Science.gov

Sample records for multiple immediate-early gene-deleted

  1. Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector

    SciTech Connect

    Watanabe, Daisuke; Brockman, Mark A.; Ndung'u, Thumbi; Mathews, Lydia; Lucas, William T.; Murphy, Cynthia G.; Felber, Barbara K.; Pavlakis, George N.; Deluca, Neal A.; Knipe, David M. . E-mail: david_knipe@hms.harvard.edu

    2007-01-20

    Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV gene products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli {beta}-galactosidase induced durable {beta}-gal-specific IgG and CD8{sup +} T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes.

  2. Efficient and simple generation of multiple unmarked gene deletions in Mycobacterium smegmatis

    PubMed Central

    Mao, Xu-Jian; Yan, Mei-Yi; Zhu, Hui; Guo, Xiao-Peng; Sun, Yi-Cheng

    2016-01-01

    Research on mycobacterial genetics relies heavily on techniques for directed gene mutation, but genetic studies are often hampered by the difficulty of generating gene deletions in mycobacteria. We developed an efficient and improved deletion system, described here in detail, which can be used to construct multiple unmarked recombinants in mycobacteria. We tested this system by using it to sequentially delete four pairs of toxin-antitoxin genes in Mycobacterium smegmatis. PMID:26972108

  3. Construction and application of an efficient multiple-gene-deletion system in Corynebacterium glutamicum.

    PubMed

    Hu, Jinyu; Tan, Yanzhen; Li, Yanyan; Hu, Xiaoqing; Xu, Daqing; Wang, Xiaoyuan

    2013-11-01

    Gene deletion techniques are important for modifying Corynebacterium glutamicum, the bacterium for industrial production of amino acids. In this study, a novel multiple-gene-deletion system for C. glutamicum was developed. The system is composed of three plasmids pDTW109, pDTW201 and pDTW202. pDTW109 is a temperature-sensitive vector which harbors a cat gene under the tacM promoter, a cre gene under the tac promoter, an origin oriE for replicating in Escherichia coli, and another origin rep(TS) for replicating in C. glutamicum only at low temperatures; it has high transformation efficiency in C. glutamicum and can be easily eliminated by growing at 37°C. pDTW201 and pDTW202 carry loxp-flanked or mutant lox-flanked kan, respectively. This deletion system combines homologous recombination and Cre/lox site-specific recombination, could efficiently delete the aceE gene from the chromosome of C. glutamicum ATCC13032, ATCC13869 or ATCC14067, respectively, and could also delete both genes of aceE and ilvA from the chromosome of C. glutamicum ATCC14067. The system is simple and efficient, and can be easily implemented for multiple-gene-deletion in C. glutamicum. PMID:23856168

  4. Assessment of the toxicity of CuO nanoparticles by using Saccharomyces cerevisiae mutants with multiple genes deleted.

    PubMed

    Bao, Shaopan; Lu, Qicong; Fang, Tao; Dai, Heping; Zhang, Chao

    2015-12-01

    To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

  5. Assessment of the Toxicity of CuO Nanoparticles by Using Saccharomyces cerevisiae Mutants with Multiple Genes Deleted

    PubMed Central

    Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao

    2015-01-01

    To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067

  6. The green monster process for the generation of yeast strains carrying multiple gene deletions.

    PubMed

    Suzuki, Yo; Stam, Jason; Novotny, Mark; Yachie, Nozomu; Lasken, Roger S; Roth, Frederick P

    2012-01-01

    Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition(1,2). There are examples where many genes need to be deleted to unmask hidden gene functions(3,4). Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative. In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker(5,6,7,8,9,10). However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated. Here we describe the Green Monster method for routinely engineering multiple deletions in yeast(11). In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction. The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci-either Green Monster GMToolkit-a or GMToolkit

  7. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

    PubMed Central

    Suzuki, Yo; Stam, Jason; Novotny, Mark; Yachie, Nozomu; Lasken, Roger S.; Roth, Frederick P.

    2012-01-01

    Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative. In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated. Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction. The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci—either Green Monster GMToolkit-a or GMToolkit-α at the

  8. Zinc transporter 3 (ZnT3) gene deletion reduces spinal cord white matter damage and motor deficits in a murine MOG-induced multiple sclerosis model.

    PubMed

    Choi, Bo Young; Kim, In Yeol; Kim, Jin Hee; Kho, A Ra; Lee, Song Hee; Lee, Bo Eun; Sohn, Min; Koh, Jae-Young; Suh, Sang Won

    2016-10-01

    The present study aimed to evaluate the role of zinc transporter 3 (ZnT3) on multiple sclerosis (MS) pathogenesis. Experimental autoimmune encephalomyelitis (EAE), a disease model of multiple sclerosis, was induced by immunization with myelin oligodendrocyte glycoprotein (MOG35-55) in female mice. Three weeks after the initial immunization, demyelination, immune cell infiltration and blood brain barrier (BBB) disruption in the spinal cord were analyzed. Clinical signs of EAE first appeared on day 11 and reached a peak level on day 19 after the initial immunization. ZnT3 gene deletion profoundly reduced the daily clinical score of EAE. The ZnT3 gene deletion-mediated inhibition of the clinical course of EAE was accompanied by suppression of inflammation and demyelination in the spinal cord. The motor deficit accompanying neuropathological changes associated with EAE were mild in ZnT3 gene deletion mice. This reduction in motor deficit was accompanied by coincident reductions in demyelination and infiltration of encephalitogenic immune cells including CD4+ T cells, CD8+ T cells, CD20+ B cells and F4/80+ microglia in the spinal cord. These results demonstrate that ZnT3 gene deletion inhibits the clinical features and neuropathological changes associated with EAE. ZnT3 gene deletion also remarkably inhibited formation of EAE-associated aberrant synaptic zinc patches, matrix metalloproteinases-9 (MMP-9) activation and BBB disruption. Therefore, amelioration of EAE-induced clinical and neuropathological changes by ZnT3 gene deletion suggests that vesicular zinc may be involved in several steps of MS pathogenesis. PMID:27370228

  9. Analysis of the CYP21A2 gene with intergenic recombination and multiple gene deletions in the RCCX module.

    PubMed

    Chang, Shwu-Fen; Lee, Hsien-Hsiung

    2011-01-01

    The most frequent bimodular RCCX module of the RP1-C4A-CYP21A1P-TNXA-RP2-C4B-CYP21A2-TNXB gene sequence is located on chromosome 6p21.3. To determine RCCX alterations, we used the polymerase chain reaction (PCR) product containing the tenascin B (TNXB) and CYP21A2 genes with TaqI digestion and Southern blot analysis with AseI and NdeI endonuclease digestion of genomic DNA from congenital adrenal hyperplasia patients with common mutations resulting from an intergenic conversion of CYP21A1P, such as an I2 splice, I172N, V281L, F306-L307insT, Q318X, and R356W, and dual mutations of I236N/V237E in the CYP21A2 gene. The results showed that a 3.7-kb fragment of the CYP21A2 gene was detected in each case, and 21.6- and 11.3-kb DNA fragments were found in the RCCX region by a Southern blot analysis with these corresponding mutations. However, the IVS2-12A/C- > G (I2 splice) haplotype in combination with the 707-714delGAGACTAC (without the P30L mutation) mutation produced a 3.2-kb TaqI fragment in the PCR product analysis and a specific 9.3-kb fragment by the Southern blot method. Therefore, we concluded that the rearrangement in the RCCX region resulting from processing of either an intergenic recombination or multiple gene deletions can be identified by the PCR analysis and Southern blot method based on a fragment-distinguishing configuration without a family study. PMID:21117955

  10. Interstitial deletion of 11(p11.2p12): A newly described contiguous gene deletion syndrome involving the gene for hereditary multiple exostoses

    SciTech Connect

    Potocki, L.; Shaffer, L.G.

    1996-03-29

    Individuals with deletions of the proximal portion of the short arm of chromosome 11 share many manifestations including mental retardation, biparietal foramina, minor facial anomalies, and multiple cartilaginous exostoses. The finding of multiple exostoses in these patients is remarkable as the disorder hereditary multiple exostoses, which is inherited in an autosomal dominant manner, has recently been mapped by linkage to three regions, including proximal 11p. We report the clinical and molecular findings in an additional patient with an 11(p11.2p12) deletion. Cytogenetic and molecular analysis demonstrated a de novo, paternally derived deletion for markers which have been shown to be tightly linked to the 11p locus (EXT2). These data support the location of EXT2 within this region and also provide information regarding the ordering of polymorphic markers on 11p. Deletion 11(p11.2p12) is a rare, yet specific, deletion syndrome involving the EXT2 locus, a gene for parietal foramina, and a mental retardation locus, and therefore can be classified as a contiguous gene deletion syndrome. 24 refs., 4 figs., 1 tab.

  11. Serum Leukocyte Immunoglobulin-Like Receptor A3 (LILRA3) Is Increased in Patients with Multiple Sclerosis and Is a Strong Independent Indicator of Disease Severity; 6.7kbp LILRA3 Gene Deletion Is Not Associated with Diseases Susceptibility

    PubMed Central

    An, Hongyan; Lim, Chai; Guillemin, Gilles J.; Vollmer-Conna, Ute; Rawlinson, William; Bryant, Katherine; Tedla, Nicodemus

    2016-01-01

    Leukocyte immunoglobulin-like receptor A3 (LILRA3) is a soluble immune regulatory molecule primarily expressed by monocytes and macrophages. A homozygous 6.7kbp LILRA3 gene deletion that removes the first seven of its eight exons is predicted to lead to lack of LILRA3 protein, although this has not been experimentally confirmed. Moreover, there are conflicting results with regards to the link between the LILRA3 homozygous genetic deletion and susceptibility to multiple sclerosis (MS) in different European populations. The aim of this study was to investigate whether LILRA3 gene deletion is associated with MS susceptibility in a North American cohort of European ancestry and assess if serum LILRA3 protein level is a marker of clinical subtype and/or disease severity in MS. A total of 456 patients with MS and 99 unrelated healthy controls were genotyped for the 6.7kbp LILRA3 gene deletion and levels of LILRA3 protein in sera determined by in-house sandwich ELISA. We showed that LILRA3 gene deletion was not associated with MS susceptibility and did not affect the age of disease onset, clinical subtype or disease severity. However, we discovered for the first time that homozygous LILRA3 gene deletion results in lack of production of LILRA3 protein. Importantly, LILRA3 protein level was significantly increased in sera of patients with MS when compared with control subjects, particularly in more severe type primary progressive MS. Multiple regression analysis showed that LILRA3 level in serum was one of the strongest independent markers of disease severity in MS, which potentially can be used as a diagnostic marker. PMID:26871720

  12. IAP gene deletion and conditional knockout models.

    PubMed

    Silke, John; Vaux, David L

    2015-03-01

    Gene deletion studies have helped reveal the unique and overlapping roles played by IAP proteins. Crossing IAP mutant mice has helped unravel the complex feed-back regulatory circuits in which cIAP1, cIAP2 and XIAP allow innate defensive responses to microbial pathogens, without the development of auto-inflammatory syndromes. Deletion of genes for Survivin and its homologs in yeasts, invertebrates and mammals has shown that it functions differently, as it is not a regulator of innate immunity or apoptosis, but acts together with INCENP, aurora kinase B and Borealin to allow chromosome segregation during mitosis. PMID:25545814

  13. Group II Intron-Anchored Gene Deletion in Clostridium

    PubMed Central

    Jia, Kaizhi; Zhu, Yan; Zhang, Yanping; Li, Yin

    2011-01-01

    Clostridium plays an important role in commercial and medical use, for which targeted gene deletion is difficult. We proposed an intron-anchored gene deletion approach for Clostridium, which combines the advantage of the group II intron “ClosTron” system and homologous recombination. In this approach, an intron carrying a fragment homologous to upstream or downstream of the target site was first inserted into the genome by retrotransposition, followed by homologous recombination, resulting in gene deletion. A functional unknown operon CAC1493–1494 located in the chromosome, and an operon ctfAB located in the megaplasmid of C. acetobutylicum DSM1731 were successfully deleted by using this approach, without leaving antibiotic marker in the genome. We therefore propose this approach can be used for targeted gene deletion in Clostridium. This approach might also be applicable for gene deletion in other bacterial species if group II intron retrotransposition system is established. PMID:21304965

  14. Conditional IL-2 Gene Deletion: Consequences for T Cell Proliferation

    PubMed Central

    Popmihajlov, Zoran; Xu, Dong; Morgan, Heather; Milligan, Zoie; Smith, Kendall A.

    2012-01-01

    To explore the role of interleukin-2 (IL-2) in T cell proliferation, and to circumvent the IL-2 deficiency autoimmune syndrome of conventional il2 gene deletion, mice were created to allow conditional il2 gene deletion when treated with the estrogen analog, tamoxifen (TAM) as adults. Splenocytes from four different mouse strains, C57Bl/6 wild type (WT), conventional IL-2(−/−), TAM-treated Cre recombinase-negative (Cre−)/IL2fl/fl, and Cre recombinase-positive (Cre+)/IL2fl/fl, were activated with anti-CD3 and anti-CD28, and monitored for CD4+ and CD8+ T cell lymphocyte blastogenesis, aerobic glycolysis, BrdU incorporation into newly synthesized DNA, and CFSE dye dilution to monitor cell division. IL-2 production was monitored by quantitative ELISA and multiple additional cytokines were monitored by quantitative protein-bead arrays. Splenocytes from conventional IL-2(−/−) and TAM-treated Cre+ mice resulted in undetectable IL-2 production by ELISA, so that both strains were IL-2-deficient. As monitored by flow cytometry, activated CD4+ and CD8+ T cells from WT, Cre+, and Cre− mice all underwent blastogenesis, whereas far fewer cells from conventional IL-2(−/−) mice did so. By comparison, only cells from IL-2 sufficient WT and Cre− mice switched to aerobic glycolysis as evidenced by a drop in media pH. Blastogenesis was mirrored by BrdU incorporation and CFSE dye dilution by CD4+ and CD8+ T cells from WT, Cre+, and Cre− mice, which were all equivalent, while proliferation of cells from conventional IL-2(−/−) mice was compromised. Splenocytes from IL-2 deficient conventional IL-2(−/−) mice produced low or undetectable other γc-chain cytokines (IL-4, IL-7, IL-9, IL-13, IL-15, and IL-21), whereas production of these γc-chain cytokines from IL-2-deficient conditional IL-2(−/−) Cre+ mice were comparable with WT and Cre− mice. These results indicate that CD4+ and CD8+ T cell blastogenesis cannot be attributable to IL-2 alone, but a switch

  15. Using Immediate-Early Genes to Map Hippocampal Subregional Functions

    ERIC Educational Resources Information Center

    Kubik, Stepan; Miyashita, Teiko; Guzowski, John F.

    2007-01-01

    Different functions have been suggested for the hippocampus and its subdivisions along both transversal and longitudinal axes. Expression of immediate-early genes (IEGs) has been used to map specific functions onto neuronal activity in different areas of the brain including the hippocampus (IEG imaging). Here we review IEG studies on hippocampal…

  16. Efficient sequential repetitive gene deletions in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing ß-recombinase acting on si...

  17. Structure of the immediate early gene of canine herpesvirus.

    PubMed

    Miyoshi, M; Takiguchi, M; Yasuda, J; Hashimoto, A; Takada, A; Okazaki, K; Kida, H

    1999-01-01

    The nucleotide sequence of the immediate early (IE) gene of canine herpesvirus was determined. This gene was located in the inverted repeat regions, encoding a polypeptide of 1,383 amino acids. The predicted amino acid sequence was most closely related to that of the feline herpesvirus 1 IE protein among those of other alphaherpesviruses. DNA binding and transcriptional activation domains were found in the IE protein. A spliced region of the IE gene transcript was determined in its 5' non-coding region. PMID:10470264

  18. Immunological evasion of immediate-early varicella zoster virus proteins.

    PubMed

    Meysman, Pieter; Fedorov, Dmitry; Van Tendeloo, Viggo; Ogunjimi, Benson; Laukens, Kris

    2016-07-01

    The varicella zoster virus (VZV) causes the childhood disease commonly known as chickenpox and can later in life reactivate as herpes zoster. The adaptive immune system is known to play an important role in suppressing VZV reactivation. A central aspect of this system is the presentation of VZV-derived peptides by the major histocompatibility complex (MHC) proteins. Here, we investigate if key VZV proteins have evolved their amino acid sequence to avoid presentation by MHC based on predictive models of MHC-peptide affinity. This study shows that the immediate-early proteins of all characterized VZV strains are profoundly depleted for high-affinity MHC-I-restricted epitopes. The same depletion can be found in its closest animal analog, the simian varicella virus. Further orthology analysis towards other herpes viruses suggests that the protein amino acid frequency is one of the primary drivers of targeted epitope depletion. PMID:27020058

  19. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  20. Influence of Isoflurane on Immediate-Early Gene Expression

    PubMed Central

    Bunting, Kristopher M.; Nalloor, Rebecca I.; Vazdarjanova, Almira

    2016-01-01

    Background: Anterograde amnesia is a hallmark effect of volatile anesthetics. Isoflurane is known to affect both the translation and transcription of plasticity-associated genes required for normal memory formation in many brain regions. What is not known is whether isoflurane anesthesia prevents the initiation of transcription or whether it halts transcription already in progress. We tested the hypothesis that general anesthesia with isoflurane prevents learning-induced initiation of transcription of several memory-associated immediate-early genes (IEGs) correlated with amnesia; we also assessed whether it stops transcription initiated prior to anesthetic administration. Methods: Using a Tone Fear Conditioning paradigm, rats were trained to associate a tone with foot-shock. Animals received either no anesthesia, anesthesia immediately after training, or anesthesia before, during, and after training. Animals were either sacrificed after training or tested 24 h later for long-term memory. Using Cellular Compartment Analysis of Temporal Activity by Fluorescence in situ Hybridization (catFISH), we examined the percentage of neurons expressing the IEGs Arc/Arg3.1 and Zif268/Egr1/Ngfi-A/Krox-24 in the dorsal hippocampus, primary somatosensory cortex, and primary auditory cortex. Results: On a cellular level, isoflurane administered at high doses (general anesthesia) prevented initiation of transcription, but did not stop transcription of Arc and Zif268 mRNA initiated prior to anesthesia. On a behavioral level, the same level of isoflurane anesthesia produced anterograde amnesia for fear conditioning when administered before and during training, but did not produce retrograde amnesia when administered immediately after training. Conclusion: General anesthesia with isoflurane prevents initiation of learning-related transcription but does not stop ongoing transcription of two plasticity-related IEGs, Arc and Zif268, a pattern of disruption that parallels the effects of

  1. Molecular basis of human growth hormone gene deletions.

    PubMed Central

    Vnencak-Jones, C L; Phillips, J A; Chen, E Y; Seeburg, P H

    1988-01-01

    Crossover sites resulting from unequal recombination within the human growth hormone (GH) gene cluster that cause GH1 gene deletions and isolated GH deficiency type 1A were localized in nine patients. In eight unrelated subjects homozygous for 6.7-kilobase (kb) deletions, the breakpoints are within two blocks of highly homologous DNA sequences that lie 5' and 3' to the GH1 gene. In seven of these eight cases, the breakpoints map within a 1250-base-pair (bp) region composed of 300-bp Alu sequences of 86% homology and flanking non-Alu sequences that are 600 and 300 bp in length and are of 96% and 88% homology, respectively. In the eighth patient, the breakpoints are 5' to these Alu repeats and are most likely within a 700-bp region of 96% homologous DNA sequences. In the ninth patient homozygous for a 7.6-kb deletion, the breakpoints are contained within a 29-bp perfect repeat lying 5' to GH1 and the human chorionic somatomammotropin pseudogene (CSHP1). Together, these results indicate that the presence of highly homologous DNA sequences flanking GH1 predispose to recurrent unequal recombinational events presumably through chromosomal misalignment. Images PMID:2840669

  2. Tetranectin gene deletion induces Parkinson's disease by enhancing neuronal apoptosis.

    PubMed

    Chen, Zhifeng; Wang, Ersong; Hu, Rong; Sun, Yu; Zhang, Lei; Jiang, Jue; Zhang, Ying; Jiang, Hong

    Parkinson's disease (PD) is a chronic neurodegenerative disorder characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNpc). We previously identified tetranectin (TET) as a potential biomarker for PD whose expression is downregulated in the cerebrospinal fluid of PD patients. In the present study, we investigate the role of TET in neurodegeneration in vitro and in vivo. Our results showed that siRNA knockdown of TET decreased cell viability and the number of tyrosine hydroxylase (TH) positive cells, whereas it increased caspase-3 activity and the Bax/Bcl-2 ratio in cultured primary dopaminergic neurons. Overexpression of TET protected dopaminergic neurons against neuronal apoptosis in 1-methyl-4-phenylpyridinium cell culture model in vitro. In TET knockdown mouse model of PD, TET gene deletion decreased the number of TH positive cells in the SNpc, induced apoptosis via the p53/Bax pathway, and significantly impaired the motor behavior of transgenic mice. The findings suggest that TET plays a neuroprotective role via reducing neuron apoptosis and could be a valuable biomarker or potential therapeutic target for the treatment of patients with PD. PMID:26597345

  3. Pseudomonas putida KT2440 markerless gene deletion using a combination of λ Red recombineering and Cre/loxP site-specific recombination.

    PubMed

    Luo, Xi; Yang, Yunwen; Ling, Wen; Zhuang, Hao; Li, Qin; Shang, Guangdong

    2016-02-01

    Pseudomonas putida KT2440 is a saprophytic, environmental microorganism that plays important roles in the biodegradation of environmental toxic compounds and production of polymers, chemicals and secondary metabolites. Gene deletion of KT2440 usually involves cloning of the flanking homologous fragments of the gene of interest into a suicide vector followed by transferring into KT2440 via triparental conjugation. Selection and counterselection steps are then employed to generate gene deletion mutant. However, these methods are tedious and are not suitable for the manipulation of multiple genes simultaneously. Herein, a two-step, markerless gene deletion method is presented. First, homologous armsflanked loxP-neo-loxP was knocked-in to replace the gene of interest, then the kanamycin resistance marker is removed by Cre recombinase catalyzed site-specific recombination. Both two-plasmid and one-plasmid gene systems were established. MekR/PmekA regulated gene expression system was found to be suitable for tight Cre expression in one-plasmid deletion system. The straightforward, time saving and highly efficient markerless gene deletion strategy has the potential to facilitate the genetics and functional genomics study of P. putida KT2440. PMID:26802072

  4. Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR.

    PubMed

    Ge, Xiuchun; Xu, Ping

    2012-01-01

    Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria (1,2). Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse

  5. Sub-optimal phenotypes of double-knockout mutants of Escherichia coli depend on the order of gene deletions.

    PubMed

    Gawand, Pratish; Said Abukar, Fatumina; Venayak, Naveen; Partow, Siavash; Motter, Adilson E; Mahadevan, Radhakrishnan

    2015-08-01

    Metabolic networks are characterized by multiple redundant reactions that do not have a clear biological function. The redundancies in the metabolic networks are implicated in adaptation to random mutations and survival under different environmental conditions. Reactions that are not active under wild-type growth conditions, but get transiently activated after a mutation event such as gene deletion are known as latent reactions. Characterization of multiple-gene knockout mutants can identify the physiological roles of latent reactions. In this study, we characterized double-gene deletion mutants of E. coli with the aim of investigating the sub-optimal physiology of the mutants and the possible roles of latent reactions. Specifically, we investigated the effects of the deletion of the glyoxylate-shunt gene aceA (encoding a latent reaction enzyme, isocitrate lyase) on the growth characteristics of the mutant E. coli Δpgi. The deletion of aceA reduced the growth rate of E. coli Δpgi, indicating that the activation of the glyoxylate shunt plays an important role in adaptation of the mutant E. coli Δpgi when no other latent reactions are concurrently inactivated. We also investigated the effect of the order of the gene deletions on the growth rates and substrate uptake rates of the double-gene deletion mutants. The results indicate that the order in which genes are deleted determines the phenotype of the mutants during the sub-optimal growth phase. To elucidate the mechanism behind the difference between the observed phenotypes, we carried out transcriptomic analysis and constraint-based modeling of the mutants. Transcriptomic analysis showed differential expression of the gene aceK (encoding the protein isocitrate dehydrogenase kinase) involved in controlling the isocitrate flux through the TCA cycle and the glyoxylate shunt. Higher acetate production in the E. coli ΔaceA1 Δpgi2 mutant was consistent with the increased aceK expression, which limits the TCA cycle

  6. Negative elongation factor NELF controls transcription of immediate early genes in a stimulus-specific manner

    SciTech Connect

    Fujita, Toshitsugu; Piuz, Isabelle; Schlegel, Werner

    2009-01-15

    The transcription rate of immediate early genes (IEGs) is controlled directly by transcription elongation factors at the transcription elongation step. Negative elongation factor (NELF) and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) stall RNA polymerase II (pol II) soon after transcription initiation. Upon induction of IEG transcription, DSIF is converted into an accelerator for pol II elongation. To address whether and how NELF as well as DSIF controls overall IEG transcription, its expression was reduced using stable RNA interference in GH4C1 cells. NELF knock-down reduced thyrotropin-releasing hormone (TRH)-induced transcription of the IEGs c-fos, MKP-1, and junB. In contrast, epidermal growth factor (EGF)-induced transcription of these IEGs was unaltered or even slightly increased by NELF knock-down. Thus, stable knock-down of NELF affects IEG transcription stimulation-specifically. Conversely, DSIF knock-down reduced both TRH- and EGF-induced transcription of the three IEGs. Interestingly, TRH-induced activation of the MAP kinase pathway, a pathway essential for transcription of the three IEGs, was down-regulated by NELF knock-down. Thus, stable knock-down of NELF, by modulating intracellular signaling pathways, caused stimulation-specific loss of IEG transcription. These observations indicate that NELF controls overall IEG transcription via multiple mechanisms both directly and indirectly.

  7. Attenuation of serum inducibility of immediate early genes by oncoproteins in tyrosine kinase signaling pathways.

    PubMed Central

    Yu, C L; Prochownik, E V; Imperiale, M J; Jove, R

    1993-01-01

    Immediate early genes involved in controlling cell proliferation are rapidly and transiently induced following stimulation of susceptible cells with serum. To study how oncoproteins regulate immediate early genes, we examined serum inducibility of these genes in cells transformed by various oncoproteins. We found that induction of the immediate early gene, c-fos, by serum stimulation was markedly attenuated in four independent cell lines stably transformed by the v-Src tyrosine kinase. Cells chronically transformed by other oncoproteins implicated in tyrosine kinase signaling pathways, including v-Sis, v-Ras, and v-Raf, showed the same pattern of attenuation. In contrast, serum inducibility of c-fos was not attenuated in cells transformed by simian virus 40, which is thought to transform cells through a different pathway. Cell cycle analyses showed that proliferation of these transformed cell lines could be arrested effectively in 0.1% serum, demonstrating that the attenuation was not simply due to continuous cycling of transformed cells after serum deprivation. Moreover, serum inducibility of other immediate early genes, including c-jun, junB, egr-1, and NGFI-B, also was strikingly attenuated by these same oncoproteins. Nuclear run-on transcription assays established that this attenuation of serum inducibility occurred at the transcriptional level. Finally, flow cytometric analysis demonstrated that serum-starved v-Src-transformed cells were viable and able to progress into S phase of the cell cycle after serum stimulation, even though the induction of immediate early genes was greatly attenuated in these cells. Our results suggest that activation of immediate early genes is repressed by chronic stimulation of tyrosine kinase signaling pathways in transformed cells. Images PMID:8384301

  8. Acute Megakaryoblastic Leukemia with Myelodysplasia-related Changes Associated with ATM Gene Deletion.

    PubMed

    Ureshino, Hiroshi; Tanabe, Momoka; Kurogi, Kazuya; Miyahara, Masaharu; Kimura, Shinya

    2016-01-01

    Ataxia telangiectasia mutated (ATM) is a tumor suppressor gene, and its somatic inactivation plays a role in the pathogenesis of lymphoid malignancies. However, the role of ATM in patients with myeloid malignancies is still unknown. We herein report a case of acute megakaryoblastic leukemia (AMKL) with ATM gene deletion. An 84-year-old Japanese woman presenting with a pale face and pancytopenia was admitted to our institution and diagnosed to have AMKL with ATM gene deletion. She was treated with intravenous azacitidine. The azacitidine treatment was effective for approximately 1 year. Somatic inactivation of the ATM gene may therefore be involved in the pathogenesis of AMKL. PMID:27301517

  9. Fine specificity of cellular immune responses in humans to human cytomegalovirus immediate-early 1 protein.

    PubMed Central

    Alp, N J; Allport, T D; Van Zanten, J; Rodgers, B; Sissons, J G; Borysiewicz, L K

    1991-01-01

    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known about responses against this protein by CD4+ T cells, which may be important as direct effector cells or helper cells for antibody and CD8+ responses. Proliferative-T-cell responses to HCMV IE1 were studied in normal seropositive subjects. Peripheral blood mononuclear cells from 85% of seropositive subjects proliferated in response to HCMV from infected fibroblasts, and of these, 73% responded to recombinant baculovirus IE1. Responding cells were predominantly CD3+ CD4+. IE1 antigen preparations, including baculovirus recombinant protein, transfected rat cell nuclei, and synthetic peptides, induced IE1-specific T-cell lines which cross-reacted between the preparations. The fine specificity of these IE1-specific T-cell lines was studied by using overlapping synthetic peptides encompassing the entire sequence of the IE1 protein. The regions of the IE1 molecule recognized were identified and these varied between individuals, possibly reflecting differences in major histocompatibility complex (MHC) class II haplotype. In one subject, the peptide specificities of proliferative and MHC class I-restricted cytotoxic determinants on IE1 were spatially distinct. Thus, no single immunodominant T-cell determinant within HCMV IE1 was identified, suggesting that multiple peptides or a region of the 72-kDa IE1 protein would be required to induce specific T-cell responses in humans. PMID:1714519

  10. Ethological concepts revisited: immediate early gene induction in response to sexual stimuli in birds.

    PubMed

    Ball, G F; Balthazar, J

    2001-05-01

    Courtship behaviors were interpreted by ethologists as being examples of 'sign stimuli' that would act as 'releasers' of stereotypic species-typical behaviors in conspecifics. A key component of the sign stimulus concept is that some form of stimulus filtering occurs that is responsible for the marked selective behavioral responsiveness. Studies of immediate early gene induction in the avian brain in response to conspecific stimuli associated with courtship and mating reveal that such gene induction is highly selective. In male Japanese quail (Coturnix japonica), studies of the immediate early gene c-fos or zenk have been conducted in birds engaging in both appetitive and consummatory aspects of male sexual behavior. High induction of immediate early genes occurs in hypothalamic and limbic areas such as the medial preoptic nucleus, bed nucleus striae terminalis and parts of the archistriatum in birds who had copulated and/or who had expressed a learned social proximity response, reflecting appetitive sexual behavior. Immediate early gene expression was also increased in telencephalic areas such as the hyperstriatum ventrale that presumably plays a role in the integration of sensory cues related to female recognition. In European starlings, studies of zenk induction have been conducted in females who hear male-typical courtship song. Clayton and Mello had shown that zenk is induced in the auditory telencephalon of canaries and zebra finches at high levels specifically in response to conspecific song. Immediate early genes such as fos and zenk are also expressed in song control nuclei specifically in association with song production. In starlings it was found that song was effective in rapidly inducing zenk expression in the auditory telencephalon in males and in females in the breeding as well as in the non-breeding season. Thus, the expression is not greater in females who use song to choose mates or during the breeding season when females are choosing mates

  11. Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

  12. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii.

    PubMed

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin; Choi, Chul Hee; Han, Kyudong

    2015-05-15

    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  13. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

    2015-01-01

    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  14. Dissecting the phenotypes of Dravet syndrome by gene deletion.

    PubMed

    Rubinstein, Moran; Han, Sung; Tai, Chao; Westenbroek, Ruth E; Hunker, Avery; Scheuer, Todd; Catterall, William A

    2015-08-01

    Neurological and psychiatric syndromes often have multiple disease traits, yet it is unknown how such multi-faceted deficits arise from single mutations. Haploinsufficiency of the voltage-gated sodium channel Nav1.1 causes Dravet syndrome, an intractable childhood-onset epilepsy with hyperactivity, cognitive deficit, autistic-like behaviours, and premature death. Deletion of Nav1.1 channels selectively impairs excitability of GABAergic interneurons. We studied mice having selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons. In brain slices, these deletions cause increased threshold for action potential generation, impaired action potential firing in trains, and reduced amplification of postsynaptic potentials in those interneurons. Selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons increases susceptibility to thermally-induced seizures, which are strikingly prolonged when Nav1.1 is deleted in both interneuron types. Mice with global haploinsufficiency of Nav1.1 display autistic-like behaviours, hyperactivity and cognitive impairment. Haploinsufficiency of Nav1.1 in parvalbumin-expressing interneurons causes autistic-like behaviours, but not hyperactivity, whereas haploinsufficiency in somatostatin-expressing interneurons causes hyperactivity without autistic-like behaviours. Heterozygous deletion in both interneuron types is required to impair long-term spatial memory in context-dependent fear conditioning, without affecting short-term spatial learning or memory. Thus, the multi-faceted phenotypes of Dravet syndrome can be genetically dissected, revealing synergy in causing epilepsy, premature death and deficits in long-term spatial memory, but interneuron-specific effects on hyperactivity and autistic-like behaviours. These results show that multiple disease traits can arise from similar functional deficits in specific interneuron types. PMID:26017580

  15. Dissecting the phenotypes of Dravet syndrome by gene deletion

    PubMed Central

    Rubinstein, Moran; Han, Sung; Tai, Chao; Westenbroek, Ruth E.; Hunker, Avery; Scheuer, Todd

    2015-01-01

    Neurological and psychiatric syndromes often have multiple disease traits, yet it is unknown how such multi-faceted deficits arise from single mutations. Haploinsufficiency of the voltage-gated sodium channel Nav1.1 causes Dravet syndrome, an intractable childhood-onset epilepsy with hyperactivity, cognitive deficit, autistic-like behaviours, and premature death. Deletion of Nav1.1 channels selectively impairs excitability of GABAergic interneurons. We studied mice having selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons. In brain slices, these deletions cause increased threshold for action potential generation, impaired action potential firing in trains, and reduced amplification of postsynaptic potentials in those interneurons. Selective deletion of Nav1.1 in parvalbumin- or somatostatin-expressing interneurons increases susceptibility to thermally-induced seizures, which are strikingly prolonged when Nav1.1 is deleted in both interneuron types. Mice with global haploinsufficiency of Nav1.1 display autistic-like behaviours, hyperactivity and cognitive impairment. Haploinsufficiency of Nav1.1 in parvalbumin-expressing interneurons causes autistic-like behaviours, but not hyperactivity, whereas haploinsufficiency in somatostatin-expressing interneurons causes hyperactivity without autistic-like behaviours. Heterozygous deletion in both interneuron types is required to impair long-term spatial memory in context-dependent fear conditioning, without affecting short-term spatial learning or memory. Thus, the multi-faceted phenotypes of Dravet syndrome can be genetically dissected, revealing synergy in causing epilepsy, premature death and deficits in long-term spatial memory, but interneuron-specific effects on hyperactivity and autistic-like behaviours. These results show that multiple disease traits can arise from similar functional deficits in specific interneuron types. PMID:26017580

  16. Gene expression profiling in spleens of deoxynivalenol-exposed mice: immediate early genes as primary targets.

    PubMed

    Kinser, Shawn; Jia, Qunshan; Li, Maioxing; Laughter, Ashley; Cornwell, Paul; Corton, J Christopher; Pestka, James

    2004-09-24

    signaling, were increased, while Jun kinase 2 (JNK2) was decreased. Taken together, data suggest that DON upregulated the expression of multiple immediate early genes, many of which are likely to contribute to the complex immunological effects reported for this and other trichothecenes. PMID:15371230

  17. Physical and functional interactions between herpes simplex virus immediate-early proteins ICP4 and ICP27.

    PubMed Central

    Panagiotidis, C A; Lium, E K; Silverstein, S J

    1997-01-01

    The ordered expression of herpes simplex virus type 1 (HSV-1) genes, during the course of a productive infection, requires the action of the virus immediate-early regulatory proteins. Using a protein interaction assay, we demonstrate specific in vitro protein-protein interactions between ICP4 and ICP27, two immediate-early proteins of HSV-1 that are essential for virus replication. We map multiple points of contact between these proteins. Furthermore, by coimmunoprecipitation experiments, we demonstrate the following. (i) ICP4-ICP27 complexes are present in extracts from HSV-1 infected cells. (ii) ICP27 binds preferentially to less modified forms of ICP4, a protein that is extensively modified posttranslationally. We also demonstrate, by performing electrophoretic mobility shift assays and supershifts with monoclonal antibodies to ICP4 or ICP27, that both proteins are present in a DNA-protein complex with a noncanonical ICP4 binding site present in the HSV thymidine kinase (TK) gene. ICP4, in extracts from cells infected with ICP27-deficient viruses, is impaired in its ability to form complexes with the TK site but not with the canonical site from the alpha4 gene. However, ICP4 is able to form complexes with the TK probe, in the absence of ICP27, when overproduced in mammalian cells or expressed in bacteria. These data suggest that the inability of ICP4 from infected cell extracts to bind the TK probe in the absence of ICP27 does not reflect a requirement for the physical presence of ICP27 in the complex. Rather, they imply that ICP27 is likely to modulate the DNA binding activity of ICP4 by affecting its posttranslational modification status. Therefore, we propose that ICP27, in addition to its established role as a posttranscriptional regulator of virus gene expression, may also modulate transcription either through direct or indirect interactions with HSV regulatory regions, or through its ability to modulate the DNA binding activity of ICP4. PMID:8995681

  18. Expression of immediate early genes after treatment of human astrocytoma cells with radiation and taxol

    SciTech Connect

    Gubits, R.M.; Geard, C.R.; Schiff, P.B.

    1993-10-20

    The promising chemotherapeutic agent, taxol, has been shown to sensitize the G18 line of human astrocytoma cells to ionizing radiation. The present studies were performed to identify specific changes in gene expression associated with this altered sensitivity. The products of immediate early genes, which are induced transiently in cells in response to a variety of treatments, including growth factors, neurotransmitters, and irradiation with UV light or X rays, are thought to initiate a cascade of genetic responses to alterations in cellular environment. The present results demonstrate a dramatic attenuation in one immediate early gene response in association with a treatment that enhances radiosensitivity in a refractory human brain tumor line. 22 refs., 5 figs., 1 tab.

  19. Mullerian Duct Cyst Causing Bladder Outlet Obstruction in a Patient with HNF-1β Gene Deletion

    PubMed Central

    Honore, Matthew; Fowler, Ross; Kiosoglous, Anthony J.

    2016-01-01

    A 24-year-old male was referred to a tertiary hospital for a possible prostatic abscess. The patient went into acute urinary retention. Transurethral drainage was performed. MRI pelvis three days post-operatively identified the prostatic cystic structure as a müllerian duct cyst. Several other phenotypical features were noted on examination as well as findings on investigations. From these diagnosis of hepatocyte nuclear factor-1β (HNF-1β) gene deletion was made. PMID:27390584

  20. Effects of G-gene Deletion and Replacement on Rabies Virus Vector Gene Expression

    PubMed Central

    Sato, Sho; Ohara, Shinya; Tsutsui, Ken-Ichiro; Iijima, Toshio

    2015-01-01

    The glycoprotein-gene (G gene) -deleted rabies virus (RV) vector is a powerful tool to examine the function and structure of neural circuits. We previously reported that the deletion of the G gene enhances the transgene expression level of the RV vector. However, the mechanism of this enhancement remains to be clarified. We presume that there are two possible factors for this enhancement. The first factor is the glycoprotein of RV, which shows cytotoxicity; thus, may cause a dysfunction in the translation process of infected cells. The second possible factor is the enhanced expression of the L gene, which encodes viral RNA polymerase. In the RV, it is known that the gene expression level is altered depending on the position of the gene. Since G-gene deletion displaces the L gene in the genome, the expression of the L gene and viral transcription may be enhanced. In this study, we compared the transgene expression level and viral transcription of three recombinant RV vectors. The effect of glycoprotein was examined by comparing the viral gene expression of G-gene-intact RV and G-gene-replaced RV. Despite the fact that the L-gene transcription level of these two RV vectors was similar, the G-gene-replaced RV vector showed higher viral transcription and transgene expression level than the G-gene-intact RV vector. To examine the effect of the position of the L gene, we compared the viral gene expression of the G-gene-deleted RV and G-gene-replaced RV. The G-gene-deleted RV vector showed higher L-gene transcription, viral transcription, and transgene expression level than the G-gene-replaced RV vector. These results indicate that G-gene deletion enhances the transgene expression level through at least two factors, the absence of glycoprotein and enhancement of L-gene expression. These findings enable investigators to design a useful viral vector that shows a controlled desirable transgene expression level in applications. PMID:26023771

  1. Pheromone-induced expression of immediate early genes in the mouse vomeronasal sensory system.

    PubMed

    Haga-Yamanaka, Sachiko; Touhara, Kazushige

    2013-01-01

    Immediate early genes (IEGs) are powerful tools for visualizing activated neurons and extended circuits that are stimulated by sensory input. Several kinds of IEGs (e.g., c-fos, egr-1) have been utilized for detecting activated receptor neurons in the pheromone sensory organ called the vomeronasal organ (VNO), as well as for mapping the neurons within the central nervous system (CNS) excited by pheromones.In this chapter, we describe the procedure for the detection of pheromone-induced neural activation in the VNO and CNS using the c-Fos immunostaining technique. PMID:24014367

  2. A UL47 Gene Deletion Mutant of Bovine Herpesvirus Type 1 Exhibits Impaired Growth in Cell Culture and Lack of Virulence in Cattle▿ †

    PubMed Central

    Lobanov, Vladislav A.; Maher-Sturgess, Sheryl L.; Snider, Marlene G.; Lawman, Zoe; Babiuk, Lorne A.; van Drunen Littel-van den Hurk, Sylvia

    2010-01-01

    Tegument protein VP8 encoded by the UL47 gene of bovine herpesvirus type 1 (BHV-1) is the most abundant constituent of mature virions. In the present report, we describe the characterization of UL47 gene-deleted BHV-1 in cultured cells and its natural host. The UL47 deletion mutant exhibited reduced plaque size and more than 100-fold decrease in intracellular and extracellular viral titers in cultured cells. Ultrastructural observations of infected cells showed normal maturation of BHV-1 virions in the absence of VP8. There was no evidence for a change in immediate-early gene activator function of VP16 in the UL47 deletion mutant virus-infected cells, since bovine ICP4 mRNA and protein levels were similar to those in the wild-type and revertant virus-infected cells throughout the course of infection. Whereas VP16, glycoprotein C (gC), gB, and VP5 were expressed to wild-type levels in the UL47 deletion mutant-infected cells, the gD and VP22 protein levels were significantly reduced. The reduction in gD protein was associated with increased turnover of the protein. Furthermore, some of the analyzed early and late proteins were expressed with earlier kinetics in the absence of VP8. Extracellular virions of the UL47 deletion mutant contained reduced amounts of gD, gB, gC, and VP22 but similar amounts of VP16 compared to those of wild-type or revertant virus particles. In addition, the UL47 gene product was indispensable for BHV-1 replication in vivo, since no clinical manifestations or viral shedding were detected in the UL47 deletion mutant-infected calves, and the virus failed to induce significant levels of humoral and cellular immunity. PMID:19864376

  3. Expression of cyr61, a growth factor-inducible immediate-early gene.

    PubMed Central

    O'Brien, T P; Yang, G P; Sanders, L; Lau, L F

    1990-01-01

    A set of immediate-early genes that are rapidly activated by serum or purified platelet-derived growth factor in mouse 3T3 fibroblasts has been previously identified. Among these genes, several are related to known or putative transcription factors and growth factors, supporting the notion that some of these genes encode regulatory molecules important to cell growth. We show here that a member of this set of genes, cyr61 (originally identified by its cDNA 3CH61), encodes a 379-amino-acid polypeptide rich in cysteine residues. cyr61 can be induced through protein kinase C-dependent and -independent pathways. Unlike many immediate-early genes that are transiently expressed, the cyr61 mRNA is accumulated from the G0/G1 transition through mid-G1. This expression pattern is due to persistent transcription, while the mRNA is rapidly turned over during the G0/G1 transition and in mid-G1 at the same rate. In logarithmically growing cells, the cyr61 mRNA level is constant throughout the cell cycle. Cyr61 contains an N-terminal secretory signal sequence; however, it is not detected in the culture medium by immunoprecipitation. Cyr61 is synthesized maximally at 1 to 2 h after serum stimulation and has a short half-life within the cell. Images PMID:2355916

  4. Gene deletion strategy to examine the involvement of the two chondroitin lyases in Flavobacterium columnare virulence.

    PubMed

    Li, Nan; Qin, Ting; Zhang, Xiao Lin; Huang, Bei; Liu, Zhi Xin; Xie, Hai Xia; Zhang, Jin; McBride, Mark J; Nie, Pin

    2015-11-01

    Flavobacterium columnare is an important bacterial pathogen of freshwater fish that causes high mortality of infected fish and heavy economic losses in aquaculture. The pathogenesis of this bacterium is poorly understood, in part due to the lack of efficient methods for genetic manipulation. In this study, a gene deletion strategy was developed and used to determine the relationship between the production of chondroitin lyases and virulence. The F. johnsoniae ompA promoter (PompA) was fused to sacB to construct a counterselectable marker for F. columnare. F. columnare carrying PompA-sacB failed to grow on media containing 10% sucrose. A suicide vector carrying PompA-sacB was constructed, and a gene deletion strategy was developed. Using this approach, the chondroitin lyase-encoding genes, cslA and cslB, were deleted. The ΔcslA and ΔcslB mutants were both partially deficient in digestion of chondroitin sulfate A, whereas a double mutant (ΔcslA ΔcslB) was completely deficient in chondroitin lyase activity. Cells of F. columnare wild-type strain G4 and of the chondroitin lyase-deficient ΔcslA ΔcslB mutant exhibited similar levels of virulence toward grass carp in single-strain infections. Coinfections, however, revealed a competitive advantage for the wild type over the chondroitin lyase mutant. The results indicate that chondroitin lyases are not essential virulence factors of F. columnare but may contribute to the ability of the pathogen to compete and cause disease in natural infections. The gene deletion method developed in this study may be employed to investigate the virulence factors of this bacterium and may have wide application in many other members of the phylum Bacteroidetes. PMID:26253667

  5. Model-guided identification of gene deletion targets for metabolic engineering in Saccharomyces cerevisiae.

    PubMed

    Brochado, Ana Rita; Patil, Kiran Raosaheb

    2014-01-01

    Identification of metabolic engineering strategies for rerouting intracellular fluxes towards a desired product is often a challenging task owing to the topological and regulatory complexity of metabolic networks. Genome-scale metabolic models help tackling this complexity through systematic consideration of mass balance and reaction directionality constraints over the entire network. Here, we describe how genome-scale metabolic models can be used for identifying gene deletion targets leading to increased production of the desired product. Vanillin production in Saccharomyces cerevisiae is used as a case study throughout this chapter. PMID:24744040

  6. Satb1 Ablation Alters Temporal Expression of Immediate Early Genes and Reduces Dendritic Spine Density during Postnatal Brain Development

    PubMed Central

    Balamotis, Michael A.; Tamberg, Nele; Woo, Young Jae; Li, Jingchuan; Davy, Brian

    2012-01-01

    Complex behaviors, such as learning and memory, are associated with rapid changes in gene expression of neurons and subsequent formation of new synaptic connections. However, how external signals are processed to drive specific changes in gene expression is largely unknown. We found that the genome organizer protein Satb1 is highly expressed in mature neurons, primarily in the cerebral cortex, dentate hilus, and amygdala. In Satb1-null mice, cortical layer morphology was normal. However, in postnatal Satb1-null cortical pyramidal neurons, we found a substantial decrease in the density of dendritic spines, which play critical roles in synaptic transmission and plasticity. Further, we found that in the cerebral cortex, Satb1 binds to genomic loci of multiple immediate early genes (IEGs) (Fos, Fosb, Egr1, Egr2, Arc, and Bdnf) and other key neuronal genes, many of which have been implicated in synaptic plasticity. Loss of Satb1 resulted in greatly alters timing and expression levels of these IEGs during early postnatal cerebral cortical development and also upon stimulation in cortical organotypic cultures. These data indicate that Satb1 is required for proper temporal dynamics of IEG expression. Based on these findings, we propose that Satb1 plays a critical role in cortical neurons to facilitate neuronal plasticity. PMID:22064485

  7. PDX1, a cellular homeoprotein, binds to and regulates the activity of human cytomegalovirus immediate early promoter.

    PubMed

    Chao, Sheng-Hao; Harada, Josephine N; Hyndman, Francie; Gao, Xiaoqi; Nelson, Christian G; Chanda, Sumit K; Caldwell, Jeremy S

    2004-04-16

    Cellular homeoproteins have been shown to regulate the transcription of several viruses, including herpes simplex viruses, human papillomaviruses, and mouse mammary tumor viruses. Previous studies investigating the anti-viral mechanisms of several cyclin-dependent kinase inhibitors showed that the homeoproteins, pre B-cell leukemia transcription factor 1 (PBX1) and PBX-regulating protein-1 (PREP1), function as transcriptional activators of Moloney murine leukemia virus. Here, we examined the involvement of cellular homeoproteins in regulating the activity of the human cytomegalovirus immediate early (CMV IE) promoter. We identified a 45-bp element located at position -593 to -549 upstream of the transcription start site of the CMV IE gene, which contains multiple putative homeoprotein binding motifs. Gel shift assays demonstrated the physical association between a homeodomain protein, pancreatic-duodenal homeobox factor-1 (PDX1) and the 45-bp cytomegalovirus (CMV) region. We further determined that PDX1 represses the CMV IE promoter activity in 293 cells. Overexpression of PDX1 resulted in a decrease in transcription of the CMV IE gene. Conversely, blocking PDX1 protein synthesis and mutating the PDX1 binding sites enhanced CMV IE-dependent transcription. Collectively, our results represent the first work demonstrating that a cellular homeoprotein, PDX1, may be a repressor involved in regulation of human CMV gene expression. PMID:14764605

  8. A Diverse Repertoire of CD4 T Cells Targets the Immediate-Early 1 Protein of Human Cytomegalovirus

    PubMed Central

    Ameres, Stefanie; Liang, Xiaoling; Wiesner, Martina; Mautner, Josef; Moosmann, Andreas

    2015-01-01

    T-cell responses to the immediate-early 1 (IE-1) protein of human cytomegalovirus (HCMV) are associated with protection from viral disease. Thus, IE-1 is a promising target for immunotherapy. CD8 T-cell responses to IE-1 are generally strong. In contrast, CD4 T-cell responses to IE-1 were described to be comparatively infrequent or undetectable in HCMV carriers, and information on their target epitopes and their function has been limited. To analyze the repertoire of IE-1-specific CD4 T cells, we expanded them from healthy donors with autologous IE-1-expressing mini-Epstein–Barr virus-transformed B-cell lines and established IE-1-specific CD4 T-cell clones. Clones from seven out of seven HCMV-positive donors recognized endogenously processed IE-1 epitopes restricted through HLA-DR, DQ, or DP. Three to seven IE-1 epitopes were recognized per donor. Cumulatively, about 27 different HLA/peptide class II complexes were recognized by 117 IE-1-specific clones. Our results suggest that a highly diversified repertoire of IE-1-specific CD4 T cells targeting multiple epitopes is usually present in healthy HCMV carriers. Therefore, multiepitope approaches to immunomonitoring and immunotherapy will make optimal use of this potentially important class of HCMV-specific effector cells. PMID:26635812

  9. DNA methylation and gene deletion analysis of brain metastases in melanoma patients identifies mutually exclusive molecular alterations

    PubMed Central

    Marzese, Diego M.; Scolyer, Richard A.; Roqué, Maria; Vargas-Roig, Laura M.; Huynh, Jamie L.; Wilmott, James S.; Murali, Rajmohan; Buckland, Michael E.; Barkhoudarian, Garni; Thompson, John F.; Morton, Donald L.; Kelly, Daniel F.; Hoon, Dave S. B.

    2014-01-01

    Background The brain is a common target of metastases for melanoma patients. Little is known about the genetic and epigenetic alterations in melanoma brain metastases (MBMs). Unraveling these molecular alterations is a key step in understanding their aggressive nature and identifying novel therapeutic targets. Methods Genome-wide DNA methylation analyses of MBMs (n = 15) and normal brain tissues (n = 91) and simultaneous multigene DNA methylation and gene deletion analyses of metastatic melanoma tissues (99 MBMs and 43 extracranial metastases) were performed. BRAF and NRAS mutations were evaluated in MBMs by targeted sequencing. Results MBMs showed significant epigenetic heterogeneity. RARB, RASSF1, ESR1, APC, PTEN, and CDH13 genes were frequently hypermethylated. Deletions were frequently detected in the CDKN2A/B locus. Of MBMs, 46.1% and 28.8% had BRAF and NRAS missense mutations, respectively. Compared with lung and liver metastases, MBMs exhibited higher frequency of CDH13 hypermethylation and CDKN2A/B locus deletion. Mutual exclusivity between hypermethylated genes and CDKN2A/B locus deletion identified 2 clinically relevant molecular subtypes of MBMs. CDKN2A/B deletions were associated with multiple MBMs and frequently hypermethylated genes with shorter time to brain metastasis. Conclusions Melanoma cells that colonize the brain harbor numerous genetically and epigenetically altered genes. This study presents an integrated genomic and epigenomic analysis that reveals MBM-specific molecular alterations and mutually exclusive molecular subtypes. PMID:24968695

  10. Immediate Early and Early Lytic Cycle Proteins Are Frequent Targets of the Epstein-Barr Virus–induced Cytotoxic T Cell Response

    PubMed Central

    Steven, N.M.; Annels, N.E.; Kumar, A.; Leese, A.M.; Kurilla, M.G.; Rickinson, A.B.

    1997-01-01

    Epstein-Barr virus (EBV), a human γ-herpesvirus, can establish both nonproductive (latent) and productive (lytic) infections. Although the CD8+ cytotoxic T lymphocyte (CTL) response to latently infected cells is well characterized, very little is known about T cell controls over lytic infection; this imbalance in our understanding belies the importance of virus-replicative lesions in several aspects of EBV disease pathogenesis. The present work shows that the primary CD8+ CTL response to EBV in infectious mononucleosis patients contains multiple lytic antigen-specific reactivities at levels at least as high as those seen against latent antigens; similar reactivities are also detectable in CTL memory. Clonal analysis revealed individual responses to the two immediate early proteins BZLF1 and BRLF1, and to three (BMLF1, BMRF1, and BALF2) of the six early proteins tested. In several cases, the peptide epitope and HLA-restricting determinant recognized by these CTLs has been defined, one unusual feature being the number of responses restricted through HLA-C alleles. The work strongly suggests that EBVreplicative lesions are subject to direct CTL control in vivo and that immediate early and early proteins are frequently the immunodominant targets. This contrasts with findings in α- and β-herpesvirus systems (herpes simplex, cytomegalovirus) where viral interference with the antigen-processing pathway during lytic infection renders immediate early and early proteins much less immunogenic. The unique capacity of γ-herpesvirus to amplify the viral load in vivo through a latent growth-transforming infection may have rendered these agents less dependent upon viral replication as a means of successfully colonizing their hosts. PMID:9151898

  11. Targeted gene deletion in Candida parapsilosis demonstrates the role of secreted lipase in virulence

    PubMed Central

    Gácser, Attila; Trofa, David; Schäfer, Wilhelm; Nosanchuk, Joshua D.

    2007-01-01

    Candida parapsilosis is a major cause of human disease, yet little is known about the pathogen’s virulence. We have developed an efficient gene deletion system for C. parapsilosis based on the repeated use of the dominant nourseothricin resistance marker (caSAT1) and its subsequent deletion by FLP-mediated, site-specific recombination. Using this technique, we deleted the lipase locus in the C. parapsilosis genome consisting of adjacent genes CpLIP1 and CpLIP2. Additionally we reconstructed the CpLIP2 gene, which restored lipase activity. Lipolytic activity was absent in the null mutants, whereas the WT, heterozygous, and reconstructed mutants showed similar lipase production. Biofilm formation was inhibited with lipase-negative mutants and their growth was significantly reduced in lipid-rich media. The knockout mutants were more efficiently ingested and killed by J774.16 and RAW 264.7 macrophage-like cells. Additionally, the lipase-negative mutants were significantly less virulent in infection models that involve inoculation of reconstituted human oral epithelium or murine intraperitoneal challenge. These studies represent what we believe to be the first targeted disruption of a gene in C. parapsilosis and show that C. parapsilosis–secreted lipase is involved in disease pathogenesis. This efficient system for targeted gene deletion holds great promise for rapidly enhancing our knowledge of the biology and virulence of this increasingly common invasive fungal pathogen. PMID:17853941

  12. Constitutional and mosaic large NF1 gene deletions in neurofibromatosis type 1.

    PubMed Central

    Rasmussen, S A; Colman, S D; Ho, V T; Abernathy, C R; Arn, P H; Weiss, L; Schwartz, C; Saul, R A; Wallace, M R

    1998-01-01

    A set of neurofibromatosis type 1 (NF1) patients was screened for large NF1 gene deletions by comparing patient and parent genotypes at 10 intragenic polymorphic loci. Of 67 patient/parent sets (47 new mutation patients and 20 familial cases), five (7.5%) showed loss of heterozygosity (LOH), indicative of NF1 gene deletion. These five patients did not have severe NF1 manifestations, mental retardation, or dysmorphic features, in contrast to previous reports of large NF1 deletions. All five deletions were de novo and occurred on the maternal chromosome. However, two patients showed partial LOH, consistent with somatic mosaicism for the deletion, suggesting that mosaicism may be more frequent in NF1 than previously recognised (and may have bearing on clinical severity). We suggest that large NF1 deletions (1) are not always associated with unusual clinical features, (2) tend to occur more frequently on maternal alleles, and (3) are an important mechanism for constitutional and somatic mutations in NF1 patients. Images PMID:9643287

  13. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    SciTech Connect

    Zhang, Y.; Woloschak, G.E.

    1997-08-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF{sub 1} male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P < 0.05) higher percentage of mRb deletions in lung adenocarcinomas from mice exposed to 60 once-weekly {gamma}-ray doses than those from mice receiving 24 once-weekly {gamma}-ray doses at low doses and low dose rates; however, the percentage was not significantly different (P > 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose {gamma} irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed.

  14. The immediate early gene of canine herpesvirus is transcribed through early and late phases.

    PubMed

    Miyoshi, Masahiro; Okazaki, Katsunori; Takiguchi, Mitsuyoshi; Kida, Hiroshi; Hashimoto, Akira

    2002-07-01

    The immediate early (IE) gene of canine herpesvirus (CHV), homologue of the infected cell protein 4 (ICP4) gene of herpes simplex virus 1, is transcribed as a 4.9kb mRNA during IE phase. The IE gene was further transcribed as a 4.8kb mRNA through early (E) and late (L) phases of productive infection. Transcription of the 4.8kb mRNA initiated from downstream of the TATA box in an intron which was spliced out during IE phase. The reverse transcription-polymerase chain reaction revealed that the IE promoter was turned off during L phase at a permissive temperature. We, thus, propose to redesignate the IE gene of CHV as CICP4 gene. PMID:12185320

  15. Central Renin Injections: Effects on Drinking and Expression of Immediate Early Genes

    NASA Technical Reports Server (NTRS)

    Xu, Zhice; Johnson, Alan Kim

    1998-01-01

    This study investigated the drinking response and the expression of Fos- and Egr-1-immunoreactivity (Fos-ir, Egr-1-ir) in the brain induced by endogenous angiotensin generated by intracerebroventricular (i.c.v.) injection of renin. Renin induced Fos-ir in the subformical organ (SFO), median preoptic (MnPO), supraoptic and paraventricular nuclei (SON and PVN), area postrema (AP), nuclei of the solitary tract (NTS) and lateral parabrachial nuclei (LPBN). Renin-induced Egr-1-ir exhibited a similar pattern of distribution as that observed for Fos-ir. The dose of i.c.v. renin that induced expression of immediate early gene (IEG) product immunoreactivity also produced vigorous drinking. When renin-injected rats were pretreated with captopril, an angiotensin converting enzyme inhibitor, drinking was blocked. With the same captopril pretreatment, both Fos- and Egr-1-ir in the SFO, MnPO, SON, PVN, AP and LPBN were also significantly reduced.

  16. A requirement for the immediate early gene zif268 in reconsolidation of recognition memory after retrieval.

    PubMed

    Bozon, Bruno; Davis, Sabrina; Laroche, Serge

    2003-11-13

    Recent research has revived interest in the possibility that previously consolidated memories need to reconsolidate when recalled to return to accessible long-term memory. Evidence suggests that both consolidation and reconsolidation of certain types of memory require protein synthesis, but whether similar molecular mechanisms are involved remains unclear. Here, we explore whether zif268, an activity-dependent inducible immediate early gene (IEG) required for consolidation of new memories, is also recruited for reconsolidation of recognition memory following reactivation. We show that when a consolidated memory for objects is recalled, zif268 mutant mice are impaired in further long-term but not short-term recognition memory. The impairment is specific to reactivation with the previously memorized objects in the relevant context, occurs in delayed recall, and does not recover over several days. These findings indicate that IEG-mediated transcriptional regulation in neurons is one common molecular mechanism for the storage of newly formed and reactivated recognition memories. PMID:14622575

  17. Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice

    PubMed Central

    Zuloaga, Kristen L.; Zhang, Wenri; Roese, Natalie E.; Alkayed, Nabil J.

    2015-01-01

    Soluble epoxide hydrolase (sEH), a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs), is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS) female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15–18 month old) and young (3–4 month old) female sEH knockout (sEHKO) mice and wild type (WT) mice were subjected to 45 min middle cerebral artery occlusion (MCAO) with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24 h thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography (OMAG). Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24 h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24 h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice. PMID:25642188

  18. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  19. Three new isolates of porcine respiratory coronavirus with various pathogenicities and spike (S) gene deletions.

    PubMed Central

    Vaughn, E M; Halbur, P G; Paul, P S

    1994-01-01

    Three new isolates of porcine respiratory coronavirus (PRCV) were isolated and partially characterized. These PRCV isolates showed a selective tropism for respiratory tissue and were antigenically related to transmissible gastroenteritis virus. PCR amplification of the 5' half of the spike (S) genes of the three PRCV isolates indicated that a large deletion, characteristic of PRCV, was present. By using cDNA probes specific for the transmissible gastroenteritis virus S gene, the PCR products were shown to be specific in a Southern blot. The three new PRCV isolates were shown to vary in S gene deletion size. In a separate study, these isolates have also been shown to vary in pathogenicity. These new PRCV isolates should serve as important tools in gaining a better understanding of the pathogenesis of coronavirus infections. Images PMID:7929779

  20. A novel adipose-specific gene deletion model demonstrates potential pitfalls of existing methods.

    PubMed

    Mullican, Shannon E; Tomaru, Takuya; Gaddis, Christine A; Peed, Lindsey C; Sundaram, Anand; Lazar, Mitchell A

    2013-01-01

    Adipose-specific gene deletion in mice is crucial in determining gene function in adipocyte homeostasis and the development of obesity. We noted 100% mortality when the Hdac3 gene was conditionally deleted using Fabp4-Cre mice, the most commonly used model of adipose-targeted Cre recombinase. However, this surprising result was not reproduced using other models of adipose targeting of Cre, including a novel Retn-Cre mouse. These findings underscore the need for caution when interpreting data obtained using Fabp4-Cre mice and should encourage the use of additional or alternative adipose-targeting Cre mouse models before drawing conclusions about in vivo adipocyte-specific functions. PMID:23192980

  1. Immunogenic response induced by wzm and wzt gene deletion mutants from Brucella abortus S19.

    PubMed

    Wang, Xiu-Ran; Yan, Guang-Mou; Zhang, Rui; Lang, Xu-Long; Yang, Yan-Ling; Li, Xiao-Yan; Chen, Si; Qian, Jing; Wang, Xing-Long

    2014-02-01

    Brucellosis is an infectious disease affecting humans and animals worldwide. Effective methods of control include inducing immunity in animals by vaccination and elimination. Brucella abortus S19 is one of the popular vaccines for control of cattle brucellosis, as it has low virulence. In this paper, allelic exchange plasmids of wzm and wzt genes were constructed and partially knocked out to evaluate the effects on the induction of immunity to Brucella abortus S19 mutants. Cytokine secretion in vitro, INF-γ induction in vivo and antibody dynamics were evaluated. These data suggested that the immunity-eliciting ability of the wzm and wzt gene deletion mutants was similar, although reduced compared with the S19 strain. The results demonstrated that the wzt gene may be more important in the regulation of the induction of immunity than the wzm gene. PMID:24247358

  2. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System

    PubMed Central

    Min, Kyunghun; Ichikawa, Yuichi

    2016-01-01

    ABSTRACT Clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated gene 9 (CRISPR-Cas9) systems are used for a wide array of genome-editing applications in organisms ranging from fungi to plants and animals. Recently, a CRISPR-Cas9 system has been developed for the diploid fungal pathogen Candida albicans; the system accelerates genetic manipulation dramatically [V. K. Vyas, M. I. Barrasa, and G. R. Fink, Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. We show here that the CRISPR-Cas9 genetic elements can function transiently, without stable integration into the genome, to enable the introduction of a gene deletion construct. We describe a transient CRISPR-Cas9 system for efficient gene deletion in C. albicans. Our observations suggest that there are two mechanisms that lead to homozygous deletions: (i) independent recombination of transforming DNA into each allele and (ii) recombination of transforming DNA into one allele, followed by gene conversion of the second allele. Our approach will streamline gene function analysis in C. albicans, and our results indicate that DNA can function transiently after transformation of this organism. IMPORTANCE The fungus Candida albicans is a major pathogen. Genetic analysis of this organism has revealed determinants of pathogenicity, drug resistance, and other unique biological features, as well as the identities of prospective drug targets. The creation of targeted mutations has been greatly accelerated recently through the implementation of CRISPR genome-editing technology by Vyas et al. [Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. In this study, we find that CRISPR elements can be expressed from genes that are present only transiently, and we develop a transient CRISPR system that further accelerates C. albicans genetic manipulation. PMID:27340698

  3. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area.

    PubMed

    Wu, Hao; Xu, Feng-Lei; Yin, Yong; Da, Peng; You, Xiao-Dong; Xu, Hui-Min; Tang, Yan

    2015-08-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate-early genes (IEGs) was reported to correlate with neuronal activity, in particular activity-regulated cytoskeleton-associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N-methyl D-aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post-cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  4. Mapping of Brain Activity by Automated Volume Analysis of Immediate Early Genes.

    PubMed

    Renier, Nicolas; Adams, Eliza L; Kirst, Christoph; Wu, Zhuhao; Azevedo, Ricardo; Kohl, Johannes; Autry, Anita E; Kadiri, Lolahon; Umadevi Venkataraju, Kannan; Zhou, Yu; Wang, Victoria X; Tang, Cheuk Y; Olsen, Olav; Dulac, Catherine; Osten, Pavel; Tessier-Lavigne, Marc

    2016-06-16

    Understanding how neural information is processed in physiological and pathological states would benefit from precise detection, localization, and quantification of the activity of all neurons across the entire brain, which has not, to date, been achieved in the mammalian brain. We introduce a pipeline for high-speed acquisition of brain activity at cellular resolution through profiling immediate early gene expression using immunostaining and light-sheet fluorescence imaging, followed by automated mapping and analysis of activity by an open-source software program we term ClearMap. We validate the pipeline first by analysis of brain regions activated in response to haloperidol. Next, we report new cortical regions downstream of whisker-evoked sensory processing during active exploration. Last, we combine activity mapping with axon tracing to uncover new brain regions differentially activated during parenting behavior. This pipeline is widely applicable to different experimental paradigms, including animal species for which transgenic activity reporters are not readily available. PMID:27238021

  5. Role of Immediate-Early Genes in Synaptic Plasticity and Neuronal Ensembles Underlying the Memory Trace

    PubMed Central

    Minatohara, Keiichiro; Akiyoshi, Mika; Okuno, Hiroyuki

    2016-01-01

    In the brain, neuronal gene expression is dynamically changed in response to neuronal activity. In particular, the expression of immediate-early genes (IEGs) such as egr-1, c-fos, and Arc is rapidly and selectively upregulated in subsets of neurons in specific brain regions associated with learning and memory formation. IEG expression has therefore been widely used as a molecular marker for neuronal populations that undergo plastic changes underlying formation of long-term memory. In recent years, optogenetic and pharmacogenetic studies of neurons expressing c-fos or Arc have revealed that, during learning, IEG-positive neurons encode and store information that is required for memory recall, suggesting that they may be involved in formation of the memory trace. However, despite accumulating evidence for the role of IEGs in synaptic plasticity, the molecular and cellular mechanisms associated with this process remain unclear. In this review, we first summarize recent literature concerning the role of IEG-expressing neuronal ensembles in organizing the memory trace. We then focus on the physiological significance of IEGs, especially Arc, in synaptic plasticity, and describe our hypotheses about the importance of Arc expression in various types of input-specific circuit reorganization. Finally, we offer perspectives on Arc function that would unveil the role of IEG-expressing neurons in the formation of memory traces in the hippocampus and other brain areas. PMID:26778955

  6. Modeling the Kinetics of a Memory-Associated Immediate Early Gene's Compartmental Expression After Sensory Experience

    NASA Astrophysics Data System (ADS)

    Willats, Adam; Ivanova, Tamara; Prinz, Astrid; Liu, Robert

    2015-03-01

    Immediate Early Genes (IEGs) are rapidly and transiently transcribed in neurons after a sensory experience. Some of these genes act as effector IEGs, which mediate specific effects on cellular function. Arc is one such effector IEG that is essential for synaptic plasticity and memory consolidation in hippocampus and cortex. The expression of Arc in neurons has previously been examined using an imaging method known as Compartmental Analysis of Temporal Fluorescent In-Situ Hybridization. Previous work found that the time course of Arc expression within the nuclear and perinuclear cytoplasmic compartments of a neuron is altered by prior sensory experience. We explore a simple model of the kinetics of IEG transcription and nuclear export, with the aim of eventually uncovering possible mechanisms for how experience alters expression kinetics. Thus far, we characterize our compartmental model using phase-plane analysis and validate it against several IEG expression data sets, including one where prior experience with vocalizing mice alters the time course of call-induced Arc expression in the auditory cortex of a listening mouse. Our model provides a framework to explore why Arc expression may change depending on a receiver's past sound experience and internal state. Adam Willats was supported by NIH Training Grant 5T90DA032466. This research was also supported by NIDCD R01 DC8343.

  7. Salicylate-induced changes in immediate-early genes in the hippocampal CA1 area

    PubMed Central

    WU, HAO; XU, FENG-LEI; YIN, YONG; DA, PENG; YOU, XIAO-DONG; XU, HUI-MIN; TANG, YAN

    2015-01-01

    Studies have suggested that salicylate affects neuronal function via interactions with specific membrane channels/receptors. However, the effect of salicylate on activity and synaptic morphology of the hippocampal Cornu Ammonis (CA) 1 area remains to be elucidated. The activation of immediate-early genes (IEGs) was reported to correlate with neuronal activity, in particular activity-regulated cytoskeleton-associated protein and early growth response gene 1. The aim of the present study was to evaluate the expression of these IEGs, as well that of N-methyl D-aspartate (NMDA) receptor subunit 2B in rats following acute and chronic salicylate treatment. Protein and messenger RNA levels of all three genes were increased in rats following chronic administration of salicylate (300 mg/kg for 10 days), returning to baseline levels 14 days post-cessation of treatment. The transient upregulation of gene expression following treatment was accompanied by ultrastructural alterations in hippocampal CA1 area synapses. An increase in synaptic interface curvature was observed as well as an increased number of presynaptic vesicles; in addition, postsynaptic densities thickened and lengthened. In conclusion, the results of the present study indicated that chronic exposure to salicylate may lead to structural alteration of hippocampal CA1 neurons, and it was suggested that this process occurs through induced expression of IEGs via NMDA receptor activation. PMID:25873216

  8. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  9. TISSUE-PLASMINOGEN ACTIVATOR IS INDUCED AS AN IMMEDIATE-EARLY GENE DURING SEIZURE, KINDLING, AND LONG-TERM POTENTIATION

    EPA Science Inventory

    Activity-dependent genes in brain have been identified using differential screening of hippocampal cDNA library from rats exposed to metrazol seizures under conditions of superconduction. Five immediate early genes whose expression is elevated by neural activity were identified. ...

  10. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  11. A Form of Perforant Path LTP Can Occur without ERK1/2 Phosphorylation or Immediate Early Gene Induction

    ERIC Educational Resources Information Center

    Steward, Oswald; Huang, Fen; Guzowski, John F.

    2007-01-01

    Stimulation paradigms that induce perforant path long-term potentiation (LTP) initiate phosphorylation of ERK1/2 and induce expression of a variety of immediate early genes (IEGs). These events are thought to be critical components of the mechanism for establishing the changes in synaptic efficacy that endure for hours or longer. Here we show that…

  12. Impact of UGT2B17 Gene Deletion on the Pharmacokinetics of 17-Hydroexemestane in Healthy Volunteers.

    PubMed

    Chen, Shanly M; Atchley, Daniel H; Murphy, Michael A; Gurley, Bill J; Kamdem, Landry K

    2016-07-01

    Exemestane is an aromatase inhibitor drug used for the treatment of hormone-dependent breast cancer. 17-Hydroexemestane, the major and biologically active metabolite of exemestane in humans, is eliminated via glucuronidation by the polymorphic UGT2B17 phase II drug-metabolizing enzyme. Previous microsomal studies have shown that UGT2B17 gene deletion affects the intrinsic hepatic clearances of 17-hydroexemestane in vitro. In this open-label study we set out to assess the effect of UGT2B17 gene deletion on the pharmacokinetics of 17-hydroexemestane in healthy female volunteers with and without UGT2B17. To achieve this goal, 14 healthy postmenopausal women (8 carriers of the homozygous UGT2B17 wild-type allele and 6 carriers of the homozygous UGT2B17 gene-deletion allele) were enrolled and invited to receive a single 25-mg oral dose of exemestane. Pharmacokinetics was assessed over 72 hours postdosing. Our results showed that there were statistically significant differences in plasma 17-hydroexemestane AUC0-∞ (P = .0007) and urine 17-hydroexemestane C24h (P = .001) between UGT2B17 genotype groups. Our data suggest that UGT2B17 gene deletion influences 17-hydroexemestane pharmacokinetics in humans. PMID:26608382

  13. A self-excising beta-recombinase/six cassette for repetitive gene deletion and homokaryon purification in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a previous study we developed a cassette employing a bacterial beta-recombinase acting on six recognition sequences (beta-rec/six), which allowed repetitive site-specific gene deletion and marker recycling in Neurospora crassa. However, only one positive selection marker was used in the cassette...

  14. Structural organization, expression, and functional characterization of the murine cytomegalovirus immediate-early gene 3.

    PubMed Central

    Messerle, M; Bühler, B; Keil, G M; Koszinowski, U H

    1992-01-01

    We have previously defined ie3 as a coding region located downstream of the ie1 gene which gives rise to a 2.75-kb immediate-early (IE) transcript. Here we describe the structural organization of the ie3 gene, the amino acid sequence of the gene product, and some of the functional properties of the protein. The 2.75-kb ie3 mRNA is generated by splicing and is composed of four exons. The first three exons, of 300, 111, and 191 nucleotides (nt), are shared with the ie1 mRNA and are spliced to exon 5, which is located downstream of the fourth exon used by the ie1 mRNA. Exon 5 starts 28 nt downstream of the 3' end of the ie1 mRNA and has a length of 1,701 nt. The IE3 protein contains 611 amino acids, the first 99 of which are shared with the ie1 product pp89. The IE3 protein expressed at IE times has a relative mobility of 88 kDa in gels, and a mobility shift to 90 kDa during the early phase is indicative of posttranslational modification. Sequence comparison reveals significant homology of the exon 5-encoded amino acid sequence with the respective sequence of UL 122, a component of the IE1-IE2 complex of human cytomegalovirus (HCMV). This homology is also apparent at the functional level. The IE3 protein is a strong transcriptional activator of the murine cytomegalovirus (MCMV) e1 promoter and shows an autoregulatory function by repression of the MCMV ie1/ie3 promoter. The high degree of conservation between the MCMV ie3 and HCMV IE2 genes and their products with regard to gene structure, amino acid sequence, and protein functions suggests that these genes play a comparable role in the transcriptional control of the two cytomegaloviruses. Images PMID:1309246

  15. Mapping memory function in the medial temporal lobe with the immediate-early gene Arc.

    PubMed

    Sauvage, Magdalena M; Nakamura, Nozomu H; Beer, Zachery

    2013-10-01

    For the past two decades an increasing number of studies have underlined the crucial role of the immediate - early gene Arc in plasticity processes thought to sustain memory function. Because of the high spatial and temporal resolution of this technique, the detection of Arc products appears to have become a new standard for the mapping of cognitive processes. To date, most Arc studies have focused on identifying the contribution of the hippocampal subfields CA1 and CA3 to spatial processes. In contrast, few have investigated their role in non-spatial memory, or the role of other medial temporal lobe (MTL) areas in spatial and non-spatial memory. This short review describes recent studies focusing on these issues. After a brief overview of Arc's functions, we report a set of studies that put to the test some well-accepted theories in recognition memory. First, we describe data indicating that the parahippocampal areas may not be strictly segregated into spatial and non-spatial streams, as originally described. Second, we report findings revealing a functional segregation along the dorsoventral axis in CA1, but not in CA3. Finally, we bring evidence for a segregation of CA3 along the proximodistal axis and discuss the involvement of a proximal CA3-distal CA1 network during non-spatial memory. In summary, 'Arc imaging' appears to be a powerful tool to identify neural substrates of cognitive processes, not only in the hippocampus but also in the remaining of the MTL. Moreover, because of its fundamental role in synaptic processes, it offers a rare and exciting opportunity to further bridge plasticity processes and memory function. PMID:23648768

  16. Maturation of coordinated immediate early gene expression by cocaine during adolescence.

    PubMed

    Caster, J M; Kuhn, C M

    2009-04-21

    Adolescence may be a critical period for drug addiction. Young adolescent male rats have greater locomotor responses than adults after acute low dose cocaine administration. Further, repeated cocaine administration produces as much or more conditioned place preference but reduced locomotor sensitization in adolescents compared to adults. Acute activation of neurons by cocaine induces long-term changes in behavior by activating transcriptional complexes. The purpose of the present study was to correlate cocaine-induced locomotor activity with neuronal activation in subregions of the striatum and cortex by acute cocaine in young adolescent (postnatal (PN) 28) and adult (PN 65) male rats by measuring the induction of the plasticity-associated immediate early genes (IEGs) c-fos and zif268 using in situ hybridization. Animals were treated with saline, low (10 mg/kg), or high (40 mg/kg) dose cocaine in locomotor activity chambers and killed 30 min later. Low dose cocaine induced more locomotor activity and striatal c-fos expression in adolescents than adults whereas high dose cocaine induced more locomotor activity, striatal c-fos, and striatal zif268 expression in adults. Locomotor activity correlated with the expression of both genes in adults but correlated with striatal c-fos only in adolescents. Finally, there was a significant correlation between the expression of c-fos and zif268 in the adult striatum but not in adolescents. Our results suggest that the coordinated expression of transcription factors by cocaine continues to develop during adolescence. The immature regulation of transcription factors by cocaine could explain why adolescents show unique sensitivity to specific long-term behavioral alterations following cocaine treatment. PMID:19245875

  17. The immediate early gene Egr3 mediates adaptation to stress and novelty

    PubMed Central

    Gallitano-Mendel1, Amelia; Izumi, Yukitoshi; Tokuda, Kazuhiro; Zorumski, Charles F.; Howell, Maureen P.; Muglia, Louis J.; Wozniak, David F.; Milbrandt, Jeffrey

    2007-01-01

    Stress and exploration of novel environments induce neural expression of immediate early gene transcription factors (IEG-TFs). However, as yet no IEG-TF has been shown to be required for the normal biological or behavioral responses to these stimuli. Here we show that mice deficient for the IEG-TF early growth response gene (Egr) 3, display accentuated behavioral responses to the mild stress of handling paralleled by increased release of the stress hormone corticosterone. Egr3−/− mice also display abnormal responses to novelty, including heightened reactivity to novel environments and failure to habituate to social cues or startling acoustic stimuli. In a Y-maze spontaneous alternation task, they perform fewer sequential arm entries than controls, suggesting defects in immediate memory. Because stress and novelty stimulate hippocampal long-term depression (LTD), and because abnormalities in habituation to novelty and Y-maze performance have been associated with LTD deficits, we examined this form of synaptic plasticity in Egr3−/− mice. We found that Egr3−/− mice fail to establish hippocampal LTD in response to low frequency stimulation and exhibit dysfunction of an ifenprodil-sensitive (NR1/NR2B) NMDA receptor subclass. LTP induction was not altered. The NR2B-dependent dysfunction does not result from transcriptional regulation of this subunit by Egr3, because NR2B mRNA levels did not differ in the hippocampi of Egr3−/− and control mice. These findings are the first demonstration of the requirement for an IEG-TF in mediating the response to stress and novelty, and in the establishment of LTD. PMID:17692471

  18. Impact of UGT2B17 gene deletion on the steroid profile of an athlete.

    PubMed

    Martín-Escudero, Pilar; Muñoz-Guerra, Jesús; Del Prado, Nayade; Galindo Canales, Mercedes; Fuentes Ferrer, Manuel; Vargas, Soledad; Soldevilla, Ana B; Serrano-Garde, Ester; Miguel-Tobal, Francisco; Maestro de Las Casas, Marisa; Fernandez-Pérez, Cristina

    2015-12-01

    The measurement of the testosterone to epitestosterone ratio (T/E ratio) in urine is often used as a marker for testosterone administration in the doping control field. This study examines the frequencies of the different expression forms of the UGT2B17 gene, and assesses their effects on this marker in volunteer subjects. The sample for this descriptive study was composed of male and female athletes aged between 16 and 55 years old who practiced different sports disciplines. All participants underwent a sports-medical physical examination, and subsequently provided 10 urine samples consecutively over a period of 48 h. The dependent variable examined was T/E and the main independent variable was the UGT2B17 gene polymorphism. During 1 year, 1410 urine samples were obtained from 141 athletes. The frequencies of the three genotypes were as follows: wt homozygotes (ins/ins) 48.2% (n = 68), mutant homozygotes (del/del) 12.1% (n = 17), and heterozygotes (ins/del) 39.7% (n = 56). Genotype distributions varied significantly (P < 0.001) according to ethnicity, 80% of Asian subjects being homozygous for the gene deletion (del/del) compared to 6.9% of Caucasian subjects. A multivariate analysis adjusted for genotype, age, sex, and sports discipline revealed that athletes with the del/del polymorphism showed a significantly lower mean T/E than heterozygotes (ins/del). In contrast, homozygous athletes for the gene insertion (ins/ins) showed higher mean T/E ratios than heterozygotes (ins/del). UGT2B17 gene deletion has a strong influence on the T/E ratio in urine, which is the most efficient indicator of testosterone prohormone misuse. Others factors studied seem not to have such an impact. The genotyping of UGT2B17 is an important source of information for understanding steroid profiling in the doping control field; therefore it is suggested that it be included in the Athletes Biological Passport. PMID:26668303

  19. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9.

    PubMed

    Carroll, Kelli J; Makarewich, Catherine A; McAnally, John; Anderson, Douglas M; Zentilin, Lorena; Liu, Ning; Giacca, Mauro; Bassel-Duby, Rhonda; Olson, Eric N

    2016-01-12

    Clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)9 genomic editing has revolutionized the generation of mutant animals by simplifying the creation of null alleles in virtually any organism. However, most current approaches with this method require zygote injection, making it difficult to assess the adult, tissue-specific functions of genes that are widely expressed or which cause embryonic lethality when mutated. Here, we describe the generation of cardiac-specific Cas9 transgenic mice, which express high levels of Cas9 in the heart, but display no overt defects. In proof-of-concept experiments, we used Adeno-Associated Virus 9 (AAV9) to deliver single-guide RNA (sgRNA) that targets the Myh6 locus exclusively in cardiomyocytes. Intraperitoneal injection of postnatal cardiac-Cas9 transgenic mice with AAV9 encoding sgRNA against Myh6 resulted in robust editing of the Myh6 locus. These mice displayed severe cardiomyopathy and loss of cardiac function, with elevation of several markers of heart failure, confirming the effectiveness of this method of adult cardiac gene deletion. Mice with cardiac-specific expression of Cas9 provide a tool that will allow rapid and accurate deletion of genes following a single injection of AAV9-sgRNAs, thereby circumventing embryonic lethality. This method will be useful for disease modeling and provides a means of rapidly editing genes of interest in the heart. PMID:26719419

  20. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1

    PubMed Central

    de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean

    2008-01-01

    We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

  1. Protective effect of myostatin gene deletion on aging-related muscle metabolic decline.

    PubMed

    Chabi, B; Pauly, M; Carillon, J; Carnac, G; Favier, F B; Fouret, G; Bonafos, B; Vanterpool, F; Vernus, B; Coudray, C; Feillet-Coudray, C; Bonnieu, A; Lacan, D; Koechlin-Ramonatxo, C

    2016-06-01

    While myostatin gene deletion is a promising therapy to fight muscle loss during aging, this approach induces also skeletal muscle metabolic changes such as mitochondrial deficits, redox alteration and increased fatigability. In the present study, we evaluated the effects of aging on these features in aged wild-type (WT) and mstn knockout (KO) mice. Moreover, to determine whether an enriched-antioxidant diet may be useful to prevent age-related disorders, we orally administered to the two genotypes a melon concentrate rich in superoxide dismutase for 12 weeks. We reported that mitochondrial functional abnormalities persisted (decreased state 3 and 4 of respiration; p<0.05) in skeletal muscle from aged KO mice; however, differences with WT mice were attenuated at old age in line with reduced difference on running endurance between the two genotypes. Interestingly, we showed an increase in glutathione levels, associated with lower lipid peroxidation levels in KO muscle. Enriched antioxidant diet reduced the aging-related negative effects on maximal aerobic velocity and running limit time (p<0.05) in both groups, with systemic adaptations on body weight. The redox status and the hypertrophic phenotype appeared to be beneficial to KO mice, mitigating the effect of aging on the skeletal muscle metabolic remodeling. PMID:26944368

  2. Underlying Mechanisms of Memory Deficits Induced by Etomidate Anesthesia in Aged Rat Model: Critical Role of Immediate Early Genes

    PubMed Central

    Li, Xu; Lu, Fen; Li, Wei; Xu, Jun; Sun, Xiao-Jing; Qin, Ling-Zhi; Zhang, Qian-Lin; Yao, Yong; Yu, Qing-Kai; Liang, Xin-Liang

    2016-01-01

    Background: Etomidate (R-1-[1-ethylphenyl] imidazole-5-ethyl ester) is a widely used anesthetic drug that had been reported to contribute to cognitive deficits after general surgery. However, its underlying mechanisms have not been fully elucidated. In this study, we aimed to explore the neurobiological mechanisms of cognitive impairments that caused by etomidate. Methods: A total of 30 Sprague-Dawley rats were used and divided into two groups randomly to receive a single injection of etomidate or vehicle. Then, the rats’ spatial memory ability and neuronal survival were evaluated using the Morris water maze test and Nissl staining, respectively. Furthermore, we analyzed levels of oxidative stress, as well as cyclic adenosine 3’,5’-monophosphate response element-binding (CREB) protein phosphorylation and immediate early gene (IEG, including Arc, c-fos, and Egr1) expression levels using Western blot analysis. Results: Compared with vehicle-treated rats, the etomidate-treated rats displayed impaired spatial learning (day 4: 27.26 ± 5.33 s vs. 35.52 ± 3.88 s, t = 2.988, P = 0.0068; day 5: 15.84 ± 4.02 s vs. 30.67 ± 4.23 s, t = 3.013, P = 0.0057; day 6: 9.47 ± 2.35 s vs. 25.66 ± 4.16 s, t = 3.567, P = 0.0036) and memory ability (crossing times: 4.40 ± 1.18 vs. 2.06 ± 0.80, t = 2.896, P = 0.0072; duration: 34.00 ± 4.24 s vs. 18.07 ± 4.79 s, t = 3.023, P = 0.0053; total swimming distance: 40.73 ± 3.45 cm vs. 27.40 ± 6.56 cm, t = 2.798, P = 0.0086) but no neuronal death. Furthermore, etomidate did not cause oxidative stress or deficits in CREB phosphorylation. The levels of multiple IEGs (Arc: vehicle treated rats 100%, etomidate treated rats 86%, t = 2.876, P = 0.0086; c-fos: Vehicle treated rats 100%, etomidate treated rats 72%, t = 2.996, P = 0.0076; Egr1: Vehicle treated rats 100%, etomidate treated rats 58%, t = 3.011, P = 0.0057) were significantly reduced in hippocampi of etomidate-treated rats. Conclusion: Our data suggested that etomidate might

  3. The 6-Aminoquinolone WC5 Inhibits Human Cytomegalovirus Replication at an Early Stage by Interfering with the Transactivating Activity of Viral Immediate-Early 2 Protein ▿ †

    PubMed Central

    Loregian, Arianna; Mercorelli, Beatrice; Muratore, Giulia; Sinigalia, Elisa; Pagni, Silvana; Massari, Serena; Gribaudo, Giorgio; Gatto, Barbara; Palumbo, Manlio; Tabarrini, Oriana; Cecchetti, Violetta; Palù, Giorgio

    2010-01-01

    WC5 is a 6-aminoquinolone that potently inhibits the replication of human cytomegalovirus (HCMV) but has no activity, or significantly less activity, against other herpesviruses. Here we investigated the nature of its specific anti-HCMV activity. Structure-activity relationship studies on a small series of analogues showed that WC5 possesses the most suitable pattern of substitutions around the quinolone scaffold to give potent and selective anti-HCMV activity. Studies performed to identify the possible target of WC5 indicated that it prevents viral DNA synthesis but does not significantly affect DNA polymerase activity. In yield reduction experiments with different multiplicities of infection, the anti-HCMV activity of WC5 appeared to be highly dependent on the viral inoculum, suggesting that WC5 may act at an initial stage of virus replication. Consistently, time-of-addition and time-of-removal studies demonstrated that WC5 affects a phase of the HCMV replicative cycle that precedes viral DNA synthesis. Experiments to monitor the effects of the compound on virus attachment and entry showed that it does not inhibit either process. Evaluation of viral mRNA and protein expression revealed that WC5 targets an event of the HCMV replicative cycle that follows the transcription and translation of immediate-early genes and precedes those of early and late genes. In cell-based assays to test the effects of WC5 on the transactivating activity of the HCMV immediate-early 2 (IE2) protein, WC5 markedly interfered with IE2-mediated transactivation of viral early promoters. Finally, WC5 combined with ganciclovir in checkerboard experiments exhibited highly synergistic activity. These findings suggest that WC5 deserves further investigation as a candidate anti-HCMV drug with a novel mechanism of action. PMID:20194695

  4. Varicella-zoster virus open reading frame 4 encodes an immediate-early protein with posttranscriptional regulatory properties.

    PubMed Central

    Defechereux, P; Debrus, S; Baudoux, L; Rentier, B; Piette, J

    1997-01-01

    Varicella-zoster virus (VZV) encodes four putative immediate-early proteins based on sequence homology with herpes simplex virus type 1: the products of ORF4, -61, -62, and -63. Until now, only two VZV proteins have been described as being truly expressed with immediate-early kinetics (IE62 and IE63). The ORF4-encoded protein can stimulate gene expression either alone or in synergy with the major regulatory protein IE62. Making use of a sequential combination of transcription and protein synthesis inhibitors (actinomycin D and cycloheximide, respectively), we demonstrated the immediate-early nature of the ORF4 gene product, which can thus be named IE4. The fact that IE4 is expressed with kinetics similar to that of IE62 further underlines the possible cooperation between these two VZV proteins in gene expression. Analysis of the IE4-mediated autologous or heterologous viral gene expression at the mRNA levels clearly indicated that IE4 may have several mechanisms of action. Activation of the two VZV genes tested could occur partly by a posttranscriptional mechanism, since increases in chloramphenicol acetyltransferase (CAT) mRNA levels do not account for the stimulation of CAT activity. On the other hand, stimulation of the human immunodeficiency virus type 1 long terminal repeat- or the cytomegalovirus promoter-associated CAT activity is correlated with an increase in the corresponding CAT mRNA. PMID:9261438

  5. Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells.

    PubMed Central

    Chapman, B S; Thayer, R M; Vincent, K A; Haigwood, N L

    1991-01-01

    A 2.4 kb fragment of hCMV (Towne strain), containing the 5' end of the major immediate-early gene, has been cloned, sequenced, and used to construct a series of mammalian cell expression plasmids. The effects of regulatory regions present on this fragment were assessed using human glycoproteins as reporter molecules. We compared secreted levels of Factor VIII, t-PA, and HIV-1 envelope glycoproteins in cells transfected with plasmids in which intron A of the immediate-early gene was present or absent. Secretion of several glycoproteins was significantly higher when cells were transfected with intron A-containing plasmids. Mutation of three basepairs in the strong nuclear factor 1 (NF1) binding site in intron A led to reduced transient expression levels, but not to the level observed in the absence of intron A. Reduced expression from NF1 mutant plasmids was roughly correlated with reduced binding in vitro of NF1 proteins to a synthetic oligonucleotide containing the mutation. The evidence indicates that sequences in intron A positively regulate expression from the hCMV immediate-early enhancer/promoter in transformed monkey kidney cells. Images PMID:1650459

  6. Protein Kinase Cδ Blocks Immediate-Early Gene Expression in Senescent Cells by Inactivating Serum Response Factor

    PubMed Central

    Wheaton, Keith; Riabowol, Karl

    2004-01-01

    Fibroblasts lose the ability to replicate in response to growth factors and become unable to express growth-associated immediate-early genes, including c-fos and egr-1, as they become senescent. The serum response factor (SRF), a major transcriptional activator of immediate-early gene promoters, loses the ability to bind to the serum response element (SRE) and becomes hyperphosphorylated in senescent cells. We identify protein kinase C delta (PKCδ) as the kinase responsible for inactivation of SRF both in vitro and endogenously in senescent cells. This is due to a higher level of PKCδ activity as cells age, production of the PKCδ catalytic fragment, and its nuclear localization in senescent but not in low-passage-number cells. The phosphorylation of T160 of SRF by PKCδ in vitro and in vivo led to loss of SRF DNA binding activity. Both the PKCδ inhibitor rottlerin and ectopic expression of a dominant negative form of PKCδ independently restored SRE-dependent transcription and immediate-early gene expression in senescent cells. Modulation of PKCδ activity in vivo with rottlerin or bistratene A altered senescent- and young-cell morphology, respectively. These observations support the idea that the coordinate transcriptional inhibition of several growth-associated genes by PKCδ contributes to the senescent phenotype. PMID:15282327

  7. TRPV1 gene deletion exacerbates inflammation and atypical cardiac remodeling after myocardial infarction

    PubMed Central

    Huang, Wei; Rubinstein, Jack; Prieto, Alejandro R.; Thang, Loc Vinh; Wang, Donna H.

    2009-01-01

    The transient receptor potential vanilloid (TRPV1) channels expressed in sensory afferent fibers innervating the heart may be activated by proton or endovanilloids released during myocardial ischemia (MI), leading to angina. Although our previous in vitro data indicate that TRPV1 activation may preserve cardiac function after ischemia-reperfusion (I/R) injury, the underlying mechanisms are largely unknown. To test the hypothesis that TRPV1 modulates inflammatory and early remodeling processes to prevent cardiac functional deterioration after myocardial infarction, TRPV1-null mutant (TRPV1-/-) and wild-type (WT) mice were subjected to left anterior descending coronary ligation or sham operation. The infarct size was greater in TRPV1-/- than in WT mice (P < 0.001) 3 days after MI, and the mortality rate was higher in TRPV1-/- than in WT mice (P < 0.05) 7 days after MI. The levels of plasma cardiac troponin I; cytokines including TNF-α, IL-1β, and IL-6; chemokines including MCP-1 and MIP-2; infiltration of inflammatory cells including neutrophil, macrophage, and myofibroblast; as well as collagen contents were greater in TRPV1-/- than in WT mice (P < 0.05) in the infarct area on day 3 and 7 after MI. Changes in left ventricular (LV) geometry led to increased end-systolic and -diastolic diameters and reduced contractile function in TRPV1-/- compared to WT mice. These data show that TRPV1 gene deletion results in excessive inflammation, disproportional LV remodeling, and deteriorated cardiac function after MI, indicating that TRPV1 may prevent infarct expansion and cardiac injury by inhibiting inflammation and abnormal tissue remodeling. PMID:19114647

  8. Gene Deletion of nos2 Protects Against Manganese-Induced Neurological Dysfunction in Juvenile Mice

    PubMed Central

    Streifel, Karin M.; Moreno, Julie A.; Hanneman, William H.; Legare, Marie E.; Tjalkens, Ronald B.

    2012-01-01

    The mechanisms underlying cognitive and neurobehavioral abnormalities associated with childhood exposure to manganese (Mn) are not well understood but may be influenced by neuroinflammatory activation of microglia and astrocytes that results in nitrosative stress due to expression of inducible nitric oxide synthase (iNOS/NOS2). We therefore postulated that gene deletion of NOS2 would protect against the neurotoxic effects of Mn in vivo and in vitro. Juvenile NOS2 knockout (NOS2−/−) mice were orally exposed to 50 mg/kg of MnCl2 by intragastric gavage from days 21 to 34 postnatal. Results indicate that NOS2−/− mice exposed to Mn were protected against neurobehavioral alterations, despite histopathological activation of astrocytes and microglia in Mn-treated mice in both genotypes. NOS2−/− mice had decreased Mn-induced formation of 3-nitrotyrosine protein adducts within neurons in the basal ganglia that correlated with protection against Mn-induced neurobehavioral defects. Primary striatal astrocytes from wildtype mice caused apoptosis in cocultured striatal neurons following treatment with MnCl2 and tumor necrosis factor-α, whereas NOS2−/− astrocytes failed to cause any increase in markers of apoptosis in striatal neurons. Additionally, scavenging nitric oxide (NO) with 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (PTIO) prevented the ability of Mn- and cytokine-treated wildtype astrocytes to cause apoptosis in cocultured striatal neurons. These data demonstrate that NO plays a crucial role in Mn-induced neurological dysfunction in juvenile mice and that NOS2 expression in activated glia is an important mediator of neuroinflammatory injury during Mn exposure. PMID:22174044

  9. Gene Deletion by Fluorescence-Reported Allelic Exchange Mutagenesis in Chlamydia trachomatis

    PubMed Central

    Mueller, Konrad E.; Wolf, Katerina

    2016-01-01

    ABSTRACT Although progress in Chlamydia genetics has been rapid, genomic modification has previously been limited to point mutations and group II intron insertions which truncate protein products. The bacterium has thus far been intractable to gene deletion or more-complex genomic integrations such as allelic exchange. Herein, we present a novel suicide vector dependent on inducible expression of a chlamydial gene that renders Chlamydia trachomatis fully genetically tractable and permits rapid reverse genetics by fluorescence-reported allelic exchange mutagenesis (FRAEM). We describe the first available system of targeting chlamydial genes for deletion or allelic exchange as well as curing plasmids from C. trachomatis serovar L2. Furthermore, this approach permits the monitoring of mutagenesis by fluorescence microscopy without disturbing bacterial growth, a significant asset when manipulating obligate intracellular organisms. As proof of principle, trpA was successfully deleted and replaced with a sequence encoding both green fluorescent protein (GFP) and β-lactamase. The trpA-deficient strain was unable to grow in indole-containing medium, and this phenotype was reversed by complementation with trpA expressed in trans. To assess reproducibility at alternate sites, FRAEM was repeated for genes encoding type III secretion effectors CTL0063, CTL0064, and CTL0065. In all four cases, stable mutants were recovered one passage after the observation of transformants, and allelic exchange was limited to the specific target gene, as confirmed by whole-genome sequencing. Deleted sequences were not detected by quantitative real-time PCR (qPCR) from isogenic mutant populations. We demonstrate that utilization of the chlamydial suicide vector with FRAEM renders C. trachomatis highly amenable to versatile and efficient genetic manipulation. PMID:26787828

  10. OMP gene deletion results in an alteration in odorant-induced mucosal activity patterns.

    PubMed

    Youngentob, S L; Kent, P F; Margolis, F L

    2003-12-01

    Previous behavioral work, using a complex five-odorant identification task, demonstrated that olfactory marker protein (OMP) is critically involved in odor processing to the extent that its loss results in an alteration in odorant quality perception. Exactly how the lack of OMP exerts its influence on the perception of odorant quality is unknown. However, there is considerable neurophysiological evidence that different odorants produce different spatiotemporal patterns of neural activity at the level of the mucosa and that these patterns predict the psychophysically determined perceptual relationship among odorants. In this respect, OMP gene deletion is known to result in a constellation of physiologic defects (i.e., marked reduction in the electroolfactogram (EOG) and altered response and recovery kinetics) that would be expected to alter the odorant-induced spatiotemporal activity patterns that are characteristic of different odorants. This, in turn, would be expected to alter the spatiotemporal patterning of information that results from the mucosal projection onto the bulb, thereby changing odorant quality perception. To test the hypothesis that odorant-induced mucosal activity patterns are altered in mice lacking the gene for OMP, we optically recorded the fluorescent changes in response to odorant stimulation from both the septum and turbinates of both OMP-null and control mice using a voltage-sensitive dye (di-4-ANEPPS Molecular Probes, Eugene, OR) and a Dalsa 120 x 120, 12-bit CCD camera. To maintain continuity with the previous behavioral work, the odorants 2-propanol, citral, carvone, ethylacetoacetate, and propyl acetate were again used. Each odorant was randomly presented to each mucosal surface in a Latin-Square design. The results of this study demonstrated that, for both mouse strains, there do indeed exist different spatiotemporal activity patterns for different odorants. More importantly, however, these patterns significantly differed between OMP

  11. Total beta-globin gene deletion has high frequency in Filipinos

    SciTech Connect

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  12. Construction of Recombinant Mouse IgG1 Antibody Directed Against Varicella Zoster Virus Immediate Early Protein 63

    PubMed Central

    MUELLER, NIKLAUS H.; GRAF, LAURIE L.; SHEARER, ANDREW J.; OWENS, GREGORY P.; GILDEN, DONALD H.; COHRS, RANDALL J.

    2010-01-01

    Five varicella zoster virus (VZV) genes are known to be transcribed in latently infected human ganglia. Transcripts from VZV gene 63, which encodes an immediate early (IE) protein, are the most prevalent and abundant. To obtain a reagent that might facilitate studies of the role of the IE63 protein in latency and reactivation, we selected an IE63-specific Fab fragment from a phage library and used it to prepare a recombinant mouse IgG1 antibody that detects IE63 and functions in Western blot, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), and immunofluorescence assays. PMID:18294070

  13. Identification and characterization of an Egr ortholog as a neural immediate early gene in the European honeybee (Apis mellifera L.).

    PubMed

    Ugajin, Atsushi; Kunieda, Takekazu; Kubo, Takeo

    2013-10-01

    To date, there are only few reports of immediate early genes (IEGs) available in insects. Aiming at identifying a conserved IEG in insects, we characterized an Egr homolog of the honeybee (AmEgr: Apis mellifera Egr). AmEgr was transiently induced in whole worker brains after seizure induction. In situ hybridization for AmEgr indicated that neural activity of a certain mushroom body (a higher brain center) neuron subtype, which is the same as that we previously identified using another non-coding IEG, termed kakusei, is more enhanced in forager brains. These findings suggest that Egr can be utilized as an IEG in insects. PMID:23994532

  14. PYRETHROID INDUCED ALTERATIONS IN TRANSCRIPTION OF CALCIUM RESPONSIVE AND IMMEDIATE EARLY GENES IN VIVO.

    EPA Science Inventory

    Multiple molecular targets for pyrethroid insecticides have been evaluated in in vitro preparations, including but not limited to voltage-sensitive sodium channels (VSSCs), voltage-sensitive calcium channels (VSCCs), GABAergic receptors, ATPases and mitochondrial respiratory chai...

  15. The superantigen-homologous viral immediate-early gene ie14/vsag in herpesvirus saimiri-transformed human T cells.

    PubMed Central

    Knappe, A; Hiller, C; Thurau, M; Wittmann, S; Hofmann, H; Fleckenstein, B; Fickenscher, H

    1997-01-01

    Herpesvirus saimiri C488 transforms human T lymphocytes to stable growth in culture. The growth-transformed human T cells harbor the viral genome in a nonintegrated episomal form without production of virus particles. In these cells, virus gene expression was previously found to be confined to the transforming genes stpC and tip. In order to analyze virus gene expression in more detail, we applied a subtractive hybridization technique and compared stimulated virus-transformed cells with uninfected parental T cells of the same donor. A number of known T-cell activation genes were isolated. Viral stpC/tip cDNAs were enriched after subtraction. In addition, the viral immediate-early, superantigen-homologous gene ie14/vsag was represented by numerous cDNA clones that comprised the entire spliced transcript. Whereas a weak basal expression of ie14/vsag was detected by reverse transcription-PCR only, the phorbol ester-induced transcripts were readily shown by Northern blotting. ie14/vsag, which before had been classified as a major immediate-early gene of herpesvirus saimiri, is localized within a highly conserved region with extensive homologies to the cellular genome. Mutant viruses without the ie14/vsag gene are replication competent and fully capable of transforming human and marmoset T cells. Since ie14/vsag is transiently expressed after stimulation, it may increase T-cell proliferation in an activation-dependent and superantigen-like but apparently Vbeta-independent way. PMID:9371569

  16. The Immediate Early Gene Product EGR1 and Polycomb Group Proteins Interact in Epigenetic Programming during Chondrogenesis

    PubMed Central

    Caron, Marjolein M. J.; Prickaerts, Peggy; Rofel, Celine; Dahlmans, Vivian E. H.; Surtel, Don A. M.; Paulis, Yvette; Schweizer, Finja; Welting, Tim J. M.; Eijssen, Lars M.; Voncken, Jan Willem

    2013-01-01

    Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3) blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis. PMID:23483971

  17. An Adenovirus Type 5 Mutant with the Preterminal Protein Gene Deleted Efficiently Provides Helper Functions for the Production of Recombinant Adeno-Associated Virus

    PubMed Central

    Maxwell, Ian H.; Maxwell, Francoise; Schaack, Jerome

    1998-01-01

    Production of recombinant adeno-associated virus (rAAV) requires helper functions that have routinely been provided by infection of the producer cells with adenovirus. Complete removal and/or inactivation of progeny adenovirus, present in such rAAV preparations, presents significant difficulty. Here, we report that an adenovirus type 5 (Ad5) mutant with the preterminal protein (pTP) gene deleted can provide helper function for the growth of rAAV. At high multiplicity, Ad5dl308ΔpTP was as efficient as the phenotypically wild-type Ad5dl309 in permitting growth of rAAV. Use of Ad5dl308ΔpTP, which is incapable of replication in the absence of complementation for pTP, as a helper avoids the need to remove contaminating adenovirus infectious activity by heat inactivation or by purification. Comparison of the transducing ability of rAAV generated with either Ad5dl308ΔpTP or Ad5dl309 as a helper demonstrated that the heat inactivation protocol generally used does not remove all of the helper Ad5dl309 function. PMID:9733887

  18. Diverse fission yeast genes required for responding to oxidative and metal stress: Comparative analysis of glutathione-related and other defense gene deletions.

    PubMed

    Pluskal, Tomáš; Sajiki, Kenichi; Becker, Joanne; Takeda, Kojiro; Yanagida, Mitsuhiro

    2016-06-01

    Living organisms have evolved multiple sophisticated mechanisms to deal with reactive oxygen species. We constructed a collection of twelve single-gene deletion strains of the fission yeast Schizosaccharomyces pombe designed for the study of oxidative and heavy metal stress responses. This collection contains deletions of biosynthetic enzymes of glutathione (Δgcs1 and Δgsa1), phytochelatin (Δpcs2), ubiquinone (Δabc1) and ergothioneine (Δegt1), as well as catalase (Δctt1), thioredoxins (Δtrx1 and Δtrx2), Cu/Zn- and Mn- superoxide dismutases (SODs; Δsod1 and Δsod2), sulfiredoxin (Δsrx1) and sulfide-quinone oxidoreductase (Δhmt2). First, we employed metabolomic analysis to examine the mutants of the glutathione biosynthetic pathway. We found that ophthalmic acid was produced by the same enzymes as glutathione in S. pombe. The identical genetic background of the strains allowed us to assess the severity of the individual gene knockouts by treating the deletion strains with oxidative agents. Among other results, we found that glutathione deletion strains were not particularly sensitive to peroxide or superoxide, but highly sensitive to cadmium stress. Our results show the astonishing diversity in cellular adaptation mechanisms to various types of oxidative and metal stress and provide a useful tool for further research into stress responses. PMID:27005325

  19. THOC5 controls 3′end-processing of immediate early genes via interaction with polyadenylation specific factor 100 (CPSF100)

    PubMed Central

    Tran, Doan Duy Hai; Saran, Shashank; Williamson, Andrew J.K.; Pierce, Andrew; Dittrich-Breiholz, Oliver; Wiehlmann, Lutz; Koch, Alexandra; Whetton, Anthony D.; Tamura, Teruko

    2014-01-01

    Transcription of immediate early genes (IEGs) in response to extrinsic and intrinsic signals is tightly regulated at multiple stages. It is known that untranslated regions of the RNA can play a role in these processes. Here we show that THOC5, a member of the TREX (transcription/export) complex, plays a role in expression of only a subset of constitutively active genes, however transcriptome analysis reveals that more than 90% of IEG were not induced by serum in THOC5 depleted cells. Furthermore, THOC5 depletion does not influence the expression of the most rapidly induced IEGs, e.g. Fos and Jun. One group of THOC5 target genes, including Id1, Id3 and Wnt11 transcripts, were not released from chromatin in THOC5 depleted cells. Genes in another group, including Myc and Smad7 transcripts, were released with shortening of 3′UTR by alternative cleavage, and were spliced but export was impaired in THOC5 depleted cells. By interactome analysis using THOC5 as bait, we show that upon stimulation with serum THOC5 forms a complex with polyadenylation-specific factor 100 (CPSF100). THOC5 is required for recruitment of CPSF100 to 3′UTR of THOC5 target genes. These data suggest the presence of a novel mechanism for the control of IEG response by THOC5 via 3′end-processing. PMID:25274738

  20. Robust Parameter Identification to Perform the Modeling of pta and poxB Genes Deletion Effect on Escherichia Coli.

    PubMed

    Guerrero-Torres, V; Rios-Lozano, M; Badillo-Corona, J A; Chairez, I; Garibay-Orijel, C

    2016-08-01

    The aim of this study was to design a robust parameter identification algorithm to characterize the effect of gene deletion on Escherichia coli (E. coli) MG1655. Two genes (pta and poxB) in the competitive pathways were deleted from this microorganism to inhibit pyruvate consumption. This condition deviated the E. coli metabolism toward the Krebs cycle. As a consequence, the biomass, substrate (glucose), lactic, and acetate acids as well as ethanol concentrations were modified. A hybrid model was proposed to consider the effect of gene deletion on the metabolism of E. coli. The model parameters were estimated by the application of a least mean square method based on the instrument variable technique. To evaluate the parametric identifier method, a set of robust exact differentiators, based on the super-twisting algorithm, was implemented. The hybrid model was successfully characterized by the parameters obtained from experimental information of E. coli MG1655. The significant difference between parameters obtained with wild-type strain and the modified (with deleted genes) justifies the application of the parametric identification algorithm. This characterization can be used to optimize the production of different byproducts of commercial interest. PMID:27093969

  1. Glycosylation defects and virulence phenotypes of Leishmania mexicana phosphomannomutase and dolicholphosphate-mannose synthase gene deletion mutants.

    PubMed

    Garami, A; Mehlert, A; Ilg, T

    2001-12-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophosphoglycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glycoinositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana the gene encoding the enzyme phosphomannomutase (PMM) and the previously described dolicholphosphate-Man synthase gene (DPMS) that are involved in Man activation. Surprisingly, gene deletion experiments resulted in viable parasite lines lacking the respective open reading frames (DeltaPMM and DeltaDPMS), a result against expectation and in contrast to the lethal phenotype observed in gene deletion experiments with fungi. L. mexicana DeltaDPMS exhibits a selective defect in LPG, protein GPI anchor, and GIPL biosynthesis, but despite the absence of these structures, which have been implicated in parasite virulence and viability, the mutant remains infectious to macrophages and mice. By contrast, L. mexicana DeltaPMM are largely devoid of all known Man-containing glycoconjugates and are unable to establish an infection in mouse macrophages or the living animal. Our results define Man activation leading to GDP-Man as a virulence pathway in Leishmania. PMID:11689705

  2. Improving freeze-tolerance of baker's yeast through seamless gene deletion of NTH1 and PUT1.

    PubMed

    Dong, Jian; Chen, Didi; Wang, Guanglu; Zhang, Cuiying; Du, Liping; Liu, Shanshan; Zhao, Yu; Xiao, Dongguang

    2016-06-01

    Baker's yeast strains with freeze-tolerance are highly desirable to maintain high leavening ability after freezing. Enhanced intracellular concentration of trehalose and proline in yeast is linked with freeze-tolerance. In this study, we constructed baker's yeast with enhanced freeze-tolerance by simultaneous deletion of the neutral trehalase-encoded gene NTH1 and the proline oxidase-encoded gene PUT1. We first used the two-step integration-based seamless gene deletion method to separately delete NTH1 and PUT1 in haploid yeast. Subsequently, through two rounds of hybridization and sporulation-based allelic exchange and colony PCR-mediated tetrad analysis, we obtained strains with restored URA3 and deletion of NTH1 and/or PUT1. The resulting strain showed higher cell survival and dough-leavening ability after freezing compared to the wild-type strain due to enhanced accumulation of trehalose and/or proline. Moreover, mutant with simultaneous deletion of NTH1 and PUT1 exhibits the highest relative dough-leavening ability after freezing compared to mutants with single-gene deletion perhaps due to elevated levels of both trehalose and proline. These results verified that it is applicable to construct frozen dough baker's yeast using the method proposed in this paper. PMID:26965428

  3. Pattern of cerebrospinal immediate early gene c-fos expression in an ovine model of non-accidental head injury.

    PubMed

    Finnie, J W; Blumbergs, P C; Manavis, J; Vink, R

    2013-12-01

    Expression of the immediate early gene, c-fos, was examined in a large animal model of non-accidental head injury ("shaken baby syndrome"). Lambs were used because they have a relatively large gyrencephalic brain and weak neck muscles resembling a human infant. Neonatal lambs were manually shaken in a manner similar to that believed to occur with most abused human infants, but there was no head impact. The most striking c-fos expression was in meningothelial cells of the cranial cervical spinal cord and, to a lesser degree, in hemispheric, cerebellar, and brainstem meninges. Vascular endothelial cells also frequently showed c-fos immunopositivity in the meninges and hemispheric white matter. It was hypothesised that this c-fos immunoreactivity was due to mechanical stress induced by shaking, with differential movement of different craniospinal components. PMID:24035422

  4. A requirement for the immediate early gene Zif268 in the expression of late LTP and long-term memories.

    PubMed

    Jones, M W; Errington, M L; French, P J; Fine, A; Bliss, T V; Garel, S; Charnay, P; Bozon, B; Laroche, S; Davis, S

    2001-03-01

    The induction of long-term potentiation (LTP) in the dentate gyrus of the hippocampus is associated with a rapid and robust transcription of the immediate early gene Zif268. We used a mutant mouse with a targeted disruption of Zif268 to ask whether this gene, which encodes a zinc finger transcription factor, is required for the maintenance of late LTP and for the expression of long-term memory. We show that whereas mutant mice exhibit early LTP in the dentate gyrus, late LTP is absent when measured 24 and 48 hours after tetanus in the freely moving animal. In both spatial and non-spatial learning tasks, short-term memory remained intact, whereas performance was impaired in tests requiring long-term memory. Thus, Zif268 is essential for the transition from short- to long-term synaptic plasticity and for the expression of long-term memories. PMID:11224546

  5. Characterization of a Replication-Incompetent Pseudorabies Virus Mutant Lacking the Sole Immediate Early Gene IE180

    PubMed Central

    Wu, Brendan W.

    2014-01-01

    ABSTRACT The alphaherpesvirus pseudorabies virus (PRV) encodes a single immediate early gene called IE180. The IE180 protein is a potent transcriptional activator of viral genes involved in DNA replication and RNA transcription. A PRV mutant with both copies of IE180 deleted was constructed 20 years ago (S. Yamada and M. Shimizu, Virology 199:366–375, 1994, doi:10.1006/viro.1994.1134), but propagation of the mutant depended on complementing cell lines that expressed the toxic IE180 protein constitutively. Recently, Oyibo et al. constructed a novel set of PRV IE180 mutants and a stable cell line with inducible IE180 expression (H. Oyibo, P. Znamenskiy, H. V. Oviedo, L. W. Enquist, A. Zador, Front. Neuroanat. 8:86, 2014, doi:10.3389/fnana.2014.00086), which we characterized further here. These mutants failed to replicate new viral genomes, synthesize immediate early, early, or late viral proteins, and assemble infectious virions. The PRV IE180-null mutant did not form plaques in epithelial cell monolayers and could not spread from primary infected neurons to second-order neurons in culture. PRV IE180-null mutants lacked the property of superinfection exclusion. When PRV IE180-null mutants infected cells first, subsequent superinfecting viruses were not blocked in cell entry and formed replication compartments in epithelial cells, fibroblasts, and neurons. Cells infected with PRV IE180-null mutants survived as long as uninfected cells in culture while expressing a fluorescent reporter gene. Transcomplementation with IE180 in epithelial cells restored all mutant phenotypes to wild type. The conditional expression of PRV IE180 protein enables the propagation of replication-incompetent PRV IE180-null mutants and will facilitate construction of long-term single-cell-infecting PRV mutants for precise neural circuit tracing and high-capacity gene delivery vectors. PMID:25389174

  6. Heterologous protection in pigs induced by a plasmid-cured and crp gene-deleted Salmonella choleraesuis live vaccine.

    PubMed

    Chu, Chun-Yen; Wang, Shiang-Yiu; Chen, Zeng-Weng; Chien, Maw-Sheng; Huang, Ji-Ping; Chen, Jen-Jin; Hong, Li-Shian; Shiau, Ai-Li; Tsai, Jeng-Liang; Wu, Chao-Liang

    2007-10-10

    In this study, we exploited a crp (cAMP receptor protein) gene-deleted, virulence plasmid-cured Salmonella choleraesuis mutant with decreased carbon source utilization, designated S.C.-Deltacrp/vpl(-), as a live vaccine strain. Normal weight gain with no clinical signs was observed in pigs immunized with high doses of S.C.-Deltacrp/vpl(-) live vaccine. Vaccination in pregnant sows induced high maternal antibodies, which could prevent piglets from Salmonella infection. Moreover, serial transmission of the vaccine strain in piglets produced no evidence of reversion to virulence. Furthermore, the peripheral blood mononuclear cells from immunized piglets also developed Salmonella specific T-cell proliferative response in vitro. Our results indicate that immunogenic antigens in S.C.-Deltacrp/vpl(-) can induce adequate immunity to protect pigs against challenge with a heterologous virulent strain. Thus, this mutant holds promise for the development of a new live S. choleraesuis vaccine. PMID:17825957

  7. Time Course of Immediate Early Gene Protein Expression in the Spinal Cord following Conditioning Stimulation of the Sciatic Nerve in Rats

    PubMed Central

    Bojovic, Ognjen; Panja, Debabrata; Bittins, Margarethe; Bramham, Clive R.; Tjølsen, Arne

    2015-01-01

    Long-term potentiation induced by conditioning electrical stimulation of afferent fibers is a widely studied form of synaptic plasticity in the brain and the spinal cord. In the spinal cord dorsal horn, long-term potentiation is induced by a series of high-frequency trains applied to primary afferent fibers. Conditioning stimulation (CS) of sciatic nerve primary afferent fibers also induces expression of immediate early gene proteins in the lumbar spinal cord. However, the time course of immediate early gene expression and the rostral-caudal distribution of expression in the spinal cord have not been systematically studied. Here, we examined the effects of sciatic nerve conditioning stimulation (10 stimulus trains, 0.5 ms stimuli, 7.2 mA, 100 Hz, train duration 2 s, 8 s intervals between trains) on cellular expression of immediate early genes, Arc, c-Fos and Zif268, in anesthetized rats. Immunohistochemical analysis was performed on sagittal sections obtained from Th13- L5 segments of the spinal cord at 1, 2, 3, 6 and 12 h post-CS. Strikingly, all immediate early genes exhibited a monophasic increase in expression with peak increases detected in dorsal horn neurons at 2 hours post-CS. Regional analysis showed peak increases at the location between the L3 and L4 spinal segments. Both Arc, c-Fos and Zif268 remained significantly elevated at 2 hours, followed by a sharp decrease in immediate early gene expression between 2 and 3 hours post-CS. Colocalization analysis performed at 2 hours post-CS showed that all c-Fos and Zif268 neurons were positive for Arc, while 30% and 43% of Arc positive neurons were positive for c-Fos and Zif268, respectively. The present study identifies the spinal cord level and time course of immediate early gene (IEGP) expression of relevance for analysis of IEGPs function in neuronal plasticity and nociception. PMID:25860146

  8. MK-801 Impairs Cognitive Coordination on a Rotating Arena (Carousel) and Contextual Specificity of Hippocampal Immediate-Early Gene Expression in a Rat Model of Psychosis.

    PubMed

    Kubík, Stěpán; Buchtová, Helena; Valeš, Karel; Stuchlík, Aleš

    2014-01-01

    Flexible behavior in dynamic, real-world environments requires more than static spatial learning and memory. Discordant and unstable cues must be organized in coherent subsets to give rise to meaningful spatial representations. We model this form of cognitive coordination on a rotating arena - Carousel where arena- and room-bound spatial cues are dissociated. Hippocampal neuronal ensemble activity can repeatedly switch between multiple representations of such an environment. Injection of tetrodotoxin into one hippocampus prevents cognitive coordination during avoidance of a stationary room-defined place on the Carousel and increases coactivity of previously unrelated neurons in the uninjected hippocampus. Place avoidance on the Carousel is impaired after systemic administration of non-competitive NMDAr blockers (MK-801) used to model schizophrenia in animals and people. We tested if this effect is due to cognitive disorganization or other effect of NMDAr antagonism such as hyperlocomotion, spatial memory impairment, or general learning deficit. We also examined if the same dose of MK-801 alters patterns of immediate-early gene (IEG) expression in the hippocampus. IEG expression is triggered in neuronal nuclei in a context-specific manner after behavioral exploration and it is used to map activity in neuronal populations. IEG expression is critical for maintenance of synaptic plasticity and memory consolidation. We show that the same dose of MK-801 that impairs spatial coordination of rats on the Carousel also eliminates contextual specificity of IEG expression in hippocampal CA1 ensembles. This effect is due to increased similarity between ensembles activated in different environments, consistent with the idea that it is caused by increased coactivity between neurons, which did not previously fire together. Our data support the proposition of the Hypersynchrony theory that cognitive disorganization in psychosis is due to increased coactivity between unrelated

  9. Herpes simplex virus type 1 ICP0 regulates expression of immediate-early, early, and late genes in productively infected cells.

    PubMed Central

    Cai, W; Schaffer, P A

    1992-01-01

    The herpes simplex virus type 1 protein, ICP0, can activate expression of all kinetic classes of viral promoters in transient expression assays. To examine the role of ICP0 in the regulation of viral gene expression during productive infection, we characterized the wild-type virus, an ICP0 null mutant (7134), and several ICP0 nonsense mutant viruses with regard to virus replication and protein synthesis in Vero cells. Relative to wild-type virus, 7134 was severely deficient in viral growth and protein synthesis at low multiplicities of infection but exhibited a nearly wild-type phenotype at high multiplicities. The phenotypes of the ICP0 nonsense mutants were intermediate between those of the wild-type virus and 7134 in that the more ICP0-coding sequence expressed by a given nonsense mutant, the more wild type-like was its phenotype. The location of the ICP0 domain responsible for transactivation during productive infection was confirmed to be within the N-terminal portion of the protein, as previously shown in transient expression assays. Immunoprecipitation and immunofluorescence tests were used to detect low-level expression of selected immediate-early (IE), early (E), and late (L) proteins by mutant and wild-type viruses following low-multiplicity infection. The 7134 deletion mutant and several nonsense mutants expressed markedly reduced levels of E and L proteins but wild-type levels of the IE protein, ICP4. Because the latency-associated transcripts (LATs) are specified by the strand opposite that which encodes ICP0, the ICP0 deletion and nonsense mutants are by definition ICP0-LAT double mutants. The ability of a LAT- ICP0+ mutant to replicate as efficiently as wild-type virus at low multiplicities and the ability of ICP0-expressing 0-28 cells to complement the defects of the mutants in E and L protein synthesis indicates that the phenotypes of the mutants are caused by mutations in ICP0 and not the LATs. Thus, we conclude that ICP0 up-regulates E and L but

  10. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  11. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    SciTech Connect

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang . E-mail: gracelow@ntu.edu.tw

    2005-04-10

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter.

  12. Investigation of the dynamics of the viral immediate-early protein 1 in different conformations and oligomerization states.

    PubMed

    Stump, Joachim D; Sticht, Heinrich

    2016-05-01

    The viral immediate-early protein 1 (IE1) is crucial for efficient replication of cytomegalovirus (CMV). A recent crystal structure of the IE1 protein from rhesus CMV revealed that the protein exhibits a novel fold and crystallizes in two slightly different dimeric arrangements. Molecular dynamics simulations and energetic analyses performed in this study show that both dimers are stable and allowed us to identify a common set of five residues that appear particularly important for dimer formation. These residues are distributed over the entire dimer interface and do not form a typical hot spot for protein interactions. In addition, the dimer interface of IE1 proved to include a high portion of hydrophilic interactions pointing toward the transient nature of dimer formation. Characterization of monomeric and dimeric IE1 revealed three sequentially discontinuous dynamic domains that exhibit correlated motion within the domain and are simultaneously anti-correlated to the adjacent domains. The hinge motions observed between the dynamic domains increase the shape complementarity to the coiled-coil region of tripartite motif proteins, suggesting that the detected dynamics of IE1 might be physiologically important by enabling a better interaction with its cellular target molecules. PMID:26104474

  13. Activation of immediate-early response gene c-Fos protein in the rat paralimbic cortices after myocardial infarction

    PubMed Central

    Ahn, Ji Yun; Tae, Hyun-Jin; Cho, Jeong-Hwi; Kim, In Hye; Ahn, Ji Hyeon; Park, Joon Ha; Kim, Dong Won; Cho, Jun Hwi; Won, Moo-Ho; Hong, Seongkweon; Lee, Jae-Chul; Seo, Jeong Yeol

    2015-01-01

    c-Fos is a good biological marker for detecting the pathogenesis of central nervous system disorders. Few studies are reported on the change in myocardial infarction-induced c-Fos expression in the paralimbic regions. Thus, in this study, we investigated the changes in c-Fos expression in the rat cingulate and piriform cortices after myocardial infarction. Neuronal degeneration in cingulate and piriform cortices after myocardial infarction was detected using cresyl violet staining, NeuN immunohistochemistry and Fluoro-Jade B histofluorescence staining. c-Fos-immunoreactive cells were observed in cingulate and piriform cortices at 3 days after myocardial infarction and peaked at 7 and 14 days after myocardial infarction. But they were hardly observed at 56 days after myocardial infarction. The chronological change of c-Fos expression determined by western blot analysis was basically the same as that of c-Fos immunoreactivity. These results indicate that myocardial infarction can cause the chronological change of immediate-early response gene c-Fos protein expression, which might be associated with the neural activity induced by myocardial infarction. PMID:26487852

  14. Calcium-dependent immediate-early gene induction in lymphocytes is negatively regulated by p21Ha-ras.

    PubMed Central

    Chen, C Y; Forman, L W; Faller, D V

    1996-01-01

    The induction of immediate-early (IE) response genes, such as egr-1, c-fos, and c-jun, occurs rapidly after the activation of T lymphocytes. The process of activation involves calcium mobilization, activation of protein kinase C (PKC), and phosphorylation of tyrosine kinases. p21(ras), a guanine nucleotide binding factor, mediates T-cell signal transduction through PKC-dependent and PKC-independent pathways. The involvement of p21(ras) in the regulation of calcium-dependent signals has been suggested through analysis of its role in the activation of NF-AT. We have investigated the inductions of the IE genes in response to calcium signals in Jurkat cells (in the presence of activated p21(ras)) and their correlated consequences. The expression of activated p21(ras) negatively regulated the induction of IE genes by calcium ionophore. This inhibition of calcium-activated IE gene induction was reversed by treatment with cyclosporin A, suggesting the involvement of calcineurin in this regulation. A later result of inhibition of this activation pathway by p21(ras) was down-regulation of the activity of the transcription factor AP-1 and subsequent coordinate reductions in IL-2 gene expression and protein production. These results suggest that p2l(ras) is an essential mediator in generating not only positive but also negative modulatory mechanisms controlling the competence of T cells in response to inductive stimulations. PMID:8887687

  15. Changes in neurotransmitter levels and expression of immediate early genes in brain of mice infected with Neospora caninum

    PubMed Central

    Ihara, Fumiaki; Nishimura, Maki; Muroi, Yoshikage; Furuoka, Hidefumi; Yokoyama, Naoaki; Nishikawa, Yoshifumi

    2016-01-01

    Neospora caninum is an obligate intracellular parasite that causes neurological disorders in dogs and cattle. The majority of host animals are asymptomatic at the chronic stage of infection. However, it remains unclear whether cerebral function is normal in asymptomatic animals. In this study, mice were infected with N. caninum (strain Nc-1) and their brains were examined to understand changes in cerebral function at the chronic stage of infection. Mice infected with N. caninum showed impaired locomotor activity, but no differences in clinical symptoms were observed. In the brains of infected mice, parasites were distributed throughout the brain and histological lesions were observed everywhere except for the cerebellum. Expression levels of proinflammatory cytokines, interferon-gamma and tumour necrosis factor-alpha, were highly upregulated in several brain regions of infected mice. Additionally, the level of neurotransmitters glutamate, glycine, gamma-aminobutyric acid, dopamine and 5-hydroxytryptamine, were altered in infected mice compared with those of uninfected mice. Interestingly, the expression levels of immediately early genes, c-Fos and Arc, in the brain of infected mice were lower than those of in uninfected mice. Our findings may provide insight into neurological disorders associated with N. caninum infection. PMID:26971577

  16. Decreased approach behavior and nucleus accumbens immediate early gene expression in response to Parkinsonian ultrasonic vocalizations in rats.

    PubMed

    Pultorak, Joshua D; Kelm-Nelson, Cynthia A; Holt, Lauren R; Blue, Katherine V; Ciucci, Michelle R; Johnson, Aaron M

    2016-08-01

    Many individuals with Parkinson disease (PD) have difficulty producing normal speech and voice, resulting in problems with interpersonal communication and reduced quality of life. Translational animal models of communicative dysfunction have been developed to assess disease pathology. However, it is unknown whether acoustic feature changes associated with vocal production deficits in these animal models lead to compromised communication. In rodents, male ultrasonic vocalizations (USVs) have a well-established role in functional inter-sexual communication. To test whether acoustic deficits in USVs observed in a PTEN-induced putative kinase 1 (PINK1) knockout (KO) PD rat model compromise communication, we presented recordings of male PINK1 KO USVs and normal wild-type (WT) USVs to female rat listeners. We measured approached behavior and immediate early gene expression (c-Fos) in brain regions implicated in auditory processing and sexual motivation. Our results suggest that females show reduced approach in response to PINK1 KO USVs compared with WT. Moreover, females exposed to PINK1 KO USVs had lower c-Fos immunolabeling in the nucleus accumbens, a region implicated in sexual motivation. These results are the first to demonstrate that vocalization deficits in a rat PD model result in compromised communication. Thus, the PINK1 KO PD model may be valuable for assessing treatments aimed at restoring vocal communicative function. PMID:26313334

  17. Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors

    PubMed Central

    Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

  18. Saccule contribution to immediate early gene induction in the gerbil brainstem with posterior canal galvanic or hypergravity stimulation

    NASA Technical Reports Server (NTRS)

    Marshburn, T. H.; Kaufman, G. D.; Purcell, I. M.; Perachio, A. A.

    1997-01-01

    Immunolabeling patterns of the immediate early gene-related protein Fos in the gerbil brainstem were studied following stimulation of the sacculus by both hypergravity and galvanic stimulation. Head-restrained, alert animals were exposed to a prolonged (1 h) inertial vector of 2 G (19.6 m/s2) head acceleration directed in a dorso-ventral head axis to maximally stimulate the sacculus. Fos-defined immunoreactivity was quantified, and the results compared to a control group. The hypergravity stimulus produced Fos immunolabeling in the dorsomedial cell column (dmcc) of the inferior olive independently of other subnuclei. Similar dmcc labeling was induced by a 30 min galvanic stimulus of up to -100 microA applied through a stimulating electrode placed unilaterally on the bony labyrinth overlying the posterior canal (PC). The pattern of vestibular afferent firing activity induced by this galvanic stimulus was quantified in anesthetized gerbils by simultaneously recording from Scarpa's ganglion. Only saccular and PC afferent neurons exhibited increases in average firing rates of 200-300%, suggesting a pattern of current spread involving only PC and saccular afferent neurons at this level of stimulation. These results suggest that alteration in saccular afferent firing rates are sufficient to induce Fos-defined genomic activation of the dmcc, and lend further evidence to the existence of a functional vestibulo-olivary-cerebellar pathway of adaptation to novel gravito-inertial environments.

  19. How necessary is the activation of the immediate early gene zif268 in synaptic plasticity and learning?

    PubMed

    Davis, Sabrina; Bozon, Bruno; Laroche, Serge

    2003-06-16

    The immediate early genes (IEGs) are activated rapidly and transiently in response to a multitude of stimuli. The zif268 belongs to a category of regulatory IEGs that activate downstream target genes and is considered to be a triggering mechanism to activate the genomic response in neurons. Several studies have shown that zif268 mRNA is upregulated during different forms of associative learning, and following tetanic stimulation that induces long-lasting LTP. To date, there is a general consensus that zif268 activation may constitute a critical mechanism for the encoding of long-lasting memories, however this is based on relatively few studies. Given the fact that zif268 can be activated by a number of different types of stimuli, it becomes important to determine exactly how it may be implicated in memory. Examination of the current literature suggests that zif268 is necessary in the processing of several types of memory, however, it is not entirely clear what aspects of memory zif268 may be implicated in. Here, we review the existing literature and emphasise that understanding the signalling pathways that lead to activation of the IEGs and the downstream targets of these genes will advance our understanding of how functional activation of zif268 may be implicated in processing long-term memories. PMID:12798262

  20. Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory

    ERIC Educational Resources Information Center

    Pevzner, Aleksandr; Guzowski, John F.

    2015-01-01

    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

  1. Small-molecule inhibitors of ERK-mediated immediate early gene expression and proliferation of melanoma cells expressing mutated BRaf.

    PubMed

    Samadani, Ramin; Zhang, Jun; Brophy, Amanda; Oashi, Taiji; Priyakumar, U Deva; Raman, E Prabhu; St John, Franz J; Jung, Kwan-Young; Fletcher, Steven; Pozharski, Edwin; MacKerell, Alexander D; Shapiro, Paul

    2015-05-01

    Constitutive activation of the extracellular-signal-regulated kinases 1 and 2 (ERK1/2) are central to regulating the proliferation and survival of many cancer cells. The current inhibitors of ERK1/2 target ATP binding or the catalytic site and are therefore limited in their utility for elucidating the complex biological roles of ERK1/2 through its phosphorylation and regulation of over 100 substrate proteins. To overcome this limitation, a combination of computational and experimental methods was used to identify low-molecular-mass inhibitors that are intended to target ERK1/2 substrate-docking domains and selectively interfere with ERK1/2 regulation of substrate proteins. In the present study, we report the identification and characterization of compounds with a thienyl benzenesulfonate scaffold that were designed to inhibit ERK1/2 substrates containing an F-site or DEF (docking site for ERK, FXF) motif. Experimental evidence shows the compounds inhibit the expression of F-site containing immediate early genes (IEGs) of the Fos family, including c-Fos and Fra1, and transcriptional regulation of the activator protein-1 (AP-1) complex. Moreover, this class of compounds selectively induces apoptosis in melanoma cells containing mutated BRaf and constitutively active ERK1/2 signalling, including melanoma cells that are inherently resistant to clinically relevant kinase inhibitors. These findings represent the identification and initial characterization of a novel class of compounds that inhibit ERK1/2 signalling functions and their potential utility for elucidating ERK1/2 and other signalling events that control the growth and survival of cancer cells containing elevated ERK1/2 activity. PMID:25695333

  2. Identification of Cellular Proteins that Interact with Human Cytomegalovirus Immediate-Early Protein 1 by Protein Array Assay

    PubMed Central

    Puerta Martínez, Francisco; Tang, Qiyi

    2013-01-01

    Human cytomegalovirus (HCMV) gene expression during infection is characterized as a sequential process including immediate-early (IE), early (E), and late (L)-stage gene expression. The most abundantly expressed gene at the IE stage of infection is the major IE (MIE) gene that produces IE1 and IE2. IE1 has been the focus of study because it is an important protein, not only for viral gene expression but also for viral replication. It is believed that IE1 plays important roles in viral gene regulation by interacting with cellular proteins. In the current study, we performed protein array assays and identified 83 cellular proteins that interact with IE1. Among them, seven are RNA-binding proteins that are important in RNA processing; more than half are nuclear proteins that are involved in gene regulations. Tumorigenesis-related proteins are also found to interact with IE1, implying that the role of IE1 in tumorigenesis might need to be reevaluated. Unexpectedly, cytoplasmic proteins, such as Golgi autoantigen and GGA1 (both related to the Golgi trafficking protein), are also found to be associated with IE1. We also employed a coimmunoprecipitation assay to test the interactions of IE1 and some of the proteins identified in the protein array assays and confirmed that the results from the protein array assays are reliable. Many of the proteins identified by the protein array assay have not been previously reported. Therefore, the functions of the IE1-protein interactions need to be further explored in the future. PMID:24385082

  3. Physical interaction between the herpes simplex virus type 1 immediate-early regulatory proteins ICP0 and ICP4.

    PubMed Central

    Yao, F; Schaffer, P A

    1994-01-01

    The herpes simplex virus type 1 immediate-early protein ICP0 enhances expression of a spectrum of viral genes alone and synergistically with ICP4. To test whether ICP0 and ICP4 interact physically, we performed far-Western blotting analysis of proteins from mock-, wild-type-, and ICP4 mutant virus-infected cells with in vitro-synthesized [35S]Met-labeled ICP0 and ICP4 as probes. The ICP4 and ICP0 polypeptides synthesized in vitro exhibited molecular weights similar to those of their counterparts in herpes simplex virus type 1-infected cells, and the in vitro-synthesized ICP4 was able to bind to a probe containing the ICP4 consensus binding site. Far-Western blotting experiments demonstrated that ICP0 interacts directly and specifically with ICP4 and with itself. To further define the interaction between ICP0 and ICP4, we generated a set of glutathione S-transferase (GST)-ICP0 fusion proteins that contain GST and either ICP0 N-terminal amino acids 1 to 244 or 1 to 394 or C-terminal amino acids 395 to 616 or 395 to 775. Using GST-ICP0 fusion protein affinity chromatography and in vitro-synthesized [35S]Met-labeled ICP0 and ICP4, ICP4 was shown to interact preferentially with the fusion protein containing ICP0 C-terminal amino acids 395 to 775, whereas ICP0 interacted efficiently with both the N-terminal GST-ICP0 fusion proteins and the C-terminal GST-ICP0 fusion proteins containing amino acids 395 to 775. Fusion protein affinity chromatography also demonstrated that the C-terminal 235 amino acid residues of ICP4 are important for efficient interaction with ICP0. Collectively, these results reveal a direct and specific physical interaction between ICP0 and ICP4. Images PMID:7966607

  4. Downregulation of immediate-early genes linking to suppression of neuronal plasticity in rats after 28-day exposure to glycidol

    SciTech Connect

    Akane, Hirotoshi; Saito, Fumiyo; Shiraki, Ayako; Takeyoshi, Masahiro; Imatanaka, Nobuya; Itahashi, Megu; Murakami, Tomoaki; Shibutani, Makoto

    2014-09-01

    We previously found that the 28-day oral toxicity study of glycidol at 200 mg/kg/day in rats resulted in axonopathy in both the central and peripheral nervous systems and aberrations in the late-stage of hippocampal neurogenesis targeting the process of neurite extension. To capture the neuronal parameters in response to glycidol toxicity, these animals were subjected to region-specific global gene expression profiling in four regions of cerebral and cerebellar architectures, followed by immunohistochemical analysis of selected gene products. Expression changes of genes related to axonogenesis and synaptic transmission were observed in the hippocampal dentate gyrus, cingulate cortex and cerebellar vermis at 200 mg/kg showing downregulation in most genes. In the corpus callosum, genes related to growth, survival and functions of glial cells fluctuated their expression. Immunohistochemically, neurons expressing gene products of immediate-early genes, i.e., Arc, Fos and Jun, decreased in their number in the dentate granule cell layer, cingulate cortex and cerebellar vermis. We also applied immunohistochemical analysis in rat offspring after developmental exposure to glycidol through maternal drinking water. The results revealed increases of Arc{sup +} neurons at 1000 ppm and Fos{sup +} neurons at ≥ 300 ppm in the dentate granule cell layer of offspring only at the adult stage. These results suggest that glycidol suppressed neuronal plasticity in the brain after 28-day exposure to young adult animals, in contrast to the operation of restoration mechanism to increase neuronal plasticity at the adult stage in response to aberrations in neurogenesis after developmental exposure. - Highlights: • Neuronal toxicity parameters after 28-day glycidol treatment were examined in rats. • Region-specific global gene expression profiling was conducted in brain regions. • Cortical tissues downregulated genes on axonogenesis and synaptic transmission. • Cortical tissues

  5. Distinct mechanisms for induction and tolerance regulate the immediate early genes encoding interleukin 1β and tumor necrosis factor α.

    PubMed

    Adamik, Juraj; Wang, Kent Z Q; Unlu, Sebnem; Su, An-Jey A; Tannahill, Gillian M; Galson, Deborah L; O'Neill, Luke A; Auron, Philip E

    2013-01-01

    Interleukin-1β and Tumor Necrosis Factor α play related, but distinct, roles in immunity and disease. Our study revealed major mechanistic distinctions in the Toll-like receptor (TLR) signaling-dependent induction for the rapidly expressed genes (IL1B and TNF) coding for these two cytokines. Prior to induction, TNF exhibited pre-bound TATA Binding Protein (TBP) and paused RNA Polymerase II (Pol II), hallmarks of poised immediate-early (IE) genes. In contrast, unstimulated IL1B displayed very low levels of both TBP and paused Pol II, requiring the lineage-specific Spi-1/PU.1 (Spi1) transcription factor as an anchor for induction-dependent interaction with two TLR-activated transcription factors, C/EBPβ and NF-κB. Activation and DNA binding of these two pre-expressed factors resulted in de novo recruitment of TBP and Pol II to IL1B in concert with a permissive state for elongation mediated by the recruitment of elongation factor P-TEFb. This Spi1-dependent mechanism for IL1B transcription, which is unique for a rapidly-induced/poised IE gene, was more dependent upon P-TEFb than was the case for the TNF gene. Furthermore, the dependence on phosphoinositide 3-kinase for P-TEFb recruitment to IL1B paralleled a greater sensitivity to the metabolic state of the cell and a lower sensitivity to the phenomenon of endotoxin tolerance than was evident for TNF. Such differences in induction mechanisms argue against the prevailing paradigm that all IE genes possess paused Pol II and may further delineate the specific roles played by each of these rapidly expressed immune modulators. PMID:23936458

  6. Immediate early gene expression reveals interactions between social and nicotine rewards on brain activity in adolescent male rats.

    PubMed

    Bastle, Ryan M; Peartree, Natalie A; Goenaga, Julianna; Hatch, Kayla N; Henricks, Angela; Scott, Samantha; Hood, Lauren E; Neisewander, Janet L

    2016-10-15

    Smoking initiation predominantly occurs during adolescence, often in the presence of peers. Therefore, understanding the neural mechanisms underlying the rewarding effects of nicotine and social stimuli is vital. Using the conditioned place preference (CPP) procedure, we measured immediate early gene (IEG) expression in animals following exposure either to a reward-conditioned environment or to the unconditioned stimuli (US). Adolescent, male rats were assigned to the following CPP US conditions: (1) Saline+Isolated, (2) Nicotine+Isolated, (3) Saline+Social, or (4) Nicotine+Social. For Experiment 1, brain tissue was collected 90min following the CPP expression test and processed for Fos immunohistochemistry. We found that rats conditioned with nicotine with or without a social partner exhibited CPP; however, we found no group differences in Fos expression in any brain region analyzed, with the exception of the nucleus accumbens core that exhibited a social-induced attenuation in Fos expression. For Experiment 2, brain tissue was collected 90min following US exposure during the last conditioning session. We found social reward-induced increases in IEG expression in striatal and amydalar subregions. In contrast, nicotine reduced IEG expression in prefrontal and striatal subregions. Reward interactions were also found in the dorsolateral striatum, basolateral amygdala, and ventral tegmental area where nicotine alone attenuated IEG expression and social reward reversed this effect. These results suggest that in general social rewards enhance, whereas nicotine attenuates, activation of mesocorticolimbic regions; however, the rewards given together interact to enhance activation in some regions. The findings contribute to knowledge of how a social environment influences nicotine effects. PMID:27435419

  7. Contrasting Networks for Recognition Memory and Recency Memory Revealed by Immediate-Early Gene Imaging in the Rat

    PubMed Central

    2014-01-01

    The expression of the immediate-early gene c-fos was used to compare networks of activity associated with recency memory (temporal order memory) and recognition memory. In Experiment 1, rats were first familiarized with sets of objects and then given pairs of different, familiar objects to explore. For the recency test group, each object in a pair was separated by 110 min in the time between their previous presentations. For the recency control test, each object in a pair was separated by less than a 1 min between their prior presentations. Temporal discrimination of the objects correlated with c-fos activity in the recency test group in several sites, including area Te2, the perirhinal cortex, lateral entorhinal cortex, as well as the dentate gyrus, hippocampal fields CA3 and CA1. For both the test and control conditions, network models were derived using structural equation modeling. The recency test model emphasized serial connections from the perirhinal cortex to lateral entorhinal cortex and then to the CA1 subfield. The recency control condition involved more parallel pathways, but again highlighted CA1 within the hippocampus. Both models contrasted with those derived from tests of object recognition (Experiment 2), because stimulus novelty was associated with pathways from the perirhinal cortex to lateral entorhinal cortex that then involved both the dentate gyrus (and CA3) and CA1 in parallel. The present findings implicate CA1 for the processing of familiar stimuli, including recency discriminations, while the dentate gyrus and CA3 pathways are recruited when the perirhinal cortex signals novel stimuli. PMID:24933661

  8. Experience affects immediate early gene expression in response to conspecific call notes in black-capped chickadees (Poecile atricapillus).

    PubMed

    Hahn, Allison H; Guillette, Lauren M; Lee, Daniel; McMillan, Neil; Hoang, John; Sturdy, Christopher B

    2015-01-01

    Black-capped chickadees (Poecile atricapillus) produce numerous vocalizations, including the acoustically complex chick-a-dee call that is composed of A, B, C, and D notes. D notes are longer in duration and lower in frequency than the other note types and contain information regarding flock and species identification. Adult wild-caught black-capped chickadees have been shown to have similar amounts of immediate early gene (IEG) expression following playback of vocalizations with harmonic-like acoustic structure, similar to D notes. Here we examined how different environmental experiences affect IEG response to conspecific D notes. We hand-reared black-capped chickadees under three conditions: (1) with adult conspecifics, (2) with adult heterospecific mountain chickadees, and (3) without adults. We presented all hand-reared birds and a control group of field-reared black-capped chickadees, with conspecific D notes and quantified IEG expression in the caudomedial mesopallium (CMM) and caudomedial nidopallium (NCM). We found that field-reared birds that heard normal D notes had a similar neural response as a group of field-reared birds that heard playback of reversed D notes. Field-reared birds that heard normal D notes also had a similar neural response as birds reared with adult conspecifics. Birds reared without adults had a significantly reduced IEG response, whereas the IEG expression in birds reared with heterospecifics was at intermediate levels between birds reared with conspecifics and birds reared without adults. Although acoustic characteristics have been shown to drive IEG expression, our results demonstrate that experience with adults or normal adult vocalizations is also an important factor. PMID:25813748

  9. Small-molecule inhibitors of ERK-mediated immediate early gene expression and proliferation of melanoma cells expressing mutated BRaf

    PubMed Central

    Samadani, Ramin; Zhang, Jun; Brophy, Amanda; Oashi, Taiji; Priyakumar, U. Deva; Raman, E. Prabhu; St John, Franz J.; Jung, Kwan-Young; Fletcher, Steven; Pozharski, Edwin; MacKerell, Alexander D.; Shapiro, Paul

    2015-01-01

    Constitutive activation of the extracellular-signal-regulated kinases 1 and 2 (ERK1/2) are central to regulating the proliferation and survival of many cancer cells. The current inhibitors of ERK1/2 target ATP binding or the catalytic site and are therefore limited in their utility for elucidating the complex biological roles of ERK1/2 through its phosphorylation and regulation of over 100 substrate proteins. To overcome this limitation, a combination of computational and experimental methods was used to identify low-molecular-mass inhibitors that are intended to target ERK1/2 substrate-docking domains and selectively interfere with ERK1/2 regulation of substrate proteins. In the present study, we report the identification and characterization of compounds with a thienyl benzenesulfonate scaffold that were designed to inhibit ERK1/2 substrates containing an F-site or DEF (docking site for ERK, FXF) motif. Experimental evidence shows the compounds inhibit the expression of F-site containing immediate early genes (IEGs) of the Fos family, including c-Fos and Fra1, and transcriptional regulation of the activator protein-1 (AP-1) complex. Moreover, this class of compounds selectively induces apoptosis in melanoma cells containing mutated BRaf and constitutively active ERK1/2 signalling, including melanoma cells that are inherently resistant to clinically relevant kinase inhibitors. These findings represent the identification and initial characterization of a novel class of compounds that inhibit ERK1/2 signalling functions and their potential utility for elucidating ERK1/2 and other signalling events that control the growth and survival of cancer cells containing elevated ERK1/2 activity. PMID:25695333

  10. The Contribution of Whole Gene Deletions and Large Rearrangements to the Mutation Spectrum in Inherited Tumor Predisposing Syndromes.

    PubMed

    Smith, Miriam J; Urquhart, Jill E; Harkness, Elaine F; Miles, Emma K; Bowers, Naomi L; Byers, Helen J; Bulman, Michael; Gokhale, Carolyn; Wallace, Andrew J; Newman, William G; Evans, D Gareth

    2016-03-01

    Heterozygous whole gene deletions (WGDs), and intragenic microdeletions, account for a significant proportion of mutations underlying cancer predisposition syndromes. We analyzed the frequency and genotype-phenotype correlations of microdeletions in 12 genes (BRCA1, BRCA2, TP53, MSH2, MLH1, MSH6, PMS2, NF1, NF2, APC, PTCH1, and VHL) representing seven tumor predisposition syndromes in 5,897 individuals (2,611 families) from our center. Overall, microdeletions accounted for 14% of identified mutations. As expected, smaller deletions or duplications were more common (12%) than WGDs (2.2%). Where a WGD was identified in the germline in NF2, the mechanism of somatic second hit was not deletion, as previously described for NF1. For neurofibromatosis type 1 and 2, we compared the mechanism of germline deletion. Unlike NF1, where three specific deletion sizes account for most germline WGDs, NF2 deletion breakpoints were different across seven samples tested. One of these deletions was 3.93 Mb and conferred a severe phenotype, thus refining the region for a potential NF2 modifier gene to a 2.04-Mb region on chromosome 22. The milder phenotype of NF2 WGDs may be due to the apparent absence of chromosome 22 loss as the second hit. These observations of WGD phenotypes will be helpful for interpreting incidental findings from microarray analysis and next-generation sequencing. PMID:26615784

  11. Gene deleted live attenuated Leishmania vaccine candidates against visceral leishmaniasis elicit pro-inflammatory cytokines response in human PBMCs.

    PubMed

    Avishek, Kumar; Kaushal, Himanshu; Gannavaram, Sreenivas; Dey, Ranadhir; Selvapandiyan, Angamuthu; Ramesh, V; Negi, Narender Singh; Dubey, Uma S; Nakhasi, Hira L; Salotra, Poonam

    2016-01-01

    Currently no effective vaccine is available for human visceral leishmaniasis(VL) caused by Leishmania donovani. Previously, we showed that centrin1 and p27gene deleted live attenuated Leishmania parasites (LdCen1(-/-) and Ldp27(-/-)) are safe, immunogenic and protective in animal models. Here, to assess the correlates of protection, we evaluated immune responses induced by LdCen1(-/-) and Ldp27(-/-) in human blood samples obtained from healthy, healed VL (HVL), post kala-azar dermal leishmaniasis(PKDL) and VL subjects. Both parasites infected human macrophages, as effectively as the wild type parasites. Further, LdCen1(-/-) and Ldp27(-/-) strongly stimulated production of pro-inflammatory cytokines including, IL-12, IFN-γ, TNF-α, IL-2, IL-6 and IL-17 in the PBMCs obtained from individuals with a prior exposure to Leishmania (HVL and PKDL). There was no significant stimulation of anti-inflammatory cytokines (IL-4 and IL-10). Induction of Th1 biased immune responses was supported by a remarkable increase in IFN-γ secreting CD4(+) and CD8(+) T cells and IL-17 secreting CD4(+) cells in PBMCs from HVL cases with no increase in IL-10 secreting T cells. Hence, LdCen1(-/-) and Ldp27(-/-) are promising as live vaccine candidates against VL since they elicit strong protective immune response in human PBMCs from HVL, similar to the wild type parasite infection, mimicking a naturally acquired protection following cure. PMID:27624408

  12. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector.

    PubMed

    Murlidharan, Giridhar; Sakamoto, Kensuke; Rao, Lavanya; Corriher, Travis; Wang, Dan; Gao, Guangping; Sullivan, Patrick; Asokan, Aravind

    2016-01-01

    Gene therapy using recombinant adeno-associated viral (AAV) vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9), which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137) in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities. PMID:27434683

  13. Topographical evaluation of behavioural phenotype in a line of mice with targeted gene deletion of the D2 dopamine receptor.

    PubMed

    Clifford, J J; Usiello, A; Vallone, D; Kinsella, A; Borrelli, E; Waddington, J L

    2000-01-28

    The phenotype of spontaneous and dopamine D2-like agonist-induced behaviour was assessed topographically in a line of mice with targeted gene deletion of the D1 receptor. An ethologically-based, rapid time-sampling behavioural check-list technique was used to resolve and quantify all behaviours in the natural repertoire of the mouse. Relative to wildtypes [D2+/+], D2-null [D2-/-] mice evidenced over a 1 h period of initial exploration modest but significant reductions in locomotion, grooming, rearing free and rearing to wall; rearing seated, sniffing, sifting and stillness were not altered. Individual elements of behaviour habituated similarly over a 6 h period for both genotypes. The dose-dependent induction of stereotyped sniffing and ponderous locomotion by the D2-like agonist RU 24213 (0.1-12.5 mg/kg) in wildtypes was essentially absent in D2-null mice. The ethogram of spontaneous behaviour in D2-null mice was characterised by only modest reductions in, and topographical shifts between, certain individual elements of behaviour. Essential abolition of D2-like agonist responsivity in D2-null mice vis-à-vis considerable preservation of spontaneous behavioural topography suggests compensatory processes subsequent to developmental absence of the D2 receptor that are able to sustain function under naturalistic, tonic conditions but not during phasic challenge. PMID:10698004

  14. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  15. Analysis of Noncanonical Calcium-Dependent Protein Kinases in Toxoplasma gondii by Targeted Gene Deletion Using CRISPR/Cas9.

    PubMed

    Long, Shaojun; Wang, Qiuling; Sibley, L David

    2016-05-01

    Calcium-dependent protein kinases (CDPKs) are expanded in apicomplexan parasites, especially in Toxoplasma gondii where 14 separate genes encoding these enzymes are found. Although previous studies have shown that several CDPKs play a role in controlling invasion, egress, and cell division in T. gondii, the roles of most of these genes are unexplored. Here we developed a more efficient method for gene disruption using CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated protein 9) that was modified to completely delete large, multiexonic genes from the genome and to allow serial replacement by recycling of the selectable marker using Cre-loxP. Using this system, we generated a total of 24 mutants in type 1 and 2 genetic backgrounds to ascertain the functions of noncanonical CDPKs. Remarkably, although we were able to confirm the essentiality of CDPK1 and CDPK7, the majority of CDPKs had no discernible phenotype for growth in vitro or infection in the mouse model. The exception to this was CDPK6, loss of which leads to reduced plaquing, fitness defect in a competition assay, and reduced tissue cyst formation in chronically infected mice. Our findings highlight the utility of CRISPR/Cas9 for rapid serial gene deletion and also suggest that additional models are needed to reveal the functions of many genes in T. gondii. PMID:26755159

  16. Macrophage Inhibitory Cytokine-1 (MIC-1/GDF15) Gene Deletion Promotes Cancer Growth in TRAMP Prostate Cancer Prone Mice

    PubMed Central

    Husaini, Yasmin; Lockwood, Glen P.; Nguyen, Trung V.; Tsai, Vicky Wang-Wei; Mohammad, Mohammad G.; Russell, Pamela J.; Brown, David A.; Breit, Samuel N.

    2015-01-01

    The divergent TGF-β superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15), is overexpressed by most cancers, including prostate cancer (PCa). Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-). On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+). Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1) had metastases than TRAMPMIC+/+ mice (p<0.0001). We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread. PMID:25695521

  17. Macrophage inhibitory cytokine-1 (MIC-1/GDF15) gene deletion promotes cancer growth in TRAMP prostate cancer prone mice.

    PubMed

    Husaini, Yasmin; Lockwood, Glen P; Nguyen, Trung V; Tsai, Vicky Wang-Wei; Mohammad, Mohammad G; Russell, Pamela J; Brown, David A; Breit, Samuel N

    2015-01-01

    The divergent TGF-β superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15), is overexpressed by most cancers, including prostate cancer (PCa). Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-). On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+). Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1) had metastases than TRAMPMIC+/+ mice (p<0.0001). We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread. PMID:25695521

  18. Characterization of DNA binding properties of the immediate-early gene product of equine herpesvirus type 1.

    PubMed

    Kim, S K; Smith, R H; O'Callaghan, D J

    1995-10-20

    The equine herpesvirus type 1 (EHV-1) immediate-early (IE) gene encodes a phosphoprotein that is essential for the activation of transcription from viral early and late promoters and that regulates the transcription from its own promoter. Employment of EHV-1 IE promoter DNA probes and glutathione S-transferase fusion proteins harboring truncated portions of the IE gene product in gel shift assays, super shift assays with anti-IE monoclonal antibodies, and DNase I footprinting analyses revealed: (1) amino acid residues 422 to 597 within the 1487-amino-acid IE protein are sufficient for sequence-specific DNA binding; (2) the IE protein binds to EHV-1 DNA at sequences from -11 to +14 that overlap the transcription initiation site (+1); (3) the conserved pentanucleotide 5'-ATCGT-3' in the IE promoter located at nucleotides (nt) -6 to -2, relative to the transcription initiation site (+1), is critical for IE protein binding; (4) a weak binding site for the IE protein is also present at nt -92 to -82 of the IE gene within the sequence (-86)ATCGA(-82) in which four of the five nt in the consensus binding sequence are conserved; (5) the IE protein binds to sequences in EHV-1 early and late promoters that contain a degenerate version of the consensus sequence 5'-ATCGT-3'; and (6) mutation of the C or G nt in the pentanucleotide 5'-ATCGT-3' prevents sequence-specific binding of the IE protein, whereas mutation of each of the other three nt only reduces binding. These results suggest that the IE protein can recognize the sites which differ slightly from the proposed consensus sequence. Overall, these findings suggest that formation of a specific complex between an IE protein and its own gene promoter may be a common mechanism used by Alphaherpesvirinae to autoregulate transcription of an essential IE gene. In addition, the finding that the DNA binding domain of the IE protein maps within amino acids 422 to 597, a domain conserved in the IR2 early protein that is a truncated

  19. Type I Interferon Released by Myeloid Dendritic Cells Reversibly Impairs Cytomegalovirus Replication by Inhibiting Immediate Early Gene Expression

    PubMed Central

    Holzki, Julia Katharina; Dağ, Franziska; Dekhtiarenko, Iryna; Rand, Ulfert; Casalegno-Garduño, Rosaely; Trittel, Stephanie; May, Tobias; Riese, Peggy

    2015-01-01

    ABSTRACT Cytomegalovirus (CMV) is a ubiquitous beta-herpesvirus whose reactivation from latency is a major cause of morbidity and mortality in immunocompromised hosts. Mouse CMV (MCMV) is a well-established model virus to study virus-host interactions. We showed in this study that the CD8-independent antiviral function of myeloid dendritic cells (mDC) is biologically relevant for the inhibition of MCMV replication in vivo and in vitro. In vivo ablation of CD11c+ DC resulted in higher viral titers and increased susceptibility to MCMV infection in the first 3 days postinfection. We developed in vitro coculture systems in which we cocultivated MCMV-infected endothelial cells or fibroblasts with T cell subsets and/or dendritic cells. While CD8 T cells failed to control MCMV replication, bone marrow-derived mDC reduced viral titers by a factor of up to 10,000. Contact of mDC with the infected endothelial cells was crucial for their antiviral activity. Soluble factors secreted by the mDC blocked MCMV replication at the level of immediate early (IE) gene expression, yet the viral lytic cycle reinitiated once the mDC were removed from the cells. On the other hand, the mDC did not impair MCMV replication in cells deficient for the interferon (IFN) alpha/beta receptor (IFNAR), arguing that type I interferons were critical for viral control by mDC. In light of our recent observation that type I IFN is sufficient for the induction of latency immediately upon infection, our results imply that IFN secreted by mDC may play an important role in the establishment of CMV latency. IMPORTANCE Numerous studies have focused on the infection of DC with cytomegaloviruses and on the establishment of latency within them. However, almost all of these studies have relied on the infection of DC monocultures in vitro, whereas DC are just one among many cell types present in an infection site in vivo. To mimic this aspect of the in vivo situation, we cocultured DC with infected endothelial cells

  20. Possible involvement of hippocampal immediate-early genes in contextual fear memory deficit induced by cranial irradiation.

    PubMed

    Son, Yeonghoon; Kang, Sohi; Kim, Jinwook; Lee, Sueun; Kim, Jong-Choon; Kim, Sung-Ho; Kim, Joong-Sun; Jo, Sung-Kee; Jung, Uhee; Youn, BuHyun; Shin, Taekyun; Yang, Miyoung; Moon, Changjong

    2016-09-01

    Cranial irradiation can trigger adverse effects on brain functions, including cognitive ability. However, the cellular and molecular mechanisms underlying radiation-induced cognitive impairments remain still unknown. Immediate-early genes (IEGs) are implicated in neuronal plasticity and the related functions (i.e., memory formation) in the hippocampus. The present study quantitatively assessed changes in the mRNA and protein levels of the learning-induced IEGs, including Arc, c-fos, and zif268, in the mouse hippocampus after cranial irradiation using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) and immunohistochemistry, respectively. Mice (male, 8-week-old C57BL/6) received whole-brain irradiation with 0 or 10Gy of gamma-ray and, 2weeks later, contextual fear conditioning (CFC) was used to induce IEGs. In the CFC task, mice evaluated 2weeks after irradiation exhibited significant memory deficits compared with sham (0Gy)-irradiated controls. The levels of mRNA encoding IEGs were significantly upregulated in the hippocampus 10 and 30min after CFC training. The mRNA levels in the irradiated hippocampi were significantly lower than those in the sham-irradiated controls. The IEG protein levels were significantly increased in all hippocampal regions, including the hippocampal dentate gyrus, cornu ammonis (CA)1, and CA3, after CFC training. The CFC-induced upregulation of Arc and c-fos in 10Gy-irradiated hippocampi was significantly lower than that in sham-irradiated controls, although there were no significant differences in the protein levels of the learning-induced zif268 between sham-irradiated and 10Gy-irradiated hippocampi. Thus, cranial irradiation with 10Gy of gamma-ray impairs the induction of hippocampal IEGs (particularly Arc and c-fos) via behavioral contextual fear memory, and this disturbance may be associated with the memory deficits evident in mice after cranial irradiation, possibly through the dysregulation of neuronal

  1. Immediate early gene expression in the vestibular nuclei and related vegetative areas in rats during space flight.

    PubMed

    Pompeiano, O; d'Ascanio, P; Centini, C; Pompeiano, M; Cirelli, C; Tononi, G

    2001-01-01

    Changes in neuronal activity resulting in somatic and vegetative deficits occur during different space flight conditions. Immediate early genes (IEGs: c-fos and Fos-related antigen [FRA]) are useful indicators of changes in neuronal activity and plasticity. They are induced within minutes of several extracellular stimulations, while the corresponding proteins persist for hours (Fos) or days (FRAs). Changes in IEG expression are likely to contribute to adaptation to microgravity and readaptation to the terrestrial environment. During the NASA Neurolab Mission (STS-90), changes in IEG expression were studied in adult male albino rats (Fisher 344) sacrificed at flight day (FD) 2 (24 h after launch), FD14 and at similar time points after re-entry (R + 1, 24 h after re-entry, and R + 13). These time points were chosen to maximize the probability of detecting changes in IEG expression related to changes in gravitational fields occurring during the mission, e.g. (i) increase in gravitational force from 1 to 3 g during the launch, before reaching about 0 g at FD2; (ii) adaptation to 0 g at FD14; (iii) increase in gravity from 0 to approximately 1.5-1.8 g before reaching 1 g at R + 1; and (iv) readaptation to 1 g at R + 13. Fos- and FRA-positive cells were identified in the brainstem of flight rats and ground-based controls using immunocytochemistry. With respect to control rats, the number of labeled cells increased in flight animals in the medial and spinal vestibular nuclei (but not in the lateral vestibular nucleus) at FD2, decreased at FD14, greatly increased at R + 1 and returned to baseline levels at R + 13. Similar changes in IEG expression were also observed in the nucleus of the solitary tract, the area postrema and the central nucleus of the amygdala. In particular, in these vegetative areas the number of Fos-positive cells decreased in flight rats with respect to controls at FD14, i.e. after exposure to 0 g, but significantly increased at R + 1, i.e. after

  2. pNEB193-derived suicide plasmids for gene deletion and protein expression in the methane-producing archaeon, Methanosarcina acetivorans.

    PubMed

    Shea, Mitchell T; Walter, Mary E; Duszenko, Nikolas; Ducluzeau, Anne-Lise; Aldridge, Jared; King, Shannon K; Buan, Nicole R

    2016-01-01

    Gene deletion and protein expression are cornerstone procedures for studying metabolism in any organism, including methane-producing archaea (methanogens). Methanogens produce coenzymes and cofactors not found in most bacteria, therefore it is sometimes necessary to express and purify methanogen proteins from the natural host. Protein expression in the native organism is also useful when studying post-translational modifications and their effect on gene expression or enzyme activity. We have created several new suicide plasmids to complement existing genetic tools for use in the methanogen, Methanosarcina acetivorans. The new plasmids are derived from the commercially available Escherichia coli plasmid, pNEB193, and cannot replicate autonomously in methanogens. The designed plasmids facilitate markerless gene deletion, gene transcription, protein expression, and purification of proteins with cleavable affinity tags from the methanogen, M. acetivorans. PMID:26876941

  3. The product of Kaposi's sarcoma-associated herpesvirus immediate early gene K4.2 regulates immunoglobulin secretion and calcium homeostasis by interacting with and inhibiting pERP1.

    PubMed

    Wong, Lai-Yee; Brulois, Kevin; Toth, Zsolt; Inn, Kyung-Soo; Lee, Sun-Hwa; O'Brien, Kathryn; Lee, Hyera; Gao, Shou-Jiang; Cesarman, Ethel; Ensser, Armin; Jung, Jae U

    2013-11-01

    Chaperones are proteins that assist the noncovalent folding and assembly of macromolecular polypeptide chains, ultimately preventing the formation of nonfunctional or potentially toxic protein aggregates. Plasma cell-induced-endoplasmic reticulum (ER)-resident protein 1 (pERP1) is a cellular chaperone that is preferentially expressed in marginal-zone B cells and is highly upregulated during plasma cell differentiation. While initially identified as a dedicated factor for the assembly of secreted IgM, pERP1 has since been implicated in suppressing calcium mobilization, and its expression is misregulated in multiple tumors. A number of herpesvirus immediate early gene products play important roles in the regulation of viral gene expression and/or evasion of host immune responses. Here, we report that the Kaposi's sarcoma-associated herpesvirus (KSHV) immediate early viral gene K4.2 encodes an endoplasmic reticulum-localized protein that interacts with and inhibits pERP1. Consequently, K4.2 expression interfered with immunoglobulin secretion by delaying the kinetics of immunoglobulin assembly and also led to increased responsiveness of B-cell receptor signal transduction by enhancing phosphotyrosine signals and intracellular calcium fluxes. Furthermore, K4.2 expression also appeared to contribute to maximal lytic replication by enhancing viral glycoprotein expression levels and ultimately promoting infectious-virus production. Finally, immunohistochemistry analysis showed that pERP1 expression was readily detected in KSHV-positive cells from multicentric Castleman's disease (MCD) and Kaposi's sarcoma (KS) lesions, suggesting that pERP1 may have potential roles in the KSHV life cycle and malignancy. In conclusion, our data suggest that K4.2 participates in lytic replication by enhancing calcium flux and viral glycoprotein expression, but also by interfering with immunoglobulin assembly to potentially dampen the adaptive immune response. PMID:23986581

  4. Novel Comparative Pattern Count Analysis Reveals a Chronic Ethanol-Induced Dynamic Shift in Immediate Early NF-κB Genome-wide Promoter Binding During Liver Regeneration

    PubMed Central

    Kuttippurathu, Lakshmi; Patra, Biswanath; Hoek, Jan B; Vadigepalli, Rajanikanth

    2016-01-01

    Liver regeneration after partial hepatectomy is a clinically important process that is impaired by adaptation to chronic alcohol intake. We focused on the initial time points following partial hepatectomy (PHx) to analyze genome-wide binding activity of NF-κB, a key immediate early regulator. We investigated the effect of chronic alcohol intake on immediate early NF-κB genome-wide localization, in the adapted state as well as in response to partial hepatectomy, using chromatin immunoprecipitation followed by promoter microarray analysis. We found many ethanol-specific NF-κB binding target promoters in the ethanol-adapted state, corresponding to regulation of biosynthetic processes, oxidation-reduction and apoptosis. Partial hepatectomy induced a diet-independent shift in NF-κB binding loci relative to the transcription start sites. We employed a novel pattern count analysis to exhaustively enumerate and compare the number of promoters corresponding to the temporal binding patterns in ethanol and pair-fed control groups. The highest pattern count corresponded to promoters with NF-κB binding exclusively in the ethanol group at 1h post PHx. This set was associated with regulation of cell death, response to oxidative stress, histone modification, mitochondrial function, and metabolic processes. Integration with the global gene expression profiles to identify putative transcriptional consequences of NF-κB binding patterns revealed that several of ethanol-specific 1h binding targets showed ethanol-specific differential expression through 6h post PHx. Motif analysis yielded co-incident binding loci for STAT3, AP-1, CREB, C/EBP-β, PPAR-γ and C/EBP-α, likely participating in co-regulatory modules with NF-κB in shaping the immediate early response to PHx. We conclude that adaptation to chronic ethanol intake disrupts the NF-κB promoter binding landscape with consequences for the immediate early gene regulatory response to the acute challenge of PHx. PMID:26847025

  5. Inhibition of the FACT Complex Reduces Transcription from the Human Cytomegalovirus Major Immediate Early Promoter in Models of Lytic and Latent Replication.

    PubMed

    O'Connor, Christine M; Nukui, Masatoshi; Gurova, Katerina V; Murphy, Eain A

    2016-04-01

    The successful colonization of the majority of the population by human cytomegalovirus is a direct result of the virus's ability to establish and, more specifically, reactivate from latency. The underlying cellular factors involved in viral reactivation remain unknown. Here, we show that the host complexfacilitateschromatintranscription (FACT) binds to the major immediate early promoter (MIEP) and that inhibition of this complex reduces MIEP transactivation, thus inhibiting viral reactivation. PMID:26865717

  6. Bovine Herpes Virus 1 Major Immediate Early Transcription Unit 1 (IETU-1) Uses Alternative Promoters to Transcribe BICP0 and BICP4 Transcripts.

    PubMed

    Pokhriyal, Mayank; Verma, O P; Ratta, Barkha; Kumar, Ajay; Saxena, Meeta; Sharma, Bhaskar

    2016-04-01

    Immediate early (IE) genes are transcribed immediately after infection in BHV1 from two different immediate early transcription units. It is reported that the immediate early transcription unit I (IE TU1) of Bovine herpesvirus 1 (BHV1) transcribes two proteins BICP0 and BICP4 from a single promoter by alternative splicing but with identical 5'UTR. We found that the transcripts of BICP0 and BICP4 have different 5'UTRs. The bioinformatics analysis shows two similar spatially arranged TATA less promoter for the two transcripts. The bioinformatics analysis also showed a similar promoter for the IE TU2 which transcribes BICP22. The data strongly suggest that BICP0 and BICP4 are transcribed from two different promoters. The transcript produced by each promoter is spliced specifically as opposed to what has been reported earlier. The BICP0 and BICP4 also show different levels of expression. The expression level of BICP4 continuously declines after attaining a peak level at 1 h, while BICP0 shows biphasic expression supporting the earlier observation that it is expressed from two different promoters. PMID:26719189

  7. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  8. C-fos and egr-1 immediate-early gene induction by cocaine and cocaethylene in rat brain: a comparative study.

    PubMed

    Thiriet, N; Aunis, D; Zwiller, J

    2000-09-01

    The induction of immediate-early genes can now be considered as a tool to study neuronal activation in different brain structures. These genes, which are rapidly and transiently induced in response to diverse extracellular stimulation, coordinate alterations in gene expression underlying neuronal plasticity. Using in situ hybridization, we found that acute i.p. cocaine (20 mg/kg) injection produced a strong expression of egr-1 and c-fos genes in the nucleus accumbens, caudate-putamen, and frontal cortex in the rat. Cocaethylene is an active metabolite of cocaine that is formed when cocaine is consumed together with ethyl alcohol. Injection of cocaethylene at a dose equivalent to cocaine induced the expression of the two immediate-early genes in the same brain structures, but to a lesser extent. A high dose of ethanol increased egr-1 and c-fos expression in the frontal cortex and in the lateral part of the caudate-putamen. Since cocaine is known to potently inhibit both dopamine and serotonin transporters, whereas cocaethylene only inhibits the dopamine transporter, our results strongly suggest that the serotonergic system participates in the mode of action of cocaine in its ability to trigger immediate-early gene transcription. PMID:11085307

  9. RNA from an immediate early region of the type 1 herpes simplex virus genome is present in the trigeminal ganglia of latently infected mice

    SciTech Connect

    Deatly, A.M.; Spivack, J.G.; Lavi, E.; Fraser, N.W.

    1987-05-01

    Transcription of the type 1 herpes simplex virus (HSV-1) genome in trigeminal ganglia of latently infected mice was studied using in situ hybridization. Probes representative of each temporal gene class were used to determine the regions of the genome that encode the transcripts present in latently infected cells. Probes encoding HSV-1 sequences of the five immediate early genes and representative early (thymidine kinase), early-late (major capsid protein), and late (glycoprotein C) genes were used in these experiments. Of the probes tested, only those encoding the immediate early gene product infected-cell polypeptide (ICP) 0 hybridized to RNA in latently infected tissues. Probes containing the other immediate early genes (ICP4, ICP22, ICP27, and ICP47) and the representative early, early-late, and late genes did not hybridize. Two probes covering approx. = 30% of the HSV-1 genome and encoding over 20 early and late transcripts also did not hybridize to RNA in latently infected tissues. These results, with probes spanning > 60% of the HSV-1 genome, suggest that transcription of the HSV-1 genome is restricted to one region in latently infected mouse trigeminal ganglia.

  10. Paradoxical effects of prodynorphin gene deletion on basal and cocaine-evoked dopaminergic neurotransmission in the nucleus accumbens.

    PubMed

    Chefer, V I; Shippenberg, T S

    2006-01-01

    Quantitative and conventional microdialysis were used to investigate the effects of constitutive deletion of the prodynorphin gene on basal dopamine (DA) dynamics in the nucleus accumbens (NAc) and the responsiveness of DA neurons to an acute cocaine challenge. Saline- and cocaine-evoked locomotor activity were also assessed. Quantitative microdialysis revealed that basal extracellular DA levels were decreased, while the DA extraction fraction, an indirect measure of DA uptake, was unchanged in dynorphin (DYN) knockout (KO) mice. The ability of cocaine to increase NAc DA levels was reduced in KO. Similarly, cocaine-evoked locomotor activity was decreased in KO. The selective kappa opioid receptor agonist U-69593 decreased NAc dialysate DA levels in wildtype mice and this effect was enhanced in KO. Administration of the selective kappa opioid receptor (KOPr) antagonist nor-binaltorphimine to KO mice attenuated the decrease in cocaine-induced DA levels. However, it was ineffective in altering the decreased locomotor response to cocaine. These studies demonstrate that constitutive deletion of prodynorphin is associated with a reduction of extracellular NAc DA levels and a decreased responsiveness to acute cocaine. Data regarding the effects of U-69593 and nor-binaltorphimine in KO suggest that the kappa opioid receptor is up-regulated as a consequence of prodynorphin gene deletion and that this adaptation underlies the decrease in basal DA dynamics and cocaine-evoked DA levels observed in DYN KO mice. These findings suggest that the phenotype of DYN KO mice is not solely due to loss of endogenous opioid peptide but also reflects developmental compensations that occur at the level of the opioid receptor. PMID:16420432

  11. Soluble epoxide hydrolase inhibition and gene deletion are protective against myocardial ischemia-reperfusion injury in vivo.

    PubMed

    Motoki, Atsuko; Merkel, Matthias J; Packwood, William H; Cao, Zhiping; Liu, Lijuan; Iliff, Jeffrey; Alkayed, Nabil J; Van Winkle, Donna M

    2008-11-01

    Soluble epoxide hydrolase (sEH) metabolizes epoxyeicosatrienoic acids (EETs) to dihydroxyeicosatrienoic acids. EETs are formed from arachidonic acid during myocardial ischemia and play a protective role against ischemic cell death. Deletion of sEH has been shown to be protective against myocardial ischemia in the isolated heart preparation. We tested the hypothesis that sEH inactivation by targeted gene deletion or pharmacological inhibition reduces infarct size (I) after regional myocardial ischemia-reperfusion injury in vivo. Male C57BL\\6J wild-type or sEH knockout mice were subjected to 40 min of left coronary artery (LCA) occlusion and 2 h of reperfusion. Wild-type mice were injected intraperitoneally with 12-(3-adamantan-1-yl-ureido)-dodecanoic acid butyl ester (AUDA-BE), a sEH inhibitor, 30 min before LCA occlusion or during ischemia 10 min before reperfusion. 14,15-EET, the main substrate for sEH, was administered intravenously 15 min before LCA occlusion or during ischemia 5 min before reperfusion. The EET antagonist 14,15-epoxyeicosa-5(Z)-enoic acid (EEZE) was given intravenously 15 min before reperfusion. Area at risk (AAR) and I were assessed using fluorescent microspheres and triphenyltetrazolium chloride, and I was expressed as I/AAR. I was significantly reduced in animals treated with AUDA-BE or 14,15-EET, independent of the time of administration. The cardioprotective effect of AUDA-BE was abolished by the EET antagonist 14,15-EEZE. Immunohistochemistry revealed abundant sEH protein expression in left ventricular tissue. Strategies to increase 14,15-EET, including sEH inactivation, may represent a novel therapeutic approach for cardioprotection against myocardial ischemia-reperfusion injury. PMID:18835921

  12. Tph2 gene deletion enhances amphetamine-induced hypermotility: effect of 5-HT restoration and role of striatal noradrenaline release.

    PubMed

    Carli, Mirjana; Kostoula, Chrysaugi; Sacchetti, Giuseppina; Mainolfi, Pierangela; Anastasia, Alessia; Villani, Claudia; Invernizzi, Roberto William

    2015-11-01

    Variants of tryptophan hydroxylase-2 (Tph2), the gene encoding enzyme responsible for the synthesis of brain serotonin (5-HT), have been associated with neuropsychiatric disorders, substance abuse and addiction. This study assessed the effect of Tph2 gene deletion on motor behavior and found that motor activity induced by 2.5 and 5 mg/kg amphetamine was enhanced in Tph2(-/-) mice. Using the in vivo microdialysis technique we found that the ability of amphetamine to stimulate noradrenaline (NA) release in the striatum was reduced by about 50% in Tph2(-/-) mice while the release of dopamine (DA) was not affected. Tph2 deletion did not affect the release of NA and DA in the prefrontal cortex. The role of endogenous 5-HT in enhancing the effect of amphetamine was confirmed showing that treatment with the 5-HT precursor 5-hydroxytryptophan (10 mg/kg) restored tissue and extracellular levels of brain 5-HT and the effects of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. Treatment with the NA precursor dihydroxyphenylserine (400 mg/kg) was sufficient to restore the effect of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. These findings indicate that amphetamine-induced hyperactivity is attenuated by endogenous 5-HT through the inhibition of striatal NA release. Tph2(-/-) mice may be a useful preclinical model to assess the role of 5-HT-dependent mechanisms in the action of psychostimulants. Acute sensitivity to the motor effects of amphetamine has been associated to increased risk of psychostimulant abuse. Here, we show that deletion of Tph2, the gene responsible for brain 5-HT synthesis, enhances the motor effect of amphetamine in mice through the inhibition of striatal NA release. This suggests that Tph2(-/-) mice is a useful preclinical model to assess the role of 5-HT-dependent mechanisms in psychostimulants action. Tph2, tryptophan hydroxylase-2. PMID:26259827

  13. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice

    PubMed Central

    Esteva-Font, Cristina; Jin, Byung-Ju; Verkman, A. S.

    2014-01-01

    Aquaporin 1 (AQP1) is a plasma membrane water-transporting protein expressed strongly in tumor microvascular endothelia. We previously reported impaired angiogenesis in implanted tumors in AQP1-deficient mice and reduced migration of AQP1-deficient endothelial cells in vitro. Here, we investigated the consequences of AQP1 deficiency in mice that spontaneously develop well-differentiated, luminal-type breast adenomas with lung metastases [mouse mammary tumor virus-driven polyoma virus middle T oncogene (MMTV-PyVT)]. AQP1+/+ MMTV-PyVT mice developed large breast tumors with total tumor mass 3.5 ± 0.5 g and volume 265 ± 36 mm3 (se, 11 mice) at age 98 d. Tumor mass (1.6±0.2 g) and volume (131±15 mm3, 12 mice) were greatly reduced in AQP1−/− MMTV-PyVT mice (P<0.005). CD31 immunofluorescence showed abnormal microvascular anatomy in tumors of AQP1−/− MMTV-PyVT mice, with reduced vessel density. HIF-1α expression was increased in tumors in AQP1−/− MMTV-PyVT mice. The number of lung metastases (5±1/mouse) was much lower than in AQP1+/+ MMTV-PyVT mice (31±8/mouse, P<0.005). These results implicate AQP1 as an important determinant of tumor angiogenesis and, hence, as a potential drug target for adjuvant therapy of solid tumors.—Esteva-Font, C., Jin, B.-J., Verkman, A. S. Aquaporin-1 gene deletion reduces breast tumor growth and lung metastasis in tumor-producing MMTV-PyVT mice. PMID:24334548

  14. Na+ dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    PubMed Central

    Christensen, Henriette L.; Nguyen, An T.; Pedersen, Fredrik D.; Damkier, Helle H.

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na+ dependent Cl−/HCO3− exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na+:HCO3− cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na+:HCO3− cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na+/H+ exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed. PMID:24155723

  15. Cystathionine-Gamma-Lyase Gene Deletion Protects Mice against Inflammation and Liver Sieve Injury following Polymicrobial Sepsis

    PubMed Central

    Gaddam, Ravinder Reddy; Fraser, Robin; Badiei, Alireza; Chambers, Stephen; Cogger, Victoria C; Le Couteur, David G; Ishii, Isao; Bhatia, Madhav

    2016-01-01

    Background Hydrogen sulfide (H2S), produced by the activity of cystathionine-gamma-lyase (CSE), is a key mediator of inflammation in sepsis. The liver sinusoidal endothelial cells (LSECs) are important target and mediator of sepsis. The aim of this study was to investigate the role of CSE-derived H2S on inflammation and LSECs fenestrae in caecal-ligation and puncture (CLP)-induced sepsis using CSE KO mice. Methods Sepsis was induced by CLP, and mice (C57BL/6J, male) were sacrificed after 8 hours. Liver, lung, and blood were collected and processed to measure CSE expression, H2S synthesis, MPO activity, NF-κB p65, ERK1/2, and cytokines/chemokines levels. Diameter, frequency, porosity and gap area of the liver sieve were calculated from scanning electron micrographs of the LSECs. Results An increased CSE expression and H2S synthesizing activity in the liver and lung of wild-type mice following CLP-induced sepsis. This was associated with an increased liver and lung MPO activity, and increased liver and lung and plasma levels of the pro-inflammatory cytokines TNF-α, IL-6, and IL-1β, and the chemokines MCP-1 and MIP-2α. Conversely, CSE KO mice had less liver and lung injury and reduced inflammation following CLP-induced sepsis as evidenced by decreased levels of H2S synthesizing activity, MPO activity, and pro-inflammatory cytokines/chemokines production. Extracellular-regulated kinase (ERK1/2) and nuclear factor-κB p65 (NF-κB) became significantly activated after the CLP in WT mice but not in CSE KO mice. In addition, CLP-induced damage to the LSECs, as indicated by increased defenestration and gaps formation in the LSECs compared to WT sham control. CSE KO mice showed decreased defenestration and gaps formation following sepsis. Conclusions Mice with CSE (an H2S synthesising enzyme) gene deletion are less susceptible to CLP-induced sepsis and associated inflammatory response through ERK1/2-NF-κB p65 pathway as evidenced by reduced inflammation, tissue damage

  16. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity

    PubMed Central

    Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie

    2012-01-01

    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

  17. Bacterial Infection of endometrial stromal cells influences bovine herpersvirus 4 immediate early gene activation: a new insight into bacterial and viral interaction for uterine disease

    PubMed Central

    Donofrio, Gaetano; Ravanetti, Lara; Cavirani, Sandro; Herath, Shan; Capocefalo, Antonio; Sheldon, Iain Martin

    2009-01-01

    Experimental infection with the gammaherpesvirus Bovine herpesvirus 4 (BoHV-4) rarely establishes disease, yet BoHV-4 is commonly associated with uterine disease in cattle. Uterine disease involves co-infection with bacteria such as Escherichia coli, which stimulate the production of prostaglandin E2 (PGE2) by endometrial cells. BoHV-4 replication depends on Immediate Early 2 (IE2) gene transactivation, and in the present study, PGE2, E. coli or its lipopolysaccharide (LPS), up-regulated the IE2 gene promoter in uterine cells. Bacterial co-infection is important for BoHV-4 uterine disease. PMID:18577555

  18. HBV polymerase overexpression due to large core gene deletion enhances hepatoma cell growth by binding inhibition of microRNA-100

    PubMed Central

    Huang, Ya-Hui; Tseng, Ying-Hsin; Lin, Wey-Ran; Hung, George; Chen, Tse-Ching; Wang, Tong-Hong; Lee, Wei-Chen; Yeh, Chau-Ting

    2016-01-01

    Different types of hepatitis B virus (HBV) core gene deletion mutants were identified in chronic hepatitis B patients. However, their clinical roles in different stages of natural chronic HBV infection remained unclear. To address this issue, HBV core genes were sequenced in three gender- and age-matched patient groups diagnosed as chronic hepatitis, cirrhosis and hepatocellular carcinoma (HCC), respectively. Functional analysis of the identified mutants was performed. A novel type of large-fragment core gene deletion (LFCD) was identified exclusively in HCC patients and significantly associated with unfavorable postoperative survival. The presence of LFCDs resulted in generation of precore-polymerase fusion protein or brought the polymerase reading frame under direct control of HBV precore/core promoter, leading to its over-expression. Enhanced cell proliferation and increased tumorigenicity in nude mice were found in hepatoma cells expressing LFCDs. Because of the epsilon-binding ability of HBV polymerase, we hypothesized that the over-expressed polymerase carrying aberrant amino-terminal sequence could bind to cellular microRNAs. Screening of a panel of microRNAs revealed physical association of a precore-polymerase fusion protein with microRNA-100. A binding inhibition effect on microRNA-100 by the precore-polymerase fusion protein with up-regulation of its target, polo-like kinase 1 (PLK1), was discovered. The binding inhibition and growth promoting effects could be reversed by overexpressing microRNA-100. Together, HCC patients carrying hepatitis B large-fragment core gene deletion mutants had an unfavorable postoperative prognosis. The growth promoting effect was partly due to polymerase overexpression, leading to binding inhibition of microRNA-100 and up-regulation of PLK1. PMID:26824500

  19. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides

    PubMed Central

    2014-01-01

    Background Rhodosporidium toruloides is a β-carotenoid accumulating, oleaginous yeast that has great biotechnological potential. The lack of reliable and efficient genetic manipulation tools have been a major hurdle blocking its adoption as a biotechnology platform. Results We report for the first time the development of a highly efficient targeted gene deletion method in R. toruloides ATCC 10657 via Agrobacterium tumefaciens-mediated transformation. To further improve targeting frequency, the KU70 and KU80 homologs in R. toruloides were isolated and characterized in detail. A KU70-deficient mutant (∆ku70e) generated with the hygromycin selection cassette removed by the Cre-loxP recombination system showed a dramatically improved targeted gene deletion frequency, with over 90% of the transformants being true knockouts when homology sequence length of at least 1 kb was used. Successful gene targeting could be made with homologous flanking sequences as short as 100 bp in the ∆ku70e strain. KU70 deficiency did not perturb cell growth although an elevated sensitivity to DNA mutagenic agents was observed. Compared to the other well-known oleaginous yeast, Yarrowia lipolytica, R. toruloides KU70/KU80 genes contain much higher density of introns and are the most GC-rich KU70/KU80 genes reported. Conclusions The KU70-deficient mutant generated herein was effective in improving gene deletion frequency and allowed shorter homology sequences to be used for gene targeting. It retained the key oleaginous and fast growing features of R. toruloides. The strain should facilitate both fundamental and applied studies in this important yeast, with the approaches taken here likely to be applicable in other species in subphylum Pucciniomycotina. PMID:25188820

  20. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    SciTech Connect

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  1. Investigation of TBX1 gene deletion in Iranian children with 22q11.2 deletion syndrome: correlation with conotruncal heart defects

    PubMed Central

    Ganji, Hamid; Salehi, Mansoor; Sedghi, Maryam; Abdali, Hossein; Nouri, Nayereh; Sadri, Leyli; Hosseinzadeh, Majid; Vakili, Bahareh; Lotfi, Mahdi

    2013-01-01

    Background DiGeorge syndrome (DGS) is the result of a microdeletion in chromosome 22q11.2 in over 90% of cases. DGS is the second most frequent syndrome after Down syndrome and has an incidence of 1/4000 births. Unequal crossover between low-copy repeats, on the proximal part of the long arm of chromosome 22, usually results in a 3 Mb deletion in one of the chromosome 22 and a reciprocal and similarly sized duplication on the other one. Several studies have indicated that TBX1 (T-box 1) haploinsufficiency is responsible for many of the phenotypic traits of 22q11.2 deletion syndrome. Conotruncal heart defects (CTDs) are present in 75–85% of patients with 22q11.2 deletion syndrome in Western countries. Methods Among 78 patients fulfilling the criteria for DGS diagnosed by the fluorescence in situ hybridisation test, 24 had 22q11.2 deletion. Screening for TBX1 gene deletion was performed by multiplex ligation-dependent probe amplification (MLPA). Results Our results revealed that of 24 patients with TBX1 gene deletion, 12 had CTDs while 12 did not show any heart defects. Conclusions Our findings indicate that other genes or gene interactions may play a role in penetrance or the severity of heart disease among patients with DGS. PMID:27326128

  2. Heterozygous Hfe gene deletion leads to impaired glucose homeostasis, but not liver injury in mice fed a high-calorie diet.

    PubMed

    Britton, Laurence; Jaskowski, Lesley; Bridle, Kim; Santrampurwala, Nishreen; Reiling, Janske; Musgrave, Nick; Subramaniam, V Nathan; Crawford, Darrell

    2016-06-01

    Heterozygous mutations of the Hfe gene have been proposed as cofactors in the development and progression of nonalcoholic fatty liver disease (NAFLD). Homozygous Hfe deletion previously has been shown to lead to dysregulated hepatic lipid metabolism and accentuated liver injury in a dietary mouse model of NAFLD We sought to establish whether heterozygous deletion of Hfe is sufficient to promote liver injury when mice are exposed to a high-calorie diet (HCD). Eight-week-old wild-type and Hfe(+/-) mice received 8 weeks of a control diet or HCD Liver histology and pathways of lipid and iron metabolism were analyzed. Liver histology demonstrated that mice fed a HCD had increased NAFLD activity score (NAS), steatosis, and hepatocyte ballooning. However, liver injury was unaffected by Hfe genotype. Hepatic iron concentration (HIC) was increased in Hfe(+/-) mice of both dietary groups. HCD resulted in a hepcidin-independent reduction in HIC Hfe(+/-) mice demonstrated raised fasting serum glucose concentrations and HOMA-IR score, despite unaltered serum adiponectin concentrations. Downstream regulators of hepatic de novo lipogenesis (pAKT, SREBP-1, Fas, Scd1) and fatty acid oxidation (AdipoR2, Pparα, Cpt1) were largely unaffected by genotype. In summary, heterozygous Hfe gene deletion is associated with impaired iron and glucose metabolism. However, unlike homozygous Hfe deletion, heterozygous gene deletion did not affect lipid metabolism pathways or liver injury in this model. PMID:27354540

  3. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

    SciTech Connect

    Lee Jialing; Klase, Zachary; Gao Xiaoqi; Caldwell, Jeremy S.; Stinski, Mark F.; Kashanchi, Fatah; Chao, S.-H.

    2007-09-15

    An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein

  4. Human T-lymphotropic virus tax activates human cytomegalovirus major-immediate early promoter and improves production of recombinant proteins in HEK293 cells.

    PubMed

    Lwa, Teng Rhui; Lee, Jialing; Ng, Chew Har; Lew, Qiao Jing; Hia, Hui Ching; Chao, Sheng-Hao

    2011-01-01

    The human cytomegalovirus (CMV) major immediate-early (MIE) promoter is widely used in mammalian cells for production of recombinant proteins. It is of great interest to further enhance protein production driven by the CMV promoter. Here, we report that the Tax protein of human T-lymphotropic virus stimulates the transgene expression under the control of CMV MIE promoter in HEK293 cells. At least threefold increases in transient production of recombinant proteins, including luciferase and two biopharmaceutical proteins (erythropoietin and interferon-γ), were detected. Furthermore, cyclic adenosine monophosphate (AMP)-response element binding protein 2 (CREB2) was identified as a cellular cofactor, which might be responsible for Tax transactivation of the CMV MIE promoter. Our results not only demonstrate the potential use of this novel expression strategy for improvement of recombinant protein production in HEK293 cells but also provide the molecular mechanism for Tax-mediated activation of CMV MIE promoter. PMID:21425252

  5. Immediate-early gene transcriptional activation in hippocampus CA1 and CA3 does not accurately reflect rapid, pattern completion-based retrieval of context memory

    PubMed Central

    Pevzner, Aleksandr

    2015-01-01

    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual representation. Despite differences in behavior, we did not find any difference in CA1 or CA3 IEG activity associated with this rapid recall phase when comparing context preexposed and non-pre-exposed groups. These findings indicate that IEG activation in CA1 and CA3 is not an accurate readout of the neural activity associated with hippocampus-dependent rapid memory retrieval. PMID:25512571

  6. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    SciTech Connect

    Kenney, S.; Kamine, J.; Markovitz, D.; Fenrick, R.; Pagano, J.

    1988-03-01

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses.

  7. Hippocampus and medial striatum dissociation during goal navigation by geometry or features in the domestic chick: An immediate early gene study.

    PubMed

    Mayer, Uwe; Pecchia, Tommaso; Bingman, Verner Peter; Flore, Michele; Vallortigara, Giorgio

    2016-01-01

    We employed a standard reference memory task to study the involvement of the hippocampal formation (HF) of domestic chicks that used the boundary geometry of a test environment to orient to and locate a reward. Using the immediate early gene product c-Fos as a neuronal activity marker, we found enhanced HF activation in chicks that learned to locate rewarded corners using the shape of a rectangular arena compared to chicks trained to solve the task by discriminating local features in a square-shaped arena. We also analyzed neuronal activity in the medial part of the medial striatum (mMSt). Surprisingly, in mMSt we observed a reverse pattern, with higher activity in the chicks that were trained to locate the goal by local features. Our results identify two seemingly parallel, memory systems in chicks, with HF central to the processing of spatial-geometrical information and mMSt important in supporting local feature discrimination. PMID:26135386

  8. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  9. Human cytomegalovirus pp65- and immediate early 1 antigen-specific HLA class I-restricted cytotoxic T cell responses induced by cross-presentation of viral antigens.

    PubMed

    Tabi, Z; Moutaftsi, M; Borysiewicz, L K

    2001-05-01

    Dendritic cells (DCs) play a pivotal role in the development of anti-viral CD8(+) CTL responses. This is straightforward if they are directly infected with virus, but is less clear in response to viruses that cannot productively infect DCS: Human CMV (HCMV) shows strain-specific cell tropism: fibroblast (Fb)-adapted laboratory strains (AD169) and recent clinical isolates do not infect DCs, whereas endothelial cell-adapted strains (TB40/E) result in productive lytic DC infection. However, we show here that uninfected DCs induce CD8(+) T cell cytotoxicity and IFN-gamma production against HCMV pp65 and immediate early 1 Ags following in vitro coculture with HCMV-AD169-infected Fbs, regardless of the HLA type of these FBS: CD8(+) T cell stimulation was inhibited by pretreatment of DCs with cytochalasin B or brefeldin A, indicating a phagosome/endosome to cytosol pathway. HCMV-infected Fbs were not apoptotic as measured by annexin V binding, and induction of apoptosis of infected Fbs in vitro did not augment CTL induction by DCs, suggesting a mechanism other than apoptosis in the initiation of cross-presentation. Furthermore, HCMV-infected Fbs provided a maturation signal for immature DCs during coculture, as evidenced by increased CD83 and HLA class II expression. Cross-presentation of HCMV Ags by host DCs enables these professional APCs to bypass some of the evasion mechanisms HCMV has developed to avoid T cell recognition. It may also serve to explain the presence of immediate early 1 Ag-specific CTLs in the face of pp65-induced inhibition of Ag presentation at the level of the infected cell. PMID:11313411

  10. Intranasal application of vasopressin fails to elicit changes in brain immediate early gene expression, neural activity and behavioral performance of rats

    PubMed Central

    Ludwig, Mike; Tobin, Vicky A.; Callahan, Michael F.; Papadaki, Eirini; Becker, Axel; Engelmann, Mario; Leng, Gareth

    2013-01-01

    Intranasal administration has been widely used to investigate effects of the neuropeptides vasopressin and oxytocin on human behaviors and neurological disorders, but exactly what happens when these neuropeptides are administered intranasally is far from clear. In particular, it is not clear whether a physiological significant amount of peptide enters the brain to account for the observed effects. Here, we investigated whether intranasal administration of vasopressin and oxytocin to rats induces expression of the immediate-early gene product Fos in brain areas that are sensitive to centrally administered peptide, whether it alters neuronal activity in the way that centrally administered peptide does, and whether it affects behavior in ways expected from studies of centrally administered peptide. We found that, whereas intracerebroventricular (icv) injection of very low doses of vasopressin or oxytocin increased Fos expression in several distinct brain regions, intranasal administration of large doses of the peptides had no significant effect. In contrast to the effects of vasopressin applied topically to the main olfactory bulb, we saw no changes in the electrical activity of olfactory bulb mitral cells after intranasal vasopressin administration. In addition, vasopressin given intranasally had no significant effects on social recognition or short-term recognition memory. Finally, intranasal infusions of vasopressin had no significant effects on the parameters monitored on the elevated plus maze, a rodent model of anxiety. Our data in rats suggest that, after intranasal administration, significant amounts of vasopressin and oxytocin do not reach areas in the brain at levels sufficient to change immediate early gene expression, neural activity or behavior in the ways described for central administration of the peptides. PMID:23656518

  11. Co-inheritance of compound heterozygous Hb Constant Spring and a single -alpha(3.7) gene deletion with heterozygous deltabeta thalassaemia: a diagnostic challenge.

    PubMed

    Azma, Raja Zahratul; Othman, Ainoon; Azman, Norazlina; Alauddin, Hafiza; Ithnin, Azlin; Yusof, Nurasyikin; Razak, Noor Farisah; Sardi, Nor Hidayati; Hussin, Noor Hamidah

    2012-06-01

    Haemoglobin Constant Spring (Hb CS) mutation and single gene deletions are common underlying genetic abnormalities for alpha thalassaemias. Co-inheritance of deletional and non-deletional alpha (alpha) thalassaemias may result in various thalassaemia syndromes. Concomitant co-inheritance with beta (beta) and delta (delta) gene abnormalities would result in improved clinical phenotype. We report here a 33-year-old male patient who was admitted with dengue haemorrhagic fever, with a background history of Grave's disease, incidentally noted to have mild hypochromic microcytic red cell indices. Physical examination revealed no thalassaemic features or hepatosplenomegaly. His full blood picture showed hypochromic microcytic red cells with normal haemoglobin (Hb) level. Quantitation of Hb using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE) revealed raised Hb F, normal Hb A2 and Hb A levels. There was also small peak of Hb CS noted in CE. H inclusions was negative. Kleihauer test was positive with heterocellular distribution of Hb F among the red cells. DNA analysis for alpha globin gene mutations showed a single -alpha(-3.7) deletion and Hb CS mutation. These findings were suggestive of compound heterozygosity of Hb CS and a single -alpha(-3.7) deletion with a concomitant heterozygous deltabeta thalassaemia. Co-inheritance of Hb CS and a single -alpha(-3.7) deletion is expected to result at the very least in a clinical phenotype similar to that of two alpha genes deletion. However we demonstrate here a phenotypic modification of alpha thalassemia presumptively as a result of co-inheritance with deltabeta chain abnormality as suggested by the high Hb F level. PMID:22870600

  12. A new reporter mouse cytomegalovirus reveals maintained immediate-early gene expression but poor virus replication in cycling liver sinusoidal endothelial cells

    PubMed Central

    2013-01-01

    Background The MCMV major immediate early promoter/enhancer (MIEP) is a bidirectional promoter that drives the expression of the three immediate early viral genes, namely ie1, ie2 and ie3. The regulation of their expression is intensively studied, but still incompletely understood. Methods We constructed a reporter MCMV, (MCMV-MIEPr) expressing YFP and tdTomato under the control of the MIEP as proxies of ie1 and ie2, respectively. Moreover, we generated a liver sinusoidal endothelial cell line (LSEC-uniLT) where cycling is dependent on doxycycline. We used these novel tools to study the kinetics of MIEP-driven gene expression in the context of infection and at the single cell level by flow cytometry and by live imaging of proliferating and G0-arrested cells. Results MCMV replicated to higher titers in G0-arrested LSEC, and cycling cells showed less cytopathic effect or YFP and tdTomato expression at 5 days post infection. In the first 24 h post infection, however, there was no difference in MIEP activity in cycling or G0-arrested cells, although we could observe different profiles of MIEP gene expression in different cell types, like LSECs, fibroblasts or macrophages. We monitored infected LSEC-uniLT in G0 by time lapse microscopy over five days and noticed that most cells survived infection for at least 96 h, arguing that quick lysis of infected cells could not account for the spread of the virus. Interestingly, we noticed a strong correlation between the ratio of median YFP and tdTomato expression and length of survival of infected cells. Conclusion By means of our newly developed genetic tools, we showed that the expression pattern of MCMV IE1 and IE2 genes differs between macrophages, endothelial cells and fibroblasts. Substantial and cell-cycle independent differences in the ie1 and ie2 transcription could also be observed within individual cells of the same population, and marked ie2 gene expression was associated with longer survival of the infected cells

  13. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  14. Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress

    PubMed Central

    Jensen, Sheila I.; Lennen, Rebecca M.; Herrgård, Markus J.; Nielsen, Alex T.

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains in which four to seven genes were deleted in E. coli W and E. coli K-12. The growth rate of an E. coli K-12 quintuple deletion strain was significantly improved in the presence of high concentrations of acetate and NaCl. In conclusion, we have generated a method that enables efficient and simultaneous deletion of multiple genes in several E. coli variants. The method enables deletion of up to seven genes in as little as seven days. PMID:26643270

  15. The herpes simplex virus type 1 immediate-early protein ICP0 is necessary for the efficient establishment of latent infection.

    PubMed

    Wilcox, C L; Smith, R L; Everett, R D; Mysofski, D

    1997-09-01

    The immediate-early protein ICP0 of herpes simplex virus type 1 (HSV-1) is not essential for viral replication. However, ICP0 is important for efficient viral replication during the productive infection and for reactivation of latent HSV-1 in vivo. The in vitro model of HSV-1 latency in dorsal root ganglia neurons was used to examine the role of ICP0 in the individual steps that could lead to the appearance of a decreased reactivation phenotype of ICP0 mutant viruses. After establishment of latent infections in the neuronal cultures, induction of reactivation by nerve growth factor (NGF) deprivation resulted in the production of infectious virus with delayed kinetics and a burst size that was significantly decreased for the ICP0 mutants compared with wild-type HSV-1. The efficiency of establishment of latency with the ICP0 mutants was similarly decreased at least 10-fold, as measured by three criteria: (i) the percentage of neurons expressing the major latency-associated transcript during the latent infection, (ii) the amount of viral DNA detected in the neuronal cultures, and (iii) the percentage of neurons expressing ICP4 immunoreactivity after the induction of reactivation. The most striking finding was that ICP0 supplied by an adenovirus vector significantly restored the ability of an ICP0 mutant to establish latency and reactivation. These results strongly indicate a critical role for ICP0 in the establishment of the latent HSV-1 infection in the in vitro neuronal model. PMID:9261402

  16. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell. PMID:26143921

  17. The Epstein-Barr Virus Immediate-Early Gene Product, BRLF1, Interacts with the Retinoblastoma Protein during the Viral Lytic Cycle

    PubMed Central

    Zacny, Valerie L.; Wilson, Julie; Pagano, Joseph S.

    1998-01-01

    Retinoblastoma protein (Rb) is a key regulator of cellular proliferation, controlling entry into G1/S in the cell cycle, largely through its action in binding the cellular transcription factor E2F, which activates genes important in DNA synthesis. Small DNA tumor viruses encode gene products which can functionally inactivate Rb, promoting cellular proliferation and viral DNA synthesis. In this study, the Epstein-Barr virus (EBV) immediate-early lytic gene product, BRLF1 (R), is shown to bind Rb in vivo, shortly after induction of the viral lytic cycle in EBV-infected Akata cells. Furthermore, the temporal kinetics of R-Rb interaction correlate with displacement of E2F1 from Rb. Mapping of the domains required for the interaction of R and Rb proteins reveals that R binds specifically to the N terminus of Rb, outside the Rb pocket, and that the first 200 amino acids of R are required for this interaction. The interaction of R and Rb may initiate cell cycle progression and facilitate viral DNA synthesis during lytic replication. PMID:9733844

  18. Dynamic shifts in corticostriatal expression patterns of the immediate early genes Homer 1a and Zif268 during early and late phases of instrumental training.

    PubMed

    Hernandez, Pepe J; Schiltz, Craig A; Kelley, Ann E

    2006-01-01

    Adaptive motor actions require prior knowledge of instrumental contingencies. With practice, these actions can become highly automatic in nature. However, the molecular and anatomical substrates mediating these related forms of learning are not understood. In the present study, we used in situ hybridization to measure the mRNA levels of two immediate early genes (IEGs) in an instrumental paradigm where rats learned to lever-press for food. We report that after three training sessions, Homer 1a and Zif268 (an effector and regulatory IEG, respectively) were significantly induced within an extensive corticostriatal network relative to untrained controls. With extended training (23 sessions), however, a shift in the expression patterns of the two genes was evident. Expression of Homer 1a (official symbol Homer1) decreased significantly in frontal and cingulate cortices, whereas striatal expression was generally maintained. Interestingly, Homer 1a expression markedly increased with extensive training in the ventrolateral region of the striatum (VLS) relative to early learners, suggesting that plasticity in the VLS is required for the efficient production of the learned behavior or in habit formation. Zif268 (official symbol Egr1) expression generally decreased with extensive training; however, these changes were not significant. These results demonstrate for the first time, on a molecular level, a dynamic shift in the contribution of corticostriatal systems mediating the early acquisition and consolidation of goal-directed responses to those engaged after extensive training. PMID:17015857

  19. Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

    PubMed

    Mukilan, Murugan; Ragu Varman, Durairaj; Sudhakar, Sivasubramaniam; Rajan, Koilmani Emmanuvel

    2015-04-01

    The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C. sphinx. However, the infusion of AS-ODN post-training did not cause a deficit in memory formation. Furthermore, the inhibition of miR-132 reduced the olfactory training-induced expression of IEGs and post synaptic density protein-95 (PSD-95) in the OB. Additionally, we show that miR-132 regulates the activation of calcium/calmodulin-dependent protein kinase-II (CaMKII) and cAMP response element binding protein (CREB), possibly through miR-148a. These data suggest that olfactory training induces the expression of miR-132 and IEGs, which in turn activates post-synaptic proteins that regulate olfactory memory formation. PMID:25725166

  20. The immediate early gene Arc is associated with behavioral resilience to stress exposure in an animal model of posttraumatic stress disorder.

    PubMed

    Kozlovsky, Nitsan; Matar, Michael A; Kaplan, Zeev; Kotler, Moshe; Zohar, Joseph; Cohen, Hagit

    2008-02-01

    Mechanisms involved in adaptative and maladaptive changes in neural plasticity and synaptic efficacy in various brain areas are pivotal to understanding the physiology of the response to stress and the pathophysiology of posttraumatic stress disorder (PTSD). Activity-regulated cytoskeletal-associated protein (Arc) is an effector immediate early gene (IEG) which has direct effects on intracellular homeostatic functions. Increased expression of Arc has been associated with increased neuronal activity and with consolidation of long-term memory. It may thus play an important role in mediating experience-induced reorganization and/or development of synaptic connections. This study sought to characterize the pattern of expression of mRNA for the Arc gene in selected brain areas of test subjects classified according to their individual pattern of behavioral response to a stressor, correlated with circulating levels of corticosterone (as a physiological marker of stress response). The hippocampal CA1 and CA3 subregions of individuals whose behavior was minimally or partially disrupted in response to predator scent stress demonstrated significantly increased levels of mRNA for Arc, compared to unexposed controls. The group whose behavior was severely disrupted demonstrated no such upregulation. Consistent with the hypothesis that the Arc gene has a promoting effect on neuronal function and/or structural changes, the lack of Arc expression in the behaviorally and physiologically more severely affected individuals raises the possibility that Arc may be associated with resilience and/or recovery after stress exposure. PMID:17611082

  1. Activation of stress-activated MAP protein kinases up-regulates expression of transgenes driven by the cytomegalovirus immediate/early promoter.

    PubMed Central

    Bruening, W; Giasson, B; Mushynski, W; Durham, H D

    1998-01-01

    The immediate/early promoter/enhancer of cytomegalovirus (CMV promoter) is one of the most commonly used promoters for expression of transgenes in eukaryotic cells. In practice, the CMV promoter is often thought of as a constitutively active unregulated promoter. However, we have observed that transcription from the CMV promoter can be up-regulated by a variety of environmental stresses. Many forms of cellular stress stimulate MAP kinase signalling pathways, resulting in activation of stress-activated protein kinases [SAPKs, also called Jun N-terminal kinases (JNKs)] and p38 kinases. We have found that the same conditions that lead to activation of SAPK/JNKs and p38 kinases can also dramatically increase expression from the CMV promoter. Inhibitors of p38 kinases abolished basal transcription from the CMV promoter and completely blocked stress-induced up-regulation of the CMV promoter. Overexpression of a dominant negative JNK kinase had no effect on basal transcription, but significantly reduced up-regulation caused by stress. These results have grave implications for use of the CMV promoter. If the CMV promoter can be up-regulated by cellular stresses, inadvertent activation of the stress kinase pathways may complicate, if not invalidate, the interpretation of a wide range of experiments. PMID:9421504

  2. Effect of hypergravity on expression of the immediate early gene, c-fos, in central nervous system of medaka (Oryzias latipes)

    NASA Astrophysics Data System (ADS)

    Sayaka, Shimomura-Umemura; Ijiri, Kenichi

    2006-01-01

    Immediate-early genes serve as useful neurobiological tools for mapping brain activity induced by a sensory stimulation. In this study, we have examined brain activity related to gravity perception of medaka (Oryzias latipes) by use of c-fos. The gene, which is homologous to the c-fos genes of other vertebrates, was identified in medaka. Functionally important domains are highly conserved among all the vertebrate species analyzed. Intraperitoneal administration of kainic acid transiently induced the c-fos mRNAs in medaka brains. The results indicate that the expression of c-fos can be utilized as a suitable anatomical marker for the increased neural activities in the central nervous system of medaka. Fish were continuously exposed to 3 g hypergravity by centrifugation. Investigation of c-fos mRNA expression indicated that c-fos mRNA significantly increased 30 min after a start of 3 g exposure. The distribution of its transcripts within the brains was analyzed by an in situ hybridization method. The 3-g treated medakas displayed c-fos positive cells in their brainstem regions, which are related to vestibular function, such as torus semicircularis, nucleus tangentialis, posterior octavu nucleus, and inferior olive. Our results established a method to follow the effect of gravity stimulation, which can be used to investigate gravity perception.

  3. Isolation rearing attenuates social interaction-induced expression of immediate early gene protein products in the medial prefrontal cortex of male and female rats

    PubMed Central

    Wall, Vanessa L.; Fischer, Eva K.; Bland, Sondra T.

    2013-01-01

    Early life adversity and stress in humans has been related to a number of psychological disorders including anxiety, depression, and addiction. The present study used isolation rearing, a well-characterized animal model of early life adversity, to examine its effects on social behavior and immediate early gene (IEG) expression produced by exposure to a novel social experience. Male and female rats were housed in same-sex groups or in isolation for 4 weeks beginning at weaning and were tested during late adolescence. The protein products of the IEGs c-fos and Arc, as well as the neurotrophic factor BDNF were assessed in medial prefrontal cortex (mPFC) subregions (anterior cingulate, prelimbic and infralimbic) using immunohistochemistry. Aggressive and non-aggressive behaviors during novel social exposure were also assessed. Exposure to a novel conspecific produced increases in Arc and c-fos activation in the mPFC of group reared animals in a sex- and subregion-dependent fashion compared to no social exposure controls, but this increase was blunted or absent in isolated animals. Isolates engaged in more social interactions and more aggressive behavior than group reared rats. Sex differences in some behaviors as well as in Arc and BDNF expression were observed. These results indicate that isolation rearing alters IEG activation in the mPFC produced by exposure to a novel conspecific, in addition to changing social behavior, and that these effects depend in part on sex. PMID:22982514

  4. Replication origins and a sequence involved in coordinate induction of the immediate-early gene family are conserved in an intergenic region of herpes simplex virus.

    PubMed Central

    Whitton, J L; Clements, J B

    1984-01-01

    We have determined the structure of the 5' portion of herpes simplex virus type 2 (HSF-2) immediate-early (IE) mRNA-3 and have obtained the DNA sequence specifying the N terminus of its encoded polypeptide, Vmw182, its untranslated leader and the intergenic region between IEmRNAs-3 & 4/5. Comparison of the HSV-2 intergenic sequences with the HSV-1 equivalent region identifies several conserved regions: (1) an AT-rich element with core consensus TAATGARAT which is likely to be the 'activator' sequence through which coordinate induction of the IE gene family is mediated. (2) GC-rich and GA-rich tracts, found in a wide variety of eukaryotic promoters, which vary in position and orientation between HSV-2 and HSV-1 and which represent modulators of transcription. (3) TATA homologies present 15-25 base pairs (bp) upstream of mRNA 5' termini. (4) a 137bp direct repeat in HSV-2 which contains sequence almost identical to the HSV-1 replication origin. Images PMID:6322134

  5. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  6. Transcriptional activation and repression by Fos are independent functions: the C terminus represses immediate-early gene expression via CArG elements.

    PubMed

    Gius, D; Cao, X M; Rauscher, F J; Cohen, D R; Curran, T; Sukhatme, V P

    1990-08-01

    The Fos-Jun complex has been shown to activate transcription through the regulatory element known as the AP-1 binding site. We show that Fos down regulates several immediate-early genes (c-fos, Egr-1, and Egr-2) after mitogenic stimulation. Specifically, we demonstrate that the target for this repression is a sequence of the form CC(A/T)6GG, also known as a CArG box. Whereas Fos bound to the AP-1 site through a domain rich in basic amino acids and associated with Jun via a leucine zipper interaction, mutant Fos proteins lacking these structures were still capable of causing repression. Furthermore, Jun neither enhanced nor inhibited down regulation by Fos. Critical residues required for repression are located within the C-terminal 27 amino acids of c-Fos, since v-Fos and C-terminal truncations of c-Fos did not down regulate. In addition, transfer of 180 c-Fos C-terminal amino acids to Jun conferred upon it the ability to repress. Finally, Fra-1, a Fos-related protein which has striking similarity to Fos in its C-terminal 40 amino acids, also down regulated Egr-1 expression. Thus, Fos is a transcriptional regulator that can activate or repress gene expression by way of two separate functional domains that act on distinct regulatory elements. PMID:2115122

  7. Regulated transcription of the immediate-early gene Zif268: mechanisms and gene dosage-dependent function in synaptic plasticity and memory formation.

    PubMed

    Bozon, Bruno; Davis, Sabrina; Laroche, Serge

    2002-01-01

    The immediate-early gene Zif268 is a member of the Egr family of inducible transcription factors. Data from gene expression studies have suggested that this gene may play a critical role in initial triggering of the genetic machinery that has long been considered a necessary mechanism for maintenance of the later phases of LTP and also for the consolidation or stabilization of long-lasting memories. Until recently, however, the data supporting this assumption have been based primarily on circumstantial evidence, with no direct evidence to suggest that Zif268 is required for long-lasting synaptic plasticity and memory. In this report, we review our own data using Zif268 mutant mice; we show that although the early phase of dentate gyrus LTP is normal in these mice, the later phases are not present, and the ability of the mice to maintain learned information over a 24-h period is deficient. In addition, we present new information showing a task-dependent gene dosage effect in Zif268 heterozygous mice. We show that spatial learning is particularly sensitive to reduced levels of Zif268, as one-half of the complement of Zif268 in heterozygous mice is insufficient to maintain spatial long-term memories. PMID:12440572

  8. The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

    PubMed Central

    Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

    2010-01-01

    The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

  9. Characterization of Xylan Utilization and Discovery of a New Endoxylanase in Thermoanaerobacterium saccharolyticum through Targeted Gene Deletions

    PubMed Central

    Podkaminer, Kara K.; Guss, Adam M.; Trajano, Heather L.; Hogsett, David A.

    2012-01-01

    The economical production of fuels and commodity chemicals from lignocellulose requires the utilization of both the cellulose and hemicellulose fractions. Xylanase enzymes allow greater utilization of hemicellulose while also increasing cellulose hydrolysis. Recent metabolic engineering efforts have resulted in a strain of Thermoanaerobacterium saccharolyticum that can convert C5 and C6 sugars, as well as insoluble xylan, into ethanol at high yield. To better understand the process of xylan solubilization in this organism, a series of targeted deletions were constructed in the homoethanologenic T. saccharolyticum strain M0355 to characterize xylan hydrolysis and xylose utilization in this organism. While the deletion of β-xylosidase xylD slowed the growth of T. saccharolyticum on birchwood xylan and led to an accumulation of short-chain xylo-oligomers, no other single deletion, including the deletion of the previously characterized endoxylanase XynA, had a phenotype distinct from that of the wild type. This result indicates a multiplicity of xylanase enzymes which facilitate xylan degradation in T. saccharolyticum. Growth on xylan was prevented only when a previously uncharacterized endoxylanase encoded by xynC was also deleted in conjunction with xynA. Sequence analysis of xynC indicates that this enzyme, a low-molecular-weight endoxylanase with homology to glycoside hydrolase family 11 enzymes, is secreted yet untethered to the cell wall. Together, these observations expand our understanding of the enzymatic basis of xylan hydrolysis by T. saccharolyticum. PMID:23023741

  10. Characterization of xylan utilization and discovery of a new endoxylanase in Thermoanaerobacterium saccharolyticum through targeted gene deletions

    SciTech Connect

    Podkaminer, Kara K; Guss, Adam M; McKenzie, Heather; Hogsett, David; Lynd, Lee R

    2012-01-01

    The economical production of fuels and commodity chemicals from lignocellulose requires the utilization of both the cellulose and hemicellulose fractions. Xylanase enzymes allow greater utilization of hemicellulose while also increasing cellulose hydrolysis. Recent metabolic engineering efforts have resulted in a strain of Thermoanaerobacterium saccharolyticum that can convert C(5) and C(6) sugars, as well as insoluble xylan, into ethanol at high yield. To better understand the process of xylan solubilization in this organism, a series of targeted deletions were constructed in the homoethanologenic T. saccharolyticum strain M0355 to characterize xylan hydrolysis and xylose utilization in this organism. While the deletion of -xylosidase xylD slowed the growth of T. saccharolyticum on birchwood xylan and led to an accumulation of short-chain xylo-oligomers, no other single deletion, including the deletion of the previously characterized endoxylanase XynA, had a phenotype distinct from that of the wild type. This result indicates a multiplicity of xylanase enzymes which facilitate xylan degradation in T. saccharolyticum. Growth on xylan was prevented only when a previously uncharacterized endoxylanase encoded by xynC was also deleted in conjunction with xynA. Sequence analysis of xynC indicates that this enzyme, a low-molecular-weight endoxylanase with homology to glycoside hydrolase family 11 enzymes, is secreted yet untethered to the cell wall. Together, these observations expand our understanding of the enzymatic basis of xylan hydrolysis by T. saccharolyticum.

  11. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system.

    PubMed

    Song, Yuning; Yuan, Lin; Wang, Yong; Chen, Mao; Deng, Jichao; Lv, Qingyan; Sui, Tingting; Li, Zhanjun; Lai, Liangxue

    2016-08-01

    The CRISPR RNA-guided Cas9 nuclease gene-targeting system has been extensively used to edit the genome of several organisms. However, most mutations reported to date have been are indels, resulting in multiple mutations and numerous alleles in targeted genes. In the present study, a large deletion of 105 kb in the TYR (tyrosinase) gene was generated in rabbit via a dual sgRNA-directed CRISPR/Cas9 system. The typical symptoms of albinism accompanied significantly decreased expression of TYR in the TYR knockout rabbits. Furthermore, the same genotype and albinism phenotype were found in the F1 generation, suggesting that large-fragment deletions can be efficiently transmitted to the germline and stably inherited in offspring. Taken together, our data demonstrate that mono and biallelic large deletions can be achieved using the dual sgRNA-directed CRISPR/Cas9 system. This system produces no mosaic mutations or off-target effects, making it an efficient tool for large-fragment deletions in rabbit and other organisms. PMID:26817461

  12. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice.

    PubMed

    Silva-Valenzuela, Cecilia A; Molina-Quiroz, Roberto C; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A; McClelland, Michael

    2015-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented Kan(R), SGD-K, or antisense-oriented Cam(R), SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems. PMID:26779130

  13. Conditional gene deletion with DiCre demonstrates an essential role for CRK3 in L eishmania mexicana cell cycle regulation

    PubMed Central

    Duncan, Samuel M.; Myburgh, Elmarie; Philipon, Cintia; Brown, Elaine; Meissner, Markus; Brewer, James

    2016-01-01

    Summary Leishmania mexicana has a large family of cyclin‐dependent kinases (CDKs) that reflect the complex interplay between cell cycle and life cycle progression. Evidence from previous studies indicated that Cdc2‐related kinase 3 (CRK3) in complex with the cyclin CYC6 is a functional homologue of the major cell cycle regulator CDK1, yet definitive genetic evidence for an essential role in parasite proliferation is lacking. To address this, we have implemented an inducible gene deletion system based on a dimerised Cre recombinase (diCre) to target CRK3 and elucidate its role in the cell cycle of L. mexicana. Induction of diCre activity in promastigotes with rapamycin resulted in efficient deletion of floxed CRK3, resulting in G2/M growth arrest. Co‐expression of a CRK3 transgene during rapamycin‐induced deletion of CRK3 resulted in complementation of growth, whereas expression of an active site CRK3 T178E mutant did not, showing that protein kinase activity is crucial for CRK3 function. Inducible deletion of CRK3 in stationary phase promastigotes resulted in attenuated growth in mice, thereby confirming CRK3 as a useful therapeutic target and diCre as a valuable new tool for analyzing essential genes in Leishmania. PMID:26991545

  14. Single tube genotyping of CYP2A6 gene deletion based on copy number determination by quantitative real-time PCR.

    PubMed

    Liu, Jin-hui; Xun, Xiao-jie; Pang, Cong; Ma, Jun; Zou, Hui; Chen, Chao; Dai, Peng-gao

    2014-12-01

    The CYP2A6*4 allele, characterized as the whole deletion of this gene, is closely associated with nicotine dependence, cancer susceptibility, and drug responsiveness. It has long been a significant challenge for pharmacogenetics scientists to develop a reliable method to detect this molecular variant due to its high homology with its homologous genes CYP2A6 and CYP2A3 in the clinical setting. Here, we introduce a quantitative real-time PCR assay that specifically amplifies CYP2A6 by designing a specific set of primers and the probe, which effectively prevent the amplification of the CYP2A7 and CYP2A13 alleles. CYP2A6 gene copy numbers were normalized to albumin (ALB) which was co-amplified simultaneously in a single-tube duplex reaction and at a setting as the internal reference gene. The established assay was validated with a selection of previously genotyped DNA samples, which harbored none, one or two CYP2A6 gene copies. The results were in complete concordance with previously published data and no overlap between the three groups was observed. Further analysis of a cohort of 120 samples revealed high specificity and sensitivity of this assay as demonstrated by the agreement of determined gene copy numbers in all of the cases. In conclusion, this novel assay allows reliable and sensitive detection of the CYP2A6 gene deletion, which will be useful for pharmacogenetics studies and routine clinical settings. PMID:25446842

  15. Analysis of Two Complementary Single-Gene Deletion Mutant Libraries of Salmonella Typhimurium in Intraperitoneal Infection of BALB/c Mice

    PubMed Central

    Silva-Valenzuela, Cecilia A.; Molina-Quiroz, Roberto C.; Desai, Prerak; Valenzuela, Camila; Porwollik, Steffen; Zhao, Ming; Hoffman, Robert M.; Andrews-Polymenis, Helene; Contreras, Inés; Santiviago, Carlos A.; McClelland, Michael

    2016-01-01

    Two pools of individual single gene deletion (SGD) mutants of S. Typhimurium 14028s encompassing deletions of 3,923 annotated non-essential ORFs and sRNAs were screened by intraperitoneal (IP) injection in BALB/c mice followed by recovery from spleen and liver 2 days post infection. The relative abundance of each mutant was measured by microarray hybridization. The two mutant libraries differed in the orientation of the antibiotic resistance cassettes (either sense-oriented KanR, SGD-K, or antisense-oriented CamR, SGD-C). Consistent systemic colonization defects were observed in both libraries and both organs for hundreds of mutants of genes previously reported to be important after IP injection in this animal model, and for about 100 new candidate genes required for systemic colonization. Four mutants with a range of apparent fitness defects were confirmed using competitive infections with the wild-type parental strain: ΔSTM0286, ΔSTM0551, ΔSTM2363, and ΔSTM3356. Two mutants, ΔSTM0286 and ΔSTM2363, were then complemented in trans with a plasmid encoding an intact copy of the corresponding wild-type gene, and regained the ability to fully colonize BALB/c mice systemically. These results suggest the presence of many more undiscovered Salmonella genes with phenotypes in IP infection of BALB/c mice, and validate the libraries for application to other systems. PMID:26779130

  16. Third case of 8q23.3-q24.13 deletion in a patient with Langer-Giedion syndrome phenotype without TRPS1 gene deletion.

    PubMed

    Pereza, Nina; Severinski, Srećko; Ostojić, Saša; Volk, Marija; Maver, Aleš; Dekanić, Kristina Baraba; Kapović, Miljenko; Peterlin, Borut

    2012-03-01

    Langer-Giedion syndrome (LGS) is a contiguous gene syndrome caused by a hemizygous deletion on chromosome 8q23.3-q24.11 involving TRPS1 and EXT1 genes. We report on a girl with LGS phenotype and a 7.5 Mb interstitial deletion at chromosome 8q23.3-q24.13. Array-comparative genomic hybridization (a-CGH) revealed a deletion encompassing only the EXT1 and not the TRPS1 gene. Even though the deletion of TRPS1 and EXT1 genes is responsible for craniofacial and skeletal features of LGS, there have been previous reports of patients with LGS phenotype and 8q24 deletions leaving the TRPS1 gene intact. To our knowledge, this is the third such case. Our patient differs from previously reported LGS patients without TRPS1 gene deletion in that she has the typical LGS facial dysmorphism and skeletal abnormalities. However, the girl is of normal height and has only a mild developmental delay. Additionally, she has dyslalia and premature adrenarche classified as Tanner stage 3 premature pubarche which have not yet been described as features of LGS. We examine the molecular breakpoints and phenotypes of our patient and previously reported cases. PMID:22315192

  17. Expression pattern of immediate early genes in the cerebellum of D1R KO, D2R KO, and wild type mice under vestibular-controlled activity.

    PubMed

    Nakamura, Toru; Sato, Asako; Kitsukawa, Takashi; Sasaoka, Toshikuni; Yamamori, Tetsuo

    2015-01-01

    We previously reported the different motor abilities of D1R knockout (KO), D2R KO and wild-type (WT) mice. To understand the interaction between the cerebellum and the striatal direct and indirect pathways, we examined the expression patterns of immediate early genes (IEG) in the cerebellum of these three genotypes of mice. In the WT naive mice, there was little IEG expression. However, we observed a robust expression of c-fos mRNA in the vermis and hemisphere after running rota-rod tasks. In the vermis, c-fos was expressed throughout the lobules except lobule 7, and also in crus 1 of the ansiform lobule (Crus1), copula of the pyramis (Cop) and most significantly in the flocculus in the hemisphere. jun-B was much less expressed but more preferentially expressed in Purkinje cells. In addition, we observed significant levels of c-fos and jun-B expressions after handling mice, and after the stationary rota-rod task in naive mice. Surprisingly, we observed significant expression of c-fos and jun-B even 30 min after single weighing. Nonetheless, certain additional c-fos and jun-B expressions were observed in three genotypes of the mice that experienced several sessions of motor tasks 24 h after stationary rota-rod task and on days 1 and 5 after rota-rod tasks, but no significant differences in expressions after the running rota-rod tasks were observed among the three genotypes. In addition, there may be some differences 24 h after the stationary rota-rod task between the naive mice and the mice that experienced several sessions of motor tasks. PMID:26137459

  18. Contrasting role of phospholipase C-{gamma}1 in the expression of immediate early genes induced by epidermal or platelet-derived growth factors

    SciTech Connect

    Liao Hongjun; Santos, Josue de los; Carpenter, Graham . E-mail: graham.carpenter@vanderbilt.edu

    2006-04-01

    While significant progress has been achieved in identifying the signal transduction elements that operate downstream of activated receptor tyrosine kinases, it remains unclear how different receptors utilize these signaling elements to achieve a common response. This study compares the capacity of epidermal growth factor (EGF) and platelet-derived growth factor (PDGF) to elicit the induction of immediate early gene (IEG) mRNAs in the presence or absence of phospholipase C-{gamma}1 (PLC-{gamma}1). The results show that while PDGF induction of nearly all IEG mRNAs is abrogated in plcg1 null cells, EGF induction of the same genes is variable in the null cells and exhibits three distinct responses. Five IEG mRNAs (Nup475, Cyr61, TF, Gly, TS7) are completely inducible by EGF in the presence or absence of PLC-{gamma}1, while three others (JE, KC, FIC) exhibit a stringent requirement for the presence of PLC-{gamma}1. The third type of response is exhibited by c-fos and COX-2. While these mRNAs are completely induced by EGF in the absence of PLC-{gamma}1, the time course of their accumulation is significantly delayed. No IEG was identified as completely inducible by EGF and PDGF in the absence of PLC-{gamma}1. Electrophoretic mobility shift assays (EMSA) demonstrate that PLC-{gamma}1 is necessary for nuclear extracts from PDGF-treated cells, but not EGF-treated cells, to interact with probes for AP-1 or NF-{kappa}B.

  19. Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T cells.

    PubMed Central

    Yu-Lee, L Y; Hrachovy, J A; Stevens, A M; Schwarz, L A

    1990-01-01

    The pituitary peptide hormone prolactin (Prl) is a potent inducer of Nb2 T lymphoma cell proliferation. To analyze the early genetic response to the mitogenic signals of Prl, a cDNA library was constructed from Nb2 T cells stimulated for 4 h with Prl and the protein synthesis inhibitor cycloheximide. Of 26 distinct clones isolated by differential screening, one clone, designated c25, exhibited extremely rapid but transient kinetics of induction by Prl and superinduction by Prl plus cycloheximide. Run-on transcription analysis indicated that c25 gene transcription was induced greater than 20-fold within 30 to 60 min of Prl stimulation. Surprisingly, DNA sequence analysis of c25 cDNA revealed that this Prl-inducible early-response gene is the rat homolog of the mouse transcription factor interferon-regulatory factor 1 (IRF-1), sharing 91% coding sequence similarity with mouse IRF-1. At the protein level, rat IRF-1 shares 97% and 92% homology with mouse IRF-1 and human IRF-1, respectively, suggesting that this molecule has been functionally conserved throughout evolution. Our studies show that the gene for IRF-1 is an immediate-early gene in Prl-stimulated T cells, which suggests that IRF-1 is a multifunctional molecule. In addition to its role in regulating growth-inhibitory interferon genes, IRF-1 may, therefore, also play a stimulatory role in cell proliferation. The gene for IRF-1 is one of the earliest genes known to be transcriptionally regulated by Prl. Images PMID:2342469

  20. Identification of domains within the human cytomegalovirus major immediate-early 86-kilodalton protein and the retinoblastoma protein required for physical and functional interaction with each other.

    PubMed Central

    Fortunato, E A; Sommer, M H; Yoder, K; Spector, D H

    1997-01-01

    The human cytomegalovirus major immediate-early 86-kDa protein (IE2 86) plays an important role in the trans activation and regulation of HCMV gene expression. Previously, we demonstrated that IE2 86 contains three regions (amino acids [aa] 86 to 135, 136 to 290, and 291 to 364) that can independently bind to in vitro-translated Rb when IE2 86 is produced as a glutathione S-transferase fusion protein (M. H. Sommer, A. L. Scully, and D. H. Spector, J. Virol. 68:6223-6231, 1994). In this report, we have elucidated the regions of Rb involved in binding to IE2 86 and have further analyzed the functional nature of the interaction between these two proteins. We find that two domains on Rb, the A/B pocket and the carboxy terminus, can each independently form a complex with IE2 86. In functional assays, we demonstrate that IE2 86 and another IE protein, IE1 72, can counter the enlarged flat cell phenotype, but not the G1/S block, which results from expression of wild-type Rb in the human osteosarcoma cell line Saos-2. Mutational analysis reveals that there are two domains on IE2 86 that can independently affect Rb function. One region (aa 241 to 369) includes the major Rb-binding domain, while the second maps to the amino-terminal region (aa 1 to 85) common to both IE2 86 and IE1 72. These data show that Rb and IE2 86 physically and functionally interact with each other via at least two separate domains and provide further support for the hypothesis that IE2 86 may exert its pleiotropic effects through the formation of multimeric protein complexes. PMID:9343168

  1. Cocaine reverses the naltrexone-induced reduction in operant ethanol self-administration: the effects on immediate-early gene expression in the rat prefrontal cortex.

    PubMed

    Echeverry-Alzate, Víctor; Tuda-Arízcun, María; Bühler, Kora-Mareen; Santos, Ángel; Giné, Elena; Olmos, Pedro; Gorriti, Miguel Ángel; Huertas, Evelio; Rodríguez de Fonseca, Fernando; López-Moreno, Jose Antonio

    2012-11-01

    Naltrexone is a clinically approved medication for alcoholism. We aimed to investigate the effectiveness of naltrexone co-administered with cocaine and the association of these substances with immediate-early gene expression in the rat prefrontal cortex. We used chronic operant ethanol self-administration and oral treatments prescribed for alcoholism and available in pharmacies to maximise the predictive validity in humans. We performed real-time PCR analysis to determine gene expression levels in the prefrontal cortex. Only the highest dose of naltrexone (1, 3, and 10 mg/kg, p.o.) reduced the response to ethanol. Cocaine increased ethanol self-administration in a dose-dependent manner (2.5, 10, 20 mg/kg, i.p.) and reversed the naltrexone-induced reduction. Naltrexone failed to prevent the cocaine-induced increase in locomotor activity observed in these animals. Chronic self-administration of ethanol reduced the expression of the C-fos gene 4- to 12-fold and increased expression of the COX-2 (up to 4-fold) and Homer1a genes in the rat prefrontal cortex. Chronic ethanol self-administration is prevented by naltrexone, but cocaine fully reverses this effect. This result suggests that cocaine may overcome naltrexone's effectiveness as a treatment for alcoholism. The ethanol-induced reduction in C-fos gene expression in the prefrontal cortex reveals an abnormal activity of these neurons, which may be relevant in the compulsive consumption of ethanol, the control of reward-related areas and the behavioural phenotype of ethanol addiction. PMID:22749946

  2. Motor-Coordination-Dependent Learning, More than Others, Is Impaired in Transgenic Mice Expressing Pseudorabies Virus Immediate-Early Protein IE180

    PubMed Central

    López-Ramos, Juan C.; Tomioka, Yukiko; Morimatsu, Masami; Yamamoto, Sayo; Ozaki, Kinuyo; Ono, Etsuro; Delgado-García, José M.

    2010-01-01

    The cerebellum in transgenic mice expressing pseudorabies virus immediate-early protein IE180 (TgIE96) was substantially diminished in size, and its histoarchitecture was severely disorganized, resulting in severe ataxia. TgIE96 mice can therefore be used as an experimental model to study the involvement of cerebellar circuits in different learning tasks. The performance of three-month-old TgIE96 mice was studied in various behavioral tests, including associative learning (classical eyeblink conditioning), object recognition, spatial orientation (water maze), startle response and prepulse inhibition, and passive avoidance, and compared with that of wild-type mice. Wild-type and TgIE96 mice presented similar reflexively evoked eyeblinks, and acquired classical conditioned eyelid responses with similar learning curves for both trace and delay conditioning paradigms. The two groups of mice also had similar performances during the object recognition test. However, they showed significant differences for the other three tests included in this study. Although both groups of animals were capable of swimming, TgIE96 mice failed to learn the water maze task during the allowed time. The startle response to a severe tone was similar in both control and TgIE96 mice, but the latter were unable to produce a significant prepulse inhibition. TgIE96 mice also presented evident deficits for the proper accomplishment of a passive avoidance test. These results suggest that the cerebellum is not indispensable for the performance of classical eyeblink conditioning and for object recognition tasks, but seems to be necessary for the proper performance of water maze, prepulse inhibition, and passive avoidance tests. PMID:20711341

  3. The time course of systems consolidation of spatial memory from recent to remote retention: A comparison of the Immediate Early Genes Zif268, c-Fos and Arc.

    PubMed

    Barry, Daniel N; Coogan, Andrew N; Commins, Sean

    2016-02-01

    Systems consolidation is a process involving the stabilisation of memory traces in the neocortex over time. The medial prefrontal cortex becomes increasingly important during the retrieval of older memories, however the timescale of its involvement is unclear, and the contribution of other neocortical brain regions to remote memory have received little attention. The Immediate Early Genes (IEGs) Zif268, c-Fos and Arc have been utilised as markers of neural activity during spatial memory retrieval, however the lack of a direct comparison between them hinders the interpretation of results. To address these questions, we examined the expression of Zif268, Arc and c-Fos protein in the medial prefrontal cortex, as well as the hippocampus, and the entorhinal, perirhinal, retrosplenial and parietal cortices of male Wistar rats following a probe trial of the Morris water maze either one day, seven days, 14 days or 30 days after acquisition. Activity of the medial prefrontal cortex during retrieval, as measured by all three IEGs, increased in correspondence with the age of the memory, reaching significance between 14 and 30 days. Similar increases in c-Fos and Arc were observed over the course of consolidation in other neocortical and parahippocampal areas, however this pattern was not observed with Zif268. Activity of the hippocampus remained largely unchanged across retention intervals. These findings suggest that systems consolidation of spatial memory takes at least two weeks, are consistent with an ongoing role for the hippocampus in the retrieval of spatial memory, and suggest that c-Fos and Arc may be a more sensitive measure of neural activity in response to behavioural tasks than Zif268. PMID:26748021

  4. Role of immediate early protein ICP27 in the differential sensitivity of herpes simplex viruses 1 and 2 to leptomycin B.

    PubMed

    Park, Donglim; Lengyel, Joy; Rice, Stephen A

    2013-08-01

    Leptomycin B (LMB) is a highly specific inhibitor of CRM1, a cellular karyopherin-β that transports nuclear export signal-containing proteins from the nucleus to the cytoplasm. Previous work has shown that LMB blocks herpes simplex virus 1 (HSV-1) replication in Vero cells and that certain mutations in viral immediate early protein ICP27 can confer LMB resistance. However, little is known of the molecular mechanisms involved. Here we report that HSV-2, a close relative of HSV-1, is naturally resistant to LMB. To see whether the ICP27 gene determines this phenotypic difference, we generated an HSV-1 mutant that expresses the HSV-2 ICP27 instead of the HSV-1 protein. This recombinant was fully sensitive to LMB, indicating that one or more other viral genes must be important in determining HSV-2's LMB-resistant phenotype. In additional work, we report several findings that shed light on how HSV-1 ICP27 mutations can confer LMB resistance. First, we show that LMB treatment of HSV-1-infected cells leads to suppression of late viral protein synthesis and a block to progeny virion release. Second, we identify a novel type of ICP27 mutation that can confer LMB resistance, that being the addition of a 100-residue amino-terminal affinity purification tag. Third, by studying infections where both LMB-sensitive and LMB-resistant forms of ICP27 are present, we show that HSV-1's sensitivity to LMB is dominant to its resistance. Together, our results suggest a model in which the N-terminal portion of ICP27 mediates a nonessential activity that interferes with HSV-1 replication when CRM1 is inactive. We suggest that LMB resistance mutations weaken or abrogate this activity. PMID:23740995

  5. Prenatal exposure to moderate levels of ethanol alters social behavior in adult rats: Relationship to structural plasticity and immediate early gene expression in frontal cortex

    PubMed Central

    Hamilton, Derek A.; Akers, Katherine G.; Rice, James P.; Johnson, Travis E.; Candelaria-Cook, Felicha T.; Maes, Levi I.; Rosenberg, Martina; Valenzuela, C. Fernando; Savage, Daniel D.

    2009-01-01

    The goals of the present study were to characterize the effects of prenatal exposure to moderate levels of ethanol on adult social behavior, and to evaluate fetal-ethanol-related effects on dendritic morphology, structural plasticity and activity-related immediate early gene (IEG) expression in the agranular insular (AID) and prelimbic (Cg3) regions of frontal cortex. Baseline fetal-ethanol-related alterations in social behavior were limited to reductions in social investigation in males. Repeated experience with novel cage-mates resulted in comparable increases in wrestling and social investigation among saccharin- and ethanol-exposed females, whereas social behavioral effects among males were more evident in ethanol-exposed animals. Male ethanol-exposed rats also displayed profound increases in wrestling when social interaction was motivated by 24 hours of isolation. Baseline decreases in dendritic length and spine density in AID were observed in ethanol-exposed rats that were always housed with the same cage-mate. Modest experience-related decreases in dendritic length and spine density in AID were observed in saccharin-exposed rats housed with various cage-mates. In contrast, fetal-ethanol-exposed rats displayed experience-related increases in dendritic length in AID, and no experience-related changes in spine density. The only effect observed in Cg3 was a baseline increase in basilar dendritic length among male ethanol-exposed rats. Robust increases in activity-related IEG expression in AID (c-fos and Arc) and Cg3 (c-fos) were observed following social interaction in saccharin-exposed rats, however, activity-related increases in IEG expression were not observed in fetal-ethanol-exposed rats in either region. The results indicate that deficits in social behavior are among the long-lasting behavioral consequences of moderate ethanol exposure during brain development, and implicate AID, and to a lesser degree Cg3, in fetal-ethanol-related social behavior

  6. The murine gammaherpesvirus immediate-early Rta synergizes with IRF4, targeting expression of the viral M1 superantigen to plasma cells.

    PubMed

    O'Flaherty, Brigid M; Soni, Tanushree; Wakeman, Brian S; Speck, Samuel H

    2014-08-01

    MHV68 is a murine gammaherpesvirus that infects laboratory mice and thus provides a tractable small animal model for characterizing critical aspects of gammaherpesvirus pathogenesis. Having evolved with their natural host, herpesviruses encode numerous gene products that are involved in modulating host immune responses to facilitate the establishment and maintenance of lifelong chronic infection. One such protein, MHV68 M1, is a secreted protein that has no known homologs, but has been shown to play a critical role in controlling virus reactivation from latently infected macrophages. We have previous demonstrated that M1 drives the activation and expansion of Vβ4+ CD8+ T cells, which are thought to be involved in controlling MHV68 reactivation through the secretion of interferon gamma. The mechanism of action and regulation of M1 expression are poorly understood. To gain insights into the function of M1, we set out to evaluate the site of expression and transcriptional regulation of the M1 gene. Here, using a recombinant virus expressing a fluorescent protein driven by the M1 gene promoter, we identify plasma cells as the major cell type expressing M1 at the peak of infection in the spleen. In addition, we show that M1 gene transcription is regulated by both the essential viral immediate-early transcriptional activator Rta and cellular interferon regulatory factor 4 (IRF4), which together potently synergize to drive M1 gene expression. Finally, we show that IRF4, a cellular transcription factor essential for plasma cell differentiation, can directly interact with Rta. The latter observation raises the possibility that the interaction of Rta and IRF4 may be involved in regulating a number of viral and cellular genes during MHV68 reactivation linked to plasma cell differentiation. PMID:25101696

  7. Gene expression profiling in a mouse model of infantile neuronal ceroid lipofuscinosis reveals upregulation of immediate early genes and mediators of the inflammatory response

    PubMed Central

    Qiao, Xingwen; Lu, Jui-Yun; Hofmann, Sandra L

    2007-01-01

    Background The infantile form of neuronal ceroid lipofuscinosis (also known as infantile Batten disease) is caused by hereditary deficiency of a lysosomal enzyme, palmitoyl-protein thioesterase-1 (PPT1), and is characterized by severe cortical degeneration with blindness and cognitive and motor dysfunction. The PPT1-deficient knockout mouse recapitulates the key features of the disorder, including seizures and death by 7–9 months of age. In the current study, we compared gene expression profiles of whole brain from PPT1 knockout and normal mice at 3, 5 and 8 months of age to identify temporal changes in molecular pathways implicated in disease pathogenesis. Results A total of 267 genes were significantly (approximately 2-fold) up- or downregulated over the course of the disease. Immediate early genes (Arc, Cyr61, c-fos, jun-b, btg2, NR4A1) were among the first genes upregulated during the presymptomatic period whereas immune response genes dominated at later time points. Chemokine ligands and protease inhibitors were among the most transcriptionally responsive genes. Neuronal survival factors (IGF-1 and CNTF) and a negative regulator of neuronal apoptosis (DAP kinase-1) were upregulated late in the course of the disease. Few genes were downregulated; these included the α2 subunit of the GABA-A receptor, a component of cortical and hippocampal neurons, and Hes5, a transcription factor important in neuronal differentiation. Conclusion A molecular description of gene expression changes occurring in the brain throughout the course of neuronal ceroid lipofuscinosis suggests distinct phases of disease progression, provides clues to potential markers of disease activity, and points to new targets for therapy. PMID:18021406

  8. Stressor and glucocorticoid-dependent induction of the immediate early gene kruppel-like factor 9: implications for neural development and plasticity.

    PubMed

    Bonett, Ronald M; Hu, Fang; Bagamasbad, Pia; Denver, Robert J

    2009-04-01

    Krüppel-like factor 9 (KLF9) is a thyroid hormone-induced, immediate early gene implicated in neural development in vertebrates. We analyzed stressor and glucocorticoid (GC)-dependent regulation of KLF9 expression in the brain of the frog Xenopus laevis, and investigated a possible role for KLF9 in neuronal differentiation. Exposure to shaking/confinement stressor increased plasma corticosterone (CORT) concentration, and KLF9 immunoreactivity in several brain regions, which included the medial amygdala and bed nucleus of the stria terminalis, anterior preoptic area (homologous to the mammalian paraventricular nucleus), and optic tectum (homologous to the mammalian superior colliculus). The stressor-induced KLF9 mRNA expression in the brain was blocked by pretreatment with the GC receptor antagonist RU486, or mimicked by injection of CORT. Treatment with CORT also caused a rapid and dose-dependent increase in KLF9 mRNA in X. laevis XTC-2 cells that was resistant to inhibition of protein synthesis. The action of CORT on KLF9 expression in XTC-2 cells was blocked by RU486, but not by the mineralocorticoid receptor antagonist spironolactone. To test for functional consequences of up-regulation of KLF9, we introduced a KLF9 expression plasmid into living tadpole brain by electroporation-mediated gene transfer. Forced expression of KLF9 in tadpole brain caused an increase in Golgi-stained cells, reflective of neuronal differentiation/maturation. Our results support that KLF9 is a direct, GC receptor target gene that is induced by stress, and functions as an intermediary in the actions of GCs on brain gene expression and neuronal structure. PMID:19036875

  9. BZLF1, an Epstein-Barr virus immediate-early protein, induces p65 nuclear translocation while inhibiting p65 transcriptional function

    SciTech Connect

    Morrison, Thomas E.; Kenney, Shannon C. . E-mail: shann@med.unc.edu

    2004-10-25

    We have previously demonstrated that the Epstein-Barr virus immediate-early BZLF1 protein interacts with, and is inhibited by, the NF-{kappa}B family member p65. However, the effects of BZLF1 on NF-{kappa}B activity have not been intensively studied. Here we show that BZLF1 inhibits p65-dependent gene expression. BZLF1 inhibited the ability of IL-1, as well as transfected p65, to activate the expression of two different NF-{kappa}B-responsive genes, ICAM-1 and I{kappa}B-{alpha}. BZLF1 also reduced the constitutive level of I{kappa}B-{alpha} protein in HeLa and A549 cells, and increased the amount of nuclear NF-{kappa}B to a similar extent as tumor necrosis factor-alpha (TNF-{alpha}) treatment. In spite of this BZLF1-associated increase in the nuclear form of NF-{kappa}B, BZLF1 did not induce binding of NF-{kappa}B to NF-{kappa}B responsive promoters (as determined by chromatin immunoprecipitation assay) in vivo, although TNF-{alpha} treatment induced NF-{kappa}B binding as expected. Overexpression of p65 dramatically inhibited the lytic replication cycle of EBV in 293-EBV cells, confirming that NF-{kappa}B also inhibits BZLF1 transcriptional function. Our results are consistent with a model in which BZLF1 inhibits the transcriptional function of p65, resulting in decreased transcription of I{kappa}B-{alpha}, decreased expression of I{kappa}B-{alpha} protein, and subsequent translocation of NF-{kappa}B to the nucleus. This nuclear translocation of NF-{kappa}B may promote viral latency by negatively regulating BZLF1 transcriptional activity. In situations where p65 activity is limiting in comparison to BZLF1, the ability of BZLF1 to inhibit p65 transcriptional function may protect the virus from the host immune system during the lytic form of infection.

  10. Effects of human cytomegalovirus major immediate-early proteins in controlling the cell cycle and inhibiting apoptosis: studies with ts13 cells.

    PubMed

    Lukac, D M; Alwine, J C

    1999-04-01

    The major immediate-early (MIE) gene of human cytomegalovirus (HCMV) encodes several MIE proteins (MIEPs) produced as a result of alternative splicing and polyadenylation of the primary transcript. Previously we demonstrated that the HCMV MIEPs expressed from the entire MIE gene could rescue the temperature-sensitive (ts) transcriptional defect in the ts13 cell line. This defect is caused by a ts mutation in TAFII250, the 250-kDa TATA binding protein-associated factor (TAF). These and other data suggested that the MIEPs perform a TAF-like function in complex with the basal transcription factor TFIID. In addition to the transcriptional defect, the ts mutation in ts13 cells results in a defect in cell cycle progression which ultimately leads to apoptosis. Since all of these defects can be rescued by wild-type TAFII250, we asked whether the MIEPs could rescue the cell cycle defect and/or affect the progression to apoptosis. We have found that the MIEPs, expressed from the entire MIE gene, do not rescue the cell cycle block in ts13 cells grown at the nonpermissive temperature. However, despite the maintenance of the cell cycle block, the ts13 cells which express the MIEPs are resistant to apoptosis. MIEP mutants, which have previously been shown to be defective in rescuing the ts transcriptional defect, maintained the ability to inhibit apoptosis. Hence, the MIEP functions which affect transcription appear to be separable from the functions which inhibit apoptosis. We discuss these data in the light of the HCMV life cycle and the possibility that the MIEPs promote cellular transformation by a "hit-and-run" mechanism. PMID:10074130

  11. Improved cell survival by the reduction of immediate-early gene expression in replication-defective mutants of herpes simplex virus type 1 but not by mutation of the virion host shutoff function.

    PubMed Central

    Johnson, P A; Wang, M J; Friedmann, T

    1994-01-01

    Derivatives of herpes simplex virus type 1 (HSV-1) have elicited considerable interest as gene transfer vectors because of their ability to infect a wide range of cell types efficiently, including fully differentiated neurons. However, it has been found that infection of many types of cell with vectors derived from replication-defective mutants of HSV-1 is associated with cytopathic effects (CPE). We have previously shown that viral gene expression played an important role in the induction of CPE caused by an HSV-1 mutant deleted for the essential immediate-early gene 3 (IE 3) (P.A. Johnson, A. Miyanohara, F. Levine, T. Cahill, and T. Friedmann, J. Virol. 66:2952-2965, 1992). We have investigated which viral genes might be responsible for CPE by comparing the ability of each of the individual genes expressed by an IE 3 deletion mutant during a nonproductive infection to inhibit biochemical transformation after cotransfection of BHK or CV-1 cells with a selectable marker gene. Transfection of IE genes 1,2, and 4 individually all caused a marked inhibition of colony formation, while transfection of IE 5 and the large subunit of ribonucleotide reductase had little effect. These results suggested that it would be necessary to mutate or reduce the expression of nearly all HSV-1 IE genes to reduce virus-induced CPE. Therefore, we have used VP16 mutants, which are unable to transinduce IE gene expression (C. I. Ace, T. A. McKee, J. M. Ryan, J. M. Cameron, and C. M. Preston, J. Virol. 63:2260-2269, 1989), to derive two replication-defective strains: 14H delta 3, which is deleted for both copies of IE 3, and in 1850 delta 42, which has a deletion in the essential early gene UL42. The IE 3-VP16 double mutant, 14H delta 3, is significantly less toxic than a single IE 3 deletion mutant over a range of multiplicities of infection, as measured in a cell-killing assay, and has an enhanced ability to persist in infected cells in a biologically retrievable form. In contrast, the UL

  12. Screening of High-Level 4-Hydroxy-2 (or 5)-Ethyl-5 (or 2)-Methyl-3(2H)-Furanone-Producing Strains from a Collection of Gene Deletion Mutants of Saccharomyces cerevisiae

    PubMed Central

    Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

    2014-01-01

    4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1Δ) exhibited the maximum HEMF production capacity. Further investigations of the adh1Δ mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

  13. Screening of high-level 4-hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone-producing strains from a collection of gene deletion mutants of Saccharomyces cerevisiae.

    PubMed

    Uehara, Kenji; Watanabe, Jun; Akao, Takeshi; Watanabe, Daisuke; Mogi, Yoshinobu; Shimoi, Hitoshi

    2015-01-01

    4-Hydroxy-2 (or 5)-ethyl-5 (or 2)-methyl-3(2H)-furanone (HEMF) is an important flavor compound that contributes to the sensory properties of many natural products, particularly soy sauce and soybean paste. The compound exhibits a caramel-like aroma and several important physiological activities, such as strong antioxidant activity. HEMF is produced by yeast species in soy sauce manufacturing; however, the enzymes involved in HEMF production remain unknown, hindering efforts to breed yeasts with high-level HEMF production. In this study, we identified high-level HEMF-producing mutants among a Saccharomyces cerevisiae gene deletion mutant collection. Fourteen deletion mutants were screened as high-level HEMF-producing mutants, and the ADH1 gene deletion mutant (adh1Δ) exhibited the maximum HEMF production capacity. Further investigations of the adh1Δ mutant implied that acetaldehyde accumulation contributes to HEMF production, agreeing with previous findings. Therefore, acetaldehyde might be a precursor for HEMF. The ADH1 gene deletion mutant of Zygosaccharomyces rouxii, which is the dominant strain of yeast found during soy sauce fermentation, also produces HEMF effectively, suggesting that acetaldehyde accumulation might be a benchmark for breeding industrial yeasts with excellent HEMF production abilities. PMID:25362059

  14. Herpes simplex virus mutants defective in the virion-associated shutoff of host polypeptide synthesis and exhibiting abnormal synthesis of alpha (immediate early) viral polypeptides.

    PubMed Central

    Read, G S; Frenkel, N

    1983-01-01

    Six mutants isolated from herpes simplex virus type 1 were judged to be defective with respect to the virion-associated function acting to rapidly shut off host polypeptide synthesis in herpes simplex virus-infected cells. The mutants were capable of proper entry into the cells, but, unlike the parent wild-type virus, they failed to shut off host polypeptide syntehsis in the presence of actinomycin D. They were consequently designated as virion-associated host shutoff (vhs) mutants. In the presence of actinomycin D, three of the mutants, vhs1, -2, and -3, failed to shut off the host at both 34 and 39 degrees C, whereas vhs4, -5, and -6 exhibited a temperature-dependent vhs phenotype. Since the mutants were capable of growth at 34 degrees C, it appeared that the vhs function was not essential for virus replication in cultured cells. Temperature-shift experiments performed with the vhs4 mutant showed that an active vhs function was required throughout the shutoff process and that, once established, the translational shutoff could not be reversed. In the absence of actinomycin D, the mutants induced a generalized, secondary shutoff of host translation, which required the synthesis of beta (early) or gamma (late) viral polypeptide(s). The vhs mutants appeared to be defective also with respect to post-transcriptional shutoff of alpha (immediate early) viral gene expression, since (i) cells infected with mutant viruses overproduced alpha viral polypeptides, (ii) there was an increased functional stability of alpha mRNA in the vhs1 mutant virus-infected cells, and (iii) superinfection of vhs1-infected cells with wild-type virus, in the presence of actinomycin D, resulted in a more pronounced shutoff of alpha polypeptide synthesis from preformed alpha mRNA than equivalent superinfection with vhs1 virus. The data suggest that the synthesis of alpha polypeptides in wild-type virus infections is subject to a negative post-transcriptional control involving viral gene product

  15. Temporal and anatomic patterns of immediate-early gene expression in the forebrain of C57BL/6 and DBA/2 mice after morphine administration.

    PubMed

    Ziółkowska, B; Gieryk, A; Solecki, W; Przewłocki, R

    2015-01-22

    Although morphine was previously reported to produce an instant induction of c-fos in the striatum, our recent studies have demonstrated that the expression of numerous immediate early genes (IEGs) is significantly elevated at delayed time-points (several hours) after morphine administration. To better dissect the time-course of opioid-produced IEG induction, we used in situ hybridization to examine the expression of the IEGs c-fos, zif268 and arc in the mouse forebrain at several time-points after acute morphine injection. To link drug-produced behavioral changes with the activity of specific neuronal complexes, this study was performed comparatively in the C57BL/6 and DBA/2 mouse strains, which differ markedly in their locomotor responses to opioids and opioid reward. Our study demonstrates that morphine produces two episodes of IEG induction, which are separate in time (30 min vs. 4-6 h) and which have different neuroanatomic distribution. At 30 min, one or more IEGs were induced in circumscribed subregions of the dorsal striatum (dStr) and of the nucleus accumbens (NAc) shell, as well as in the lateral septum. The observed inter-strain differences in IEG expression at 30 min support earlier proposals that activation of the dorsomedial striatum may mediate morphine-elicited locomotor stimulation (both effects were present only in the C57BL/6 strain). In contrast, NAc shell activation does not appear to be linked to morphine-elicited changes in locomotor behavior. The second IEG induction (of arc and of zif268) was more widespread, involving most of the dStr and the cortex. The second IEG induction peaked earlier in the DBA/2 mice than in the C57BL/6 mice (4 h compared with 6 h) and displayed no apparent relation to locomotor behavior. This delayed episode of IEG activation, which has largely been overlooked thus far, may contribute to the development of long-term effects of opioids such as tolerance, dependence and/or addiction. PMID:25290009

  16. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  17. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection.

    PubMed

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  18. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection

    PubMed Central

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  19. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response.

    PubMed

    Harwardt, Thomas; Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C; Nevels, Michael; Paulus, Christina

    2016-07-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  20. Prolonged gene expression and cell survival after infection by a herpes simplex virus mutant defective in the immediate-early genes encoding ICP4, ICP27, and ICP22.

    PubMed Central

    Wu, N; Watkins, S C; Schaffer, P A; DeLuca, N A

    1996-01-01

    Very early in infection, herpes simplex virus (HSV) expresses four immediate-early (IE) regulatory proteins, ICP4, ICP0, ICP22, and ICP27. The systematic inactivation of sets of the IE proteins in cis, and the subsequent phenotypic analysis of the resulting mutants, should provide insights into how these proteins function in the HSV life cycle and also into the specific macromolecular events that are altered or perturbed in cells infected with virus strains blocked very early in infection. This approach may also provide a rational basis to assess the efficacy and safety of HSV mutants for use in gene transfer experiments. In this study, we generated and examined the phenotype of an HSV mutant simultaneously mutated in the ICP4, ICP27, and ICP22 genes of HSV. Unlike mutants deficient in ICP4 (d120), ICP4 and ICP27 (d92), and ICP4 and ICP22 (d96), mutants defective in ICP4, ICP27, and ICP22 (d95) were visually much less toxic to Vero and human embryonic lung cells. Cells infected with d95 at a multiplicity of infection of 10 PFU per cell retained a relatively normal morphology and expressed genes from the viral and cellular genomes for at least 3 days postinfection. The other mutant backgrounds were too toxic to allow examination of gene expression past 1 day postinfection. However, when cell survival was measured by the capacity of the infected cells to form colonies, d95 inhibited colony formation similarly to d92. This apparent paradox was reconciled by the observation that host cell DNA synthesis was inhibited in cells infected with d120, d92, d96, and d95. In addition, all of the mutants exhibited pronounced and distinctive alterations in nuclear morphology, as determined by electron microscopy. The appearance of d95-infected cells deviated from that of uninfected cells in that large circular structures formed in the nucleus. d95-infected cells abundantly expressed ICP0, which accumulated in fine punctate structures in the nucleus at early times postinfection

  1. The herpes simplex virus immediate-early protein ICP0 affects transcription from the viral genome and infected-cell survival in the absence of ICP4 and ICP27.

    PubMed Central

    Samaniego, L A; Wu, N; DeLuca, N A

    1997-01-01

    ICP4, ICP0, and ICP27 are the immediate-early (IE) regulatory proteins of herpes simplex virus that have the greatest effect on viral gene expression and growth. Comparative analysis of viral mutants defective in various subsets of these IE genes should help elucidate how these proteins affect cellular and viral processes. This study focuses on the mutant d97, which is defective for the genes encoding ICP4, ICP0, and ICP27 and expresses the bacterial beta-galactosidase (beta-gal) gene from the ICP0 promoter. Together with the d92 virus (ICP4- ICP27-) and the ICP0-complementing cell line L7, d97 provided a unique opportunity to evaluate ICP0 function in the absence of the regulatory activities specified by ICP4 and ICP27. The pattern of protein synthesis in d97-infected cells was unique relative to other IE gene mutants in that it was similar to that seen in the absence of prior viral protein synthesis, possibly approximating the effect of cellular factors and virion components alone. Inactivation of ICP0 in the absence of ICP4 produced a significant decrease in the levels of the early mRNAs ICP6 and thymidine kinase (tk). There was also a marginal reduction in the levels of the IE ICP22 mRNA, and this was most notable at low multiplicity of infection (MOI). In d97-infected L7 cells, the levels of the viral mRNAs were mostly restored to those observed in infections with d92. Nuclear runoff transcription analysis demonstrated that the presence of ICP0 resulted in an increase in the transcription rates of the analyzed genes. The transcription rates of the early genes were dramatically reduced in the absence of ICP0. At low MOI, the transcription rates of ICP6 and tk were comparable to the rate of transcription of a cellular gene. Relevant to the potential use of d97 as a transfer vector, it was also determined that the absence of ICP0 reduced the cellular toxicity of the virus compared to that of d92. The beta-gal transgene expressed from an IE promoter was detected

  2. From Whole Gene Deletion to Point Mutations of EP300-Positive Rubinstein-Taybi Patients: New Insights into the Mutational Spectrum and Peculiar Clinical Hallmarks.

    PubMed

    Negri, Gloria; Magini, Pamela; Milani, Donatella; Colapietro, Patrizia; Rusconi, Daniela; Scarano, Emanuela; Bonati, Maria Teresa; Priolo, Manuela; Crippa, Milena; Mazzanti, Laura; Wischmeijer, Anita; Tamburrino, Federica; Pippucci, Tommaso; Finelli, Palma; Larizza, Lidia; Gervasini, Cristina

    2016-02-01

    Rubinstein-Taybi syndrome (RSTS) is a rare congenital neurodevelopmental disorder characterized by growth deficiency, skeletal abnormalities, dysmorphic features, and intellectual disability. Causative mutations in CREBBP and EP300 genes have been identified in ∼55% and ∼8% of affected individuals. To date, only 28 EP300 alterations in 29 RSTS clinically described patients have been reported. EP300 analysis of 22 CREBBP-negative RSTS patients from our cohort led us to identify six novel mutations: a 376-kb deletion depleting EP300 gene; an exons 17-19 deletion (c.(3141+1_3142-1)_(3590+1_3591-1)del/p.(Ile1047Serfs*30)); two stop mutations, (c.3829A>T/p.(Lys1277*) and c.4585C>T/p.(Arg1529*)); a splicing mutation (c.1878-12A>G/p.(Ala627Glnfs*11)), and a duplication (c.4640dupA/p.(Asn1547Lysfs*3)). All EP300-mutated individuals show a mild RSTS phenotype and peculiar findings including maternal gestosis, skin manifestation, especially nevi or keloids, back malformations, and a behavior predisposing to anxiety. Furthermore, the patient carrying the complete EP300 deletion does not show a markedly severe clinical picture, even if a more composite phenotype was noticed. By characterizing six novel EP300-mutated patients, this study provides further insights into the EP300-specific clinical presentation and expands the mutational repertoire including the first case of a whole gene deletion. These new data will enhance EP300-mutated cases identification highlighting distinctive features and will improve the clinical practice allowing a better genotype-phenotype correlation. PMID:26486927

  3. CDKN2 Gene Deletion as Poor Prognosis Predictor Involved in the Progression of Adult B-Lineage Acute Lymphoblastic Leukemia Patients

    PubMed Central

    Xu, Na; Li, Yu-ling; Zhou, Xuan; Cao, Rui; Li, Huan; Lu, Qi-si; Li, Lin; Lu, Zi-yuan; Huang, Ji-xian; Sun, Jing; Liu, Qi-fa; Du, Qing-feng; Liu, Xiao-li

    2015-01-01

    Deletion of cyclin-dependent kinase inhibitor 2A/B (CDKN2A/B) is well known in many hematologic malignancies, but only few reports have investigated this deletion effect on clinical prognosis. This study performed analysis of the CDKN2 deletion in 215 adult B- lineage acute lymphoblastic leukemia (B-ALL) patients, and related cytogenetic prognostic factors (BCR/ABL; E2A/PBXl; TEL/AML1; Mixed Lineage Leukemia (MLL) rearrangement; MYC, Immunoglobulin heavy locus (IGH) translocation). The prevalence of CDKN2 deletions in all study populations was 28.4%. There is no difference between patients with CDKN2 deletion and wild-type patients in sex, age, white blood cells (WBC) count, BM blast percentage, extra infiltration and induction complete remission (CR) rate. Analysis in relapse patients revealed that the distribution of CDKN2 deletion is higher in relapse patients (44.6%) than all patients (28.4%, P=0.006). Deletion of CDKN2 was significantly associated with poor outcomes including decreased overall survival (OS) (P<0.001), lower disease free-survival (DFS) (P<0.001), and increased cumulative incidence of relapse (P=0.002); Also, CDKN2 deletion was strongly associated with IGH translocation (P=0.021); and had an adverse effect on patients with BCR-ABL fusion gene or with MLL rearrangement. Patients with CDKN2 gene deletion benefited from allogenic hematopoietic stem cell transplantation (Allo-HSCT). Deletion of CDKN2 gene was commonly observed through leukemia progression and was poor prognostic marker in long-term outcomes. PMID:26516359

  4. Oncolytic Adenoviral Mutants with E1B19K Gene Deletions Enhance Gemcitabine-induced Apoptosis in Pancreatic Carcinoma Cells and Anti-Tumor Efficacy In vivo

    PubMed Central

    Leitner, Stephan; Sweeney, Katrina; Öberg, Daniel; Davies, Derek; Miranda, Enrique; Lemoine, Nick R.; Halldén, Gunnel

    2010-01-01

    Purpose Pancreatic adenocarcinoma is a rapidly progressive malignancy that is highly resistant to current chemotherapeutic modalities and almost uniformly fatal.We show that a novel targeting strategy combining oncolytic adenoviral mutants with the standard cytotoxic treatment, gemcitabine, can markedly improve the anticancer potency. Experimental Design Adenoviral mutants with the E1B19K gene deleted with and without E3B gene expression (AdΔE1B19K and dl337 mutants, respectively) were assessed for synergistic interactions in combination with gemcitabine. Cell viability, mechanism of cell death, and antitumor efficacy in vivo were determined in the pancreatic carcinoma cells PT45 and Suit2, normal human bronchial epithelial cells, and in PT45 xenografts. Results The ΔE1B19K-deleted mutants synergized with gemcitabine to selectively kill cultured pancreatic cancer cells and xenografts in vivo with no effect in normal cells. The corresponding wild-type virus (Ad5) stimulated drug-induced cell killing to a lesser degree. Gemcitabine blocked replication of all viruses despite the enhanced cell killing activity due to gemcitabine-induced delay in G1/S-cell cycle progression, with repression of cyclin E and cdc25A, which was not abrogated by viral E1A-expression. Synergistic cell death occurred through enhancement of gemcitabine-induced apoptosis in the presence of both AdΔE1B19K and dl337 mutants, shown by increased cell membrane fragmentation, caspase-3 activation, and mitochondrial dysfunction. Conclusions Our data suggest that oncolytic mutants lacking the antiapoptotic E1B19K gene can improve efficacy of DNA-damaging drugs such as gemcitabine through convergence on cellular apoptosis pathways.These findings imply that less toxic doses than currently practicedin the clinic could efficiently target pancreatic adenocarcinomas when combined with adenoviral mutants. PMID:19223497

  5. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice

    PubMed Central

    Zhang, Yiqiang; Davis, Carol; Sakellariou, George K.; Shi, Yun; Kayani, Anna C.; Pulliam, Daniel; Bhattacharya, Arunabh; Richardson, Arlan; Jackson, Malcolm J.; McArdle, Anne; Brooks, Susan V.; Van Remmen, Holly

    2013-01-01

    We have previously shown that deletion of CuZnSOD in mice (Sod1−/− mice) leads to accelerated loss of muscle mass and contractile force during aging. To dissect the relative roles of skeletal muscle and motor neurons in this process, we used a Cre-Lox targeted approach to establish a skeletal muscle-specific Sod1-knockout (mKO) mouse to determine whether muscle-specific CuZnSOD deletion is sufficient to cause muscle atrophy. Surprisingly, mKO mice maintain muscle masses at or above those of wild-type control mice up to 18 mo of age. In contrast, maximum isometric specific force measured in gastrocnemius muscle is significantly reduced in the mKO mice. We found no detectable increases in global measures of oxidative stress or ROS production, no reduction in mitochondrial ATP production, and no induction of adaptive stress responses in muscle from mKO mice. However, Akt-mTOR signaling is elevated and the number of muscle fibers with centrally located nuclei is increased in skeletal muscle from mKO mice, which suggests elevated regenerative pathways. Our data demonstrate that lack of CuZnSOD restricted to skeletal muscle does not lead to muscle atrophy but does cause muscle weakness in adult mice and suggest loss of CuZnSOD may potentiate muscle regenerative pathways.—Zhang, Y., Davis, C., Sakellariou, G.K., Shi, Y., Kayani, A.C., Pulliam, D., Bhattacharya, A., Richardson, A., Jackson, M.J., McArdle, A., Brooks, S.V., Van Remmen, H. CuZnSOD gene deletion targeted to skeletal muscle leads to loss of contractile force but does not cause muscle atrophy in adult mice. PMID:23729587

  6. Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India

    PubMed Central

    Bharti, Praveen Kumar; Chandel, Himanshu Singh; Ahmad, Amreen; Krishna, Sri; Udhayakumar, Venkatachalam; Singh, Neeru

    2016-01-01

    Background Plasmodium falciparum encoded histidine rich protein (HRP2) based malaria rapid diagnostic tests (RDTs) are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions. Methods This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR. Results Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521) and 1.8% (27/1521) of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0–25% (2.4, 95% CI; 1.6–3.3). The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0–8% (1.6, 95% CI; 1.0–2.4). Conclusion This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs. PMID:27518538

  7. Co-ordinate regulation of herpes simplex virus gene expression is mediated by the functional interaction of two immediate early gene products.

    PubMed

    Gelman, I H; Silverstein, S

    1986-10-01

    At early times after infection with herpes simplex virus, transcription from beta-promoters is initiated only in the presence of a functional 174,000 Mr phosphoprotein (ICP4), encoded by an immediate early (alpha) gene (IE4). A transient expression assay was used to analyze the requirement for two (ICP4 and ICP0) of the five alpha-gene products in the transcriptional regulation of model alpha and beta-gene promoters. These studies reveal that cells cotransfected with plasmids containing the alpha-gene sequences for infected cell proteins (ICPs) 4 and 0 and a thymidine kinase (TK, a beta-gene) gene or the thymidine kinase promoter fused to a chloramphenicol acetyltransferase (CAT) cassette accumulate 10 to 20-fold more RNA or exhibit 10 to 20-fold more CAT activity than cells cotransfected with a plasmid encoding either alpha-gene protein and a thymidine kinase indicator gene. Functional ICP4 is required for enhanced transcriptional activation in the transient expression assay system. It is also required for the uniform dispersal of ICP0 throughout the nucleus as shown by immunofluorescence staining analysis of transfected cells. Two alpha-promoter-CAT fusions were used as targets to study what effects ICP4, ICP0 and Vmw65 (the virion-associated alpha-gene transactivator) have on expression from alpha-promoters that contain all of the sequences that confer alpha-gene regulation, or only the core sequence governing basal level expression. We conclude that ICP4 can activate alpha-gene expression from the core sequence and, depending on its abundance, activate or repress expression from a promoter containing the sequences required for alpha-gene regulation. Independent of these alpha-regulatory sequences cotransfection with low levels of sequences encoding both ICP0 and ICP4 activate expression. At higher ratios of effector (both ICP4 and ICP0) the target accumulation of CAT activity decreases. Although a ts allele of IE4 (cloned from the mutant virus tsK) does not

  8. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger.

    PubMed

    Dai, Ziyu; Aryal, Uma K; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D; Magnuson, Jon K; Adney, William S; Beckham, Gregg T; Brunecky, Roman; Himmel, Michael E; Decker, Stephen R; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E

    2013-12-01

    Dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl α-1,3-mannosyltransferase (also known as "asparagine-linked glycosylation 3", or ALG3) is involved in early N-linked glycan synthesis and thus is essential for formation of N-linked protein glycosylation. In this study, we examined the effects of alg3 gene deletion (alg3Δ) on growth, development, pigment production, protein secretion and recombinant Trichoderma reesei cellobiohydrolase (rCel7A) expressed in Aspergillus niger. The alg3Δ delayed spore germination in liquid cultures of complete medium (CM), potato dextrose (PD), minimal medium (MM) and CM with addition of cAMP (CM+cAMP), and resulted in significant reduction of hyphal growth on CM, potato dextrose agar (PDA), and CM+cAMP and spore production on CM. The alg3Δ also led to a significant accumulation of red pigment on both liquid and solid CM cultures. The relative abundances of 54 of the total 215 proteins identified in the secretome were significantly altered as a result of alg3Δ, 63% of which were secreted at higher levels in alg3Δ strain than the parent. The rCel7A expressed in the alg3Δ mutant was smaller in size than that expressed in both wild-type and parental strains, but still larger than T. reesei Cel7A. The circular dichroism (CD)-melt scans indicated that change in glycosylation of rCel7A does not appear to impact the secondary structure or folding. Enzyme assays of Cel7A and rCel7A on nanocrystalline cellulose and bleached kraft pulp demonstrated that the rCel7As have improved activities on hydrolyzing the nanocrystalline cellulose. Overall, the results suggest that alg3 is critical for growth, sporulation, pigment production, and protein secretion in A. niger, and demonstrate the feasibility of this alternative approach to evaluate the roles of N-linked glycosylation in glycoprotein secretion and function. PMID:24076077

  9. A Suitable Streptomycin-Resistant Mutant for Constructing Unmarked In-Frame Gene Deletions Using rpsL as a Counter-Selection Marker

    PubMed Central

    Tsai, Yu-Kuo; Liou, Ci-Hong; Lin, Jung-Chung; Ma, Ling; Fung, Chang-Phone; Chang, Feng-Yee; Siu, L. Kristopher

    2014-01-01

    The streptomycin counter-selection system is a useful tool for constructing unmarked in-frame gene deletions, which is a fundamental approach to study bacteria and their pathogenicity at the molecular level. A prerequisite for this system is acquiring a streptomycin-resistant strain due to rpsL mutations, which encodes the ribosomal protein S12. However, in this study no streptomycin resistance was found to be caused by rpsL mutations in all 127 clinical strains of Klebsiella pneumoniae isolated from liver abscess patients. By screening 107 spontaneous mutants of streptomycin resistance from a clinical strain of K. pneumoniae, nucleotide substitution or insertion located within the rpsL was detected in each of these strains. Thirteen different mutants with varied S12 proteins were obtained, including nine streptomycin-dependent mutants. The virulence of all four streptomycin-resistant mutants was further evaluated. Compared with the parental strain, the K42N, K42T and K87R mutants showed a reduction in growth rate, and the K42N and K42T mutants became susceptible to normal human serum. In the mice LD50 (the bacterial dose that caused 50% death) assay, the K42N and K42T mutants were ∼1,000-fold less lethal (∼2×105 CFU) and the K87R mutant was ∼50-fold less lethal (∼1×104 CFU) than the parental strain (∼2×102 CFU). A K42R mutant showed non-observable effects on the above assays, while this mutant exhibited a small cost (P<0.01) in an in vitro growth competition experiment. In summary, most of the K. pneumoniae strains with streptomycin resistance caused by rpsL mutations are less virulent than their parental strain in the absence of streptomycin. The K42R mutant showed similar pathogenicity to its parental strain and should be one of the best choices when using rpsL as a counter-selection marker. PMID:25268958

  10. Analysis of DNA sequences which regulate the transcription of herpes simplex virus immediate early gene 3: DNA sequences required for enhancer-like activity and response to trans-activation by a virion polypeptide.

    PubMed Central

    Bzik, D J; Preston, C M

    1986-01-01

    The far upstream region of herpes simplex virus (HSV) immediate early (IE) gene 3 has previously been shown to increase gene expression in an enhancer-like manner, and to contain sequences which respond to stimulation of transcription by a virion polypeptide, Vmw65. To analyse the specific DNA sequences which mediate these functions, sequential deletions from each end of the far upstream region were made. The effects of the deletions on transcription in the absence or presence of the Vmw65 were measured by use of a transient expression assay. The enhancer-like activity was due to three separable elements, whereas two additional DNA regions were involved in the response to Vmw65. One of the responding elements corresponded to an AT-rich consensus (TAATGARATTC, where R = purine) present in all IE gene far upstream regions, and the other was a GA-rich sequence also present in IE genes 2 and 4/5. The TAATGARATTC element could mediate responsiveness to Vmw65 but it was fully active only in the presence of the GA-rich element. The GA-rich element was unable to confer a strong response alone but could activate an otherwise nonfunctional homologue of TAATGARATTC. PMID:3003700

  11. Analysis of DNA sequences which regulate the transcription of herpes simplex virus immediate early gene 3: DNA sequences required for enhancer-like activity and response to trans-activation by a virion polypeptide.

    PubMed

    Bzik, D J; Preston, C M

    1986-01-24

    The far upstream region of herpes simplex virus (HSV) immediate early (IE) gene 3 has previously been shown to increase gene expression in an enhancer-like manner, and to contain sequences which respond to stimulation of transcription by a virion polypeptide, Vmw65. To analyse the specific DNA sequences which mediate these functions, sequential deletions from each end of the far upstream region were made. The effects of the deletions on transcription in the absence or presence of the Vmw65 were measured by use of a transient expression assay. The enhancer-like activity was due to three separable elements, whereas two additional DNA regions were involved in the response to Vmw65. One of the responding elements corresponded to an AT-rich consensus (TAATGARATTC, where R = purine) present in all IE gene far upstream regions, and the other was a GA-rich sequence also present in IE genes 2 and 4/5. The TAATGARATTC element could mediate responsiveness to Vmw65 but it was fully active only in the presence of the GA-rich element. The GA-rich element was unable to confer a strong response alone but could activate an otherwise nonfunctional homologue of TAATGARATTC. PMID:3003700

  12. Platelet-derived growth factor induction of the immediate-early gene MCP-1 is mediated by NF-kappaB and a 90-kDa phosphoprotein coactivator.

    PubMed

    Freter, R R; Alberta, J A; Hwang, G Y; Wrentmore, A L; Stiles, C D

    1996-07-19

    A broad panel of agents including serum, interleukin-1, double-stranded RNA, and platelet-derived growth factor (PDGF) stimulate transcription of the "slow" immediate-early gene MCP-1. These disparate inducers act through a tight cluster of regulatory elements in the distal 5'-flanking sequences of the MCP-1 gene. We describe a 22-base element in this cluster which, in single copy, confers PDGF-inducibility to a tagged MCP-1 reporter gene. In mobility shift assays, the element binds a PDGF-activated form of NF-kappaB, and a 90-kDa protein (p90) which binds constitutively. Antibody supershift and UV cross-linking experiments indicate that the PDGF-activated NF-kappaB species is a Rel A homodimer. The DNA binding form of p90 is a nuclear-restricted serine/threonine phosphoprotein. Mutagenesis of the 22-base element shows that the NF-kappaB and p90 binding sites overlap, but binding of the two species is mutually independent. Both sites, however, are required for optimum PDGF induction of MCP-1. Therefore, p90 appears to be a coactivator with NF-kappaB in PDGF-mediated induction of MCP-1. PMID:8663287

  13. Herpes simplex virus induces the marked up-regulation of the zinc finger transcriptional factor INSM1, which modulates the expression and localization of the immediate early protein ICP0

    PubMed Central

    2011-01-01

    Background Herpes simplex viruses (HSVs) rapidly shut off macromolecular synthesis in host cells. In contrast, global microarray analyses have shown that HSV infection markedly up-regulates a number of host cell genes that may play important roles in HSV-host cell interactions. To understand the regulatory mechanisms involved, we initiated studies focusing on the zinc finger transcription factor insulinoma-associated 1 (INSM1), a host cell protein markedly up-regulated by HSV infection. Results INSM1 gene expression in HSV-1-infected normal human epidermal keratinocytes increased at least 400-fold 9 h after infection; INSM1 promoter activity was also markedly stimulated. Expression and subcellular localization of the immediate early HSV protein ICP0 was affected by INSM1 expression, and chromatin immunoprecipitation (ChIP) assays revealed binding of INSM1 to the ICP0 promoter. Moreover, the role of INSM1 in HSV-1 infection was further clarified by inhibition of HSV-1 replication by INSM1-specific siRNA. Conclusions The results suggest that INSM1 up-regulation plays a positive role in HSV-1 replication, probably by binding to the ICP0 promoter. PMID:21609490

  14. Expression of the immediate early IE180 protein under the control of the hTERT and CEA tumor-specific promoters in recombinant pseudorabies viruses: Effects of IE180 protein on promoter activity and apoptosis induction.

    PubMed

    Lerma, L; Alcalá, S; Piñero, C; Torres, M; Martin, B; Lim, F; Sainz, B; Tabarés, E

    2016-01-15

    Since the pseudorabies virus (PRV) genome encodes for a single immediate-early protein, IE180, we reasoned that this strong transactivating protein could represent a key regulatory switch that could be genetically manipulated in order to alter its tropism towards cancer cells. We therefore initiated studies to test whether the human telomerase reverse transcriptase (hTERT) and carcinoembryonic antigen (CEA) tumor promoters could functionally replace the IE180 promoter. We show that both promoters can functionally substitute the IE180 promoter in plasmid constructs and recombinant viruses, and observed that IE180 differentially auto-regulated each promoter tested, with PRV IE180 negatively regulating the hTERT promoter but positively hyper-activating the CEA promoter. Interestingly, we also observed that the recombinant PRV-TER and PRV-CEA viruses preferentially replicated in diverse cancer cell lines compared to control non-cancer cells, and the PRV-CEA was capable of additionally inducing a profound apoptotic phenotype which we correlated to the overexpression of IE180. PMID:26590793

  15. Binding of the human cytomegalovirus 80-kDa immediate-early protein (IE2) to minor groove A/T-rich sequences bounded by CG dinucleotides is regulated by protein oligomerization and phosphorylation.

    PubMed

    Waheed, I; Chiou, C J; Ahn, J H; Hayward, G S

    1998-12-01

    The 80-kDa immediate-early regulatory protein IE2 of human cytomegalovirus (HCMV) functions as an essential positive transactivator of downstream viral promoters, but it also specifically down-regulates transcription from the major immediate-early promoter through a 14-bp DNA target motif known as the cis-repression signal (CRS) located at the transcription start site. The IE2 protein purified from bacteria as a fusion product of either staphylococcal Protein A/IE2(290-579) or glutathione-S-transferase (GST)/IE2(346-579) bound specifically to a [32P]-labeled CRS oligonucleotide probe in an in vitro electrophoretic mobility shift assay (EMSA). In contrast, no direct interaction with the CRS probes could be detected with IE2 wild-type protein in extracts from infected or transfected mammalian cells or when synthesized by in vitro translation. However, in vitro phosphorylation of GST/IE2(346-579) by incubation with either the catalytic subunit of protein kinase A (PKA) or a HeLa cell nuclear extract strongly inhibited its DNA-binding activity. This process required ATP hydrolysis and could be reversed by subsequent incubation with bacterial alkaline phosphatase. Importantly, dephosphorylation of the constitutively expressed native IE2 protein present in a nuclear extract from the U373(A45) cell line unmasked a specific CRS DNA-binding activity that could be supershifted with anti-IE2 monoclonal antibody (mAb). A series of high-molecular-weight hetero-oligomeric DNA-bound structures of intermediate mobility were formed in EMSA assays when a mixture of staphylococcal Protein A/IE2 and GST/IE2 was coincubated with the CRS probe. Coincubation with a DNA-binding negative but dimerization-competent GST/IE2 deletion mutant competitively inhibited DNA-binding by staphylococcal Protein A/IE2, whereas coincubation with a GST/IE2 deletion mutant that lacked the ability to both dimerize and bind to DNA failed to influence the mobility of the DNA-bound staphylococcal Protein A/IE2

  16. Inhibition of iridovirus protein synthesis and virus replication by antisense morpholino oligonucleotides targeted to the major capsid protein, the 18 kDa immediate-early protein, and a viral homolog of RNA polymerase II

    SciTech Connect

    Sample, Robert; Bryan, Locke; Long, Scott; Majji, Sai; Hoskins, Glenn; Sinning, Allan; Olivier, Jake; Chinchar, V. Gregory . E-mail: vchinchar@microbio.umsmed.edu

    2007-02-20

    Frog virus 3 (FV3) is a large DNA virus that encodes {approx} 100 proteins. Although the general features of FV3 replication are known, the specific roles that most viral proteins play in the virus life cycle have not yet been elucidated. To address the question of viral gene function, antisense morpholino oligonucleotides (asMOs) were used to transiently knock-down expression of specific viral genes and thus infer their role in virus replication. We designed asMOs directed against the major capsid protein (MCP), an 18 kDa immediate-early protein (18K) that was thought to be a viral regulatory protein, and the viral homologue of the largest subunit of RNA polymerase II (vPol-II{alpha}). All three asMOs successfully inhibited translation of the targeted protein, and two of the three asMOs resulted in marked phenotypic changes. Knock-down of the MCP resulted in a marked reduction in viral titer without a corresponding drop in the synthesis of other late viral proteins. Transmission electron microscopy (TEM) showed that in cells treated with the anti-MCP MO assembly sites were devoid of viral particles and contained numerous aberrant structures. In contrast, inhibition of 18K synthesis did not block virion formation, suggesting that the 18K protein was not essential for replication of FV3 in fathead minnow (FHM) cells. Finally, consistent with the view that late viral gene expression is catalyzed by a virus-encoded or virus-modified Pol-II-like protein, knock-down of vPol-II{alpha} triggered a global decline in late gene expression and virus yields without affecting the synthesis of early viral genes. Collectively, these results demonstrate the utility of using asMOs to elucidate the function of FV3 proteins.

  17. Control of Murine Cytomegalovirus in the Lungs: Relative but Not Absolute Immunodominance of the Immediate-Early 1 Nonapeptide during the Antiviral Cytolytic T-Lymphocyte Response in Pulmonary Infiltrates

    PubMed Central

    Holtappels, Rafaela; Podlech, Jürgen; Geginat, Gernot; Steffens, Hans-Peter; Thomas, Doris; Reddehase, Matthias J.

    1998-01-01

    The lungs are a major organ site of cytomegalovirus (CMV) infection, pathogenesis, and latency. Interstitial CMV pneumonia represents a critical manifestation of CMV disease, in particular in recipients of bone marrow transplantation (BMT). We have employed a murine model for studying the immune response to CMV in the lungs in the specific scenario of immune reconstitution after syngeneic BMT. Control of pulmonary infection was associated with a vigorous infiltration of the lungs, which was characterized by a preferential recruitment and massive expansion of the CD8 subset of α/β T cells. The infiltrate provided a microenvironment in which the CD8 T cells differentiated into mature effector cells, that is, into functionally active cytolytic T lymphocytes (CTL). This gave us the opportunity for an ex vivo testing of the antigen specificities of CTL present at a relevant organ site of viral pathogenesis. The contribution of the previously identified immediate-early 1 (IE1) nonapeptide of murine CMV was evaluated by comparison with the CD3ɛ-redirected cytolytic activity used as a measure of the overall CTL response in the lungs. The IE1 peptide was detected by pulmonary CTL, but it accounted for a minor part of the response. Interestingly, no additional viral or virus-induced antigenic peptides were detectable among naturally processed peptides derived from infected lungs, even though infected fibroblasts were recognized in a major histocompatibility complex-restricted manner. We conclude that the antiviral pulmonary immune response is a collaborative function that involves many antigenic peptides, among which the IE1 peptide is immunodominant in a relative sense. PMID:9696814

  18. Profiling of the toxicity mechanisms of coated and uncoated silver nanoparticles to yeast Saccharomyces cerevisiae BY4741 using a set of its 9 single-gene deletion mutants defective in oxidative stress response, cell wall or membrane integrity and endocytosis.

    PubMed

    Käosaar, Sandra; Kahru, Anne; Mantecca, Paride; Kasemets, Kaja

    2016-09-01

    The widespread use of nanosilver in various antibacterial, antifungal, and antiviral products warrants the studies of the toxicity pathways of nanosilver-enabled materials toward microbes and viruses. We profiled the toxicity mechanisms of uncoated, casein-coated, and polyvinylpyrrolidone-coated silver nanoparticles (AgNPs) using Saccharomyces cerevisiae wild-type (wt) and its 9 single-gene deletion mutants defective in oxidative stress (OS) defense, cell wall/membrane integrity, and endocytosis. The 48-h growth inhibition assay in organic-rich growth medium and 24-h cell viability assay in deionized (DI) water were applied whereas AgNO3, H2O2, and SDS served as positive controls. Both coated AgNPs (primary size 8-12nm) were significantly more toxic than the uncoated (~85nm) AgNPs. All studied AgNPs were ~30 times more toxic if exposed to yeast cells in DI water than in the rich growth medium: the IC50 based on nominal concentration of AgNPs in the growth inhibition test ranged from 77 to 576mg Ag/L and in the cell viability test from 2.7 to 18.7mg Ag/L, respectively. Confocal microscopy showed that wt but not endocytosis mutant (end3Δ) internalized AgNPs. Comparison of toxicity patterns of wt and mutant strains defective in OS defense and membrane integrity revealed that the toxicity of the studied AgNPs to S. cerevisiae was not caused by the OS or cell wall/membrane permeabilization. PMID:27260961

  19. The equine herpesvirus-1 IR3 gene that lies antisense to the sole immediate-early (IE) gene is trans-activated by the IE protein, and is poorly expressed to a protein

    SciTech Connect

    Ahn, Byung Chul; Breitenbach, Jonathan E.; Kim, Seong K.; O'Callaghan, Dennis J. . E-mail: docall@lsuhsc.edu

    2007-06-20

    The unique IR3 gene of equine herpesvirus 1 (EHV-1) is expressed as a late 1.0-kb transcript. Previous studies confirmed the IR3 transcription initiation site and tentatively identified other cis-acting elements specific to IR3 such as a TATA box, a 443 base pair 5'untranslated region (UTR), a 285 base pair open reading frame (ORF), and a poly adenylation (A) signal [Holden, V.R., Harty, R.N., Yalamanchili, R.R., O'Callaghan, D.J., 1992. The IR3 gene of equine herpesvirus type 1: a unique gene regulated by sequences within the intron of the immediate-early gene. DNA Seq. 3, 143-152]. Transient transfection assays revealed that the IR3 promoter is strongly trans-activated by the IE protein (IEP) and that coexpression of the IEP with the early EICP0 and IR4 regulatory proteins results in maximal trans-activation of the IR3 promoter. Gel shift assays revealed that the IEP directly binds to the IR3 promoter region. Western blot analysis showed that the IR3 protein produced in E. coli was detected by antibodies to IR3 synthetic peptides; however, the IR3 protein was not detected in EHV-1 infected cell extracts by these same anti-IR3 antibodies, even though the IR3 transcript was detected by northern blot. These findings suggest that the IR3 may not be expressed to a protein. Expression of an IR3/GFP fusion gene was not observed, but expression of a GFP/IR3 fusion gene was detected by fluorescent microscopy. In further attempts to detect the IR3/GFP fusion protein using anti-GFP antibody, western blot analysis showed that the IR3/GFP fusion protein was not detected in vivo. Interestingly, a truncated form of the GFP/IR3 protein was synthesized from the GFP/IR3 fusion gene. However, GFP/IR3 and IR3/GFP fusion proteins of the predicted sizes were synthesized by in vitro coupled transcription and translation of the fusion genes, suggesting poor expression of the IR3 protein in vivo. The possible role of the IR3 transcript in EHV-1 infection is discussed.

  20. mdv1-miR-M7-5p, located in the newly identified first intron of the latency-associated transcript of Marek's disease virus, targets the immediate-early genes ICP4 and ICP27.

    PubMed

    Strassheim, S; Stik, G; Rasschaert, D; Laurent, S

    2012-08-01

    Marek's disease virus serotype 1 (MDV-1) is an oncogenic alphaherpesvirus causing fatal T-cell lymphoma in chickens. MDV latency is characterized by the production of latency-associated transcripts (LATs), a family of non-protein-coding spliced RNAs. A cluster of four microRNAs (cluster mdv1-miR-M8-M10) was identified, but not formally mapped, at the predicted LAT 5' end. We established a LAT cDNA library from latently MDV-infected cell line MSB-1. We identified 22 highly variable LATs, which were due to the extensive alternative splicing of a total of 14 introns. RACE PCR confirmed the predicted 3' end and allowed identification of the 5' end, 400 nt upstream of the previously predicted LAT end. The LATs share their transcription start site with the microRNA-expressing transcript described previously, localizing the microRNAs to the first LAT intron and identifying the LATs as the primary transcripts of the microRNAs. We identified MDV immediate-early (IE) genes ICP4 and ICP27 as putative targets of mdv1-miR-M7-5p, the third microRNA of the cluster mdv1-miR-M8-M10. Endogenously expressed mdv1-miR-M7-5p in MSB-1 cells reduced luciferase activity significantly when microRNA-responsive elements from ICP4 or ICP27 were cloned in the 3' UTR of the firefly luciferase gene. ICP27 protein levels were decreased by 70 % when the mdv1-miR-M7-5p precursor was co-expressed with an ICP27 expression plasmid. Additionally, we showed a negative correlation between the decreased expression of mdv1-miR-M7-5p and an increase in ICP27 expression during virus reactivation. Our results suggest that, by targeting two IE genes, MDV microRNAs produced from LAT transcripts may contribute to establish and/or maintain latency. PMID:22513387

  1. Transforming Growth Factor Beta 1 Stimulates Expression of the Epstein-Barr Virus BZLF1 Immediate-Early Gene Product ZEBRA by an Indirect Mechanism Which Requires the MAPK Kinase Pathway

    PubMed Central

    Fahmi, Hassan; Cochet, Chantal; Hmama, Zakariae; Opolon, Paule; Joab, Irene

    2000-01-01

    Disruption of Epstein-Barr virus (EBV) latency is mediated by ZEBRA, the protein product of the immediate-early EBV gene, BZLF1. In vitro, phorbol 12-myristate 13-acetate (PMA), a potent activator of protein kinase C (PKC), induces reactivation of EBV. However, the physiological stimuli responsible for the disruption of viral latency are not well characterized. Transforming growth factor beta 1 (TGF-β1) has also been shown to trigger the reactivation of EBV in Burkitt lymphoma cell lines; however, the effect of TGF-β1 on ZEBRA expression has not been reported. To further understand this phenomenon, we have investigated the effect of TGF-β1 on ZEBRA expression. Our results indicate that the treatment of different EBV-positive Burkitt's lymphoma cell lines with TGF-β1 induces a time-dependent activation of BZLF1 transcription with a corresponding increase in the production of the protein ZEBRA. TGF-β1 has been shown to exert its effects through a wide range of intracellular routes; in the present study, we have explored these pathways. Transient expression of Smad proteins on their own had no effect on ZEBRA expression. A specific inhibitor of p38 mitogen-activated protein kinase (MAPK), SB203580, did not affect TGF-β1-induced ZEBRA expression, whereas treatment with the MAPK/ERK kinase inhibitors, PD98059 and U0126, dramatically decreased this induction. This suggests that TGF-β1 effect on BZLF1 expression requires the MAPK pathway. However, in Raji and B95-8 cells additional routes can be used, as (i) the inhibition of ZEBRA induction by PD98059 or U0126 was incomplete, whereas these inhibitors completely abolished PMA-induced ZEBRA expression, (ii) TGF-β1 induction of ZEBRA expression occurs in PKC-depleted cells, (iii) in Raji and in B95-8 cells, the effect of TGF-β1 and PMA are additive. Transient transfection of the EBV-negative B-cell line DG75 with a BZLF1 promoter-fusion construct (Zp-CAT) showed that under conditions where the BZLF1 promoter is

  2. Two distinct upstream regulatory domains containing multicopy cellular transcription factor binding sites provide basal repression and inducible enhancer characteristics to the immediate-early IES (US3) promoter from human cytomegalovirus.

    PubMed

    Chan, Y J; Tseng, W P; Hayward, G S

    1996-08-01

    The US3 gene of human cytomegalovirus (HCMV) is expressed at immediate-early (IE) times in permissive HF cells, but not in nonpermissive rodent cells, and encodes several proteins that have been reported to have regulatory characteristics, although they are dispensable for growth in cell culture. Both spliced and unspliced forms of US3 IE transcripts are associated with the second of only two known large and complex upstream enhancer domains within the 229-kb HCMV genome, which we refer to as the IES cis-acting control region. Only the 260-bp proximal segment (from -313 to -55) of the 600-bp IES control domain, which contains multicopy NF-kappaB binding sites, proved to be necessary to transfer both high basal expression plus phorbol ester- and okadaic acid-inducible characteristics to heterologous promoters in transient assays in U-937 and K-562 cells. However, the IES control region contains a distinctive 280-bp distal domain, characterized by the presence of seven interspersed repeats of a 10-bp TGTCGCGACA palindromic consensus motif that encompasses a NruI site. This far upstream Nru repeat region (from -596 to -314) imparted up to 20-fold down-regulation effects onto strong basal heterologous promoters as well as onto the IES enhancer plus minimal promoter region in both U-937 and K-562 cells. Functional Nru repressor elements (NREs) could not be generated by multimerizing either the palindromic (P) Nru motifs alone or adjacent degenerate interrupted (I Nru motifs alone. However, multimerized forms of the combined P plus I elements reconstituted the full 20-fold cis-acting down-regulation phenotype of the intact NRE domain. The P and I forms of the Nru elements each bound independently and specifically to related cellular DNA-binding factors to form differently migrating A or B complexes, respectively, whereas the combined P plus I elements bound cooperatively to both the A and B complexes with high affinity. Interestingly, nuclear extracts from U-937, K-562

  3. 3-Hydroxy-3-methylglutaryl CoA lyase (HL): Mouse and human HL gene (HMGCL) cloning and detection of large gene deletions in two unrelated HL-deficient patients

    SciTech Connect

    Wang, S.P.; Robert, M.F.; Mitchell, G.A.

    1996-04-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL, EC 4.1.3.4) catalyzes the cleavage of 3-hydroxy-3-methylglutaryl CoA to acetoacetic acid and acetyl CoA, the final reaction of both ketogenesis and leucine catabolism. Autosomal-recessive HL deficiency in humans results in episodes of hypoketotic hypoglycemia and coma. Using a mouse HL cDNA as a probe, we isolated a clone containing the full-length mouse HL gene that spans about 15 kb of mouse chromosome 4 and contains nine exons. The promoter region of the mouse HL gene contains elements characteristic of a housekeeping gene: a CpG island containing multiple Sp1 binding sites surrounds exon 1, and neither a TATA nor a CAAT box are present. We identified multiple transcription start sites in the mouse HL gene, 35 to 9 bases upstream of the translation start codon. We also isolated two human HL genomic clones that include HL exons 2 to 9 within 18 kb. The mouse and human HL genes (HGMW-approved symbol HMGCL) are highly homologous, with identical locations of intron-exon junctions. By genomic Southern blot analysis and exonic PCR, was found 2 of 33 HL-deficient probands to be homozygous for large deletions in the HL gene. 26 refs., 4 figs., 2 tabs.

  4. Distinct cardioprotective mechanisms of immediate, early and delayed ischaemic postconditioning.

    PubMed

    Barsukevich, Veronika; Basalay, Marina; Sanchez, Jenifer; Mrochek, Alexander; Whittle, John; Ackland, Gareth L; Gourine, Alexander V; Gourine, Andrey

    2015-01-01

    Cardioprotection against ischaemia/reperfusion injury in mice can be achieved by delayed ischaemic postconditioning (IPost) applied as late as 30 min after the onset of reperfusion. We determined the efficacy of delayed IPost in a rat model of myocardial infarction (MI) and investigated potential underlying mechanisms of this phenomenon. Rats were subjected to 20, 30 or 45 min of coronary artery occlusion followed by 120 min of reperfusion (I/R). Immediate and early IPost included six cycles of I/R (10/10 s) applied 10 s or 10 min after reperfusion onset. In the second series of experiments, the rats were subjected to 30 min of coronary occlusion followed by IPost applied 10 s, 10, 30, 45 or 60 min after the onset of reperfusion. Immediate and early IPost (applied 10 s or 10 min of reperfusion) established cardioprotection only when applied after a period of myocardial ischaemia lasting 30 min. Delayed IPost applied after 30 or 45 min of reperfusion reduced infarct sizes by 36 and 41 %, respectively (both P < 0.01). IPost applied 60 min after reperfusion onset was ineffective. Inhibition of RISK pathway (administration of ERK1/2 inhibitor PD-98059 or PI3K inhibitor LY-294002) abolished cardioprotection established by immediate IPost but had no effect on cardioprotection conferred by early IPost. Blockade of SAFE pathway using JAK/STAT inhibitor AG490 had no effect on the immediate or early IPost cardioprotection. Blockade of mitochondrial KATP (mitoKATP) channels (with 5-Hydroxydecanoate) abolished cardioprotection achieved by immediate and early IPost, but had no effect on cardioprotection when IPost was applied 30 or 45 min into the reperfusion period. Immediate IPost increased phosphorylation of PI3K-AKT and ERK1/2. Early or delayed IPost had no effect on phosphorylation of PI3K-AKT, ERK1/2 or STAT3. These data show that in the rat model, delayed IPost confers significant cardioprotection even if applied 45 min after onset of reperfusion. Cardioprotection induced by immediate and early postconditioning involves recruitment of RISK pathway and/or mitoKATP channels, while delayed postconditioning appears to rely on a different mechanism. PMID:25449894

  5. SHC2 gene copy number in multiple system atrophy (MSA)

    PubMed Central

    Ferguson, Marcus C.; Garland, Emily M.; Hedges, Lora; Womack-Nunley, Bethany; Hamid, Rizwan; Phillips, John A.; Shibao, Cyndya A.; Raj, Satish R.; Biaggioni, Italo; Robertson, David

    2013-01-01

    Purpose Multiple system atrophy (MSA) is a sporadic, late onset, rapidly-progressing neurodegenerative disorder, which is characterized by autonomic failure, together with parkinsonian, cerebellar, and pyramidal motor symptoms. The pathologic hallmark is the glial cytoplasmic inclusion with alpha-synuclein aggregates. MSA is thus an alpha synucleinopathy. Recently, Sasaki et al. reported that heterozygosity for copy number loss of Src homology 2 domain containing-transforming protein 2 (SHC2) genes (heterozygous SHC2 gene deletions) occurred in DNAs from many Japanese individuals with MSA. Because background copy number variation (CNV) can be distinct in different human populations, we assessed SHC2 allele copy number in DNAs from a US cohort of individuals with MSA, to determine the contribution of SHC2 gene copy number variation in an American cohort followed at a US referral center for MSA. Our cohort included 105 carefully phenotyped individuals with MSA. Methods We studied 105 well characterized patients with MSA and 5 control subjects with reduced SHC2 gene copy number. We used two TaqMan Gene Copy Number Assays, to determine the copy number of two segments of the SHC2 gene that are separated by 27 Kb. Results Assay results of DNAs from all of our 105 subjects with MSA showed two copies of both segments of their SHC2 genes. Conclusion Our results indicate that SHC2 gene deletions underlie few, if any, cases of well characterized MSA in the US population. This is in contrast to the Japanese experience reported by Sasaki et al., likely reflecting heterogeneity of the disease in different genetic backgrounds. PMID:24170347

  6. Trehalose-related gene deletions in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a widespread corn pathogen that causes root, stalk, and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Our goal is to assess the feasibility of exploiting trehalose metabolism as a target for F. verticillioide...

  7. CHARACTERIZING FUMONISIN BIOSYNTHESIS THROUGH ANALYSIS OF FUM GENE DELETION MUTANTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fumonisins are produced by Gibberella moniliformis, a causal agent of maize ear and stalk rot, and pose a health risk to humans and livestock alike. Recently, a fumonisin biosynthetic gene cluster was described in G. moniliformis. The cluster consists of 15 co-regulated genes (FUM1 and FUM6 throug...

  8. Site-directed mutagenesis and gene deletion using reverse genetics.

    PubMed

    Muhl, Daniela; Filloux, Alain

    2014-01-01

    Understanding gene function is far easier when tools are available to engineer a bacterial strain lacking a specific gene and phenotypically compare its behavior with the corresponding parental strain. Such mutants could be selected randomly, either by natural selection under particular stress conditions or by random mutagenesis using transposon delivery as described elsewhere in this book. However, with the advent of the genomic era there are now hundreds of bacterial genomes whose sequence is available, and thus, genes can be identified, chosen, and strategies designed to specifically inactivate them. This can be done by using suicide plasmids and is most convenient when the bacterium of interest is easily amenable to genetic manipulation. The method presented here will describe the use of a suicide vector, pKNG101, which allows the selection of a double-recombination event. The first event results in the integration of the pKNG101 derivative carrying the "mutator" fragment onto the chromosome, and could be selected on plates containing appropriate antibiotics. The pKNG101 carries the sacB gene, which induces death when cells are grown on sucrose. Growth on sucrose plates will thus select the second homologous recombination event, which results in removing the plasmid backbone and leaving behind the mutated target gene. This method has been widely used over the last 20 years to inactivate genes in a wide range of gram-negative bacteria and in particular in Pseudomonas aeruginosa. PMID:24818930

  9. CaMK4 Gene Deletion Induces Hypertension

    PubMed Central

    Santulli, Gaetano; Cipolletta, Ersilia; Sorriento, Daniela; Del Giudice, Carmine; Anastasio, Antonio; Monaco, Sara; Maione, Angela Serena; Condorelli, Gianluigi; Puca, Annibale; Trimarco, Bruno; Illario, Maddalena; Iaccarino, Guido

    2012-01-01

    Background The expression of calcium/calmodulin-dependent kinase IV (CaMKIV) was hitherto thought to be confined to the nervous system. However, a recent genome-wide analysis indicated an association between hypertension and a single-nucleotide polymorphism (rs10491334) of the human CaMKIV gene (CaMK4), which suggests a role for this kinase in the regulation of vascular tone. Methods and Results To directly assess the role of CaMKIV in hypertension, we characterized the cardiovascular phenotype of CaMK4−/− mice. They displayed a typical hypertensive phenotype, including high blood pressure levels, cardiac hypertrophy, vascular and kidney damage, and reduced tolerance to chronic ischemia and myocardial infarction compared with wild-type littermates. Interestingly, in vitro experiments showed the ability of this kinase to activate endothelial nitric oxide synthase. Eventually, in a population study, we found that the rs10491334 variant associates with a reduction in the expression levels of CaMKIV in lymphocytes from hypertensive patients. Conclusions Taken together, our results provide evidence that CaMKIV plays a pivotal role in blood pressure regulation through the control of endothelial nitric oxide synthase activity. (J Am Heart Assoc. 2012;1:e001081 doi: 10.1161/JAHA.112.001081.) PMID:23130158

  10. Trehalose-related Gene Deletions in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a widespread corn pathogen that causes root, stalk and ear rot and produces fumonisins, toxic secondary metabolites associated with disease in livestock and humans. Our goal is to assess the feasibility of exploiting trehalose metabolism as a target for F. verticillioides...