Science.gov

Sample records for multiplex polymerase chain

  1. Thermally multiplexed polymerase chain reaction

    PubMed Central

    Phaneuf, Christopher R.; Pak, Nikita; Saunders, D. Curtis; Holst, Gregory L.; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L.; Jerris, Robert; Forest, Craig R.

    2015-01-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously—each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  2. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  3. Detection of Microsatellite Instability by Fluorescence Multiplex Polymerase Chain Reaction

    PubMed Central

    Berg, Karin D.; Glaser, Cynthia L.; Thompson, Richard E.; Hamilton, Stanley R.; Griffin, Constance A.; Eshleman, James R.

    2000-01-01

    We have created a clinical molecular diagnostic assay to test for microsatellite instability (MSI) at multiple loci simultaneously in paraffin-embedded surgical pathology colon resection specimens. This fluorescent multiplex polymerase chain reaction (PCR) assay analyzes the five primary microsatellite loci recommended at the 1997 National Cancer Institute-sponsored conference on MSI for the identification of MSI or replication errors in colorectal cancer: Bat-25, Bat-26, D2S123, D5S346, and D17S250. Amplicon detection is accomplished by capillary electrophoresis using the ABI 310 Genetic Analyzer. Assay validation compared 18 specimens previously assessed by radioactive PCR and polyacrylamide gel electrophoresis detection to results generated by the reported assay. Germline and tumor DNA samples were amplified in separate multiplex PCR reactions, sized in separate capillary electrophoresis runs, and compared directly to identify novel length alleles in tumor tissue. A concordance of 100% between the two modalities was achieved. The multiplex assay routinely detected a subpopulation of 10% tumor alleles in the presence of 90% normal alleles. A novel statistical model was generated that corroborates the validity of using results generated by analysis of five independent microsatellites to achieve a single overall MSI diagnosis. The assay presented is superior to standard radioactive monoplex PCR, polyacrylamide gel electrophoretic analysis, primarily due to the multiplex PCR format. PMID:11272898

  4. Single Multiplex Polymerase Chain Reaction To Detect Diverse Loci Associated with Diarrheagenic Escherichia coli

    PubMed Central

    López-Saucedo, Catalina; Cerna, Jorge F.; Villegas-Sepulveda, Nicolas; Thompson, Rocío; Velazquez, F. Raul; Torres, Javier; Tarr, Phillip I.

    2003-01-01

    We developed and tested a single multiplex polymerase chain reaction (PCR) that detects enterotoxigenic, enteropathogenic, enteroinvasive, and Shiga-toxin–producing Escherichia coli. This PCR is specific, sensitive, and rapid in detecting target isolates in stool and food. Because of its simplicity, economy, and efficiency, this protocol warrants further evaluation in large, prospective studies of polymicrobial substances. PMID:12533296

  5. Multiplex polymerase chain reaction method for differentiating western and northern corn rootworm larvae (Coleoptera: Chrysomelidae).

    PubMed

    Roehrdanz, Richard L

    2003-06-01

    Western corn rootworm, Diabrotica virgifera virgifera LeConte, and northern corn rootworm, D. barberi Smith and Lawrence, are sympatric species and serious pests of corn cultivation in North America. Comparison of nucleotide sequence of mitochondrial cytochrome oxidase I and II was used to design polymerase chain reaction (PCR) primers that discriminate immature stages of the two species based on differences in amplicon size. Multiplex PCR can be used to give a positive test for each species in a single amplification reaction. This provides a method to identify field caught larvae and facilitates investigations of larval interaction and competition between the species. PMID:12852603

  6. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  7. A Multiplex Polymerase Chain Reaction Microarray Assay to Detect Bioterror Pathogens in Blood

    PubMed Central

    Tomioka, Keiko; Peredelchuk, Michael; Zhu, Xiangyang; Arena, Roberto; Volokhov, Dmitri; Selvapandiyan, Angamuthu; Stabler, Katie; Mellquist-Riemenschneider, Jenny; Chizhikov, Vladimir; Kaplan, Gerardo; Nakhasi, Hira; Duncan, Robert

    2005-01-01

    Heightened concern about the dangers of bioterrorism requires that measures be developed to ensure the safety of the blood supply. Multiplex detection of such agents using a blood-screening DNA microarray is a sensitive and specific method to screen simultaneously for a number of suspected agents. We have developed and optimized a multiplex polymerase chain reaction microarray assay to screen blood for three potential bioterror bacterial pathogens and a human ribosomal RNA gene internal control. The analytical sensitivity of the assay was demonstrated to be 50 colony-forming units/ml for Bacillus anthracis, Francisella tularensis, and Yersinia pseudotuberculosis (surrogate for Yersinia pestis). The absence of any false-positives demonstrated high analytical specificity. Screening B. anthracis-infected mouse blood samples and uninfected controls demonstrated effectiveness and specificity in a preclinical application. This study represents proof of the concept of microarray technology to screen simultaneously for multiple bioterror pathogens in blood samples. PMID:16237218

  8. Detection and typing of lymphotropic herpesviruses by multiplex polymerase chain reaction.

    PubMed

    Pozo, F; Tenorio, A

    1999-04-01

    A multiplex nested-polymerase chain reaction (PCR) method was developed for the simultaneous detection and typing of all human lymphotropic herpesviruses described to date, including Ebstein Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus 6, variants A and B (HHV6-A, HHV6-B), human herpesvirus 7 (HHV7) and human herpesvirus 8 (HHV8). Oligonucleotide primers were designed to amplify a highly conserved region within the DNA polymerase gene. Each reaction component and thermal cycling parameters were thoroughly standardized to achieve optimal specificity and sensitivity for the PCR assay, which was estimated at about 10-100 molecules for each virus. An internal control, consisting of 100 molecules of a cloned fragment of the porcine pseudorabies herpesvirus (PrV) genome, was included to detect false negative results. To assess suitability and clinical application of the multiplex PCR method, a total of 35 well-characterized specimens, including Kaposi's sarcoma skin lesions, serum, cerebrospinal fluid, saliva and urine samples, were tested. Results obtained suggest this technique could be applied as a sole diagnostic tool in several clinical settings in which herpesviral infection is suspected and differential diagnosis required, avoiding the need to test specimens by separate PCR methods. PMID:10328531

  9. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    PubMed

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  10. Genotyping by multiplex polymerase chain reaction for detection of endemic hepatitis B virus transmission.

    PubMed Central

    Repp, R; Rhiel, S; Heermann, K H; Schaefer, S; Keller, C; Ndumbe, P; Lampert, F; Gerlich, W H

    1993-01-01

    A nested polymerase chain reaction (PCR) protocol was developed for rapid genotyping of hepatitis B virus (HBV). During the first PCR round, a universal HBV primer pair was used to amplify the entire pre-S region of the HBV genome. Within the pre-S region, many nucleotide exchanges are observed. These are partly correlated to the serological hepatitis B surface antigen subtypes. Five additional subtype-specific primers were selected from that region which, together with two universal non-group-specific primers, generated specific combinations of two to four DNA fragments of defined sizes. By this approach, 55 hepatitis B surface antigen-positive patients from a pediatric oncology unit in Germany were analyzed. Fifty-four patients who had been infected within 2 years had an identical pattern in the multiplex PCR, suggesting a common source of infection and person-to-person transmission within the unit. One child who was infected 5 years later had a different PCR pattern and, therefore, must have been infected from a different source. Furthermore, 109 serum samples taken from pregnant Cameroonian women and 25 serum samples from their babies taken 6 months after birth were analyzed. In one case, mother-to-infant transmission of the virus was demonstrated. Apart from its role in epidemiological studies on HBV, multiplex PCR may also be a useful tool for rapid genetic analysis in other fields if there is a moderate degree of sequence variation which enables the design of specific primers. Images PMID:8501209

  11. Monochrome Multiplexing in Polymerase Chain Reaction by Photobleaching of Fluorogenic Hydrolysis Probes.

    PubMed

    Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; von Stetten, Felix

    2016-03-01

    Multiplexing in polymerase chain reaction (PCR) is a technique widely used to save cost and sample material and to increase sensitivity compared to distributing a sample to several singleplex reactions. One of the most common methods to detect the different amplification products is the use of fluorogenic probes that emit at different wavelengths (colors). To reduce the number of detection channels, several methods for monochrome multiplexing have been suggested. However, they pose restrictions to the amplifiable target length, the sequence, or the melting temperature. To circumvent these limitations, we suggest a novel approach that uses different fluorophores with the same emission maximum. Discrimination is achieved by their different fluorescence stability during photobleaching. Atto488 (emitting at the same wavelength as 6-carboxyfluorescein, FAM) and Atto467N (emitting at the same wavelength as cyanine 5, Cy5) were found to bleach significantly less than FAM and Cy5; i.e., the final fluorescence of Atto dyes was more than tripled compared to FAM and Cy5. We successfully applied this method by performing a 4-plex PCR targeting antibiotic resistance genes in S. aureus using only 2 color channels. Confidence of discrimination between the targets was >99.9% at high copy initial copy numbers of 100 000 copies. Cases where both targets were present could be discriminated with equal confidence for Cy5 channel and reduced levels of confidence (>68%) for FAM channel. Moreover, a 2-plex digital PCR reaction in 1 color channel was shown. In the future, the degree of multiplexing may be increased by adding fluorogenic probe pairs with other emission wavelengths. The method may also be applied to other probe and assay formats, such as Förster resonance energy transfer (FRET) probes and immunoassays. PMID:26840905

  12. Detection of pathogenic Yersinia enterocolitica using the multiplex polymerase chain reaction.

    PubMed Central

    Harnett, N.; Lin, Y. P.; Krishnan, C.

    1996-01-01

    A multiplex polymerase chain reaction (PCR) was developed to detect the presence of the ail, yst, and virF genes of Yersinia enterocolitica simultaneously, quickly and accurately. The amplified fragment sizes were 356 base-pairs (bp) for the ail gene, 134 bp for the yst gene, and 231 bp for the virF gene. The specificity of the amplified products was confirmed by hybridization with digoxigenin-labelled oligonucleotide probes. Amplification was successful whether the template was derived from a single colony of bacteria, aliquots of boiled bacterial suspensions, from DNA extracted from pure or mixed cultures or from stool specimens. Amplification of the virF gene was also achieved from strains of Y. pseudotuberculosis carrying the 70 kb plasmid but not with preparations from other related Yersinia species or from other members of the family Enterobacteriaceae. The detection limit we established was 5-10 colony forming units per millilitre (cfu/ml) and 1.0 pg of DNA. Images Fig. 1 Fig. 2 PMID:8760951

  13. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future. PMID:26078959

  14. Rapid discrimination of rabies viruses isolated from various host species in Brazil by multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Sato, Go; Tanabe, Hitomi; Shoji, Youko; Itou, Takuya; Ito, Fumio H; Sato, Tetsuo; Sakai, Takeo

    2005-08-01

    Rabies is carried mainly by mammalian carnivores and vampire bats in Latin America. However, rabies virus (RV) has been isolated in recent years from not only vampire bats in rural areas but also from several non-vampire bat species in urban areas, respectively. Therefore, rapid molecular screening is necessary for efficient epidemiology of these RVs. In this study, we investigated the usefulness of multiplex reverse transcription-polymerase chain reaction (RT-PCR) for determining the origins of 54 RV isolates from various host species in Brazil. And to evaluate the multiplex RT-PCR as a potential diagnostic tool, we investigated the sensitivity of this method. In addition, we compared the results with a phylogenetic tree developed from sequences of the RV glycoprotein (G protein) gene. Multiplex RT-PCR products showed five different sizes of products, whereas the phylogenic tree showed six groups. Of these six groups, four corresponded with the four sizes of the multiplex RT-PCR products. The other two groups showed correspondance with another one size of the multiplex RT-PCR products, indicating that multiplex RT-PCR results reflected the lineage of the 54 isolates. This study also showed that this method can detect trace amounts of RNA. In conclusion, this multiplex RT-PCR method allows the rapid, specific, and simultaneous detection of RVs isolated from various host species in Brazil. PMID:16036175

  15. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  16. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  17. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    PubMed

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  18. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction

    USGS Publications Warehouse

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.

    2009-01-01

    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  19. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    PubMed Central

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  20. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction.

    PubMed

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian

    2016-03-15

    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella. PMID:26933026

  1. A novel multiplexing, polymerase chain reaction-based assay for the analysis of chromosome 18q status in colorectal cancer.

    PubMed

    Erill, Nadina; Colomer, Anna; Calvo, Miquel; Vidal, August; Román, Ruth; Verdú, Montse; Cordón-Cardó, Carlos; Puig, Xavier

    2005-10-01

    Chromosome 18q allelic loss has been reported to have prognostic significance in stage II colorectal carcinoma. We have developed a fluorescent multiplex polymerase chain reaction assay to analyze five microsatellite markers (D18S55, D18S58, D18S61, D18S64, and D18S69) for allelic loss at the long arm of chromosome 18. Amplicon detection and evaluation was accomplished by capillary electrophoresis using an ABI 310 genetic analyzer. Robustness of the assay when performed on DNA extracted from formalin-fixed, paraffin-embedded tissue sections was confirmed by analyzing its repeatability and reproducibility. Allelic loss was assessed in 61 stage II colorectal tumors and was detected in 58% (31 of 53) of tumors not showing instability. As part of the study, results of 207 previous polymerase chain reaction/polyacrylamide-based assays were re-evaluated by two independent observers to determine the degree of concordance of visual evaluation. In the case of stage II colorectal tumors, when electropherogram results were compared with those obtained from visual evaluation of the same markers after polyacrylamide gel electrophoresis, discrepancies between observers were detected in 16.4% of determinations. In conclusion, we have developed a robust and reliable assay for multiplexed loss of heterozygosity determination that improves assessment of chromosome 18q allelic loss in colorectal tumors processed as routine formalin-fixed, paraffin-embedded specimens. PMID:16237217

  2. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  3. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination. PMID:24793853

  4. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction.

    PubMed

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D

    2014-09-01

    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  5. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    PubMed Central

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  6. Simultaneous detection of seven sexually transmitted agents in human immunodeficiency virus-infected Brazilian women by multiplex polymerase chain reaction.

    PubMed

    Souza, Raquel P; de Abreu, André L P; Ferreira, Érika C; Rocha-Brischiliari, Sheila C; de B Carvalho, Maria D; Pelloso, Sandra M; Bonini, Marcelo G; Gimenes, Fabrícia; Consolaro, Marcia E L

    2013-12-01

    We determined the prevalence of seven clinically important pathogens that cause sexually transmitted infections (STIs) (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, herpes simplex virus 1 [HSV-1], HSV-2, and Treponema pallidum), by using a multiplex polymerase chain reaction (M-PCR) in samples from Brazilian woman infected with human immunodeficiency virus 1 (HIV-1) and uninfected Brazilian women (controls). The M-PCR assay identified all STIs tested for and surprisingly, occurred association between the control and STIs. This association was probably caused by excellent HIV infection control and regular monitoring in these women established by public health strategies in Brazil to combat HIV/acquired immunodeficiency syndrome. Studies using this M-PCR in different populations may help to better elucidate the roles of STIs in several conditions. PMID:24080632

  7. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals.

    PubMed

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C

    2012-07-01

    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  8. Comparison between Culture and a Multiplex Quantitative Real-Time Polymerase Chain Reaction Assay Detecting Ureaplasma urealyticum and U. parvum

    PubMed Central

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR. PMID:25047036

  9. Detection of Salmonella enterica serovar Dublin by polymerase chain reaction in multiplex format.

    PubMed

    Zhai, Ligong; Kong, Xiaohan; Lu, Zhaoxin; Lv, Fengxia; Zhang, Chong; Bie, Xiaomei

    2014-05-01

    S. Dublin has caused widespread concerns in cattle produce. Using a comparative genomic method, two specific targets like SeD_A1118 and SeD_A2283 for S. Dublin identification were firstly obtained. An efficient multiplex PCR for S. Dublin detection based on the two novel specific genes and invA was therefore developed. PMID:24607499

  10. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    PubMed

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  11. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    PubMed Central

    Han, Jae-Ik; Chang, Dong-Woo

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 µL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  12. Detection of Aeromonas salmonicida by reverse transcription-multiplex polymerase chain reaction.

    PubMed

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2012-01-01

    Aeromonas salmonicida is one of the major fish pathogens causing economically devastating losses in aquaculture. A. salmonicida subsp. salmonicida is a typical A. salmonicida causing furunculosis, while the other subspecies are atypical strains causing ulcer diseases. PCR-based methods of detecting A. salmonicida suffer from the drawback that they do not distinguish living (pathogenic) from dead cells. In this study, a method of detecting A. salmonicida was developed based on reverse transcription-multiplex PCR (RT-MPCR) using two sets of primers, SV1/SV2 and SF1/SF2, specific to the vapA gene and the fstB gene of A. salmonicida respectively. This method was found to detect A. salmonicida specifically with detection limits of 10 CFU in pure culture and 30 CFU in the presence of tissue debris. It was also found distinguish not only between viable and nonviable cells but also between typical and atypical strains of A. salmonicida. Using RT-MPCR, two DNA fragments, of 542 and 1,258 bp, were amplified from RNA of typical A. salmonicida, whereas only one DNA fragment, of 542 bp, was amplified from the RNA of the atypical ones. The proposed assay was also used successfully to detect A. salmonicida in artificially infected rainbow trout (Oncorhyncus mykiss). PMID:22484927

  13. Capillary electrophoresis combining three-step multiplex polymerase chain reactions for diagnosing α-thalassemia.

    PubMed

    Chen, Yen-Ling

    2011-02-01

    Capillary electrophoresis (CE) is the most useful tool for DNA separation because of its high resolution. In this study, different kinds of polymers were used to evaluate the separation efficiency by analyzing a 200-bp DNA ladder. Under optimized CE conditions, the CE separation was performed by DB-17 capillary. The running buffer was a 1× TBE buffer containing 0.6% w/v poly(ethylene oxide) (PEO) (Mw: 8,000,000) and 1 μM YO-PRO-1; applied voltage was -10 kV (detector at anode side) and the separation temperature was 25°C. Under these optimal conditions, 15 DNA fragments with sizes ranging from 0.2 to 3.0 kb were resolved within 11.5 min and the RSD of migration time were less than 0.55% (n=3). This method, combined with three-step multiplex PCR, was applied to detect five α-thalassemia deletions, including -α(3.7) , -α(4.2) , - -(SEA) , - -(FIL) and - -(THAI) . A total of 21 patients diagnosed with α-thalassemia were analyzed using this developed method and all results agreed with those already obtained by gel electrophoresis. PMID:21298664

  14. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  15. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  16. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  17. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples.

    PubMed

    Tramuta, Clara; Lacerenza, Daniela; Zoppi, Simona; Goria, Mariella; Dondo, Alessandro; Ferroglio, Ezio; Nebbia, Patrizia; Rosati, Sergio

    2011-07-01

    The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion. PMID:21908306

  18. Multipurpose assessment for the quantification of Vibrio spp. and total bacteria in fish and seawater using multiplex real-time polymerase chain reaction

    PubMed Central

    Kim, Ji Yeun; Lee, Jung-Lim

    2014-01-01

    Background This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. Results The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL−1 in pure culture and seawater, and 10 CFU g−1 in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Conclusion Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:24752974

  19. Damage formation and repair efficiency in the p53 gene of cell lines and blood lymphocytes assayed by multiplex long quantitative polymerase chain reaction.

    PubMed

    Wang, Yu-Chieh; Lee, Pei-Jung; Shih, Chuen-Ming; Chen, Hsing-Yu; Lee, Chin-Chu; Chang, Yuan-Yen; Hsu, Yu-Ting; Liang, Ying-Ju; Wang, Li-Ya; Han, Wen-Hua; Wang, Yi-Ching

    2003-08-15

    We examined ultraviolet (UV) irradiation and cisplatin treatment damage formation and repair efficiency in the p53 tumor suppressor gene of various cultured cell lines and lymphocytes using a nonradioactive multiplex long quantitative polymerase chain reaction (QPCR) assay, which amplified a 7-kb fragment of the target gene and a 500-bp fragment of the template control to successfully increase the sensitivity and reliability of the assay. The multiplex long QPCR detected a lesion frequency of 0.63 lesions/10kb/10J/m(2) in the p53 gene of fibroblast cells. In addition, the multiplex long QPCR assay detected pronounced differences in the repair of UV damage in the p53 gene among repair-proficient CRL-1475 cells and repair-deficient XP-A and XP-C cells. The multiplex long QPCR assay was also evaluated as a sensitive assay for the detection of DNA damage induced by cisplatin. The data indicated that the lesion frequency in the p53 gene was 1.27-1.75 times higher in the H23 cisplatin-sensitive cell than in the H1435 cisplatin-resistant cell at the IC(70) dose. After 8-h and 24-h repair periods, only 13 and 75% of cisplatin-induced damage had been removed in the H23 cells, whereas these values were 92 and 100% in the H1435 cells. In addition, our data indicate that multiplex long QPCR is a sensitive method for validly estimating repair in freshly isolated lymphocytes. The results suggest that the current protocol of the multiplex long QPCR method can be used to assess the damage formation and repair efficiency of various agents at biologically relevant doses and to allow a more precise determination of gene-specific repair in disease susceptibility and drug resistance in epidemiological studies. PMID:12871714

  20. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay.

    PubMed

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C

    2016-05-01

    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers. PMID:26836486

  1. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  2. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  3. A preliminary trial using multi-target polymerase chain reaction (multiplex PCR) and restriction fragment length polymorphism (PCR-RFLP) on the same feedstuffs to detect tissues of animal origin.

    PubMed

    Colombo, F; Marchisio, E; Trezzi, I E; Peri, V; Pinotti, L; Baldi, A; Soncini, G

    2004-08-01

    A preliminary study using multi-target polymerase chain reaction (multiplex PCR) and restriction fragment length polymorphism (PCR-RFLP) was done on the same feedstuffs to detect animal tissues. The results of the two methods differ somewhat: PCR-RFLP did not detect any signal in any sample, but multiplex PCR detected a signal in one sample. These findings could be a basis for further investigations. PMID:15509020

  4. Identification of blood meal source and infection with Trypanosoma cruzi of Chagas disease vectors using a multiplex cytochrome b polymerase chain reaction assay.

    PubMed

    Mota, Javier; Chacon, Juan C; Gutiérrez-Cabrera, Ana E; Sánchez-Cordero, Víctor; Wirtz, Robert A; Ordoñez, Rosalinda; Panzera, Francisco; Ramsey, Janine M

    2007-01-01

    Long-term control of triatomine bugs in Chagas endemic regions will depend on a full understanding of vector-parasite-host interactions. Herein we describe a cytochrome b multiplex polymerase chain reaction (PCR)-based strategy for blood meal source identification in bug foregut contents. This technique discriminates human from animal blood, and has been tested in five Triatoma species from México. Host identification has been validated for human, four rodent species, two bat species, dog, rabbit, sheep, and opossum. In addition, Trypanosoma cruzi can be identified simultaneously using S34/S67-specific kinetoplast DNA primers. Both host and parasite identification were possible as long as 10 weeks after bug feeding, and in samples stored up to 6 years. The blood meal identification procedure described here represents a powerful tool for large-scale studies identifying the biological, ecological, and environmental variables associated with Chagas disease transmission. PMID:18021027

  5. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens

    PubMed Central

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-01-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas. PMID:20889890

  6. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    PubMed Central

    Bhat, M. Mansoor; Salahuddin, Mir; Mantoo, Imtiyaz A.; Adil, Sheikh; Jalal, Henna; Pal, M. Ashraf

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating) and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level. PMID:27057103

  7. Quantitation of Bt-176 maize genomic sequences by surface plasmon resonance-based biospecific interaction analysis of multiplex polymerase chain reaction (PCR).

    PubMed

    Feriotto, Giordana; Gardenghi, Sara; Bianchi, Nicoletta; Gambari, Roberto

    2003-07-30

    Surface plasmon resonance (SPR) based biosensors have been described for the identification of genetically modified organisms (GMO) by biospecific interaction analysis (BIA). This paper describes the design and testing of an SPR-based BIA protocol for quantitative determinations of GMOs. Biotinylated multiplex Polymerase Chain Reaction (PCR) products from nontransgenic maize as well as maize powders containing 0.5 and 2% genetically modified Bt-176 sequences were immobilized on different flow cells of a sensor chip. After immobilization, different oligonucleotide probes recognizing maize zein and Bt-176 sequences were injected. The results obtained were compared with Southern blot analysis and with quantitative real-time PCR assays. It was demonstrated that sequential injections of Bt-176 and zein probes to sensor chip flow cells containing multiplex PCR products allow discrimination between PCR performed using maize genomic DNA containing 0.5% Bt-176 sequences and that performed using maize genomic DNA containing 2% Bt-176 sequences. The efficiency of SPR-based BIA in discriminating material containing different amounts of Bt-176 maize is comparable to real-time quantitative PCR and much more reliable than Southern blotting, which in the past has been used for semiquantitative purposes. Furthermore, the approach allows the BIA assay to be repeated several times on the same multiplex PCR product immobilized on the sensor chip, after washing and regeneration of the flow cell. Finally, it is emphasized that the presented strategy to quantify GMOs could be proposed for all of the SPR-based, commercially available biosensors. Some of these optical SPR-based biosensors use, instead of flow-based sensor chips, stirred microcuvettes, reducing the costs of the experimentation. PMID:14705890

  8. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics. PMID:23384180

  9. Isolation and characterization of Shiga toxigenic Escherichia coli of animal and bird origin by multiplex polymerase chain reaction

    PubMed Central

    Neher, S.; Hazarika, A. K.; Barkalita, L. M.; Borah, P.; Bora, D. P.; Sharma, R. K.

    2016-01-01

    Aim: The purpose of this study was to determine the virulence genes and serotype of Shiga toxin producing Escherichia coli (STEC) strains isolated from animals and birds. Materials and Methods: A total of 226 different samples viz., fecal, intestinal content, rectal swab and heart blood were collected from different clinically affected/healthy animals and birds and were streaked on McConkeys’ lactose agar and eosin methylene blue agar for isolation of E. coli, confirmed by staining characteristics and biochemical tests. By polymerase chain reaction (PCR) all the E. coli isolates were screened for certain virulence genes, viz., Shiga toxin 1 (stx1), stx2 and eae and enterohemolytic (Ehly) phenotype was observed in washed sheep blood agar plate. All the isolated E. coli strains were forwarded to the National Salmonella and Escherichia Centre, Central Research Institute, Kasauli (Himachal Pradesh) for serotyping. Results: Out of 226 samples 138 yielded E. coli. All the isolates were screened for molecular detection of different virulent genes, viz. stx1, stx2 and eae, based on which 36 (26.08%) were identified as STEC. Among those STEC isolates, 15 (41.67%), 14 (38.89%), 1 (2.78%) exhibited eae, stx2, stx1 alone, respectively, whereas 4 (11.11%) and 2 (5.56%) carried both stx1 and stx2, stx2 and eae, respectively. Among the STEC isolates 22 were belonged to 15 different sero-groups, viz., O2, O20, O22, O25, O43, O60, O69, O90, O91, O95, O106, O118, O130, O162 and O170 and others were untypable. Ehly phenotype was observed in 10 (27.78%) the STEC isolates. Conclusion: The present study concluded that STEC could be isolated from both clinically affected as well as healthy animals and birds. Regular monitoring of more samples from animal and bird origin is important to identify natural reservoir of STEC to prevent zoonotic infection. PMID:27051196

  10. Simultaneous detection of Pyrethroid, Organophosphate and Cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex Polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans irritans (Linnaeus, 1758), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex...

  11. An integrated slidable and valveless microdevice with solid phase extraction, polymerase chain reaction, and immunochromatographic strip parts for multiplex colorimetric pathogen detection.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Kim, Do Hyun; Seo, Tae Seok

    2015-11-01

    A total integrated genetic analysis microsystem was developed, which consisted of solid phase extraction (SPE), polymerase chain reaction (PCR), and immunochromatographic strip (ICS) parts for multiplex colorimetric detection of pathogenic Staphylococcus aureus (S. aureus) and Escherichia coli O157:H7 (E. coli O157:H7) on a portable genetic analyzer. Utilizing a slidable chamber, which is a movable glass wafer, complex microvalves could be eliminated for fluidic control in the microchannel, which could simplify the chip design and chip operation. The integrated slidable microdevice was composed of 4 layers: a 4-point Pt/Ti resistance temperature detector (RTD) wafer, a micro-patterned channel wafer, a 2 μL volume slidable chamber, and an ICS. The entire process from the DNA extraction in the SPE chamber to the detection of the target gene expression by the ICS was serially performed by simply sliding the slidable chamber from one part to another functional part. The total process for multiplex pathogenic S. aureus and E. coli O157:H7 detection on the integrated slidable microdevice was accomplished within 55 min with a detection limit of 5 cells. Furthermore, spiked bacteria samples in milk were also successfully analysed on the portable genetic analysis microsystem with sample-in-answer-out capability. The proposed total integrated microsystem is adequate for point-of-care DNA testing in that no microvalves and complex tubing systems are required due to the use of the slidable chamber and the bulky and expensive fluorescence or electrochemical detectors are not necessary due to the ICS based colorimetric detection. PMID:26394907

  12. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

    PubMed Central

    Torres, Luciene de Fátima Costa; Ribeiro, Dayana; Hirata, Raphael; Pacheco, Luis Gustavo Carvalho; Souza, Monica Cristina; dos Santos, Louisy Sanches; dos Santos, Cíntia Silva; Salah, Mohammad; da Costa, Mateus Matiuzzi; Ribeiro, Marcio Garcia; Selim, Salah A; Azevedo, Vasco Ariston de Carvalho; Mattos-Guaraldi, Ana Luiza

    2013-01-01

    Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR) assay that can simultaneously identify and determine the toxigenicity of these corynebacterial species with zoonotic potential was developed. This assay uses five primer pairs targeting the following genes: rpoB (Corynebacterium spp), 16S rRNA (C. ulcerans and C. pseudotuberculosis), pld (C. pseudotuberculosis), dtxR (C. diphtheriae) and tox [diphtheria toxin (DT) ]. In addition to describing this assay, we review the literature regarding the diseases caused by these pathogens. Of the 213 coryneform strains tested, the mPCR results for all toxigenic and non-toxigenic strains of C . diphtheriae, C. ulcerans and C. pseudotuberculosis were in 100% agreement with the results of standard biochemical tests and PCR-DT. As an alternative to conventional methods, due to its advantages of specificity and speed, the mPCR assay used in this study may successfully be applied for the diagnosis of human and/or animal diseases caused by potentially toxigenic corynebacterial species. PMID:23778659

  13. A rapid, 2-well, multiplex real-time polymerase chain reaction assay for the detection of SCCmec types I to V in methicillin-resistant Staphylococcus aureus.

    PubMed

    Valvatne, Håvard; Rijnders, Michelle I A; Budimir, Ana; Boumans, Marie-Louise; de Neeling, Albert J; Beisser, Patrick S; Stobberingh, Ellen E; Deurenberg, Ruud H

    2009-12-01

    For us to assess the spread of methicillin-resistant Staphylococcus aureus (MRSA), typing of the staphylococcal cassette chromosome mec (SCCmec) is a valuable addition to existing typing methods, such as multilocus sequence typing (MLST). Traditional SCCmec typing assays, that is, that of Oliveira et al. and Ito et al., are polymerase chain reaction (PCR) based, requiring electrophoresis. We introduce a rapid, 2-well, multiplex real-time PCR assay that can be used directly on bacterial suspensions and is able to characterize SCCmec type I to V based on the detection of the ccr genes and the mec complex. The assay was evaluated on 212 clinical MRSA isolates from various countries, associated with MLST clonal complexes (CC) 1, 5, 8, 22, 30, and 45, as well as pig-associated CC398. When comparing the real-time PCR assay with traditional methods, the correct SCCmec element was identified in 209 (99%) of the 212 MRSA isolates. The new assay enables high-throughput analyses for SCCmec on large strain collections. PMID:19781888

  14. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. PMID:27208471

  15. Detection of β-globin Gene Mutations Among β-thalassaemia Carriers and Patients in Malaysia: Application of Multiplex Amplification Refractory Mutation System–Polymerase Chain Reaction

    PubMed Central

    Hassan, Syahzuwan; Ahmad, Rahimah; Zakaria, Zubaidah; Zulkafli, Zefarina; Abdullah, Wan Zaidah

    2013-01-01

    Background: β-thalassaemia is one of the most common single-gene disorders worldwide. Each ethnic population has its own common mutations, accounting for the majority of cases, with a small number of mutations for the rarer alleles. Due to the heterogeneity of β-thalassaemia and the multi-ethnicity of Malaysians, molecular diagnostics may be expensive and time consuming. Methods: A simple polymerase chain reaction (PCR) approach involving a multiplex amplification refractory mutation system (MARMS) and one amplification refractory mutation system (ARMS), consisting of 20 β-globin gene mutations, were designed and employed to investigate β-thalassaemia patients and carriers. Results: Out of 169 carriers tested with the MARMS, Cd 41/42 (–TTCT), Cd 26 (A–G) HbE, IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 78.1%. Among the Malays, Cd 26 (A–G) HbE, Cd 41/42 (–TTCT), IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 81.4%, whereas Cd 41/42 (–TTCT) and IVS 2–654 (C–T) were most common among the Chinese (79.1%). Conclusion: We propose the use of this cheap, easy to interpret, and simple system for the molecular diagnostics of β-thalassaemia among Malaysians at the Institute for Medical Research (IMR). PMID:23613656

  16. The etiology of genital ulcer disease by multiplex polymerase chain reaction and relationship to HIV infection among patients attending sexually transmitted disease clinics in Pune, India.

    PubMed

    Risbud, A; Chan-Tack, K; Gadkari, D; Gangakhedkar, R R; Shepherd, M E; Bollinger, R; Mehendale, S; Gaydos, C; Divekar, A; Rompalo, A; Quinn, T C

    1999-01-01

    The etiology of genital ulcer disease (GUD) and the relationship between GUD and HIV infection were investigated in 302 patients presenting to a sexually transmitted disease clinic in Pune, India, in a 3-month period in 1994. Swabs of each genital ulcer were tested for herpes simplex virus (HSV) antigen by enzyme immunoassay and processed in a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of HSV, Treponema pallidum, and Haemophilus ducreyi. The seroprevalence of HIV in this series was 22.2%. Clinical diagnosis of GUD was undermined when HIV infection was present. The etiology of GUD according to M-PCR was HSV in 26%, chancroid in 23%, primary syphilis in 10%, and multiple infections in 7%; no etiology could be identified in the remaining 34% of cases. Attempts to differentiate the etiology of GUD based solely on clinical grounds resulted in many inaccurate diagnoses. Chancroid was the most common clinical diagnosis (40%), followed by HSV (24%), syphilis (20%), and multiple infections (3%). HIV seroprevalence was significantly higher in patients with HSV compared with other etiologies (odds ratio, 2.1; 95% confidence interval, 1.2-3.7), presumably as a result of HIV-induced immunosuppression and consequent HSV reactivation. Until rapid, inexpensive, and sensitive assays become available, syndromic treatment with antibiotics should be provided to patients with GUD in order to reduce the risk of acquiring HIV infection. PMID:9918324

  17. Simultaneous genotyping of CYP2D6*3, *4, *5 and *6 polymorphisms in a Spanish population through multiplex long polymerase chain reaction and minisequencing multiplex single base extension analysis.

    PubMed

    Crescenti, A; Mas, S; Gassó, P; Baiget, M; Bernardo, M; Lafuente, A

    2007-10-01

    1. The aim of the present study was to perform a descriptive study of the prevalence of the four major CYP2D6 poor metaboliser (PM) alleles (*3, *4, *5 and *6) in a Spanish population (n = 290) using a method based on a new combination of multiplex long polymerase chain reaction (PCR) and minisequencing through multiplex single base extension (SBE) analysis. 2. The method was validated using different strategies, such as allelic discrimination assay and PCR-restriction fragment length polymorphism (RFLP). 3. The allele frequencies were similar to those described for other Spanish populations, namely 0.9% (95% confidence interval (CI) 0.5-1.3), 16.4% (95% CI 14.9-18.0), 2.7% (95% CI 2.0-3.4) and 0.7% (95% CI 0.3-1.0) for the *3, *4, *5 and *6 alleles, respectively. The results were satisfactory and left little doubt as to the genotypes, which were confirmed either by allelic discrimination assay (*4 and *6) or PCR-RFLP (*3) with 100% concordance. 4. The present study corroborates the low prevalence of the most frequent polymorphism (CYP2D6*4) that leads to null CYP2D6 activity in Spain and the allelic geographical gradient between Caucasian populations in the north and south. The present study reports a technique for the detection of four polymorphisms that account for 98% of the CYP2D6 defect alleles. This multiplex long PCR-SBE technique is a combination of several known methods to genotype CYP2D6 alleles (*3, *4, *5 and*6). Given the importance of CYP2D6 in drug metabolism and the need to genotype a large number of samples, we believe that this method will find broad application. PMID:17714084

  18. Pathotypic and Phylogenetic Study of Diarrheagenic Escherichia coli and Uropathogenic E. coli Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Salmani, Hamzeh; Azarnezhad, Asaad; Fayazi, Mohammad Reza; Hosseini, Arshad

    2016-01-01

    Background: Acute diarrheal disease and urinary tract infection are leading causes of childhood morbidity and mortality in the developing world. Diarrheagenic Escherichia coli (DEC) has been identified as a major etiologic agent of diarrhea worldwide, and urinary tract infection (UTI) caused by uropathogenic Escherichia coli (UPEC) is one of the most common bacterial infections among human beings. Quick and precise detection of these bacteria help provide more effective intervention and management of infection. Objectives: In this study we present a precise and sensitive typing and phylogenetic study of UPEC and DEC using multiplex PCR in order to simplify and improve the intervention and management of diarrheal and UT infections. Materials and Methods: In total, 100 urinary tract infection samples (UTI) and 200 specimens from children with diarrhea, which had been diagnosed with E. coli as the underlying agent by differential diagnosis using MacConkey’s agar and biochemical study, were submitted for molecular detection. Pathotyping of E. coli pathotypes causing urinary tract infection and diarrhea were examined using a two set multiplex PCR, targeting six specific genes. Phylogenetic typing was done by targeting three genes, including ChuA, YjaA and TspE4C2. Results: Overall, 88% of DEC and 54% of UTI isolates were positive for one or more of the six genes encoding virulence factors. Prevalence of the genes encoding virulence factors for DEC were 62%, 25%, 24%, 13%, 7% and 5% for ST (ETEC), LT (ETEC), aggR (EAggEC), daaD (DAEC), invE (EIEC) and eae (EPEC), respectively; whereas, the prevalence rates for the UTI samples were 23%, 14%, 6%, 6% and 4% for aggR (EAggEC), LT (ETEC), daaD (DAEC), invE (EIEC) and ST (ETEC), respectively. No coding virulence factors were detected for eae (EPEC). Group B2 was the most prevalent phylogroup and ST was the most frequently detected pathotype in all phylogroups. Conclusions: ETEC and EAggEC were the most detected E. coli among

  19. Multiplex polymerase chain reaction for the detection and differentiation of avian influenza viruses and other poultry respiratory pathogens.

    PubMed

    Rashid, S; Naeem, K; Ahmed, Z; Saddique, N; Abbas, M A; Malik, S A

    2009-12-01

    A multiplex reverse transcription-PCR (mRT-PCR) was developed and standardized for the detection of type A influenza viruses, avian influenza virus (AIV) subtype H7, H9, and H5 hemagglutinin gene with simultaneous detection of 3 other poultry respiratory pathogens, Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and infectious laryngotracheitis virus (ILTV). Seven sets of specific oligonucleotide primers were used in this study for the M gene of AIV and hemagglutinin gene of subtypes H7, H9, and H5 of AIV. Three sets of other specific oligonucleotide primers were used for the detection of avian respiratory pathogens other than AIV. The mRT-PCR DNA products were visualized by agarose gel electrophoresis and consisted of DNA fragments of 1,023 bp for M gene of AIV, 149 bp for IBV, 320 bp for NDV, and 647 bp for ILTV. The second set of primers used for m-RT-PCR of H7N3, H9N2, and H5N1 provided DNA products of 300 bp for H7, 456 bp for H5, and 808 bp for H9. The mRT-PCR products for the third format consisted of DNA fragments of 149 bp for IBV, 320 bp for NDV, 647 bp for ILTV, 300 bp for H7, 456 bp for H5, and 808 bp for H9. The sensitivity and specificity of mRT-PCR was determined and the test was found to be sensitive and specific for the detection of AIV and other poultry respiratory pathogens. In this present study, multiplex PCR technique has been developed to simultaneously detect and differentiate the 3 most important subtypes of AIV along with the 3 most common avian respiratory pathogens prevalent in poultry in Pakistan. Therefore, a mRT-PCR that can rapidly differentiate between these pathogens will be very important for the control of disease transmission in poultry and in humans, along with the identification of 3 of the most common respiratory pathogens often seen as mixed infections in poultry, and hence economic losses will be reduced in poultry. PMID:19903950

  20. Genotyping of Pseudomonas aeruginosa Type III Secretion System Using Magnetic Enrichment Multiplex Polymerase Chain Reaction and Chemiluminescence.

    PubMed

    Tang, Yongjun; Li, Bo; Dai, Jianguo; Dai, Jianfang; Wang, Xinhui; Si, Jing; Ali, Zeeshan; Li, Taotao; He, Nongyue

    2016-04-01

    The pathologic characteristics and toxicity mechanism of Pseudomonas aeruginosa are different in strains with different Type III secretion system (T3SS) genes. The T3SS gene based genotyping of P. aeruginosa strains is important to understand its virulence and predict the clinical outcomes. In this study, a rapid and automatable method for T3SS genotyping was developed using magnetic enrichment multiplex PCR and chemiluminescence. Three P. aeruginosa standard strains were analyzed using this method. The results showed that the chemiluminescent intensity of exoT, exoY, and exoS of these strains were 10 times greater than that of the control, and that their Q values were greater than 2.1. These results were consistent with the regular PCR and electrophoresis results, indicating that the method was reliable. Out of the 22 clinical isolates tested using this method, 100%, 72.7%, 95.5%, and 4.5% of the isolates contained exoT, exoY, exoS, and exoU genes, respectively. The isolates harbored either exoS or exoU gene, but not both. All genotyping results of the isolates were consistent with the information obtained using regular PCR and electrophoresis. PMID:27301202

  1. Development of a multiplex polymerase chain reaction for the simultaneous detection of microsporidians, nucleopolyhedrovirus, and densovirus infecting silkworms.

    PubMed

    Ravikumar, G; Raje Urs, S; Vijaya Prakash, N B; Rao, C G P; Vardhana, K V

    2011-07-01

    We have developed a novel PCR-based assay for individual and simultaneous detection of three major pathogens (microsporidians, nucleopolyhedrovirus (NPV) and densovirus (DNV)) infecting the silkworm, Bombyx mori. Multiplex PCR, using three primer pairs, two of which were designed from the conserved regions of 16S small subunit ribosomal RNA gene of microsporidians, and polyhedrin gene of NPVs respectively, and a third primer pair designed from the internal sequences of B. mori DNVs (BmDNV), showed discrete and pathogen specific PCR products. The assay showed high specificity and sensitivity for the pathogenic DNA. Under optimized PCR conditions, the assay yielded a 794bp DNA fragment from Nosema bombycis, 471bp fragment from B. mori NPV (BmNPV) and 391bp fragment from BmDNV. Further, this detection method was successfully applied to other silkworm species such as Antheraea mylitta and Samia cynthia ricini, in detecting same or similar pathogens infecting them. This method is a valuable supplement to the conventional microscopic diagnostic methods and can be used for the early detection of pathogens infecting silkworms. Furthermore it can assist research and extension centers for the safe supply of disease-free silkworms to farmers. PMID:21570404

  2. Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran

    PubMed Central

    Yamoudy, Mahire; Mirlohi, Maryam; Isfahani, Bahram Nasr; Jalali, Mohammad; Esfandiari, Zahra; Hosseini, Nafiseh Sadat

    2015-01-01

    Background: Since 2003, the incidence of community associated Clostridium difficile infection (CA-CDI) has increased; different types of food have been supposed to be the vectors of C. difficile strains. The purpose of this study is to investigate the occurrence of C. difficile strains in ready-to-eat salads distributed in food services. Materials and Methods: A total of 106 ready-made salad specimens were sampled from different restaurants and food services located in Isfahan, in the center of Iran. Positive isolates of C. difficile were identified and confirmed for the existence of three genes including tpi, tcdA and tcdB by multiplex PCR. Results: A total of six (5.66%) samples were positive for C. difficile strains. Of which, one strain (16.6%) was positive for A and B toxins. Conclusion: The existence of toxigenic C. difficile in ready-made salads could be a caution for public health. Further investigation is required to assess the relationship between the isolated strains in our study and those from diarrheic patients through molecular typing. PMID:26015913

  3. Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

    PubMed

    Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

    2014-05-19

    A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines. PMID:24842287

  4. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-01

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences. PMID:26669715

  5. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    PubMed

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  6. Fixed nuclei as alternative template of BIOMED-2 multiplex polymerase chain reaction for immunoglobulin gene clonality testing in B-cell malignancies

    PubMed Central

    Tang, Yuan; Chen, Jie; Wang, Jianchao; Zheng, Ke; Liao, Dianying; Liao, Xiaomei; Liu, Weiping; Wang, Lin

    2015-01-01

    Evaluation of immunoglobulin (Ig) gene rearrangements with BIOMED-2 multiplex PCR has become a standard detection of clonality in mature B cell malignancies. Conventionally, this method is relatively labor-intensive and time-consuming, as it requires DNA isolation from bone marrow aspirates (BM) or peripheral blood (PB) in patients with BM or PB involvement. On the other hand, fluorescence in situ hybridization (FISH) is routinely used as genetic screening in B cell malignancies, but the surplus fixed nuclei initially prepared for FISH usually turn useless afterwards. We sought to use these surplus nuclei after FISH as a template to perform PCR-based Ig gene clonality testing. Templates of 12 patients with mature B cell malignancies, which consisted of both DNA isolated with commercial DNA isolation kit from fresh BM or PB (DNA group) and the fixed nuclei initially prepared for FISH (nuclei group) from the same individuals, were subjected to PCR with BIOMED-2 primer sets for immunoglobulin heavy chain and kappa light chain under recommended conditions. Our result, for the first time, showed a high consistency between the two groups in detecting B cell clonality, which indicates that nuclei for FISH can function as a reliable template comparable to fresh tissue-isolated DNA in PCR based Ig clonality testing. This offers a simple, rapid and more economical alternative to standard Ig testing based on regular DNA. PMID:27069754

  7. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations. PMID:23345271

  8. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    PubMed Central

    Khairnar, Krishna; Parija, Subhash C

    2007-01-01

    Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive) that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific). The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens. PMID:17524135

  9. Frequency of Pathogenic Paediatric Bacterial Meningitis in Mozambique: The Critical Role of Multiplex Real-Time Polymerase Chain Reaction to Estimate the Burden of Disease

    PubMed Central

    Nhantumbo, Aquino Albino; Cantarelli, Vlademir Vicente; Caireão, Juliana; Munguambe, Alcides Moniz; Comé, Charlotte Elizabeth; Pinto, Gabriela do Carmo; Zimba, Tomás Francisco; Mandomando, Inácio; Semá, Cynthia Baltazar; Dias, Cícero; Moraes, Milton Ozório; Gudo, Eduardo Samo

    2015-01-01

    Background In Sub-Saharan Africa, including Mozambique, acute bacterial meningitis (ABM) represents a main cause of childhood mortality. The burden of ABM is seriously underestimated because of the poor performance of culture sampling, the primary method of ABM surveillance in the region. Low quality cerebrospinal fluid (CSF) samples and frequent consumption of antibiotics prior to sample collection lead to a high rate of false-negative results. To our knowledge, this study is the first to determine the frequency of ABM in Mozambique using real-time polymerase chain reaction (qPCR) and to compare results to those of culture sampling. Method Between March 2013 and March 2014, CSF samples were collected at 3 regional hospitals from patients under 5 years of age, who met World Health Organization case definition criteria for ABM. Macroscopic examination, cytochemical study, culture, and qPCR were performed on all samples. Results A total of 369 CSF samples were collected from children clinically suspected of ABM. qPCR showed a significantly higher detection rate of ABM-causing pathogens when compared to culture (52.3% [193/369] versus 7.3% [27/369], p = 0.000). The frequency of Streptococcus pneumoniae, Haemophilus influenzae, group B Streptococci, and Neisseria meningitidis were 32.8% (121⁄369), 12.2%, (45⁄369), 3.0% (16⁄369) and 4.3% (11⁄369), respectively, significantly higher compared to that obtained on culture (p < 0.001 for each). Conclusion Our findings demonstrate that culture is less effective for the diagnosis of ABM than qPCR. The common use of culture rather than qPCR to identify ABM results in serious underestimation of the burden of the disease, and our findings strongly suggest that qPCR should be incorporated into surveillance activities for ABM. In addition, our data showed that S. pneumoniae represents the most common cause of ABM in children under 5 years of age. PMID:26393933

  10. O Serogroup-Specific Touchdown-Multiplex Polymerase Chain Reaction for Detection and Identification of Vibrio cholerae O1, O139, and Non-O1/Non-O139

    PubMed Central

    Siriphap, Achiraya; Khamsuwan, Nutsarin; Borthong, Jednipit; Chonsin, Kaknokrat

    2014-01-01

    A novel, sensitive locus-specific touchdown-multiplex polymerase chain reaction (TMPCR), which is based on two-stage amplification pertaining to multiplex PCR and conditional touchdown strategy, was used in detecting and differentiating Vibrio cholerae serogroups. A panel of molecular marker-based TMPCR method generates reproducible profiles of V. cholerae-specific (588 bp) amplicons derived from ompW gene encoding the outer membrane protein and serogroup-specific amplicons, 364 bp for the O1 and 256 bp for the O139, authentically copied from rfb genes responsible for the lipopolysaccharide biosynthesis. The TMPCR amplification efficiency yields either equally or unequally detectable duplex DNA bands of the O1 (588 and 364 bp) and O139 (588 and 256 bp) or a DNA fragment of non-O1/non-O139 (588 bp) while providing no false positive identifications using the genomic DNA templates of the other vibrios and Enterobacteriaceae. The reciprocal analysis of two-template combinations demonstrated that, using V. cholerae O1, O139, or equally mixed O1 and O139, the TMPCR had a detection limit of as low as 100 pg of the O1, O139, or non-O1/non-O139 in reactions containing unequally or equally mixed gDNAs. In addition, the O serogroup-specific TMPCR method had 100% agreement with the serotyping method when examined for the serotyped V. cholerae reference strains and those recovered from clinical samples. The potential benefit of using this TMPCR tool would augment the serotyping method used in epidemiological surveillance and monitoring of V. cholerae serogroups, O1, O139, and non-O1/non-O139 present in clinical and environmental samples. PMID:25614837

  11. The prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs in Nueva Ecija, Philippines based on multiplex polymerase chain reaction (mPCR) assay.

    PubMed

    Corales, Joyce Marielle I; Viloria, Victoria V; Venturina, Virginia M; Mingala, Claro N

    2014-01-01

    The aim of the study was to determine the prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs. It describes the practice of veterinarians in detecting tick-borne diseases in Nueva Ecija, Philippines. Seventy blood samples were collected and were subjected to multiplex PCR for the detection of E. canis, Babesia spp. and A. platys. The prevalence of babesiosis is the highest in Cabanatuan City (2/10), while a 10% prevalence (1/10) was observed in Science City of Muñoz, Talavera and Sta. Rosa. E. canis were only detected in Cabanatuan City. However, no anaplasmosis was detected in any area. The prevalence of babesiosis and ehrlichiosis in Nueva Ecija is 7.14% (5/70) and 2.85% (2/70) respectively. In addition, 70% (7/10) of the Nueva Ecija veterinary practitioners encountered cases of suspected ehrlichiosis in their practice. The diagnosis of ehrlichiosis is based primarily on presented clinical signs and complete blood counts, which include a platelet count. Of the 10 respondents, half utilized test kits while 90% interpreted blood samples. Meanwhile, only 60% of the respondents used an ELISA test kit for ehrlichiosis. For some practitioners, the main reason for not utilizing a kit is the high cost. None of the respondents had previously attended cases of suspected anaplasmosis. Only one respondent diagnosed a case of babesiosis by blood smear microscopy. PMID:25706424

  12. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    PubMed

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. PMID:25776540

  13. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  14. Polymerase Chain Reaction for Educational Settings.

    ERIC Educational Resources Information Center

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  15. Presence of Shiga toxin-producing Escherichia coli O-groups in small and very-small beef-processing plants and resulting ground beef detected by a multiplex polymerase chain reaction assay.

    PubMed

    Svoboda, Amanda L; Dudley, Edward G; Debroy, Chitrita; Mills, Edward W; Cutter, Catherine N

    2013-09-01

    Shiga toxin-producing Escherichia coli (STEC) are associated with foodborne illnesses, including hemolytic uremic syndrome in humans. Cattle and consequently, beef products are considered a major source of STEC. E. coli O157:H7 has been regulated as an adulterant in ground beef since 1996. The United States Department of Agriculture Food Safety and Inspection Service began regulating six additional STEC (O145, O121, O111, O103, O45, and O26) as adulterants in beef trim and raw ground beef in June 2012. Little is known about the presence of STEC in small and very-small beef-processing plants. Therefore, we propose to determine whether small and very-small beef-processing plants are a potential source of non-O157:H7 STEC. Environmental swabs, carcass swabs, hide swabs, and ground beef from eight small and very-small beef-processing plants were obtained from October 2010 to December 2011. A multiplex polymerase chain reaction assay was used to determine the presence of STEC O-groups: O157, O145, O121, O113, O111, O103, O45, and O26 in the samples. Results demonstrated that 56.6% (154/272) of the environmental samples, 35.0% (71/203) of the carcass samples, 85.2% (23/27) of the hide samples, and 17.0% (20/118) of the ground beef samples tested positive for one or more of the serogroups. However, only 7.4% (20/272) of the environmental samples, 4.4% (9/203) of the carcass samples, and 0% (0/118) ground beef samples tested positive for both the serogroup and Shiga toxin genes. Based on this survey, small and very-small beef processors may be a source of non-O157:H7 STEC. The information from this study may be of interest to regulatory officials, researchers, public health personnel, and the beef industry that are interested in the presence of these pathogens in the beef supply. PMID:23742295

  16. Colony Polymerase Chain Reaction with Schizosaccharomyces pombe.

    PubMed

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-01-01

    When screening a large number of individual Schizosaccharomyces pombe strains by polymerase chain reaction (PCR), a rapid "colony PCR" approach may be used. Numerous colony PCR protocols are available, and fundamental to them all is that the colony must be fresh (grown overnight) and that as few cells as possible are used. In this protocol, we present three reliable methods for preparing S. pombe cells for colony PCR. PMID:27140919

  17. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    PubMed Central

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  18. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase.

    PubMed

    McInerney, Peter; Adams, Paul; Hadi, Masood Z

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  19. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGESBeta

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  20. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    ERIC Educational Resources Information Center

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  1. Methylation-sensitive polymerase chain reaction.

    PubMed

    Moore, Hannah R; Meehan, Richard R; Young, Lorraine E

    2006-01-01

    Here, we describe a robust and reproducible methylation-sensitive polymerase chain reaction (MS-PCR) method to detect the percentage methylation in repeat sequences of individual pre-implantation ovine embryos produced by different embryo technologies. This method allows the comparison of embryos produced by nuclear transfer with other production and embryo culture methods, accounting for the heterogeneity between embryos within a single treatment. DNA extracted from single embryos is digested with a methylation-sensitive restriction enzyme to determine the percentage methylation after PCR amplification in comparison with an undigested control. The undigested control represents 100% methylation because methylation-sensitive enzymes do not cut methylated DNA, allowing the entire sample to be amplified by PCR. Image analysis quantification of the digested subsample PCR product on an ethidium bromide-stained agarose gel is proportional to the amount of methylated DNA in each embryo. By comparing quadruplicate values obtained for each embryo against a standard curve, we are able to ensure the validity of our results for each individual embryo. Compared with bisulphite sequencing methods, the method described is rapid, inexpensive, and relatively high-throughput. PMID:16761730

  2. Integrated polymerase chain reaction/electrophoresis instrument

    DOEpatents

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  3. Review of Detection of Brucella sp. by Polymerase Chain Reaction

    PubMed Central

    Yu, Wei Ling; Nielsen, Klaus

    2010-01-01

    Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

  4. Development and application of a hexaplex reverse transcription polymerase chain reaction for screening global citrus tristeza virus isolates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The discovery of the diversity of Citrus tristeza virus (CTV) genotypes has complicated detection and diagnostic measures. To simplify the identification and differentiation of CTV genotypes, an efficient multiplex reverse transcription polymerase chain reaction (M-RT-PCR) technique for the screenin...

  5. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  6. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    PubMed

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. PMID:25197027

  7. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients

    PubMed Central

    Seekhuntod, Sirirat; Thavarungkul, Paninee; Chaichanawongsaroj, Nuntaree

    2016-01-01

    Background Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR) inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC). The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR) assay to detect KRAS mutations. Methods We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D). We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE) colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay. Results Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%), G12D (25.83%) and G12V (12.50%) in codon 12. Conclusion The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues. PMID:26812617

  8. A noncontact temperature measurement method in polymerase chain reaction reactors

    NASA Astrophysics Data System (ADS)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  9. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  10. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  11. Multiplexed miRNA northern blots via hybridization chain reaction

    PubMed Central

    Schwarzkopf, Maayan; Pierce, Niles A.

    2016-01-01

    Northern blots enable detection of a target RNA of interest in a biological sample using standard benchtop equipment. miRNAs are the most challenging targets as they must be detected with a single short nucleic acid probe. With existing approaches, it is cumbersome to perform multiplexed blots in which several RNAs are detected simultaneously, impeding the study of interacting regulatory elements. Here, we address this shortcoming by demonstrating multiplexed northern blotting based on the mechanism of hybridization chain reaction (HCR). With this approach, nucleic acid probes complementary to RNA targets trigger chain reactions in which fluorophore-labeled DNA hairpins self-assemble into tethered fluorescent amplification polymers. The programmability of HCR allows multiple amplifiers to operate simultaneously and independently within a blot, enabling straightforward multiplexing. We demonstrate simultaneous detection of three endogenous miRNAs in total RNA extracted from 293T and HeLa cells. For a given target, HCR signal scales linearly with target abundance, enabling relative and absolute quantitation. Using non-radioactive HCR, sensitive and selective miRNA detection is achieved using 2′OMe-RNA probes. The HCR northern blot protocol takes ∼1.5 days independent of the number of target RNAs. PMID:27270083

  12. Multiplexed miRNA northern blots via hybridization chain reaction.

    PubMed

    Schwarzkopf, Maayan; Pierce, Niles A

    2016-09-01

    Northern blots enable detection of a target RNA of interest in a biological sample using standard benchtop equipment. miRNAs are the most challenging targets as they must be detected with a single short nucleic acid probe. With existing approaches, it is cumbersome to perform multiplexed blots in which several RNAs are detected simultaneously, impeding the study of interacting regulatory elements. Here, we address this shortcoming by demonstrating multiplexed northern blotting based on the mechanism of hybridization chain reaction (HCR). With this approach, nucleic acid probes complementary to RNA targets trigger chain reactions in which fluorophore-labeled DNA hairpins self-assemble into tethered fluorescent amplification polymers. The programmability of HCR allows multiple amplifiers to operate simultaneously and independently within a blot, enabling straightforward multiplexing. We demonstrate simultaneous detection of three endogenous miRNAs in total RNA extracted from 293T and HeLa cells. For a given target, HCR signal scales linearly with target abundance, enabling relative and absolute quantitation. Using non-radioactive HCR, sensitive and selective miRNA detection is achieved using 2'OMe-RNA probes. The HCR northern blot protocol takes ∼1.5 days independent of the number of target RNAs. PMID:27270083

  13. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    SciTech Connect

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  14. Rapid Differentiation and Identification of Potential Severe Strains of Citrus tristeza Virus by Real-Time Reverse Transcription Polymerase Chain Reaction Assays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multiplex Taqman®-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to detect all strains of Citrus tristeza virus (CTV) and to identify potentially severe strains of the virus. A CTV TaqMan probe (CTV-CY5) based on the coat protein (CP) gene sequences...

  15. Methods in molecular cardiology: the polymerase chain reaction

    PubMed Central

    Sonnemans, D.G.P.; de Windt, L.J.; de Muinck, E.D.; Doevendans, P.A.

    2002-01-01

    Several polymerase chain reaction (PCR) techniques are described in this review to give insight into the potential applications for cardiovascular research. Although PCR can be performed in several ways, all applications are based on the same general principle, the amplification of DNA or RNA by the enzyme polymerase. This amplification provides the opportunity to detect, identify and multiply a single copy of DNA or RNA, in or outside the cell. This powerful technique can be used in several directions of DNA and RNA research resulting in the ability to specifically detect the presence and activity of genes. The use of these techniques in cardiovascular research is discussed here. ImagesFigure 1Figure 2Figure 4Figure 5Figure 6Figure 7Figure 8Figure 9 PMID:25696037

  16. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  17. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods. PMID:26843052

  18. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  19. MEN2A carrier detection by combined polymerase chain reaction and ligase chain reaction (PCR/LCR) techniques

    SciTech Connect

    Wilson, V.L.; Wel, Q.; Danielson, M.S.

    1994-09-01

    Multiple endocrine neoplasia type 2A (MEN2A) is a dominantly inherited cancer syndrome that is characterized by medullary thyroid carcinoma, parathyroid hyperplasia and phaeoachromocytoma. MEN2A predisposing mutations have been shown to occur in the conserved cysteine rich extracellular domain of the ret proto-oncogene. Thus far, only five separate codons, C609, C611, C618, C620, and C634, each coding for cysteine residues in exons 10 and 11 of the human ret gene, have been associated with MEN2A. Direct analyses of all five of these codon sequences was performed by a combination of polymerase chain reaction (PCR) and ligase chain reaction (LCR) techniques. Genomic DNA was initially amplified with PCR primers surrounding the sequences of exons 10 and 11. Using a multiplex LCR reaction, and resolving the products on a 7 M urea, 10% polyacrylamide gel, the presence of a T{yields}C base substitution was immediately identified according to size. We have used these techniques to identify the prediposing mutation in genomic DNA from the proband of a MEN2A family and subsequently demonstrated the inheritance pattern of this same base substitution mutation in the rest of the family. These PCR/LCR techniques provide a rapid MEN2A detection scheme.

  20. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    PubMed Central

    Kwon, Ji Yeon; Ryu, Ki Hyun; Choi, Sun Hee

    2013-01-01

    A detection system based on a multiplex reverse transcription (RT) polymerase chain reaction (PCR) was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV), lily mottle virus (LMoV), lily symptomless virus (LSV). Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV) by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility. PMID:25288961

  1. Convective polymerase chain reaction around micro immersion heater

    NASA Astrophysics Data System (ADS)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  2. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    PubMed

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  3. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  4. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    PubMed Central

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  5. Polymerase chain reaction in rapid diagnosis of neonatal sepsis.

    PubMed

    Yadav, Ashok K; Wilson, C G; Prasad, P L; Menon, P K

    2005-07-01

    In a prospective study a total of hundred neonates who fulfilled the American College of Obstetrics and Gynecology's (ACOG) criteria for probable sepsis admitted to NICU of tertiary care armed forces hospital were investigated for evidence of sepsis. The investigation protocol included sepsis screen, blood culture and 1 mL of venous blood for molecular analysis by polymerase chain reaction (PCR) for bacterial DNA component encoding 16 s RNA in all cases. 100 newborns with probable sepsis were studied to evaluate the molecular diagnosis of sepsis using PCR amplification of 16 S RNA in newborns with risk factors for sepsis or those who have clinical evidence of sepsis. We compared the results of PCR with blood culture and other markers of sepsis screen (total leucocyte count (TLC), absolute neutrophil count (ANC), immature/total neutrophil count ratio (I/T ratio), peripheral blood smear, micro ESR and C reactive protein (CRP). Controls consisted of 30 normal healthy newborns with no overt evidence of sepsis. Sepsis screen was positive in 24 (24%) of cases in study group with sensitivity and specificity of 100% and 83.5% respectively. Blood culture was positive in 09(9%t) with sensitivity of 69.2% and specificity of 100%. PCR was positive in 13(13%) of cases (9% are both blood culture and sepsis screen positive and 4% are positive by sepsis screen); the sensitivity of PCR was 100% and specificity was 95.6%. Blood culture is the most reliable method for diagnosis of neonatal sepsis. Polymerase chain reaction is useful and superior to blood culture for early diagnosis of sepsis in neonates. PMID:16085969

  6. Effects of Upconversion Nanoparticles on Polymerase Chain Reaction

    PubMed Central

    Hwang, Sang-Hyun; Im, Su-Gyeong; Hah, Sang Soo; Cong, Vu Thanh; Lee, Eun Jeong; Lee, Yeon-Su; Lee, Geon Kook

    2013-01-01

    Nanoparticles (NPs) are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs), which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR) specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix) and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit). Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C–45°C), addition of the 40 nm UCNP (1 µg/µL) to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation. PMID:24039935

  7. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

    PubMed Central

    Lorenz, Todd C.

    2012-01-01

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: ● Set up reactions and thermal cycling

  8. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    PubMed

    Lorenz, Todd C

    2012-01-01

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  9. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease.

    PubMed

    Khalil, S H; Siegrist, K; Akhtar, M

    1997-07-01

    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  10. Application of the polymerase chain reaction to detect fowl adenoviruses.

    PubMed Central

    Jiang, P; Ojkic, D; Tuboly, T; Huber, P; Nagy, E

    1999-01-01

    The possibility of using the polymerase chain reaction (PCR) for the detection of fowl adenoviruses (FAdV) was tested. The optimal reaction parameters were evaluated and defined for purified genomic DNA of type 8 fowl adenovirus (FAdV-8), and then the same conditions were applied for nucleic acid extracted from infected cells. One hundred picograms of purified viral DNA, or 250 FAdV-8-infected cells, were detected by ethidium bromide staining of the PCR products in agarose gels. The sensitivity was increased to 10 pg purified viral DNA, or 25 infected cells, when the PCR products were hybridized with a specific labeled probe. Several field isolates of FAdV and the CELO virus (FAdV serotype 1) could be amplified by the same primers and conditions, but the size of the amplicons was smaller than that for the FAdV-8 PCR product. Other avian viruses and uninfected cell cultures tested negative. Images Figure 2. Figure 3. Figure 4. PMID:10369570

  11. Taylor dispersion in polymerase chain reaction in a microchannel

    NASA Astrophysics Data System (ADS)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav

    2008-09-01

    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  12. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction.

    PubMed

    Uphoff, Cord C; Drexler, Hans G

    2011-01-01

    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  13. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    PubMed

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. PMID:26130622

  14. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  15. Identifying of meat species using polymerase chain reaction (PCR)

    SciTech Connect

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  16. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  17. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    SciTech Connect

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  18. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  19. A Consensus on Fungal Polymerase Chain Reaction Diagnosis?

    PubMed Central

    White, P. Lewis; Barton, Richard; Guiver, Malcolm; Linton, Christopher J.; Wilson, Steve; Smith, Melvyn; Gomez, Beatriz L.; Carr, Michael J.; Kimmitt, Patrick T.; Seaton, Shila; Rajakumar, Kumar; Holyoake, Tessa; Kibbler, Chris C.; Johnson, Elizabeth; Hobson, Richard P.; Jones, Brian; Barnes, Rosemary A.

    2006-01-01

    The limitations of classical diagnostic methods for invasive fungal infections (IFIs) have led to the development of molecular techniques to aid in the detection of IFIs. Despite good published performance, interlaboratory reproduction of these assays is variable, and no consensus has been reached for an optimal method. This publication describes the first multicenter study of polymerase chain reaction methods, for the detection of Aspergillus and Candida species, currently used in the UK and Ireland by distribution and analysis of multiple specimen control panels. All three Candida methods were comparable, achieving a satisfactory level of detection (10 cfu), and the method of preference was dependent on the requirements of the particular laboratory. The results for the five Aspergillus assays were more variable, but two methods (2Asp and 4Asp) were superior (101 conidia). Formally, the overall performances of the two Aspergillus assays were comparable (κ statistic = 0.77). However, on the Roche LightCycler, there was a clear sample-type effect that greatly reduced the detection limit of the 4Asp method when testing whole blood samples. Therefore, the preferred Aspergillus method relied on the amplification platform available to the user. This study represents the initial process to achieve a consensus method for the diagnosis of IFIs. PMID:16825512

  20. Pouched Rats' Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

    PubMed Central

    Mahoney, Amanda; Weetjens, Bart J.; Cox, Christophe; Beyene, Negussie; Reither, Klaus; Makingi, George; Jubitana, Maureen; Kazwala, Rudovick; Mfinanga, Godfrey S.; Kahwa, Amos; Durgin, Amy; Poling, Alan

    2012-01-01

    Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis) of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%), and the mean specificity was 87.3% (range 84.7–90.3%). Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries. PMID:22848808

  1. Diagnosis of Whooping Cough in Switzerland: Differentiating Bordetella pertussis from Bordetella holmesii by Polymerase Chain Reaction

    PubMed Central

    Pittet, Laure F.; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M.

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001−, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447

  2. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    PubMed

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447

  3. Touchdown polymerase chain reaction detection of polycystic kidney disease and laboratory findings in different cat populations.

    PubMed

    Scalon, Marcela C; da Silva, Thamiris F; Aquino, Larissa C; Carneiro, Filipe T; Lima, Maíra G da M; Lemos, Marcelle Dos S; Paludo, Giane R

    2014-06-10

    Autosomal-dominant polycystic kidney disease (ADPKD) is the most prevalent inherited genetic disease of cats, predominantly affecting Persian and Persian-related cats. A point mutation (C→A transversion) in exon 29 of the PKD1 gene causes ADPKD, and is the specific molecular target for genetic diagnosis in cats. The current study describes a newly developed touchdown polymerase chain reaction (PCR) to detect this single point mutation, using 2 primers specific for the mutant allele, adapted from an existing multiplex amplification refractory mutation system (ARMS PCR). Furthermore, correlations between the clinical outcomes of tested animals and the results of the genetic test were investigated. A total of 334 cats were tested, 188 from the Veterinary Hospital of Small Animals at the University of Brasilia, and 146 from an anti-rabies vaccine campaign of the Federal District. A total prevalence of 9% was evident among the samples, with 33% of the Persian cats testing positive, and 7% of the Brazilian long- and shorthaired cats testing positive. Prevalence was not correlated with gender or hemogram. Positive animals exhibited hyperglobulinemia (P = 0.02). This research demonstrated that the mutation does not only occur in Persian and Persian-related cats, and that a touchdown PCR can be used to diagnose ADPKD. PMID:24916445

  4. Trends and advances in food analysis by real-time polymerase chain reaction.

    PubMed

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  5. Leptospirosis diagnosis by immunocapture polymerase chain reaction: a new tool for early diagnosis and epidemiologic surveillance.

    PubMed

    Balassiano, Ilana Teruszkin; Vital-Brazil, Juliana Magalhães; Pereira, Martha Maria

    2012-09-01

    The aim of this study was to develop an immunocapture polymerase chain reaction (IC-PCR) protocol for leptospirosis. For the standardization of IC-PCR, polyclonal (AS) and monoclonal (MAb) antibodies against different serogroups and serovars of Leptospira were coupled to polystyrene plates. Human sera were artificially contaminated with leptospires and incubated on plates. The bacterial DNA was obtained and used in a multiplex PCR. Sensitivity was tested using sera contaminated with crescent concentrations of leptospires, while specificity was established using sera contaminated with different bacterial genera and sera obtained from patients positive for viral infections. IC-PCR using AS was able to recognize specific serogroups, although some cross-reactions have been observed. No cross-reactions were observed when MAbs were used; however, the sensitivity in this case was lower than that of IC-PCR using AS. IC-PCR proved to be specific to Leptospira and is a promising tool for early diagnosis of leptospirosis, providing additional information about the infecting serovar or serogroup. PMID:22770775

  6. Polymerase chain reaction-based analysis to detect terrestrial animal protein in fish meal.

    PubMed

    Bellagamba, Federica; Valfrè, Franco; Panseri, Sara; Moretti, Vittorio M

    2003-04-01

    The recent European bovine spongiform encephalopathy crisis has focused attention on the importance of adopting stringent control measures to avoid the risk of the diffusion of mad cow disease through meat meal-based animal feedstuffs. Potential adulteration of such feedstuffs with bone particles from terrestrial animals is determined by microscopic examination by law before the release of these feedstuffs for free circulation in the European Community. This study describes a DNA monitoring method to examine fish meal for contamination with mammalian and poultry products. A polymerase chain reaction (PCR) method based on the nucleotide sequence variation in the 12S ribosomal RNA gene of mitochondrial DNA was developed and evaluated. Three species-specific primer pairs were designed for the identification of ruminant, pig, and poultry DNA. The specificity of the primers used in the PCR was tested by comparison with DNA samples for several vertebrate species and confirmed. The PCR specifically detected mammalian and poultry adulteration in fish meals containing 0.125% beef, 0.125% sheep, 0.125% pig, 0.125% chicken, and 0.5% goat. A multiplex PCR assay for ruminant and pig adulteration was optimized and had a detection limit of 0.25%. PMID:12696697

  7. Detection of hog cholera virus and differentiation from other pestiviruses by polymerase chain reaction.

    PubMed

    Wirz, B; Tratschin, J D; Müller, H K; Mitchell, D B

    1993-05-01

    Reverse transcription coupled with the polymerase chain reaction (RT-PCR) was used for the detection and differentiation of pestiviruses. For this purpose, one primer pair was selected from a highly conserved region of the genome of pestiviruses. Using these primers (PEST 1-PEST 2), DNA fragments of between 72 and 74 bp could be amplified from all pestivirus isolates tested. In order to differentiate hog cholera virus (HCV) from bovine viral diarrhea virus (BVDV) and border disease virus (BDV), we selected a primer pair from a conserved region in the genome of HCV strains that differed from that sequenced in the genome of BVDV strains. By using these primers (HCV 1-HCV 2), a DNA fragment of 478 bp could be specifically amplified from HCV isolates. By these means, viral RNA was detected in extracts of lymph node, spleen, tonsil, and lung. Such extracts were used directly for RT-PCR without prior RNA isolation. We also performed multiplex PCR by using both the PEST 1-PEST 2 and HCV 1-HCV 2 primer pairs in a single reaction. This allowed the differentiation of HCV from BVDV and BDV in one step. To assess the sensitivity of the method, RT-PCR was compared with virus propagation in tissue culture and subsequent detection by immunofluorescence staining. The results show that RT-PCR is useful for the rapid detection and differentiation of pestiviruses. PMID:8388887

  8. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  10. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  11. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  12. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  13. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    PubMed

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  14. Detection of Copy Number Imbalance in Canine Urothelial Carcinoma With Droplet Digital Polymerase Chain Reaction.

    PubMed

    Mochizuki, H; Shapiro, S G; Breen, M

    2016-07-01

    Urothelial carcinoma (UC) is the most common neoplasm of the canine urinary tract. Clinical presentation of UC is shared with several other, more common urinary tract disorders, and this often delays diagnosis of the UC. Definitive diagnosis of UC requires histopathologic examination of a biopsy specimen, but the cost and invasiveness for these diagnostic tests often result in most diagnoses being made on the basis of clinical findings, diagnostic imaging, and cytologic examination of urine sediment. Regardless of the diagnostic process used, most UCs currently are not diagnosed until they are at an advanced clinical stage and so are associated with poor prognosis. Improved methods for earlier and less invasive detection are needed. In a previous study, the authors demonstrated the presence of highly recurrent DNA copy number aberrations (CNAs) in canine UC and hypothesized that detection of these CNAs in tumor cells can be used as a molecular diagnostic for UC. In this study, a multiplexed droplet digital polymerase chain reaction (ddPCR) assay was detected to detect and quantify CNAs of specific regions of canine chromosomes 8, 13, 19, and 36. The assay was effective at differentiating 31 neoplastic and 25 nonneoplastic bladder tissues based on copy number, with 100% sensitivity and specificity in tissue samples. CNAs were also detected by ddPCR in 67% (12 of 18) of urine DNA specimens derived from UC patients. The findings show that ddPCR is a useful molecular technique to detect CNAs and may be used as a noninvasive molecular diagnostic test for canine UC. PMID:26574558

  15. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    PubMed

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  16. Prenatal detection of trisomy 21 and 18 from amniotic fluid by quantitative fluorescent polymerase chain reaction.

    PubMed Central

    Tóth, T; Findlay, I; Papp, C; Tóth-Pál, E; Marton, T; Nagy, B; Quirke, P; Papp, Z

    1998-01-01

    Prenatal diagnosis of fetal trisomies is usually performed by cytogenetic analysis on amniotic fluid. This requires lengthy laboratory procedures and high costs, and is unsuitable for large scale screening of pregnant women. An alternative method, which is both rapid and inexpensive and suitable for diagnosing trisomies even from single fetal cells, is the fluorescent polymerase chain reaction using polymorphic small tandem repeats (STRs). In this paper we present the preliminary results of a larger study comparing parallel prenatal diagnoses of trisomies 21 and 18 using cytogenetics with quantitative fluorescent polymerase chain reaction using STR markers. The results obtained by the two techniques were concordant in all cases. This is the first study reporting significant numbers of prenatal diagnoses using the quantitative fluorescent polymerase chain reaction. We believe that further studies on greater numbers of samples will determine the absolute reliability of this technique. These results also provide a model for diagnosis of trisomy from single fetal cells isolated from maternal blood. PMID:9507392

  17. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    PubMed Central

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  18. Analysis of Liver Connexin Expression Using Reverse Transcription Quantitative Real-Time Polymerase Chain Reaction.

    PubMed

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin RNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction, and data analysis. PMID:27207283

  19. Application of real-time polymerase chain reaction in the clinical genetic practice

    PubMed Central

    Nagy, Bálint

    2013-01-01

    The development of polymerase chain reaction revolutionized the molecular genetics and diagnostics. Technical improvements helped to make more specific and sensitive target determinations. Introduction of real-time polymerase chain reaction makes possible several applications in clinical genetics like detection of gene mutations, single nucleotide polymorphisms, deletions, measurement of gene expressions, micro ribonucleic acids, free nucleic acids and microbial genomes. Here I discuss a few examples for specific applications in prenatal clinical genetic practice. These are the detection of microbial genomes, deletions, trisomies, mutations, single nucleotide polymorphisms and free nucleic acids.

  20. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. PMID:25188346

  1. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  2. A Specific Qualitative Detection Method for Peanut (Arachis Hypogagea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A qualitative method for detection of peanuts in foods using polymerase chain reaction was developed. A universal primer pair CP 03-5 /CP 03-3 was designed to confirm the validity of the DNAs for PCR. The plant-specific amplified fragments were detected from 13 kinds of plants using the universal pr...

  3. A Specific Qualitative Detection Method for Peanut (Arachis Hypogaea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed a qualitative detection method for peanuts in foods using polymerase chain reaction (PCR). We designed a universal primer pair CP 03-5’/ CP 03-3’ to confirm the validity of the DNAs for PCR. The plant specific amplified fragments were detected from 13 kinds of plants using the universal...

  4. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  5. Use of polymerase chain reaction for the identification of Leptospira sp. in urine of carriers.

    PubMed

    Ruiz, Victor Manuel Banda; Vega, Laura Elena Orozco; Velázquez, Rosa Maria Urrutia

    2005-01-01

    The objectives of the present work were to detect Leptospira seropositive animals. The ELISA results report only IgG antibodies, which could be attributable to chronic infections or else, that they are healthy carriers. All polymerase chain reaction positive animals should be considered potential sources of infection. PMID:17966477

  6. Use of enrichment real time-Polymerase Chain Reaction to enumerate Salmonella on chicken parts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella that survive cooking and that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. Consequently, the present study was undertaken to use enrichment real time-polymerase chain reaction (RT-PCR) to enu...

  7. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  8. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  9. Use of tRNA consensus primers to indicate subgroups of Pseudomonas solanacearum by polymerase chain reaction amplification.

    PubMed Central

    Seal, S E; Jackson, L A; Daniels, M J

    1992-01-01

    Polymerase chain reaction amplification of DNA from 112 Pseudomonas solanacearum strains with the tRNA consensus primers T3A and T5A divided the species into three fingerprint groups. These groups correspond well with previous divisions made by restriction fragment length polymorphism analysis. This polymerase chain reaction test is a facile method for rapidly classifying P. solanacearum strains. Images PMID:1482194

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  11. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  12. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  13. Single Quantum Dot Analysis Enables Multiplexed Point Mutation Detection by Gap Ligase Chain Reaction

    PubMed Central

    Song, Yunke; Zhang, Yi; Wang, Tza-Huei

    2014-01-01

    Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and tedious assay processes. In this report, we propose an assay technology which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single molecule coincidence detection and superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. PMID:23239594

  14. A novel picoliter droplet array for parallel real-time polymerase chain reaction based on double-inkjet printing.

    PubMed

    Sun, Yingnan; Zhou, Xiaoguang; Yu, Yude

    2014-09-21

    We developed and characterized a novel picoliter droplet-in-oil array generated by a double-inkjet printing method on a uniform hydrophobic silicon chip specifically designed for quantitative polymerase chain reaction (qPCR) analysis. Double-inkjet printing was proposed to efficiently address the evaporation issues of picoliter droplets during array generation on a planar substrate without the assistance of a humidifier or glycerol. The method utilizes piezoelectric inkjet printing equipment to precisely eject a reagent droplet into an oil droplet, which had first been dispensed on a hydrophobic and oleophobic substrate. No evaporation, random movement, or cross-contamination was observed during array fabrication and thermal cycling. We demonstrated the feasibility and effectiveness of this novel double-inkjet method for real-time PCR analysis. This method can readily produce multivolume droplet-in-oil arrays with volume variations ranging from picoliters to nanoliters. This feature would be useful for simultaneous multivolume PCR experiments aimed at wide and tunable dynamic ranges. These double-inkjet-based picoliter droplet arrays may have potential for multiplexed applications that require isolated containers for single-cell cultures, single molecular enzymatic assays, or digital PCR and provide an alternative option for generating droplet arrays on planar substrates without chemical patterning. PMID:25070461

  15. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture.

    PubMed

    Alcantara, Monica Visnieski; Fragoso, Stenio Perdigão; Picchi, Gisele Fernanda Assine

    2014-07-01

    Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR) assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by PCR directly from liquid culture - without prior DNA extraction. This simple approach enabled us to generate PCR amplifications from different cultures varying from 106-108 cells/mL. We also show that it is possible to combine different primer pairs in a multiplex detection reaction and even to achieve knockout confirmation with an extremely simple interpretation of a real-time PCR result. Using the "culture PCR" approach, we show for the first time that we can assess different DNA sequence combinations by PCR directly from liquid culture, saving time in several tasks for T. cruzi genotype interrogation. PMID:24936912

  16. 18S rDNA polymerase chain reaction and sequencing in onychomycosis diagnostics.

    PubMed

    Walberg, Mette; Mørk, Cato; Sandven, Per; Jorde, Anne Tomine; Bjørås, Magnar; Gaustad, Peter

    2006-01-01

    Diagnostic approaches to onychomycosis have traditionally been based on a combination of culture and microscopy. In the present study clinical specimens from 346 patients with suspected onychomycosis were analysed by 18S polymerase chain reaction (detection) followed by sequencing and subsequent database search (identification) in parallel with routine culture on agar (detection and identification). In 49 samples Trichophyton rubrum was identified by culture and sequencing. In 67 additional culture negative samples, a positive dermatophyte sequence was obtained (T. rubrum in 54, T. mentagrophytes in 5, and T. species in 8 samples). Fifteen samples cultured positive while no sequence was obtained. Two hundred and seven samples were negative by culture as well as by sequencing. Nails from 10 healthy controls were negative by culture and sequencing. In conclusion, the number of specimens that were positive by polymerase chain reaction was more than double the number that were positive by culture alone. PMID:16710579

  17. Detection of enteric viruses in oysters by using the polymerase chain reaction.

    PubMed Central

    Atmar, R L; Metcalf, T G; Neill, F H; Estes, M K

    1993-01-01

    A procedure for the detection of enteric viral nucleic acid in oysters by the polymerase chain reaction was developed. Known quantities of poliovirus type 1 were seeded into oysters. Virus was extracted and concentrated by using organic flocculation and polyethylene glycol precipitation. Inhibitors of reverse transcription-polymerase chain reaction were present in the oyster extracts, preventing amplification of target viral nucleic acid. The use of cetyltrimethylammonium bromide precipitation sufficiently removed inhibitors to allow detection of as few as 10 PFU of poliovirus. Norwalk virus also could be detected after being seeded into oysters. This methodology may be useful for the detection of these and other shellfish-borne viral pathogens. Images PMID:8382024

  18. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing.

    PubMed

    Wilson, R K; Chen, C; Hood, L

    1990-02-01

    A high-throughput method for the preparation of single-stranded template DNA, which is suitable for sequence analysis using fluorescent labeling chemistry, is described here. In this procedure, the asymmetric polymerase chain reaction is employed to amplify recombinant plasmid or bacteriophage DNA directly from colonies or plaques. The use of amplification primers located at least 200 base pairs 5' to the site of sequencing primer annealing removes the need for extensive purification of the asymmetric polymerase chain reaction product. Instead, the single-stranded product DNA is purified by a simple isopropanol precipitation step and then directly sequenced using fluorescent dye-labeled oligonucleotides. This method significantly reduces the time and labor required for template preparation and improves fluorescent DNA sequencing strategies by providing a much more uniform yield of single-stranded DNA. PMID:2317375

  19. Sensitive and specific polymerase chain reaction detection of Toxoplasma gondii for veterinary and medical diagnosis.

    PubMed Central

    MacPherson, J M; Gajadhar, A A

    1993-01-01

    A polymerase chain reaction (PCR) method was developed for the detection of Toxoplasma gondii. A universal- and a T. gondii-specific primer was used to amplify a region of the small subunit ribosomal RNA gene. This approach allows for a theoretical detection limit of 0.01 zoite of T. gondii per sample assayed. Experiments showed that this PCR method could detect 0.1 pg of T. gondii DNA, which represents about one organism. Polymerase chain reaction tests using DNAs of cat, dog, swine, cattle, human, Sarcocystis cruzi, Eimeria ahsata, E. vermiformis, and Escherichia coli indicated no cross-reaction with nucleic acids of hosts, related coccidia, or bacteria. Data on the sensitivity and specificity suggest that this PCR assay could be extremely useful for the diagnosis of toxoplasmosis in human and veterinary medicine, as well as for food safety surveys. Images Fig. 1. Fig. 2. PMID:8431804

  20. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    PubMed

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  1. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  2. A case of canine streptococcal meningoencephalitis diagnosed using universal bacterial polymerase chain reaction assay.

    PubMed

    Messer, Jeannette S; Wagner, Susan O; Baumwart, Ryan D; Colitz, Carmen M

    2008-01-01

    A 3-year-old, spayed female, mixed-breed dog was evaluated for acute, progressive neurological disease. Analysis of cerebrospinal fluid (CSF) showed neutrophilic pleocytosis. The dog later developed liver disease, thrombocytopenia, and anemia that were presumably secondary to ceftriaxone administration. Bacterial cultures of blood, urine, and CSF were negative. However, a universal bacterial polymerase chain reaction assay of CSF identified deoxyribonucleic acid from Streptococcus spp. The dog recovered with therapy for streptococcal encephalitis. PMID:18593857

  3. Polymerase Chain Reaction as a Diagnostic Tool for Six Sexually Transmitted Infections - Preliminary Results

    PubMed Central

    GRAD, ALECSANDRA IULIA; VICA, MIHAELA LAURA; MATEI, HOREA VLADI; GRAD, DORU LUCIAN; COMAN, IOAN; TATARU, DUMITRU ALEXANDRU

    2015-01-01

    Background and aim Sexually transmitted infections are a very frequent and under-diagnosed cause of illness worldwide. A high number of detection methods and a large range of specimens in which sexually transmitted infections can be determined are available at the moment. Polymerase chain reaction performed on first void urine offers the advantage of being non-invasive, self-collectable and has high sensitivity and specificity. We looked to determine the frequency of Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Mycoplasma hominis, Mycoplasma genitalium and Ureaplasma urealyticum in symptomatic and asymptomatic patients. Methods Six sexually transmitted infections were determined in the first void urine of 15 symptomatic and asymptomatic patients by polymerase chain reaction. We used “Epicenter MasterPure™ Complete DNA and RNA Purification Kit” for the DNA purification and “Seeplex® STD6 ACE Detection” for the DNA amplification. The results were examined in UV light. Results A number of 5 patients had positive results for Chlamydia trachomatis or Neisseria gonorrhoeae. Sexually transmitted infections are more frequent in men between 27 and 40 years old. Conclusions Polymerase chain reaction is a good diagnostic tool for sexually transmitted infections because it has a high sensitivity and specificity. Chlamydia trachomatis is the most frequent sexually transmitted infection, followed by Neisseria gonorrhoeae. PMID:26528045

  4. Rapid detection of bovine viral diarrhea virus by polymerase chain reaction.

    PubMed Central

    Lopez, O J; Osorio, F A; Donis, R O

    1991-01-01

    The polymerase chain reaction was used to detect genomic sequences of the positive-stranded RNA of bovine viral diarrhea virus (BVDV), a member of the family Togaviridae. Using a set of 20-bp primers located within the conserved 3' region of the BVDV genome, we were able to consistently amplify a 205-bp target sequence from BVDV cDNA. BVDV RNAs from cell culture-propagated BVDV reference strains, diverse unrelated cytopathic and noncytopathic field isolates, and clinical serum samples were transcribed to cDNA by using avian myeloblastosis virus reverse transcriptase and further specifically amplified by using the polymerase chain reaction assay. The amplification assay was sensitive enough to detect one molecule of cloned BVDV cDNA. Reconstitution experiments conducted by adding decreasing amounts of BVDV (NADL strain) to BVDV-free serum indicated that the threshold of sensitivity of the assay was less than or equal to 1 50% tissue culture infective dose. These results show that the polymerase chain reaction may be used for the rapid detection of diverse strains of BVDV in cell cultures, biological products, and clinical specimens from cattle. Images PMID:1709950

  5. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    SciTech Connect

    Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R. ); Kawasaki, E.S. )

    1990-01-01

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction.

  6. A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain.

    PubMed

    Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub

    2015-01-01

    Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform. PMID:26437367

  7. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  8. The direct application of the polymerase chain reaction to DNA extracted from foods.

    PubMed

    Dickinson, J H; Kroll, R G; Grant, K A

    1995-04-01

    Two methods for the successful extraction of DNA from foods are described. The rapid lysis method uses a proteinase K buffer system to lyse cells and solubilize food samples. DNA is then precipitated using isopropanol. The second method achieves cell lysis using toluene and mutanolysin, and solubilization using guanidium thiocyanate. Following protein removal with organic solvents DNA is precipitated with isopropanol. Both methods enabled the polymerase chain reaction to be applied directly to DNA extracted from samples of cheese, coleslaw and raw chicken and allowed the direct rapid, sensitive and specific detection of Yersinia enterocolitica, Aerococcus viridans and Listeria monocytogenes in these foods. PMID:7766115

  9. Using Digital Polymerase Chain Reaction to Detect Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-01-01

    This protocol is designed to detect single-nucleotide substitutions generated by genome editing in a highly sensitive and quantitative manner. It uses a combination of allele-specific hydrolysis probes and a new digital polymerase chain reaction (dPCR) technology called droplet digital PCR (ddPCR). ddPCR partitions a reaction into more than 10,000 nanoliter-scale water-in-oil droplets. As a result, each droplet contains only a few copies of the genome so that ddPCR is able to detect rare genome-editing events without missing them. PMID:27250210

  10. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis of microbial community structure in landfill leachate.

    PubMed

    Uchida, Miho; Hatayoshi, Haruna; Syuku-nobe, Aoi; Shimoyama, Takefumi; Nakayama, Toru; Okuwaki, Akitsugu; Nishino, Tokuzo; Hemmi, Hisashi

    2009-05-30

    The structures of microbial communities in water samples obtained from a landfill site that had been a source of environmental pollution by emitting hydrogen sulfide were elucidated using polymerase chain reaction-denaturing gradient gel electrophoresis. The microbial communities, which consisted of a limited number of major microorganisms, were stable for several months. Microorganisms capable of degrading such chemical compounds as 2-hydroxybenzothiazole and bisphenol A were observed in landfill leachate. Microorganisms responsible for the production of hydrogen sulfide were not the primary microbes detected, even in water samples obtained from the site of gas emission. PMID:18977596

  11. Zoster ... "a lmost" ... sine herpete: diagnostic utility of real time-polymerase chain reaction.

    PubMed

    Vena, Gino A; Apruzzi, Doriana; Vestita, Michelangelo; Calvario, Agata; Foti, Caterina; Cassano, Nicoletta

    2010-10-01

    Zoster sine herpete is a particular form of varicella zoster virus (VZV) infection characterized by segmental pain and dysesthesia, without any cutaneous lesions ever becoming perceptible. This report describes the case of a female patient, presenting with intercostal pain associated with a single papulo-vesicular lesion localized within the same area. Thanks to such a lesion, real time-polymerase chain reaction (PCR) analysis on vesicle fluid swab was possible, thus revealing a significant number of VZV genome copies. This innovative tool has proven essential to diagnose this abortive form of herpes zoster, which would otherwise have remained unidentified. PMID:21213602

  12. JC polyomavirus nephropathy confirmed by using an in-house polymerase chain reaction method.

    PubMed

    Querido, S; Jorge, C; Sousa, H; Birne, R; Matias, P; Weigert, A; Adragão, T; Bruges, M; Ramos, S; Santos, M; Paixão, P; Curran, M D; Machado, D

    2015-10-01

    We report the case of an isolated JC virus (JCV) infection, without co-infection by polyoma BK virus (BKV), associated with nephropathy 4 years after kidney transplantation. Clinical suspicion followed the observation of a decrease in estimated glomerular filtration rate (eGFR) and a renal allograft biopsy revealing polyomavirus-associated tubulointerstitial nephritis and positivity for SV40. An in-house real-time polymerase chain reaction assay, targeting the presence of JCV and the absence of BKV in biopsy tissue, confirmed diagnosis. Thirteen months after diagnosis, and following therapeutic measures, eGFR remains stable. PMID:26215933

  13. [Real-time polymerase chain reaction in the diagnosis of pulmonary tuberculosis].

    PubMed

    Salina, T Iu; Morozova, T I

    2008-01-01

    To enhance the efficiency of diagnosis of oligo- and abacillar pulmonary tuberculosis and its differential diagnosis with other lung diseases, the authors studied the informative value of real-time polymerase chain reaction (PCR) used in 62 patients with different clinical forms of tuberculosis and 108 differentially diagnostic patients. Real-time PCR has been ascertained to be a significantly more sensitive and highly specific tool in tuberculosis diagnosis, which considerably improves the specific recognition of the etiology of a pathogenetic process in oligo- and abacillar patients. Particularly encouraging results have been obtained when examining differentially diagnostic patients with the rounded shadows being formed in the lung. PMID:18710048

  14. Polymerase chain reaction identification of a hymenopteran insect in the cornea: a case report.

    PubMed

    Lin, Hsien-Chung; Yeh, Wen-Bin; Chang, Cheng-Hsien; Fu, Yaw-Syan; Cheng, Chien-Chung; Wu, Horng-Jiun; Wang, Hwei-Zu

    2006-03-01

    The type of corneal injuries associated with insect encounters is related to the composition of the foreign body. However, previous reports on corneal foreign bodies as insects were rarely based on scientific evidence. Here, we report on a 49-year-old male who was stung in his left eye by an unknown insect. Emergent keratotomy was performed to remove the embedded corneal foreign body. The removed foreign body was observed under light microscopy, and a fragment of insect was suspected. The sample was sent for molecular analysis. The polymerase chain reaction product was sequenced, subjected to a BLAST search, and identified as an ichneumonoid member of the insect order Hymenoptera. PMID:16602279

  15. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    PubMed

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  16. Detection of biological warfare agents using the polymerase chain reaction. Final report, June-August 1991

    SciTech Connect

    Mann, B.J.

    1992-09-01

    The detection of biological warfare agents is an important mission for the U.S. Army. This report explores the feasibility of using the polymerase chain reaction as a means of rapid detection of biological warfare agents. Two levels of detection are proposed. The first level is group specific detection, using primers derived from 16S rDNA sequences, to detect various groups of pathogenic bacteria. The second level is species-specific detection using primers derived from DNA sequences, unique to each pathogenic organism targeted for detection. Specific examples of Vibrio cholerae, Francisella tularensis, Yersinia pestis, Staphylococcus aureus, and Bacillus anthracis are described.

  17. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

    PubMed Central

    2011-01-01

    Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR) assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs) would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit) and after 10 days (follow-up visit). Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days). The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202) of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204) (P = 0.005) of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202) in the rapid result group and 17.2% (35 of 204) in the delayed result group (P = 0

  18. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompA DNA of Chlamydia spp.

    PubMed Central

    Kaltenboeck, B; Kousoulas, K G; Storz, J

    1992-01-01

    Specific and sensitive amplification of major outer membrane protein (MOMP) gene (ompA) DNA sequences of Chlamydia species with various MOMP genotypes was achieved by a two-step polymerase chain reaction (PCR). Degenerate, inosine-containing oligonucleotide primers homologous to the 5' and 3' ends of the translated regions of all chlamydial MOMP genes were used in a PCR to amplify a DNA fragment of approximately 1,120 bp. A portion of this DNA fragment was amplified in a second genus-specific reaction that yielded a DNA fragment of approximately 930 bp. A pair of degenerate oligonucleotide primers homologous to internal sequences of the primary DNA fragment was used in this PCR. This method detected three cognate chlamydial genomes in a background of 1 microgram of unrelated DNA. MOMP genes of 13 representative chlamydial MOMP genotypes of the species C. trachomatis, C. pneumoniae, and C. psittaci were amplified. In a secondary PCR, group-specific detection was achieved by the simultaneous use of one genus-specific primer and three primers derived from different fingerprint regions of three major groups of chlamydiae. This multiplex PCR differentiated the groups by the length of the amplified DNA fragments and detected the simultaneous presence of DNA sequences of the Chlamydia spp. with different MOMP genotypes. Further differentiation as ompA restriction fragment length polymorphism types among all chlamydial strains with the various MOMP genotypes analyzed here was achieved by restriction endonuclease analysis of the secondary PCR products. DNA sequences corresponding to the ompA restriction fragment length polymorphism type B577 of C. psittaci were detected in two of seven milk samples from cases of bovine mastitis. Images PMID:1349899

  19. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    PubMed Central

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad

    2011-01-01

    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  20. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  1. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler. PMID:27271319

  2. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  3. Detection of Enterococcus faecalis in Necrotic Teeth Root Canals by Culture and Polymerase Chain Reaction Methods

    PubMed Central

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Aksoy, Semiha C.; Eronat, Cemal

    2007-01-01

    Objectives The aim of this study was to investigate the presence of Enterococcus faecalis in endodontic infections in both deciduous and permanent teeth by culture and polymerase chain reaction (PCR) methods. Methods A total of 145 children aged 5–13 years old were involved in this study. The presence of E. faecalis in necrotic deciduous and permanent teeth root canals was studied using culture and polymerase chain reaction methods. Results Among 145 molar teeth, 57% (n=83) presented necrotic asymptomatic pulp tissues and were included in this study. Culture and PCR methods detected the test species in 18 and 22 of 83 teeth involved, respectively. E. faecalis was cultured from 8 (18%) of 45 necrotic deciduous teeth and from 10 (26%) of 38 necrotic permanent teeth. PCR detection identified the target species in 10 (22%) and 12 (32%) of necrotic deciduous and permanent teeth respectively. Statistically significant difference in the presence of E. faecalis in deciduous and permanent teeth was found by culture and PCR methods (P=0.03 and 0.02, respectively). The difference in the presence of E. faecalis between two different methods was not statistically significant (P>.05). Conclusions The results of the present study confirm that both culture and PCR methods are sensitive to detect E. faecalis in root canals. PMID:19212470

  4. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    SciTech Connect

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. ); Wunder, J.S.; Andrulis, I.L. ); Gazdar, A.F. ); Willman, C.L.; Griffith, B. ); Von Hoff, D.D. )

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  5. Western thymomas lack Epstein-Barr virus by Southern blotting analysis and by polymerase chain reaction.

    PubMed Central

    Inghirami, G.; Chilosi, M.; Knowles, D. M.

    1990-01-01

    The authors investigated 16 western thymomas, 9 from the United States and 7 from Europe, for the presence of Epstein-Barr virus (EBV) DNA sequences by both Southern blot hybridization analysis and polymerase chain reaction using EBV-specific DNA probes that detect the long internal repeat and terminal repeat regions and the EBNA-1 gene. None of the 16 thymomas contained evidence of the EBV genome, even though we could detect EBV by Southern blotting when EBV DNA represents less than or equal to 1% of the total DNA and by polymerase chain reaction when a single EBV-positive cell is present among 10(5) EBV-negative cells. These results fail to demonstrate EBV genome in western thymomas and stand in contrast to those of McGuire et al (Am J Pathol 1988, 131:385) who previously reported that the EBV genome is present in thymomas occurring in southern Chinese patients. Therefore EBV does not appear to be implicated in the pathogenesis of all thymomas. The presence of EBV in eastern thymomas, regions where EBV is endemic may be due to epidemiologic factors and/or genetic predispositions. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2162629

  6. A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

    EPA Science Inventory

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

  7. Rapid differentiation and identification of potential severe strains of Citrus tristeza virus by real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Yokomi, R K; Saponari, M; Sieburth, P J

    2010-04-01

    A multiplex Taqman-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to identify potential severe strains of Citrus tristeza virus (CTV) and separate genotypes that react with the monoclonal antibody MCA13. Three strain-specific probes were developed using intergene sequences between the major and minor coat protein genes (CPi) in a multiplex reaction. Probe CPi-VT3 was designed for VT and T3 genotypes; probe CPi-T36 for T36 genotypes; and probe CPi-T36-NS to identify isolates in an outgroup clade of T36-like genotypes mild in California. Total nucleic acids extracted by chromatography on silica particles, sodium dodecyl sulfate-potassium acetate, and CTV virion immunocapture all yielded high quality templates for real-time PCR detection of CTV. These assays successfully differentiated CTV isolates from California, Florida, and a large panel of CTV isolates from an international collection maintained in Beltsville, MD. The utility of the assay was validated using field isolates collected in California and Florida. PMID:20205535

  8. Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

    PubMed

    Ha, Y; Fessehaie, A; Ling, K S; Wechter, W P; Keinath, A P; Walcott, R R

    2009-06-01

    To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae. PMID:19453225

  9. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    PubMed Central

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  10. G-quadruplex-generating polymerase chain reaction for visual colorimetric detection of amplicons.

    PubMed

    Bhadra, Sanchita; Codrea, Vlad; Ellington, Andrew D

    2014-01-15

    We have developed a self-reporting polymerase chain reaction (PCR) system for visual colorimetric gene detection and distinction of single nucleotide polymorphisms (SNPs). Amplification is performed using target-specific primers modified with a 5'-end tail that is complementary to a G-quadruplex deoxyribozyme-forming sequence. At end-point, G-quadruplexes are forced to fold from PCR-generated duplex DNA and then are used to colorimetrically report the successful occurrence of PCR by assaying their peroxidase activity using a chromogenic substrate. Furthermore, primer design considerations for the G-quadruplex-generating PCR system have allowed us to visually distinguish SNPs associated with Mycobacterium tuberculosis drug resistance alleles. PMID:24135653

  11. Polymerase Chain Reaction Diagnosis of Leishmaniasis: A Species-Specific Approach.

    PubMed

    González-Marcano, Eglys; Kato, Hirotomo; Concepción, Juan Luis; Márquez, María Elizabeth; Mondolfi, Alberto Paniz

    2016-01-01

    Leishmaniasis is an infectious disease caused by protozoan parasites of the genus Leishmania which are transmitted to humans through bites of infected sand flies. The variable clinical manifestations and the evolution of the disease are determined by the infecting species. Recognition at a species level is of utmost importance since this greatly impacts therapy decision making as well as predicts outcome for the disease. This chapter describes the application of polymerase chain reaction (PCR) in the detection of Leishmania parasites across the disease spectrum, including protocols for sample collection and transportation, genomic material extraction, and target amplification methods with special emphasis on PCR amplification of the cytochrome b gene for Leishmania spp. species identification. PMID:26843051

  12. Analysis of BRCA2 loss of heterozygosity in tumor tissue using droplet digital polymerase chain reaction.

    PubMed

    Cochran, Rory L; Cravero, Karen; Chu, David; Erlanger, Bracha; Toro, Patricia Valda; Beaver, Julia A; Zabransky, Daniel J; Wong, Hong Yuen; Cidado, Justin; Croessmann, Sarah; Parsons, Heather A; Kim, Minsoo; Wheelan, Sarah J; Argani, Pedram; Park, Ben Ho

    2014-07-01

    Loss-of-heterozygosity (LOH) analysis of archival tumor tissue can aid in determining the clinical significance of BRCA variants. Here we describe an approach for assessing LOH in formalin-fixed, paraffin-embedded (FFPE) tissues using variant-specific probes and droplet digital polymerase chain reaction (ddPCR). We evaluated LOH in 2 related breast cancer patients harboring a rare missense BRCA2 variant of unknown clinical significance (c.6966G>T; M2322I). Conventional PCR followed by Sanger sequencing suggested a change in allelic abundance in the FFPE specimens. However, we found no evidence of LOH as determined by the allelic ratio (wild type-variant) for BRCA2 in both patients' archival tumor specimens and adjacent normal control tissues using ddPCR. In summary, these experiments demonstrate the utility of ddPCR to quickly and accurately assess LOH in archival FFPE tumor tissue. PMID:24824029

  13. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    PubMed

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  14. Polymerase chain reaction comparison of the gene for strictosidine synthase from ten Rauvolfia species.

    PubMed

    Bracher, D; Kutchan, T M

    1992-05-01

    The gene for strictosidine synthase, str1, has been analyzed by the polymerase chain reaction in ten species of Rauvolfia, the origins of which span the tropical belt: R. cambodiana (Indochina), R. canescens (India), R. chinensis (China), R. heterophylla (Central America), R. mannii (West Africa), R. nitida (West Indies), R. praecox (Brasil), R. serpentina (India), R. sumatrana (Indonesia) and R. verticillata (Indochina). Restriction endonuclease analysis of the gene fragments produced with genomic DNA from each of the ten species as template revealed that str1 is highly conserved in the Rauvolfia species investigated. These results suggest that there is a stringent selection pressure on the gene for this key enzyme of indole alkaloid biosynthesis. PMID:24202981

  15. Rapid multi sample DNA amplification using rotary-linear polymerase chain reaction device (PCRDisc)

    PubMed Central

    Sugumar, D.; Kong, L. X.; Ismail, Asma; Ravichandran, M.; Su Yin, Lee

    2012-01-01

    Multiple sample DNA amplification was done by using a novel rotary-linear motion polymerase chain reaction (PCR) device. A simple compact disc was used to create the stationary sample chambers which are individually temperature controlled. The PCR was performed by shuttling the samples to different temperature zones by using a combined rotary-linear movement of the disc. The device was successfully used to amplify up to 12 samples in less than 30 min with a sample volume of 5 μl. A simple spring loaded heater mechanism was introduced to enable good thermal contact between the samples and the heaters. Each of the heater temperatures are controlled by using a simple proportional–integral–derivative pulse width modulation control system. The results show a good improvement in the amplification rate and duration of the samples. The reagent volume used was reduced to nearly 25% of that used in conventional method. PMID:22685508

  16. Detection of the Pinewood Nematode, Bursaphelenchus xylophilus, Using a Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Cao, A X; Liu, X Z; Zhu, S F; Lu, B S

    2005-05-01

    ABSTRACT The pinewood nematode, Bursaphelenchus xylophilus, has caused significant damage to pine plantations both in East Asia and North America and is an important quarantine organism. A real-time polymerase chain reaction (PCR) assay was developed to detect B. xylophilus. A set of primers and probe specific for B. xylophilus was designed to target the ribosomal DNA internal transcribed spacer region. Optimal primer concentration, Mg(2+) concentration, and extension temperature were 400 nM, 3.0 mM, and 60 degrees C, respectively. The assay was highly specific and sensitive, detecting as little as 0.01 ng of B. xylophilus DNA. The real-time PCR assay also successfully detected B. xylophilus in field samples, and it should be very useful for quarantine purposes. PMID:18943323

  17. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  18. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  19. Assembling long heteroduplexes by asymmetric polymerase chain reaction and annealing the resulting single-stranded DNAs.

    PubMed

    Wang, Mugui; Wei, Chuchu; Ye, Xiufen; Liu, Jianping; Zhang, Cuicui; Chen, Hao; Zhang, Xiaobo; Tu, Jumin

    2015-04-15

    We developed an effective protocol for generating high-purity heteroduplexes via annealing single-stranded DNAs (ssDNAs) derived from plasmid DNA by asymmetric polymerase chain reaction (A-PCR). With the addition of dimethyl sulfoxide, a one-step A-PCR procedure can generate ssDNAs stably at a range of reaction temperatures. Several annealing buffers can anneal two ssDNAs into heteroduplexes effectively. We further developed a simple strategy to create d(GATC) hemimethylated heteroduplexes by annealing fully methylated homoduplexes in the presence of excessive unmethylated ssDNAs. The constructed heteroduplexes have been well tested as substrates for mismatch repair in Escherichia coli and, thus, can be used in various biotechnology applications. PMID:25575760

  20. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  1. Rapid isolation of DNA from fresh and preserved fish scales for polymerase chain reaction.

    PubMed

    Yue, G H; Orban, L

    2001-05-01

    We developed a simple and inexpensive method to extract DNA from fresh and preserved fish scales. The procedure is based on boiling the scales in 5% Chelex 100, followed by digestion with proteinase K and subsequent absorption of genomic DNA using silica. A single fresh scale from larger species (e.g., tilapia) or a few scales from smaller species (e.g., 4 scales from zebrafish) provide over 200 ng of DNA, enough for at least 40 polymerase chain reaction amplifications. The procedure is applicable for DNA isolation not only from fresh and ethanol-preserved scales, but also from dried and formaldehyde-treated samples, and thus might be useful for investigating specimens stored in museums and other collections. Since the removal of a few scales is a gentle means of sample collection, this technique will allow analysis of genetic diversity, mating systems, and parentage in populations of endangered or ornamental fish with minimal experimental influence. PMID:14961356

  2. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis.

    PubMed Central

    Telenti, A; Marchesi, F; Balz, M; Bally, F; Böttger, E C; Bodmer, T

    1993-01-01

    A method for the rapid identification of mycobacteria to the species level was developed on the basis of evaluation by the polymerase chain reaction (PCR) of the gene encoding for the 65-kDa protein. The method involves restriction enzyme analysis of PCR products obtained with primers common to all mycobacteria. Using two restriction enzymes, BstEII and HaeIII, medically relevant and other frequent laboratory isolates were differentiated to the species or subspecies level by PCR-restriction enzyme pattern analysis. PCR-restriction enzyme pattern analysis was performed on isolates (n = 330) from solid and fluid culture media, including BACTEC, or from frozen and lyophilized stocks. The procedure does not involve hybridization steps or the use of radioactivity and can be completed within 1 working day. Images PMID:8381805

  3. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction.

    PubMed

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela

    2013-01-01

    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling. PMID:23075531

  4. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  5. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    PubMed Central

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-01-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted. Images PMID:1696290

  6. Epidemiological investigation of Salmonella tilene by pulsed-field gel electrophoresis and polymerase chain reaction

    PubMed Central

    Anand, Chandar M; Fonseca, Kevin; Longmore, Ken; Rennie, Robert; Chui, Linda; Lingley, Mike; Woodward, David

    1997-01-01

    Pulsed-field gel electrophoresis (PFGE) and DNA fingerprinting by the polymerase chain reaction (PCR) were performed on 11 isolates of Salmonella tilene. Five strains were from a cluster of human patients, six from sugar gliders and pygmy hedgehogs kept as family pets or from local pet retailers, and one isolate from the first North American case of S tilene described in Washington State in 1994. The PFGE restriction patterns showed all isolates to be similar. However, PCR using primers to the 16S and 23S rRNA genes of Escherichia coli demonstrated that the Washington State isolate differed from the rest of the other isolates, which were all similar based upon their DNA fingerprint. This study indicates that reliance on one technique alone may be insufficient to show nuances between strains that are, in many respects, closely related. PMID:22346526

  7. Rapid multi sample DNA amplification using rotary-linear polymerase chain reaction device (PCRDisc).

    PubMed

    Sugumar, D; Kong, L X; Ismail, Asma; Ravichandran, M; Su Yin, Lee

    2012-03-01

    Multiple sample DNA amplification was done by using a novel rotary-linear motion polymerase chain reaction (PCR) device. A simple compact disc was used to create the stationary sample chambers which are individually temperature controlled. The PCR was performed by shuttling the samples to different temperature zones by using a combined rotary-linear movement of the disc. The device was successfully used to amplify up to 12 samples in less than 30 min with a sample volume of 5 μl. A simple spring loaded heater mechanism was introduced to enable good thermal contact between the samples and the heaters. Each of the heater temperatures are controlled by using a simple proportional-integral-derivative pulse width modulation control system. The results show a good improvement in the amplification rate and duration of the samples. The reagent volume used was reduced to nearly 25% of that used in conventional method. PMID:22685508

  8. Detection of Epstein-Barr virus sequences in Hodgkin's disease by the polymerase chain reaction.

    PubMed Central

    Wright, C. F.; Reid, A. H.; Tsai, M. M.; Ventre, K. M.; Murari, P. J.; Frizzera, G.; O'Leary, T. J.

    1991-01-01

    The authors examined paraffin-embedded lymph node biopsies from 65 cases of Hodgkin's disease for the presence of Epstein-Barr virus (EBV) DNA, using the highly sensitive polymerase chain reaction technique. Overall 40% of the cases were positive for EBV DNA; there were no statistically significant differences in the frequency of EBV positivity among the different subtypes of Hodgkin's disease. These results are in agreement with those of previous studies that employed less sensitive detection techniques and suggest that EBV either is present in pathologic tissues only in some phases of the evolution of Hodgkin's disease or is a pathogenetic factor involved in only a portion of cases. Images Figure 1 Figure 2 Figure 3 PMID:1651058

  9. How appropriate are cerebrospinal fluid polymerase chain reaction requests for suspected central nervous system infections?

    PubMed

    Mamoojee, Yaasir; Chadwick, David

    2011-12-01

    Cerebrospinal fluid (CSF) polymerase chain reaction (PCR) assays have become the main diagnostic tests for central nervous system viral infections in recent years. Previous studies have suggested algorithms based on CSF leukocyte count and total protein levels to determine when CSF PCR assays are indicated. Based on these criteria, 1,469 CSF PCR tests requested over a two-year period were reviewed. A proportion of positive PCR results were found in children with normal CSF, unlike in adults where such occurrences were extremely rare. The results suggest that applying a strategy of screening CSF specimens using leukocyte count, glucose and protein, at least in adults, may have avoided more than half of CSF PCR requests with little detriment to patient care and considerable cost savings. Larger prospective studies are needed to determine whether algorithms using standard CSF parameters and clinical information can optimise the use of CSF PCR assays in clinical practice. PMID:22268308

  10. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  11. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  12. Use of polymerase chain reaction-amplified Helicobacter pylori urease structural genes for differentiation of isolates.

    PubMed Central

    Foxall, P A; Hu, L T; Mobley, H L

    1992-01-01

    Helicobacter pylori has been demonstrated as an etiologic agent of human gastritis and peptic ulcer formation. However, there is no straightforward basis to distinguish different isolates. We used the polymerase chain reaction (PCR) to amplify the urease structural subunit genes, ureA and ureB, which, when digested with appropriate restriction endonucleases, allow the differentiation of patterns on agarose gels. PCR amplification was possible with DNA rapidly extracted from H. pylori by alkaline lysis and phenol-chloroform. The 2.4-kb PCR products amplified from 22 clinical isolates and subjected to HaeII restriction endonuclease digestion produced 10 distinct patterns on agarose gels, with two patterns being shared between five and six strains. PCR amplification of the urease genes may enable the differentiation of closely related H. pylori strains by restriction digest analysis of PCR-amplified ureA and ureB genes. Images PMID:1313051

  13. Molecular characterization of Leishamania isolates from China by inter-simple sequence repeat polymerase chain reaction.

    PubMed

    Wang, Yong; Yang, Yuetao; Wang, Junyun; Bao, Yifang; Guan, Liren; Gao, Chunhua; Shi, Feng

    2010-05-01

    Leishmania has distinct epidemiological and biological characteristics and causes a variety of clinical symptoms. To understand the genetic diversity and the phylogenetic relationships among Leishmania isolates from China, 29 Leishmania isolates from different geographic origins, vectors, and hosts were analyzed using 21 inter-simple sequence repeat polymerase chain reaction (ISSR-PCR) primers. A total of 864 polymorphic bands were obtained. According to the results of the neighbor-joining phylogenetic tree and principal component analysis, the 29 isolates studied clustered into six groups. Isolates of Leishmania donovani complex from China share the highest similarity with the reference strain of L. donovani (DD8). This study helps to elucidate the genetic relationship among Leishmania isolates from China and similarities between Chinese isolates and World Health Organization reference strains. Furthermore, ISSR-PCR could also be a quick, simple, and reliable method for Leishmania species identification. PMID:20237800

  14. Detection of Escherichia coli in sewage and sludge by polymerase chain reaction

    SciTech Connect

    Tsai, Yuli; Palmer, C.J.; Sangermano, L.R. )

    1993-02-01

    The polymerase chain reaction (PCR) is a powerful tool in exploration of microbial activities and identities in environmental microbiology. High concentrations of humic acidlike substances in raw sewage and raw sludge have prevented the use of PCR with sewage and sludge samples. However, monitoring waste water and sludge by the PCR would lead to increased public health protection. In this study a rapid DNA extraction method and rapid purification procedure are combined with the PCR to detect Escherichia coli in sewage and sludge. The PCR is successfully used to amplify from both, a fragment of the E. coli uidAgene that codes for [beta]-D-glucuronidase. Because of their sensitivity and specificity, the PCR and nonradioactive gene probe techniques can be used to detect potentially pathogenic microorganisms in raw sewage and sludge, allowing for evaluation of the efficiency of treatments to remove pathogens.

  15. [Characterization of aldehyde dehydrogenase gene fragment from mung bean Vigna radiata using the polymerase chain reaction].

    PubMed

    Ponomarev, A G; Bubiakina, V V; Tatarinova, T D; Zelenin, S M

    1998-01-01

    Two degenerate oligonucleotide sequence primers and polymerase chain reactions on total DNA have been utilized to clone on 651--bp gene fragment coding the central part of amino acid sequence of an earlier unknown aldehyde dehydrogenase (ALDH) from mung bean. The deduced partial amino acid sequence for this aldehyde dehydrogenase shows about 65% sequence identity to ALDHs of Vibrio cholerae Rhodococcus sp., Alcaligenes eutrophus and about 45% sequence identity to mammalian ALDHs 1 and 2, ALDHs of Aspergillus niger and A, nidulans, the betain aldehyde dehydrogenase from spinach. Alignment of the mung bean aldehyde dehydrogenase partial amino acid sequence with the sequence of 16 NAD(P)(+)-dependent aldehyde dehydrogenases has demonstrated that all strictly conserved amino acid residues and all three conservative regions are identical. PMID:9778740

  16. Mapping a mutation in Caenorhabditis elegans using a polymerase chain reaction-based approach.

    PubMed

    Myers, Edith M

    2014-01-01

    Many single nucleotide polymorphisms (SNPs) have been identified within the Caenorhabditis elegans genome. SNPs present in the genomes of two isogenic C. elegans strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which undergraduate students use molecular biological techniques to map a mutation to a chromosome using a set of SNPs. Through this multi-week exercise, students perform genetic crosses, DNA extraction, polymerase chain reaction, restriction enzyme digests, agarose gel electrophoresis, and analysis of restriction fragment length polymorphisms. Students then analyze their results to deduce the chromosomal location of the mutation. Students also use bioinformatics websites to develop hypotheses that link the genotype to the phenotype. PMID:24615818

  17. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  18. Pseudogene-free amplification of HPRT1 in quantitative reverse transcriptase polymerase chain reaction.

    PubMed

    Valadan, Reza; Amjadi, Omolbanin; Tehrani, Mohsen; Rafiei, Alireza; Hedayatizadeh-Omran, Akbar; Alizadeh-Navaei, Reza

    2015-09-15

    Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) provides a powerful tool for precise gene expression analysis. The accuracy of the results highly depends on careful selection of a reference gene for data normalization. HPRT1 (hypoxanthine phosphoribosyl transferase 1) is a frequently used housekeeping gene for normalizing relative expression values. However, the existence of processed pseudogenes for HPRT1 might interfere with reliable results obtained in qRT-PCR due to amplification of unintended products. Here, we designed a primer pair for pseudogene-free amplification of HPRT1 in qRT-PCR. We demonstrate that this primer pair specifically amplified HPRT1 messenger RNA (mRNA) sequence while avoiding coamplification of the pseudogenes. PMID:26050630

  19. Varicella-zoster virus distribution in Ramsay Hunt syndrome revealed by polymerase chain reaction.

    PubMed

    Murakami, S; Nakashiro, Y; Mizobuchi, M; Hato, N; Honda, N; Gyo, K

    1998-03-01

    The pathogenesis of facial nerve paralysis and vestibulo-cochlear dysfunction of Ramsay Hunt syndrome remains unclear as varicella-zoster virus (VZV) has not been demonstrated in the lesions. Using the polymerase chain reaction, we detected VZV genomes not only in the vesicles on the auricles or oral cavity but also in the facial nerve sheath, middle ear mucosa and cerebrospinal fluid from patients with Ramsay Hunt syndrome. The VZV genome was undetectable in the same kinds of clinical samples obtained from control patients with facial nerve paralysis of other etiologies. The results indicated that VZV spreads widely in the neural components, mucocutaneous tissue and cerebrospinal fluid. The present study will facilitate better understanding of the pathogenesis of facial nerve paralysis, vertigo, hearing impairment and other cranial nerve dysfunction of Ramsay Hunt syndrome. PMID:9583779

  20. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis.

    PubMed

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming

    2016-03-01

    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment. PMID:26648455

  1. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    PubMed

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  2. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.

    PubMed Central

    Alexander, H S; Key, D W; Nagy, E

    1998-01-01

    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb BamHI fragment of the Ontario 1598 ILTV strain. Thirty-four of the Ontario isolates and all of the New Brunswick isolates were amplified successfully. This suggests that the selected primers would be useful for the majority of the isolates encountered in outbreaks of ILTV. Images Figure 1. Figure 2. PMID:9442943

  3. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  4. Detection of varicella-zoster virus (VZV) DNA in clinical samples from patients with VZV by the polymerase chain reaction.

    PubMed Central

    Kido, S; Ozaki, T; Asada, H; Higashi, K; Kondo, K; Hayakawa, Y; Morishima, T; Takahashi, M; Yamanishi, K

    1991-01-01

    A polymerase chain reaction system for the detection of varicella-zoster virus was established. Of 25 nucleotides, 4 oligonucleotide pairs (regions of thymidine kinase, thymidylate synthetase, glycoprotein I, and immediate early gene) were synthesized. The first three oligonucleotide pairs could be used as primers on the basis of specific DNA amplification. Varicella-zoster virus DNA was amplified by this polymerase chain reaction system in 20 of 20 vesicle samples, 5 of 6 crusts, and 12 of 13 throat swabs collected from patients with clinical varicella. Images PMID:1847154

  5. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction

    PubMed Central

    Elshawadfy, Ashraf M.; Keith, Brian J.; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A.

    2014-01-01

    The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the “forked-point” (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the “forked-point” and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms. PMID:24904539

  6. Development of a polymerase chain reaction test for specific identification of the urinary tract pathogen Aerococcus urinae.

    PubMed Central

    Aguirre, M; Collins, M D

    1993-01-01

    A polymerase chain reaction test was developed for identification of the gram-positive urinary tract pathogen Aerococcus urinae. Oligonucleotide primers were based on highly specific sequences within the small-subunit rRNA gene. A confirmatory test based on hybridization of the amplified products to a highly specific internal probe was also developed. Images PMID:7684752

  7. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  8. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section 147.30 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section 147.31 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  11. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  12. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section 147.30 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  13. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section 147.31 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  14. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis. PMID:27032252

  15. EFFECTIVE METHOD TO EXTRACT DNA FROM ENVIRONMENTAL SAMPLES FOR POLYMERASE CHAIN REACTION AMPLIFICATION AND DNA FINGERPRINT ANALYSIS

    EPA Science Inventory

    A rapid direct-extraction method was used to obtain DNA from environmental soil samples. eat, enzymes, and guanidine isothiocyanate were utilized to lyse cells. he DNA was purified by agarose gel electrophoresis, amplified with 16S based primers by use of the polymerase chain rea...

  16. Direct detection of Mycobacterium tuberculosis in respiratory specimens in a clinical laboratory by polymerase chain reaction.

    PubMed Central

    Forbes, B A; Hicks, K E

    1993-01-01

    The emergence of epidemic multiple-drug-resistant (MDR) strains of Mycobacterium tuberculosis in conjunction with an increase in the number of reported cases of tuberculosis (TB) represents a major public health problem. In light of a recent outbreak of MDR M. tuberculosis at our center, we began the development of a polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary TB using two sets of primers, one based on the IS6110 repeated sequence of M. tuberculosis and the other based on the protein antigen b (PAB). Reaction conditions were first optimized as to the appropriate extraction protocol and the concentrations of primer pairs, nucleotides, and MgCl2. Following a preliminary evaluation of the assay with clinical specimens, extraction and amplification procedures were further modified. PAB and IS6110 primers detected between 2 and 23 and 0.023 and 0.23 CFU of M. tuberculosis, respectively, in pooled, M. tuberculosis-negative sputa by our optimized PCR assay. After routine processing for mycobacteria, 734 specimens were subsequently amplified. DNA for amplification was obtained by boiling and beating the sediments with Tween 20. For each reaction, DNA (10 microliters) was added to an amplification mixture containing 12 pmol of IS6110 primers, 20 pmol of PAB primers, 2 mM MgCl2, 200 microM nucleotides, and 2.5 U of Taq polymerase and the mixture was then amplified for 40 cycles. The sensitivity and specificity of our PCR assay were 87.2 and 97.7%, respectively. We were unable to interpret the results for seven specimens (1%). In our experience, PCR proved to be a useful rapid diagnostic test for TB in a clinical setting and a valuable epidemiological tool for determining exposure groups in the hospital setting. Our findings also underscore the need for the systematic optimization of PCR assay conditions. Images PMID:8349744

  17. Use of polymerase chain reaction for diagnosis of picornavirus infection in subjects with and without respiratory symptoms.

    PubMed Central

    Johnston, S L; Sanderson, G; Pattemore, P K; Smith, S; Bardin, P G; Bruce, C B; Lambden, P R; Tyrrell, D A; Holgate, S T

    1993-01-01

    Rhinoviruses and enteroviruses are the major members of the picornavirus genus that cause human disease. We compared the polymerase chain reaction and viral culture for the identification of picornaviruses in nasal aspirates from children during episodes of respiratory symptoms and when asymptomatic and from asymptomatic adults. One hundred eight children, aged 9 to 11 years, completed a year-long study. Within 24 to 48 h of a report of respiratory symptoms, a nasal aspirate was taken in the home. Nasal aspirates were also taken from 65 of the children and from 33 normal adults when they had been free of respiratory symptoms for at least 2 weeks. Picornaviruses were isolated by culture for three passages in Ohio HeLa cells in rolling tubes at 33 degrees C and pH 7.0. For the polymerase chain reaction, duplicate 50-microliters samples were amplified with conserved primers from the 5' noncoding region. Picornaviruses generated approximately 380-bp bands in agarose gel electrophoresis; the specificity of these bands was confirmed by filter hybridization with a conserved internal probe. Picornaviruses were isolated by culture in 47 (46 rhinoviruses) of 292 symptomatic episodes (16%), whereas the polymerase chain reaction identified picornavirus genomic material in 146 episodes (50%), including all but one of the culture-positive episodes. As for asymptomatic samples, eight (12%) children and two (4%) adults were positive by the polymerase chain reaction, whereas only one child's specimen was positive by culture. This polymerase chain reaction assay represents a clear advance in the identification of picornavirus infection, with a detection rate threefold greater than the virus culture method. Images PMID:8380179

  18. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  19. Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis.

    PubMed

    Setthawongsin, Chanokchon; Techangamsuwan, Somporn; Tangkawattana, Sirikachorn; Rungsipipat, Anudep

    2016-08-01

    Canine transmissible venereal tumor (CTVT) is the only naturally contagious tumor that is transmitted during coitus or social behaviors. Based on the tumor's location, the diagnosis of genital TVT (GTVT) is comparably easier than those in the extragenital area (ETVT) that are more easily incorrectly diagnosed. Fortunately, CTVT cells contain a specific long interspersed nuclear elements (LINE), inserted upstream of the myc gene, allowing a diagnostic polymerase chain reaction (PCR) based detection assay. The objectives of this study were aimed to improve the diagnostic accuracy by applying the diagnostic LINE1-c-myc PCR assay and fine needle aspiration (FNA) collection in direct comparison with standard cytological and histopathological analyses. Seventy-four dogs, comprised of 41 and 31 dogs with tumor masses at their external genitalia and extragenital areas (e.g. skin and nasal cavity), respectively, were included in this study. The signalment of these 65 dogs and clinical history of 20 client-owned dogs were collected. Samples were taken by biopsy for both histopathological examination and FNA for cytological examination and diagnostic PCR. The PCR products from 10 apparently CTVT samples were purified and sequenced. Sixty-one CTVT cases were diagnosed by cytological and histological analyses, but 65 were positive by the PCR assay. Overall, the PCR assay improved the accuracy of diagnostic CTVT results, especially for the more difficult ETVT tumors. Moreover, this PCR-based approach can facilitate the decision as to discontinue chemotherapy by discrimination between residual tumor cell masses and fibrotic tissue. PMID:27075116

  20. Novel multi-targeted polymerase chain reaction for diagnosis of presumed tubercular uveitis

    PubMed Central

    2013-01-01

    Background The objective of this study was to report the use of multi-targeted polymerase chain reaction (PCR) in the diagnosis of presumed tubercular uveitis. Multi-targeted PCR using three targets specific for Mycobacterium tuberculosis, i.e., IS6110, MPB64, and protein b, was performed on intraocular fluid samples of 25 subjects. Nine had presumed tubercular uveitis, six had intraocular inflammation secondary to a nontubercular etiology (disease controls), and ten had no evidence of intraocular inflammation (normal controls). As described previously, response to antitubercular therapy was considered as the gold standard. Results Multi-targeted PCR was positive in seven out of nine patients with presumed tubercular uveitis and negative in all normal and disease controls. The sensitivity and specificity were 77.77% and 100%, respectively. For the diagnosis of presumed tubercular uveitis, multi-targeted PCR had a positive predictive value of 100% and a negative predictive value of 88.88%. Conclusion Multi-targeted PCR can be a valuable tool for diagnosing presumed tubercular uveitis. PMID:23514226

  1. Effect of single mismatches at 3′–end of primers on polymerase chain reaction

    PubMed Central

    Simsek, M; Adnan, H

    2000-01-01

    Objective and Method To investigate the effect of three different mismatches (G/T, G/A or G/G) at the 3′–end of a primer to amplify a 268 bp (base pair) region of the human β–globin gene using different annealing temperatures (45 to 65°C). Results The primer with the G/T mismatch was as efficient as the normal primer (G/C match) in the amplification of a 268 bp product at all temperatures tested. However, the primers having G/A or G/G mismatches at the 3′-end did not produce any specific polymerase chain reaction (PCR) fragment at all the annealing temperatures used, except a barely detectable 268 bp product for the G/G mismatch at 45 and 50°C. Conclusion We conclude that our PCR system was refractory to amplification when one of the primers contained a G/A or G/G mismatch at the 3′–end with template DNA. PMID:24019700

  2. Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction.

    PubMed Central

    Szabo, E A; Pemberton, J M; Desmarchelier, P M

    1993-01-01

    The polymerase chain reaction (PCR) was used as the basis for the development of highly sensitive and specific diagnostic tests for organisms harboring botulinum neurotoxin type A through E genes. Synthetic DNA primers were selected from nucleic acid sequence data for Clostridium botulinum neurotoxins. Individual components of the PCR for each serotype (serotypes A through E) were adjusted for optimal amplification of the target fragment. Each PCR assay was tested with organisms expressing each of the botulinum neurotoxin types (types A through G), Clostridium tetani, genetically related nontoxigenic organisms, and unrelated strains. Each assay was specific for the intended target. The PCR reliably identified multiple strains having the same neurotoxin type. The sensitivity of the test was determined with different concentrations of genomic DNA from strains producing each toxin type. As little as 10 fg of DNA (approximately three clostridial cells) was detected. C. botulinum neurotoxin types A, B, and E, which are most commonly associated with human botulism, could be amplified from crude DNA extracts, from vegetative cells, and from spore preparations. This suggests that there is great potential for the PCR in the identification and detection of botulinum neurotoxin-producing strains. Images PMID:8215372

  3. Specific detection of Campylobacter jejuni and Campylobacter coli by using polymerase chain reaction.

    PubMed Central

    Oyofo, B A; Thornton, S A; Burr, D H; Trust, T J; Pavlovskis, O R; Guerry, P

    1992-01-01

    Development of a routine detection assay for Campylobacter jejuni and Campylobacter coli in clinical specimens was undertaken by using the polymerase chain reaction (PCR). An oligonucleotide primer pair from a conserved 5' region of the flaA gene of C. coli VC167 was used to amplify a 450-bp region by PCR. The primer pair specifically detected 4 strains of C. coli and 47 strains of C. jejuni; but it did not detect strains of Campylobacter fetus, Campylobacter lari, Campylobacter upsaliensis, Campylobacter cryaerophila, Campylobacter butzleri, Campylobacter hyointestinalis, Wolinella recta, Helicobacter pylori, Escherichia coli, Shigella spp., Salmonella spp., Vibrio cholerae, Citrobacter freundii, or Aeromonas spp. By using a nonradioactively labeled probe internal to the PCR product, the assay could detect as little as 0.0062 pg of purified C. coli DNA, or the equivalent of four bacteria. In stools seeded with C. coli cells, the probe could detect between 30 and 60 bacteria per PCR assay. The assay was also successfully used to detect C. coli in rectal swab specimens from experimentally infected rabbits and C. jejuni in human stool samples. Images PMID:1400961

  4. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates.

    PubMed

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N

    2004-01-01

    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  5. Detection of coliform bacteria in water by polymerase chain reaction and gene probes.

    PubMed Central

    Bej, A K; Steffan, R J; DiCesare, J; Haff, L; Atlas, R M

    1990-01-01

    Polymerase chain reaction (PCR) amplification and gene probe detection of regions of two genes, lacZ and lamB, were tested for their abilities to detect coliform bacteria. Amplification of a segment of the coding region of Escherichia coli lacZ by using a PCR primer annealing temperature of 50 degrees C detected E. coli and other coliform bacteria (including Shigella spp.) but not Salmonella spp. and noncoliform bacteria. Amplification of a region of E. coli lamB by using a primer annealing temperature of 50 degrees C selectively detected E. coli and Salmonella and Shigella spp. PCR amplification and radiolabeled gene probes detected as little as 1 to 10 fg of genomic E. coli DNA and as a few as 1 to 5 viable E. coli cells in 100 ml of water. PCR amplification of lacZ and lamB provides a basis for a method to detect indicators of fecal contamination of water, and amplification of lamB in particular permits detection of E. coli and enteric pathogens (Salmonella and Shigella spp.) with the necessary specificity and sensitivity for monitoring the bacteriological quality of water so as to ensure the safety of water supplies. Images PMID:2306085

  6. Detection of Pneumocystis carinii DNA in sputum and bronchoalveolar lavage samples by polymerase chain reaction.

    PubMed Central

    Olsson, M; Elvin, K; Löfdahl, S; Linder, E

    1993-01-01

    A polymerase chain reaction (PCR)-based assay was developed for the detection of Pneumocystis carinii DNA in induced sputum and bronchoscopic alveolar lavage samples. The primer pair was selected from the published sequence of the thymidylate synthase gene of P. carinii derived from infected rats. The amplified DNA fragment of 403 bp was detected by agarose gel electrophoresis and by Southern and slot blot hybridization. No positive reaction was seen with DNA from different microorganisms typically found in the respiratory tract. P. carinii DNA was demonstrated in 30 of 42 sputum samples from immunosuppressed patients, whereas 21 of 42 sputum samples were positive by indirect immunofluorescence (IFL). Among the 42 patients, 14 were receiving prophylactic chemotherapy. In that group, PCR detected P. carinii in nine sputum samples, whereas IFL detected P. carinii in only four sputum samples. A positive PCR result was also seen in 5 of 43 IFL-negative bronchoscopic alveolar lavage samples from patients with respiratory symptoms. The PCR assay detected 10 copies of the target DNA, which corresponds to 10(-18) g of the specific P. carinii sequence. The results indicate that PCR amplification in combination with DNA hybridization is specific and is a more sensitive diagnostic method than IFL for the detection of P. carinii. Images PMID:8432806

  7. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    NASA Astrophysics Data System (ADS)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  8. Tuberculosis-associated hemophagocytic lymphohistiocytosis in adolescent diagnosed by polymerase chain reaction

    PubMed Central

    Seo, Ju-Hee; Lee, Jun Ah; Kim, Dong Ho; Cho, Joongbum

    2016-01-01

    We present a case of tuberculosis-associated hemophagocytic lymphohistiocytosis in a 14-year-old girl. The patient presented with weight loss, malaise, fatigue, prolonged fever, and generalized lymphadenopathy. Laboratory investigation revealed pancytopenia (white blood cells, 2,020 cells/µL; hemoglobin, 10.2 g/dL; platelets, 52,000 cells/µL), hypertriglyceridemia (229 mg/dL), and hyperferritinemia (1,420 ng/mL). Bone marrow biopsy showed a hypocellular bone marrow with a large numbers of histiocytes and marked hemophagocytosis; based on these findings, she was diagnosed with hemophagocytic lymphohistiocytosis. Polymerase chain reaction (PCR) with both the bone marrow aspiration and sputum samples revealed the presence of Mycobacterium tuberculosis. Antitubercular therapy with immune modulation therapy including dexamethasone and intravenous immunoglobulin was initiated. The results of all laboratory tests including bone marrow biopsy and PCR with both the bone marrow aspiration and sputum samples were normalized after treatment. Thus, early bone marrow biopsy and the use of techniques such as PCR can avoid delays in diagnosis and improve the survival rates of patients with tuberculosis-associated hemophagocytic lymphohistiocytosis. PMID:26893604

  9. Range of phytoplasma concentrations in various plant hosts as determined by competitive polymerase chain reaction.

    PubMed

    Berges, R; Rott, M; Seemüller, E

    2000-10-01

    ABSTRACT For competitive polymerase chain reaction (PCR), an internal standard DNA template was developed that consisted of a highly conserved, internally deleted 16S rDNA fragment of an aster yellows phytoplasma. The internal standard was calibrated using a quantified culture of Acholeplasma laidlawii. Serial dilutions of the internal standard and fixed amounts of target templates from infected plants were coamplified with the same primers, and the products obtained were quantified using an enzyme-linked immunosorbent assay procedure. Analysis of the data revealed that the phytoplasma concentration in the plants examined differed by a factor of about 4 x 10(6). Phytoplasma concentrations of 2.2 x 10(8) to 1.5 x 10(9) cells per g of tissue were identified in periwinkles infected with various phytoplasmas. High to moderate concentrations were detected in Malus domestica (apple) genotypes infected with the apple proliferation phytoplasma, Alnus glutinosa (alder) genotypes infected with the alder yellows phytoplasma, and most aster yellows-infected Populus (poplar) genotypes examined. Very low phytoplasma concentrations, ranging from 370 to 34,000 cells per g of tissue, were identified in proliferation-diseased apple trees on resistant rootstocks 4551 and 4608, yellows-diseased Quercus robur (oak) trees, and Carpinus betulus (hornbeam) trees. Such low concentrations, which corresponded to about 4 to 340 cells in the reaction mixture, could only be detected and quantified by nested PCR. PMID:18944479

  10. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    PubMed Central

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770