developed screens to identify individual colonies of A. vinelandii producing elevated levels of extracellular nitrogen. Targeted deletions were done to convert urea into a terminal product by disrupting the urease genes that influence the ability of A. vinelandii to recycle the urea nitrogen within the cell. Construction of a nitrogen biosensor strain was done to rapidly screen several thousand colonies disrupted by transposon insertional mutagenesis to identify strains with increased extracellular nitrogen production. Several disruptions were identified in the ammonium transporter gene amtB that resulted in the production of sufficient levels of extracellular nitrogen to support the growth of the biosensor strain. Further studies substituting the biosensor strain with the green alga Chlorella sorokiniana confirmed that levels of nitrogen produced were sufficient to support the growth of this organism when the medium was supplemented with sufficient sucrose to support the growth of the A. vinelandii in coculture. The nature and quantities of nitrogen released by urease and amtB disruptions were further compared to strains reported in previous efforts that altered the nifLA regulatory system to produce elevated levels of ammonium. These results reveal alternative approaches that can be used in various combinations to yield new strains that might have further application in biofertilizer schemes. PMID:25888177

  13. Genome-Wide Analysis of Syntenic Gene Deletion in the Grasses

    PubMed Central

    Schnable, James C.; Freeling, Michael; Lyons, Eric

    2012-01-01

    The grasses, Poaceae, are one of the largest and most successful angiosperm families. Like many radiations of flowering plants, the divergence of the major grass lineages was preceded by a whole-genome duplication (WGD), although these events are not rare for flowering plants. By combining identification of syntenic gene blocks with measures of gene pair divergence and different frequencies of ancient gene loss, we have separated the two subgenomes present in modern grasses. Reciprocal loss of duplicated genes or genomic regions has been hypothesized to reproductively isolate populations and, thus, speciation. However, in contrast to previous studies in yeast and teleost fishes, we found very little evidence of reciprocal loss of homeologous genes between the grasses, suggesting that post-WGD gene loss may not be the cause of the grass radiation. The sets of homeologous and orthologous genes and predicted locations of deleted genes identified in this study, as well as links to the CoGe comparative genomics web platform for analyzing pan-grass syntenic regions, are provided along with this paper as a resource for the grass genetics community. PMID:22275519

  14. Gene Deletions Resulting in Increased Nitrogen Release by Azotobacter vinelandii: Application of a Novel Nitrogen Biosensor.

    PubMed

    Barney, Brett M; Eberhart, Lauren J; Ohlert, Janet M; Knutson, Carolann M; Plunkett, Mary H

    2015-07-01

    Azotobacter vinelandii is a widely studied model diazotrophic (nitrogen-fixing) bacterium and also an obligate aerobe, differentiating it from many other diazotrophs that require environments low in oxygen for the function of the nitrogenase. As a free-living bacterium, A. vinelandii has evolved enzymes and transporters to minimize the loss of fixed nitrogen to the surrounding environment. In this study, we pursued efforts to target specific enzymes and further developed screens to identify individual colonies of A. vinelandii producing elevated levels of extracellular nitrogen. Targeted deletions were done to convert urea into a terminal product by disrupting the urease genes that influence the ability of A. vinelandii to recycle the urea nitrogen within the cell. Construction of a nitrogen biosensor strain was done to rapidly screen several thousand colonies disrupted by transposon insertional mutagenesis to identify strains with increased extracellular nitrogen production. Several disruptions were identified in the ammonium transporter gene amtB that resulted in the production of sufficient levels of extracellular nitrogen to support the growth of the biosensor strain. Further studies substituting the biosensor strain with the green alga Chlorella sorokiniana confirmed that levels of nitrogen produced were sufficient to support the growth of this organism when the medium was supplemented with sufficient sucrose to support the growth of the A. vinelandii in coculture. The nature and quantities of nitrogen released by urease and amtB disruptions were further compared to strains reported in previous efforts that altered the nifLA regulatory system to produce elevated levels of ammonium. These results reveal alternative approaches that can be used in various combinations to yield new strains that might have further application in biofertilizer schemes. PMID:25888177

  15. Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

    SciTech Connect

    Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y.

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.

  16. Forebrain glucocorticoid receptor gene deletion attenuates behavioral changes and antidepressant responsiveness during chronic stress.

    PubMed

    Jacobson, Lauren

    2014-10-01

    Stress is an important risk factor for mood disorders. Stress also stimulates the secretion of glucocorticoids, which have been found to influence mood. To determine the role of forebrain glucocorticoid receptors (GR) in behavioral responses to chronic stress, the present experiments compared behavioral effects of repeated social defeat in mice with forebrain GR deletion and in floxed GR littermate controls. Repeated defeat produced alterations in forced swim and tail suspension immobility in floxed GR mice that did not occur in mice with forebrain GR deletion. Defeat-induced changes in immobility in floxed GR mice were prevented by chronic antidepressant treatment, indicating that these behaviors were dysphoria-related. In contrast, although mice with forebrain GR deletion exhibited antidepressant-induced decreases in tail suspension immobility in the absence of stress, this response did not occur in mice with forebrain GR deletion after defeat. There were no marked differences in plasma corticosterone between genotypes, suggesting that behavioral differences depended on forebrain GR rather than on abnormal glucocorticoid secretion. Defeat-induced gene expression of the neuronal activity marker c-fos in the ventral hippocampus, paraventricular thalamus and lateral septum correlated with genotype-related differences in behavioral effects of defeat, whereas c-fos induction in the nucleus accumbens and central and basolateral amygdala correlated with genotype-related differences in behavioral responses to antidepressant treatment. The dependence of both negative (dysphoria-related) and positive (antidepressant-induced) behaviors on forebrain GR is consistent with the contradictory effects of glucocorticoids on mood, and implicates these or other forebrain regions in these effects. PMID:25168761

  17. Rare large homozygous CFTR gene deletion in an Iranian patient with cystic fibrosis.

    PubMed

    Farjadian, Shirin; Moghtaderi, Mozhgan; Zuntini, Roberta; Ferrari, Simona

    2014-08-16

    Cystic fibrosis, a common autosomal recessive genetic disorder among Caucasians, is caused by defects in the transmembrane conductance regulatory (CFTR) gene. The analysis of CFTR gene mutations is useful to better characterize the disease, and for preconceptional screening, prenatal and preimplantation genetic diagnosis. Here we report the results of a genetic analysis in a 16-year-old boy from southwestern Iran diagnosed as having cystic fibrosis in infancy based on gastrointestinal and pulmonary manifestations, with positive sweat chloride tests. He lacked both normal and mutant forms of the fragment corresponding to the ∆F508 allele in initial genetic studies. Multiplex ligation-dependent probe amplification-based testing revealed a homozygous deletion spanning exons 4 to 10 of the CFTR gene. We predict an in-frame deletion removing 373 amino acids based on our sequencing results. Determining CFTR gene mutations in patients and their family members would be helpful to prevent the occurrence of new cases, especially in populations in which consanguinity is common. PMID:25133155

  18. Hepatic Xbp1 Gene Deletion Promotes Endoplasmic Reticulum Stress-induced Liver Injury and Apoptosis.

    PubMed

    Olivares, Shantel; Henkel, Anne S

    2015-12-11

    Endoplasmic reticulum (ER) stress activates the unfolded protein response (UPR), a highly conserved signaling cascade that functions to alleviate stress and promote cell survival. If, however, the cell is unable to adapt and restore homeostasis, then the UPR activates pathways that promote apoptotic cell death. The molecular mechanisms governing the critical transition from adaptation and survival to initiation of apoptosis remain poorly understood. We aim to determine the role of hepatic Xbp1, a key mediator of the UPR, in controlling the adaptive response to ER stress in the liver. Liver-specific Xbp1 knockout mice (Xbp1(LKO)) and Xbp1(fl/fl) control mice were subjected to varying levels and durations of pharmacologic ER stress. Xbp1(LKO) and Xbp1(fl/fl) mice showed robust and equal activation of the UPR acutely after induction of ER stress. By 24 h, Xbp1(fl/fl) controls showed complete resolution of UPR activation and no liver injury, indicating successful adaptation to the stress. Conversely, Xbp1(LKO) mice showed ongoing UPR activation associated with progressive liver injury, apoptosis, and, ultimately, fibrosis by day 7 after induction of ER stress. These data indicate that hepatic XBP1 controls the adaptive response of the UPR and is critical to restoring homeostasis in the liver in response to ER stress. PMID:26504083

  19. Forebrain glucocorticoid receptor gene deletion attenuates behavioral changes and antidepressant responsiveness during chronic stress

    PubMed Central

    Jacobson, Lauren

    2014-01-01

    Stress is an important risk factor for mood disorders. Stress also stimulates the secretion of glucocorticoids, which have been found to influence mood. To determine the role of forebrain glucocorticoid receptors (GR) in behavioral responses to chronic stress, the present experiments compared behavioral effects of repeated social defeat in mice with forebrain GR deletion and in floxed GR littermate controls. Repeated defeat produced alterations in forced swim and tail suspension immobility in floxed GR mice that did not occur in mice with forebrain GR deletion. Defeat-induced changes in immobility in floxed GR mice were prevented by chronic antidepressant treatment, indicating that these behaviors were dysphoria-related. In contrast, although mice with forebrain GR deletion exhibited antidepressant-induced decreases in tail suspension immobility in the absence of stress, this response did not occur in mice with forebrain GR deletion after defeat. There were no marked differences in plasma corticosterone between genotypes, suggesting that behavioral differences depended on forebrain GR rather than on abnormal glucocorticoid secretion. Defeat-induced gene expression of the neuronal activity marker c-fos in the ventral hippocampus, paraventricular thalamus and lateral septum correlated with genotype-related differences in behavioral effects of defeat, whereas c-fos induction in the nucleus accumbens and central and basolateral amygdala correlated with genotype-related differences in behavioral responses to antidepressant treatment. The dependence of both negative (dysphoria-related) and positive (antidepressant-induced) behaviors on forebrain GR is consistent with the contradictory effects of glucocorticoids on mood, and implicates these or other forebrain regions in these effects. PMID:25168761

  20. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    PubMed

    Winkler, Paige A; Gornik, Kara R; Ramsey, David T; Dubielzig, Richard R; Venta, Patrick J; Petersen-Jones, Simon M; Bartoe, Joshua T

    2014-01-01

    The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

  1. A Partial Gene Deletion of SLC45A2 Causes Oculocutaneous Albinism in Doberman Pinscher Dogs

    PubMed Central

    Winkler, Paige A.; Gornik, Kara R.; Ramsey, David T.; Dubielzig, Richard R.; Venta, Patrick J.; Petersen-Jones, Simon M.; Bartoe, Joshua T.

    2014-01-01

    The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968–77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model. PMID:24647637

  2. Multiple Assessments for Multiple Intelligences. Third Edition.

    ERIC Educational Resources Information Center

    Bellanca, James; Chapman, Carolyn; Swartz, Elizabeth

    This book is designed to align assessment with instructional practices that promote the development of the multiple intelligences outlined by Howard Gardner. To facilitate the use of multiple assessments for the multiple intelligences, the information in this book is transferable to the classroom. The book explains how a teacher can design…

  3. In Australia: Multiple Intelligences in Multiple Settings.

    ERIC Educational Resources Information Center

    Vialle, Wilma

    1997-01-01

    In Australia, Gardner's multiple-intelligences theory has strongly influenced primary, preschool, and special education. A survey of 30 schools revealed that teachers use two basic approaches: teaching to, and teaching through, multiple intelligences. The first approach might develop children's music skills via playing an instrument. The second…

  4. Multiple-Ring Digital Communication Network

    NASA Technical Reports Server (NTRS)

    Kirkham, Harold

    1992-01-01

    Optical-fiber digital communication network to support data-acquisition and control functions of electric-power-distribution networks. Optical-fiber links of communication network follow power-distribution routes. Since fiber crosses open power switches, communication network includes multiple interconnected loops with occasional spurs. At each intersection node is needed. Nodes of communication network include power-distribution substations and power-controlling units. In addition to serving data acquisition and control functions, each node acts as repeater, passing on messages to next node(s). Multiple-ring communication network operates on new AbNET protocol and features fiber-optic communication.

  5. Varicella Viruses Inhibit Interferon-Stimulated JAK-STAT Signaling through Multiple Mechanisms

    PubMed Central

    Verweij, Marieke C.; Wellish, Mary; Whitmer, Travis; Malouli, Daniel; Lapel, Martin; Jonjić, Stipan; Haas, Juergen G.; DeFilippis, Victor R.; Mahalingam, Ravi; Früh, Klaus

    2015-01-01

    Varicella zoster virus (VZV) causes chickenpox in humans and, subsequently, establishes latency in the sensory ganglia from where it reactivates to cause herpes zoster. Infection of rhesus macaques with simian varicella virus (SVV) recapitulates VZV pathogenesis in humans thus representing a suitable animal model for VZV infection. While the type I interferon (IFN) response has been shown to affect VZV replication, the virus employs counter mechanisms to prevent the induction of anti-viral IFN stimulated genes (ISG). Here, we demonstrate that SVV inhibits type I IFN-activated signal transduction via the JAK-STAT pathway. SVV-infected rhesus fibroblasts were refractory to IFN stimulation displaying reduced protein levels of IRF9 and lacking STAT2 phosphorylation. Since previous work implicated involvement of the VZV immediate early gene product ORF63 in preventing ISG-induction we studied the role of SVV ORF63 in generating resistance to IFN treatment. Interestingly, SVV ORF63 did not affect STAT2 phosphorylation but caused IRF9 degradation in a proteasome-dependent manner, suggesting that SVV employs multiple mechanisms to counteract the effect of IFN. Control of SVV ORF63 protein levels via fusion to a dihydrofolate reductase (DHFR)-degradation domain additionally confirmed its requirement for viral replication. Our results also show a prominent reduction of IRF9 and inhibition of STAT2 phosphorylation in VZV-infected cells. In addition, cells expressing VZV ORF63 blocked IFN-stimulation and displayed reduced levels of the IRF9 protein. Taken together, our data suggest that varicella ORF63 prevents ISG-induction both directly via IRF9 degradation and indirectly via transcriptional control of viral proteins that interfere with STAT2 phosphorylation. SVV and VZV thus encode multiple viral gene products that tightly control IFN-induced anti-viral responses. PMID:25973608

  6. Twins, Triplets, Multiple Births

    MedlinePlus

    ... alone. Multiple births are up in the United States. More women are having babies after age 30 ... support groups for parents of multiples can help. Dept. of Health and Human Services Office on Women's ...

  7. Multiple Endocrine Neoplasia Syndromes

    MedlinePlus

    ... or cancerous (malignant) tumors or grow excessively without forming tumors. Multiple endocrine neoplasia syndromes are caused by ... This Article Generic Name Select Brand Names corticotropin H.P. ACTHAR GEL epinephrine ADRENALIN Multiple Endocrine Neoplasia ...

  8. What Is Multiple Myeloma?

    MedlinePlus

    ... other tissues. If someone has only a single plasma cell tumor, the disease is called an isolated (or solitary ) plasmacytoma . If someone has more than one plasmacytoma, they have multiple myeloma . Multiple myeloma is ...

  9. Challenges of Parenting Multiples

    MedlinePlus

    ... Parenting Multiples There are many psychological, social, and economic issues associated with multiple pregnancies. These issues should ... births can also be helpful during difficult times. ECONOMIC ISSUES • The health care cost for delivery and ...

  10. Multiple system atrophy

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/000757.htm Multiple system atrophy To use the sharing features on this page, please enable JavaScript. Multiple system atrophy (MSA) is a rare condition that causes ...

  11. National Multiple Sclerosis Society

    MedlinePlus

    Home - National Multiple Sclerosis Society Skip to navigation Skip to content Menu Navigation National Multiple Sclerosis Society Sign In In Your Area ... DIAGNOSED IN 2009 You Can Live Well with MS A healthy diet, regular exercise, stress management and ...

  12. Fatigue and Multiple Sclerosis

    MedlinePlus

    Fatigue - National Multiple Sclerosis Society Skip to navigation Skip to content Menu Navigation National Multiple Sclerosis Society Sign In In Your Area ... help* daily life for: positive-mom* The National MS Society is Here to Help Need More Information? ...

  13. MultipleColposcopyJCO

    Cancer.gov

    Performing multiple biopsies during a procedure known as colposcopy—visual inspection of the cervix—is more effective than performing only a single biopsy of the worst-appearing area for detecting cervical cancer precursors. This multiple biopsy approach

  14. Multiple sclerosis - discharge

    MedlinePlus

    Your doctor has told you that you have multiple sclerosis. This disease affects the brain and spinal cord ( ... your doctor may prescribe medicine. Some people with multiple sclerosis need to use a urinary catheter . This is ...

  15. Multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase causing excessive acetaldehyde production from ethanol by oral streptococci

    PubMed Central

    Pavlova, Sylvia I.; Jin, Ling; Gasparovich, Stephen R.

    2013-01-01

    Ethanol consumption and poor oral hygiene are risk factors for oral and oesophageal cancers. Although oral streptococci have been found to produce excessive acetaldehyde from ethanol, little is known about the mechanism by which this carcinogen is produced. By screening 52 strains of diverse oral streptococcal species, we identified Streptococcus gordonii V2016 that produced the most acetaldehyde from ethanol. We then constructed gene deletion mutants in this strain and analysed them for alcohol and acetaldehyde dehydrogenases by zymograms. The results showed that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol and ethanol, respectively. Two additional dehydrogenases, S-AdhA and TdhA, were identified with specificities to the secondary alcohol 2-propanol and threonine, respectively, but not to ethanol. S. gordonii V2016 did not show a detectable acetaldehyde dehydrogenase even though its adhE gene encodes a putative bifunctional acetaldehyde/alcohol dehydrogenase. Mutants with adhE deletion showed greater tolerance to ethanol in comparison with the wild-type and mutant with adhA or adhB deletion, indicating that AdhE is the major alcohol dehydrogenase in S. gordonii. Analysis of 19 additional strains of S. gordonii, S. mitis, S. oralis, S. salivarius and S. sanguinis showed expressions of up to three alcohol dehydrogenases, but none showed detectable acetaldehyde dehydrogenase, except one strain that showed a novel ALDH. Therefore, expression of multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase may contribute to excessive production of acetaldehyde from ethanol by certain oral streptococci. PMID:23637459

  16. Highly divergent strains of porcine reproductive and respiratory syndrome virus incorporate multiple isoforms of nonstructural protein 2 into virions.

    PubMed

    Kappes, Matthew A; Miller, Cathy L; Faaberg, Kay S

    2013-12-01

    Viral structural proteins form the critical intermediary between viral infection cycles within and between hosts, function to initiate entry, participate in immediate early viral replication steps, and are major targets for the host adaptive immune response. We report the identification of nonstructural protein 2 (nsp2) as a novel structural component of the porcine reproductive and respiratory syndrome virus (PRRSV) particle. A set of custom α-nsp2 antibodies targeting conserved epitopes within four distinct regions of nsp2 (the PLP2 protease domain [OTU], the hypervariable domain [HV], the putative transmembrane domain [TM], and the C-terminal region [C]) were obtained commercially and validated in PRRSV-infected cells. Highly purified cell-free virions of several PRRSV strains were isolated through multiple rounds of differential density gradient centrifugation and analyzed by immunoelectron microscopy (IEM) and Western blot assays using the α-nsp2 antibodies. Purified viral preparations were found to contain pleomorphic, predominantly spherical virions of uniform size (57.9 nm ± 8.1 nm diameter; n = 50), consistent with the expected size of PRRSV particles. Analysis by IEM indicated the presence of nsp2 associated with the viral particle of diverse strains of PRRSV. Western blot analysis confirmed the presence of nsp2 in purified viral samples and revealed that multiple nsp2 isoforms were associated with the virion. Finally, a recombinant PRRSV genome containing a myc-tagged nsp2 was used to generate purified virus, and these particles were also shown to harbor myc-tagged nsp2 isoforms. Together, these data identify nsp2 as a virion-associated structural PRRSV protein and reveal that nsp2 exists in or on viral particles as multiple isoforms. PMID:24089566

  17. No influence of the polymorphisms CYP2C19 and CYP2D6 on the efficacy of cyclophosphamide, thalidomide, and bortezomib in patients with Multiple Myeloma

    PubMed Central

    2010-01-01

    Background The response to treatment varies among patients with multiple myeloma and markers for prediction of treatment outcome are highly needed. Bioactivation of cyclophosphamide and thalidomide, and biodegradation of bortezomib, is dependent on cytochrome P450 metabolism. We explored the potential influence of different polymorphisms in the CYP enzymes on the outcome of treatment. Methods Data was analyzed from 348 patients undergoing high-dose treatment and stem cell support in Denmark in 1994 to 2004. Clinical information on relapse treatment in 243 individual patients was collected. The patients were genotyped for the non-functional alleles CYP2C19*2 and CYP2D6*3, *4, *5 (gene deletion), *6, and CYP2D6 gene duplication. Results In patients who were treated with bortezomib and were carriers of one or two defective CYP2D6 alleles there was a trend towards a better time-to-next treatment. We found no association between the number of functional CYP2C19 and CYP2D6 alleles and outcome of treatment with cyclophosphamide or thalidomide. Neither was the number of functional CYP2C19 and CYP2D6 alleles associated with neurological adverse reactions to thalidomide and bortezomib. Conclusion There was no association between functional CYP2C19 and CYP2D6 alleles and treatment outcome in multiple myeloma patients treated with cyclophosphamide, thalidomide or bortezomib. A larger number of patients treated with bortezomib are needed to determine the role of CYP2D6 alleles in treatment outcome. PMID:20684753

  18. Characterization of baculovirus Autographa californica multiple nuclear polyhedrosis virus infection in mammalian cells

    SciTech Connect

    Kitajima, Masayuki; Hamazaki, Hiroyuki; Miyano-Kurosaki, Naoko; Takaku, Hiroshi . E-mail: hiroshi.takaku@it-chiba.ac.jp

    2006-05-05

    The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is used as a vector in many gene therapy studies. Wild-type AcMNPV infects many mammalian cell types in vitro, but does not replicate. We investigated the dynamics of AcMNPV genomic DNA in infected mammalian cells and used flow cytometric analysis to demonstrate that recombinant baculovirus containing a cytomegalovirus immediate early promoter/enhancer with green fluorescent protein (GFP) expressed high levels of GFP in Huh-7 cells, but not B16, Raw264.7, or YAC-1 cells. The addition of butyrate, a deacetylase inhibitor, markedly enhanced the percentage of GFP-expressing Huh-7 and B16 cells, but not Raw264.7 and YAC-1 cells. The addition of 5-aza-2'-deoxycytidine, a DNA methylation inhibitor, had no enhancing effect. Polymerase chain reaction analysis using AcMNPV-gp64-specific primers indicated that AcMNPV infected not only Huh-7 and B16 cells, but also Raw264.7 and YAC-1 cells in vitro. The genomic DNA was detected in Huh-7 and B16 cells 96 h after infection. Genomic AcMNPV DNA in YAC-1 cells was not transported to the nucleus. Luciferase assay indicated that AcMNPV p35 gene mRNA and p35 promoter activity were clearly expressed only in Huh-7 and B16 cells. These results suggest that viral genomic DNA expression is restricted by different host cell factors, such as degradation, deacetylation, and inhibition of nuclear transport, depending on the mammalian cell type.

  19. Characterization of baculovirus Autographa californica multiple nuclear polyhedrosis virus infection in mammalian cells.

    PubMed

    Kitajima, Masayuki; Hamazaki, Hiroyuki; Miyano-Kurosaki, Naoko; Takaku, Hiroshi

    2006-05-01

    The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is used as a vector in many gene therapy studies. Wild-type AcMNPV infects many mammalian cell types in vitro, but does not replicate. We investigated the dynamics of AcMNPV genomic DNA in infected mammalian cells and used flow cytometric analysis to demonstrate that recombinant baculovirus containing a cytomegalovirus immediate early promoter/enhancer with green fluorescent protein (GFP) expressed high levels of GFP in Huh-7 cells, but not B16, Raw264.7, or YAC-1 cells. The addition of butyrate, a deacetylase inhibitor, markedly enhanced the percentage of GFP-expressing Huh-7 and B16 cells, but not Raw264.7 and YAC-1 cells. The addition of 5-aza-2'-deoxycytidine, a DNA methylation inhibitor, had no enhancing effect. Polymerase chain reaction analysis using AcMNPV-gp64-specific primers indicated that AcMNPV infected not only Huh-7 and B16 cells, but also Raw264.7 and YAC-1 cells in vitro. The genomic DNA was detected in Huh-7 and B16 cells 96 h after infection. Genomic AcMNPV DNA in YAC-1 cells was not transported to the nucleus. Luciferase assay indicated that AcMNPV p35 gene mRNA and p35 promoter activity were clearly expressed only in Huh-7 and B16 cells. These results suggest that viral genomic DNA expression is restricted by different host cell factors, such as degradation, deacetylation, and inhibition of nuclear transport, depending on the mammalian cell type. PMID:16545777

  20. Reference genes for quantitative gene expression studies in multiple avian species.

    PubMed

    Olias, Philipp; Adam, Iris; Meyer, Anne; Scharff, Constance; Gruber, Achim D

    2014-01-01

    Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species. PMID:24926893

  1. Reference Genes for Quantitative Gene Expression Studies in Multiple Avian Species

    PubMed Central

    Meyer, Anne; Scharff, Constance; Gruber, Achim D.

    2014-01-01

    Quantitative real-time PCR (qPCR) rapidly and reliably quantifies gene expression levels across different experimental conditions. Selection of suitable reference genes is essential for meaningful normalization and thus correct interpretation of data. In recent years, an increasing number of avian species other than the chicken has been investigated molecularly, highlighting the need for an experimentally validated pan-avian primer set for reference genes. Here we report testing a set for 14 candidate reference genes (18S, ABL, GAPDH, GUSB, HMBS, HPRT, PGK1, RPL13, RPL19, RPS7, SDHA, TFRC, VIM, YWHAZ) on different tissues of the mallard (Anas platyrhynchos), domestic chicken (Gallus gallus domesticus), common crane (Grus grus), white-tailed eagle (Haliaeetus albicilla), domestic turkey (Meleagris gallopavo f. domestica), cockatiel (Nymphicus hollandicus), Humboldt penguin (Sphenicus humboldti), ostrich (Struthio camelus) and zebra finch (Taeniopygia guttata), spanning a broad range of the phylogenetic tree of birds. Primer pairs for six to 11 genes were successfully established for each of the nine species. As a proof of principle, we analyzed expression levels of 10 candidate reference genes as well as FOXP2 and the immediate early genes, EGR1 and CFOS, known to be rapidly induced by singing in the avian basal ganglia. We extracted RNA from microbiopsies of the striatal song nucleus Area X of adult male zebra finches after they had sang or remained silent. Using three different statistical algorithms, we identified five genes (18S, PGK1, RPS7, TFRC, YWHAZ) that were stably expressed within each group and also between the singing and silent conditions, establishing them as suitable reference genes. In conclusion, the newly developed pan-avian primer set allows accurate normalization and quantification of gene expression levels in multiple avian species. PMID:24926893

  2. Elk-1 a Transcription Factor with Multiple Facets in the Brain

    PubMed Central

    Besnard, Antoine; Galan-Rodriguez, Beatriz; Vanhoutte, Peter; Caboche, Jocelyne

    2011-01-01

    The ternary complex factor (TCF) Elk-1 is a transcription factor that regulates immediate early gene (IEG) expression via the serum response element (SRE) DNA consensus site. Elk-1 is associated with a dimer of serum response factor (SRF) at the SRE site, and its phosphorylation occurs at specific residues in response to mitogen-activated protein kinases (MAPKs), including c-Jun-N terminal kinase (JNK), p38/MAPK, and extracellular-signal regulated kinase (ERK). This phosphorylation event is critical for triggering SRE-dependent transcription. Although MAPKs are fundamental actors for the instatement and maintenance of memory, and much investigation of their downstream signaling partners have been conducted, no data yet clearly implicate Elk-1 in these processes. This is partly due to the complexity of Elk-1 sub-cellular localization, and hence functions, within neurons. Elk-1 is present in its resting state in the cytoplasm, where it colocalizes with mitochondrial proteins or microtubules. In this particular sub-cellular compartment, overexpression of Elk-1 is toxic for neuronal cells. When phosphorylated by the MAPK/ERK, Elk-1 translocates to the nucleus where it is implicated in regulating chromatin remodeling, SRE-dependent transcription, and neuronal differentiation. Another post-translational modification is the conjugation to SUMO (Small Ubiquitin-like MOdifier), which relocalizes Elk-1 in the cytoplasm. Thus, Elk-1 plays a dual role in neuronal functions: pro-apoptotic within the cytoplasm, and pro-differentiation within the nucleus. To address the role of Elk-1 in the brain, one must be aware of its multiple facets, and design molecular tools that will shut down Elk-1 expression, trafficking, or activation, in specific neuronal compartments. We summarize in this review the known molecular functions of Elk-1, its regulation in neuronal cells, and present evidence of its possible implication in model systems of synaptic plasticity, learning, but also in

  3. Multiple density layered insulator

    DOEpatents

    Alger, T.W.

    1994-09-06

    A multiple density layered insulator for use with a laser is disclosed which provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation. 4 figs.

  4. Applying Multiple Intelligences

    ERIC Educational Resources Information Center

    Christodoulou, Joanna A.

    2009-01-01

    The ideas of multiple intelligences introduced by Howard Gardner of Harvard University more than 25 years ago have taken form in many ways, both in schools and in other sometimes-surprising settings. The silver anniversary of Gardner's learning theory provides an opportunity to reflect on the ways multiple intelligences theory has taken form and…

  5. Orchestrating Multiple Intelligences

    ERIC Educational Resources Information Center

    Moran, Seana; Kornhaber, Mindy; Gardner, Howard

    2006-01-01

    Education policymakers often go astray when they attempt to integrate multiple intelligences theory into schools, according to the originator of the theory, Howard Gardner, and his colleagues. The greatest potential of a multiple intelligences approach to education grows from the concept of a profile of intelligences. Each learner's intelligence…

  6. Prediction in Multiple Regression.

    ERIC Educational Resources Information Center

    Osborne, Jason W.

    2000-01-01

    Presents the concept of prediction via multiple regression (MR) and discusses the assumptions underlying multiple regression analyses. Also discusses shrinkage, cross-validation, and double cross-validation of prediction equations and describes how to calculate confidence intervals around individual predictions. (SLD)

  7. Multiple Myeloma Symptoms

    MedlinePlus

    ... it is multiple myeloma . Stay on top of discoveries, trials, research and more. Click here to sign up for the MMRF Newsletter First name Last name E-mail address CLOSE News & Press Multiple Myeloma Knowledge Center Privacy Policy Donor Privacy Policy Terms of ...

  8. Uglification: Understanding Multiplication Concepts.

    ERIC Educational Resources Information Center

    Dorwaldt, Louis E., Jr.

    1989-01-01

    Established methods of teaching multiplication (tables, flash cards, repetitive exercises) do not work well with adult underachievers. The properties and concepts of multiplication of whole numbers must be presented as observable, fun, and practical. Finger math methods may succeed where pencil and paper fail. (SK)

  9. Twins, Triplets, Multiple Births

    MedlinePlus

    ... from alone. Multiple births are up in the United States. More women are having babies after age 30 and more are taking fertility drugs. Both boost the chance of carrying more than one baby. A family history of twins also makes multiples more likely. Years ...

  10. Multiple density layered insulator

    DOEpatents

    Alger, Terry W.

    1994-01-01

    A multiple density layered insulator for use with a laser is disclosed wh provides at least two different insulation materials for a laser discharge tube, where the two insulation materials have different thermoconductivities. The multiple layer insulation materials provide for improved thermoconductivity capability for improved laser operation.

  11. Constraining Multiple Grammars

    ERIC Educational Resources Information Center

    Hopp, Holger

    2014-01-01

    This article offers the author's commentary on the Multiple Grammars (MG) language acquisition theory proposed by Luiz Amaral and Tom Roeper in the present issue. Multiple Grammars advances the claim that optionality is a constitutive characteristic of any one grammar, with interlanguage grammars being perhaps the clearest examples of a…

  12. Effects of aging and walnut diet on DNA methylation and expression of immediate-early genes in critical brain regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence indicates a direct link between age-associated changes in epigenetic mechanisms and onset of neurodegenerative diseases, and that these genomic modulations are directly affected by the diet. Diets deficient in folate, choline and methionine, or the trace elements zinc and selenium,...

  13. Aging and walnut-rich diet supplementation affects the expression of immediate-early genes in critical brain regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence indicates a direct link between age-associated changes in epigenetic mechanisms and onset of neurodegenerative diseases, and that these genomic modulations are directly affected by diet. Diets deficient in folate, choline and methionine, or the trace elements zinc and selenium, are...

  14. Splicing is required for transactivation by the immediate early gene 1 of the Lymantria dispar multinucleocapsid nuclear polyhedrosis virus.

    PubMed

    Pearson, M N; Rohrmann, G F

    1997-08-18

    A region of the Lymantria disper multinucleocapsid nuclear polyhedrosis virus (LdMNPV) genome containing the homolog of the baculovirus ie-1 gene was identified using a series of overlapping cosmids and individual plasmids in a transient transcriptional expression assay. Sequence analysis of the active region identified two ORFs, one of which is 32% identical to AcMNPV ORF141 (ie-0) and contains a putative splice donor site and the other of which is 29% identical to AcMNPV ie-1 and contains a highly conserved splice acceptor consensus sequences. Plasmids containing the LdMNPV ORF141 and ie-1 regions were able to stimulate expression of a GUS reporter gene, while plasmids containing the ie-1 region alone were inactive, suggesting that only the spliced, IE-0 form of the gene product is an active transactivator. Primer extension analysis confirmed the presence of spliced ie-0 mRNA transcripts starting at 6 hr and continuing throughout the time course of viral infection of the L dispar cell line Ld652Y. Using a plasmid containing the ie-0 spliced form of the gene as a transactivator, hr4, one of the eight homologous regions of LdMNPV, was shown to act as a transcriptional enhancer. In contrast, a reporter plasmid containing the AcMNPV hr5 enhancer did not show increased activity when cotransfected with LdMNPV ie-0, suggesting that these enhancer sequences are viral specific. In a transient replication assay system. LdMNPV ie-0 acted as an essential replication gene, but LdMNPV ie-1 was inactive. These results indicate that splicing is required to obtain an active gene product in LdMNPV in the Ld652Y cell line. PMID:9300047

  15. Sequence and function of canine herpesvirus alpha-transinducing factor and its interaction with an immediate early promoter.

    PubMed

    Tyack, Scott G; Studdert, Michael J; Johnson, Michael A

    2006-12-01

    The sequence of the alpha-transinducing factor (alpha-TIF) of canine herpesvirus (CHV-l) was determined. Alignment of the predicted CHV-1 alpha-TIF amino acid sequence with other alpha-TIF homologues reveals a core region of similarity with divergent amino and carboxyl termini. Analysis of the CHV-1 infected cell protein 4 promoter region identified a region containing nine copies of a 52 bp repeat that showed significant up-regulation of transcription by alpha-TIF. This region contained an imperfect 'TAATGARAT' motif, the binding site for herpes simplex virus 1 alpha-TIF, with an imperfect Oct-1 binding site immediately following. The infectious laryngotracheitis virus alpha-TIF was also shown to up-regulate transcription through this region of the promoter. Transfection of CHV-1 genomic DNA failed to yield infectious virus in canine kidney cell lines. Co-transfection of genomic DNA and an alpha-TIF expression plasmid resulted in virus plaques, indicating a potential essential role for alpha-TIF in CHV-1 infection. PMID:16991001

  16. Lack of increased immediate early gene expression in rats reinstating cocaine-seeking behavior to discrete sensory cues.

    PubMed

    Riedy, Matthew D; Keefe, Kristen A

    2013-01-01

    Drug-seeking behavior elicited by drug-associated cues contributes to relapse in addiction; however, whether relapse elicited by drug-associated conditioned reinforcers (CR) versus discriminative stimuli (DS) involves distinct or overlapping neuronal populations is unknown. To address this question, we developed a novel cocaine self-administration and cue-induced reinstatement paradigm that exposed the same rats to distinct cocaine-associated CR and DS. Rats were trained to self-administer cocaine in separate sessions. In one, a DS signaled cocaine availability; in the other, cocaine delivery was paired with a different CR. After extinction training and reinstatement testing, where both cues were presented in separate sessions, rats were sacrificed and processed for cellular analysis of temporal activity by fluorescent in situ hybridization (CatFISH) for activity regulated cytoskeleton-associated protein (Arc) mRNA and for radioactive in situ hybridization for Arc and zif268 mRNAs. CatFISH did not reveal significant changes in Arc mRNA expression. Similar results were obtained with radioactive in situ hybridization. We have shown that while rats reinstate drug seeking in response to temporally discrete presentations of distinct drug-associated cues, such reinstatement is not associated with increased transcriptional activation of Arc or zif268 mRNAs, suggesting that expression of these genes may not be necessary for cue-induced reinstatement of drug-seeking behavior. PMID:24069163

  17. Group 2 coronaviruses prevent immediate early interferon induction by protection of viral RNA from host cell recognition

    SciTech Connect

    Versteeg, Gijs A.; Bredenbeek, Peter J.; Worm, Sjoerd H.E. van den; Spaan, Willy J.M. . E-mail: w.j.m.spaan@lumc.nl

    2007-04-25

    Many viruses encode antagonists to prevent interferon (IFN) induction. Infection of fibroblasts with the murine hepatitis coronavirus (MHV) and SARS-coronavirus (SARS-CoV) did not result in nuclear translocation of interferon-regulatory factor 3 (IRF3), a key transcription factor involved in IFN induction, and induction of IFN mRNA transcription. Furthermore, MHV and SARS-CoV infection could not prevent IFN induction by poly (I:C) or Sendai virus, suggesting that these CoVs do not inactivate IRF3-mediated transcription regulation, but apparently prevent detection of replicative RNA by cellular sensory molecules. Our data indicate that shielding of viral RNA to host cell sensors might be the main general mechanism for coronaviruses to prevent IFN induction.

  18. Multiple scattering tomography.

    PubMed

    Modregger, Peter; Kagias, Matias; Peter, Silvia; Abis, Matteo; Guzenko, Vitaliy A; David, Christian; Stampanoni, Marco

    2014-07-11

    Multiple scattering represents a challenge for numerous modern tomographic imaging techniques. In this Letter, we derive an appropriate line integral that allows for the tomographic reconstruction of angular resolved scattering distributions, even in the presence of multiple scattering. The line integral is applicable to a wide range of imaging techniques utilizing various kinds of probes. Here, we use x-ray grating interferometry to experimentally validate the framework and to demonstrate additional structural sensitivity, which exemplifies the impact of multiple scattering tomography. PMID:25062159

  19. Taking multiple medicines safely

    MedlinePlus

    ... medlineplus.gov/ency/patientinstructions/000883.htm Taking multiple medicines safely To use the sharing features on this ... directed. Why you may Need More Than one Medicine You may take more than one medicine to ...

  20. Multiple shell fusion targets

    DOEpatents

    Lindl, J.D.; Bangerter, R.O.

    1975-10-31

    Multiple shell fusion targets for use with electron beam and ion beam implosion systems are described. The multiple shell targets are of the low-power type and use a separate relatively low Z, low density ablator at large radius for the outer shell, which reduces the focusing and power requirements of the implosion system while maintaining reasonable aspect ratios. The targets use a high Z, high density pusher shell placed at a much smaller radius in order to obtain an aspect ratio small enough to protect against fluid instability. Velocity multiplication between these shells further lowers the power requirements. Careful tuning of the power profile and intershell density results in a low entropy implosion which allows breakeven at low powers. For example, with ion beams as a power source, breakeven at 10-20 Terrawatts with 10 MeV alpha particles for imploding a multiple shell target can be accomplished.

  1. Multiple Myeloma Overview

    MedlinePlus

    ... is slightly more common in men than in women. It can often run in families. Multiple myeloma is also more common in blacks than in whites. Some studies suggest that workers in agriculture or petroleum-based industries may be ...

  2. Pomalidomide for Multiple Myeloma

    Cancer.gov

    A summary of results from a phase III trial that compared the combination of pomalidomide (Pomalyst®) and low-dose dexamethasone versus high-dose dexamethasone alone in patients with multiple myeloma that has progressed despite other treatments.

  3. Multiple duty battery

    SciTech Connect

    Cohen, F.S.; Hyland, A.L.

    1980-05-20

    A laminar battery capable of providing multiple currents and capacities at different voltages is described in which electrical access is provided to intermediate cells in the battery by conductive metal terminal layers incorporated in the structure of the battery.

  4. Multiple Turbo Codes

    NASA Technical Reports Server (NTRS)

    Divsalar, D.; Pollara, F.

    1995-01-01

    A description is given of multiple turbo codes and a suitable decoder structure derived from an approximation to the maximum a posteriori probability (MAP) decision rule, which is substantially different from the decoder for two-code-based encoders.

  5. Familial multiple lipomatosis.

    PubMed

    Dolph, J L; Demuth, R J; Miller, S H

    1980-10-01

    The literature on familial multiple lipomatosis is reviewed, and a striking case is described. The associated family history is outlined. Excisional biopsy is advocated when there is doubt in terms of diagnosis, pain, or functional impairment. PMID:7208678

  6. The Multiplicative Situation

    ERIC Educational Resources Information Center

    Hurst, Chris

    2015-01-01

    The relationships between three critical elements, and the associated mathematical language, to assist students to make the critical transition from additive to multiplicative thinking are examined in this article by Chris Hurst.

  7. Mobile multiple access study

    NASA Technical Reports Server (NTRS)

    1977-01-01

    Multiple access techniques (FDMA, CDMA, TDMA) for the mobile user and attempts to identify the current best technique are discussed. Traffic loading is considered as well as voice and data modulation and spacecraft and system design. Emphasis is placed on developing mobile terminal cost estimates for the selected design. In addition, design examples are presented for the alternative techniques of multiple access in order to compare with the selected technique.

  8. Multiple beam ptychography

    NASA Astrophysics Data System (ADS)

    Karl, Robert; Bevis, Charles; Lopez-Rios, Raymond; Reichanadter, Jonathan; Gardner, Dennis F.; Porter, Christina; Shanblatt, Elisabeth; Tanksalvala, Michael; Mancini, Giulia F.; Murnane, Margaret; Kapteyn, Henry; Adams, Daniel

    2016-03-01

    We present an extension to ptychography that allows simultaneous deconvolution of multiple, spatially separate, illuminating probes. This enables an increased field of view and hence, an increase in imaging throughput, without increased exposure times. This technique can be used for any non-interfering probes: demonstrated with multiple wavelengths and orthogonal polarizations. The latter of which gives us spatially resolved polarization spectroscopy from a single scan.

  9. Multiple stage multiple filter hydrate store

    DOEpatents

    Bjorkman, H.K. Jr.

    1983-05-31

    An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means for separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means. 7 figs.

  10. Multiple stage multiple filter hydrate store

    DOEpatents

    Bjorkman, Jr., Harry K.

    1983-05-31

    An improved hydrate store for a metal halogen battery system is disclosed which employs a multiple stage, multiple filter means or separating the halogen hydrate from the liquid used in forming the hydrate. The filter means is constructed in the form of three separate sections which combine to substantially cover the interior surface of the store container. Exit conduit means is provided in association with the filter means for transmitting liquid passing through the filter means to a hydrate former subsystem. The hydrate former subsystem combines the halogen gas generated during the charging of the battery system with the liquid to form the hydrate in association with the store. Relief valve means is interposed in the exit conduit means for controlling the operation of the separate sections of the filter means, such that the liquid flow through the exit conduit means from each of the separate sections is controlled in a predetermined sequence. The three separate sections of the filter means operate in three discrete stages to provide a substantially uniform liquid flow to the hydrate former subsystem during the charging of the battery system. The separation of the liquid from the hydrate causes an increase in the density of the hydrate by concentrating the hydrate along the filter means.

  11. Multiple Indicators, Multiple Causes Measurement Error Models

    PubMed Central

    Tekwe, Carmen D.; Carter, Randy L.; Cullings, Harry M.; Carroll, Raymond J.

    2014-01-01

    Multiple Indicators, Multiple Causes Models (MIMIC) are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times however when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are: (1) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model, (2) to develop likelihood based estimation methods for the MIMIC ME model, (3) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

  12. Multiple indicators, multiple causes measurement error models.

    PubMed

    Tekwe, Carmen D; Carter, Randy L; Cullings, Harry M; Carroll, Raymond J

    2014-11-10

    Multiple indicators, multiple causes (MIMIC) models are often employed by researchers studying the effects of an unobservable latent variable on a set of outcomes, when causes of the latent variable are observed. There are times, however, when the causes of the latent variable are not observed because measurements of the causal variable are contaminated by measurement error. The objectives of this paper are as follows: (i) to develop a novel model by extending the classical linear MIMIC model to allow both Berkson and classical measurement errors, defining the MIMIC measurement error (MIMIC ME) model; (ii) to develop likelihood-based estimation methods for the MIMIC ME model; and (iii) to apply the newly defined MIMIC ME model to atomic bomb survivor data to study the impact of dyslipidemia and radiation dose on the physical manifestations of dyslipidemia. As a by-product of our work, we also obtain a data-driven estimate of the variance of the classical measurement error associated with an estimate of the amount of radiation dose received by atomic bomb survivors at the time of their exposure. PMID:24962535

  13. The role of the PI3K-Akt signal transduction pathway in Autographa californica multiple nucleopolyhedrovirus infection of Spodoptera frugiperda cells

    SciTech Connect

    Xiao Wei; Yang Yi; Weng Qingbei; Lin Tiehao; Yuan Meijin; Yang Kai; Pang Yi

    2009-08-15

    Many viruses activate the phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway, thereby modulating diverse downstream signaling pathways associated with antiapoptosis, proliferation, cell cycling, protein synthesis and glucose metabolism, in order to augment their replication. To date, the role of the PI3K-Akt pathway in Baculovirus replication has not been defined. In the present study, we demonstrate that infection of Sf9 cells with Autographa californica multiple nucleopolyhedrovirus (AcMNPV) elevated cellular Akt phosphorylation at 1 h post-infection. The maximum Akt phosphorylation occurred at 6 h post-infection and remained unchanged until 18 h post-infection. The PI3K-specific inhibitor, LY294002, suppressed Akt phosphorylation in a dose-dependent manner, suggesting that AcMNPV-induced Akt phosphorylation is PI3K-dependent. The inhibition of PI3K-Akt activation by LY294002 significantly reduced the viral yield, including a reduction in budded viruses and occlusion bodies. The virus production was reduced only when the inhibitor was added within 24 h of infection, implying that activation of PI3K occurred early in infection. Correspondingly, both viral DNA replication and late (VP39) and very late (POLH) viral protein expression were impaired by LY294002 treatment; LY294002 had no effect on immediate-early (IE1) and early-late (GP64) protein expression. These results demonstrate that the PI3K-Akt pathway is required for efficient Baculovirus replication.

  14. Genetics Home Reference: multiple sclerosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions multiple sclerosis multiple sclerosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Multiple sclerosis is a condition characterized by areas of damage ( ...

  15. Multiple sclerosis and pregnancy.

    PubMed

    Bodiguel, E; Bensa, C; Brassat, D; Laplaud, D; Le Page, E; Ouallet, J-C; Zephir, H; De Seze, J

    2014-04-01

    The question of pregnancy in patients with multiple sclerosis is regularly raised due to the prevalence of the disease in middle age women. The multiple sclerosis think tank (Groupe de Réflexion sur la Sclérose en Plaques [GRESEP]) decided to develop recommendations on this issue, with consideration to both the impact of multiple sclerosis on pregnancy, and that of pregnancy on the disease. As with topics of previous works, the formal expert consensus method was used. The working group was composed of hospital-based and private practice neurologists. The reading group was composed of neurologists, anaesthetists and obstetricians. Each recommendation is presented with the relevant level of consensus. PMID:24684929

  16. Multiplicities of dihedral discriminants

    NASA Astrophysics Data System (ADS)

    Mayer, Daniel C.

    1992-04-01

    Given the discriminant {d_k} of a quadratic field k, the number of cyclic relative extensions N\\vert k of fixed odd prime degree p with dihedral absolute Galois group of order 2p, which share a common conductor f, is called the multiplicity of the dihedral discriminant {d_N} = {f^{2(p - 1)}}d_k^p . In this paper, general formulas for multiplicities of dihedral discriminants are derived by analyzing the p-rank of the ring class group mod f of k. For the special case p = 3,{d_k} = - 3 , an elementary proof is given additionally. The theory is illustrated by a discussion of all known discriminants of multiplicity ≥ 5 of totally real and complex cubic fields.

  17. Multiple sort flow cytometer

    DOEpatents

    Van den Engh, Ger; Esposito, Richard J.

    1996-01-01

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane.

  18. Immunopathology of multiple sclerosis.

    PubMed

    Dendrou, Calliope A; Fugger, Lars; Friese, Manuel A

    2015-09-15

    Two decades of clinical experience with immunomodulatory treatments for multiple sclerosis point to distinct immunological pathways that drive disease relapses and progression. In light of this, we discuss our current understanding of multiple sclerosis immunopathology, evaluate long-standing hypotheses regarding the role of the immune system in the disease and delineate key questions that are still unanswered. Recent and anticipated advances in the field of immunology, and the increasing recognition of inflammation as an important component of neurodegeneration, are shaping our conceptualization of disease pathophysiology, and we explore the potential implications for improved healthcare provision to patients in the future. PMID:26250739

  19. Neutron multiplicity analysis tool

    SciTech Connect

    Stewart, Scott L

    2010-01-01

    I describe the capabilities of the EXCOM (EXcel based COincidence and Multiplicity) calculation tool which is used to analyze experimental data or simulated neutron multiplicity data. The input to the program is the count-rate data (including the multiplicity distribution) for a measurement, the isotopic composition of the sample and relevant dates. The program carries out deadtime correction and background subtraction and then performs a number of analyses. These are: passive calibration curve, known alpha and multiplicity analysis. The latter is done with both the point model and with the weighted point model. In the current application EXCOM carries out the rapid analysis of Monte Carlo calculated quantities and allows the user to determine the magnitude of sample perturbations that lead to systematic errors. Neutron multiplicity counting is an assay method used in the analysis of plutonium for safeguards applications. It is widely used in nuclear material accountancy by international (IAEA) and national inspectors. The method uses the measurement of the correlations in a pulse train to extract information on the spontaneous fission rate in the presence of neutrons from ({alpha},n) reactions and induced fission. The measurement is relatively simple to perform and gives results very quickly ({le} 1 hour). By contrast, destructive analysis techniques are extremely costly and time consuming (several days). By improving the achievable accuracy of neutron multiplicity counting, a nondestructive analysis technique, it could be possible to reduce the use of destructive analysis measurements required in safeguards applications. The accuracy of a neutron multiplicity measurement can be affected by a number of variables such as density, isotopic composition, chemical composition and moisture in the material. In order to determine the magnitude of these effects on the measured plutonium mass a calculational tool, EXCOM, has been produced using VBA within Excel. This

  20. Multiple sort flow cytometer

    DOEpatents

    Engh, G. van den; Esposito, R.J.

    1996-01-09

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane. 8 figs.

  1. Multiple origins of life

    NASA Technical Reports Server (NTRS)

    Raup, D. M.; Valentine, J. W.

    1983-01-01

    There is some indication that life may have originated readily under primitive earth conditions. If there were multiple origins of life, the result could have been a polyphyletic biota today. Using simple stochastic models for diversification and extinction, we conclude: (1) the probability of survival of life is low unless there are multiple origins, and (2) given survival of life and given as many as 10 independent origins of life, the odds are that all but one would have gone extinct, yielding the monophyletic biota we have now. The fact of the survival of our particular form of life does not imply that it was unique or superior.

  2. [Hypersomnia in multiple sclerosis].

    PubMed

    Schlüter, B; Aguigah, G; Andler, W

    1996-01-01

    A 13-year-old girl presented with hyersomnia and incontinence of urine. The clinical course was complicated by strabism, muscle weakness and coordination and balance disturbances. VEP recording were pathologic. Myelin basic protein in the cerebrospinal fluid was elevated. Nuclear resonance imaging of the brain revealed multiple areas of demyelination. These findings supported the diagnosis of multiple sclerosis. There was a marked disturbance of the sleep-waking-pattern during the acute phase of the illness. The hypnogram resembled the pattern of polysymptomatic narcolepsy. Regression of symptoms was noted with dexamethasone therapy. PMID:8676595

  3. Multiple pterygium syndrome.

    PubMed

    Chen, H; Chang, C H; Misra, R P; Peters, H A; Grijalva, N S; Opitz, J M

    1980-01-01

    We describe a sporadic case and four sibs from a consanguineous Nicaraguan family affected with the multiple pterygium syndrome. Clinical manifestations included normal intelligence; short stature; pterygia of neck, axillary, antecubital, popliteal, digital, and intercrural areas; multiple joint contractures with a crouched stance; a flat, sad, motionless facial appearance; and cleft palate. Males had small penis and scrotum and cryptorchidism; females had apparent aplasia of labia majora and small clitoris. Skeletal anomalies included fusion of cervical vertebrae, scoliosis, flexion contractures of fingers and "rocker-bottom" feet with vertical talus. This review documents genetic heterogeneity: Autosomal recessive inheritance in many cases, autosomal dominant determination in others, and sporadic occurrence. PMID:7468651

  4. Problems of multiple transfusions.

    PubMed

    GARDNER, F H

    1958-02-01

    The use of blood infusion in large amounts is increasing sharply. Increased knowledge of blood group antigens has alerted physicians to the possible hazards of hemolytic reactions to subgroups that must be eliminated by proper cross-matching techniques. Multiple transfusions of preserved blood often defeat their purpose in control of bleeding, for thrombocytopenia is enhanced. Careful selection of blood or preparations of plasma concentrates offer increased protection to the recipient.Plastic bag equipment increases the yield of viable platelets and keeps blood in usable condition for longer periods of storage. The use of multiple transfusions has complicated the selection of preserved blood to control pigment metabolism. PMID:13500210

  5. Managing Multiple Measures

    ERIC Educational Resources Information Center

    DePascale, Charles A.

    2012-01-01

    Regardless of how one might feel about the recent developments in teacher evaluation systems, No Child Left Behind (NCLB) and adequate yearly progress (AYP), or student assessments for high-stakes promotion decisions, educators overwhelmingly agree that use of multiple measures is better than reliance on a single measure such as a large-scale,…

  6. Core Multiplication in Childhood

    ERIC Educational Resources Information Center

    McCrink, Koleen; Spelke, Elizabeth S.

    2010-01-01

    A dedicated, non-symbolic, system yielding imprecise representations of large quantities (approximate number system, or ANS) has been shown to support arithmetic calculations of addition and subtraction. In the present study, 5-7-year-old children without formal schooling in multiplication and division were given a task requiring a scalar…

  7. Multiple Primary Cancer Monograph

    Cancer.gov

    To identify groups of cancer survivors that are at increased risk for multiple primary cancers, investigators led an effort to provide the first comprehensive population-based analysis of the risk of subsequent cancer in the U.S., resulting in a monograph.

  8. Multiple brain abscesses.

    PubMed

    Burke, L P; Ho, S U; Cerullo, L J; Kim, K S; Harter, D H

    1981-12-01

    A young woman with 12 separate brain abscesses was treated medically after aspiration of one abscess for diagnostic bacteriological examination. She made an excellent recovery with only minimal residual neurological dysfunction. Surgical aspiration for detailed bacteriological studies followed by appropriate antimicrobial therapy is an effective way of treating multiple brain abscesses in the neurologically stable patient. PMID:7330768

  9. The Multiple Mirror Telescope

    NASA Astrophysics Data System (ADS)

    Beckers, J. M.; Ulich, B. L.; Shannon, R. R.; Carleton, N. P.; Geary, J. C.; Latham, D. W.; Angel, J. R. P.; Hoffmann, W. F.; Low, F. J.; Weymann, R. J.

    The Multiple Mirror Telescope (MMT), located on top of Mount Hopkins (2600 m) in Arizona, consists of six main telescope systems, each of which is a classical Cassegrain with a 1.8 m diameter parabolic primary with focal ratio f/2.7, and a hyperbolic secondary producing a final f/31.6 for each of the individual telescopes. The most significant departures of the MMT from conventional optical telescope technology are (1) the use of light-weight 'egg-crate' mirrors, which reduced the telescope weight, (2) the use of an alt-azimuth mount, which simplifies the gravitational effects on the structure, (3) the use of a ball-bearing support rather than hydrostatic bearings, resulting in cost savings and less maintenance, (4) the use of spur gear drives rather than worm gears, and (5) the use of multiple coaligned light collectors rather than a single monolithic mirror. Early multiple objective telescopes are discussed, and the early history of the MMT project is given. The design and performance of the telescope are explained, and MMT instrumentation (spectrograph, optical design, detector, infrared photometer, SAO CCD camera) is given. Astronomical research with the telescope is discussed, along with plans for future multiple objective telescopes.

  10. Multiple primary bronchogenic carcinomas.

    PubMed

    Yang, X; Ji, H; Paljarvi, L; Soimakallio, S

    1996-07-01

    Multiple primary bronchogenic carcinomas (MPBCa) are extremely rare. The differentiation of a MPBCa from a pulmonary metastasis due to an extrathoracic neoplasm is sometimes difficult. We reviewed 324 pathologically proved primary pulmonary carcinomas and found six cases of MPBCa (1.9%). We herewith present the series and discuss the diagnosis of MPBCa. PMID:21594435

  11. Multiple gap photovoltaic device

    DOEpatents

    Dalal, Vikram L.

    1981-01-01

    A multiple gap photovoltaic device having a transparent electrical contact adjacent a first cell which in turn is adjacent a second cell on an opaque electrical contact, includes utilizing an amorphous semiconductor as the first cell and a crystalline semiconductor as the second cell.

  12. Multiple Access Trade Study

    NASA Technical Reports Server (NTRS)

    Motamedi, Masoud

    1990-01-01

    The Personal Access Satellite System (PASS) strawman design uses a hybrid Time Division Multiple Access (TDMA)/Frequency Division Multiple Access (FDMA) implementation. TDMA is used for the forward direction (from Suppliers to Users), and FDMA for the return direction (from Users to Suppliers). An alternative architecture is proposed that will require minimal real time coordination and yet provide a fast access method by using random access Code Division Multiple Access (CDMA). The CDMA system issues are addressed such as connecting suppliers and users, both of whom may be located anywhere in the CONUS, when the user terminals are constrained in size and weight; and providing efficient traffic routing under highly variable traffic requirements. It is assumed that bandwidth efficiency is not of paramount importance. CDMA or Spread Spectrum Multiple Access (SSMA) communication is a method in which a group of carriers operate at the same nominal center frequency but are separable from each other by the low cross correlation of the spreading codes used. Interference and multipath rejection capability, ease of selective addressing and message screening, low density power spectra for signal hiding and security, and high resolution ranging are among the benefits of spread spectrum communications.

  13. Multiple Cutaneous Reticulohistiocytoma

    PubMed Central

    Hemmady, Karishma D; Someshwar, Shylaja S; Jerajani, Hemangi R

    2016-01-01

    Multicentric reticulohistiocytosis is a rare non-Langerhans cell histiocytosis characterized in its full form by severe destructive arthritis, cutaneous nodules, and systemic manifestations. Cutaneous lesions may precede, accompany, or more commonly develop later than other features in this disease. We describe a case of multiple cutaneous reticulohistiocytoma without any systemic associations after thorough investigations. PMID:26955136

  14. Universality of particle multiplicities

    NASA Astrophysics Data System (ADS)

    Goulianos, K.

    1994-09-01

    We discuss the scaling properties and universality aspects of the rapidity and multiplicity distributions of particles produced in high energy hadronic and e(+)e(-) interactions. This paper is based on material presented in three lectures on pomeron phenomenology, which included a review of traditional soft pomeron physics and selected topics on hard diffraction processes probing the structure function of the pomeron.

  15. Multiple Grammars and MOGUL

    ERIC Educational Resources Information Center

    Truscott, John

    2014-01-01

    Optionality is a central phenomenon in second language acquisition (SLA), for which any adequate theory must account. Amaral and Roeper (this issue; henceforth A&R) offer an appealing approach to it, using Roeper's Multiple Grammars Theory, which was created with first language in mind but which extends very naturally to SLA. They include…

  16. Familial multiple lipomatosis.

    PubMed

    Toy, Brian R

    2003-10-01

    Familial multiple lipomatosis is a rare hereditary syndrome with a proposed autosomal-dominant inheritance. A case of an 89-year-old man with this disease is presented, along with his pedigree. Clinical features, genetic evidence, and treatment options are reviewed. PMID:14594582

  17. Familial multiple lipomatosis.

    PubMed

    Mohar, N

    1980-01-01

    A family genealogy, comprising four cases of familial multiple lipomatosis, making their appearance one after the other in three generations is reported. Two cases with impressive clinical features are presented in detail. This report contributes to the opinion that the disease is transmitted by the autosomal dominant route of inheritance. PMID:6162336

  18. Multiple Intelligences Meet Standards.

    ERIC Educational Resources Information Center

    Greenhawk, Jan

    1997-01-01

    In the five years since a Trappe, Maryland elementary school put Gardner's multiple-intelligences theory into practice, students' overall achievement and confidence have risen substantially. Specialists helped teachers develop standards for grading students' art work and oral presentations. To prepare students for state assessments, written…

  19. From Disjunction to Multiplicity

    ERIC Educational Resources Information Center

    Greene, Maxine

    1972-01-01

    A discussion in reaction to Bell's thesis (AA 511 929) of the reflection of, and influence on, culture in art. The author focuses on literature and argues that the function of literature is to provide multiple perspectives and to influence the reader, and that this it to the good. (Author/JB)

  20. Automatic multiple applicator electrophoresis

    NASA Technical Reports Server (NTRS)

    Grunbaum, B. W.

    1977-01-01

    Easy-to-use, economical device permits electrophoresis on all known supporting media. System includes automatic multiple-sample applicator, sample holder, and electrophoresis apparatus. System has potential applicability to fields of taxonomy, immunology, and genetics. Apparatus is also used for electrofocusing.

  1. Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation

    SciTech Connect

    Lee, Gloria; Lo, Annie; Short, Sarah A.; Mankelow, Tosti J.; Spring, Frances; Parsons, Stephen F.; Mohandas, Narla; Anstee, David J.; Chasis, Joel Anne

    2006-02-15

    Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially mediates island attachments. To test this, we generated ICAM-4 knockout mice and developed quantitative, live cell techniques for harvesting intact islands and for reforming islands in vitro. We observed a 47 percent decrease in islands reconstituted from ICAM-4 null marrow compared to wild type. We also found a striking decrease in islands formed in vivo in knockout mice. Further, peptides that block ICAM-4 alpha V adhesion produced a 53-57 percent decrease in reconstituted islands, strongly suggesting that ICAM-4 binding to macrophage alpha V functions in island integrity. Importantly, we documented that alpha V integrin is expressed in macrophages isolated from erythro blastic islands. Collectively, these data provide convincing evidence that ICAM-4 is critical in erythroblastic island formation via ICAM-4/alpha V adhesion and also demonstrate that the novel experimental strategies we developed will be valuable in exploring molecular mechanisms of erythroblastic island formation and their functional role in regulating erythropoiesis.

  2. In vivo and in vitro genetic recombination between conventional and gene-deleted vaccine strains of pseudorabies virus.

    PubMed

    Henderson, L M; Katz, J B; Erickson, G A; Mayfield, J E

    1990-10-01

    Pseudorabies virus (PRV), an alpha-herpesvirus, causes substantial economic losses in the swine industry and is currently the focus of eradication and control programs. Some of these programs rely on the ability of veterinarians to differentiate animals exposed to virulent strains of PRV from animals exposed to avirulent vaccine strains of PRV on the basis of a serologic response to nonessential glycoproteins that are deleted in some vaccine strains of PRV. Genetic recombination resulting in the creation of virulent strains of PRV with the same negative immunologic markers as vaccine strains could disrupt these programs. Two strains of PRV were coinoculated either into tissue culture or into sheep to facilitate recombination. Progeny viruses were selected to detect a specific recombinant phenotype. We were able to detect genetic recombination between vaccine strains of PRV following in vitro or in vivo coinoculation of 2 strains of PRV. The selected recombinants had marker-deleted phenotypes in strains with restored virulence genes. Increased virulence was observed in sheep after coinoculation of 2 avirulent vaccine strains of PRV. PMID:2173449

  3. A 'suicide' CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans.

    PubMed

    Wang, Yu; Wei, Dongsheng; Zhu, Xiangyang; Pan, Jiao; Zhang, Ping; Huo, Liang; Zhu, Xudong

    2016-01-01

    Loss-of-function mutagenesis is an important tool used to characterize gene functions, and the CRISPR-Cas9 system is a powerful method for performing targeted mutagenesis in organisms that present low recombination frequencies, such as the serotype D strains of Cryptococcus neoformans. However, when the CRISPR-Cas9 system persists in the host cells, off-target effects and Cas9 cytotoxicity may occur, which might block subsequent genetic manipulation. Here, we report a method of spontaneously eliminating the CRISPR-Cas9 system without impairing its robust editing function. We successfully expressed single guide RNA under the driver of an endogenous U6 promoter and the human codon-optimized Cas9 endonuclease with an ACT1 promoter. This system can effectively generate an indel mutation and efficiently perform targeted gene disruption via homology-directed repair by electroporation in yeast. We then demonstrated the spontaneous elimination of the system via a cis arrangement of the CRISPR-Cas9 expression cassettes to the recombination construct. After a system-mediated double crossover, the CRISPR-Cas9 cassettes were cleaved and degraded, which was validated by Southern blotting. This 'suicide' CRISPR-Cas9 system enables the validation of gene functions by subsequent complementation and has the potential to minimize off-target effects. Thus, this technique has the potential for use in functional genomics studies of C. neoformans. PMID:27503169

  4. Efficacy of a novel virulence gene-deleted Salmonella Typhimurium vaccine for protection against Salmonella infections in growing piglets.

    PubMed

    Hur, Jin; Song, Suck Oh; Lim, Jae Sam; Chung, In Kie; Lee, John Hwa

    2011-02-15

    We have previously developed a novel attenuated Salmonella Typhimurium (S. Typhimurium) ΔcpxR Δlon vaccine. This study was carried out to examine whether this vaccine could effectively protect growing piglets against Salmonella infection. Attenuated S. Typhimurium secreting the B subunit of Escherichia coli heat-labile enterotoxin was also used as a mucosal adjuvant. Pregnant sows in groups A and B were primed and boosted with the vaccine and mucosal adjuvant, whereas sows in groups C, D and E received PBS. Piglets in groups A and C were intramuscularly primed with formalin-inactivated vaccine and orally boosted with live vaccine, while piglets in groups B, D and E received PBS. Piglets in groups A, B, C, and D were challenged with a wild type virulent S. Typhimurium at the 11th weeks of age. Colostrum sIgA and IgG titers in vaccinated groups A and B sows were approximately 50 and 40 times higher than those of non-vaccinated groups C, D and E sows (P<0.001). Serum IgG titers of group A piglets were also significantly higher than those of groups D and E piglets during the study (P<0.001). Furthermore, no clinical signs were observed in group A piglets during the entire experimental period after the challenge, while diarrhea was observed in many of the piglets in groups B, C, and D. No Salmonella was isolated from fecal samples of the groups A and C piglets on day 14 after challenge, whereas the challenge strain was isolated from several piglets in groups B and D. These results indicate that vaccination of the piglets with the vaccine and mucosal adjuvant in addition to vaccination of their sows induced effective protection against Salmonella infections in the growing piglets. PMID:20869776

  5. CD36 gene deletion reduces fat preference and intake but not post-oral fat conditioning in mice.

    PubMed

    Sclafani, A; Ackroff, K; Abumrad, N A

    2007-11-01

    Several findings suggest the existence of a "fatty" taste, and the CD36 fatty acid translocase is a candidate taste receptor. The present study compared fat preference and acceptance in CD36 knockout (KO) and wild-type (WT) mice using nutritive (triglyceride and fatty acid) and nonnutritive (Sefa Soyate oil) emulsions. In two-bottle tests (24 h/day) naive KO mice, unlike WT mice, displayed little or no preference for dilute soybean oil, linoleic acid, or Sefa Soyate emulsions. At high concentrations (2.5-20%), KO mice developed significant soybean oil preferences, although they consumed less oil than WT mice. The postoral actions of fat likely conditioned these preferences. KO mice, like WT mice, learned to prefer a flavored solution paired with intragastric soybean oil infusions. These findings support CD36 mediation of a gustatory component to fat preference but demonstrate that it is not essential for fat-conditioned flavor preferences. The finding that oil-naive KO mice failed to prefer a nonnutritive oil, assumed to provide texture rather than taste cues, requires explanation. Finally, CD36 deletion decreased fat consumption and enhanced the ability of the mice to compensate for the calories provided by their optional fat intake. PMID:17804586

  6. Decreased cysteine uptake by EAAC1 gene deletion exacerbates neuronal oxidative stress and neuronal death after traumatic brain injury.

    PubMed

    Choi, Bo Young; Kim, In Yeol; Kim, Jin Hee; Lee, Bo Eun; Lee, Song Hee; Kho, A Ra; Jung, Hee Jae; Sohn, Min; Song, Hong Ki; Suh, Sang Won

    2016-07-01

    Excitatory amino acid carrier type 1 (EAAC1), a high-affinity glutamate transporter, can expend energy to move glutamate into neurons. However, under normal physiological conditions, EAAC1 does not have a great effect on glutamate clearance but rather participates in the neuronal uptake of cysteine. This process is critical to maintaining neuronal antioxidant function by providing cysteine for glutathione synthesis. Previous study showed that mice lacking EAAC1 show increased neuronal oxidative stress following transient cerebral ischemia. In the present study, we sought to characterize the role of EAAC1 in neuronal resistance after traumatic brain injury (TBI). Young adult C57BL/6 wild-type or EAAC1 (-/-) mice were subjected to a controlled cortical impact model for TBI. Neuronal death after TBI showed more than double the number of degenerating neurons in the hippocampus in EAAC1 (-/-) mice compared with wild-type mice. Superoxide production, zinc translocation and microglia activation similarly showed a marked increase in the EAAC1 (-/-) mice. Pretreatment with N-acetyl cysteine (NAC) reduced TBI-induced neuronal death, superoxide production and zinc translocation. These findings indicate that cysteine uptake by EAAC1 is important for neuronal antioxidant function and survival following TBI. This study also suggests that administration of NAC has therapeutic potential in preventing TBI-induced neuronal death. PMID:27040821

  7. Unexpected effects of gene deletion on mercury interactions with the methylation-deficient mutant hgcAB

    SciTech Connect

    Lin, Hui; Hurt, Jr., Richard Ashley; Johs, Alexander; Parks, Jerry M; Morrell-Falvey, Jennifer L; Liang, Liyuan; Elias, Dwayne A; Gu, Baohua

    2014-01-01

    The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT, accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.

  8. A single gene deletion on 4q28.3: PCDH18--a new candidate gene for intellectual disability?

    PubMed

    Kasnauskiene, Jurate; Ciuladaite, Zivile; Preiksaitiene, Egle; Matulevičienė, Aušra; Alexandrou, Angelos; Koumbaris, George; Sismani, Carolina; Pepalytė, Ingrida; Patsalis, Philippos C; Kučinskas, Vaidutis

    2012-04-01

    We report a boy with severe developmental delay, seizures, microcephaly, hypoplastic corpus callosum, internal hydrocephalus and dysmorphic features (narrow forehead, round face, deep-set eyes, blue sclerae, large and prominent ears, nose with anteverted nares, thin upper lip, small and wide-spaced teeth, hyperextensibility of the elbows, wrists, and fingers, fingertip pads, broad hallux, sacral dimple), carrying a 1.53 Mb interstitial deletion at 4q28.3. The deletion was detected by Agilent 105K oligo-array genome hybridization and involves the genomic region between 137,417,338 and 138,947,282 base pairs on chromosome 4 (NCBI build 36). The alteration was inherited from a healthy mother and contains a single gene, PCDH18 which encodes a cadherin-related neuronal receptor thought to play a role in the establishment and function of cell-cell connections in the brain. Thus, haploinsufficiency of this gene may contribute to altered brain development and associated malformations. We found that this deletion is a private inherited copy number variation that is associated with specific clinical findings in our patient and propose the PCDH18 gene as a possible candidate gene for intellectual disability. PMID:22450339

  9. In ovo vaccination of commercial broilers with a glycoprotein J gene-deleted strain of infectious laryngotracheitis virus.

    PubMed

    Mashchenko, Anna; Riblet, Sylva M; Zavala, Guillermo; García, Maricarmen

    2013-06-01

    Conventional live attenuated vaccines have been used as the main tool worldwide for the control of infectious laryngotracheitis. However, their suboptimal attenuation combined with poor mass administration practices allowed chicken embryo origin vaccine-derived isolates to circulate in the field, regain virulence, and be the cause of continuous outbreaks of the disease. Previous studies indicated that stable attenuation of infectious laryngotracheitis virus (ILTV) can be achieved by the deletion of individual viral genes that are not essential for viral replication in vitro. One of these genes is the glycoprotein J (gJ) gene. Its deletion provided significant attenuation to virulent ILTV strains from Europe and the United States. The objective of this study was to construct an attenuated gJ-deleted ILTV strain and evaluate its safety and efficacy for in ovo (IO) administration of commercial broilers. A novel gJ-deleted virus (N(delta)gJ) was constructed, and a 10(3) median tissue culture infective dose administered at 18 days of embryo age was considered safe because it did not affect hatchability or survivability of chickens during the first week posthatch. Broilers vaccinated IO and IO + eye drop at 14 days of age presented a significant reduction in clinical signs and reduction of virus loads after challenge, as compared with the nonvaccinated challenged group of chickens. Therefore, this study presents initial proof that the N(delta)gJ strain is a potential ILTV live-attenuated vaccine candidate suitable for IO vaccination of commercial broilers. PMID:23901771

  10. Detailed gene dose analysis reveals recurrent focal gene deletions in pediatric B-cell precursor acute lymphoblastic leukemia.

    PubMed

    Ivanov Öfverholm, Ingegerd; Tran, Anh Nhi; Olsson, Linda; Zachariadis, Vasilios; Heyman, Mats; Rudd, Eva; Syk Lundberg, Elisabeth; Nordenskjöld, Magnus; Johansson, Bertil; Nordgren, Ann; Barbany, Gisela

    2016-09-01

    To identify copy number alterations (CNAs) in pediatric B-cell precursor acute lymphoblastic leukemia (BCP ALL), array comparative genomic hybridization was performed on 50 cases; detected CNAs were validated in a cohort of 191 cases analyzed by single nucleotide polymorphism arrays. Apart from CNAs involving leukemia-associated genes, recurrent deletions targeting genes not previously implicated in BCP ALL, e.g. INIP, IRF1 and PDE4B, were identified. Deletions of the DNA repair gene INIP were exclusively found in cases with t(12;21), and deletions of SH2B3 were associated with intrachromosomal amplification of chromosome 21 (p < 0.001). A majority of BTLA deletions (7/11; 64%) affected samples with gain of 21q chromosome material, suggesting that BTLA deletions are associated with both germline and somatic gain of chromosome 21. In cases without known risk-associated cytogenetic markers, CNAs associated with adverse prognosis were identified in 50% (10/20), indicating that a majority of these cases could be assigned to distinct genetic subtypes. PMID:27090575

  11. Fluid reabsorption in proximal convoluted tubules of mice with gene deletions of claudin-2 and/or aquaporin1

    PubMed Central

    Huang, Yuning; Mizel, Diane

    2013-01-01

    Deletions of claudin-2 (Cldn2) and aquaporin1 (AQP1) reduce proximal fluid reabsorption (PFR) by about 30% and 50%, respectively. Experiments were done to replicate these observations and to determine in AQP1/claudin-2 double knockout mice (DKO) if the effects of deletions of these established water pores are additive. PFR was determined in inactin/ketamine-anesthetized mice by free-flow micropuncture using single-nephron I125-iothalamate (io) clearance. Animal means of PFR [% of glomerular filtration rate (GFR)] derived from TF/Piothalamate ratios in 12 mice in each of four groups [wild type (WT), Cldn2−/−, AQP1−/−, and DKO) were 45.8 ± 0.85 (51 tubules), 35.4 ± 1 (54 tubules; P < 0.01 vs. WT), 36.8 ± 1 (63 tubules; P < 0.05 vs. WT), and 33.9 ± 1.4 (69 tubules; P < 0.01 vs. WT). Kidney and single-nephron GFRs (SNGFR) were significantly reduced in all mutant strains. The direct relationship between PFR and SNGFR was maintained in mutant mice, but the slope of this relationship was reduced in the absence of Cldn2 and/or AQP1. Transtubular osmotic pressure differences were not different between WT and Cldn2−/− mice, but markedly increased in DKO. In conclusion, the deletion of Cldn2, AQP1, or of both Cldn2 and AQP1 reduces PFR by 22.7%, 19.6%, and 26%, respectively. Our data are consistent with an up to 25% paracellular contribution to PFR. The reduced osmotic water permeability caused by absence of AQP1 augments luminal hypotonicity. Aided by a fall in filtered load, the capacity of non-AQP1-dependent transcellular reabsorption is sufficient to maintain PFR without AQP1 and claudin-2 at 75% of control. PMID:24049145

  12. Correlations between long inverted repeat (LIR) features, deletion size and distance from breakpoint in human gross gene deletions

    PubMed Central

    Aygun, Nevim

    2015-01-01

    Long inverted repeats (LIRs) have been shown to induce genomic deletions in yeast. In this study, LIRs were investigated within ±10 kb spanning each breakpoint from 109 human gross deletions, using Inverted Repeat Finder (IRF) software. LIR number was significantly higher at the breakpoint regions, than in control segments (P < 0.001). In addition, it was found that strong correlation between 5′ and 3′ LIR numbers, suggesting contribution to DNA sequence evolution (r = 0.85, P < 0.001). 138 LIR features at ±3 kb breakpoints in 89 (81%) of 109 gross deletions were evaluated. Significant correlations were found between distance from breakpoint and loop length (r = −0.18, P < 0.05) and stem length (r = −0.18, P < 0.05), suggesting DNA strands are potentially broken in locations closer to bigger LIRs. In addition, bigger loops cause larger deletions (r = 0.19, P < 0.05). Moreover, loop length (r = 0.29, P < 0.02) and identity between stem copies (r = 0.30, P < 0.05) of 3′ LIRs were more important in larger deletions. Consequently, DNA breaks may form via LIR-induced cruciform structure during replication. DNA ends may be later repaired by non-homologous end-joining (NHEJ), with following deletion. PMID:25657065

  13. Discoidin domain receptor 2 germline gene deletion leads to altered heart structure and function in the mouse

    PubMed Central

    Yeo, Seon Ju; Kim, In Jai; Park, Joong Il; Gu, Yusu; Dalton, Nancy D.; Peterson, Kirk L.; Greenberg, Barry H.

    2014-01-01

    Discoidin domain receptor 2 (DDR2) is a fibrillar collagen receptor that is expressed in mesenchymal cells throughout the body. In the heart, DDR2 is selectively expressed on cardiac fibroblasts. We generated a germline DDR2 knockout mouse and used this mouse to examine the role of DDR2 deletion on heart structure and function. Echocardiographic measurements from null mice were consistent with those from a smaller heart, with reduced left ventricular chamber dimensions and little change in wall thickness. Fractional shortening appeared normal. Left ventricular pressure measurements revealed mild inotropic and lusitropic abnormalities that were accentuated by dobutamine infusion. Both body and heart weights from 10-wk-old male mice were ∼20% smaller in null mice. The reduced heart size was not simply due to reduced body weight, since cardiomyocyte lengths were atypically shorter in null mice. Although normalized cardiac collagen mass (assayed by hydroxyproline content) was not different in null mice, the collagen area fraction was statistically higher, suggesting a reduced collagen density from altered collagen deposition and cross-linking. Cultured cardiac fibroblasts from null mice deposited collagen at a slower rate than wild-type littermates, possibly due to the expression of lower prolyl 4-hydroxylase α-isoform 1 enzyme levels. We conclude that genetic deletion of the DDR2 collagen receptor alters cardiac fibroblast function. The resulting perturbations in collagen deposition can influence the structure and function of mature cardiomyocytes. PMID:24993042

  14. Secretory leukocyte protease inhibitor gene deletion alters bleomycin-induced lung injury, but not development of pulmonary fibrosis.

    PubMed

    Habgood, Anthony N; Tatler, Amanda L; Porte, Joanne; Wahl, Sharon M; Laurent, Geoffrey J; John, Alison E; Johnson, Simon R; Jenkins, Gisli

    2016-06-01

    Idiopathic pulmonary fibrosis is a progressive, fatal disease with limited treatment options. Protease-mediated transforming growth factor-β (TGF-β) activation has been proposed as a pathogenic mechanism of lung fibrosis. Protease activity in the lung is tightly regulated by protease inhibitors, particularly secretory leukocyte protease inhibitor (SLPI). The bleomycin model of lung fibrosis was used to determine the effect of increased protease activity in the lungs of Slpi(-/-) mice following injury. Slpi(-/-), and wild-type, mice received oropharyngeal administration of bleomycin (30 IU) and the development of pulmonary fibrosis was assessed. Pro and active forms of matrix metalloproteinase (MMP)-2 and MMP-9 were measured. Lung fibrosis was determined by collagen subtype-specific gene expression, hydroxyproline concentration, and histological assessment. Alveolar TGF-β activation was measured using bronchoalveolar lavage cell pSmad2 levels and global TGF-β activity was assessed by pSmad2 immunohistochemistry. The active-MMP-9 to pro-MMP-9 ratio was significantly increased in Slpi(-/-) animals compared with wild-type animals, demonstrating enhanced metalloproteinase activity. Wild-type animals showed an increase in TGF-β activation following bleomycin, with a progressive and sustained increase in collagen type I, alpha 1 (Col1α1), III, alpha 1(Col3α1), IV, alpha 1(Col4α1) mRNA expression, and a significant increase in total lung collagen 28 days post bleomycin. In contrast Slpi(-/-) mice showed no significant increase of alveolar TGF-β activity following bleomycin, above their already elevated levels, although global TGF-β activity did increase. Slpi(-/-) mice had impaired collagen gene expression but animals demonstrated minimal reduction in lung fibrosis compared with wild-type animals. These data suggest that enhanced proteolysis does not further enhance TGF-β activation, and inhibits sustained Col1α1, Col3α1, and Col4α1 gene expression following lung injury. However, these changes do not prevent the development of lung fibrosis. Overall, these data suggest that the absence of Slpi does not markedly modify the development of lung fibrosis following bleomycin-induced lung injury. PMID:26974397

  15. A ‘suicide’ CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans

    PubMed Central

    Wang, Yu; Wei, Dongsheng; Zhu, Xiangyang; Pan, Jiao; Zhang, Ping; Huo, Liang; Zhu, Xudong

    2016-01-01

    Loss-of-function mutagenesis is an important tool used to characterize gene functions, and the CRISPR-Cas9 system is a powerful method for performing targeted mutagenesis in organisms that present low recombination frequencies, such as the serotype D strains of Cryptococcus neoformans. However, when the CRISPR-Cas9 system persists in the host cells, off-target effects and Cas9 cytotoxicity may occur, which might block subsequent genetic manipulation. Here, we report a method of spontaneously eliminating the CRISPR-Cas9 system without impairing its robust editing function. We successfully expressed single guide RNA under the driver of an endogenous U6 promoter and the human codon-optimized Cas9 endonuclease with an ACT1 promoter. This system can effectively generate an indel mutation and efficiently perform targeted gene disruption via homology-directed repair by electroporation in yeast. We then demonstrated the spontaneous elimination of the system via a cis arrangement of the CRISPR-Cas9 expression cassettes to the recombination construct. After a system-mediated double crossover, the CRISPR-Cas9 cassettes were cleaved and degraded, which was validated by Southern blotting. This ‘suicide’ CRISPR-Cas9 system enables the validation of gene functions by subsequent complementation and has the potential to minimize off-target effects. Thus, this technique has the potential for use in functional genomics studies of C. neoformans. PMID:27503169

  16. GJB1/Connexin 32 whole gene deletions in patients with X-linked Charcot–Marie–Tooth disease

    PubMed Central

    Gonzaga-Jauregui, Claudia; Zhang, Feng; Towne, Charles F.; Batish, Sat Dev

    2014-01-01

    The X-linked form of Charcot–Marie–Tooth disease (CMTX) is the second most common form of this genetically heterogeneous inherited peripheral neuropathy. CMT1X is caused by mutations in the GJB1 gene. Most of the mutations causative for CMT1X are missense mutations. In addition, a few disease causative nonsense mutations and frameshift deletions that lead to truncated forms of the protein have also been reported to be associated with CMT1X. Previously, there have been reports of patients with deletions of the coding sequence of GJB1; however, the size and breakpoints of these deletions were not assessed. Here, we report five patients with deletions that range in size from 12.2 to 48.3 kb and that completely eliminate the entire coding sequence of the GJB1 gene, resulting in a null allele for this locus. Analyses of the breakpoints of these deletions showed that they are nonrecurrent and that they can be generated by different mechanisms. In addition to PMP22, GJB1 is the second CMT gene for which both point mutations and genomic rearrangements can cause a neuropathy phenotype, stressing the importance of CMT as a genomic disorder. PMID:20532933

  17. Gene deletion of P2Y4 receptor lowers exercise capacity and reduces myocardial hypertrophy with swimming exercise.

    PubMed

    Horckmans, Michael; Léon-Gómez, Elvira; Robaye, Bernard; Balligand, Jean-Luc; Boeynaems, Jean-Marie; Dessy, Chantal; Communi, Didier

    2012-10-01

    Nucleotides released within the heart under pathological conditions can be involved in cardioprotection or cardiac fibrosis through the activation purinergic P2Y(2) and P2Y(6) receptors, respectively. We previously demonstrated that adult P2Y(4)-null mice display a microcardia phenotype related to a cardiac angiogenic defect. To evaluate the functional consequences of this defect, we performed here a combination of cardiac monitoring and exercise tests. We investigated the exercise capacity of P2Y(4) wild-type and P2Y(4)-null mice in forced swimming and running tests. Analysis of their stress, locomotion, and resignation was realized in open field, black and white box, and tail suspension experiments. Exercise-induced cardiac hypertrophy was evaluated after repeated and prolonged exercise in P2Y(4) wild-type and P2Y(4)-null hearts. We showed that P2Y(4)-null mice have a lower exercise capacity in both swimming and treadmill tests. This was not related to decreased motivation or increased stress, since open field, white and black box, and mouse tail suspension tests gave comparable results in P2Y(4) wild-type and P2Y(4)-null mice. Heart rate and blood pressure rose normally in P2Y(4)-null swimming mice equipped with a telemetric implant. On the contrary, we observed a delayed recovery of postexercise blood pressure after exercise in P2Y(4)-null mice. The heart rate increment in response to catecholamines was also similar in P2Y(4) wild-type and P2Y(4)-null implanted mice, which is consistent with a similar level of cardiac β-receptor expression. Interestingly, the heart of P2Y(4)-null mice displayed a reduced sympathetic innervation associated with a decreased norepinephrine level. We also demonstrated that exercise-induced cardiac hypertrophy was lower in P2Y(4)-null mice after repeated and prolonged exercise. This was associated with a lower increase in cardiomyocyte size and microvessel density. In conclusion, besides its role in cardiac development, P2Y(4) receptor could constitute an important regulator of acute and chronic response to exercise. PMID:22865387

  18. Portable multiplicity counter

    DOEpatents

    Newell, Matthew R.; Jones, David Carl

    2009-09-01

    A portable multiplicity counter has signal input circuitry, processing circuitry and a user/computer interface disposed in a housing. The processing circuitry, which can comprise a microcontroller integrated circuit operably coupled to shift register circuitry implemented in a field programmable gate array, is configured to be operable via the user/computer interface to count input signal pluses receivable at said signal input circuitry and record time correlations thereof in a total counting mode, coincidence counting mode and/or a multiplicity counting mode. The user/computer interface can be for example an LCD display/keypad and/or a USB interface. The counter can include a battery pack for powering the counter and low/high voltage power supplies for biasing external detectors so that the counter can be configured as a hand-held device for counting neutron events.

  19. Multiple zeros of polynomials

    NASA Technical Reports Server (NTRS)

    Wood, C. A.

    1974-01-01

    For polynomials of higher degree, iterative numerical methods must be used. Four iterative methods are presented for approximating the zeros of a polynomial using a digital computer. Newton's method and Muller's method are two well known iterative methods which are presented. They extract the zeros of a polynomial by generating a sequence of approximations converging to each zero. However, both of these methods are very unstable when used on a polynomial which has multiple zeros. That is, either they fail to converge to some or all of the zeros, or they converge to very bad approximations of the polynomial's zeros. This material introduces two new methods, the greatest common divisor (G.C.D.) method and the repeated greatest common divisor (repeated G.C.D.) method, which are superior methods for numerically approximating the zeros of a polynomial having multiple zeros. These methods were programmed in FORTRAN 4 and comparisons in time and accuracy are given.

  20. Multiple muons in MACRO

    NASA Technical Reports Server (NTRS)

    Heinz, R.

    1985-01-01

    An analysis of the multiple muon events in the Monopole Astrophysics and Cosmic Ray Observatory detector was conducted to determine the cosmic ray composition. Particular emphasis is placed on the interesting primary cosmic ray energy region above 2000 TeV/nucleus. An extensive study of muon production in cosmic ray showers has been done. Results were used to parameterize the characteristics of muon penetration into the Earth to the location of a detector.

  1. Multiple Osteolytic Lesions

    PubMed Central

    Vinayachandran, Divya; Sankarapandian, Sathasivasubramanian

    2013-01-01

    Several systemic diseases initially present with various oral manifestations. Investigation of these oral symptoms may at times lead to the diagnosis of grave underlying life-threatening conditions. We present one such case, where the patient manifested with gross enlargement of the mandible, along with lesions in the lower limbs. These lesions were the initial manifestation and on further investigations the patient was diagnosed with multiple myeloma. PMID:24516769

  2. Multiple Miniature Avionic Displays

    NASA Technical Reports Server (NTRS)

    Rye, Jeffrey M. (Inventor); Dorneich, Michael C. (Inventor); Gannon, Aaron J. (Inventor)

    2008-01-01

    A display screen for displaying multiple sets of information is provided. In one embodiment, an aviation display screen includes a main window and a plurality of miniature windows. The main window is adapted to illustrate one set of information. Each miniature window is adapted to display a set of avionic information. The avionic display is further adapted to toggle a select set of avionic information in one of the miniature windows into the main window.

  3. Multiple linear regression.

    PubMed

    Eberly, Lynn E

    2007-01-01

    This chapter describes multiple linear regression, a statistical approach used to describe the simultaneous associations of several variables with one continuous outcome. Important steps in using this approach include estimation and inference, variable selection in model building, and assessing model fit. The special cases of regression with interactions among the variables, polynomial regression, regressions with categorical (grouping) variables, and separate slopes models are also covered. Examples in microbiology are used throughout. PMID:18450050

  4. Universality of particle multiplicities

    SciTech Connect

    Goulianos, K. |

    1994-09-01

    We discuss the scaling properties and universality aspects of the rapidity and multiplicity distributions of particles produced in high energy hadronic and e{sup +}e{sup {minus}} interactions. This paper is based on material presented in three lectures on pomeron phenomenology, which included a review of traditional soft pomeron physics and selected topics on hard diffraction processes probing the structure function of the pomeron.

  5. Multiple symmetric lipomatosis.

    PubMed

    Lee, M S; Lee, M H; Hur, K B

    1988-12-01

    Multiple symmetric lipomatosis (MSL) is an extremely uncommon disorder. In the medical literatures about 200 cases have been reported. MSL is not associated with other generalized lipomatous disorders, nor are these patient to be necessarily obese. The cause of MSL is unknown. The disorder usually occurs in middle-aged males and there is frequently a history of alcoholism. Some instances of familial occurrence have been reported, but the majority of cases are sporadic. Two cases of MSL are presented. PMID:3267365

  6. Familial multiple lipomatosis.

    PubMed

    Rabbiosi, G; Borroni, G; Scuderi, N

    1977-01-01

    A clinical study was made of 14 cases of multiple symmetrical lipomata in two families. There were 7 female and 7 male patients. In one family the members affected were observed in four generations. The disease set in during the third or fourth decade of life. The lipomata ranged in size from that of a pea to that of a hen's egg. They were limited to the forearms and trunk were asymptomatic. PMID:71835

  7. Pregnancy and multiple sclerosis

    PubMed Central

    Airas, Laura; Kaaja, Risto

    2012-01-01

    The relapse rate of multiple sclerosis (MS) is typically reduced during late pregnancy but increases in the postpartum period. The reasons for the increased postpartum activity are not entirely clear, but factors such as the abrupt decrease in oestrogen levels immediately after the delivery and the loss of the immunosuppressive state of pregnancy are likely of importance. There is a general view that MS does not affect the course or outcome of pregnancy.

  8. Multiple quantum coherence spectroscopy.

    PubMed

    Mathew, Nathan A; Yurs, Lena A; Block, Stephen B; Pakoulev, Andrei V; Kornau, Kathryn M; Wright, John C

    2009-08-20

    Multiple quantum coherences provide a powerful approach for studies of complex systems because increasing the number of quantum states in a quantum mechanical superposition state increases the selectivity of a spectroscopic measurement. We show that frequency domain multiple quantum coherence multidimensional spectroscopy can create these superposition states using different frequency excitation pulses. The superposition state is created using two excitation frequencies to excite the symmetric and asymmetric stretch modes in a rhodium dicarbonyl chelate and the dynamic Stark effect to climb the vibrational ladders involving different overtone and combination band states. A monochromator resolves the free induction decay of different coherences comprising the superposition state. The three spectral dimensions provide the selectivity required to observe 19 different spectral features associated with fully coherent nonlinear processes involving up to 11 interactions with the excitation fields. The different features act as spectroscopic probes of the diagonal and off-diagonal parts of the molecular potential energy hypersurface. This approach can be considered as a coherent pump-probe spectroscopy where the pump is a series of excitation pulses that prepares a multiple quantum coherence and the probe is another series of pulses that creates the output coherence. PMID:19507812

  9. Multiple Core Galaxies

    NASA Technical Reports Server (NTRS)

    Miller, R.H.; Morrison, David (Technical Monitor)

    1994-01-01

    Nuclei of galaxies often show complicated density structures and perplexing kinematic signatures. In the past we have reported numerical experiments indicating a natural tendency for galaxies to show nuclei offset with respect to nearby isophotes and for the nucleus to have a radial velocity different from the galaxy's systemic velocity. Other experiments show normal mode oscillations in galaxies with large amplitudes. These oscillations do not damp appreciably over a Hubble time. The common thread running through all these is that galaxies often show evidence of ringing, bouncing, or sloshing around in unexpected ways, even though they have not been disturbed by any external event. Recent observational evidence shows yet another phenomenon indicating the dynamical complexity of central regions of galaxies: multiple cores (M31, Markarian 315 and 463 for example). These systems can hardly be static. We noted long-lived multiple core systems in galaxies in numerical experiments some years ago, and we have more recently followed up with a series of experiments on multiple core galaxies, starting with two cores. The relevant parameters are the energy in the orbiting clumps, their relative.masses, the (local) strength of the potential well representing the parent galaxy, and the number of cores. We have studied the dependence of the merger rates and the nature of the final merger product on these parameters. Individual cores survive much longer in stronger background potentials. Cores can survive for a substantial fraction of a Hubble time if they travel on reasonable orbits.

  10. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus

    PubMed Central

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui

    2016-01-01

    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5–8–5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  11. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus.

    PubMed

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui

    2016-01-01

    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5-8-5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  12. Multiple sclerosis and infections.

    PubMed

    Venkatesan, Arun

    2015-01-01

    The intersection between infections and multiple sclerosis (MS) is complex and bidirectional. Numerous infectious agents have been posited to play a role in the initiation of MS, while emerging evidence suggests a potential relationship between established MS and the gut microbiome. As both systemic and CNS infections are major complications of MS, the clinical manifestations and evolving epidemiology of these infections over the lifespan of the MS patient are examined in this review. Data from animal models and human studies are discussed. PMID:26611265

  13. Familial multiple angiolipomatosis.

    PubMed

    Abbasi, Naheed R; Brownell, Isaac; Fangman, William

    2007-01-01

    An 80-year-old man presented with a 50-year history of asymptomatic, subcutaneous masses on the arms, trunk, and legs. His father and maternal grandmother had had similar lesions. Histopathologic examination showed a benign angiolipoma; the same diagnosis has been made on several previous biopsy specimens. This patient's history and physical examination support the diagnosis of familial angiolipomatosis, which is a benign, autosomal-dominant condition that may be regarded as a subtype of familial multiple lipomatosis (FML) or as a distinct entity. Management of this condition may include liposuction or surgery to reduce the tumor burden. PMID:17511936

  14. Psychopathology in Multiple Sclerosis

    PubMed Central

    Brüne, Martin; Juckel, Georg

    2009-01-01

    Multiple sclerosis (MS) is a chronic inflammatory disorder of the central nervous system. Demyelinization of nerve fibres not only affects the motor and sensory systems functionally, but may also cause psychopathological signs and symptoms. In addition to the psychiatric manifestations of MS, many patients have reactive psychological problems that are often hard to distinguish from the ‘organic’ causation of psychopathology. In any event, psychiatric comorbidity in MS deserves greater clinical attention than has been previously paid, because the presence of psychopathology may have deleterious effects on the disease process and impair coping with disability. PMID:21180640

  15. Factorial Invariance in Multiple Populations: A Multiple Testing Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.; Millsap, Roger E.

    2013-01-01

    A multiple testing method for examining factorial invariance for latent constructs evaluated by multiple indicators in distinct populations is outlined. The procedure is based on the false discovery rate concept and multiple individual restriction tests and resolves general limitations of a popular factorial invariance testing approach. The…

  16. Highly divergent strains of porcine reproductive and respiratory syndrome virus incorporate multiple isoforms of nonstructural protein 2 into virions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral structural proteins formulate the critical intermediary between viral infection cycles within and between hosts, function to initiate entry, participate in immediate-early viral replication steps, and are major targets for the host adaptive immune response. We report the identification of nons...

  17. Albumin and multiple sclerosis.

    PubMed

    LeVine, Steven M

    2016-01-01

    Leakage of the blood-brain barrier (BBB) is a common pathological feature in multiple sclerosis (MS). Following a breach of the BBB, albumin, the most abundant protein in plasma, gains access to CNS tissue where it is exposed to an inflammatory milieu and tissue damage, e.g., demyelination. Once in the CNS, albumin can participate in protective mechanisms. For example, due to its high concentration and molecular properties, albumin becomes a target for oxidation and nitration reactions. Furthermore, albumin binds metals and heme thereby limiting their ability to produce reactive oxygen and reactive nitrogen species. Albumin also has the potential to worsen disease. Similar to pathogenic processes that occur during epilepsy, extravasated albumin could induce the expression of proinflammatory cytokines and affect the ability of astrocytes to maintain potassium homeostasis thereby possibly making neurons more vulnerable to glutamate exicitotoxicity, which is thought to be a pathogenic mechanism in MS. The albumin quotient, albumin in cerebrospinal fluid (CSF)/albumin in serum, is used as a measure of blood-CSF barrier dysfunction in MS, but it may be inaccurate since albumin levels in the CSF can be influenced by multiple factors including: 1) albumin becomes proteolytically cleaved during disease, 2) extravasated albumin is taken up by macrophages, microglia, and astrocytes, and 3) the location of BBB damage affects the entry of extravasated albumin into ventricular CSF. A discussion of the roles that albumin performs during MS is put forth. PMID:27067000

  18. Pediatric Multiple Sclerosis.

    PubMed

    Lee, Ji Y; Chitnis, Tanuja

    2016-04-01

    Pediatric multiple sclerosis (MS) is a chronic inflammatory neurologic disease that is challenging to diagnose and treat. Although there are many clinical parallels between pediatric-onset MS and adult-onset MS, there is also accumulating evidence of distinguishing clinical features that may, in part, arise from development-specific, neuroimmune processes governing MS pathogenesis in children. Here the authors describe the clinical features, diagnosis, and treatment of pediatric MS, with a particular focus on describing clinical features and highlighting new developments that promise a better understanding of pediatric MS pathogenesis. An important task that lies ahead for pediatric neurologists is better understanding the early gene-environment interaction that precipitates the first demyelinating event in pediatric MS. This area is of particular importance for understanding the MS etiology and the natural history of pediatric MS. Such understanding should in turn inform new developments in diagnostic tools, long-term therapies, and much-needed biomarkers. Such biomarkers are not only valuable for defining the disease onset, but also for monitoring both the treatment response and a disease evolution that spans multiple decades in children with MS. PMID:27116721

  19. [Treatment of multiple myeloma].

    PubMed

    Terriou, L; Leleu, X; Yakoub-Agha, I

    2006-01-01

    Treatment of patients with multiple myeloma has shown considerable progress these last two decades. While autologous stem cell transplantation seems to be agreed as the "gold standard" of front-line treatment in the young patients, the result of IFM99-06 prospective study would probably lead to a change regarding treatment of elderly as patients who received the thalidomide-melphalan-prednison association had better overall survival than those who received either the standard melphalan-prednison association or an intensive treatment. The best innovative therapeutic concept is illustrated by the new molecules that target both the myeloma cells and the bone marrow microenvironment. Thus, thalidomide and derivatives (Revlimid and the Actimid) and Velcade have transformed considerably the history of multiple myeloma. They have not to be considered as competitors but rather complementary whose impact will probably come of their combination and their association with the intensive treatments. The issues of maintenance therapy and allogeneic stem cell transplantation in the treatment of patients with myeloma remain to be addressed. PMID:16455512

  20. Multiple capillary biochemical analyzer

    DOEpatents

    Dovichi, Norman J.; Zhang, Jian Z.

    1995-01-01

    A multiple capillary analyzer allows detection of light from multiple capillaries with a reduced number of interfaces through which light must pass in detecting light emitted from a sample being analyzed, using a modified sheath flow cuvette. A linear or rectangular array of capillaries is introduced into a rectangular flow chamber. Sheath fluid draws individual sample streams through the cuvette. The capillaries are closely and evenly spaced and held by a transparent retainer in a fixed position in relation to an optical detection system. Collimated sample excitation radiation is applied simultaneously across the ends of the capillaries in the retainer. Light emitted from the excited sample is detected by the optical detection system. The retainer is provided by a transparent chamber having inward slanting end walls. The capillaries are wedged into the chamber. One sideways dimension of the chamber is equal to the diameter of the capillaries and one end to end dimension varies from, at the top of the chamber, slightly greater than the sum of the diameters of the capillaries to, at the bottom of the chamber, slightly smaller than the sum of the diameters of the capillaries. The optical system utilizes optic fibres to deliver light to individual photodetectors, one for each capillary tube. A filter or wavelength division demultiplexer may be used for isolating fluorescence at particular bands.

  1. Smoldering multiple myeloma

    PubMed Central

    Landgren, Ola; Mateos, María-Victoria

    2015-01-01

    Smoldering multiple myeloma (SMM) is an asymptomatic clonal plasma cell disorder. SMM is distinguished from monoclonal gammopathy of undetermined significance by a much higher risk of progression to multiple myeloma (MM). There have been major advances in the diagnosis, prognosis, and management of SMM in the last few years. These include a revised disease definition, identification of several new prognostic factors, a classification based on underlying cytogenetic changes, and new treatment options. Importantly, a subset of patients previously considered SMM is now reclassified as MM on the basis of biomarkers identifying patients with an ≥80% risk of progression within 2 years. SMM has assumed greater significance on the basis of recent trials showing that early therapy can be potentially beneficial to patients. As a result, there is a need to accurately diagnose and risk-stratify patients with SMM, including routine incorporation of modern imaging and laboratory techniques. In this review, we outline current concepts in diagnosis and risk stratification of SMM, and provide specific recommendations on the management of SMM. PMID:25838344

  2. Smoldering Multiple Myeloma

    PubMed Central

    Gao, Minjie; Yang, Guang; Kong, Yuanyuan; Wu, Xiaosong; Shi, Jumei

    2015-01-01

    Smoldering multiple myeloma (SMM) is an asymptomatic precursor stage of multiple myeloma (MM) characterized by clonal bone marrow plasma cells (BMPC) ≥ 10% and/or M protein level ≥ 30 g/L in the absence of end organ damage. It represents an intermediate stage between monoclonal gammopathy of undetermined significance (MGUS) and symptomatic MM. The risk of progression to symptomatic MM is not uniform, and several parameters have been reported to predict the risk of progression. These include the level of M protein and the percentage of BMPC, the proportion of immunophenotypically aberrant plasma cells, and the presence of immunoparesis, free light-chain (FLC) ratio, peripheral blood plasma cells (PBPC), pattern of serum M protein evolution, abnormal magnetic resonance imaging (MRI), cytogenetic abnormalities, IgA isotype, and Bence Jones proteinuria. So far treatment is still not recommended for SMM, because several trials suggested that patients with SMM do not benefit from early treatment. However, the Mateos et al. trial showed a survival benefit after early treatment with lenalidomide plus dexamethasone in patients with high-risk SMM. This trial has prompted a reevaluation of early treatment in an asymptomatic patient population. PMID:26000300

  3. Multiple capillary biochemical analyzer

    DOEpatents

    Dovichi, N.J.; Zhang, J.Z.

    1995-08-08

    A multiple capillary analyzer allows detection of light from multiple capillaries with a reduced number of interfaces through which light must pass in detecting light emitted from a sample being analyzed, using a modified sheath flow cuvette. A linear or rectangular array of capillaries is introduced into a rectangular flow chamber. Sheath fluid draws individual sample streams through the cuvette. The capillaries are closely and evenly spaced and held by a transparent retainer in a fixed position in relation to an optical detection system. Collimated sample excitation radiation is applied simultaneously across the ends of the capillaries in the retainer. Light emitted from the excited sample is detected by the optical detection system. The retainer is provided by a transparent chamber having inward slanting end walls. The capillaries are wedged into the chamber. One sideways dimension of the chamber is equal to the diameter of the capillaries and one end to end dimension varies from, at the top of the chamber, slightly greater than the sum of the diameters of the capillaries to, at the bottom of the chamber, slightly smaller than the sum of the diameters of the capillaries. The optical system utilizes optic fibers to deliver light to individual photodetectors, one for each capillary tube. A filter or wavelength division demultiplexer may be used for isolating fluorescence at particular bands. 21 figs.

  4. Input Multiplicities in Process Control.

    ERIC Educational Resources Information Center

    Koppel, Lowell B.

    1983-01-01

    Describes research investigating potential effect of input multiplicity on multivariable chemical process control systems. Several simple processes are shown to exhibit the possibility of theoretical developments on input multiplicity and closely related phenomena are discussed. (JN)

  5. Multiple mandibular fractures. Treatment outlines.

    PubMed

    Elia, Giovanni; Franco, Elena; Clauser, Luigi C

    2016-02-01

    Multiple mandibular comminuted fractures usually occur in high energy traumas. The authors describe the management and treatment of multiple mandibular fractures in a young patient after a suicide attempt. PMID:26862697

  6. The Functions of Multiple Representations.

    ERIC Educational Resources Information Center

    Ainsworth, Shaaron

    1999-01-01

    Discusses multiple representations and multimedia learning environments; describes a functional taxonomy of MERs (multiple external representations); and considers how MERs are used to support cognitive processes in learning and problem solving with computers. (Contains 41 references.) (Author/LRW)

  7. Multiple Sclerosis: Hope Through Research

    MedlinePlus

    ... of this page please turn Javascript on. Feature: Multiple Sclerosis Hope Through Research Past Issues / Spring 2012 Table ... that television journalist Neil Cavuto was diagnosed with multiple sclerosis (MS) more than 15 years ago. And that ...

  8. Multiple-Trellis-Coded Modulation

    NASA Technical Reports Server (NTRS)

    Divsalar, D.; Simon, M. K.

    1990-01-01

    Theoretical gain over simple multiple-phase-shift keying at least 2 to 3 decibels. Multiple-trellis-coded modulation scheme combined with M-ary modulation shows theoretically to yield asymptotic gains in performance over uncoded multiple-phase-shift keying, while employing symmetric multiple-phase-shift signal constellations and avoiding code catastrophe. Suitable for satellite and terrestrial-mobile/satellite communications or other communications requiring burst-error correction. Extended to such higher dimensional modulations as quadrature amplitude modulation.

  9. Teaching EFL to Multiple Intelligences.

    ERIC Educational Resources Information Center

    Ghosn, Irma K.

    This paper is in large part a critique of Howard Gardner's theory of multiple intelligences presented in his 1983 book "Frames of Mind: The Theory of Multiple Intelligences," and asserts that the multiple intelligences (MI) concept has been widely misinterpreted. The paper outlines some of the misconceptions of Gardner's theory as identified by…

  10. Multiple detectors "Influence Method".

    PubMed

    Rios, I J; Mayer, R E

    2016-05-01

    The "Influence Method" is conceived for the absolute determination of a nuclear particle flux in the absence of known detector efficiency and without the need to register coincidences of any kind. This method exploits the influence of the presence of one detector in the count rate of another detector, when they are placed one behind the other and define statistical estimators for the absolute number of incident particles and for the efficiency (Rios and Mayer, 2015a). Its detailed mathematical description was recently published (Rios and Mayer, 2015b) and its practical implementation in the measurement of a moderated neutron flux arising from an isotopic neutron source was exemplified in (Rios and Mayer, 2016). With the objective of further reducing the measurement uncertainties, in this article we extend the method for the case of multiple detectors placed one behind the other. The new estimators for the number of particles and the detection efficiency are herein derived. PMID:26943904

  11. MULTIPLE GALAXY COLLISIONS

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Here is a sampling of 15 ultraluminous infrared galaxies viewed by NASA's Hubble Space Telescope. Hubble's sharp vision reveals more complexity within these galaxies, which astronomers are interpreting as evidence of a multiple-galaxy pileup. These images, taken by the Wide Field and Planetary Camera 2, are part of a three-year study of 123 galaxies within 3 billion light-years of Earth. The study was conducted in 1996, 1997, and 1999. False colors were assigned to these photos to enhance fine details within these coalescing galaxies. Credits: NASA, Kirk Borne (Raytheon and NASA Goddard Space Flight Center, Greenbelt, Md.), Luis Colina (Instituto de Fisica de Cantabria, Spain), and Howard Bushouse and Ray Lucas (Space Telescope Science Institute, Baltimore, Md.)

  12. Multiple layer insulation cover

    DOEpatents

    Farrell, James J.; Donohoe, Anthony J.

    1981-11-03

    A multiple layer insulation cover for preventing heat loss in, for example, a greenhouse, is disclosed. The cover is comprised of spaced layers of thin foil covered fabric separated from each other by air spaces. The spacing is accomplished by the inflation of spaced air bladders which are integrally formed in the cover and to which the layers of the cover are secured. The bladders are inflated after the cover has been deployed in its intended use to separate the layers of the foil material. The sizes of the material layers are selected to compensate for sagging across the width of the cover so that the desired spacing is uniformly maintained when the cover has been deployed. The bladders are deflated as the cover is stored thereby expediting the storage process and reducing the amount of storage space required.

  13. Alemtuzumab for Multiple Sclerosis.

    PubMed

    Willis, Mark D; Robertson, Neil P

    2016-09-01

    Alemtuzumab is a humanised anti-CD52 monoclonal antibody approved for use in active, relapsing multiple sclerosis (MS). Administration results in a rapid depletion of circulating lymphocytes with a subsequent beneficial immune reconstitution. Early open-label experience and recent clinical trials have demonstrated a dramatic effect on relapse rates as well as a positive effect on radiological disease outcomes and disability measures. Despite a mechanism of action that results in profound lymphopaenia, opportunistic infections are rarely seen and no excess association with malignancy has been identified. However, acquired autoimmune disease (AID) is a common adverse event following treatment, necessitating rigorous monitoring in order to facilitate prompt detection and management. Despite this issue, a unique dosing schedule and durability of effect make alemtuzumab a welcome addition to currently available treatment options for MS. PMID:27485945

  14. Metabolomics in multiple sclerosis.

    PubMed

    Bhargava, Pavan; Calabresi, Peter A

    2016-04-01

    Multiple sclerosis (MS) is a chronic demyelinating disorder of the central nervous system with inflammatory and degenerative components. The cause of MS remains unknown although genetic and environmental factors appear to play a role in its etiopathogenesis. Metabolomics is a new "omics" technology that aims at measuring small molecules in various biological matrices and can provide information that is not readily obtained from genomics, transcriptomics, or proteomics. Currently, several different analytical platforms exist for metabolomics, and both untargeted and targeted approaches are being employed. Methods of analysis of metabolomics data are also being developed and no consensus currently exists on the optimal approach to analysis and interpretation of these data. Metabolomics has the potential to provide putative biomarkers, insights into the pathophysiology of the disease, and to aid in precision medicine for patients with MS. PMID:26754801

  15. Swamp Works- Multiple Projects

    NASA Technical Reports Server (NTRS)

    Carelli, Jonathan M.; Schuler, Jason M.; Chandler, Meredith L.

    2013-01-01

    My Surface Systems internship over the summer 2013 session covered a broad range of projects that utilized multiple fields of engineering and technology. This internship included a project to create a command center for a 120 ton regolith bin, for the design and assembly of a blast shield to add further protection for the Surface Systems engineers, for the design and assembly of a portable four monitor hyper wall strip that could extend as large as needed, research and programming a nano drill that could be utilized on a next generation robot or rover, and social media tasks including the making of videos, posting to social networking websites and creation of a new outreach program to help spread the word about the Swamp Works laboratory.

  16. Multiple-port valve

    DOEpatents

    Doody, Thomas J.

    1978-08-22

    A multiple-port valve assembly is designed to direct flow from a primary conduit into any one of a plurality of secondary conduits as well as to direct a reverse flow. The valve includes two mating hemispherical sockets that rotatably receive a spherical valve plug. The valve plug is attached to the primary conduit and includes diverging passageways from that conduit to a plurality of ports. Each of the ports is alignable wih one or more of a plurality of secondary conduits fitted into one of the hemispherical sockets. The other hemispherical socket includes a slot for the primary conduit such that the conduit's motion along that slot with rotation of the spherical plug about various axes will position the valve-plug ports in respect to the secondary conduits.

  17. Immunology of Multiple Sclerosis.

    PubMed

    Sospedra, Mireia; Martin, Roland

    2016-04-01

    Multiple sclerosis (MS) is considered a prototypic autoimmune disease of the central nervous system (CNS). A complex genetic background with the HLA-DR15 haplotype as the main genetic risk factor and over 100 mostly immune-related minor risk alleles as well as several environmental factors contribute to the etiology of MS. With respect to pathomechanisms, autoimmune inflammation in early MS is primarily mediated by adaptive immune responses and involves autoreactive T cells, B cells, and antibodies, while the later, chronic stages of MS are characterized by a compartmentalized immune response in the CNS with activated microglia and macrophages. A host of immune cells and mediators can contribute to the autoimmune process, but CNS-related factors such as localization of lesions, vulnerability of oligodendrocytes, neurons/axons, and secondary metabolic changes all play a role in the heterogeneous expression of the disease, including different pathologic lesion patterns, neuroimaging findings, disease courses, and severity and response to treatment. PMID:27116718

  18. Aging and multiple sclerosis.

    PubMed

    Sanai, Shaik Ahmed; Saini, Vasu; Benedict, Ralph Hb; Zivadinov, Robert; Teter, Barbara E; Ramanathan, Murali; Weinstock-Guttman, Bianca

    2016-05-01

    The life expectancy and average age of persons with multiple sclerosis (MS) have increased significantly during the last two decades. The introduction of disease-modifying therapies and a better delineation and understanding of the superimposed comorbidities often diagnosed in MS patients are probably the most important factors accountable for the increase in aging MS population worldwide. Healthcare teams must therefore address the problems arising due to advancing age superimposed on this chronic neurologic disease. In this review, we focus on the physiology of aging, its effects on MS disease course, and the pathological and immunological changes associated with aging and disease progression. Additionally, we discuss the common comorbidities that occur in aging persons with MS that may arise either as a result of the aging process or from relentless chronic MS disease progression as well as the challenges on differentiating the two processes for a more appropriate therapeutic approach. PMID:26895718

  19. RNAs with multiple personalities.

    PubMed

    Maute, Roy L; Dalla-Favera, Riccardo; Basso, Katia

    2014-01-01

    In the last decade, advances in sequencing technology and a renewed focus on the regulatory potential of RNA molecules have combined to stimulate an enormous expansion in the catalog of known eukaryotic RNAs. Beyond the sheer numerical diversity of RNA species, recent studies have begun to uncover hints of even greater functional complexity. An increasing number of RNA molecules, including those from classic, well-studied classes, have been found to act in previously unanticipated regulatory roles, or as substrate for the biogenesis of functionally distinct RNA molecules, or both. Thus, these molecules can fulfill multiple, parallel functions, compounding the already rich landscape of RNA biology, and potentially connecting disparate biological regulatory networks in unexpected ways. In this article, we review recently discovered instances of RNA multifunctionality, with a particular focus on regulatory small RNAs. PMID:24039180

  20. Multiple jet study

    NASA Technical Reports Server (NTRS)

    Walker, R. E.; Kors, D. L.

    1973-01-01

    Test data is presented which allows determination of jet penetration and mixing of multiple cold air jets into a ducted subsonic heated mainstream flow. Jet-to-mainstream momentum flux ratios ranged from 6 to 60. Temperature profile data is presented at various duct locations up to 24 orifice diameters downstream of the plane of jet injection. Except for two configurations, all geometries investigated had a single row of constant diameter orifices located transverse to the main flow direction. Orifice size and spacing between orifices were varied. Both of these were found to have a significant effect on jet penetration and mixing. The best mixing of the hot and cold streams was achieved with duct height.

  1. Mixed Mode Matrix Multiplication

    SciTech Connect

    Meng-Shiou Wu; Srinivas Aluru; Ricky A. Kendall

    2004-09-30

    In modern clustering environments where the memory hierarchy has many layers (distributed memory, shared memory layer, cache,...), an important question is how to fully utilize all available resources and identify the most dominant layer in certain computations. When combining algorithms on all layers together, what would be the best method to get the best performance out of all the resources we have? Mixed mode programming model that uses thread programming on the shared memory layer and message passing programming on the distributed memory layer is a method that many researchers are using to utilize the memory resources. In this paper, they take an algorithmic approach that uses matrix multiplication as a tool to show how cache algorithms affect the performance of both shared memory and distributed memory algorithms. They show that with good underlying cache algorithm, overall performance is stable. When underlying cache algorithm is bad, superlinear speedup may occur, and an increasing number of threads may also improve performance.

  2. Postinjury multiple organ failure.

    PubMed

    Dewar, David; Moore, Frederick A; Moore, Ernest E; Balogh, Zsolt

    2009-09-01

    Postinjury multiple organ failure (MOF) became prevalent as the improvements in critical care during the 1970s made it possible to keep trauma patients alive with single organ injury. Enormous efforts invested in laboratory and clinical research made it possible to better understand the epidemiology and pathophysiology of the syndrome. This has translated to improved strategies in prediction, prevention and treatment of MOF. With changes in population demographics and injury mechanisms and improvements in trauma care, changes in the epidemiology of MOF are also becoming evident. Significant improvements in trauma patient management decreased the severity and mortality of MOF, but the syndrome still remains the most significant contributor of late postinjury mortality and intensive care unit resource utilisation. This review defines the essential MOF-related terminology, summarises the changing epidemiology of MOF, describes our current understanding of the pathophysiology, discusses the available strategies for prevention/treatment based on the identified independent predictors and provides future directions for research. PMID:19541301

  3. IRON IN MULTIPLE MYELOMA

    PubMed Central

    VanderWall, Kristina; Daniels-Wells, Tracy R; Penichet, Manuel; Lichtenstein, Alan

    2013-01-01

    Multiple myeloma is a non-curable B cell malignancy in which iron metabolism plays an important role. Patients with this disorder almost universally suffer from a clinically significant anemia, which is often symptomatic, and which is due to impaired iron utilization. Recent studies indicate that the proximal cause of dysregulated iron metabolism and anemia in these patients is cytokine-induced upregulation of hepcidin expression. Malignant myeloma cells are dependent on an increased influx of iron and therapeutic efforts are being made to target this requirement. The studies detailing the characteristics and biochemical abnormalities in iron metabolism causing anemia and the initial attempts to target iron therapeutically are described in this review. PMID:23879589

  4. Multiple stage railgun

    SciTech Connect

    Aaland, K.; Hawke, R.S.; Scudder, J.K.

    1982-08-10

    A multiple stage magnetic railgun accelerator for accelerating a projectile by movement of a plasma arc along the rails. The railgun is divided into a plurality of successive rail stages which are sequentially energized by separate energy sources as the projectile moves through the bore of the railgun. Propagation of energy from an energized rail stage back towards the breech end of the railgun can be prevented by connection of the energy sources to the rails through isolation diodes. Propagation of energy from an energized rail stage back towards the breech end of the railgun can also be prevented by dividing the rails into electrically isolated rail sections. In such case means are used to extinguish the arc at the end of each energized stage and a fuse or laser device is used to initiate a new plasma arc in the next energized rail stage.

  5. MULTIPLE SPARK GAP SWITCH

    DOEpatents

    Schofield, A.E.

    1958-07-22

    A multiple spark gap switch of unique construction is described which will permit controlled, simultaneous discharge of several capacitors into a load. The switch construction includes a disc electrode with a plurality of protuberances of generally convex shape on one surface. A firing electrode is insulatingly supponted In each of the electrode protuberances and extends substantially to the apex thereof. Individual electrodes are disposed on an insulating plate parallel with the disc electrode to form a number of spark gaps with the protuberances. These electrodes are each connected to a separate charged capacitor and when a voltage ls applied simultaneously between the trigger electrodes and the dlsc electrode, each spark gap fires to connect its capacitor to the disc electrode and a subsequent load.

  6. Multiple molecular penumbras after focal cerebral ischemia.

    PubMed

    Sharp, F R; Lu, A; Tang, Y; Millhorn, D E

    2000-07-01

    Though the ischemic penumbra has been classically described on the basis of blood flow and physiologic parameters, a variety of ischemic penumbras can be described in molecular terms. Apoptosis-related genes induced after focal ischemia may contribute to cell death in the core and the selective cell death adjacent to an infarct. The HSP70 heat shock protein is induced in glia at the edges of an infarct and in neurons often at some distance from the infarct. HSP70 proteins are induced in cells in response to denatured proteins that occur as a result of temporary energy failure. Hypoxia-inducible factor (HIF) is also induced after focal ischemia in regions that can extend beyond the HSP70 induction. The region of HIF induction is proposed to represent the areas of decreased cerebral blood flow and decreased oxygen delivery. Immediate early genes are induced in cortex, hippocampus, thalamus, and other brain regions. These distant changes in gene expression occur because of ischemia-induced spreading depression or depolarization and could contribute to plastic changes in brain after stroke. PMID:10908035

  7. The Telomerase Inhibitor MST-312 Interferes with Multiple Steps in the Herpes Simplex Virus Life Cycle

    PubMed Central

    Haberichter, Jarod; Roberts, Scott; Abbasi, Imran; Dedthanou, Phonphanh; Pradhan, Prajakta

    2015-01-01

    ABSTRACT The life cycle of herpes simplex virus (HSV) has the potential to be further manipulated to yield novel, more effective therapeutic treatments. Recent research has demonstrated that HSV-1 can increase telomerase activity and that expression of the catalytic component of telomerase, telomerase reverse transcriptase (TERT), alters sensitivity to HSV-dependent apoptosis. Telomerase is a cellular enzyme that synthesizes nucleotide repeats at the ends of chromosomes (telomeres), which prevents shortening of the 3′ ends of DNA with each cell division. Once telomeres reach a critical length, cells undergo senescence and apoptosis. Here, we used a cell-permeable, reversible inhibitor of the telomerase enzyme, MST-312, to investigate telomerase activity during HSV infection. Human mammary epithelial cells immortalized through TERT expression and human carcinoma HEp-2 cells were infected with the KOS1.1 strain of HSV-1 in the presence of MST-312. MST-312 treatment reduced the number of cells displaying a cytopathic effect and the accumulation of immediate early and late viral proteins. Moreover, the presence of 20 μM to 100 μM MST-312 during infection led to a 2.5- to 5.5-log10 decrease in viral titers. MST-312 also inhibited the replication of HSV-2 and a recent clinical isolate of HSV-1. Additionally, we determined that MST-312 has the largest impact on viral events that take place prior to 5 h postinfection (hpi). Furthermore, MST-312 treatment inhibited virus replication, as measured by adsorption assays and quantification of genome replication. Together, these findings demonstrate that MST-312 interferes with the HSV life cycle. Further investigation into the mechanism for MST-312 is warranted and may provide novel targets for HSV therapies. IMPORTANCE Herpes simplex virus (HSV) infections can lead to cold sores, blindness, and brain damage. Identification of host factors that are important for the virus life cycle may provide novel targets for HSV

  8. Disability in multiple sclerosis

    PubMed Central

    Chamot, Eric; Salter, Amber R.; Cutter, Gary R.; Bacon, Tamar E.; Herbert, Joseph

    2013-01-01

    Objective: To create a reference table of disability outcomes in multiple sclerosis (MS) that would enable patients to rank their disability relative to others' with similar disease duration and to develop a cost-effective research tool for comparing MS severity across patient populations and time periods. Methods: The North American Research Committee on Multiple Sclerosis (NARCOMS) Registry collects disability data from patients with MS on a validated, 9-point Patient-Determined Disease Steps (PDDS) scale. We compiled the Disability Expectancy Table, which displays cumulative frequencies of PDDS scores for each year of disease duration, from 0 to 45 years. We also tabulated disease duration–adjusted mean ranks of PDDS scores, referred to as Patient-derived MS Severity Scores (P-MSSS). Results: The cohort consisted of 27,918 NARCOMS enrollees, 72.7% of whom were female and 90.1% of whom were white. Mean age at symptom onset was 30.1 ± 10.1 years, and age at enrollment was 47.1 ± 11.0 years. The Disability Expectancy Table and P-MSSS afford a detailed overview of disability outcomes in a large MS cohort over a 45-year period. In the first year of disease, 15% of patients reported need of ambulatory aid, and 4% needed bilateral assistance or worse; after 45 years of disease, 76% of patients required ambulatory aid, and 52% bilateral assistance or worse. Proportion of patients who reported minimal or no interference in daily activities (PDDS ≤ 1) declined from 63% in the first year to 8% after 45 years of disease. Conclusion: The Disability Expectancy Table allows individual patients to determine how their disability ranks relative to NARCOMS enrollees with the same disease duration. P-MSSS may be used to compare disability across patient populations and to track disease progression in patient cohorts. P-MSSS does not require a formal neurologic examination and may therefore find wide applicability as a practical and cost-effective outcome measure in

  9. Viruses and Multiple Sclerosis

    PubMed Central

    Owens, Gregory P.; Gilden, Don; Burgoon, Mark P.; Yu, Xiaoli; Bennett, Jeffrey L.

    2012-01-01

    Multiple sclerosis (MS) is a chronic demyelinating disorder of unknown etiology, possibly caused by a virus or virus-triggered immunopathology. The virus might reactivate after years of latency and lyse oligodendrocytes, as in progressive multifocal leukoencephalopathy, or initiate immunopathological demyelination, as in animals infected with Theiler’s murine encephalomyelitis virus or coronaviruses. The argument for a viral cause of MS is supported by epidemiological analyses and studies of MS in identical twins, indicating that disease is acquired. However, the most important evidence is the presence of bands of oligoclonal IgG (OCBs) in MS brain and CSF that persist throughout the lifetime of the patient. OCBs are found almost exclusively in infectious CNS disorders, and antigenic targets of OCBs represent the agent that causes disease. Here, the authors review past attempts to identify an infectious agent in MS brain cells and discuss the promise of using recombinant antibodies generated from clonally expanded plasma cells in brain and CSF to identify disease-relevant antigens. They show how this strategy has been used successfully to analyze antigen specificity in subacute sclerosing panencephalitis, a chronic encephalitis caused by measles virus, and in neuromyelitis optica, a chronic autoimmune demyelinating disease produced by antibodies directed against the aquaporin-4 water channel. PMID:22130640

  10. Multiple trellis coded modulation

    NASA Technical Reports Server (NTRS)

    Simon, Marvin K. (Inventor); Divsalar, Dariush (Inventor)

    1990-01-01

    A technique for designing trellis codes to minimize bit error performance for a fading channel. The invention provides a criteria which may be used in the design of such codes which is significantly different from that used for average white Gaussian noise channels. The method of multiple trellis coded modulation of the present invention comprises the steps of: (a) coding b bits of input data into s intermediate outputs; (b) grouping said s intermediate outputs into k groups of s.sub.i intermediate outputs each where the summation of all s.sub.i,s is equal to s and k is equal to at least 2; (c) mapping each of said k groups of intermediate outputs into one of a plurality of symbols in accordance with a plurality of modulation schemes, one for each group such that the first group is mapped in accordance with a first modulation scheme and the second group is mapped in accordance with a second modulation scheme; and (d) outputting each of said symbols to provide k output symbols for each b bits of input data.

  11. Astrocytes in multiple sclerosis.

    PubMed

    Ludwin, Samuel K; Rao, Vijayaraghava Ts; Moore, Craig S; Antel, Jack P

    2016-08-01

    Recent experimental and clinical studies on astrocytes are unraveling the capabilities of these multi-functional cells in normal homeostasis, and in central nervous system (CNS) disease. This review focuses on understanding their behavior in all aspects of the initiation, evolution, and resolution of the multiple sclerosis (MS) lesion. Astrocytes display remarkable flexibility and variability of their physical structure and biochemical output, each aspect finely tuned to the specific stage and location of the disease, participating in both pathogenic and beneficial changes seen in acute and progressive forms. As examples, chemo-attractive or repulsive molecules may facilitate the entry of destructive immune cells but may also aid in the recruitment of oligodendrocyte precursors, essential for repair. Pro-inflammatory cytokines may attack pathogenic cells and also destroy normal oligodendrocytes, myelin, and axons. Protective trophic factors may also open the blood-brain barrier and modulate the extracellular matrix to favor recruitment and persistence of CNS-specific immune cells. A chronic glial scar may confer structural support following tissue loss and inhibit ingress of further noxious insults and also inhibit migration of reparative cells and molecules into the damaged tissue. Continual study into these processes offers the therapeutic opportunities to enhance the beneficial capabilities of these cells while limiting their destructive effects. PMID:27207458

  12. Viruses and multiple sclerosis.

    PubMed

    Owens, Gregory P; Gilden, Don; Burgoon, Mark P; Yu, Xiaoli; Bennett, Jeffrey L

    2011-12-01

    Multiple sclerosis (MS) is a chronic demyelinating disorder of unknown etiology, possibly caused by a virus or virus-triggered immunopathology. The virus might reactivate after years of latency and lyse oligodendrocytes, as in progressive multifocal leukoencephalopathy, or initiate immunopathological demyelination, as in animals infected with Theiler's murine encephalomyelitis virus or coronaviruses. The argument for a viral cause of MS is supported by epidemiological analyses and studies of MS in identical twins, indicating that disease is acquired. However, the most important evidence is the presence of bands of oligoclonal IgG (OCBs) in MS brain and CSF that persist throughout the lifetime of the patient. OCBs are found almost exclusively in infectious CNS disorders, and antigenic targets of OCBs represent the agent that causes disease. Here, the authors review past attempts to identify an infectious agent in MS brain cells and discuss the promise of using recombinant antibodies generated from clonally expanded plasma cells in brain and CSF to identify disease-relevant antigens. They show how this strategy has been used successfully to analyze antigen specificity in subacute sclerosing panencephalitis, a chronic encephalitis caused by measles virus, and in neuromyelitis optica, a chronic autoimmune demyelinating disease produced by antibodies directed against the aquaporin-4 water channel. PMID:22130640

  13. Multiple cystic lung disease.

    PubMed

    Ferreira Francisco, Flavia Angélica; Soares Souza, Arthur; Zanetti, Gláucia; Marchiori, Edson

    2015-12-01

    Multiple cystic lung disease represents a diverse group of uncommon disorders that can present a diagnostic challenge due to the increasing number of diseases associated with this presentation. High-resolution computed tomography of the chest helps to define the morphological aspects and distribution of lung cysts, as well as associated findings. The combination of appearance upon imaging and clinical features, together with extrapulmonary manifestations, when present, permits confident and accurate diagnosis of the majority of these diseases without recourse to open-lung biopsy. The main diseases in this group that are discussed in this review are lymphangioleiomyomatosis, pulmonary Langerhans cell histiocytosis and folliculin gene-associated syndrome (Birt-Hogg-Dubé); other rare causes of cystic lung disease, including cystic metastasis of sarcoma, are also discussed. Disease progression is unpredictable, and understanding of the complications of cystic lung disease and their appearance during evolution of the disease are essential for management. Correlation of disease evolution and clinical context with chest imaging findings provides important clues for defining the underlying nature of cystic lung disease, and guides diagnostic evaluation and management. PMID:26621970

  14. [Congenital multiple arthrogryposis].

    PubMed

    Parsch, Klaus; Pietrzak, Szymon

    2007-03-01

    From 1975 to 2004 a total of 38 children handicapped by congenital multiple arthrogryposis were cared for. The congenital joint contractures demand a major effort in terms of surgical reconstruction. In the case of distal arthrogryposis the chances that patients will be able to walk without help are good, while those with amyoplasia are likely to be dependent on mobility aids throughout their lives. The ultimate goal of treatment for patients is to develop into self-confident adults who can cope with life despite their handicaps. The hip in arthrogryposis shows variable forms of pathology, ranging from the almost normal hip to hip contractures with dislocation. Its treatment has some limited advantages, but hardly improves mobility. The knee contractures are actively treated to allow patients to sit, stand and walk better. The club foot and the rocker-bottom foot need sophisticated conservative and operative treatments. If conservative manipulation of bilateral extension contractures of the elbow fails operative treatment is carried out on the dominant side. For shoulder, hand and finger contractures conservative manipulation brings about little improvement, and surgical approaches help hardly at all. PMID:17323063

  15. Multiple stage railgun

    DOEpatents

    Hawke, Ronald S.; Scudder, Jonathan K.; Aaland, Kristian

    1982-01-01

    A multiple stage magnetic railgun accelerator (10) for accelerating a projectile (15) by movement of a plasma arc (13) along the rails (11,12). The railgun (10) is divided into a plurality of successive rail stages (10a-n) which are sequentially energized by separate energy sources (14a-n) as the projectile (15) moves through the bore (17) of the railgun (10). Propagation of energy from an energized rail stage back towards the breech end (29) of the railgun (10) can be prevented by connection of the energy sources (14a-n) to the rails (11,12) through isolation diodes (34a-n). Propagation of energy from an energized rail stage back towards the breech end of the railgun can also be prevented by dividing the rails (11,12) into electrically isolated rail sections (11a-n, 12a-n). In such case means (55a-n) are used to extinguish the arc at the end of each energized stage and a fuse (31) or laser device (61) is used to initiate a new plasma arc in the next energized rail stage.

  16. Thermoregulation in multiple sclerosis

    PubMed Central

    Wilson, Thad E.; White, Andrea T.; Frohman, Elliot M.

    2010-01-01

    Multiple sclerosis (MS) is a progressive neurological disorder that disrupts axonal myelin in the central nervous system. Demyelination produces alterations in saltatory conduction, slowed conduction velocity, and a predisposition to conduction block. An estimated 60–80% of MS patients experience temporary worsening of clinical signs and neurological symptoms with heat exposure. Additionally, MS may produce impaired neural control of autonomic and endocrine functions. This review focuses on five main themes regarding the current understanding of thermoregulatory dysfunction in MS: 1) heat sensitivity; 2) central regulation of body temperature; 3) thermoregulatory effector responses; 4) heat-induced fatigue; and 5) countermeasures to improve or maintain function during thermal stress. Heat sensitivity in MS is related to the detrimental effects of increased temperature on action potential propagation in demyelinated axons, resulting in conduction slowing and/or block, which can be quantitatively characterized using precise measurements of ocular movements. MS lesions can also occur in areas of the brain responsible for the control and regulation of body temperature and thermoregulatory effector responses, resulting in impaired neural control of sudomotor pathways or neural-induced changes in eccrine sweat glands, as evidenced by observations of reduced sweating responses in MS patients. Fatigue during thermal stress is common in MS and results in decreased motor function and increased symptomatology likely due to impairments in central conduction. Although not comprehensive, some evidence exists concerning treatments (cooling, precooling, and pharmacological) for the MS patient to preserve function and decrease symptom worsening during heat stress. PMID:20671034

  17. Neuroimaging in multiple sclerosis.

    PubMed

    Zivadinov, Robert; Cox, Jennifer L

    2007-01-01

    Conventional magnetic resonance imaging (MRI) has routinely been used to improve the accuracy of multiple sclerosis (MS) diagnosis and prognosis. Metrics derived from conventional MRI are now routinely used to detect therapeutic effects and extend clinical observations. However, conventional MRI measures, such as the use of lesion volume and count of gadolinium-enhancing and T2 lesions, have insufficient sensitivity and specificity to reveal the true degree of pathological changes occurring in MS. They cannot distinguish between inflammation, edema, demyelination, Wallerian degeneration, and axonal loss. In addition, they do not show a reliable correlation with clinical measures of disability and do not provide a complete assessment of therapeutic outcomes. Recent neuropathologic studies of typical chronic MS brains reveal macroscopic demyelination in cortical and deep gray matter (GM) that cannot be detected by currently available MRI techniques. Therefore, there is a pressing need for the development of newer MRI techniques to detect these lesions. Newer metrics of MRI analysis, including T1-weighted hypointense lesions, central nervous system atrophy measures, magnetization transfer imaging, magnetic resonance spectroscopy, and diffusion tensor imaging, are able to capture a more global picture of the range of tissue alterations caused by inflammation and neurodegeneration. At this time, they provide the only proof--albeit indirect--that important occult pathology is occurring in the GM. However, evidence is increasing that these nonconventional MRI measures correlate better with both existing and developing neurological impairment and disability when compared to conventional metrics. PMID:17531854

  18. Progressive multiple sclerosis

    PubMed Central

    Ontaneda, Daniel; Fox, Robert J.

    2015-01-01

    Purpose to Review To highlight the pathological features and clinical aspects of progressive multiple sclerosis (PMS). To highlight results of clinical trial experience to date and review ongoing clinical trials and perspective new treatment options. Explain the challenges of clinical trial design in PMS. Recent Findings MS has been identified as a chronic immune mediated disease, and the progressive phase of the disease appears to have significant neurodegenerative mechanisms. The classification of the course of PMS has been re-organized into categories of active vs. inactive inflammatory disease and the presence vs. absence of gradual disease progression. This differentiation allows clearer conceptualization of PMS and possibly even more efficient recruitment of PMS subjects into clinical trials. Clinical trial experience to date in PMS has been negative with anti-inflammatory medications used in relapsing MS. Simvastatin was recently tested in a phase II trial and showed a 43% reduction on annualized atrophy progression in secondary progressive MS. Ongoing PMS trials are currently being conducted with the phosphodiesterase inhibitor ibudilast, S1P modulator siponimod, and anti-B-cell therapy ocrelizumab. Several efforts for development of outcome measures in PMS are ongoing. Summary PMS represents a significant challenge, as the pathogenesis of the disease is not well understood, no validated outcome metrics have been established, and clinical trial experience to date has been disappointing. Advances in the understanding of the disease and lessons learned in previous clinical trials are paving the way for successful development of disease modifying agents for this disease. PMID:25887766

  19. Immunopathogenesis of multiple sclerosis.

    PubMed

    Racke, Michael K

    2009-10-01

    Multiple sclerosis (MS) is a suspected autoimmune disease in which myelin-specific CD4+ and CD8+ T cells enter the central nervous system (CNS) and initiate an inflammatory response directed against myelin and other components of the CNS. Acute MS exacerbations are believed be the result of active inflammation, and progression of disability is generally believed to reflect accumulation of damage to the CNS, particularly axonal damage. Over the last several years, the pathophysiology of MS is being appreciated to be much more complex, and it appears that the development of the MS plaque involves a large number of cell populations, including CD8+ T lymphocytes, B cells, and Th17 cells (a population of helper T cells that secrete the inflammatory cytokine IL-17). The axonal transection and degeneration that is thought to represent the basis for progressive MS is now recognized to begin early in the disease process and to continue in the progressive forms of the disease. Molecules important for limiting aberrant neural connections in the CNS have been identified, which suppress axonal sprouting and regeneration of transected axons within the CNS. Pathways have also been identified that prevent remyelination of the MS lesion by oligodendrocyte precursors. Novel neuroimaging methodologies and potential biomarkers are being developed to monitor various aspects of the disease process in MS. As we identify the pathways responsible for the clinical phenomena of MS, we will be able to develop new therapeutic strategies for this disabling illness of young adults. PMID:20182567

  20. [Pathophysiology of multiple sclerosis].

    PubMed

    Smith, Kenneth J

    2006-06-30

    Patients with multiple sclerosis (MS) can exhibit an exceptionally wide variety of symptoms. This is largely due to the semi-random distribution of the lesions in the central nervous system (CNS). Most lesions occur in apparently "silent" areas in the brain, and so cause no detectable symptoms. The disease is therefore much more active than a mere clinical monitoring would suggest. Most symptoms are related to a loss of function. During the relapses, this is due to a failure of axonal conduction at the site of the lesion(s). The conduction block is caused by the local demyelination which prevents the saltatory conduction but also seemingly, to some extend, by the inflammation per se. Remissions are related to a recovery of function of the affected axons owing to a spreading of sodium channels along the demyelinated axolemma but also to cerebral functional plasticity and remyelination. However, nerve conduction remains slower and less secure than normal, easily altered by physico-chemical changes such as the increase in body temperature (Uhthoff's phenomenon). Remission is incomplete when the lesion has led to axonal transaction and therefore axonal loss. Progression in MS is mainly related to "slow-burning" diffuse and chronic axonal loss in a toxic inflammatory milieu. Lastly, some symptoms in MS are so-called "positive" arising from an acquired hyperexcitability of demyelinated axons and occur either spontaneously (e.g. paresthesias) or mechanically (e.g. Lhermitte's sign). PMID:16948217

  1. MULTIPLE SHAFT TOOL HEAD

    DOEpatents

    Colbert, H.P.

    1962-10-23

    An improved tool head arrangement is designed for the automatic expanding of a plurality of ferruled tubes simultaneously. A plurality of output shafts of a multiple spindle drill head are driven in unison by a hydraulic motor. A plurality of tube expanders are respectively coupled to the shafts through individual power train arrangements. The axial or thrust force required for the rolling operation is provided by a double acting hydraulic cylinder having a hollow through shaft with the shaft cooperating with an internally rotatable splined shaft slidably coupled to a coupling rigidly attached to the respectlve output shaft of the drill head, thereby transmitting rotary motion and axial thrust simultaneously to the tube expander. A hydraulic power unit supplies power to each of the double acting cylinders through respective two-position, four-way valves, under control of respective solenoids for each of the cylinders. The solenoids are in turn selectively controlled by a tool selection control unit which in turn is controlled by signals received from a programmed, coded tape from a tape reader. The number of expanders that are extended in a rolling operation, which may be up to 42 expanders, is determined by a predetermined program of operations depending upon the arrangement of the ferruled tubes to be expanded in the tube bundle. The tape reader also supplies dimensional information to a machine tool servo control unit for imparting selected, horizontal and/or vertical movement to the tool head assembly. (AEC)

  2. Thermoregulation in multiple sclerosis.

    PubMed

    Davis, Scott L; Wilson, Thad E; White, Andrea T; Frohman, Elliot M

    2010-11-01

    Multiple sclerosis (MS) is a progressive neurological disorder that disrupts axonal myelin in the central nervous system. Demyelination produces alterations in saltatory conduction, slowed conduction velocity, and a predisposition to conduction block. An estimated 60-80% of MS patients experience temporary worsening of clinical signs and neurological symptoms with heat exposure. Additionally, MS may produce impaired neural control of autonomic and endocrine functions. This review focuses on five main themes regarding the current understanding of thermoregulatory dysfunction in MS: 1) heat sensitivity; 2) central regulation of body temperature; 3) thermoregulatory effector responses; 4) heat-induced fatigue; and 5) countermeasures to improve or maintain function during thermal stress. Heat sensitivity in MS is related to the detrimental effects of increased temperature on action potential propagation in demyelinated axons, resulting in conduction slowing and/or block, which can be quantitatively characterized using precise measurements of ocular movements. MS lesions can also occur in areas of the brain responsible for the control and regulation of body temperature and thermoregulatory effector responses, resulting in impaired neural control of sudomotor pathways or neural-induced changes in eccrine sweat glands, as evidenced by observations of reduced sweating responses in MS patients. Fatigue during thermal stress is common in MS and results in decreased motor function and increased symptomatology likely due to impairments in central conduction. Although not comprehensive, some evidence exists concerning treatments (cooling, precooling, and pharmacological) for the MS patient to preserve function and decrease symptom worsening during heat stress. PMID:20671034

  3. Injectable Multiple Sclerosis Medications

    PubMed Central

    Tran, Zung Vu

    2012-01-01

    Although injection-site reactions (ISRs) occur with US Food and Drug Administration–approved injectable disease-modifying therapies (DMTs) for multiple sclerosis, there are currently few reports of real-world data on ISR management strategies or possible correlations between ISRs and patient demographics, disease characteristics, and missed injections. Patient-reported data on the use of DMTs, patient demographic and disease characteristics, missed injections, and ISR reduction strategies were collected via e-mail, a patient registry (www.ms-cam.org), and a Web-based survey. Of the 1380 respondents, 1201 (87%) indicated that they had used injectable DMTs, of whom 377 (31%) had used intramuscular (IM) interferon beta-1a (IFNβ-1a), 172 (14%) had used subcutaneous (SC) IFNβ-1a, 183 (15%) had used SC IFNβ-1b, and 469 (39%) had used glatiramer acetate (GA). The majority of respondents were older (73% were ≥40 years), female (79%), married or living with a partner (72%), white (94%), and nonsmoking (82%). Injection-site reaction incidence, grouped according to severity, varied among DMTs, with IM IFNβ-1a causing significantly (P < .001) fewer mild, moderate, or severe ISRs than the other therapies. Female sex and younger age were significantly (P < .05) associated with more moderate ISRs among users of IM IFNβ-1a, SC IFNβ-1b, and GA. Nonwhites reported severe ISRs more often than whites. For all DMTs injection-site massage and avoidance of sensitive sites were the most frequently used strategies to minimize ISRs. These data may help identify patients with characteristics associated with a higher risk for ISRs, allowing health-care professionals to provide anticipatory guidance to patients at risk for decreased adherence or discontinuation. PMID:24453732

  4. [Multiple system atrophy].

    PubMed

    Damon-Perrière, Nathalie; Tison, François; Meissner, Wassilios G

    2010-09-01

    Multiple system atrophy (MSA) is a sporadic neurodegenerative disorder of unknown etiology. It is the most frequent disorder among atypical parkinsonism with an estimated prevalence of 2 to 5 per 100 000 inhabitants. The clinical symptoms are rapidly progressing with a mean survival ranging between 6 to 9 years. The diagnosis is based on consensus criteria that have been revised in 2008. The diagnostic criteria allow defining "possible", "probable" and "definite" MSA. The latter requires post mortem confirmation of striatonigral and olivopontocerebellar degeneration with alpha-synuclein containing glial cytoplasmic inclusions. The diagnosis of "possible" and "probable" MSA is based on the variable presence and severity of parkinsonism, cerebellar dysfunction, autonomic failure and pyramidal signs. According to the revised criteria, atrophy of putamen, pons, middle cerebellar peduncle (MCP) or cerebellum on brain magnetic resonance imaging are considered to be additional features for the diagnosis of "possible" MSA. T2-weighted brain imaging may further reveal a putaminal hypointensity, a hyperintense lateral putaminal rim, the so called "hot cross bun sign" and MCP hyperintensities. Cardiovascular examination, urodynamic testing and anal sphincter electromyography may be helpful for the diagnosis of autonomic failure. Some patients may respond to levodopa, but usually to a lesser extent than those suffering from Parkinson's disease, and high doses are already required in early disease stages. No specific therapy is available for cerebellar dysfunction, while effective treatments exist for urinary and cardiovascular autonomic failure. Physical therapy may help to improve the difficulties of gait and stance, and to prevent their complications. In later disease stages, speech therapy becomes necessary for the treatment of dysarthria and dysphagia. Percutaneous gastrostomy is sometimes necessary in patients with severe dysphagia. Beyond these strategies, psychological

  5. Multiple-image radiography

    NASA Astrophysics Data System (ADS)

    Wernick, Miles N.; Wirjadi, Oliver; Chapman, Dean; Zhong, Zhong; Galatsanos, Nikolas P.; Yang, Yongyi; Brankov, Jovan G.; Oltulu, Oral; Anastasio, Mark A.; Muehleman, Carol

    2003-12-01

    Conventional radiography produces a single image of an object by measuring the attenuation of an x-ray beam passing through it. When imaging weakly absorbing tissues, x-ray attenuation may be a suboptimal signature of disease-related information. In this paper we describe a new phase-sensitive imaging method, called multiple-image radiography (MIR), which is an improvement on a prior technique called diffraction-enhanced imaging (DEI). This paper elaborates on our initial presentation of the idea in Wernick et al (2002 Proc. Int. Symp. Biomed. Imaging pp 129-32). MIR simultaneously produces several images from a set of measurements made with a single x-ray beam. Specifically, MIR yields three images depicting separately the effects of refraction, ultra-small-angle scatter and attenuation by the object. All three images have good contrast, in part because they are virtually immune from degradation due to scatter at higher angles. MIR also yields a very comprehensive object description, consisting of the angular intensity spectrum of a transmitted x-ray beam at every image pixel, within a narrow angular range. Our experiments are based on data acquired using a synchrotron light source; however, in preparation for more practical implementations using conventional x-ray sources, we develop and evaluate algorithms designed for Poisson noise, which is characteristic of photon-limited imaging. The results suggest that MIR is capable of operating at low photon count levels, therefore the method shows promise for use with conventional x-ray sources. The results also show that, in addition to producing new types of object descriptions, MIR produces substantially more accurate images than its predecessor, DEI. MIR results are shown in the form of planar images of a phantom and a biological specimen. A preliminary demonstration of the use of MIR for computed tomography is also presented.

  6. Obesity and multiple myeloma.

    PubMed

    Friedman, G D; Herrinton, L J

    1994-09-01

    An exploratory study was conducted of common clinical conditions as predictors of subsequent cancer in 143,574 outpatients of a health maintenance organization (in California, USA). An association was noted between obesity, diagnosed in 14,388 patients, and the subsequent development of multiple myeloma (MM) in up to 21 years (33 cases observed, 21.3 expected based on the experience of the entire cohort; standardized morbidity ratio = 1.55, 95 percent confidence interval [CI] = 1.06-2.17). This association was evaluated further in a second cohort of 163,561 multiphasic-checkup examinees followed up for as many as 24 years. Body mass index (BMI) at entry examination was associated positively with the incidence of MM in White men (e.g., relative risk [RR] = 1.07, CI = 1.01-1.15 per unit increase in BMI; and RR = 1.68, CI = 0.75-3.78, comparing the highest with lowest quartile). This association was absent in White women, partially confirmed in Black men and women (BMI quartiles two, three, and four showed higher risk than quartile one), and not explained by the presence of diabetes mellitus. The association was reduced or absent with BMI based on reported greatest adult-weight, and in White women was inverse with BMI based on reported lowest adult-weight. Among subjects with more than one checkup, increased risk was associated directly with weight loss among White men and associated inversely with weight gain among Black women. These findings suggest that body build or nutritional status may be involved in the development of MM by mechanisms that are presently unknown.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7999970

  7. Swamp Works- Multiple Projects

    NASA Technical Reports Server (NTRS)

    Carelli, Jonathan M.

    2013-01-01

    My Surface Systems internship over the summer 2013 session covered a broad range of projects that ranged multiple aspects and fields of engineering and technology. This internship included a project to create a command center for a 120 ton regolith bin, a design and build for a blast shield to add further protection for the Surface Systems engineers, a design for a portable four monitor hyper wall that can extend as large as needed, research and programming a nano drill for a next generation robot, and social media tasks including the making of videos, posting to social networking websites and implementation of a new weekly outreach program to help spread the word about the Swamp Works laboratory. The objectives for the command center were to create a central computer controlled area for the still in production lunar regolith bin. It needed to be easy to use and the operating systems had to be Linux. The objectives for the hyper wall were to build a mobile transport of monitors that could potentially attach to one another. It needed to be light but sturdy, and have the ability to last. The objectives for the blast shield included a robust design that could withstand a small equipment malfunction, while also being convenient for use. The objectives for the nano-drill included the research and implementation of programming for vertical and horizontal movement. The hyper wall and blasts shield project were designed by me in the Pro/Engineer/Creo2 software. Each project required a meeting with the Swamp Works engineers and was declared successful.

  8. Zinc in Multiple Sclerosis

    PubMed Central

    Frederiksen, Jette Lautrup

    2016-01-01

    In the last 35 years, zinc (Zn) has been examined for its potential role in the disease multiple sclerosis (MS). This review gives an overview of the possible role of Zn in the pathogenesis of MS as well as a meta-analysis of studies having measured Zn in serum or plasma in patients with MS. Searching the databases PubMed and EMBASE as well as going through reference lists in included articles 24 studies were found measuring Zn in patients with MS. Of these, 13 met inclusion criteria and were included in the meta-analysis. The result of the meta-analysis shows a reduction in serum or plasma Zn levels in patients with MS with a 95% CI of [−3.66, −0.93] and a p value of .001 for the difference in Zn concentration in μM. One of six studies measuring cerebrospinal fluid, Zn levels found a significant increase in patients with MS with controls. The studies measuring whole blood and erythrocyte Zn levels found up to several times higher levels of Zn in patients with MS compared with healthy controls with decreasing levels during attacks in relapsing-remitting MS patients. Future studies measuring serum or plasma Zn are encouraged to analyze their data through homogenous MS patient subgroups on especially age, sex, and disease subtype since the difference in serum or plasma Zn in these subgroups have been found to be significantly different. It is hypothesized that local alterations of Zn may be actively involved in the pathogenesis of MS. PMID:27282383

  9. Multiplicative Thinking: Much More than Knowing Multiplication Facts and Procedures

    ERIC Educational Resources Information Center

    Hurst, Chris; Hurrell, Derek

    2016-01-01

    Multiplicative thinking is accepted as a "big idea" of mathematics that underpins important mathematical concepts such as fraction understanding, proportional reasoning, and algebraic thinking. It is characterised by understandings such as the multiplicative relationship between places in the number system, basic and extended number…

  10. Multiple star formation

    NASA Astrophysics Data System (ADS)

    Kraus, Adam L.

    2010-11-01

    In this thesis, I present a study of the formation and evolution of stars, particularly multiple stellar systems. Binary stars provide a key constraint on star formation because any successful model should reproduce the mass-dependent frequency, distribution of separations, and distribution of mass ratios. I have pursued a number of surveys for different ranges of parameter space, all yielding one overarching conclusion: binary formation is fundamentally tied to mass. Solar-mass stars have a high primordial binary frequency (50%--75%) and a wide range of separations (extending to >10,000 AU), but as the system mass decreases, the frequency and separation distribution also decrease. For brown dwarfs, binaries are rare (~10%--15%) and have separations of <5 AU. Inside of this outer separation cutoff, the separation distribution appears to be log-flat for solar-mass stars, and perhaps for lower-mass systems. Solar-mass binary systems appear to have a flat mass ratio distribution, but for primary masses <0.3 Msun, the distribution becomes increasingly biased toward similar-mass companions. My results also constrain the binary formation timescale and the postformation evolutionary processes that sculpt binary populations. The dynamical interaction timescale in sparse associations like Taurus and Upper Sco is far longer than their ages, which suggests that those populations are dynamically pristine. However, binary systems in denser clusters undergo significant dynamical processing that strips outer binary companions; the difference in wide binary properties between my sample and the field is explained by the composite origin of the field population. I also have placed the individual components of young binary systems on the HR diagram in order to infer their coevality. In Taurus, binary systems are significantly more coeval (Δτ~0.5 Myr) than the association as a whole (Δτ~3--5 Myr). Finally, my survey of young very-low-mass stars and brown dwarfs found no planetary

  11. Multiple sclerosis and Natalizumab.

    PubMed

    Fiore, Domenico

    2007-01-01

    Natalizumab (NTZ), defined as "the first of a new class of drugs known as elective adhesion molecule inhibitors" was developed at the beginning of 2003 to treat relapsing-remitting multiple sclerosis (MS) and was approved in the United States in November 2004. In February 2005, the production of NTZ was suspended by Producer Firms on account of the occurrence of two serious adverse events: two patients who had been taking NTZ manifested a progressive multifocal leukoencephalopathy; the patients showed progressive neurologic deterioration, initially believed to be a worsening of the pre-existing condition of MS. In March 2006, the Advisory Panel of the Food and Drug Administration voted unanimously in favor of the return of NTZ on the market with the majority of the panel also recommending that NTZ be considered the first choice of treatment in MS. NTZ should only be administered to patients who are not taking other medicines for MS and only in highly specialized centers. Inhibiting the adhesion of the circulating immune-competent cells to the vascular endothelium and reducing the precipitation of the circulating immune complexes (CICs) into the central nervous system, NTZ causes the level of the CICs to rise to values that inhibit the production of the antibodies (above all of the immunoglobulin Ms); because of the relative lack of antibodies, the pertussis toxins, no longer complexed, attack the nerve epithelia directly. We must conclude that 1) in remittent MS, between one attack and another (successive re-infection of bordetella pertussis) there are no CICs that can precipitate into the central nervous system, and thus the treatment with NTZ is useless and superfluous; 2) in chronic-progressive MS, the final result of the treatment with NTZ will be that of transforming MS into lateral amyotrophic sclerosis or progressive multifocal leukoencephalopathy; 3) in progressive MS, however, NTZ can be of considerable use in the first 2 months of antibiotic treatment to

  12. Can Multiple Myeloma Be Found Early?

    MedlinePlus

    ... Topic Signs and symptoms of multiple myeloma Can multiple myeloma be found early? It’s difficult to diagnose multiple myeloma early. Often, multiple myeloma causes no symptoms until it reaches an ...

  13. Multiplication Fact Fluency Using Doubles

    ERIC Educational Resources Information Center

    Flowers, Judith M.; Rubenstein, Rheta N.

    2010-01-01

    Not knowing multiplication facts creates a gap in a student's mathematics development and undermines confidence and disposition toward further mathematical learning. Learning multiplication facts is a first step in proportional reasoning, "the capstone of elementary arithmetic and the gateway to higher mathematics" (NRC 2001, p. 242). Proportional…

  14. Multiple Intelligences for Differentiated Learning

    ERIC Educational Resources Information Center

    Williams, R. Bruce

    2007-01-01

    There is an intricate literacy to Gardner's multiple intelligences theory that unlocks key entry points for differentiated learning. Using a well-articulated framework, rich with graphic representations, Williams provides a comprehensive discussion of multiple intelligences. He moves the teacher and students from curiosity, to confidence, to…

  15. The problem with multiple robots

    NASA Technical Reports Server (NTRS)

    Huber, Marcus J.; Kenny, Patrick G.

    1994-01-01

    The issues that can arise in research associated with multiple, robotic agents are discussed. Two particular multi-robot projects are presented as examples. This paper was written in the hope that it might ease the transition from single to multiple robot research.

  16. Symptomatic therapy in multiple sclerosis

    PubMed Central

    Frohman, Teresa C.; Castro, Wanda; Shah, Anjali; Courtney, Ardith; Ortstadt, Jeffrey; Davis, Scott L.; Logan, Diana; Abraham, Thomas; Abraham, Jaspreet; Remington, Gina; Treadaway, Katherine; Graves, Donna; Hart, John; Stuve, Olaf; Lemack, Gary; Greenberg, Benjamin; Frohman, Elliot M.

    2011-01-01

    Multiple sclerosis is the most common disabling neurological disease of young adults. The ability to impact the quality of life of patients with multiple sclerosis should not only incorporate therapies that are disease modifying, but should also include a course of action for the global multidisciplinary management focused on quality of life and functional capabilities. PMID:21694806

  17. Parameters of Multiple College Attendance.

    ERIC Educational Resources Information Center

    Dillon, Paul H.

    This is a report analyzing the multiple community college attendance patterns of students from nine colleges in the Los Angeles Community College District (California) from 1990-2000. The assessment utilizes the Multiple College Index (MCI), which is a measure based on the proportion of units a student earns at different colleges. The study…

  18. Bent Bonds and Multiple Bonds.

    ERIC Educational Resources Information Center

    Robinson, Edward A.; Gillespie, Ronald J.

    1980-01-01

    Considers carbon-carbon multiple bonds in terms of Pauling's bent bond model, which allows direct calculation of double and triple bonds from the length of a CC single bond. Lengths of these multiple bonds are estimated from direct measurements on "bent-bond" models constructed of plastic tubing and standard kits. (CS)

  19. Adult Multiple Intelligences and Math.

    ERIC Educational Resources Information Center

    Costanzo, Meg Ryback

    In the Adult Multiple Intelligences (AMI) study, 10 teachers of adults from the northeastern region of the United States explored for 18 months the ways that multiple intelligences (MI) theory could support instruction and assessment in various adult learning contexts. The results of this research were published in a book by Julie Viens called MI…

  20. Multiple Intelligences Centers and Projects.

    ERIC Educational Resources Information Center

    Chapman, Carolyn; Freeman, Lynn

    Based upon Gardner's theory of multiple intelligences, this book guides elementary school teachers through the process of using classroom learning centers and projects by providing choices for students. The guide is divided into two sections, providing the theoretical background and information on how to develop multiple intelligences learning…