Science.gov

Sample records for multiplex polymerase chain

  1. Thermally multiplexed polymerase chain reaction

    PubMed Central

    Phaneuf, Christopher R.; Pak, Nikita; Saunders, D. Curtis; Holst, Gregory L.; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L.; Jerris, Robert; Forest, Craig R.

    2015-01-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously—each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  2. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  3. Detection of Microsatellite Instability by Fluorescence Multiplex Polymerase Chain Reaction

    PubMed Central

    Berg, Karin D.; Glaser, Cynthia L.; Thompson, Richard E.; Hamilton, Stanley R.; Griffin, Constance A.; Eshleman, James R.

    2000-01-01

    We have created a clinical molecular diagnostic assay to test for microsatellite instability (MSI) at multiple loci simultaneously in paraffin-embedded surgical pathology colon resection specimens. This fluorescent multiplex polymerase chain reaction (PCR) assay analyzes the five primary microsatellite loci recommended at the 1997 National Cancer Institute-sponsored conference on MSI for the identification of MSI or replication errors in colorectal cancer: Bat-25, Bat-26, D2S123, D5S346, and D17S250. Amplicon detection is accomplished by capillary electrophoresis using the ABI 310 Genetic Analyzer. Assay validation compared 18 specimens previously assessed by radioactive PCR and polyacrylamide gel electrophoresis detection to results generated by the reported assay. Germline and tumor DNA samples were amplified in separate multiplex PCR reactions, sized in separate capillary electrophoresis runs, and compared directly to identify novel length alleles in tumor tissue. A concordance of 100% between the two modalities was achieved. The multiplex assay routinely detected a subpopulation of 10% tumor alleles in the presence of 90% normal alleles. A novel statistical model was generated that corroborates the validity of using results generated by analysis of five independent microsatellites to achieve a single overall MSI diagnosis. The assay presented is superior to standard radioactive monoplex PCR, polyacrylamide gel electrophoretic analysis, primarily due to the multiplex PCR format. PMID:11272898

  4. Single Multiplex Polymerase Chain Reaction To Detect Diverse Loci Associated with Diarrheagenic Escherichia coli

    PubMed Central

    López-Saucedo, Catalina; Cerna, Jorge F.; Villegas-Sepulveda, Nicolas; Thompson, Rocío; Velazquez, F. Raul; Torres, Javier; Tarr, Phillip I.

    2003-01-01

    We developed and tested a single multiplex polymerase chain reaction (PCR) that detects enterotoxigenic, enteropathogenic, enteroinvasive, and Shiga-toxin–producing Escherichia coli. This PCR is specific, sensitive, and rapid in detecting target isolates in stool and food. Because of its simplicity, economy, and efficiency, this protocol warrants further evaluation in large, prospective studies of polymicrobial substances. PMID:12533296

  5. Multiplex polymerase chain reaction method for differentiating western and northern corn rootworm larvae (Coleoptera: Chrysomelidae).

    PubMed

    Roehrdanz, Richard L

    2003-06-01

    Western corn rootworm, Diabrotica virgifera virgifera LeConte, and northern corn rootworm, D. barberi Smith and Lawrence, are sympatric species and serious pests of corn cultivation in North America. Comparison of nucleotide sequence of mitochondrial cytochrome oxidase I and II was used to design polymerase chain reaction (PCR) primers that discriminate immature stages of the two species based on differences in amplicon size. Multiplex PCR can be used to give a positive test for each species in a single amplification reaction. This provides a method to identify field caught larvae and facilitates investigations of larval interaction and competition between the species. PMID:12852603

  6. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  7. A Multiplex Polymerase Chain Reaction Microarray Assay to Detect Bioterror Pathogens in Blood

    PubMed Central

    Tomioka, Keiko; Peredelchuk, Michael; Zhu, Xiangyang; Arena, Roberto; Volokhov, Dmitri; Selvapandiyan, Angamuthu; Stabler, Katie; Mellquist-Riemenschneider, Jenny; Chizhikov, Vladimir; Kaplan, Gerardo; Nakhasi, Hira; Duncan, Robert

    2005-01-01

    Heightened concern about the dangers of bioterrorism requires that measures be developed to ensure the safety of the blood supply. Multiplex detection of such agents using a blood-screening DNA microarray is a sensitive and specific method to screen simultaneously for a number of suspected agents. We have developed and optimized a multiplex polymerase chain reaction microarray assay to screen blood for three potential bioterror bacterial pathogens and a human ribosomal RNA gene internal control. The analytical sensitivity of the assay was demonstrated to be 50 colony-forming units/ml for Bacillus anthracis, Francisella tularensis, and Yersinia pseudotuberculosis (surrogate for Yersinia pestis). The absence of any false-positives demonstrated high analytical specificity. Screening B. anthracis-infected mouse blood samples and uninfected controls demonstrated effectiveness and specificity in a preclinical application. This study represents proof of the concept of microarray technology to screen simultaneously for multiple bioterror pathogens in blood samples. PMID:16237218

  8. Detection and typing of lymphotropic herpesviruses by multiplex polymerase chain reaction.

    PubMed

    Pozo, F; Tenorio, A

    1999-04-01

    A multiplex nested-polymerase chain reaction (PCR) method was developed for the simultaneous detection and typing of all human lymphotropic herpesviruses described to date, including Ebstein Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus 6, variants A and B (HHV6-A, HHV6-B), human herpesvirus 7 (HHV7) and human herpesvirus 8 (HHV8). Oligonucleotide primers were designed to amplify a highly conserved region within the DNA polymerase gene. Each reaction component and thermal cycling parameters were thoroughly standardized to achieve optimal specificity and sensitivity for the PCR assay, which was estimated at about 10-100 molecules for each virus. An internal control, consisting of 100 molecules of a cloned fragment of the porcine pseudorabies herpesvirus (PrV) genome, was included to detect false negative results. To assess suitability and clinical application of the multiplex PCR method, a total of 35 well-characterized specimens, including Kaposi's sarcoma skin lesions, serum, cerebrospinal fluid, saliva and urine samples, were tested. Results obtained suggest this technique could be applied as a sole diagnostic tool in several clinical settings in which herpesviral infection is suspected and differential diagnosis required, avoiding the need to test specimens by separate PCR methods. PMID:10328531

  9. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    PubMed

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  10. Genotyping by multiplex polymerase chain reaction for detection of endemic hepatitis B virus transmission.

    PubMed Central

    Repp, R; Rhiel, S; Heermann, K H; Schaefer, S; Keller, C; Ndumbe, P; Lampert, F; Gerlich, W H

    1993-01-01

    A nested polymerase chain reaction (PCR) protocol was developed for rapid genotyping of hepatitis B virus (HBV). During the first PCR round, a universal HBV primer pair was used to amplify the entire pre-S region of the HBV genome. Within the pre-S region, many nucleotide exchanges are observed. These are partly correlated to the serological hepatitis B surface antigen subtypes. Five additional subtype-specific primers were selected from that region which, together with two universal non-group-specific primers, generated specific combinations of two to four DNA fragments of defined sizes. By this approach, 55 hepatitis B surface antigen-positive patients from a pediatric oncology unit in Germany were analyzed. Fifty-four patients who had been infected within 2 years had an identical pattern in the multiplex PCR, suggesting a common source of infection and person-to-person transmission within the unit. One child who was infected 5 years later had a different PCR pattern and, therefore, must have been infected from a different source. Furthermore, 109 serum samples taken from pregnant Cameroonian women and 25 serum samples from their babies taken 6 months after birth were analyzed. In one case, mother-to-infant transmission of the virus was demonstrated. Apart from its role in epidemiological studies on HBV, multiplex PCR may also be a useful tool for rapid genetic analysis in other fields if there is a moderate degree of sequence variation which enables the design of specific primers. Images PMID:8501209

  11. Monochrome Multiplexing in Polymerase Chain Reaction by Photobleaching of Fluorogenic Hydrolysis Probes.

    PubMed

    Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; von Stetten, Felix

    2016-03-01

    Multiplexing in polymerase chain reaction (PCR) is a technique widely used to save cost and sample material and to increase sensitivity compared to distributing a sample to several singleplex reactions. One of the most common methods to detect the different amplification products is the use of fluorogenic probes that emit at different wavelengths (colors). To reduce the number of detection channels, several methods for monochrome multiplexing have been suggested. However, they pose restrictions to the amplifiable target length, the sequence, or the melting temperature. To circumvent these limitations, we suggest a novel approach that uses different fluorophores with the same emission maximum. Discrimination is achieved by their different fluorescence stability during photobleaching. Atto488 (emitting at the same wavelength as 6-carboxyfluorescein, FAM) and Atto467N (emitting at the same wavelength as cyanine 5, Cy5) were found to bleach significantly less than FAM and Cy5; i.e., the final fluorescence of Atto dyes was more than tripled compared to FAM and Cy5. We successfully applied this method by performing a 4-plex PCR targeting antibiotic resistance genes in S. aureus using only 2 color channels. Confidence of discrimination between the targets was >99.9% at high copy initial copy numbers of 100 000 copies. Cases where both targets were present could be discriminated with equal confidence for Cy5 channel and reduced levels of confidence (>68%) for FAM channel. Moreover, a 2-plex digital PCR reaction in 1 color channel was shown. In the future, the degree of multiplexing may be increased by adding fluorogenic probe pairs with other emission wavelengths. The method may also be applied to other probe and assay formats, such as Förster resonance energy transfer (FRET) probes and immunoassays. PMID:26840905

  12. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future. PMID:26078959

  13. Detection of pathogenic Yersinia enterocolitica using the multiplex polymerase chain reaction.

    PubMed Central

    Harnett, N.; Lin, Y. P.; Krishnan, C.

    1996-01-01

    A multiplex polymerase chain reaction (PCR) was developed to detect the presence of the ail, yst, and virF genes of Yersinia enterocolitica simultaneously, quickly and accurately. The amplified fragment sizes were 356 base-pairs (bp) for the ail gene, 134 bp for the yst gene, and 231 bp for the virF gene. The specificity of the amplified products was confirmed by hybridization with digoxigenin-labelled oligonucleotide probes. Amplification was successful whether the template was derived from a single colony of bacteria, aliquots of boiled bacterial suspensions, from DNA extracted from pure or mixed cultures or from stool specimens. Amplification of the virF gene was also achieved from strains of Y. pseudotuberculosis carrying the 70 kb plasmid but not with preparations from other related Yersinia species or from other members of the family Enterobacteriaceae. The detection limit we established was 5-10 colony forming units per millilitre (cfu/ml) and 1.0 pg of DNA. Images Fig. 1 Fig. 2 PMID:8760951

  14. Rapid discrimination of rabies viruses isolated from various host species in Brazil by multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Sato, Go; Tanabe, Hitomi; Shoji, Youko; Itou, Takuya; Ito, Fumio H; Sato, Tetsuo; Sakai, Takeo

    2005-08-01

    Rabies is carried mainly by mammalian carnivores and vampire bats in Latin America. However, rabies virus (RV) has been isolated in recent years from not only vampire bats in rural areas but also from several non-vampire bat species in urban areas, respectively. Therefore, rapid molecular screening is necessary for efficient epidemiology of these RVs. In this study, we investigated the usefulness of multiplex reverse transcription-polymerase chain reaction (RT-PCR) for determining the origins of 54 RV isolates from various host species in Brazil. And to evaluate the multiplex RT-PCR as a potential diagnostic tool, we investigated the sensitivity of this method. In addition, we compared the results with a phylogenetic tree developed from sequences of the RV glycoprotein (G protein) gene. Multiplex RT-PCR products showed five different sizes of products, whereas the phylogenic tree showed six groups. Of these six groups, four corresponded with the four sizes of the multiplex RT-PCR products. The other two groups showed correspondance with another one size of the multiplex RT-PCR products, indicating that multiplex RT-PCR results reflected the lineage of the 54 isolates. This study also showed that this method can detect trace amounts of RNA. In conclusion, this multiplex RT-PCR method allows the rapid, specific, and simultaneous detection of RVs isolated from various host species in Brazil. PMID:16036175

  15. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  16. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  17. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction

    USGS Publications Warehouse

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.

    2009-01-01

    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  18. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    PubMed

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  19. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    PubMed Central

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  20. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction.

    PubMed

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian

    2016-03-15

    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella. PMID:26933026

  1. A novel multiplexing, polymerase chain reaction-based assay for the analysis of chromosome 18q status in colorectal cancer.

    PubMed

    Erill, Nadina; Colomer, Anna; Calvo, Miquel; Vidal, August; Román, Ruth; Verdú, Montse; Cordón-Cardó, Carlos; Puig, Xavier

    2005-10-01

    Chromosome 18q allelic loss has been reported to have prognostic significance in stage II colorectal carcinoma. We have developed a fluorescent multiplex polymerase chain reaction assay to analyze five microsatellite markers (D18S55, D18S58, D18S61, D18S64, and D18S69) for allelic loss at the long arm of chromosome 18. Amplicon detection and evaluation was accomplished by capillary electrophoresis using an ABI 310 genetic analyzer. Robustness of the assay when performed on DNA extracted from formalin-fixed, paraffin-embedded tissue sections was confirmed by analyzing its repeatability and reproducibility. Allelic loss was assessed in 61 stage II colorectal tumors and was detected in 58% (31 of 53) of tumors not showing instability. As part of the study, results of 207 previous polymerase chain reaction/polyacrylamide-based assays were re-evaluated by two independent observers to determine the degree of concordance of visual evaluation. In the case of stage II colorectal tumors, when electropherogram results were compared with those obtained from visual evaluation of the same markers after polyacrylamide gel electrophoresis, discrepancies between observers were detected in 16.4% of determinations. In conclusion, we have developed a robust and reliable assay for multiplexed loss of heterozygosity determination that improves assessment of chromosome 18q allelic loss in colorectal tumors processed as routine formalin-fixed, paraffin-embedded specimens. PMID:16237217

  2. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  3. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination. PMID:24793853

  4. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction.

    PubMed

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D

    2014-09-01

    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  5. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    PubMed Central

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  6. Simultaneous detection of seven sexually transmitted agents in human immunodeficiency virus-infected Brazilian women by multiplex polymerase chain reaction.

    PubMed

    Souza, Raquel P; de Abreu, André L P; Ferreira, Érika C; Rocha-Brischiliari, Sheila C; de B Carvalho, Maria D; Pelloso, Sandra M; Bonini, Marcelo G; Gimenes, Fabrícia; Consolaro, Marcia E L

    2013-12-01

    We determined the prevalence of seven clinically important pathogens that cause sexually transmitted infections (STIs) (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, herpes simplex virus 1 [HSV-1], HSV-2, and Treponema pallidum), by using a multiplex polymerase chain reaction (M-PCR) in samples from Brazilian woman infected with human immunodeficiency virus 1 (HIV-1) and uninfected Brazilian women (controls). The M-PCR assay identified all STIs tested for and surprisingly, occurred association between the control and STIs. This association was probably caused by excellent HIV infection control and regular monitoring in these women established by public health strategies in Brazil to combat HIV/acquired immunodeficiency syndrome. Studies using this M-PCR in different populations may help to better elucidate the roles of STIs in several conditions. PMID:24080632

  7. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals.

    PubMed

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C

    2012-07-01

    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  8. Comparison between Culture and a Multiplex Quantitative Real-Time Polymerase Chain Reaction Assay Detecting Ureaplasma urealyticum and U. parvum

    PubMed Central

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR. PMID:25047036

  9. Detection of Salmonella enterica serovar Dublin by polymerase chain reaction in multiplex format.

    PubMed

    Zhai, Ligong; Kong, Xiaohan; Lu, Zhaoxin; Lv, Fengxia; Zhang, Chong; Bie, Xiaomei

    2014-05-01

    S. Dublin has caused widespread concerns in cattle produce. Using a comparative genomic method, two specific targets like SeD_A1118 and SeD_A2283 for S. Dublin identification were firstly obtained. An efficient multiplex PCR for S. Dublin detection based on the two novel specific genes and invA was therefore developed. PMID:24607499

  10. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    PubMed

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  11. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    PubMed Central

    Han, Jae-Ik; Chang, Dong-Woo

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 µL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  12. Capillary electrophoresis combining three-step multiplex polymerase chain reactions for diagnosing α-thalassemia.

    PubMed

    Chen, Yen-Ling

    2011-02-01

    Capillary electrophoresis (CE) is the most useful tool for DNA separation because of its high resolution. In this study, different kinds of polymers were used to evaluate the separation efficiency by analyzing a 200-bp DNA ladder. Under optimized CE conditions, the CE separation was performed by DB-17 capillary. The running buffer was a 1× TBE buffer containing 0.6% w/v poly(ethylene oxide) (PEO) (Mw: 8,000,000) and 1 μM YO-PRO-1; applied voltage was -10 kV (detector at anode side) and the separation temperature was 25°C. Under these optimal conditions, 15 DNA fragments with sizes ranging from 0.2 to 3.0 kb were resolved within 11.5 min and the RSD of migration time were less than 0.55% (n=3). This method, combined with three-step multiplex PCR, was applied to detect five α-thalassemia deletions, including -α(3.7) , -α(4.2) , - -(SEA) , - -(FIL) and - -(THAI) . A total of 21 patients diagnosed with α-thalassemia were analyzed using this developed method and all results agreed with those already obtained by gel electrophoresis. PMID:21298664

  13. Detection of Aeromonas salmonicida by reverse transcription-multiplex polymerase chain reaction.

    PubMed

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2012-01-01

    Aeromonas salmonicida is one of the major fish pathogens causing economically devastating losses in aquaculture. A. salmonicida subsp. salmonicida is a typical A. salmonicida causing furunculosis, while the other subspecies are atypical strains causing ulcer diseases. PCR-based methods of detecting A. salmonicida suffer from the drawback that they do not distinguish living (pathogenic) from dead cells. In this study, a method of detecting A. salmonicida was developed based on reverse transcription-multiplex PCR (RT-MPCR) using two sets of primers, SV1/SV2 and SF1/SF2, specific to the vapA gene and the fstB gene of A. salmonicida respectively. This method was found to detect A. salmonicida specifically with detection limits of 10 CFU in pure culture and 30 CFU in the presence of tissue debris. It was also found distinguish not only between viable and nonviable cells but also between typical and atypical strains of A. salmonicida. Using RT-MPCR, two DNA fragments, of 542 and 1,258 bp, were amplified from RNA of typical A. salmonicida, whereas only one DNA fragment, of 542 bp, was amplified from the RNA of the atypical ones. The proposed assay was also used successfully to detect A. salmonicida in artificially infected rainbow trout (Oncorhyncus mykiss). PMID:22484927

  14. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  15. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  16. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples.

    PubMed

    Tramuta, Clara; Lacerenza, Daniela; Zoppi, Simona; Goria, Mariella; Dondo, Alessandro; Ferroglio, Ezio; Nebbia, Patrizia; Rosati, Sergio

    2011-07-01

    The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion. PMID:21908306

  17. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  18. Multipurpose assessment for the quantification of Vibrio spp. and total bacteria in fish and seawater using multiplex real-time polymerase chain reaction

    PubMed Central

    Kim, Ji Yeun; Lee, Jung-Lim

    2014-01-01

    Background This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. Results The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL−1 in pure culture and seawater, and 10 CFU g−1 in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Conclusion Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:24752974

  19. Damage formation and repair efficiency in the p53 gene of cell lines and blood lymphocytes assayed by multiplex long quantitative polymerase chain reaction.

    PubMed

    Wang, Yu-Chieh; Lee, Pei-Jung; Shih, Chuen-Ming; Chen, Hsing-Yu; Lee, Chin-Chu; Chang, Yuan-Yen; Hsu, Yu-Ting; Liang, Ying-Ju; Wang, Li-Ya; Han, Wen-Hua; Wang, Yi-Ching

    2003-08-15

    We examined ultraviolet (UV) irradiation and cisplatin treatment damage formation and repair efficiency in the p53 tumor suppressor gene of various cultured cell lines and lymphocytes using a nonradioactive multiplex long quantitative polymerase chain reaction (QPCR) assay, which amplified a 7-kb fragment of the target gene and a 500-bp fragment of the template control to successfully increase the sensitivity and reliability of the assay. The multiplex long QPCR detected a lesion frequency of 0.63 lesions/10kb/10J/m(2) in the p53 gene of fibroblast cells. In addition, the multiplex long QPCR assay detected pronounced differences in the repair of UV damage in the p53 gene among repair-proficient CRL-1475 cells and repair-deficient XP-A and XP-C cells. The multiplex long QPCR assay was also evaluated as a sensitive assay for the detection of DNA damage induced by cisplatin. The data indicated that the lesion frequency in the p53 gene was 1.27-1.75 times higher in the H23 cisplatin-sensitive cell than in the H1435 cisplatin-resistant cell at the IC(70) dose. After 8-h and 24-h repair periods, only 13 and 75% of cisplatin-induced damage had been removed in the H23 cells, whereas these values were 92 and 100% in the H1435 cells. In addition, our data indicate that multiplex long QPCR is a sensitive method for validly estimating repair in freshly isolated lymphocytes. The results suggest that the current protocol of the multiplex long QPCR method can be used to assess the damage formation and repair efficiency of various agents at biologically relevant doses and to allow a more precise determination of gene-specific repair in disease susceptibility and drug resistance in epidemiological studies. PMID:12871714

  20. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay.

    PubMed

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C

    2016-05-01

    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers. PMID:26836486

  1. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  2. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  3. A preliminary trial using multi-target polymerase chain reaction (multiplex PCR) and restriction fragment length polymorphism (PCR-RFLP) on the same feedstuffs to detect tissues of animal origin.

    PubMed

    Colombo, F; Marchisio, E; Trezzi, I E; Peri, V; Pinotti, L; Baldi, A; Soncini, G

    2004-08-01

    A preliminary study using multi-target polymerase chain reaction (multiplex PCR) and restriction fragment length polymorphism (PCR-RFLP) was done on the same feedstuffs to detect animal tissues. The results of the two methods differ somewhat: PCR-RFLP did not detect any signal in any sample, but multiplex PCR detected a signal in one sample. These findings could be a basis for further investigations. PMID:15509020

  4. Identification of blood meal source and infection with Trypanosoma cruzi of Chagas disease vectors using a multiplex cytochrome b polymerase chain reaction assay.

    PubMed

    Mota, Javier; Chacon, Juan C; Gutiérrez-Cabrera, Ana E; Sánchez-Cordero, Víctor; Wirtz, Robert A; Ordoñez, Rosalinda; Panzera, Francisco; Ramsey, Janine M

    2007-01-01

    Long-term control of triatomine bugs in Chagas endemic regions will depend on a full understanding of vector-parasite-host interactions. Herein we describe a cytochrome b multiplex polymerase chain reaction (PCR)-based strategy for blood meal source identification in bug foregut contents. This technique discriminates human from animal blood, and has been tested in five Triatoma species from México. Host identification has been validated for human, four rodent species, two bat species, dog, rabbit, sheep, and opossum. In addition, Trypanosoma cruzi can be identified simultaneously using S34/S67-specific kinetoplast DNA primers. Both host and parasite identification were possible as long as 10 weeks after bug feeding, and in samples stored up to 6 years. The blood meal identification procedure described here represents a powerful tool for large-scale studies identifying the biological, ecological, and environmental variables associated with Chagas disease transmission. PMID:18021027

  5. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens

    PubMed Central

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-01-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas. PMID:20889890

  6. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    PubMed Central

    Bhat, M. Mansoor; Salahuddin, Mir; Mantoo, Imtiyaz A.; Adil, Sheikh; Jalal, Henna; Pal, M. Ashraf

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating) and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level. PMID:27057103

  7. Quantitation of Bt-176 maize genomic sequences by surface plasmon resonance-based biospecific interaction analysis of multiplex polymerase chain reaction (PCR).

    PubMed

    Feriotto, Giordana; Gardenghi, Sara; Bianchi, Nicoletta; Gambari, Roberto

    2003-07-30

    Surface plasmon resonance (SPR) based biosensors have been described for the identification of genetically modified organisms (GMO) by biospecific interaction analysis (BIA). This paper describes the design and testing of an SPR-based BIA protocol for quantitative determinations of GMOs. Biotinylated multiplex Polymerase Chain Reaction (PCR) products from nontransgenic maize as well as maize powders containing 0.5 and 2% genetically modified Bt-176 sequences were immobilized on different flow cells of a sensor chip. After immobilization, different oligonucleotide probes recognizing maize zein and Bt-176 sequences were injected. The results obtained were compared with Southern blot analysis and with quantitative real-time PCR assays. It was demonstrated that sequential injections of Bt-176 and zein probes to sensor chip flow cells containing multiplex PCR products allow discrimination between PCR performed using maize genomic DNA containing 0.5% Bt-176 sequences and that performed using maize genomic DNA containing 2% Bt-176 sequences. The efficiency of SPR-based BIA in discriminating material containing different amounts of Bt-176 maize is comparable to real-time quantitative PCR and much more reliable than Southern blotting, which in the past has been used for semiquantitative purposes. Furthermore, the approach allows the BIA assay to be repeated several times on the same multiplex PCR product immobilized on the sensor chip, after washing and regeneration of the flow cell. Finally, it is emphasized that the presented strategy to quantify GMOs could be proposed for all of the SPR-based, commercially available biosensors. Some of these optical SPR-based biosensors use, instead of flow-based sensor chips, stirred microcuvettes, reducing the costs of the experimentation. PMID:14705890

  8. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics. PMID:23384180

  9. Isolation and characterization of Shiga toxigenic Escherichia coli of animal and bird origin by multiplex polymerase chain reaction

    PubMed Central

    Neher, S.; Hazarika, A. K.; Barkalita, L. M.; Borah, P.; Bora, D. P.; Sharma, R. K.

    2016-01-01

    Aim: The purpose of this study was to determine the virulence genes and serotype of Shiga toxin producing Escherichia coli (STEC) strains isolated from animals and birds. Materials and Methods: A total of 226 different samples viz., fecal, intestinal content, rectal swab and heart blood were collected from different clinically affected/healthy animals and birds and were streaked on McConkeys’ lactose agar and eosin methylene blue agar for isolation of E. coli, confirmed by staining characteristics and biochemical tests. By polymerase chain reaction (PCR) all the E. coli isolates were screened for certain virulence genes, viz., Shiga toxin 1 (stx1), stx2 and eae and enterohemolytic (Ehly) phenotype was observed in washed sheep blood agar plate. All the isolated E. coli strains were forwarded to the National Salmonella and Escherichia Centre, Central Research Institute, Kasauli (Himachal Pradesh) for serotyping. Results: Out of 226 samples 138 yielded E. coli. All the isolates were screened for molecular detection of different virulent genes, viz. stx1, stx2 and eae, based on which 36 (26.08%) were identified as STEC. Among those STEC isolates, 15 (41.67%), 14 (38.89%), 1 (2.78%) exhibited eae, stx2, stx1 alone, respectively, whereas 4 (11.11%) and 2 (5.56%) carried both stx1 and stx2, stx2 and eae, respectively. Among the STEC isolates 22 were belonged to 15 different sero-groups, viz., O2, O20, O22, O25, O43, O60, O69, O90, O91, O95, O106, O118, O130, O162 and O170 and others were untypable. Ehly phenotype was observed in 10 (27.78%) the STEC isolates. Conclusion: The present study concluded that STEC could be isolated from both clinically affected as well as healthy animals and birds. Regular monitoring of more samples from animal and bird origin is important to identify natural reservoir of STEC to prevent zoonotic infection. PMID:27051196

  10. Simultaneous detection of Pyrethroid, Organophosphate and Cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex Polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans irritans (Linnaeus, 1758), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex...

  11. An integrated slidable and valveless microdevice with solid phase extraction, polymerase chain reaction, and immunochromatographic strip parts for multiplex colorimetric pathogen detection.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Kim, Do Hyun; Seo, Tae Seok

    2015-11-01

    A total integrated genetic analysis microsystem was developed, which consisted of solid phase extraction (SPE), polymerase chain reaction (PCR), and immunochromatographic strip (ICS) parts for multiplex colorimetric detection of pathogenic Staphylococcus aureus (S. aureus) and Escherichia coli O157:H7 (E. coli O157:H7) on a portable genetic analyzer. Utilizing a slidable chamber, which is a movable glass wafer, complex microvalves could be eliminated for fluidic control in the microchannel, which could simplify the chip design and chip operation. The integrated slidable microdevice was composed of 4 layers: a 4-point Pt/Ti resistance temperature detector (RTD) wafer, a micro-patterned channel wafer, a 2 μL volume slidable chamber, and an ICS. The entire process from the DNA extraction in the SPE chamber to the detection of the target gene expression by the ICS was serially performed by simply sliding the slidable chamber from one part to another functional part. The total process for multiplex pathogenic S. aureus and E. coli O157:H7 detection on the integrated slidable microdevice was accomplished within 55 min with a detection limit of 5 cells. Furthermore, spiked bacteria samples in milk were also successfully analysed on the portable genetic analysis microsystem with sample-in-answer-out capability. The proposed total integrated microsystem is adequate for point-of-care DNA testing in that no microvalves and complex tubing systems are required due to the use of the slidable chamber and the bulky and expensive fluorescence or electrochemical detectors are not necessary due to the ICS based colorimetric detection. PMID:26394907

  12. A rapid, 2-well, multiplex real-time polymerase chain reaction assay for the detection of SCCmec types I to V in methicillin-resistant Staphylococcus aureus.

    PubMed

    Valvatne, Håvard; Rijnders, Michelle I A; Budimir, Ana; Boumans, Marie-Louise; de Neeling, Albert J; Beisser, Patrick S; Stobberingh, Ellen E; Deurenberg, Ruud H

    2009-12-01

    For us to assess the spread of methicillin-resistant Staphylococcus aureus (MRSA), typing of the staphylococcal cassette chromosome mec (SCCmec) is a valuable addition to existing typing methods, such as multilocus sequence typing (MLST). Traditional SCCmec typing assays, that is, that of Oliveira et al. and Ito et al., are polymerase chain reaction (PCR) based, requiring electrophoresis. We introduce a rapid, 2-well, multiplex real-time PCR assay that can be used directly on bacterial suspensions and is able to characterize SCCmec type I to V based on the detection of the ccr genes and the mec complex. The assay was evaluated on 212 clinical MRSA isolates from various countries, associated with MLST clonal complexes (CC) 1, 5, 8, 22, 30, and 45, as well as pig-associated CC398. When comparing the real-time PCR assay with traditional methods, the correct SCCmec element was identified in 209 (99%) of the 212 MRSA isolates. The new assay enables high-throughput analyses for SCCmec on large strain collections. PMID:19781888

  13. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. PMID:27208471

  14. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

    PubMed Central

    Torres, Luciene de Fátima Costa; Ribeiro, Dayana; Hirata, Raphael; Pacheco, Luis Gustavo Carvalho; Souza, Monica Cristina; dos Santos, Louisy Sanches; dos Santos, Cíntia Silva; Salah, Mohammad; da Costa, Mateus Matiuzzi; Ribeiro, Marcio Garcia; Selim, Salah A; Azevedo, Vasco Ariston de Carvalho; Mattos-Guaraldi, Ana Luiza

    2013-01-01

    Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR) assay that can simultaneously identify and determine the toxigenicity of these corynebacterial species with zoonotic potential was developed. This assay uses five primer pairs targeting the following genes: rpoB (Corynebacterium spp), 16S rRNA (C. ulcerans and C. pseudotuberculosis), pld (C. pseudotuberculosis), dtxR (C. diphtheriae) and tox [diphtheria toxin (DT) ]. In addition to describing this assay, we review the literature regarding the diseases caused by these pathogens. Of the 213 coryneform strains tested, the mPCR results for all toxigenic and non-toxigenic strains of C . diphtheriae, C. ulcerans and C. pseudotuberculosis were in 100% agreement with the results of standard biochemical tests and PCR-DT. As an alternative to conventional methods, due to its advantages of specificity and speed, the mPCR assay used in this study may successfully be applied for the diagnosis of human and/or animal diseases caused by potentially toxigenic corynebacterial species. PMID:23778659

  15. Detection of β-globin Gene Mutations Among β-thalassaemia Carriers and Patients in Malaysia: Application of Multiplex Amplification Refractory Mutation System–Polymerase Chain Reaction

    PubMed Central

    Hassan, Syahzuwan; Ahmad, Rahimah; Zakaria, Zubaidah; Zulkafli, Zefarina; Abdullah, Wan Zaidah

    2013-01-01

    Background: β-thalassaemia is one of the most common single-gene disorders worldwide. Each ethnic population has its own common mutations, accounting for the majority of cases, with a small number of mutations for the rarer alleles. Due to the heterogeneity of β-thalassaemia and the multi-ethnicity of Malaysians, molecular diagnostics may be expensive and time consuming. Methods: A simple polymerase chain reaction (PCR) approach involving a multiplex amplification refractory mutation system (MARMS) and one amplification refractory mutation system (ARMS), consisting of 20 β-globin gene mutations, were designed and employed to investigate β-thalassaemia patients and carriers. Results: Out of 169 carriers tested with the MARMS, Cd 41/42 (–TTCT), Cd 26 (A–G) HbE, IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 78.1%. Among the Malays, Cd 26 (A–G) HbE, Cd 41/42 (–TTCT), IVS 1–1 (G–T), and IVS 1–5 (G–C) were the most common mutations, accounting for 81.4%, whereas Cd 41/42 (–TTCT) and IVS 2–654 (C–T) were most common among the Chinese (79.1%). Conclusion: We propose the use of this cheap, easy to interpret, and simple system for the molecular diagnostics of β-thalassaemia among Malaysians at the Institute for Medical Research (IMR). PMID:23613656

  16. The etiology of genital ulcer disease by multiplex polymerase chain reaction and relationship to HIV infection among patients attending sexually transmitted disease clinics in Pune, India.

    PubMed

    Risbud, A; Chan-Tack, K; Gadkari, D; Gangakhedkar, R R; Shepherd, M E; Bollinger, R; Mehendale, S; Gaydos, C; Divekar, A; Rompalo, A; Quinn, T C

    1999-01-01

    The etiology of genital ulcer disease (GUD) and the relationship between GUD and HIV infection were investigated in 302 patients presenting to a sexually transmitted disease clinic in Pune, India, in a 3-month period in 1994. Swabs of each genital ulcer were tested for herpes simplex virus (HSV) antigen by enzyme immunoassay and processed in a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of HSV, Treponema pallidum, and Haemophilus ducreyi. The seroprevalence of HIV in this series was 22.2%. Clinical diagnosis of GUD was undermined when HIV infection was present. The etiology of GUD according to M-PCR was HSV in 26%, chancroid in 23%, primary syphilis in 10%, and multiple infections in 7%; no etiology could be identified in the remaining 34% of cases. Attempts to differentiate the etiology of GUD based solely on clinical grounds resulted in many inaccurate diagnoses. Chancroid was the most common clinical diagnosis (40%), followed by HSV (24%), syphilis (20%), and multiple infections (3%). HIV seroprevalence was significantly higher in patients with HSV compared with other etiologies (odds ratio, 2.1; 95% confidence interval, 1.2-3.7), presumably as a result of HIV-induced immunosuppression and consequent HSV reactivation. Until rapid, inexpensive, and sensitive assays become available, syndromic treatment with antibiotics should be provided to patients with GUD in order to reduce the risk of acquiring HIV infection. PMID:9918324

  17. Simultaneous genotyping of CYP2D6*3, *4, *5 and *6 polymorphisms in a Spanish population through multiplex long polymerase chain reaction and minisequencing multiplex single base extension analysis.

    PubMed

    Crescenti, A; Mas, S; Gassó, P; Baiget, M; Bernardo, M; Lafuente, A

    2007-10-01

    1. The aim of the present study was to perform a descriptive study of the prevalence of the four major CYP2D6 poor metaboliser (PM) alleles (*3, *4, *5 and *6) in a Spanish population (n = 290) using a method based on a new combination of multiplex long polymerase chain reaction (PCR) and minisequencing through multiplex single base extension (SBE) analysis. 2. The method was validated using different strategies, such as allelic discrimination assay and PCR-restriction fragment length polymorphism (RFLP). 3. The allele frequencies were similar to those described for other Spanish populations, namely 0.9% (95% confidence interval (CI) 0.5-1.3), 16.4% (95% CI 14.9-18.0), 2.7% (95% CI 2.0-3.4) and 0.7% (95% CI 0.3-1.0) for the *3, *4, *5 and *6 alleles, respectively. The results were satisfactory and left little doubt as to the genotypes, which were confirmed either by allelic discrimination assay (*4 and *6) or PCR-RFLP (*3) with 100% concordance. 4. The present study corroborates the low prevalence of the most frequent polymorphism (CYP2D6*4) that leads to null CYP2D6 activity in Spain and the allelic geographical gradient between Caucasian populations in the north and south. The present study reports a technique for the detection of four polymorphisms that account for 98% of the CYP2D6 defect alleles. This multiplex long PCR-SBE technique is a combination of several known methods to genotype CYP2D6 alleles (*3, *4, *5 and*6). Given the importance of CYP2D6 in drug metabolism and the need to genotype a large number of samples, we believe that this method will find broad application. PMID:17714084

  18. Pathotypic and Phylogenetic Study of Diarrheagenic Escherichia coli and Uropathogenic E. coli Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Salmani, Hamzeh; Azarnezhad, Asaad; Fayazi, Mohammad Reza; Hosseini, Arshad

    2016-01-01

    Background: Acute diarrheal disease and urinary tract infection are leading causes of childhood morbidity and mortality in the developing world. Diarrheagenic Escherichia coli (DEC) has been identified as a major etiologic agent of diarrhea worldwide, and urinary tract infection (UTI) caused by uropathogenic Escherichia coli (UPEC) is one of the most common bacterial infections among human beings. Quick and precise detection of these bacteria help provide more effective intervention and management of infection. Objectives: In this study we present a precise and sensitive typing and phylogenetic study of UPEC and DEC using multiplex PCR in order to simplify and improve the intervention and management of diarrheal and UT infections. Materials and Methods: In total, 100 urinary tract infection samples (UTI) and 200 specimens from children with diarrhea, which had been diagnosed with E. coli as the underlying agent by differential diagnosis using MacConkey’s agar and biochemical study, were submitted for molecular detection. Pathotyping of E. coli pathotypes causing urinary tract infection and diarrhea were examined using a two set multiplex PCR, targeting six specific genes. Phylogenetic typing was done by targeting three genes, including ChuA, YjaA and TspE4C2. Results: Overall, 88% of DEC and 54% of UTI isolates were positive for one or more of the six genes encoding virulence factors. Prevalence of the genes encoding virulence factors for DEC were 62%, 25%, 24%, 13%, 7% and 5% for ST (ETEC), LT (ETEC), aggR (EAggEC), daaD (DAEC), invE (EIEC) and eae (EPEC), respectively; whereas, the prevalence rates for the UTI samples were 23%, 14%, 6%, 6% and 4% for aggR (EAggEC), LT (ETEC), daaD (DAEC), invE (EIEC) and ST (ETEC), respectively. No coding virulence factors were detected for eae (EPEC). Group B2 was the most prevalent phylogroup and ST was the most frequently detected pathotype in all phylogroups. Conclusions: ETEC and EAggEC were the most detected E. coli among

  19. Multiplex polymerase chain reaction for the detection and differentiation of avian influenza viruses and other poultry respiratory pathogens.

    PubMed

    Rashid, S; Naeem, K; Ahmed, Z; Saddique, N; Abbas, M A; Malik, S A

    2009-12-01

    A multiplex reverse transcription-PCR (mRT-PCR) was developed and standardized for the detection of type A influenza viruses, avian influenza virus (AIV) subtype H7, H9, and H5 hemagglutinin gene with simultaneous detection of 3 other poultry respiratory pathogens, Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and infectious laryngotracheitis virus (ILTV). Seven sets of specific oligonucleotide primers were used in this study for the M gene of AIV and hemagglutinin gene of subtypes H7, H9, and H5 of AIV. Three sets of other specific oligonucleotide primers were used for the detection of avian respiratory pathogens other than AIV. The mRT-PCR DNA products were visualized by agarose gel electrophoresis and consisted of DNA fragments of 1,023 bp for M gene of AIV, 149 bp for IBV, 320 bp for NDV, and 647 bp for ILTV. The second set of primers used for m-RT-PCR of H7N3, H9N2, and H5N1 provided DNA products of 300 bp for H7, 456 bp for H5, and 808 bp for H9. The mRT-PCR products for the third format consisted of DNA fragments of 149 bp for IBV, 320 bp for NDV, 647 bp for ILTV, 300 bp for H7, 456 bp for H5, and 808 bp for H9. The sensitivity and specificity of mRT-PCR was determined and the test was found to be sensitive and specific for the detection of AIV and other poultry respiratory pathogens. In this present study, multiplex PCR technique has been developed to simultaneously detect and differentiate the 3 most important subtypes of AIV along with the 3 most common avian respiratory pathogens prevalent in poultry in Pakistan. Therefore, a mRT-PCR that can rapidly differentiate between these pathogens will be very important for the control of disease transmission in poultry and in humans, along with the identification of 3 of the most common respiratory pathogens often seen as mixed infections in poultry, and hence economic losses will be reduced in poultry. PMID:19903950

  20. Development of a multiplex polymerase chain reaction for the simultaneous detection of microsporidians, nucleopolyhedrovirus, and densovirus infecting silkworms.

    PubMed

    Ravikumar, G; Raje Urs, S; Vijaya Prakash, N B; Rao, C G P; Vardhana, K V

    2011-07-01

    We have developed a novel PCR-based assay for individual and simultaneous detection of three major pathogens (microsporidians, nucleopolyhedrovirus (NPV) and densovirus (DNV)) infecting the silkworm, Bombyx mori. Multiplex PCR, using three primer pairs, two of which were designed from the conserved regions of 16S small subunit ribosomal RNA gene of microsporidians, and polyhedrin gene of NPVs respectively, and a third primer pair designed from the internal sequences of B. mori DNVs (BmDNV), showed discrete and pathogen specific PCR products. The assay showed high specificity and sensitivity for the pathogenic DNA. Under optimized PCR conditions, the assay yielded a 794bp DNA fragment from Nosema bombycis, 471bp fragment from B. mori NPV (BmNPV) and 391bp fragment from BmDNV. Further, this detection method was successfully applied to other silkworm species such as Antheraea mylitta and Samia cynthia ricini, in detecting same or similar pathogens infecting them. This method is a valuable supplement to the conventional microscopic diagnostic methods and can be used for the early detection of pathogens infecting silkworms. Furthermore it can assist research and extension centers for the safe supply of disease-free silkworms to farmers. PMID:21570404

  1. Genotyping of Pseudomonas aeruginosa Type III Secretion System Using Magnetic Enrichment Multiplex Polymerase Chain Reaction and Chemiluminescence.

    PubMed

    Tang, Yongjun; Li, Bo; Dai, Jianguo; Dai, Jianfang; Wang, Xinhui; Si, Jing; Ali, Zeeshan; Li, Taotao; He, Nongyue

    2016-04-01

    The pathologic characteristics and toxicity mechanism of Pseudomonas aeruginosa are different in strains with different Type III secretion system (T3SS) genes. The T3SS gene based genotyping of P. aeruginosa strains is important to understand its virulence and predict the clinical outcomes. In this study, a rapid and automatable method for T3SS genotyping was developed using magnetic enrichment multiplex PCR and chemiluminescence. Three P. aeruginosa standard strains were analyzed using this method. The results showed that the chemiluminescent intensity of exoT, exoY, and exoS of these strains were 10 times greater than that of the control, and that their Q values were greater than 2.1. These results were consistent with the regular PCR and electrophoresis results, indicating that the method was reliable. Out of the 22 clinical isolates tested using this method, 100%, 72.7%, 95.5%, and 4.5% of the isolates contained exoT, exoY, exoS, and exoU genes, respectively. The isolates harbored either exoS or exoU gene, but not both. All genotyping results of the isolates were consistent with the information obtained using regular PCR and electrophoresis. PMID:27301202

  2. Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran

    PubMed Central

    Yamoudy, Mahire; Mirlohi, Maryam; Isfahani, Bahram Nasr; Jalali, Mohammad; Esfandiari, Zahra; Hosseini, Nafiseh Sadat

    2015-01-01

    Background: Since 2003, the incidence of community associated Clostridium difficile infection (CA-CDI) has increased; different types of food have been supposed to be the vectors of C. difficile strains. The purpose of this study is to investigate the occurrence of C. difficile strains in ready-to-eat salads distributed in food services. Materials and Methods: A total of 106 ready-made salad specimens were sampled from different restaurants and food services located in Isfahan, in the center of Iran. Positive isolates of C. difficile were identified and confirmed for the existence of three genes including tpi, tcdA and tcdB by multiplex PCR. Results: A total of six (5.66%) samples were positive for C. difficile strains. Of which, one strain (16.6%) was positive for A and B toxins. Conclusion: The existence of toxigenic C. difficile in ready-made salads could be a caution for public health. Further investigation is required to assess the relationship between the isolated strains in our study and those from diarrheic patients through molecular typing. PMID:26015913

  3. Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

    PubMed

    Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

    2014-05-19

    A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines. PMID:24842287

  4. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-01

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences. PMID:26669715

  5. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    PubMed

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  6. Fixed nuclei as alternative template of BIOMED-2 multiplex polymerase chain reaction for immunoglobulin gene clonality testing in B-cell malignancies

    PubMed Central

    Tang, Yuan; Chen, Jie; Wang, Jianchao; Zheng, Ke; Liao, Dianying; Liao, Xiaomei; Liu, Weiping; Wang, Lin

    2015-01-01

    Evaluation of immunoglobulin (Ig) gene rearrangements with BIOMED-2 multiplex PCR has become a standard detection of clonality in mature B cell malignancies. Conventionally, this method is relatively labor-intensive and time-consuming, as it requires DNA isolation from bone marrow aspirates (BM) or peripheral blood (PB) in patients with BM or PB involvement. On the other hand, fluorescence in situ hybridization (FISH) is routinely used as genetic screening in B cell malignancies, but the surplus fixed nuclei initially prepared for FISH usually turn useless afterwards. We sought to use these surplus nuclei after FISH as a template to perform PCR-based Ig gene clonality testing. Templates of 12 patients with mature B cell malignancies, which consisted of both DNA isolated with commercial DNA isolation kit from fresh BM or PB (DNA group) and the fixed nuclei initially prepared for FISH (nuclei group) from the same individuals, were subjected to PCR with BIOMED-2 primer sets for immunoglobulin heavy chain and kappa light chain under recommended conditions. Our result, for the first time, showed a high consistency between the two groups in detecting B cell clonality, which indicates that nuclei for FISH can function as a reliable template comparable to fresh tissue-isolated DNA in PCR based Ig clonality testing. This offers a simple, rapid and more economical alternative to standard Ig testing based on regular DNA. PMID:27069754

  7. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations. PMID:23345271

  8. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    PubMed Central

    Khairnar, Krishna; Parija, Subhash C

    2007-01-01

    Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive) that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific). The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens. PMID:17524135

  9. Frequency of Pathogenic Paediatric Bacterial Meningitis in Mozambique: The Critical Role of Multiplex Real-Time Polymerase Chain Reaction to Estimate the Burden of Disease

    PubMed Central

    Nhantumbo, Aquino Albino; Cantarelli, Vlademir Vicente; Caireão, Juliana; Munguambe, Alcides Moniz; Comé, Charlotte Elizabeth; Pinto, Gabriela do Carmo; Zimba, Tomás Francisco; Mandomando, Inácio; Semá, Cynthia Baltazar; Dias, Cícero; Moraes, Milton Ozório; Gudo, Eduardo Samo

    2015-01-01

    Background In Sub-Saharan Africa, including Mozambique, acute bacterial meningitis (ABM) represents a main cause of childhood mortality. The burden of ABM is seriously underestimated because of the poor performance of culture sampling, the primary method of ABM surveillance in the region. Low quality cerebrospinal fluid (CSF) samples and frequent consumption of antibiotics prior to sample collection lead to a high rate of false-negative results. To our knowledge, this study is the first to determine the frequency of ABM in Mozambique using real-time polymerase chain reaction (qPCR) and to compare results to those of culture sampling. Method Between March 2013 and March 2014, CSF samples were collected at 3 regional hospitals from patients under 5 years of age, who met World Health Organization case definition criteria for ABM. Macroscopic examination, cytochemical study, culture, and qPCR were performed on all samples. Results A total of 369 CSF samples were collected from children clinically suspected of ABM. qPCR showed a significantly higher detection rate of ABM-causing pathogens when compared to culture (52.3% [193/369] versus 7.3% [27/369], p = 0.000). The frequency of Streptococcus pneumoniae, Haemophilus influenzae, group B Streptococci, and Neisseria meningitidis were 32.8% (121⁄369), 12.2%, (45⁄369), 3.0% (16⁄369) and 4.3% (11⁄369), respectively, significantly higher compared to that obtained on culture (p < 0.001 for each). Conclusion Our findings demonstrate that culture is less effective for the diagnosis of ABM than qPCR. The common use of culture rather than qPCR to identify ABM results in serious underestimation of the burden of the disease, and our findings strongly suggest that qPCR should be incorporated into surveillance activities for ABM. In addition, our data showed that S. pneumoniae represents the most common cause of ABM in children under 5 years of age. PMID:26393933

  10. O Serogroup-Specific Touchdown-Multiplex Polymerase Chain Reaction for Detection and Identification of Vibrio cholerae O1, O139, and Non-O1/Non-O139

    PubMed Central

    Siriphap, Achiraya; Khamsuwan, Nutsarin; Borthong, Jednipit; Chonsin, Kaknokrat

    2014-01-01

    A novel, sensitive locus-specific touchdown-multiplex polymerase chain reaction (TMPCR), which is based on two-stage amplification pertaining to multiplex PCR and conditional touchdown strategy, was used in detecting and differentiating Vibrio cholerae serogroups. A panel of molecular marker-based TMPCR method generates reproducible profiles of V. cholerae-specific (588 bp) amplicons derived from ompW gene encoding the outer membrane protein and serogroup-specific amplicons, 364 bp for the O1 and 256 bp for the O139, authentically copied from rfb genes responsible for the lipopolysaccharide biosynthesis. The TMPCR amplification efficiency yields either equally or unequally detectable duplex DNA bands of the O1 (588 and 364 bp) and O139 (588 and 256 bp) or a DNA fragment of non-O1/non-O139 (588 bp) while providing no false positive identifications using the genomic DNA templates of the other vibrios and Enterobacteriaceae. The reciprocal analysis of two-template combinations demonstrated that, using V. cholerae O1, O139, or equally mixed O1 and O139, the TMPCR had a detection limit of as low as 100 pg of the O1, O139, or non-O1/non-O139 in reactions containing unequally or equally mixed gDNAs. In addition, the O serogroup-specific TMPCR method had 100% agreement with the serotyping method when examined for the serotyped V. cholerae reference strains and those recovered from clinical samples. The potential benefit of using this TMPCR tool would augment the serotyping method used in epidemiological surveillance and monitoring of V. cholerae serogroups, O1, O139, and non-O1/non-O139 present in clinical and environmental samples. PMID:25614837

  11. The prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs in Nueva Ecija, Philippines based on multiplex polymerase chain reaction (mPCR) assay.

    PubMed

    Corales, Joyce Marielle I; Viloria, Victoria V; Venturina, Virginia M; Mingala, Claro N

    2014-01-01

    The aim of the study was to determine the prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs. It describes the practice of veterinarians in detecting tick-borne diseases in Nueva Ecija, Philippines. Seventy blood samples were collected and were subjected to multiplex PCR for the detection of E. canis, Babesia spp. and A. platys. The prevalence of babesiosis is the highest in Cabanatuan City (2/10), while a 10% prevalence (1/10) was observed in Science City of Muñoz, Talavera and Sta. Rosa. E. canis were only detected in Cabanatuan City. However, no anaplasmosis was detected in any area. The prevalence of babesiosis and ehrlichiosis in Nueva Ecija is 7.14% (5/70) and 2.85% (2/70) respectively. In addition, 70% (7/10) of the Nueva Ecija veterinary practitioners encountered cases of suspected ehrlichiosis in their practice. The diagnosis of ehrlichiosis is based primarily on presented clinical signs and complete blood counts, which include a platelet count. Of the 10 respondents, half utilized test kits while 90% interpreted blood samples. Meanwhile, only 60% of the respondents used an ELISA test kit for ehrlichiosis. For some practitioners, the main reason for not utilizing a kit is the high cost. None of the respondents had previously attended cases of suspected anaplasmosis. Only one respondent diagnosed a case of babesiosis by blood smear microscopy. PMID:25706424

  12. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    PubMed

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. PMID:25776540

  13. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  14. Polymerase Chain Reaction for Educational Settings.

    ERIC Educational Resources Information Center

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  15. Presence of Shiga toxin-producing Escherichia coli O-groups in small and very-small beef-processing plants and resulting ground beef detected by a multiplex polymerase chain reaction assay.

    PubMed

    Svoboda, Amanda L; Dudley, Edward G; Debroy, Chitrita; Mills, Edward W; Cutter, Catherine N

    2013-09-01

    Shiga toxin-producing Escherichia coli (STEC) are associated with foodborne illnesses, including hemolytic uremic syndrome in humans. Cattle and consequently, beef products are considered a major source of STEC. E. coli O157:H7 has been regulated as an adulterant in ground beef since 1996. The United States Department of Agriculture Food Safety and Inspection Service began regulating six additional STEC (O145, O121, O111, O103, O45, and O26) as adulterants in beef trim and raw ground beef in June 2012. Little is known about the presence of STEC in small and very-small beef-processing plants. Therefore, we propose to determine whether small and very-small beef-processing plants are a potential source of non-O157:H7 STEC. Environmental swabs, carcass swabs, hide swabs, and ground beef from eight small and very-small beef-processing plants were obtained from October 2010 to December 2011. A multiplex polymerase chain reaction assay was used to determine the presence of STEC O-groups: O157, O145, O121, O113, O111, O103, O45, and O26 in the samples. Results demonstrated that 56.6% (154/272) of the environmental samples, 35.0% (71/203) of the carcass samples, 85.2% (23/27) of the hide samples, and 17.0% (20/118) of the ground beef samples tested positive for one or more of the serogroups. However, only 7.4% (20/272) of the environmental samples, 4.4% (9/203) of the carcass samples, and 0% (0/118) ground beef samples tested positive for both the serogroup and Shiga toxin genes. Based on this survey, small and very-small beef processors may be a source of non-O157:H7 STEC. The information from this study may be of interest to regulatory officials, researchers, public health personnel, and the beef industry that are interested in the presence of these pathogens in the beef supply. PMID:23742295

  16. Colony Polymerase Chain Reaction with Schizosaccharomyces pombe.

    PubMed

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-01-01

    When screening a large number of individual Schizosaccharomyces pombe strains by polymerase chain reaction (PCR), a rapid "colony PCR" approach may be used. Numerous colony PCR protocols are available, and fundamental to them all is that the colony must be fresh (grown overnight) and that as few cells as possible are used. In this protocol, we present three reliable methods for preparing S. pombe cells for colony PCR. PMID:27140919

  17. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase.

    PubMed

    McInerney, Peter; Adams, Paul; Hadi, Masood Z

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  18. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGESBeta

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  19. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    PubMed Central

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  20. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    ERIC Educational Resources Information Center

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  1. Integrated polymerase chain reaction/electrophoresis instrument

    DOEpatents

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  2. Methylation-sensitive polymerase chain reaction.

    PubMed

    Moore, Hannah R; Meehan, Richard R; Young, Lorraine E

    2006-01-01

    Here, we describe a robust and reproducible methylation-sensitive polymerase chain reaction (MS-PCR) method to detect the percentage methylation in repeat sequences of individual pre-implantation ovine embryos produced by different embryo technologies. This method allows the comparison of embryos produced by nuclear transfer with other production and embryo culture methods, accounting for the heterogeneity between embryos within a single treatment. DNA extracted from single embryos is digested with a methylation-sensitive restriction enzyme to determine the percentage methylation after PCR amplification in comparison with an undigested control. The undigested control represents 100% methylation because methylation-sensitive enzymes do not cut methylated DNA, allowing the entire sample to be amplified by PCR. Image analysis quantification of the digested subsample PCR product on an ethidium bromide-stained agarose gel is proportional to the amount of methylated DNA in each embryo. By comparing quadruplicate values obtained for each embryo against a standard curve, we are able to ensure the validity of our results for each individual embryo. Compared with bisulphite sequencing methods, the method described is rapid, inexpensive, and relatively high-throughput. PMID:16761730

  3. Review of Detection of Brucella sp. by Polymerase Chain Reaction

    PubMed Central

    Yu, Wei Ling; Nielsen, Klaus

    2010-01-01

    Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

  4. Development and application of a hexaplex reverse transcription polymerase chain reaction for screening global citrus tristeza virus isolates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The discovery of the diversity of Citrus tristeza virus (CTV) genotypes has complicated detection and diagnostic measures. To simplify the identification and differentiation of CTV genotypes, an efficient multiplex reverse transcription polymerase chain reaction (M-RT-PCR) technique for the screenin...

  5. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  6. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    PubMed

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. PMID:25197027

  7. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients

    PubMed Central

    Seekhuntod, Sirirat; Thavarungkul, Paninee; Chaichanawongsaroj, Nuntaree

    2016-01-01

    Background Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR) inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC). The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR) assay to detect KRAS mutations. Methods We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D). We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE) colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay. Results Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%), G12D (25.83%) and G12V (12.50%) in codon 12. Conclusion The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues. PMID:26812617

  8. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  9. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  10. A noncontact temperature measurement method in polymerase chain reaction reactors

    NASA Astrophysics Data System (ADS)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  11. Multiplexed miRNA northern blots via hybridization chain reaction.

    PubMed

    Schwarzkopf, Maayan; Pierce, Niles A

    2016-09-01

    Northern blots enable detection of a target RNA of interest in a biological sample using standard benchtop equipment. miRNAs are the most challenging targets as they must be detected with a single short nucleic acid probe. With existing approaches, it is cumbersome to perform multiplexed blots in which several RNAs are detected simultaneously, impeding the study of interacting regulatory elements. Here, we address this shortcoming by demonstrating multiplexed northern blotting based on the mechanism of hybridization chain reaction (HCR). With this approach, nucleic acid probes complementary to RNA targets trigger chain reactions in which fluorophore-labeled DNA hairpins self-assemble into tethered fluorescent amplification polymers. The programmability of HCR allows multiple amplifiers to operate simultaneously and independently within a blot, enabling straightforward multiplexing. We demonstrate simultaneous detection of three endogenous miRNAs in total RNA extracted from 293T and HeLa cells. For a given target, HCR signal scales linearly with target abundance, enabling relative and absolute quantitation. Using non-radioactive HCR, sensitive and selective miRNA detection is achieved using 2'OMe-RNA probes. The HCR northern blot protocol takes ∼1.5 days independent of the number of target RNAs. PMID:27270083

  12. Multiplexed miRNA northern blots via hybridization chain reaction

    PubMed Central

    Schwarzkopf, Maayan; Pierce, Niles A.

    2016-01-01

    Northern blots enable detection of a target RNA of interest in a biological sample using standard benchtop equipment. miRNAs are the most challenging targets as they must be detected with a single short nucleic acid probe. With existing approaches, it is cumbersome to perform multiplexed blots in which several RNAs are detected simultaneously, impeding the study of interacting regulatory elements. Here, we address this shortcoming by demonstrating multiplexed northern blotting based on the mechanism of hybridization chain reaction (HCR). With this approach, nucleic acid probes complementary to RNA targets trigger chain reactions in which fluorophore-labeled DNA hairpins self-assemble into tethered fluorescent amplification polymers. The programmability of HCR allows multiple amplifiers to operate simultaneously and independently within a blot, enabling straightforward multiplexing. We demonstrate simultaneous detection of three endogenous miRNAs in total RNA extracted from 293T and HeLa cells. For a given target, HCR signal scales linearly with target abundance, enabling relative and absolute quantitation. Using non-radioactive HCR, sensitive and selective miRNA detection is achieved using 2′OMe-RNA probes. The HCR northern blot protocol takes ∼1.5 days independent of the number of target RNAs. PMID:27270083

  13. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    SciTech Connect

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  14. Rapid Differentiation and Identification of Potential Severe Strains of Citrus tristeza Virus by Real-Time Reverse Transcription Polymerase Chain Reaction Assays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multiplex Taqman®-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to detect all strains of Citrus tristeza virus (CTV) and to identify potentially severe strains of the virus. A CTV TaqMan probe (CTV-CY5) based on the coat protein (CP) gene sequences...

  15. Methods in molecular cardiology: the polymerase chain reaction

    PubMed Central

    Sonnemans, D.G.P.; de Windt, L.J.; de Muinck, E.D.; Doevendans, P.A.

    2002-01-01

    Several polymerase chain reaction (PCR) techniques are described in this review to give insight into the potential applications for cardiovascular research. Although PCR can be performed in several ways, all applications are based on the same general principle, the amplification of DNA or RNA by the enzyme polymerase. This amplification provides the opportunity to detect, identify and multiply a single copy of DNA or RNA, in or outside the cell. This powerful technique can be used in several directions of DNA and RNA research resulting in the ability to specifically detect the presence and activity of genes. The use of these techniques in cardiovascular research is discussed here. ImagesFigure 1Figure 2Figure 4Figure 5Figure 6Figure 7Figure 8Figure 9 PMID:25696037

  16. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  17. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  18. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods. PMID:26843052

  19. MEN2A carrier detection by combined polymerase chain reaction and ligase chain reaction (PCR/LCR) techniques

    SciTech Connect

    Wilson, V.L.; Wel, Q.; Danielson, M.S.

    1994-09-01

    Multiple endocrine neoplasia type 2A (MEN2A) is a dominantly inherited cancer syndrome that is characterized by medullary thyroid carcinoma, parathyroid hyperplasia and phaeoachromocytoma. MEN2A predisposing mutations have been shown to occur in the conserved cysteine rich extracellular domain of the ret proto-oncogene. Thus far, only five separate codons, C609, C611, C618, C620, and C634, each coding for cysteine residues in exons 10 and 11 of the human ret gene, have been associated with MEN2A. Direct analyses of all five of these codon sequences was performed by a combination of polymerase chain reaction (PCR) and ligase chain reaction (LCR) techniques. Genomic DNA was initially amplified with PCR primers surrounding the sequences of exons 10 and 11. Using a multiplex LCR reaction, and resolving the products on a 7 M urea, 10% polyacrylamide gel, the presence of a T{yields}C base substitution was immediately identified according to size. We have used these techniques to identify the prediposing mutation in genomic DNA from the proband of a MEN2A family and subsequently demonstrated the inheritance pattern of this same base substitution mutation in the rest of the family. These PCR/LCR techniques provide a rapid MEN2A detection scheme.

  20. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    PubMed Central

    Kwon, Ji Yeon; Ryu, Ki Hyun; Choi, Sun Hee

    2013-01-01

    A detection system based on a multiplex reverse transcription (RT) polymerase chain reaction (PCR) was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV), lily mottle virus (LMoV), lily symptomless virus (LSV). Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV) by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility. PMID:25288961

  1. Convective polymerase chain reaction around micro immersion heater

    NASA Astrophysics Data System (ADS)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  2. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    PubMed

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  3. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  4. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    PubMed Central

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  5. Polymerase chain reaction in rapid diagnosis of neonatal sepsis.

    PubMed

    Yadav, Ashok K; Wilson, C G; Prasad, P L; Menon, P K

    2005-07-01

    In a prospective study a total of hundred neonates who fulfilled the American College of Obstetrics and Gynecology's (ACOG) criteria for probable sepsis admitted to NICU of tertiary care armed forces hospital were investigated for evidence of sepsis. The investigation protocol included sepsis screen, blood culture and 1 mL of venous blood for molecular analysis by polymerase chain reaction (PCR) for bacterial DNA component encoding 16 s RNA in all cases. 100 newborns with probable sepsis were studied to evaluate the molecular diagnosis of sepsis using PCR amplification of 16 S RNA in newborns with risk factors for sepsis or those who have clinical evidence of sepsis. We compared the results of PCR with blood culture and other markers of sepsis screen (total leucocyte count (TLC), absolute neutrophil count (ANC), immature/total neutrophil count ratio (I/T ratio), peripheral blood smear, micro ESR and C reactive protein (CRP). Controls consisted of 30 normal healthy newborns with no overt evidence of sepsis. Sepsis screen was positive in 24 (24%) of cases in study group with sensitivity and specificity of 100% and 83.5% respectively. Blood culture was positive in 09(9%t) with sensitivity of 69.2% and specificity of 100%. PCR was positive in 13(13%) of cases (9% are both blood culture and sepsis screen positive and 4% are positive by sepsis screen); the sensitivity of PCR was 100% and specificity was 95.6%. Blood culture is the most reliable method for diagnosis of neonatal sepsis. Polymerase chain reaction is useful and superior to blood culture for early diagnosis of sepsis in neonates. PMID:16085969

  6. Effects of Upconversion Nanoparticles on Polymerase Chain Reaction

    PubMed Central

    Hwang, Sang-Hyun; Im, Su-Gyeong; Hah, Sang Soo; Cong, Vu Thanh; Lee, Eun Jeong; Lee, Yeon-Su; Lee, Geon Kook

    2013-01-01

    Nanoparticles (NPs) are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs), which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR) specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix) and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit). Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C–45°C), addition of the 40 nm UCNP (1 µg/µL) to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation. PMID:24039935

  7. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    PubMed

    Lorenz, Todd C

    2012-01-01

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  8. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

    PubMed Central

    Lorenz, Todd C.

    2012-01-01

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: ● Set up reactions and thermal cycling

  9. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease.

    PubMed

    Khalil, S H; Siegrist, K; Akhtar, M

    1997-07-01

    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  10. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    PubMed

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. PMID:26130622

  11. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  12. Identifying of meat species using polymerase chain reaction (PCR)

    SciTech Connect

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  13. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  14. Application of the polymerase chain reaction to detect fowl adenoviruses.

    PubMed Central

    Jiang, P; Ojkic, D; Tuboly, T; Huber, P; Nagy, E

    1999-01-01

    The possibility of using the polymerase chain reaction (PCR) for the detection of fowl adenoviruses (FAdV) was tested. The optimal reaction parameters were evaluated and defined for purified genomic DNA of type 8 fowl adenovirus (FAdV-8), and then the same conditions were applied for nucleic acid extracted from infected cells. One hundred picograms of purified viral DNA, or 250 FAdV-8-infected cells, were detected by ethidium bromide staining of the PCR products in agarose gels. The sensitivity was increased to 10 pg purified viral DNA, or 25 infected cells, when the PCR products were hybridized with a specific labeled probe. Several field isolates of FAdV and the CELO virus (FAdV serotype 1) could be amplified by the same primers and conditions, but the size of the amplicons was smaller than that for the FAdV-8 PCR product. Other avian viruses and uninfected cell cultures tested negative. Images Figure 2. Figure 3. Figure 4. PMID:10369570

  15. Taylor dispersion in polymerase chain reaction in a microchannel

    NASA Astrophysics Data System (ADS)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav

    2008-09-01

    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  16. A Consensus on Fungal Polymerase Chain Reaction Diagnosis?

    PubMed Central

    White, P. Lewis; Barton, Richard; Guiver, Malcolm; Linton, Christopher J.; Wilson, Steve; Smith, Melvyn; Gomez, Beatriz L.; Carr, Michael J.; Kimmitt, Patrick T.; Seaton, Shila; Rajakumar, Kumar; Holyoake, Tessa; Kibbler, Chris C.; Johnson, Elizabeth; Hobson, Richard P.; Jones, Brian; Barnes, Rosemary A.

    2006-01-01

    The limitations of classical diagnostic methods for invasive fungal infections (IFIs) have led to the development of molecular techniques to aid in the detection of IFIs. Despite good published performance, interlaboratory reproduction of these assays is variable, and no consensus has been reached for an optimal method. This publication describes the first multicenter study of polymerase chain reaction methods, for the detection of Aspergillus and Candida species, currently used in the UK and Ireland by distribution and analysis of multiple specimen control panels. All three Candida methods were comparable, achieving a satisfactory level of detection (10 cfu), and the method of preference was dependent on the requirements of the particular laboratory. The results for the five Aspergillus assays were more variable, but two methods (2Asp and 4Asp) were superior (101 conidia). Formally, the overall performances of the two Aspergillus assays were comparable (κ statistic = 0.77). However, on the Roche LightCycler, there was a clear sample-type effect that greatly reduced the detection limit of the 4Asp method when testing whole blood samples. Therefore, the preferred Aspergillus method relied on the amplification platform available to the user. This study represents the initial process to achieve a consensus method for the diagnosis of IFIs. PMID:16825512

  17. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    SciTech Connect

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  18. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  19. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction.

    PubMed

    Uphoff, Cord C; Drexler, Hans G

    2011-01-01

    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  20. Polymerase chain reaction-based analysis to detect terrestrial animal protein in fish meal.

    PubMed

    Bellagamba, Federica; Valfrè, Franco; Panseri, Sara; Moretti, Vittorio M

    2003-04-01

    The recent European bovine spongiform encephalopathy crisis has focused attention on the importance of adopting stringent control measures to avoid the risk of the diffusion of mad cow disease through meat meal-based animal feedstuffs. Potential adulteration of such feedstuffs with bone particles from terrestrial animals is determined by microscopic examination by law before the release of these feedstuffs for free circulation in the European Community. This study describes a DNA monitoring method to examine fish meal for contamination with mammalian and poultry products. A polymerase chain reaction (PCR) method based on the nucleotide sequence variation in the 12S ribosomal RNA gene of mitochondrial DNA was developed and evaluated. Three species-specific primer pairs were designed for the identification of ruminant, pig, and poultry DNA. The specificity of the primers used in the PCR was tested by comparison with DNA samples for several vertebrate species and confirmed. The PCR specifically detected mammalian and poultry adulteration in fish meals containing 0.125% beef, 0.125% sheep, 0.125% pig, 0.125% chicken, and 0.5% goat. A multiplex PCR assay for ruminant and pig adulteration was optimized and had a detection limit of 0.25%. PMID:12696697

  1. Pouched Rats' Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

    PubMed Central

    Mahoney, Amanda; Weetjens, Bart J.; Cox, Christophe; Beyene, Negussie; Reither, Klaus; Makingi, George; Jubitana, Maureen; Kazwala, Rudovick; Mfinanga, Godfrey S.; Kahwa, Amos; Durgin, Amy; Poling, Alan

    2012-01-01

    Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis) of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%), and the mean specificity was 87.3% (range 84.7–90.3%). Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries. PMID:22848808

  2. Diagnosis of Whooping Cough in Switzerland: Differentiating Bordetella pertussis from Bordetella holmesii by Polymerase Chain Reaction

    PubMed Central

    Pittet, Laure F.; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M.

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001−, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447

  3. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    PubMed

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447

  4. Touchdown polymerase chain reaction detection of polycystic kidney disease and laboratory findings in different cat populations.

    PubMed

    Scalon, Marcela C; da Silva, Thamiris F; Aquino, Larissa C; Carneiro, Filipe T; Lima, Maíra G da M; Lemos, Marcelle Dos S; Paludo, Giane R

    2014-06-10

    Autosomal-dominant polycystic kidney disease (ADPKD) is the most prevalent inherited genetic disease of cats, predominantly affecting Persian and Persian-related cats. A point mutation (C→A transversion) in exon 29 of the PKD1 gene causes ADPKD, and is the specific molecular target for genetic diagnosis in cats. The current study describes a newly developed touchdown polymerase chain reaction (PCR) to detect this single point mutation, using 2 primers specific for the mutant allele, adapted from an existing multiplex amplification refractory mutation system (ARMS PCR). Furthermore, correlations between the clinical outcomes of tested animals and the results of the genetic test were investigated. A total of 334 cats were tested, 188 from the Veterinary Hospital of Small Animals at the University of Brasilia, and 146 from an anti-rabies vaccine campaign of the Federal District. A total prevalence of 9% was evident among the samples, with 33% of the Persian cats testing positive, and 7% of the Brazilian long- and shorthaired cats testing positive. Prevalence was not correlated with gender or hemogram. Positive animals exhibited hyperglobulinemia (P = 0.02). This research demonstrated that the mutation does not only occur in Persian and Persian-related cats, and that a touchdown PCR can be used to diagnose ADPKD. PMID:24916445

  5. Trends and advances in food analysis by real-time polymerase chain reaction.

    PubMed

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  6. Leptospirosis diagnosis by immunocapture polymerase chain reaction: a new tool for early diagnosis and epidemiologic surveillance.

    PubMed

    Balassiano, Ilana Teruszkin; Vital-Brazil, Juliana Magalhães; Pereira, Martha Maria

    2012-09-01

    The aim of this study was to develop an immunocapture polymerase chain reaction (IC-PCR) protocol for leptospirosis. For the standardization of IC-PCR, polyclonal (AS) and monoclonal (MAb) antibodies against different serogroups and serovars of Leptospira were coupled to polystyrene plates. Human sera were artificially contaminated with leptospires and incubated on plates. The bacterial DNA was obtained and used in a multiplex PCR. Sensitivity was tested using sera contaminated with crescent concentrations of leptospires, while specificity was established using sera contaminated with different bacterial genera and sera obtained from patients positive for viral infections. IC-PCR using AS was able to recognize specific serogroups, although some cross-reactions have been observed. No cross-reactions were observed when MAbs were used; however, the sensitivity in this case was lower than that of IC-PCR using AS. IC-PCR proved to be specific to Leptospira and is a promising tool for early diagnosis of leptospirosis, providing additional information about the infecting serovar or serogroup. PMID:22770775

  7. Detection of hog cholera virus and differentiation from other pestiviruses by polymerase chain reaction.

    PubMed

    Wirz, B; Tratschin, J D; Müller, H K; Mitchell, D B

    1993-05-01

    Reverse transcription coupled with the polymerase chain reaction (RT-PCR) was used for the detection and differentiation of pestiviruses. For this purpose, one primer pair was selected from a highly conserved region of the genome of pestiviruses. Using these primers (PEST 1-PEST 2), DNA fragments of between 72 and 74 bp could be amplified from all pestivirus isolates tested. In order to differentiate hog cholera virus (HCV) from bovine viral diarrhea virus (BVDV) and border disease virus (BDV), we selected a primer pair from a conserved region in the genome of HCV strains that differed from that sequenced in the genome of BVDV strains. By using these primers (HCV 1-HCV 2), a DNA fragment of 478 bp could be specifically amplified from HCV isolates. By these means, viral RNA was detected in extracts of lymph node, spleen, tonsil, and lung. Such extracts were used directly for RT-PCR without prior RNA isolation. We also performed multiplex PCR by using both the PEST 1-PEST 2 and HCV 1-HCV 2 primer pairs in a single reaction. This allowed the differentiation of HCV from BVDV and BDV in one step. To assess the sensitivity of the method, RT-PCR was compared with virus propagation in tissue culture and subsequent detection by immunofluorescence staining. The results show that RT-PCR is useful for the rapid detection and differentiation of pestiviruses. PMID:8388887

  8. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  10. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  11. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  12. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  13. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    PubMed

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  14. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    PubMed

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  15. Detection of Copy Number Imbalance in Canine Urothelial Carcinoma With Droplet Digital Polymerase Chain Reaction.

    PubMed

    Mochizuki, H; Shapiro, S G; Breen, M

    2016-07-01

    Urothelial carcinoma (UC) is the most common neoplasm of the canine urinary tract. Clinical presentation of UC is shared with several other, more common urinary tract disorders, and this often delays diagnosis of the UC. Definitive diagnosis of UC requires histopathologic examination of a biopsy specimen, but the cost and invasiveness for these diagnostic tests often result in most diagnoses being made on the basis of clinical findings, diagnostic imaging, and cytologic examination of urine sediment. Regardless of the diagnostic process used, most UCs currently are not diagnosed until they are at an advanced clinical stage and so are associated with poor prognosis. Improved methods for earlier and less invasive detection are needed. In a previous study, the authors demonstrated the presence of highly recurrent DNA copy number aberrations (CNAs) in canine UC and hypothesized that detection of these CNAs in tumor cells can be used as a molecular diagnostic for UC. In this study, a multiplexed droplet digital polymerase chain reaction (ddPCR) assay was detected to detect and quantify CNAs of specific regions of canine chromosomes 8, 13, 19, and 36. The assay was effective at differentiating 31 neoplastic and 25 nonneoplastic bladder tissues based on copy number, with 100% sensitivity and specificity in tissue samples. CNAs were also detected by ddPCR in 67% (12 of 18) of urine DNA specimens derived from UC patients. The findings show that ddPCR is a useful molecular technique to detect CNAs and may be used as a noninvasive molecular diagnostic test for canine UC. PMID:26574558

  16. Prenatal detection of trisomy 21 and 18 from amniotic fluid by quantitative fluorescent polymerase chain reaction.

    PubMed Central

    Tóth, T; Findlay, I; Papp, C; Tóth-Pál, E; Marton, T; Nagy, B; Quirke, P; Papp, Z

    1998-01-01

    Prenatal diagnosis of fetal trisomies is usually performed by cytogenetic analysis on amniotic fluid. This requires lengthy laboratory procedures and high costs, and is unsuitable for large scale screening of pregnant women. An alternative method, which is both rapid and inexpensive and suitable for diagnosing trisomies even from single fetal cells, is the fluorescent polymerase chain reaction using polymorphic small tandem repeats (STRs). In this paper we present the preliminary results of a larger study comparing parallel prenatal diagnoses of trisomies 21 and 18 using cytogenetics with quantitative fluorescent polymerase chain reaction using STR markers. The results obtained by the two techniques were concordant in all cases. This is the first study reporting significant numbers of prenatal diagnoses using the quantitative fluorescent polymerase chain reaction. We believe that further studies on greater numbers of samples will determine the absolute reliability of this technique. These results also provide a model for diagnosis of trisomy from single fetal cells isolated from maternal blood. PMID:9507392

  17. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    PubMed Central

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  18. Analysis of Liver Connexin Expression Using Reverse Transcription Quantitative Real-Time Polymerase Chain Reaction.

    PubMed

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin RNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction, and data analysis. PMID:27207283

  19. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. PMID:25188346

  20. Application of real-time polymerase chain reaction in the clinical genetic practice

    PubMed Central

    Nagy, Bálint

    2013-01-01

    The development of polymerase chain reaction revolutionized the molecular genetics and diagnostics. Technical improvements helped to make more specific and sensitive target determinations. Introduction of real-time polymerase chain reaction makes possible several applications in clinical genetics like detection of gene mutations, single nucleotide polymorphisms, deletions, measurement of gene expressions, micro ribonucleic acids, free nucleic acids and microbial genomes. Here I discuss a few examples for specific applications in prenatal clinical genetic practice. These are the detection of microbial genomes, deletions, trisomies, mutations, single nucleotide polymorphisms and free nucleic acids.

  1. A Specific Qualitative Detection Method for Peanut (Arachis Hypogagea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A qualitative method for detection of peanuts in foods using polymerase chain reaction was developed. A universal primer pair CP 03-5 /CP 03-3 was designed to confirm the validity of the DNAs for PCR. The plant-specific amplified fragments were detected from 13 kinds of plants using the universal pr...

  2. A Specific Qualitative Detection Method for Peanut (Arachis Hypogaea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed a qualitative detection method for peanuts in foods using polymerase chain reaction (PCR). We designed a universal primer pair CP 03-5’/ CP 03-3’ to confirm the validity of the DNAs for PCR. The plant specific amplified fragments were detected from 13 kinds of plants using the universal...

  3. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  4. Use of polymerase chain reaction for the identification of Leptospira sp. in urine of carriers.

    PubMed

    Ruiz, Victor Manuel Banda; Vega, Laura Elena Orozco; Velázquez, Rosa Maria Urrutia

    2005-01-01

    The objectives of the present work were to detect Leptospira seropositive animals. The ELISA results report only IgG antibodies, which could be attributable to chronic infections or else, that they are healthy carriers. All polymerase chain reaction positive animals should be considered potential sources of infection. PMID:17966477

  5. Use of enrichment real time-Polymerase Chain Reaction to enumerate Salmonella on chicken parts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella that survive cooking and that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. Consequently, the present study was undertaken to use enrichment real time-polymerase chain reaction (RT-PCR) to enu...

  6. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  7. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  8. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  11. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  12. Use of tRNA consensus primers to indicate subgroups of Pseudomonas solanacearum by polymerase chain reaction amplification.

    PubMed Central

    Seal, S E; Jackson, L A; Daniels, M J

    1992-01-01

    Polymerase chain reaction amplification of DNA from 112 Pseudomonas solanacearum strains with the tRNA consensus primers T3A and T5A divided the species into three fingerprint groups. These groups correspond well with previous divisions made by restriction fragment length polymorphism analysis. This polymerase chain reaction test is a facile method for rapidly classifying P. solanacearum strains. Images PMID:1482194

  13. Single Quantum Dot Analysis Enables Multiplexed Point Mutation Detection by Gap Ligase Chain Reaction

    PubMed Central

    Song, Yunke; Zhang, Yi; Wang, Tza-Huei

    2014-01-01

    Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and tedious assay processes. In this report, we propose an assay technology which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single molecule coincidence detection and superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. PMID:23239594

  14. A novel picoliter droplet array for parallel real-time polymerase chain reaction based on double-inkjet printing.

    PubMed

    Sun, Yingnan; Zhou, Xiaoguang; Yu, Yude

    2014-09-21

    We developed and characterized a novel picoliter droplet-in-oil array generated by a double-inkjet printing method on a uniform hydrophobic silicon chip specifically designed for quantitative polymerase chain reaction (qPCR) analysis. Double-inkjet printing was proposed to efficiently address the evaporation issues of picoliter droplets during array generation on a planar substrate without the assistance of a humidifier or glycerol. The method utilizes piezoelectric inkjet printing equipment to precisely eject a reagent droplet into an oil droplet, which had first been dispensed on a hydrophobic and oleophobic substrate. No evaporation, random movement, or cross-contamination was observed during array fabrication and thermal cycling. We demonstrated the feasibility and effectiveness of this novel double-inkjet method for real-time PCR analysis. This method can readily produce multivolume droplet-in-oil arrays with volume variations ranging from picoliters to nanoliters. This feature would be useful for simultaneous multivolume PCR experiments aimed at wide and tunable dynamic ranges. These double-inkjet-based picoliter droplet arrays may have potential for multiplexed applications that require isolated containers for single-cell cultures, single molecular enzymatic assays, or digital PCR and provide an alternative option for generating droplet arrays on planar substrates without chemical patterning. PMID:25070461

  15. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture.

    PubMed

    Alcantara, Monica Visnieski; Fragoso, Stenio Perdigão; Picchi, Gisele Fernanda Assine

    2014-07-01

    Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR) assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by PCR directly from liquid culture - without prior DNA extraction. This simple approach enabled us to generate PCR amplifications from different cultures varying from 106-108 cells/mL. We also show that it is possible to combine different primer pairs in a multiplex detection reaction and even to achieve knockout confirmation with an extremely simple interpretation of a real-time PCR result. Using the "culture PCR" approach, we show for the first time that we can assess different DNA sequence combinations by PCR directly from liquid culture, saving time in several tasks for T. cruzi genotype interrogation. PMID:24936912

  16. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  17. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing.

    PubMed

    Wilson, R K; Chen, C; Hood, L

    1990-02-01

    A high-throughput method for the preparation of single-stranded template DNA, which is suitable for sequence analysis using fluorescent labeling chemistry, is described here. In this procedure, the asymmetric polymerase chain reaction is employed to amplify recombinant plasmid or bacteriophage DNA directly from colonies or plaques. The use of amplification primers located at least 200 base pairs 5' to the site of sequencing primer annealing removes the need for extensive purification of the asymmetric polymerase chain reaction product. Instead, the single-stranded product DNA is purified by a simple isopropanol precipitation step and then directly sequenced using fluorescent dye-labeled oligonucleotides. This method significantly reduces the time and labor required for template preparation and improves fluorescent DNA sequencing strategies by providing a much more uniform yield of single-stranded DNA. PMID:2317375

  18. Sensitive and specific polymerase chain reaction detection of Toxoplasma gondii for veterinary and medical diagnosis.

    PubMed Central

    MacPherson, J M; Gajadhar, A A

    1993-01-01

    A polymerase chain reaction (PCR) method was developed for the detection of Toxoplasma gondii. A universal- and a T. gondii-specific primer was used to amplify a region of the small subunit ribosomal RNA gene. This approach allows for a theoretical detection limit of 0.01 zoite of T. gondii per sample assayed. Experiments showed that this PCR method could detect 0.1 pg of T. gondii DNA, which represents about one organism. Polymerase chain reaction tests using DNAs of cat, dog, swine, cattle, human, Sarcocystis cruzi, Eimeria ahsata, E. vermiformis, and Escherichia coli indicated no cross-reaction with nucleic acids of hosts, related coccidia, or bacteria. Data on the sensitivity and specificity suggest that this PCR assay could be extremely useful for the diagnosis of toxoplasmosis in human and veterinary medicine, as well as for food safety surveys. Images Fig. 1. Fig. 2. PMID:8431804

  19. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    PubMed

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  20. Detection of enteric viruses in oysters by using the polymerase chain reaction.

    PubMed Central

    Atmar, R L; Metcalf, T G; Neill, F H; Estes, M K

    1993-01-01

    A procedure for the detection of enteric viral nucleic acid in oysters by the polymerase chain reaction was developed. Known quantities of poliovirus type 1 were seeded into oysters. Virus was extracted and concentrated by using organic flocculation and polyethylene glycol precipitation. Inhibitors of reverse transcription-polymerase chain reaction were present in the oyster extracts, preventing amplification of target viral nucleic acid. The use of cetyltrimethylammonium bromide precipitation sufficiently removed inhibitors to allow detection of as few as 10 PFU of poliovirus. Norwalk virus also could be detected after being seeded into oysters. This methodology may be useful for the detection of these and other shellfish-borne viral pathogens. Images PMID:8382024

  1. 18S rDNA polymerase chain reaction and sequencing in onychomycosis diagnostics.

    PubMed

    Walberg, Mette; Mørk, Cato; Sandven, Per; Jorde, Anne Tomine; Bjørås, Magnar; Gaustad, Peter

    2006-01-01

    Diagnostic approaches to onychomycosis have traditionally been based on a combination of culture and microscopy. In the present study clinical specimens from 346 patients with suspected onychomycosis were analysed by 18S polymerase chain reaction (detection) followed by sequencing and subsequent database search (identification) in parallel with routine culture on agar (detection and identification). In 49 samples Trichophyton rubrum was identified by culture and sequencing. In 67 additional culture negative samples, a positive dermatophyte sequence was obtained (T. rubrum in 54, T. mentagrophytes in 5, and T. species in 8 samples). Fifteen samples cultured positive while no sequence was obtained. Two hundred and seven samples were negative by culture as well as by sequencing. Nails from 10 healthy controls were negative by culture and sequencing. In conclusion, the number of specimens that were positive by polymerase chain reaction was more than double the number that were positive by culture alone. PMID:16710579

  2. A case of canine streptococcal meningoencephalitis diagnosed using universal bacterial polymerase chain reaction assay.

    PubMed

    Messer, Jeannette S; Wagner, Susan O; Baumwart, Ryan D; Colitz, Carmen M

    2008-01-01

    A 3-year-old, spayed female, mixed-breed dog was evaluated for acute, progressive neurological disease. Analysis of cerebrospinal fluid (CSF) showed neutrophilic pleocytosis. The dog later developed liver disease, thrombocytopenia, and anemia that were presumably secondary to ceftriaxone administration. Bacterial cultures of blood, urine, and CSF were negative. However, a universal bacterial polymerase chain reaction assay of CSF identified deoxyribonucleic acid from Streptococcus spp. The dog recovered with therapy for streptococcal encephalitis. PMID:18593857

  3. Rapid detection of bovine viral diarrhea virus by polymerase chain reaction.

    PubMed Central

    Lopez, O J; Osorio, F A; Donis, R O

    1991-01-01

    The polymerase chain reaction was used to detect genomic sequences of the positive-stranded RNA of bovine viral diarrhea virus (BVDV), a member of the family Togaviridae. Using a set of 20-bp primers located within the conserved 3' region of the BVDV genome, we were able to consistently amplify a 205-bp target sequence from BVDV cDNA. BVDV RNAs from cell culture-propagated BVDV reference strains, diverse unrelated cytopathic and noncytopathic field isolates, and clinical serum samples were transcribed to cDNA by using avian myeloblastosis virus reverse transcriptase and further specifically amplified by using the polymerase chain reaction assay. The amplification assay was sensitive enough to detect one molecule of cloned BVDV cDNA. Reconstitution experiments conducted by adding decreasing amounts of BVDV (NADL strain) to BVDV-free serum indicated that the threshold of sensitivity of the assay was less than or equal to 1 50% tissue culture infective dose. These results show that the polymerase chain reaction may be used for the rapid detection of diverse strains of BVDV in cell cultures, biological products, and clinical specimens from cattle. Images PMID:1709950

  4. Polymerase Chain Reaction as a Diagnostic Tool for Six Sexually Transmitted Infections - Preliminary Results

    PubMed Central

    GRAD, ALECSANDRA IULIA; VICA, MIHAELA LAURA; MATEI, HOREA VLADI; GRAD, DORU LUCIAN; COMAN, IOAN; TATARU, DUMITRU ALEXANDRU

    2015-01-01

    Background and aim Sexually transmitted infections are a very frequent and under-diagnosed cause of illness worldwide. A high number of detection methods and a large range of specimens in which sexually transmitted infections can be determined are available at the moment. Polymerase chain reaction performed on first void urine offers the advantage of being non-invasive, self-collectable and has high sensitivity and specificity. We looked to determine the frequency of Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Mycoplasma hominis, Mycoplasma genitalium and Ureaplasma urealyticum in symptomatic and asymptomatic patients. Methods Six sexually transmitted infections were determined in the first void urine of 15 symptomatic and asymptomatic patients by polymerase chain reaction. We used “Epicenter MasterPure™ Complete DNA and RNA Purification Kit” for the DNA purification and “Seeplex® STD6 ACE Detection” for the DNA amplification. The results were examined in UV light. Results A number of 5 patients had positive results for Chlamydia trachomatis or Neisseria gonorrhoeae. Sexually transmitted infections are more frequent in men between 27 and 40 years old. Conclusions Polymerase chain reaction is a good diagnostic tool for sexually transmitted infections because it has a high sensitivity and specificity. Chlamydia trachomatis is the most frequent sexually transmitted infection, followed by Neisseria gonorrhoeae. PMID:26528045

  5. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    SciTech Connect

    Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R. ); Kawasaki, E.S. )

    1990-01-01

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction.

  6. A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain.

    PubMed

    Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub

    2015-01-01

    Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform. PMID:26437367

  7. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  8. Polymerase chain reaction identification of a hymenopteran insect in the cornea: a case report.

    PubMed

    Lin, Hsien-Chung; Yeh, Wen-Bin; Chang, Cheng-Hsien; Fu, Yaw-Syan; Cheng, Chien-Chung; Wu, Horng-Jiun; Wang, Hwei-Zu

    2006-03-01

    The type of corneal injuries associated with insect encounters is related to the composition of the foreign body. However, previous reports on corneal foreign bodies as insects were rarely based on scientific evidence. Here, we report on a 49-year-old male who was stung in his left eye by an unknown insect. Emergent keratotomy was performed to remove the embedded corneal foreign body. The removed foreign body was observed under light microscopy, and a fragment of insect was suspected. The sample was sent for molecular analysis. The polymerase chain reaction product was sequenced, subjected to a BLAST search, and identified as an ichneumonoid member of the insect order Hymenoptera. PMID:16602279

  9. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    PubMed

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  10. Detection of biological warfare agents using the polymerase chain reaction. Final report, June-August 1991

    SciTech Connect

    Mann, B.J.

    1992-09-01

    The detection of biological warfare agents is an important mission for the U.S. Army. This report explores the feasibility of using the polymerase chain reaction as a means of rapid detection of biological warfare agents. Two levels of detection are proposed. The first level is group specific detection, using primers derived from 16S rDNA sequences, to detect various groups of pathogenic bacteria. The second level is species-specific detection using primers derived from DNA sequences, unique to each pathogenic organism targeted for detection. Specific examples of Vibrio cholerae, Francisella tularensis, Yersinia pestis, Staphylococcus aureus, and Bacillus anthracis are described.

  11. Using Digital Polymerase Chain Reaction to Detect Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-01-01

    This protocol is designed to detect single-nucleotide substitutions generated by genome editing in a highly sensitive and quantitative manner. It uses a combination of allele-specific hydrolysis probes and a new digital polymerase chain reaction (dPCR) technology called droplet digital PCR (ddPCR). ddPCR partitions a reaction into more than 10,000 nanoliter-scale water-in-oil droplets. As a result, each droplet contains only a few copies of the genome so that ddPCR is able to detect rare genome-editing events without missing them. PMID:27250210

  12. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis of microbial community structure in landfill leachate.

    PubMed

    Uchida, Miho; Hatayoshi, Haruna; Syuku-nobe, Aoi; Shimoyama, Takefumi; Nakayama, Toru; Okuwaki, Akitsugu; Nishino, Tokuzo; Hemmi, Hisashi

    2009-05-30

    The structures of microbial communities in water samples obtained from a landfill site that had been a source of environmental pollution by emitting hydrogen sulfide were elucidated using polymerase chain reaction-denaturing gradient gel electrophoresis. The microbial communities, which consisted of a limited number of major microorganisms, were stable for several months. Microorganisms capable of degrading such chemical compounds as 2-hydroxybenzothiazole and bisphenol A were observed in landfill leachate. Microorganisms responsible for the production of hydrogen sulfide were not the primary microbes detected, even in water samples obtained from the site of gas emission. PMID:18977596

  13. Zoster ... "a lmost" ... sine herpete: diagnostic utility of real time-polymerase chain reaction.

    PubMed

    Vena, Gino A; Apruzzi, Doriana; Vestita, Michelangelo; Calvario, Agata; Foti, Caterina; Cassano, Nicoletta

    2010-10-01

    Zoster sine herpete is a particular form of varicella zoster virus (VZV) infection characterized by segmental pain and dysesthesia, without any cutaneous lesions ever becoming perceptible. This report describes the case of a female patient, presenting with intercostal pain associated with a single papulo-vesicular lesion localized within the same area. Thanks to such a lesion, real time-polymerase chain reaction (PCR) analysis on vesicle fluid swab was possible, thus revealing a significant number of VZV genome copies. This innovative tool has proven essential to diagnose this abortive form of herpes zoster, which would otherwise have remained unidentified. PMID:21213602

  14. JC polyomavirus nephropathy confirmed by using an in-house polymerase chain reaction method.

    PubMed

    Querido, S; Jorge, C; Sousa, H; Birne, R; Matias, P; Weigert, A; Adragão, T; Bruges, M; Ramos, S; Santos, M; Paixão, P; Curran, M D; Machado, D

    2015-10-01

    We report the case of an isolated JC virus (JCV) infection, without co-infection by polyoma BK virus (BKV), associated with nephropathy 4 years after kidney transplantation. Clinical suspicion followed the observation of a decrease in estimated glomerular filtration rate (eGFR) and a renal allograft biopsy revealing polyomavirus-associated tubulointerstitial nephritis and positivity for SV40. An in-house real-time polymerase chain reaction assay, targeting the presence of JCV and the absence of BKV in biopsy tissue, confirmed diagnosis. Thirteen months after diagnosis, and following therapeutic measures, eGFR remains stable. PMID:26215933

  15. [Real-time polymerase chain reaction in the diagnosis of pulmonary tuberculosis].

    PubMed

    Salina, T Iu; Morozova, T I

    2008-01-01

    To enhance the efficiency of diagnosis of oligo- and abacillar pulmonary tuberculosis and its differential diagnosis with other lung diseases, the authors studied the informative value of real-time polymerase chain reaction (PCR) used in 62 patients with different clinical forms of tuberculosis and 108 differentially diagnostic patients. Real-time PCR has been ascertained to be a significantly more sensitive and highly specific tool in tuberculosis diagnosis, which considerably improves the specific recognition of the etiology of a pathogenetic process in oligo- and abacillar patients. Particularly encouraging results have been obtained when examining differentially diagnostic patients with the rounded shadows being formed in the lung. PMID:18710048

  16. The direct application of the polymerase chain reaction to DNA extracted from foods.

    PubMed

    Dickinson, J H; Kroll, R G; Grant, K A

    1995-04-01

    Two methods for the successful extraction of DNA from foods are described. The rapid lysis method uses a proteinase K buffer system to lyse cells and solubilize food samples. DNA is then precipitated using isopropanol. The second method achieves cell lysis using toluene and mutanolysin, and solubilization using guanidium thiocyanate. Following protein removal with organic solvents DNA is precipitated with isopropanol. Both methods enabled the polymerase chain reaction to be applied directly to DNA extracted from samples of cheese, coleslaw and raw chicken and allowed the direct rapid, sensitive and specific detection of Yersinia enterocolitica, Aerococcus viridans and Listeria monocytogenes in these foods. PMID:7766115

  17. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

    PubMed Central

    2011-01-01

    Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR) assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs) would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit) and after 10 days (follow-up visit). Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days). The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202) of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204) (P = 0.005) of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202) in the rapid result group and 17.2% (35 of 204) in the delayed result group (P = 0

  18. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompA DNA of Chlamydia spp.

    PubMed Central

    Kaltenboeck, B; Kousoulas, K G; Storz, J

    1992-01-01

    Specific and sensitive amplification of major outer membrane protein (MOMP) gene (ompA) DNA sequences of Chlamydia species with various MOMP genotypes was achieved by a two-step polymerase chain reaction (PCR). Degenerate, inosine-containing oligonucleotide primers homologous to the 5' and 3' ends of the translated regions of all chlamydial MOMP genes were used in a PCR to amplify a DNA fragment of approximately 1,120 bp. A portion of this DNA fragment was amplified in a second genus-specific reaction that yielded a DNA fragment of approximately 930 bp. A pair of degenerate oligonucleotide primers homologous to internal sequences of the primary DNA fragment was used in this PCR. This method detected three cognate chlamydial genomes in a background of 1 microgram of unrelated DNA. MOMP genes of 13 representative chlamydial MOMP genotypes of the species C. trachomatis, C. pneumoniae, and C. psittaci were amplified. In a secondary PCR, group-specific detection was achieved by the simultaneous use of one genus-specific primer and three primers derived from different fingerprint regions of three major groups of chlamydiae. This multiplex PCR differentiated the groups by the length of the amplified DNA fragments and detected the simultaneous presence of DNA sequences of the Chlamydia spp. with different MOMP genotypes. Further differentiation as ompA restriction fragment length polymorphism types among all chlamydial strains with the various MOMP genotypes analyzed here was achieved by restriction endonuclease analysis of the secondary PCR products. DNA sequences corresponding to the ompA restriction fragment length polymorphism type B577 of C. psittaci were detected in two of seven milk samples from cases of bovine mastitis. Images PMID:1349899

  19. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    PubMed Central

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad

    2011-01-01

    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  20. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  1. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler. PMID:27271319

  2. Detection of Enterococcus faecalis in Necrotic Teeth Root Canals by Culture and Polymerase Chain Reaction Methods

    PubMed Central

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Aksoy, Semiha C.; Eronat, Cemal

    2007-01-01

    Objectives The aim of this study was to investigate the presence of Enterococcus faecalis in endodontic infections in both deciduous and permanent teeth by culture and polymerase chain reaction (PCR) methods. Methods A total of 145 children aged 5–13 years old were involved in this study. The presence of E. faecalis in necrotic deciduous and permanent teeth root canals was studied using culture and polymerase chain reaction methods. Results Among 145 molar teeth, 57% (n=83) presented necrotic asymptomatic pulp tissues and were included in this study. Culture and PCR methods detected the test species in 18 and 22 of 83 teeth involved, respectively. E. faecalis was cultured from 8 (18%) of 45 necrotic deciduous teeth and from 10 (26%) of 38 necrotic permanent teeth. PCR detection identified the target species in 10 (22%) and 12 (32%) of necrotic deciduous and permanent teeth respectively. Statistically significant difference in the presence of E. faecalis in deciduous and permanent teeth was found by culture and PCR methods (P=0.03 and 0.02, respectively). The difference in the presence of E. faecalis between two different methods was not statistically significant (P>.05). Conclusions The results of the present study confirm that both culture and PCR methods are sensitive to detect E. faecalis in root canals. PMID:19212470

  3. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    SciTech Connect

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. ); Wunder, J.S.; Andrulis, I.L. ); Gazdar, A.F. ); Willman, C.L.; Griffith, B. ); Von Hoff, D.D. )

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  4. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  5. Western thymomas lack Epstein-Barr virus by Southern blotting analysis and by polymerase chain reaction.

    PubMed Central

    Inghirami, G.; Chilosi, M.; Knowles, D. M.

    1990-01-01

    The authors investigated 16 western thymomas, 9 from the United States and 7 from Europe, for the presence of Epstein-Barr virus (EBV) DNA sequences by both Southern blot hybridization analysis and polymerase chain reaction using EBV-specific DNA probes that detect the long internal repeat and terminal repeat regions and the EBNA-1 gene. None of the 16 thymomas contained evidence of the EBV genome, even though we could detect EBV by Southern blotting when EBV DNA represents less than or equal to 1% of the total DNA and by polymerase chain reaction when a single EBV-positive cell is present among 10(5) EBV-negative cells. These results fail to demonstrate EBV genome in western thymomas and stand in contrast to those of McGuire et al (Am J Pathol 1988, 131:385) who previously reported that the EBV genome is present in thymomas occurring in southern Chinese patients. Therefore EBV does not appear to be implicated in the pathogenesis of all thymomas. The presence of EBV in eastern thymomas, regions where EBV is endemic may be due to epidemiologic factors and/or genetic predispositions. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2162629

  6. A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

    EPA Science Inventory

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

  7. Rapid differentiation and identification of potential severe strains of Citrus tristeza virus by real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Yokomi, R K; Saponari, M; Sieburth, P J

    2010-04-01

    A multiplex Taqman-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to identify potential severe strains of Citrus tristeza virus (CTV) and separate genotypes that react with the monoclonal antibody MCA13. Three strain-specific probes were developed using intergene sequences between the major and minor coat protein genes (CPi) in a multiplex reaction. Probe CPi-VT3 was designed for VT and T3 genotypes; probe CPi-T36 for T36 genotypes; and probe CPi-T36-NS to identify isolates in an outgroup clade of T36-like genotypes mild in California. Total nucleic acids extracted by chromatography on silica particles, sodium dodecyl sulfate-potassium acetate, and CTV virion immunocapture all yielded high quality templates for real-time PCR detection of CTV. These assays successfully differentiated CTV isolates from California, Florida, and a large panel of CTV isolates from an international collection maintained in Beltsville, MD. The utility of the assay was validated using field isolates collected in California and Florida. PMID:20205535

  8. Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

    PubMed

    Ha, Y; Fessehaie, A; Ling, K S; Wechter, W P; Keinath, A P; Walcott, R R

    2009-06-01

    To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae. PMID:19453225

  9. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    PubMed Central

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  10. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  11. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    PubMed Central

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-01-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted. Images PMID:1696290

  12. Epidemiological investigation of Salmonella tilene by pulsed-field gel electrophoresis and polymerase chain reaction

    PubMed Central

    Anand, Chandar M; Fonseca, Kevin; Longmore, Ken; Rennie, Robert; Chui, Linda; Lingley, Mike; Woodward, David

    1997-01-01

    Pulsed-field gel electrophoresis (PFGE) and DNA fingerprinting by the polymerase chain reaction (PCR) were performed on 11 isolates of Salmonella tilene. Five strains were from a cluster of human patients, six from sugar gliders and pygmy hedgehogs kept as family pets or from local pet retailers, and one isolate from the first North American case of S tilene described in Washington State in 1994. The PFGE restriction patterns showed all isolates to be similar. However, PCR using primers to the 16S and 23S rRNA genes of Escherichia coli demonstrated that the Washington State isolate differed from the rest of the other isolates, which were all similar based upon their DNA fingerprint. This study indicates that reliance on one technique alone may be insufficient to show nuances between strains that are, in many respects, closely related. PMID:22346526

  13. Rapid multi sample DNA amplification using rotary-linear polymerase chain reaction device (PCRDisc).

    PubMed

    Sugumar, D; Kong, L X; Ismail, Asma; Ravichandran, M; Su Yin, Lee

    2012-03-01

    Multiple sample DNA amplification was done by using a novel rotary-linear motion polymerase chain reaction (PCR) device. A simple compact disc was used to create the stationary sample chambers which are individually temperature controlled. The PCR was performed by shuttling the samples to different temperature zones by using a combined rotary-linear movement of the disc. The device was successfully used to amplify up to 12 samples in less than 30 min with a sample volume of 5 μl. A simple spring loaded heater mechanism was introduced to enable good thermal contact between the samples and the heaters. Each of the heater temperatures are controlled by using a simple proportional-integral-derivative pulse width modulation control system. The results show a good improvement in the amplification rate and duration of the samples. The reagent volume used was reduced to nearly 25% of that used in conventional method. PMID:22685508

  14. Detection of Epstein-Barr virus sequences in Hodgkin's disease by the polymerase chain reaction.

    PubMed Central

    Wright, C. F.; Reid, A. H.; Tsai, M. M.; Ventre, K. M.; Murari, P. J.; Frizzera, G.; O'Leary, T. J.

    1991-01-01

    The authors examined paraffin-embedded lymph node biopsies from 65 cases of Hodgkin's disease for the presence of Epstein-Barr virus (EBV) DNA, using the highly sensitive polymerase chain reaction technique. Overall 40% of the cases were positive for EBV DNA; there were no statistically significant differences in the frequency of EBV positivity among the different subtypes of Hodgkin's disease. These results are in agreement with those of previous studies that employed less sensitive detection techniques and suggest that EBV either is present in pathologic tissues only in some phases of the evolution of Hodgkin's disease or is a pathogenetic factor involved in only a portion of cases. Images Figure 1 Figure 2 Figure 3 PMID:1651058

  15. How appropriate are cerebrospinal fluid polymerase chain reaction requests for suspected central nervous system infections?

    PubMed

    Mamoojee, Yaasir; Chadwick, David

    2011-12-01

    Cerebrospinal fluid (CSF) polymerase chain reaction (PCR) assays have become the main diagnostic tests for central nervous system viral infections in recent years. Previous studies have suggested algorithms based on CSF leukocyte count and total protein levels to determine when CSF PCR assays are indicated. Based on these criteria, 1,469 CSF PCR tests requested over a two-year period were reviewed. A proportion of positive PCR results were found in children with normal CSF, unlike in adults where such occurrences were extremely rare. The results suggest that applying a strategy of screening CSF specimens using leukocyte count, glucose and protein, at least in adults, may have avoided more than half of CSF PCR requests with little detriment to patient care and considerable cost savings. Larger prospective studies are needed to determine whether algorithms using standard CSF parameters and clinical information can optimise the use of CSF PCR assays in clinical practice. PMID:22268308

  16. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  17. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  18. Use of polymerase chain reaction-amplified Helicobacter pylori urease structural genes for differentiation of isolates.

    PubMed Central

    Foxall, P A; Hu, L T; Mobley, H L

    1992-01-01

    Helicobacter pylori has been demonstrated as an etiologic agent of human gastritis and peptic ulcer formation. However, there is no straightforward basis to distinguish different isolates. We used the polymerase chain reaction (PCR) to amplify the urease structural subunit genes, ureA and ureB, which, when digested with appropriate restriction endonucleases, allow the differentiation of patterns on agarose gels. PCR amplification was possible with DNA rapidly extracted from H. pylori by alkaline lysis and phenol-chloroform. The 2.4-kb PCR products amplified from 22 clinical isolates and subjected to HaeII restriction endonuclease digestion produced 10 distinct patterns on agarose gels, with two patterns being shared between five and six strains. PCR amplification of the urease genes may enable the differentiation of closely related H. pylori strains by restriction digest analysis of PCR-amplified ureA and ureB genes. Images PMID:1313051

  19. Molecular characterization of Leishamania isolates from China by inter-simple sequence repeat polymerase chain reaction.

    PubMed

    Wang, Yong; Yang, Yuetao; Wang, Junyun; Bao, Yifang; Guan, Liren; Gao, Chunhua; Shi, Feng

    2010-05-01

    Leishmania has distinct epidemiological and biological characteristics and causes a variety of clinical symptoms. To understand the genetic diversity and the phylogenetic relationships among Leishmania isolates from China, 29 Leishmania isolates from different geographic origins, vectors, and hosts were analyzed using 21 inter-simple sequence repeat polymerase chain reaction (ISSR-PCR) primers. A total of 864 polymorphic bands were obtained. According to the results of the neighbor-joining phylogenetic tree and principal component analysis, the 29 isolates studied clustered into six groups. Isolates of Leishmania donovani complex from China share the highest similarity with the reference strain of L. donovani (DD8). This study helps to elucidate the genetic relationship among Leishmania isolates from China and similarities between Chinese isolates and World Health Organization reference strains. Furthermore, ISSR-PCR could also be a quick, simple, and reliable method for Leishmania species identification. PMID:20237800

  20. Detection of Escherichia coli in sewage and sludge by polymerase chain reaction

    SciTech Connect

    Tsai, Yuli; Palmer, C.J.; Sangermano, L.R. )

    1993-02-01

    The polymerase chain reaction (PCR) is a powerful tool in exploration of microbial activities and identities in environmental microbiology. High concentrations of humic acidlike substances in raw sewage and raw sludge have prevented the use of PCR with sewage and sludge samples. However, monitoring waste water and sludge by the PCR would lead to increased public health protection. In this study a rapid DNA extraction method and rapid purification procedure are combined with the PCR to detect Escherichia coli in sewage and sludge. The PCR is successfully used to amplify from both, a fragment of the E. coli uidAgene that codes for [beta]-D-glucuronidase. Because of their sensitivity and specificity, the PCR and nonradioactive gene probe techniques can be used to detect potentially pathogenic microorganisms in raw sewage and sludge, allowing for evaluation of the efficiency of treatments to remove pathogens.

  1. [Characterization of aldehyde dehydrogenase gene fragment from mung bean Vigna radiata using the polymerase chain reaction].

    PubMed

    Ponomarev, A G; Bubiakina, V V; Tatarinova, T D; Zelenin, S M

    1998-01-01

    Two degenerate oligonucleotide sequence primers and polymerase chain reactions on total DNA have been utilized to clone on 651--bp gene fragment coding the central part of amino acid sequence of an earlier unknown aldehyde dehydrogenase (ALDH) from mung bean. The deduced partial amino acid sequence for this aldehyde dehydrogenase shows about 65% sequence identity to ALDHs of Vibrio cholerae Rhodococcus sp., Alcaligenes eutrophus and about 45% sequence identity to mammalian ALDHs 1 and 2, ALDHs of Aspergillus niger and A, nidulans, the betain aldehyde dehydrogenase from spinach. Alignment of the mung bean aldehyde dehydrogenase partial amino acid sequence with the sequence of 16 NAD(P)(+)-dependent aldehyde dehydrogenases has demonstrated that all strictly conserved amino acid residues and all three conservative regions are identical. PMID:9778740

  2. Analysis of BRCA2 loss of heterozygosity in tumor tissue using droplet digital polymerase chain reaction.

    PubMed

    Cochran, Rory L; Cravero, Karen; Chu, David; Erlanger, Bracha; Toro, Patricia Valda; Beaver, Julia A; Zabransky, Daniel J; Wong, Hong Yuen; Cidado, Justin; Croessmann, Sarah; Parsons, Heather A; Kim, Minsoo; Wheelan, Sarah J; Argani, Pedram; Park, Ben Ho

    2014-07-01

    Loss-of-heterozygosity (LOH) analysis of archival tumor tissue can aid in determining the clinical significance of BRCA variants. Here we describe an approach for assessing LOH in formalin-fixed, paraffin-embedded (FFPE) tissues using variant-specific probes and droplet digital polymerase chain reaction (ddPCR). We evaluated LOH in 2 related breast cancer patients harboring a rare missense BRCA2 variant of unknown clinical significance (c.6966G>T; M2322I). Conventional PCR followed by Sanger sequencing suggested a change in allelic abundance in the FFPE specimens. However, we found no evidence of LOH as determined by the allelic ratio (wild type-variant) for BRCA2 in both patients' archival tumor specimens and adjacent normal control tissues using ddPCR. In summary, these experiments demonstrate the utility of ddPCR to quickly and accurately assess LOH in archival FFPE tumor tissue. PMID:24824029

  3. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    PubMed

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  4. Polymerase chain reaction comparison of the gene for strictosidine synthase from ten Rauvolfia species.

    PubMed

    Bracher, D; Kutchan, T M

    1992-05-01

    The gene for strictosidine synthase, str1, has been analyzed by the polymerase chain reaction in ten species of Rauvolfia, the origins of which span the tropical belt: R. cambodiana (Indochina), R. canescens (India), R. chinensis (China), R. heterophylla (Central America), R. mannii (West Africa), R. nitida (West Indies), R. praecox (Brasil), R. serpentina (India), R. sumatrana (Indonesia) and R. verticillata (Indochina). Restriction endonuclease analysis of the gene fragments produced with genomic DNA from each of the ten species as template revealed that str1 is highly conserved in the Rauvolfia species investigated. These results suggest that there is a stringent selection pressure on the gene for this key enzyme of indole alkaloid biosynthesis. PMID:24202981

  5. Rapid multi sample DNA amplification using rotary-linear polymerase chain reaction device (PCRDisc)

    PubMed Central

    Sugumar, D.; Kong, L. X.; Ismail, Asma; Ravichandran, M.; Su Yin, Lee

    2012-01-01

    Multiple sample DNA amplification was done by using a novel rotary-linear motion polymerase chain reaction (PCR) device. A simple compact disc was used to create the stationary sample chambers which are individually temperature controlled. The PCR was performed by shuttling the samples to different temperature zones by using a combined rotary-linear movement of the disc. The device was successfully used to amplify up to 12 samples in less than 30 min with a sample volume of 5 μl. A simple spring loaded heater mechanism was introduced to enable good thermal contact between the samples and the heaters. Each of the heater temperatures are controlled by using a simple proportional–integral–derivative pulse width modulation control system. The results show a good improvement in the amplification rate and duration of the samples. The reagent volume used was reduced to nearly 25% of that used in conventional method. PMID:22685508

  6. Detection of the Pinewood Nematode, Bursaphelenchus xylophilus, Using a Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Cao, A X; Liu, X Z; Zhu, S F; Lu, B S

    2005-05-01

    ABSTRACT The pinewood nematode, Bursaphelenchus xylophilus, has caused significant damage to pine plantations both in East Asia and North America and is an important quarantine organism. A real-time polymerase chain reaction (PCR) assay was developed to detect B. xylophilus. A set of primers and probe specific for B. xylophilus was designed to target the ribosomal DNA internal transcribed spacer region. Optimal primer concentration, Mg(2+) concentration, and extension temperature were 400 nM, 3.0 mM, and 60 degrees C, respectively. The assay was highly specific and sensitive, detecting as little as 0.01 ng of B. xylophilus DNA. The real-time PCR assay also successfully detected B. xylophilus in field samples, and it should be very useful for quarantine purposes. PMID:18943323

  7. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  8. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  9. Assembling long heteroduplexes by asymmetric polymerase chain reaction and annealing the resulting single-stranded DNAs.

    PubMed

    Wang, Mugui; Wei, Chuchu; Ye, Xiufen; Liu, Jianping; Zhang, Cuicui; Chen, Hao; Zhang, Xiaobo; Tu, Jumin

    2015-04-15

    We developed an effective protocol for generating high-purity heteroduplexes via annealing single-stranded DNAs (ssDNAs) derived from plasmid DNA by asymmetric polymerase chain reaction (A-PCR). With the addition of dimethyl sulfoxide, a one-step A-PCR procedure can generate ssDNAs stably at a range of reaction temperatures. Several annealing buffers can anneal two ssDNAs into heteroduplexes effectively. We further developed a simple strategy to create d(GATC) hemimethylated heteroduplexes by annealing fully methylated homoduplexes in the presence of excessive unmethylated ssDNAs. The constructed heteroduplexes have been well tested as substrates for mismatch repair in Escherichia coli and, thus, can be used in various biotechnology applications. PMID:25575760

  10. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  11. Rapid isolation of DNA from fresh and preserved fish scales for polymerase chain reaction.

    PubMed

    Yue, G H; Orban, L

    2001-05-01

    We developed a simple and inexpensive method to extract DNA from fresh and preserved fish scales. The procedure is based on boiling the scales in 5% Chelex 100, followed by digestion with proteinase K and subsequent absorption of genomic DNA using silica. A single fresh scale from larger species (e.g., tilapia) or a few scales from smaller species (e.g., 4 scales from zebrafish) provide over 200 ng of DNA, enough for at least 40 polymerase chain reaction amplifications. The procedure is applicable for DNA isolation not only from fresh and ethanol-preserved scales, but also from dried and formaldehyde-treated samples, and thus might be useful for investigating specimens stored in museums and other collections. Since the removal of a few scales is a gentle means of sample collection, this technique will allow analysis of genetic diversity, mating systems, and parentage in populations of endangered or ornamental fish with minimal experimental influence. PMID:14961356

  12. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis.

    PubMed Central

    Telenti, A; Marchesi, F; Balz, M; Bally, F; Böttger, E C; Bodmer, T

    1993-01-01

    A method for the rapid identification of mycobacteria to the species level was developed on the basis of evaluation by the polymerase chain reaction (PCR) of the gene encoding for the 65-kDa protein. The method involves restriction enzyme analysis of PCR products obtained with primers common to all mycobacteria. Using two restriction enzymes, BstEII and HaeIII, medically relevant and other frequent laboratory isolates were differentiated to the species or subspecies level by PCR-restriction enzyme pattern analysis. PCR-restriction enzyme pattern analysis was performed on isolates (n = 330) from solid and fluid culture media, including BACTEC, or from frozen and lyophilized stocks. The procedure does not involve hybridization steps or the use of radioactivity and can be completed within 1 working day. Images PMID:8381805

  13. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction.

    PubMed

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela

    2013-01-01

    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling. PMID:23075531

  14. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.

    PubMed Central

    Alexander, H S; Key, D W; Nagy, E

    1998-01-01

    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb BamHI fragment of the Ontario 1598 ILTV strain. Thirty-four of the Ontario isolates and all of the New Brunswick isolates were amplified successfully. This suggests that the selected primers would be useful for the majority of the isolates encountered in outbreaks of ILTV. Images Figure 1. Figure 2. PMID:9442943

  15. Varicella-zoster virus distribution in Ramsay Hunt syndrome revealed by polymerase chain reaction.

    PubMed

    Murakami, S; Nakashiro, Y; Mizobuchi, M; Hato, N; Honda, N; Gyo, K

    1998-03-01

    The pathogenesis of facial nerve paralysis and vestibulo-cochlear dysfunction of Ramsay Hunt syndrome remains unclear as varicella-zoster virus (VZV) has not been demonstrated in the lesions. Using the polymerase chain reaction, we detected VZV genomes not only in the vesicles on the auricles or oral cavity but also in the facial nerve sheath, middle ear mucosa and cerebrospinal fluid from patients with Ramsay Hunt syndrome. The VZV genome was undetectable in the same kinds of clinical samples obtained from control patients with facial nerve paralysis of other etiologies. The results indicated that VZV spreads widely in the neural components, mucocutaneous tissue and cerebrospinal fluid. The present study will facilitate better understanding of the pathogenesis of facial nerve paralysis, vertigo, hearing impairment and other cranial nerve dysfunction of Ramsay Hunt syndrome. PMID:9583779

  16. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis.

    PubMed

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming

    2016-03-01

    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment. PMID:26648455

  17. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    PubMed

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  18. G-quadruplex-generating polymerase chain reaction for visual colorimetric detection of amplicons.

    PubMed

    Bhadra, Sanchita; Codrea, Vlad; Ellington, Andrew D

    2014-01-15

    We have developed a self-reporting polymerase chain reaction (PCR) system for visual colorimetric gene detection and distinction of single nucleotide polymorphisms (SNPs). Amplification is performed using target-specific primers modified with a 5'-end tail that is complementary to a G-quadruplex deoxyribozyme-forming sequence. At end-point, G-quadruplexes are forced to fold from PCR-generated duplex DNA and then are used to colorimetrically report the successful occurrence of PCR by assaying their peroxidase activity using a chromogenic substrate. Furthermore, primer design considerations for the G-quadruplex-generating PCR system have allowed us to visually distinguish SNPs associated with Mycobacterium tuberculosis drug resistance alleles. PMID:24135653

  19. Pseudogene-free amplification of HPRT1 in quantitative reverse transcriptase polymerase chain reaction.

    PubMed

    Valadan, Reza; Amjadi, Omolbanin; Tehrani, Mohsen; Rafiei, Alireza; Hedayatizadeh-Omran, Akbar; Alizadeh-Navaei, Reza

    2015-09-15

    Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) provides a powerful tool for precise gene expression analysis. The accuracy of the results highly depends on careful selection of a reference gene for data normalization. HPRT1 (hypoxanthine phosphoribosyl transferase 1) is a frequently used housekeeping gene for normalizing relative expression values. However, the existence of processed pseudogenes for HPRT1 might interfere with reliable results obtained in qRT-PCR due to amplification of unintended products. Here, we designed a primer pair for pseudogene-free amplification of HPRT1 in qRT-PCR. We demonstrate that this primer pair specifically amplified HPRT1 messenger RNA (mRNA) sequence while avoiding coamplification of the pseudogenes. PMID:26050630

  20. Polymerase Chain Reaction Diagnosis of Leishmaniasis: A Species-Specific Approach.

    PubMed

    González-Marcano, Eglys; Kato, Hirotomo; Concepción, Juan Luis; Márquez, María Elizabeth; Mondolfi, Alberto Paniz

    2016-01-01

    Leishmaniasis is an infectious disease caused by protozoan parasites of the genus Leishmania which are transmitted to humans through bites of infected sand flies. The variable clinical manifestations and the evolution of the disease are determined by the infecting species. Recognition at a species level is of utmost importance since this greatly impacts therapy decision making as well as predicts outcome for the disease. This chapter describes the application of polymerase chain reaction (PCR) in the detection of Leishmania parasites across the disease spectrum, including protocols for sample collection and transportation, genomic material extraction, and target amplification methods with special emphasis on PCR amplification of the cytochrome b gene for Leishmania spp. species identification. PMID:26843051

  1. Mapping a mutation in Caenorhabditis elegans using a polymerase chain reaction-based approach.

    PubMed

    Myers, Edith M

    2014-01-01

    Many single nucleotide polymorphisms (SNPs) have been identified within the Caenorhabditis elegans genome. SNPs present in the genomes of two isogenic C. elegans strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which undergraduate students use molecular biological techniques to map a mutation to a chromosome using a set of SNPs. Through this multi-week exercise, students perform genetic crosses, DNA extraction, polymerase chain reaction, restriction enzyme digests, agarose gel electrophoresis, and analysis of restriction fragment length polymorphisms. Students then analyze their results to deduce the chromosomal location of the mutation. Students also use bioinformatics websites to develop hypotheses that link the genotype to the phenotype. PMID:24615818

  2. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  3. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  4. Detection of varicella-zoster virus (VZV) DNA in clinical samples from patients with VZV by the polymerase chain reaction.

    PubMed Central

    Kido, S; Ozaki, T; Asada, H; Higashi, K; Kondo, K; Hayakawa, Y; Morishima, T; Takahashi, M; Yamanishi, K

    1991-01-01

    A polymerase chain reaction system for the detection of varicella-zoster virus was established. Of 25 nucleotides, 4 oligonucleotide pairs (regions of thymidine kinase, thymidylate synthetase, glycoprotein I, and immediate early gene) were synthesized. The first three oligonucleotide pairs could be used as primers on the basis of specific DNA amplification. Varicella-zoster virus DNA was amplified by this polymerase chain reaction system in 20 of 20 vesicle samples, 5 of 6 crusts, and 12 of 13 throat swabs collected from patients with clinical varicella. Images PMID:1847154

  5. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction

    PubMed Central

    Elshawadfy, Ashraf M.; Keith, Brian J.; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A.

    2014-01-01

    The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the “forked-point” (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the “forked-point” and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms. PMID:24904539

  6. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section 147.30 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  7. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section 147.31 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  8. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section 147.30 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section 147.31 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  11. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis. PMID:27032252

  12. Development of a polymerase chain reaction test for specific identification of the urinary tract pathogen Aerococcus urinae.

    PubMed Central

    Aguirre, M; Collins, M D

    1993-01-01

    A polymerase chain reaction test was developed for identification of the gram-positive urinary tract pathogen Aerococcus urinae. Oligonucleotide primers were based on highly specific sequences within the small-subunit rRNA gene. A confirmatory test based on hybridization of the amplified products to a highly specific internal probe was also developed. Images PMID:7684752

  13. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  14. EFFECTIVE METHOD TO EXTRACT DNA FROM ENVIRONMENTAL SAMPLES FOR POLYMERASE CHAIN REACTION AMPLIFICATION AND DNA FINGERPRINT ANALYSIS

    EPA Science Inventory

    A rapid direct-extraction method was used to obtain DNA from environmental soil samples. eat, enzymes, and guanidine isothiocyanate were utilized to lyse cells. he DNA was purified by agarose gel electrophoresis, amplified with 16S based primers by use of the polymerase chain rea...

  15. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  16. Direct detection of Mycobacterium tuberculosis in respiratory specimens in a clinical laboratory by polymerase chain reaction.

    PubMed Central

    Forbes, B A; Hicks, K E

    1993-01-01

    The emergence of epidemic multiple-drug-resistant (MDR) strains of Mycobacterium tuberculosis in conjunction with an increase in the number of reported cases of tuberculosis (TB) represents a major public health problem. In light of a recent outbreak of MDR M. tuberculosis at our center, we began the development of a polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary TB using two sets of primers, one based on the IS6110 repeated sequence of M. tuberculosis and the other based on the protein antigen b (PAB). Reaction conditions were first optimized as to the appropriate extraction protocol and the concentrations of primer pairs, nucleotides, and MgCl2. Following a preliminary evaluation of the assay with clinical specimens, extraction and amplification procedures were further modified. PAB and IS6110 primers detected between 2 and 23 and 0.023 and 0.23 CFU of M. tuberculosis, respectively, in pooled, M. tuberculosis-negative sputa by our optimized PCR assay. After routine processing for mycobacteria, 734 specimens were subsequently amplified. DNA for amplification was obtained by boiling and beating the sediments with Tween 20. For each reaction, DNA (10 microliters) was added to an amplification mixture containing 12 pmol of IS6110 primers, 20 pmol of PAB primers, 2 mM MgCl2, 200 microM nucleotides, and 2.5 U of Taq polymerase and the mixture was then amplified for 40 cycles. The sensitivity and specificity of our PCR assay were 87.2 and 97.7%, respectively. We were unable to interpret the results for seven specimens (1%). In our experience, PCR proved to be a useful rapid diagnostic test for TB in a clinical setting and a valuable epidemiological tool for determining exposure groups in the hospital setting. Our findings also underscore the need for the systematic optimization of PCR assay conditions. Images PMID:8349744

  17. Use of polymerase chain reaction for diagnosis of picornavirus infection in subjects with and without respiratory symptoms.

    PubMed Central

    Johnston, S L; Sanderson, G; Pattemore, P K; Smith, S; Bardin, P G; Bruce, C B; Lambden, P R; Tyrrell, D A; Holgate, S T

    1993-01-01

    Rhinoviruses and enteroviruses are the major members of the picornavirus genus that cause human disease. We compared the polymerase chain reaction and viral culture for the identification of picornaviruses in nasal aspirates from children during episodes of respiratory symptoms and when asymptomatic and from asymptomatic adults. One hundred eight children, aged 9 to 11 years, completed a year-long study. Within 24 to 48 h of a report of respiratory symptoms, a nasal aspirate was taken in the home. Nasal aspirates were also taken from 65 of the children and from 33 normal adults when they had been free of respiratory symptoms for at least 2 weeks. Picornaviruses were isolated by culture for three passages in Ohio HeLa cells in rolling tubes at 33 degrees C and pH 7.0. For the polymerase chain reaction, duplicate 50-microliters samples were amplified with conserved primers from the 5' noncoding region. Picornaviruses generated approximately 380-bp bands in agarose gel electrophoresis; the specificity of these bands was confirmed by filter hybridization with a conserved internal probe. Picornaviruses were isolated by culture in 47 (46 rhinoviruses) of 292 symptomatic episodes (16%), whereas the polymerase chain reaction identified picornavirus genomic material in 146 episodes (50%), including all but one of the culture-positive episodes. As for asymptomatic samples, eight (12%) children and two (4%) adults were positive by the polymerase chain reaction, whereas only one child's specimen was positive by culture. This polymerase chain reaction assay represents a clear advance in the identification of picornavirus infection, with a detection rate threefold greater than the virus culture method. Images PMID:8380179

  18. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  19. Polymerase chain reaction for detection of Toxoplasma gondii in human biological samples.

    PubMed

    Cermáková, Z; Rysková, O; Plísková, L

    2005-01-01

    Using the polymerase chain reaction (PCR), Toxoplasma gondii from gene TGR1E with primers TGR1E-1, TGR1E-2 (standard PCR), and from B1 gene with primers TM1, TM2, TM3 (hemi-nested PCR) was detected in biological samples from 347 individuals (441 biological materials). Of the total of 441 biological materials, T. gondii DNA was detected in 5.2 %; it was positive in the following samples: blood (n = 6), blood from newborns (2), biopsies (2) and samples of progenitor cells (2) (from candidates for bone marrow transplantation). DNA of T. gondii was also revealed in 11 samples (8.3 %) of 120 cases of pregnant women during prenatal examinations. A positive result in the blood was also found in two cases of newborn babies from mothers who were infected in later pregnancy. The positive PCR examination was confirmed by serological methods (ELISA and complement fixation test). Agreement of PCR results and the detection of antibodies against toxoplasma was found in 83.3 %. Rapid PCR examination for the confirmation of acute parasitemia T. gondii is particularly important for the patients in whom the infection may cause serious consequences (e.g., for fetus in pregnant women or for patients suffering from imunosuppression). PMID:16408853

  20. Polymerase chain reaction for the specific detection of Escherichia coli/Shigella.

    PubMed

    Spierings, G; Ockhuijsen, C; Hofstra, H; Tommassen, J

    1993-09-01

    The outer membrane protein PhoE of members of the family Enterobacteriaceae consists of conserved membrane-spanning segments and hypervariable surface-exposed regions. Two oligonucleotides based on DNA sequences encoding two different cell-surface-exposed regions of the Escherichia coli K12 PhoE protein were tested for their specificity in polymerase chain reactions. They reacted with all strains of the species E. coli/Shigella tested, except for strain S. boydii serovar 13, which is known to represent a different DNA-relatedness group. The probes did not react with any other Enterobacteriaceae tested, including strains of Escherichia blattae, Escherichia hermanii, Escherichia vulneris and Escherichia adecarboxylata, except for an Escherichia fergusonnii strain, which is most closely related to E. coli. Therefore, the primer couple showed a high degree of species-specificity. In addition, a second primer couple based on two conserved regions of the phoE genes was tested. This primer couple recognized a broad group of closely related enteric bacteria including Salmonella and Shigella. PMID:8310181

  1. Specific and Rapid Detection of Mycobacterium tuberculosis Complex in Clinical Samples by Polymerase Chain Reaction

    PubMed Central

    Singh, Anamika; Kashyap, Vijendra Kumar

    2012-01-01

    Background. Tuberculosis, a global health problem and highly prevalent in India, has always been a serious problem with respect to definitive diagnosis. Polymerase chain reaction (PCR) techniques are now widely used for early detection and species differentiation of mycobacteria, but mostly with their own limitations. We aim to detect and differentiate Mycobacterium tuberculosis (Mtb) infections by choosing appropriate target sequences, ideally present in all mycobacterial species (MTB complex) and absent in others. Methods. Amplification of three target sequences from unrelated genes, namely, hsp 65 (165 bp), dnaJ (365 bp), and insertion element IS 6110 (541 bp) by PCR was carried out in clinical samples from suspected cases of tuberculosis/ mycobacterioses and healthy controls. Results. The sensitivity of this method ranged from 73.33% to 84.61%, and the specificity was 80%. The PCR method was significantly better (P = 0.03 and P = 0.009) than both smear and culture methods. Conclusion. Our trimarker-based PCR method could specifically detect M. tuberculosis and MTB complex infection from that of major pathogenic NTM and nonpathogenic mycobacteria. This method, by well distinguishing between MTB complex and NTM, presented a fast and accurate method to detect and diagnose mycobacterial infections more efficiently and could thereby help in better patient management particularly considering the increase in mycobacterial infections due to emergence of NTM over the past decades. PMID:23093958

  2. Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis

    PubMed Central

    SETTHAWONGSIN, Chanokchon; TECHANGAMSUWAN, Somporn; TANGKAWATTANA, Sirikachorn; RUNGSIPIPAT, Anudep

    2016-01-01

    Canine transmissible venereal tumor (CTVT) is the only naturally contagious tumor that is transmitted during coitus or social behaviors. Based on the tumor’s location, the diagnosis of genital TVT (GTVT) is comparably easier than those in the extragenital area (ETVT) that are more easily incorrectly diagnosed. Fortunately, CTVT cells contain a specific long interspersed nuclear elements (LINE), inserted upstream of the myc gene, allowing a diagnostic polymerase chain reaction (PCR) based detection assay. The objectives of this study were aimed to improve the diagnostic accuracy by applying the diagnostic LINE1-c-myc PCR assay and fine needle aspiration (FNA) collection in direct comparison with standard cytological and histopathological analyses. Seventy-four dogs, comprised of 41 and 31 dogs with tumor masses at their external genitalia and extragenital areas (e.g. skin and nasal cavity), respectively, were included in this study. The signalment of these 65 dogs and clinical history of 20 client-owned dogs were collected. Samples were taken by biopsy for both histopathological examination and FNA for cytological examination and diagnostic PCR. The PCR products from 10 apparently CTVT samples were purified and sequenced. Sixty-one CTVT cases were diagnosed by cytological and histological analyses, but 65 were positive by the PCR assay. Overall, the PCR assay improved the accuracy of diagnostic CTVT results, especially for the more difficult ETVT tumors. Moreover, this PCR-based approach can facilitate the decision as to discontinue chemotherapy by discrimination between residual tumor cell masses and fibrotic tissue. PMID:27075116

  3. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  4. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Souza, M T; Carvalho-Zilse, G A

    2014-01-01

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  5. Two putative protein-tyrosine kinases identified by application of the polymerase chain reaction.

    PubMed Central

    Wilks, A F

    1989-01-01

    The pivotal role that protein-tyrosine kinases (PTKs) play in the growth regulation of eukaryotic cells is manifest in the frequent appearance of members of the PTK family as growth factor receptors or as the transforming agents of acutely transforming retroviruses. A feature common to all members of the PTK family is a highly conserved catalytic domain which is characteristic of the group as a whole and whose activity appears to be tightly regulated within the cell by other domains of the PTK. Degenerate oligonucleotide probes corresponding to two invariant amino acid sequence motifs within the catalytic domains of all PTK family members were synthesized and employed in the polymerase chain reaction (PCR) to amplify cDNA sequences between them. An M13 PCR library was produced in this way from cDNA prepared against mRNA from the murine hemopoietic cell line FDC-P1. The PCR library was then screened by DNA sequencing for PTK-related sequences. Two sequences were identified that, on the basis of sequence comparison with known PTKs, may encode representatives of a new class of PTK. Images PMID:2466296

  6. Detection of hepatitis C virus ribonucleic acid in the serum by amplification with polymerase chain reaction.

    PubMed Central

    Kato, N; Yokosuka, O; Omata, M; Hosoda, K; Ohto, M

    1990-01-01

    Hepatitis C virus (HCV) RNA was detected in the sera of patients with non-A, non-B chronic liver disease by polymerase chain reaction (PCR). RNA was extracted from the serum, reverse transcribed to cDNA, and amplified by PCR. With this method, 30 patients with non-A, non-B chronic liver disease and 10 healthy subjects were tested. HCV RNA was detected in 13 of 16 (81%) anti-HCV-positive patients and also in 7 of 14 (50%) anti-HCV-negative patients, but in none of 10 anti-HCV-negative healthy subjects. Specificity of this method was confirmed by direct sequencing of amplified cDNA segment. The nucleotide sequences (37 nucleotides) obtained from 15 patients showed only 68-78% homology compared with the prototype HCV nucleotide sequence. In addition, of 15 nucleotide sequences, there were 12 different types. But the translated amino acid sequences (12 amino acids) showed 83-100% homology compared with the prototype HCV amino acid sequence. These data suggest the majority of anti-HCV-positive patients are carriers of HCV. But to detect all the viremic patients, the anti-HCV antibody testing may be insufficient. Direct detection of HCV RNA may be useful in the study of virus replication and its association with various liver diseases. Images PMID:2173727

  7. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus.

    PubMed

    Tolardo, Aline Lavado; Souza, William Marciel de; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; Araujo, Jansen de; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; Fonseca, Benedito Antonio Lopes da; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-06-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  8. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    PubMed Central

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  9. A quantitative real-time polymerase chain reaction assay for the seagrass pathogen Labyrinthula zosterae.

    PubMed

    Bergmann, Nina; Fricke, Birgit; Schmidt, Martina C; Tams, Verena; Beining, Katrin; Schwitte, Hildegard; Boettcher, Anne A; Martin, Daniel L; Bockelmann, Anna-Christina; Reusch, Thorsten B H; Rauch, Gisep

    2011-11-01

    The protist Labyrinthula zosterae (Phylum Bigyra, sensu Tsui et al. 2009) has been identified as a causative agent of wasting disease in eelgrass (Zostera marina), of which the most intense outbreak led to the destruction of 90% of eelgrass beds in eastern North America and western Europe in the 1930s. Outbreaks still occur today, albeit at a smaller scale. Traditionally, L. zosterae has been quantified by measuring the necrotic area of Z. marina leaf tissue. This indirect method can however only lead to a very rough estimate of pathogen load. Here, we present a quantitative real-time polymerase chain reaction (qPCR) approach to directly detect and quantify L. zosterae in eelgrass tissue. Based on the internal transcribed spacer (ITS) sequences of rRNA genes, species-specific primers were designed. Using our qPCR, we were able to quantify accurately and specifically L. zosterae load both from culture and eelgrass leaves using material from Europe and North America. Our detection limit was less than one L. zosterae cell. Our results demonstrate the potential of this qPCR assay to provide rapid, accurate and sensitive molecular identification and quantification of L. zosterae. In view of declining seagrass populations worldwide, this method will provide a valuable tool for seagrass ecologists and conservation projects. PMID:21777400

  10. Detection of tetracycline resistance genes in bacteria isolated from fish farms using polymerase chain reaction

    PubMed Central

    Hedayatianfard, Keshvad; Akhlaghi, Mostafa; Sharifiyazdi, Hassan

    2014-01-01

    Five common tetracycline resistance genes tet(A), tet(B), tet(M), tet(O) and tet(S) were studied by polymerase chain reaction in 100 bacteria isolated from Iranian fish farms. In the antibiogram test most of the bacteria were either intermediately or completely resistant to tetracycline. Nine isolates out of 46 Aeromonas spp. contained either tet(A/M/S) resistant genes as follows: tet(A) in A. veronii/sobria (n = 1), A. media (n = 2), A. aquariorum (n = 1), and A. veronii (n = 3); tet(M) in one isolate of A. sobria and tet(S) in 1 isolate of A. jandaei. In other bacteria, tet(A) gene was detected in Citrobacter freundi (n = 1), Pseudomonas putida (n = 1); tet(S) was also identified in Yersinia ruckeri (n = 1), Arthrobacter arilaitensis (n = 1) and P. putida (n = 1). In total, 31 isolates (31.00%) contained the tetracycline resistance genes in which 21 bacteria (21.00%) showed the tet(S), nine bacteria (9.00%) contained the tet(A) and 1 bacteria (1.00%) was positive for tet(M). All of the L. garvieae isolates contained tet(S) in this study. The most widely distributed resistance gene was gene tet(A) and the least known resistance genes was tet(M) among the studied bacteria of the genus Aeromonas in this study. PMID:25610578

  11. Nested reverse transcriptase-polymerase chain reaction for the detection of group A rotaviruses.

    PubMed

    Elschner, M; Prudlo, J; Hotzel, H; Otto, P; Sachse, K

    2002-03-01

    Rotaviruses are important pathogens associated with diarrhoeal diseases in almost all species of mammals. In the present study, a nested reverse transcriptase-polymerase chain reaction (RT-PCR) for the detection of group A rotaviruses was developed, which is based on a target region in gene segment 6. Rotavirus strains of human, bovine, porcine, canine, feline, equine, and ovine origin were examined. Furthermore several faecal specimens, in which rotavirus had already been detected using other methods than PCR, were included in the study. A nested RT-PCR product was formed with all strains and faecal samples tested. The detection limit for virus-containing cell culture supernatant was 3 x 10(-2) [50% tissue culture infective dose (TCID50)] by RT-PCR and 3 x 10(-3) TCID50) by nested amplification. In order to examine the influence of the sample matrix on sensitivity, a rotavirus-negative faecal specimen was spiked with virus-containing cell culture suspension of the porcine rotavirus OSU. The detection limit of the present PCR procedure was approximately 1.6 x 10(2) TCID50 per g faeces and could be increased by one order of magnitude using nested PCR. The present method for detection and identification of group A rotaviruses represents a powerful diagnostic tool and was shown to be applicable to rotaviruses of different origin, including human sources. PMID:12002423

  12. Detection of bovine group B rotaviruses in feces by polymerase chain reaction.

    PubMed

    Chinsangaram, J; Akita, G Y; Osburn, B I

    1994-07-01

    A pair of primers designed from the sequence of genome segment 9 of group B rat rotavirus (IDIR) were employed to amplify genome segment 9 of a group B bovine rotavirus in a polymerase chain reaction (PCR) and to sequence the derived PCR products. A new pair of primers were synthesized from the obtained sequence data and used in a PCR detection assay for group B bovine rotavirus in fecal samples. In addition, another pair of primers were designed to produce a PCR-derived internal probe. This probe was used in a chemiluminescent hybridization to confirm the specificity and to increase the sensitivity of the assay. This assay could detect 0.1 fg of target double-stranded RNA. It was specific to group B bovine rotavirus and did not detect group B rat (IDIR) and porcine rotaviruses, group A bovine (NCDV), simian (SA-11), equine (H-2), porcine (OSU), human (DS-1), deer, and avian rotaviruses, coronavirus, or other enteric organisms tested in this study. PMID:7948199

  13. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    PubMed

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  14. Histopathologic, immunohistochemical, and polymerase chain reaction assays in the study of cases with fatal sporadic myocarditis.

    PubMed

    Guarner, Jeannette; Bhatnagar, Julu; Shieh, Wun-Ju; Nolte, Kurt B; Klein, Dennis; Gookin, Michelle S; Peñaranda, Silvia; Oberste, M Steven; Jones, Tara; Smith, Chalanda; Pallansch, Mark A; Zaki, Sherif R

    2007-09-01

    Paraffin tissue blocks from 27 cases with sporadic myocarditis were collected during a 12-year period at a single medical examiner's office. Blocks were studied by using histopathology; immunohistochemistry for viruses (adenovirus, enterovirus, influenza A and B, and human herpes types 4 and 5), bacteria (Neisseria meningitidis, Ehrlichia sp, spotted fever group Rickettsia) and parasites (Toxoplasma gondii and Trypanosoma cruzi); and polymerase chain reaction (PCR)/RT-PCR for adenovirus and enterovirus. We identified enterovirus in 5 (18.5%) cases and Sarcocystis in a 36-year-old woman who had focal inflammation and myocyte necrosis. Immunohistochemical evidence of enteroviruses was found in the myocytes of 2 patients less than 6 months old who had diffuse mononuclear myocardial inflammation, interstitial pneumonitis; one also had encephalitis. In these 2 patients, the presence of enterovirus was confirmed by RT-PCR targeting the 5' nontranslated region and was serotyped as coxsackievirus B2 by sequencing the VP1 capsid region. In another 3 cases (ages 12, 47, and 54), enterovirus was detected by the 5' nontranslated region region; VP1 sequencing identified these as echoviruses 6, 13, and 7, respectively. Accurately identifying an infectious agent is the foundation for clinical and public health interventions. Despite using multiple diagnostic methods, an organism could only be detected in a small proportion of sporadic myocarditis cases. PMID:17602724

  15. Polymerase chain reaction as a tool for developing stress protein probes

    SciTech Connect

    Cochrane, B.J.; Mattley, Y.D. . Dept. of Biology); Snell, T.W. . Div. of Biology)

    1994-08-01

    Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

  16. Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

    PubMed Central

    Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro

    2015-01-01

    The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238

  17. Detection of coliform bacteria in water by polymerase chain reaction and gene probes.

    PubMed Central

    Bej, A K; Steffan, R J; DiCesare, J; Haff, L; Atlas, R M

    1990-01-01

    Polymerase chain reaction (PCR) amplification and gene probe detection of regions of two genes, lacZ and lamB, were tested for their abilities to detect coliform bacteria. Amplification of a segment of the coding region of Escherichia coli lacZ by using a PCR primer annealing temperature of 50 degrees C detected E. coli and other coliform bacteria (including Shigella spp.) but not Salmonella spp. and noncoliform bacteria. Amplification of a region of E. coli lamB by using a primer annealing temperature of 50 degrees C selectively detected E. coli and Salmonella and Shigella spp. PCR amplification and radiolabeled gene probes detected as little as 1 to 10 fg of genomic E. coli DNA and as a few as 1 to 5 viable E. coli cells in 100 ml of water. PCR amplification of lacZ and lamB provides a basis for a method to detect indicators of fecal contamination of water, and amplification of lamB in particular permits detection of E. coli and enteric pathogens (Salmonella and Shigella spp.) with the necessary specificity and sensitivity for monitoring the bacteriological quality of water so as to ensure the safety of water supplies. Images PMID:2306085

  18. Detection of Pneumocystis carinii DNA in sputum and bronchoalveolar lavage samples by polymerase chain reaction.

    PubMed Central

    Olsson, M; Elvin, K; Löfdahl, S; Linder, E

    1993-01-01

    A polymerase chain reaction (PCR)-based assay was developed for the detection of Pneumocystis carinii DNA in induced sputum and bronchoscopic alveolar lavage samples. The primer pair was selected from the published sequence of the thymidylate synthase gene of P. carinii derived from infected rats. The amplified DNA fragment of 403 bp was detected by agarose gel electrophoresis and by Southern and slot blot hybridization. No positive reaction was seen with DNA from different microorganisms typically found in the respiratory tract. P. carinii DNA was demonstrated in 30 of 42 sputum samples from immunosuppressed patients, whereas 21 of 42 sputum samples were positive by indirect immunofluorescence (IFL). Among the 42 patients, 14 were receiving prophylactic chemotherapy. In that group, PCR detected P. carinii in nine sputum samples, whereas IFL detected P. carinii in only four sputum samples. A positive PCR result was also seen in 5 of 43 IFL-negative bronchoscopic alveolar lavage samples from patients with respiratory symptoms. The PCR assay detected 10 copies of the target DNA, which corresponds to 10(-18) g of the specific P. carinii sequence. The results indicate that PCR amplification in combination with DNA hybridization is specific and is a more sensitive diagnostic method than IFL for the detection of P. carinii. Images PMID:8432806

  19. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    NASA Astrophysics Data System (ADS)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  20. Tuberculosis-associated hemophagocytic lymphohistiocytosis in adolescent diagnosed by polymerase chain reaction

    PubMed Central

    Seo, Ju-Hee; Lee, Jun Ah; Kim, Dong Ho; Cho, Joongbum

    2016-01-01

    We present a case of tuberculosis-associated hemophagocytic lymphohistiocytosis in a 14-year-old girl. The patient presented with weight loss, malaise, fatigue, prolonged fever, and generalized lymphadenopathy. Laboratory investigation revealed pancytopenia (white blood cells, 2,020 cells/µL; hemoglobin, 10.2 g/dL; platelets, 52,000 cells/µL), hypertriglyceridemia (229 mg/dL), and hyperferritinemia (1,420 ng/mL). Bone marrow biopsy showed a hypocellular bone marrow with a large numbers of histiocytes and marked hemophagocytosis; based on these findings, she was diagnosed with hemophagocytic lymphohistiocytosis. Polymerase chain reaction (PCR) with both the bone marrow aspiration and sputum samples revealed the presence of Mycobacterium tuberculosis. Antitubercular therapy with immune modulation therapy including dexamethasone and intravenous immunoglobulin was initiated. The results of all laboratory tests including bone marrow biopsy and PCR with both the bone marrow aspiration and sputum samples were normalized after treatment. Thus, early bone marrow biopsy and the use of techniques such as PCR can avoid delays in diagnosis and improve the survival rates of patients with tuberculosis-associated hemophagocytic lymphohistiocytosis. PMID:26893604

  1. Range of phytoplasma concentrations in various plant hosts as determined by competitive polymerase chain reaction.

    PubMed

    Berges, R; Rott, M; Seemüller, E

    2000-10-01

    ABSTRACT For competitive polymerase chain reaction (PCR), an internal standard DNA template was developed that consisted of a highly conserved, internally deleted 16S rDNA fragment of an aster yellows phytoplasma. The internal standard was calibrated using a quantified culture of Acholeplasma laidlawii. Serial dilutions of the internal standard and fixed amounts of target templates from infected plants were coamplified with the same primers, and the products obtained were quantified using an enzyme-linked immunosorbent assay procedure. Analysis of the data revealed that the phytoplasma concentration in the plants examined differed by a factor of about 4 x 10(6). Phytoplasma concentrations of 2.2 x 10(8) to 1.5 x 10(9) cells per g of tissue were identified in periwinkles infected with various phytoplasmas. High to moderate concentrations were detected in Malus domestica (apple) genotypes infected with the apple proliferation phytoplasma, Alnus glutinosa (alder) genotypes infected with the alder yellows phytoplasma, and most aster yellows-infected Populus (poplar) genotypes examined. Very low phytoplasma concentrations, ranging from 370 to 34,000 cells per g of tissue, were identified in proliferation-diseased apple trees on resistant rootstocks 4551 and 4608, yellows-diseased Quercus robur (oak) trees, and Carpinus betulus (hornbeam) trees. Such low concentrations, which corresponded to about 4 to 340 cells in the reaction mixture, could only be detected and quantified by nested PCR. PMID:18944479

  2. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    PubMed Central

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770

  3. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens.

    PubMed

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C

    1993-01-01

    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323

  4. Rapid and biologically safe diagnosis of African swine fever virus infection by using polymerase chain reaction.

    PubMed Central

    Steiger, Y; Ackermann, M; Mettraux, C; Kihm, U

    1992-01-01

    In order to circumvent the need for infectious virus for the diagnosis of African swine fever (ASF), we established the polymerase chain reaction (PCR) technique for the detection of ASF virus (ASFV) DNA. A 740-bp fragment that originated from the conserved region of the viral genome was partially sequenced. From this sequence, four PCR primers and one oligonucleotide probe were designed and synthesized. A specific 640-bp PCR product was amplified by using oligonucleotides 1 and 5 as primers and extracts of the following samples as templates: organs and plasma obtained from ASFV-infected pigs, ASFV-infected cell cultures, and cloned DNA fragments containing the same conserved genomic region as that in the original 740-bp clone. No specific reaction products were observed in the corresponding controls. The identities of the PCR products were confirmed either by a second amplification with nested primers or by hybridization with a specific, biotinylated oligonucleotide probe. PCR proved to be a quicker and more sensitive method than virus isolation followed by the hemadsorption test when spleen and plasma samples from experimentally ASFV-infected pigs were tested. Furthermore, cloned virus DNA could be used as a positive control in the place of a live virus control. This is advantageous whenever the use of live virus is undesirable. Images PMID:1734041

  5. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice

    PubMed Central

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×101 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples. PMID:24349270

  6. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  7. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

  8. A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control

    PubMed Central

    Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen

    2009-01-01

    This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760

  9. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    PubMed

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  10. Effect of reference database on frequency estimates of polymerase chain reaction (PCR)-based DNA profiles.

    PubMed

    Monson, K L; Budowle, B

    1998-05-01

    A variety of general, regional, ancestral and ethnic databases is available for the polymerase chain reaction (PCR)-based loci LDLR, GYPA, HBGG, D7S8, Gc, DQA1, and D1S80. Generally, we observed greater differences in frequency estimations of DNA profiles between racial groups than between ethnic or geographic subgroups. Analysis revealed few forensically significant differences within ethnic subgroups, particularly within general United States groups, and multi-locus frequency estimates typically differ by less than a factor of ten. Using a database different from the one to which a target profile belongs tends to overestimate rarity. Implementation of the general correction of homozygote frequencies for a population substructure, advised by the 1996 National Research Council report, The Evaluation of Forensic DNA Evidence, has a minimal effect on profile frequencies. Even when it is known that both the suspect and all possible perpetrators must belong to the same isolated population, the special correction for inbreeding, which was proposed by the 1996 National Research Council report for this special case, has a relatively modest effect, typically a factor of two or less for 1% inbreeding. The effect becomes more substantial (exceeding a factor of ten) for inbreeding of 3% or more in multi-locus profiles rarer than about one in a million. PMID:9608687

  11. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    NASA Astrophysics Data System (ADS)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  12. Homogeneous duplex polymerase chain reaction assay using switchable lanthanide fluorescence probes.

    PubMed

    Lehmusvuori, Ari; Tapio, Antti-Heikki; Mäki-Teeri, Petra; Rantakokko-Jalava, Kaisu; Wang, Qi; Takalo, Harri; Soukka, Tero

    2013-05-01

    We have developed a duplex polymerase chain reaction (PCR) assay based on switchable lanthanide chelate complementation probes. In the complementation probe technology, two nonfluorescent oligonucleotide probes, one labeled with a lanthanide ion carrier chelate and another with a light absorbing antenna ligand, form a fluorescent complex by self-assembly of the reporter molecules when the two probes are hybridized in adjacent positions to the target DNA. Here we report the synthesis of a new terbium(III) (Tb(III)) ion carrier chelate and a new light-absorbing antenna ligand for Tb(III) and the development of a duplex Chlamydia trachomatis (Ct) PCR assay. For the detection of Ct in urine samples, a specific sequence in Ct cryptic plasmid was amplified and detected using europium(III) (Eu(III)) complementation probes. An internal amplification control was amplified in each reaction and detected using Tb(III) complementation probes to verify the Ct negative results. Ct bacteria were concentrated from urine samples with a rapid and simple centrifugation-based sample preparation method. Good diagnostic accuracy (99-100%) was achieved, and also Ct positive reactions yielded a very high Eu(III) signal-to-background ratio (maximum of 244). High performance of the complementation probes is advantageous when sample may contain impurities after a simple sample preparation. PMID:23353013

  13. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.

    PubMed

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E

    1996-12-01

    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  14. Applications of constant denaturant capillary electrophoresis/high-fidelity polymerase chain reaction to human genetic analysis.

    PubMed

    Li-Sucholeiki, X C; Khrapko, K; André, P C; Marcelino, L A; Karger, B L; Thilly, W G

    1999-06-01

    Constant denaturant capillary electrophoresis (CDCE) permits high-resolution separation of single-base variations occurring in an approximately 100 bp isomelting DNA sequence based on their differential melting temperatures. By coupling CDCE for highly efficient enrichment of mutants with high-fidelity polymerase chain reaction (hifi PCR), we have developed an analytical approach to detecting point mutations at frequencies equal to or greater than 10(-6) in human genomic DNA. In this article, we present several applications of this approach in human genetic studies. We have measured the point mutational spectra of a 100 bp mitochondrial DNA sequence in human tissues and cultured cells. The observations have led to the conclusion that the primary causes of mutation in human mitochondrial DNA are spontaneous in origin. In the course of studying the mitochondrial somatic mutations, we have also identified several nuclear pseudogenes homologous to the analyzed mitochondrial DNA fragment. Recently, through developments of the means to isolate the desired target sequences from bulk genomic DNA and to increase the loading capacity of CDCE, we have extended the CDCE/hifi PCR approach to study a chemically induced mutational spectrum in a single-copy nuclear sequence. Future applications of the CDCE/hifi PCR approach to human genetic analysis include studies of somatic mitochondrial mutations with respect to aging, measurement of mutational spectra of nuclear genes in healthy human tissues and population screening for disease-associated single nucleotide polymorphisms (SNPs) in large pooled samples. PMID:10380762

  15. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum.

    PubMed

    Tan, Ching Giap; Ideris, Aini; Omar, Abdul R; Yii, Chen Pei; Kleven, Stanley H

    2014-01-01

    The present study was based on the reverse transcription polymerase chain reaction (RT-PCR) of the 16S ribosomal nucleic acid (rRNA) of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20-25 h at 37 °C, 22-25 h at 16 °C, and 23-27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h). The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum. PMID:25686255

  16. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification

    SciTech Connect

    Zietkiewicz, E.; Labuda, D. ); Rafalski, A. )

    1994-03-15

    Simple sequence repeats (SSR), or microsatellites, are ubiquitous in eukaryotic genomes. Here the authors demonstrate the utility of microsatellite-directed DNA fingerprinting by polymerase chain reaction (PCR) amplification of the interrepeat region. No sequencing is required to design the oligonucleotide primers. They tested primers anchored at 3[prime] or 5[prime] termini of the (A)[sub n] repeats, extended into the flanking sequence by 2 to 4 nucleotide residues [3[prime]-anchored primers: (CA)[sub 8]RG, (CA)[sub 8]RY, and (CA)[sub 7]RTCY; and 5[prime]-anchored primers: BDB(CA)[sub 7]C, DBDA(CA)[sub 7], VHVG(TG)[sub 7] and HVH(TG)[sub 7]T]. Radioactively labeled amplification products were analyzed by electrophoresis, revealing information on multiple genomic loci in a single gel lane. Complex, species-specific patterns were obtained from a variety of eukaryotic taxa. Intraspecies polymorphisms were also observed and shown to segregate as Mendelian markers. Inter-SSR PCR provides a novel fingerprinting approach applicable for taxonomic and phylogenetic comparisons and as a mapping tool in a wide range of organisms. This application of (CA)[sub n] repeats may be extended to different microsatellites and other common dispersed elements. 24 refs., 6 figs.

  17. Specific detection of banana residue in processed foods using polymerase chain reaction.

    PubMed

    Sakai, Yumiko; Ishihata, Kimie; Nakano, Shigeru; Yamada, Toshihiro; Yano, Takeo; Uchida, Kouji; Nakao, Yoshiki; Urisu, Atsuo; Adachi, Reiko; Teshima, Reiko; Akiyama, Hiroshi

    2010-07-28

    Specific polymerase chain reaction (PCR) methods were developed for the detection of banana residue in processed foods. For high banana specificity, the primer set BAN-F/BAN-R was designed on the basis of the large subunit of ribulose-1,5-bisphosphate carboxylase (rbcL) genes of chloroplasts and used to obtain amplified products specific to banana by both conventional and real-time PCR. To confirm the specificity of these methods, genomic DNA samples from 31 other species were examined; no amplification products were detected. Subsequently, eight kinds of processed foods containing banana were investigated using these methods to confirm the presence of banana DNA. Conventional PCR had a detection limit of 1 ppm (w/w) banana DNA spiked in 50 ng of salmon testis DNA, whereas SYBR Green I real-time semiquantitative PCR had a detection limit as low as 10 ppm banana DNA. Thus, both methods show high sensitivity and may be applicable as specific tools for the detection of trace amounts of banana in commercial food products. PMID:20604506

  18. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples.

    PubMed

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A

    1999-02-01

    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  19. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    PubMed

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  20. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    PubMed

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  1. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    NASA Astrophysics Data System (ADS)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  2. Real-time polymerase chain reaction for the diagnosis of necrotizing herpes stromal keratitis

    PubMed Central

    Ma, Jun-Xin; Wang, Lin-Nong; Zhou, Ru-Xia; Yu, Yang; Du, Tong-Xin

    2016-01-01

    AIM To design, optimize and validate a rapid, internally controlled real-time polymerase chain reaction (RT-PCR) test for herpes simplex virus (HSV) in the diagnosis of necrotizing herpes stromal keratitis. METHODS Tears alone or together with corneal epithelium scrapings from 30 patients (30 eyes) suspected of necrotizing herpes stromal keratitis were tested for HSV DNA by RT-PCR. The samples were collected during the first visit and then on the subsequent 7, 14, 28, 42, and 56d. The symptoms of the patients were scored before treatment to determine the correlation between HSV concentration in the corneal epithelium scrapings and clinical scores. RESULTS The positive rate (46.4%) in the corneal epithelium group before the therapy was significantly higher than that (13.3%) in the tears group (P=0.006). There were 13 positive HSV patients before the therapy, the concentration of HSV DNA in corneal epithelium scrapings group was significantly higher than that in the tears group (paired t-test, P=0.0397). Multilevel mixed-effects model analysis showed that the difference between the corneal epithelium scrapings group and the tears group was statistically significant (P=0.0049). The Spearman rank correlation analysis indicated a positive correlation between the HSV concentration in the corneal epithelium scrapings and clinical scores before the treatment (r=0.844, P<0.0001). CONCLUSION RT-PCR appears to be a powerful molecular tool for the diagnosis of necrotizing herpes stromal keratitis. PMID:27275421

  3. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    PubMed Central

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction patterns generated with AluI, PacI, and PsiI restriction endonucleases. Results: Variations in the number and size of digested fragments were recorded from treated individuals compared with controls showing that the restriction enzymes created a cut at different locations. In addition, sequences of COII gene from control and treated individuals were also used to confirm the RFLP patterns. From the sequence alignment data, it was found that mutations caused the destruction and generation of restriction sites in the gene sequence of treated individuals. Conclusion: This study indicates that all the three pesticides had potential to induce mutations in the normal sequence of COII gene and also advocates the use of PCR-RFLP assay as an efficient, rapid, and sensitive technique to detect mutagenicity of pesticides. PMID:24403735

  4. GSH2 promoter methylation in pancreatic cancer analyzed by quantitative methylation-specific polymerase chain reaction

    PubMed Central

    GAO, FEI; HUANG, HAO-JIE; GAO, JUN; LI, ZHAO-SHEN; MA, SHU-REN

    2015-01-01

    Tumor suppressor gene silencing via promoter hypermethylation is an important event in pancreatic cancer pathogenesis. Aberrant DNA hypermethylation events are highly tumor specific, and may provide a diagnostic tool for pancreatic cancer patients. The objective of the current study was to identify novel methylation-related genes that may potentially be used to establish novel therapeutic and diagnostic strategies against pancreatic cancer. The methylation status of the GS homeobox 2 (GSH2) gene was analyzed using the sodium bisulfite sequencing method. The GSH2 methylation ratio was examined in primary carcinomas and corresponding normal tissues derived from 47 patients with pancreatic cancer, using quantitative methylation-specific polymerase chain reaction. Methylation ratios were found to be associated with the patient's clinicopathological features. GSH2 gene methylation was detected in 26 (55.3%) of the 47 pancreatic cancer patients, indicating that it occurs frequently in pancreatic cancer. A significant association with methylation was observed for tumor-node-metastasis stage (P=0.031). GSH2 may be a novel methylation-sensitive tumor suppressor gene in pancreatic cancer and may be a tumor-specific biomarker of the disease. PMID:26171036

  5. Detection of strawberry vein banding virus by polymerase chain reaction and dot blot hybridization.

    PubMed

    Mráz, I; Petrzik, K; Fránová-Honetslegrová, J; Síp, M

    1997-08-01

    Strawberry vein banding virus (SVBV) is one of seventeen members of the family Caulimoviridae. Natural infection with the virus is known in Fragaria species only. Infections caused by SVBV are often symptomless (1), but their significance increases in mixed infections with strawberry crinkle or strawberry latent C viruses (2,3). This virus has been originally found on strawberries in USA and firstly described by Frazier (4), but it is probably world-wide distributed by planting or breeding materials. SVBV has been observed on cultivated strawberries in North America, Australia, Brazil, Japan (5) and recently in Europe (6,7). The concentration of SVBV in infected plants is usually very low. Its detection by ELISA is impossible because of lack of specific antibodies. Evidence of the caulimovirus nature of SVBV has been confirmed by its circular dsDNA genome, shape and size of viral particles (8), presence of cytoplasmic inclusion bodies typical for caulimoviruses, and distant serological relationship with cauliflower mosaic virus (CaMV, 9). In this paper we present detection of SVBV by combination of two detection methods--polymerase chain reaction (PCR) and dot blot hybridization with a non-radioactive probe. PMID:9391655

  6. Classification of mutations at the HLA-A locus by use of the polymerase chain reaction

    SciTech Connect

    Joseph, G.; Grist, S.; Firgaira, F.; Turner, D.; Morley, A. )

    1993-01-01

    The authors investigated whether the polymerase chain reaction (PCR) could be used to determine the mechanism of mutation in lymphocyte clones mutated at the HLA-A locus. Three polymorphisms, at Factor XIIIA, D6S109, and intron 3 of the HLA-A gene, were used to study a series of clones previously characterized by Southern blotting (SB) at multiple loci on chromosome 6. For detection of loss of heterozygosity, the results of PCR and SB were concordant in 140 of 141 clones when polymorphism in the Factor XIIIA region was studied and in 144 of 145 clones when polymorphism in the HLA-A gene was studied. For classification of the mechanism of mutation, PCR and SB gave the same result in 88 of 92 clones (96%) when a combination of the HLA-A and Factor XIIIA polymorphisms was used and in 46 of 47 clones (98%) when a combination of the HLA-A and D6S109 polymorphisms was used. The results indicate that PCR provides a simple and reliable method for categorizing mutations at the HLA-A locus as arising from mitotic recombination, deletion, or from presumptive minor changes within the gene. Rare events such as gene conversion, nondisjunction, or large deletions extending to the telomere will be misclassified. However, such events are rare for mutations at this locus. 9 refs., 2 figs., 5 tabs.

  7. Polymerase chain reaction–based assays for the diagnosis of human brucellosis

    PubMed Central

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed. PMID:25082566

  8. Polymerase Chain Reaction: A Better Method for Diagnosing Chronic Schistosoma mansoni Infections

    PubMed Central

    Abdel-Hafeez, Ekhlas Hamed; Mohamed, Rabie M.; Belal, Usama S.; Abdel-Raheem, Ehab M.; Naoi, Koji; Norose, Kazumi

    2015-01-01

    For more effective diagnosis of the acute and chronic stages of Schistosoma mansoni infection in humans, the polymerase chain reaction (PCR) technique was compared with the Kato-Katz method. A total of 150 stool samples were collected from inpatient and outpatient clinics at the Department of Tropical Medicine, Minia University Hospital, Egypt. Three groups of patients, 50 with acute intestinal schistosomiasis, 70 with chronic intestinal schistosomiasis and 30 normal healthy controls were studied. Stool samples were analyzed by PCR and the Kato-Katz method. The mean number of eggs per gram of feces was 4.6 when estimated by the Kato-Katz method in positive stool samples from acute schistosomiasis cases but only 1.7 in chronic cases. In acute intestinal schistosomiasis, 15 and 45 out of 50 cases were positive by Kato-Katz and PCR, respectively. In the chronic intestinal schistosomiasis cases, 6 and 68 out of 70 cases were positive by the Kato-Katz and PCR methods, respectively. We conclude that PCR appears to be an effective diagnostic technique for S. mansoni infection, especially where a low worm burden exists, such as in chronic cases. PMID:26865821

  9. High sensitivity detection of active botulinum neurotoxin by glyco-quantitative polymerase chain-reaction.

    PubMed

    Kwon, Seok Joon; Jeong, Eun Ji; Yoo, Yung Choon; Cai, Chao; Yang, Gi-Hyeok; Lee, Jae Chul; Dordick, Jonathan S; Linhardt, Robert J; Lee, Kyung Bok

    2014-03-01

    The sensitive detection of highly toxic botulinum neurotoxin (BoNT) from Clostridium botulinum is of critical importance because it causes human illnesses if foodborne or introduced in wounds and as an iatrogenic substance. Moreover, it has been recently considered a possible biological warfare agent. Over the past decade, significant progress has been made in BoNT detection technologies, including mouse lethality assays, enzyme-linked immunosorbent assays, and endopeptidase assays and by mass spectrometry. Critical assay requirements, including rapid assay, active toxin detection, sensitive and accurate detection, still remain challenging. Here, we present a novel method to detect active BoNTs using a Glyco-quantitative polymerase chain-reaction (qPCR) approach. Sialyllactose, which interacts with the binding-domain of BoNTs, is incorporated into a sialyllactose-DNA conjugate as a binding-probe for active BoNT and recovered through BoNT-immunoprecipitation. Glyco-qPCR analysis of the bound sialyllactose-DNA is then used to detect low attomolar concentrations of BoNT and attomolar to femtomolar concentrations of BoNT in honey, the most common foodborne source of infant botulism. PMID:24506443

  10. Novel multi-targeted polymerase chain reaction for diagnosis of presumed tubercular uveitis

    PubMed Central

    2013-01-01

    Background The objective of this study was to report the use of multi-targeted polymerase chain reaction (PCR) in the diagnosis of presumed tubercular uveitis. Multi-targeted PCR using three targets specific for Mycobacterium tuberculosis, i.e., IS6110, MPB64, and protein b, was performed on intraocular fluid samples of 25 subjects. Nine had presumed tubercular uveitis, six had intraocular inflammation secondary to a nontubercular etiology (disease controls), and ten had no evidence of intraocular inflammation (normal controls). As described previously, response to antitubercular therapy was considered as the gold standard. Results Multi-targeted PCR was positive in seven out of nine patients with presumed tubercular uveitis and negative in all normal and disease controls. The sensitivity and specificity were 77.77% and 100%, respectively. For the diagnosis of presumed tubercular uveitis, multi-targeted PCR had a positive predictive value of 100% and a negative predictive value of 88.88%. Conclusion Multi-targeted PCR can be a valuable tool for diagnosing presumed tubercular uveitis. PMID:23514226

  11. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis.

    PubMed

    Ote, Isabelle; Taminiau, Bernard; Duprez, Jean-Noël; Dizier, Isabelle; Mainil, Jacques G

    2011-12-15

    Staphylococcus aureus is recognized worldwide as a pathogen causing many serious diseases in humans and animals, and is the most common aetiological agent of clinical and subclinical bovine mastitis. The importance of evaluating the combination of S. aureus virulence factors has been emphasized both in human and veterinary medicine, and knowledge about the genetic variability within different S. aureus populations would help in the design of efficient treatments. The aim of the present study was to determine the genetic profiles of S. aureus strains isolated from milk of cows suffering from clinical and subclinical mastitis in Belgium. The presence of about forty virulence-associated genes was investigated by specific polymerase chain reaction (PCR) amplification. A high number of genotypic subtypes were observed, demonstrating further the large variation in the presence of virulence genes in S. aureus isolates and the considerable diversity of strains populations that are able to cause mastitis in cows. In accordance with other studies, we showed that some genes are associated with mastitis-causing S. aureus isolates, whereas others are absent or rarely present. We also further highlighted the presence of conserved gene combinations, namely the enterotoxigenic egc-cluster and the bovine pathogenicity island SaPIbov. Importantly, the presence of isolates carrying genes coding for toxins involved in important human infections makes the milk of cows with mastitis a potential reservoir for these toxins, and therefore a potential danger in human health, which strengthens the importance to consider raw milk consumption and its processing very carefully. PMID:21708435

  12. Combination of immunosensor detection with viability testing and confirmation using the polymerase chain reaction and culture.

    PubMed

    Johnson-White, Brandy; Lin, Baochuan; Ligler, Frances S

    2007-01-01

    Rapid and accurate differential determination of viable versus nonviable microbes is critical for formulation of an appropriate response after pathogen detection. Sensors for rapid bacterial identification can be used for applications ranging from environmental monitoring and homeland defense to food process monitoring, but few provide viability information. This study combines the rapid screening capability of the array biosensor using an immunoassay format with methods for determination of viability. Additionally, cells captured by the immobilized antibodies can be cultured following fluorescence imaging to further confirm viability and for cell population expansion for further characterization, e.g., strain identification or antibiotic susceptibility testing. Finally, we demonstrate analysis of captured bacteria using the polymerase chain reaction (PCR). PCR results for waveguide-captured cells were 3 orders of magnitude more sensitive than the fluorescence immunoassay and can also provide additional genetic information on the captured microbes. These approaches can be used to rapidly detect and distinguish viable versus nonviable and pathogenic versus nonpathogenic captured organisms, provide culture materials for further analysis on a shorter time scale, and assess the efficacy of decontamination or sterilization procedures. PMID:17194131

  13. Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction.

    PubMed Central

    Green, E D; Olson, M V

    1990-01-01

    We have developed an approach for screening ordered arrays of yeast artificial-chromosome (YAC) clones containing human DNA that is based on the polymerase chain reaction (PCR). This approach is designed to determine the locations of positive clones within a YAC library that is stored as individual clones in 96-well microtiter plates. The high sensitivity and specificity of the PCR allow the detection of target sequences in DNA prepared from pools of 1920 or more YAC clones. The PCR-based screening protocol is performed in two successive stages, which effectively limit the location of a positive clone to four microtiter plates (384 clones). Final localization of each positive clone is accomplished by conventional DNA.DNA hybridization using a single filter containing the YAC clones from the appropriate four microtiter plates. This PCR-based screening strategy has proven highly efficient, allowing the identification and isolation of numerous YAC clones containing specific human genes. The prospects of developing a strategy for screening YAC libraries based completely on PCR assays are discussed, as are the potential applications of this approach to the systematic analysis of the human genome. Images PMID:2405397

  14. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  15. Effect of single mismatches at 3′–end of primers on polymerase chain reaction

    PubMed Central

    Simsek, M; Adnan, H

    2000-01-01

    Objective and Method To investigate the effect of three different mismatches (G/T, G/A or G/G) at the 3′–end of a primer to amplify a 268 bp (base pair) region of the human β–globin gene using different annealing temperatures (45 to 65°C). Results The primer with the G/T mismatch was as efficient as the normal primer (G/C match) in the amplification of a 268 bp product at all temperatures tested. However, the primers having G/A or G/G mismatches at the 3′-end did not produce any specific polymerase chain reaction (PCR) fragment at all the annealing temperatures used, except a barely detectable 268 bp product for the G/G mismatch at 45 and 50°C. Conclusion We conclude that our PCR system was refractory to amplification when one of the primers contained a G/A or G/G mismatch at the 3′–end with template DNA. PMID:24019700

  16. Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction.

    PubMed Central

    Szabo, E A; Pemberton, J M; Desmarchelier, P M

    1993-01-01

    The polymerase chain reaction (PCR) was used as the basis for the development of highly sensitive and specific diagnostic tests for organisms harboring botulinum neurotoxin type A through E genes. Synthetic DNA primers were selected from nucleic acid sequence data for Clostridium botulinum neurotoxins. Individual components of the PCR for each serotype (serotypes A through E) were adjusted for optimal amplification of the target fragment. Each PCR assay was tested with organisms expressing each of the botulinum neurotoxin types (types A through G), Clostridium tetani, genetically related nontoxigenic organisms, and unrelated strains. Each assay was specific for the intended target. The PCR reliably identified multiple strains having the same neurotoxin type. The sensitivity of the test was determined with different concentrations of genomic DNA from strains producing each toxin type. As little as 10 fg of DNA (approximately three clostridial cells) was detected. C. botulinum neurotoxin types A, B, and E, which are most commonly associated with human botulism, could be amplified from crude DNA extracts, from vegetative cells, and from spore preparations. This suggests that there is great potential for the PCR in the identification and detection of botulinum neurotoxin-producing strains. Images PMID:8215372

  17. Specific detection of Campylobacter jejuni and Campylobacter coli by using polymerase chain reaction.

    PubMed Central

    Oyofo, B A; Thornton, S A; Burr, D H; Trust, T J; Pavlovskis, O R; Guerry, P

    1992-01-01

    Development of a routine detection assay for Campylobacter jejuni and Campylobacter coli in clinical specimens was undertaken by using the polymerase chain reaction (PCR). An oligonucleotide primer pair from a conserved 5' region of the flaA gene of C. coli VC167 was used to amplify a 450-bp region by PCR. The primer pair specifically detected 4 strains of C. coli and 47 strains of C. jejuni; but it did not detect strains of Campylobacter fetus, Campylobacter lari, Campylobacter upsaliensis, Campylobacter cryaerophila, Campylobacter butzleri, Campylobacter hyointestinalis, Wolinella recta, Helicobacter pylori, Escherichia coli, Shigella spp., Salmonella spp., Vibrio cholerae, Citrobacter freundii, or Aeromonas spp. By using a nonradioactively labeled probe internal to the PCR product, the assay could detect as little as 0.0062 pg of purified C. coli DNA, or the equivalent of four bacteria. In stools seeded with C. coli cells, the probe could detect between 30 and 60 bacteria per PCR assay. The assay was also successfully used to detect C. coli in rectal swab specimens from experimentally infected rabbits and C. jejuni in human stool samples. Images PMID:1400961

  18. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates.

    PubMed

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N

    2004-01-01

    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  19. Use of polymerase chain reaction in human African trypanosomiasis stage determination and follow-up.

    PubMed Central

    Truc, P.; Jamonneau, V.; Cuny, G.; Frézil, J. L.

    1999-01-01

    Stage determination of human African trypanosomiasis is based on the detection of parasites and measurements of biological changes in the cerebrospinal fluid (CSF) (concentration of white blood cells > 5 cells per mm3 and increased total protein levels). The patient is treated accordingly. Demonstration of the absence or presence of trypanosomes by the double centrifugation technique is still the only test available to clinicians for assessing treatment success. In this study, however, we evaluate the polymerase chain reaction (PCR) as a tool for assessing the disease stage of trypanosomiasis and for determining whether treatment has been successful. All 15 study patients considered to be in the advanced stage of the disease were PCR positive; however, trypanosomes were demonstrated by double centrifugation in only 11 patients. Of the five remaining patients, who were considered to be in the early stage, PCR and double centrifugation were negative. Following treatment, 13 of the 15 second-stage patients were found to be negative for the disease in at least two samples by PCR and double centrifugation. Two others were still positive by PCR immediately and one month after the treatment. Trypanosome DNA detection using PCR suggested that the two positive patients were not cured but that their possible relapse could not be identified by a search for parasites using the double centrifugation technique. Further evaluation of the PCR method is required, in particular to determine whether PCR assays could be used in studies on patients who fail to respond to melarsoprol, as observed in several foci. PMID:10534898

  20. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  1. Polymerase chain reaction-restriction fragment length polymorphism authentication of raw meats from game birds.

    PubMed

    Rojas, María; González, Isabel; Fajardo, Violeta; Martín, Irene; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2008-01-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis has been applied to the identification of meats from quail (Coturnix coturnix), pheasant (Phasianus colchicus), red-legged partridge (Alectoris rufa), guinea fowl (Numida meleagris), capercaillie (Tetrao urogallus), Eurasian woodcock (Scolopax rusticola), woodpigeon (Columba palumbus), and song thrush (Turdus philomelos). PCR amplification was performed using a set of primers flanking a conserved region of approximately 720 base pairs (bp) from the mitochondrial 12S rRNA gene. Restriction site analysis based on sequence data from this DNA fragment permitted the selection of AluI and BfaI endonucleases for species identification. The restriction profiles obtained when amplicons were digested with the chosen enzymes allowed the unequivocal identification of all game bird species analyzed. However, the use of the PCR-RFLP technique described is limited to raw meat authentication. It is not suitable for cooked products because thermal treatment strongly accelerates DNA degradation leading to difficulties in amplifying the 720 bp fragment. PMID:19202803

  2. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  3. Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis.

    PubMed

    Setthawongsin, Chanokchon; Techangamsuwan, Somporn; Tangkawattana, Sirikachorn; Rungsipipat, Anudep

    2016-08-01

    Canine transmissible venereal tumor (CTVT) is the only naturally contagious tumor that is transmitted during coitus or social behaviors. Based on the tumor's location, the diagnosis of genital TVT (GTVT) is comparably easier than those in the extragenital area (ETVT) that are more easily incorrectly diagnosed. Fortunately, CTVT cells contain a specific long interspersed nuclear elements (LINE), inserted upstream of the myc gene, allowing a diagnostic polymerase chain reaction (PCR) based detection assay. The objectives of this study were aimed to improve the diagnostic accuracy by applying the diagnostic LINE1-c-myc PCR assay and fine needle aspiration (FNA) collection in direct comparison with standard cytological and histopathological analyses. Seventy-four dogs, comprised of 41 and 31 dogs with tumor masses at their external genitalia and extragenital areas (e.g. skin and nasal cavity), respectively, were included in this study. The signalment of these 65 dogs and clinical history of 20 client-owned dogs were collected. Samples were taken by biopsy for both histopathological examination and FNA for cytological examination and diagnostic PCR. The PCR products from 10 apparently CTVT samples were purified and sequenced. Sixty-one CTVT cases were diagnosed by cytological and histological analyses, but 65 were positive by the PCR assay. Overall, the PCR assay improved the accuracy of diagnostic CTVT results, especially for the more difficult ETVT tumors. Moreover, this PCR-based approach can facilitate the decision as to discontinue chemotherapy by discrimination between residual tumor cell masses and fibrotic tissue. PMID:27075116

  4. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  5. Use of Polymerase Chain Reaction for Bivalve Pathogen Surveillance in the Yellow Clam Mesodesma mactroides.

    PubMed

    Carvalho, Yuri Bovi Morais; da Silva Santos, Juan Jethro; Raibenberg, Fernando C; Poersch, Luis Henrique; Romano, Luis Alberto

    2016-06-01

    The yellow clam Mesodesma mactroides is a valuable shellfish occurring from the southeastern coast of Brazil to the northern coast of Argentina. Populations of yellow clams are disappearing from their entire range, and the cause is still unknown. The objective of this paper was to search for World Organisation for Animal Health (OIE)-listed pathogens and their relatives in the genera Marteilia, Bonamia, and Perkinsus as well as Mikrocytos mackini and the virus OsHV-1 μ var the yellow clam population in southern Brazil using molecular techniques and classic histology protocols. A total of 180 clams were manually collected in the intertidal region at six sampling points covering the entire coast of Rio Grande do Sul State (length, 622 km) in 2013. Tissue samples were tested by OIE-recommended single-step conventional polymerase chain reaction assays. The screening showed no evidence of the specific sequences of the protistan parasites and viral pathogens at any site within the six zones under study. We recommend continuous monitoring of the mollusks in the region. Received July 3, 2015; accepted February 3, 2016. PMID:27221761

  6. Detection of feline immunodeficiency virus in saliva and plasma by cultivation and polymerase chain reaction.

    PubMed Central

    Matteucci, D; Baldinotti, F; Mazzetti, P; Pistello, M; Bandecchi, P; Ghilarducci, R; Poli, A; Tozzini, F; Bendinelli, M

    1993-01-01

    The rates of feline immunodeficiency virus (FIV) isolation from saliva, plasma, and peripheral blood mononuclear cells (PBMC) of infected cats were compared; isolation rates were 18, 14, and 81%, respectively, in naturally infected cats and 25, 57, and 100%, respectively, in experimentally infected animals. There was no obvious relationship between isolation rate and clinical stage or between isolation rate and the titer of neutralizing antibody in serum. Virus could be isolated from one salivary gland as early as 1 week postinfection and, on a more regular basis, starting at 3 weeks postinfection, when, however, most other tissues were also positive. Polymerase chain reaction analysis showed that FIV genomes are present in saliva and plasma more frequently than expected on the basis of isolation data. Saliva was also found to contain viral DNA, indicating that it may harbor virus-infected cells as well as free virus. The addition of plasma but not of saliva to PBMC cultures delayed FIV growth. Isolation from plasma may be hampered by FIV neutralizing antibody and by the cytotoxic activity of this fluid for the PBMC used as a cell substrate. Images PMID:8384624

  7. Detection of avian group D rotavirus using the polymerase chain reaction for the VP6 gene.

    PubMed

    Bezerra, Delana Andreza Melo; da Silva, René Ribeiro; Kaiano, Jane Haruko Lima; Silvestre, Rodrigo Vellasco Duarte; de Souza Oliveira, Darleise; Linhares, Alexandre C; Gabbay, Yvone Benchimol; Mascarenhas, Joana D'Arc Pereira

    2012-11-01

    Group D rotaviruses (RVs-D) have been documented in birds and, while they may be common in these animals, few molecular studies are available for this specific group. In this study, specific primers for the gene that encodes for the RVs-D VP6 protein were designed and used in a reverse transcription polymerase chain reaction (RT-PCR). Thirty pools of samples were tested by polyacrylamide gel electrophoresis (PAGE) yielding a 30% (9/30) positivity. These pools were subjected subsequently to RT-PCR, with a 53% (16/30) positivity rate. The sensitivity of the PCR assay was demonstrated up to a dilution of 5 × 10(-4)ng/μL (0.5 pg/μL) of the cloned VP6 gene. The four samples were sequenced and showed 90.8-91.1% similarity with regards to the RVs-D VP6 gene. To assess for specificity our RT-PCR was applied to nine samples known to contain enteric viral agents other than group D rotaviruses including picobirnavirus, rotavirus group A, and reovirus with negative results. Overall, the data confirm the specificity of the primers used for detecting the RVs-D by RT-PCR, suggesting that this assay can be used for diagnostic purposes. PMID:22820073

  8. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  9. Detection of bovine leukemia virus in cattle by the polymerase chain reaction.

    PubMed

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C

    1991-06-01

    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  10. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis

    PubMed Central

    Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

    2003-01-01

    Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268

  11. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

    PubMed Central

    White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

    2015-01-01

    Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

  12. Pasteurella multocida in backyard chickens in Upper Egypt: incidence with polymerase chain reaction analysis for capsule type, virulence in chicken embryos and antimicrobial resistance.

    PubMed

    Mohamed, Moemen A; Mohamed, Mohamed-Wael A; Ahmed, Ahmed I; Ibrahim, Awad A; Ahmed, Mohamed S

    2012-01-01

    The prevalence of Pasteurella multocida strains among 275 backyard chickens from different regions of Upper Egypt was studied. A total of 21 isolates of P. multocida were recovered in 21 out of 275 chickens tested (7.6%) and were confirmed using phenotypic characterisation. Somatic serotyping of the 21 isolates resulted in 12 isolates being classed as serotype A:1 (57.14%), 4 as serotype A:3 (19.05%) and 5 could not be typed (23.8%). Capsular typing, using multiplex polymerase chain reaction (PCR), demonstrated that 18 strains were capsular type A (85.7%), and 3 were type D (14.3%). The present findings suggest that a multiplex capsular PCR could be valuable for the rapid identification of P. multocida in cases of fowl cholera infection. A total of 5 isolates of P. multocida were selected to study their pathogenicity in embryonated chicken eggs instead of conducting a study in mature chickens. The results showed a variation in pathogenicity between the strains tested, namely: serotype A:1 strains caused 80% mortality, in contrast to 20% mortality by type D strains. Pathological findings included severe congestion of the entire embryo, haemorrhaging of the skin, feather follicles and toe, and ecchymotic haemorrhages on the liver of the inoculated embryos. The observations in this study indicate that P. multocida serogroup A could be highly pathogenic for mature chickens and therefore might be a cause of considerable economic losses in commercial production. A total of 10 isolates were subjected to antimicrobial susceptibility to determine the minimal inhibitory concentration of 7 antimicrobials. All isolates were susceptible to ciprofloxacin, florfenicol, streptomycin and sulphamethoxazol with trimethoprim and with varying degrees of sensitivity to the other agents. PMID:22485004

  13. A centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria.

    PubMed

    Choi, Goro; Jung, Jae Hwan; Park, Byung Hyun; Oh, Seung Jun; Seo, Ji Hyun; Choi, Jong Seob; Kim, Do Hyun; Seo, Tae Seok

    2016-06-21

    In this study, we developed a centrifugal direct recombinase polymerase amplification (direct-RPA) microdevice for multiplex and real-time identification of food poisoning bacteria contaminated milk samples. The microdevice was designed to contain identical triplicate functional units and each unit has four reaction chambers, thereby making it possible to perform twelve direct-RPA reactions simultaneously. The integrated microdevice consisted of two layers: RPA reagents were injected in the top layer, while spiked milk samples with food poisoning bacteria were loaded into sample reservoirs in the bottom layer. For multiplex bacterial detection, the target gene-specific primers and probes were dried in each reaction chamber. The introduced samples and reagents could be equally aliquoted and dispensed into each reaction chamber by centrifugal force, and then the multiplex direct-RPA reaction was executed. The target genes of bacteria spiked in milk could be amplified at 39 °C without a DNA extraction step by using the direct-RPA cocktails, which were a combination of a direct PCR buffer and RPA enzymes. As the target gene amplification proceeded, the increased fluorescence signals coming from the reaction chambers were recorded in real-time at an interval of 2 min. The entire process, including the sample distribution, the direct-RPA reaction, and the real-time analysis, was accomplished with a custom-made portable genetic analyzer and a miniaturized optical detector. Monoplex, duplex, and triplex food poisoning bacteria (Salmonella enterica, Escherichia coli O157:H7, and Vibrio parahaemolyticus) detection was successfully performed with a detection sensitivity of 4 cells per 3.2 μL of milk samples within 30 min. By implementing the direct-PRA on the miniaturized centrifugal microsystem, the on-site food poisoning bacteria analysis would be feasible with high speed, sensitivity, and multiplicity. PMID:27216297

  14. Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens.

    PubMed

    Kersting, Sebastian; Rausch, Valentina; Bier, Frank F; von Nickisch-Rosenegk, Markus

    2014-01-01

    We report on the development of an on-chip RPA (recombinase polymerase amplification) with simultaneous multiplex isothermal amplification and detection on a solid surface. The isothermal RPA was applied to amplify specific target sequences from the pathogens Neisseria gonorrhoeae, Salmonella enterica and methicillin-resistant Staphylococcus aureus (MRSA) using genomic DNA. Additionally, a positive plasmid control was established as an internal control. The four targets were amplified simultaneously in a quadruplex reaction. The amplicon is labeled during on-chip RPA by reverse oligonucleotide primers coupled to a fluorophore. Both amplification and spatially resolved signal generation take place on immobilized forward primers bount to expoxy-silanized glass surfaces in a pump-driven hybridization chamber. The combination of microarray technology and sensitive isothermal nucleic acid amplification at 38 °C allows for a multiparameter analysis on a rather small area. The on-chip RPA was characterized in terms of reaction time, sensitivity and inhibitory conditions. A successful enzymatic reaction is completed in <20 min and results in detection limits of 10 colony-forming units for methicillin-resistant Staphylococcus aureus and Salmonella enterica and 100 colony-forming units for Neisseria gonorrhoeae. The results show this method to be useful with respect to point-of-care testing and to enable simplified and miniaturized nucleic acid-based diagnostics. FigureThe combination of multiplex isothermal nucleic acid amplification with RPA and spatially-resolved signal generation on specific immobilized oligonucleotides. PMID:25253912

  15. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  16. Real-time polymerase chain reaction method for detection of toxigenic Clostridium difficile from stools and presumptive identification of NAP1 clone.

    PubMed

    Jayaratne, Padman A; Monkman, Lori; Broukhanski, George; Pillai, Dillan R; Lee, Christine

    2013-02-01

    This study describes the development of a cost-effective, multiplex real-time polymerase chain reaction (RTPCR) method for detection of toxigenic Clostridium difficile from stools and presumptive identification of the NAP-1 strain. The diagnostic value of the new method is for the detection of toxigenic C. difficile which has the following performance characteristics: 99.8% specificity, 95.1% sensitivity, 97.5% positive predictive value, and 99.5% negative predictive value. Examination of 24 specimens presumptively identified as NAP1 strain by RTPCR with Pulsed-field gel electrophoresis performed on C. difficile isolated from those specimens showed 100% agreement. This RTPCR showed equivalent test performance characteristics as the 2 commercially available assays which were evaluated. The estimated cost per test is CAD$9.50 and which is significantly less than the commercial assays. The average turnaround time from setup to detection is 3.5 h. The RTPCR method described here is a cost-effective and highly sensitive test which can be implemented in a clinical laboratory to assist clinicians in establishing the diagnosis of C. difficile infection and indirectly determine the presence of the hypervirulent epidemic binary toxin (BI)/NAP 1 strain for prompt infection control interventions. PMID:23182075

  17. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene

    PubMed Central

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-01-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis′ economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis′ origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3′-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  18. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene.

    PubMed

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-04-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis' economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis' origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3'-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  19. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  20. [Detection of gamma-interferon mRNA in JEG-3 choriocarcinoma cell line by means of polymerase chain reaction].

    PubMed

    Fülöp, V; Szigetvári, I; Szepesi, J; Gáti, I

    1994-05-01

    To investigate the pathogenesis of choriocarcinoma the authors employed a newly developed gene amplification method by reverse polymerase chain reaction for the detection of gamma-interferon messenger RNA in JEG-3 choriocarcinoma cell line. Polymerase chain reaction products were analysed by agarose gel electrophoresis. Using 1 Kb DNA ladder as a marker, 84 base-pair fragment was selectively amplified correlating with published gamma-interferon gene fragment length. Because cDNA contains a virtually complete copy of the mRNA this method provides an evidence for the expression of gamma-interferon gene in JEG-3 choriocarcinoma cell line. Based on these results a potential autocrine mechanism may be present in JEG-3 choriocarcinoma cell line. PMID:8183543

  1. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) Larvae in Wetlands, Western Kenya: Confirmation by Polymerase Chain Reaction Method

    PubMed Central

    OHBA, SHIN-YA; KAWADA, HITOSHI; DIDA, GABRIEL O.; JUMA, DUNCAN; SONYE, GORGE; MINAKAWA, NOBORU; TAKAGI, MASAHIRO

    2010-01-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  2. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method.

    PubMed

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro

    2010-09-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  3. Field application of polymerase chain reaction diagnosis and strain typing of Trypanosoma cruzi in Bolivian triatomines.

    PubMed

    Breniere, S F; Bosseno, M F; Telleria, J; Carrasco, R; Vargas, F; Yaksic, N; Noireau, F

    1995-08-01

    A new approach for direct identification and characterization of Trypanosoma cruzi stocks in biological samples was tested for field applicability on an extensive sample of feces collected from triatomine vectors from four different species found in Bolivia. The first step of the technique is polymerase chain reaction (PCR) amplification of the hypervariable region of kinetoplast DNA minicircles of T. cruzi parasites. In this report, 345 fecal samples were analyzed and the PCR results were compared with microscopic examination. For Triatoma infestans, the principal Bolivian vector, both techniques were in concordance 85.3% of the time. For the three other species, Rhodnius pictipes, Eratyrus mucronatus, and Triatoma sordida, the fecal samples were all negative by microscopic examination whereas PCR results showed several T. cruzi-infected insects in each species. The second step of the procedure is the characterization of the T. cruzi clones by means of hybridization of the PCR products with clone-specific probes generated by the PCR. We used two probes corresponding to major clones circulating in high frequency in Bolivia (as shown by previous population genetic studies using isoenzyme characterization). We obtained four primary results: 1) we confirm the importance of two major clones in Bolivia in two distinct regions; 2) we report high rates of mixed infections (multiple clones in a single vector) in Triatoma infestans, up to 22% and 35% in Cochabamba and La Paz departments, respectively; 3) the results favor the absence of interaction between different clones; and 4) we find, for the first time, evidence of the major clones circulating in three species of triatomines that are known as mainly sylvatic species.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7677221

  4. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system.

    PubMed

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John

    2003-03-01

    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  5. Accuracy of universal polymerase chain reaction (PCR) for detection of bacterial meningitis among suspected patients

    PubMed Central

    Moayedi, Ali Reza; Nejatizadeh, Abdolazim; Mohammadian, Maryam; Rahmati, Mohammad Bagher; Namardizadeh, Vahideh

    2015-01-01

    Introduction Central nervous system (CNS) infections are life-threatening diseases caused by viral, bacterial, parasitic and fungal microorganisms. The aim of this study was to determine the accuracy of universal polymerase chain reaction (PCR) for the detection of bacterial meningitis among patients who were referred to Koodakan Hospital in Bandar Abbas because they were suspected of having the disease. Methods This study was conducted in 2013 on the patients who were admitted to Bandar Abbas’ Koodakan Hospital because they were suspected of having meningitis. A questionnaire, including demographic data, was completed for each patient. Universal PCR, Cerebrospinal fluid (CSF) analysis, and gram staining and cultures were done for all the patients. The data were analyzed using SPSS software. Results Among the 100 patients studied 59 (59%) were male and 41 (41%) were female. No patient in our study had a positive smear and culture for meningitis. Among the patients with negative smears and cultures six (6%) had positive universal PCR, and 94 (94%) had negative universal PCR. Based on these results, PCR had 95% specificity and 100% negative predictive value for the prediction of meningitis. In 30 patients (30%), the biochemical analysis of CSF were in favor of meningitis. Among the 30 patients, six patients (20%) had positive universal PCR and 24 patients (80%) had negative universal PCR. Conclusion Based on our results, the universal PCR test is useful in the diagnosis of bacterial meningitis in children. We recommend using it in combination with other tests, such as CSF analysis, for diagnosis of bacterial meningitis. PMID:26816587

  6. Human von Willebrand factor gene and pseudogene: Structural analysis and differentiation by polymerase chain reaction

    SciTech Connect

    Mancuso, D.J.; Tuley, E.A.; Westfield, L.A.; Lester-Mancuso, T.L.; Sorace, J.M.; Sadler, J.E. ); Le Beau, M.M. )

    1991-01-01

    Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseudogene on chromosome 22q11-13. The structures of the von Willebrand factor pseudogene and corresponding segment of the gene were determined, and methods were developed for the rapid differentiation of von Willebrand factor gene and pseudogene sequences. The pseudogene is 21-29 kilobases in length and corresponds to 12 exons (exons 23-34) of the von Willebrand factor gene. Approximately 21 kilobases of the gene and pseudogene were sequenced, including the 5{prime} boundary of the pseudogene. The 3{prime} boundary of the pseudogene lies within an 8-kb region corresponding to intron 34 of the gene. The presence of splice site and nonsense mutations suggests that the pseudogene cannot yield functional transcripts. The pseudogene has diverged {approximately}3.1{percent} in nucleotide sequence from the gene. This suggests a recent evolutionary origin {approximately}19-29 million years ago, near the time of divergence of humans and apes from monkeys. Several repetitive sequences were identified, including 4 Alu, one Line-1, and several short simple sequence repeats. Several of these simple repeats differ in length between the gene and pseudogene and provide useful markers for distinguishing these loci. Sequence differences between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from homologous sequences in the pseudogene.

  7. Optimization of quantitative polymerase chain reactions for detection and quantification of eight periodontal bacterial pathogens

    PubMed Central

    2012-01-01

    Background The aim of this study was to optimize quantitative (real-time) polymerase chain reaction (qPCR) assays for 8 major periodontal pathogens, i.e. Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum, Parvimonas micros, Porphyromonas gingivalis, Prevotella intermedia, Tanerella forsythia and Treponema denticola, and of the caries pathogen Streptococcus mutans. Results Eighteen different primer pairs were analyzed in silico regarding specificity (using BLAST analysis) and the presence of secondary structures at primer binding sites (using mFOLD). The most specific and efficiently binding primer pairs, according to these analyses, were selected for qPCR-analysis to determine amplification efficiency, limit of quantification and intra-run reproducibility. For the selected primer pairs, one for each species, the specificity was confirmed by assessing amplification of DNA extracts from isolates of closely related species. For these primer pairs, the intercycler portability was evaluated on 3 different thermal cyclers (the Applied Biosystems 7300, the Bio-Rad iQ5 and the Roche Light Cycler 480). For all assays on the different cyclers, a good correlation of the standard series was obtained (i.e. r2 ≥ 0.98), but quantification limits varied among cyclers. The overall best quantification limit was obtained by using a 2 μl sample in a final volume of 10 μl on the Light Cycler 480. Conclusions In conclusion, the proposed assays allow to quantify the bacterial loads of S. mutans, 6 periodontal pathogenic species and the genus Fusobacterium.This can be of use in assessing periodontal risk, determination of the optimal periodontal therapy and evaluation of this treatment. PMID:23199017

  8. Integrated continuous flow polymerase chain reaction and micro-capillary electrophoresis system with bioaffinity preconcentration.

    PubMed

    Njoroge, Samuel K; Witek, Magorzata A; Battle, Katrina N; Immethun, Vicki E; Hupert, Mateusz L; Soper, Steven A

    2011-11-01

    An integrated and modular DNA analysis system is reported that consists of two modules: (i) A continuous flow polymerase chain reaction (CFPCR) module fabricated in a high T(g) (150°C) polycarbonate substrate in which selected gene fragments were amplified using biotin and fluorescently labeled primers accomplished by continuously shuttling small packets of PCR reagents and template through isothermal zones as opposed to heating and cooling large thermal masses typically performed in batch-type thermal reactors. (ii) μCE (micro-capillary electrophoresis) module fabricated in poly(methylmethacrylate) (PMMA), which utilized a bioaffinity selection and purification bed (2.9  μL) to preconcentrate and purify the PCR products generated from the CFPCR module prior to electrophoretic sorting. Biotin-labeled CFPCR products were hydrostatically pumped through the streptavidin-modified bed, where they were extracted onto the surface of micropillars. The affinity bed was also fabricated in PMMA and was populated with an array of microposts (50  μm width; 100  μm height) yielding a total surface area of ∼117  mm(2). This solid-phase extraction (SPE) process demonstrated high selectivity for biotinylated amplicons and utilized the strong streptavidin/biotin interaction (K(d) = 10(-15)  M) to generate high recoveries. The SPE selected CFPCR products were thermally denatured and single-stranded DNA released for injection into a 7-cm-long μCE channel for size-based separations and fluorescence detection. The utility of the system was demonstrated using Alu DNA typing for gender and ethnicity determinations as a model. Compared with the traditional cross-T injection procedure typically used for μCE, the affinity pre-concentration and injection procedure generated signal enhancements of 17- to 40-fold, critical for CFPCR thermal cyclers due to Taylor dispersion associated with their operation. PMID:22038569

  9. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, Tonie E.; Smith, Susan R.; Miyamoto, Amy; Shadduck, Daniel J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  10. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, T.E.; Smith, S.R.; Miyamoto, A.; Shadduck, D.J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 ?? 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  11. Development of a polymerase chain reaction assay to detect cyprinid herpesvirus 2 in goldfish.

    PubMed

    Waltzek, Thomas B; Kurobe, Tomofumi; Goodwin, Andrew E; Hedrick, Ronald P

    2009-03-01

    Cyprinid herpesvirus 2 (CyHV2) has been associated with epidemic mortality among cultured populations of goldfish Carassius auratus. As the principal target tissues are hematopoietic cells in the kidney and spleen, the disease is designated herpesviral hematopoietic necrosis (HVHN). Originally described from Japan, the virus is present in at least five other countries and probably has a global distribution in goldfish. Preventing the further spread of the virus via control programs that exploit sensitive viral detection methods is critical. We developed a conventional polymerase chain reaction (PCR) test based on unique sequences found in the putative helicase gene of CyHV2 and completed initial steps toward the validation of this test. The helicase CyHV2 PCR has an analytic sensitivity of at least 78 copies of the target sequence per reaction in serially diluted plasmid and 84 copies/microg of DNA from the kidney and spleen of goldfish experimentally infected with CyHV2. The analytic specificity of the helicase CyHV2 PCR was demonstrated by the lack of amplification of genomic DNA from cyprinid herpesvirus 1, cyprinid herpesvirus 3, and ictalurid herpesvirus 1 (IcHV1). The helicase CyHV2 PCR effectively detected DNA from CyHV2 from goldfish over a broad geographic range, including Japan, California, Ohio, and Pennsylvania. The performance of the helicase CyHV2 PCR was compared with that of the previously described real-time TaqMan PCR for CyHV2 on a set of 37 samples of DNA from goldfish after experimental or natural exposure to CyHV2. The two tests had very strong agreement (kappa coefficient = 0.907) in classifying fish as positive or negative for CyHV2. The helicase CyHV2 PCR therefore complements the real-time PCR test as a conventional diagnostic method for preventing the further spread of CyHV2. PMID:19485127

  12. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  13. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive. PMID:21225195

  14. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  15. Predictive role of polymerase chain reaction in the early diagnosis of congenital Trypanosoma cruzi infection.

    PubMed

    Velázquez, Elsa B; Rivero, Rocío; De Rissio, Ana María; Malagrino, Nora; Esteva, Mónica I; Riarte, Adelina Rosa; Ruiz, Andrés Mariano

    2014-09-01

    The efficacy of specific chemotherapy in congenital Chagas disease before the first year of life ranges between 90 and 100%. Between this age and 15 years of age, the efficacy decreases to around 60%. Therefore, early infection detection is a priority in vertical transmission. The aim of this work was to assess whether polymerase chain reaction (PCR) plays a predictive role in the diagnosis of congenital Chagas disease as compared to conventional parasitological and serological methods. To this end, we studied a total of 468 children born to Trypanosoma cruzi seroreactive mothers came from Argentina, Bolivia and Paraguay, who lived in the city of Buenos Aires and suburban areas (Argentina), a non-endemic area of this country. These children were assessed by PCR from 2004 to 2009 with the specific primers Tcz1 and Tcz2, and 121 and 122. PCR allowed detecting 49 T. cruzi-positive children. Eight of these 49 children were excluded from the analysis: six because they did not complete follow-up and two because the first control was performed after 12 months of age. Parasitological methods allowed detecting 25 positive children, 7 of whom had been earlier diagnosed by PCR (1.53±2.00 vs. 6.71±1.46 months; p=0.0002). Serological methods allowed detecting 16 positive children, 12 of whom had been earlier diagnosed by PCR (1.46±1.48 vs. 11.77±4.40 months; p<0.0001). None of the children negative by PCR was positive by serological or parasitological methods. This study shows that PCR allows early diagnosis in congenital Chagas disease. At present, an early positive PCR is not indicative for treatment. However, a positive PCR would alert the health system to search only those infected infants diagnosed by early PCR and thus generate greater efficiency in the diagnosis and treatment of congenital T. cruzi infection. PMID:24892867

  16. Comparative genotyping of Streptococcus mutans by repetitive extragenic palindromic polymerase chain reaction and multilocus sequence typing.

    PubMed

    Momeni, S S; Whiddon, J; Moser, S A; Cheon, K; Ruby, J D; Childers, N K

    2013-02-01

    The genetic diversity of Streptococcus mutans has been extensively studied using a variety of genotyping methods. Repetitive extragenic palindromic-polymerase chain reaction (rep-PCR) is a genotyping approach used for screening large numbers of bacterial isolates. This two-part study used multilocus sequence typing (MLST) analysis to evaluate genotypes previously identified as unique using rep-PCR. In part one, an isolate was selected from each of the 22 S. mutans rep-PCR genotype groups representing 8000 clinical isolates. For part two, four additional isolates were selected from the six most commonly occurring genotype groups (GG) for further analysis. Real-time PCR was performed using eight housekeeping S. mutans gene loci and the amplicons were sequenced. Sequence data analysis was performed using CLC DNA Workbench and alleles were compared with the PubMLST database for Oral Streptococcus using the Nakano scheme. Concatenated sequences were evaluated with MEGA using a minimum evolution method with bootstrap. All 22 rep-PCR genotypes were unique by MLST analysis. Within rep-PCR GGs, MLST matched rep-PCR in three groups demonstrating clonality; three groups exhibited more diversity with MLST. The discovery of three clonal groups is unique to this study and suggests that S. mutans genotypes are shared between unrelated subjects. Furthermore, MLST defined 19 new alleles and 26 new sequence types that have been confirmed and registered with PubMLST. Methods for processing were streamlined and a process for using MLST with rep-PCR is suggested. In conclusion, MLST verified that rep-PCR is a reliable and cost-effective method for screening large numbers of S. mutans strains for epidemiological study. PMID:23194334

  17. Detection of MYCN Amplification in Serum DNA Using Conventional Polymerase Chain Reaction.

    PubMed

    Ma, Youngeun; Lee, Ji Won; Park, Soo Jin; Yi, Eun Sang; Choi, Young Bae; Yoo, Keon Hee; Sung, Ki Woong; Koo, Hong Hoe

    2016-09-01

    Neuroblastoma (NB) is the most common extra-cranial solid tumor of childhood and is characterized by a wide range of clinical behaviors. Amplification of MYCN is a well-known poor prognostic factor in NB patients. As the MYCN amplification status is usually tested using tumor specimens, lengthy and invasive procedures are unavoidable. To evaluate the possibility of detecting MYCN amplification without invasive procedure, we performed conventional polymerase chain reaction (PCR) analysis to identify MYCN amplification using the preserved serum DNA. PCR of serum DNA was done in 105 NB patients whose MYCN status had been confirmed by fluorescence in situ hybridization. MYCN amplification was evaluated as the ratio of signal intensities between MYCN and NAGK (M/N ratio). When regarding the tissue FISH results as a reference, 10 patients had MYCN-amplified (MNA) NB, and 95 had non-MNA NB. The M/N ratio of the MNA group (median 2.56, range 1.01-3.58) was significantly higher than that of the non-MNA group (median 0.97, range 0.67-5.18) (P < 0.001). In the receiver operating characteristic curve analysis, the area under the curve was 0.957 (95% confidence interval 0.898-1.000; P < 0.001), and it showed 90.9% sensitivity and 97.9% specificity with the selected cut-off value set as 1.6. The detection of MYCN amplification using conventional PCR analysis of serum samples seems to be a simple and promising method to evaluate the MYCN status of NB patients. Further study with a larger set of patients is needed to confirm the accuracy of this result. PMID:27510381

  18. Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

    PubMed

    Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

    2011-06-01

    Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated. PMID:21461443

  19. Rapid Polymerase Chain Reaction-based Screening Assay for Bacterial Biothreat Agents

    PubMed Central

    Yang, Samuel; Rothman, Richard E.; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A.

    2013-01-01

    Objectives To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. Methods The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. Results The UniProbe detected the presence of all tested Eubacteria (31 / 31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. Conclusions A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents. PMID:18370996

  20. Incidence of enteroviruses in Mamala Bay, Hawaii using cell culture and direct polymerase chain reaction methodologies.

    PubMed

    Reynolds, K A; Roll, K; Fujioka, R S; Gerba, C P; Pepper, I L

    1998-06-01

    The consequence of point and nonpoint pollution sources, discharged into marine waters, on public recreational beaches in Mamala Bay, Hawaii was evaluated using virus cell culture and direct reverse transcriptase-polymerase chain reaction (RT-PCR). Twelve sites, nine marine, two freshwater (one stream and one canal), and one sewage, were assessed either quarterly or monthly for 1 year to detect the presence of human enteric viruses. Water samples were concentrated from initial volumes of 400 L to final volumes of 30 mL using Filterite electronegative cartridge filters and a modified beef extract elution procedure. Cell culture was applied using the Buffalo Green Monkey kidney cell line to analyze samples for enteroviruses. Positive samples were also evaluated by RT-PCR, using enterovirus-specific primers. Levels of RT-PCR inhibition varied with each concentrated sample. Resin column purification increased PCR detection sensitivity by at least one order of magnitude in a variety of sewage outfall and recreational marine water samples but not in the freshwater canal samples. Using cell culture, viable enteroviruses were found in 50 and 17% of all outfall and canal samples, respectively. Samples were positive at beaches 8% of the time. These data illustrate the potential public health hazard associated with recreational waters. Using direct PCR, viruses were detected at the outfall but were not found in any beach or canal samples, in part, owing to substances that inhibit PCR. Therefore, conventional cell culture is the most effective means of detecting low levels of infectious enteroviruses in environmental waters, whereas direct RT-PCR is rendered less effective by inhibitory compounds and low equivalent reaction volumes. PMID:9734309

  1. Use of polymerase chain reaction for early identification of Mycobacterium tuberculosis in positive cultures.

    PubMed Central

    Cormican, M. G.; Barry, T.; Gannon, F.; Flynn, J.

    1992-01-01

    AIMS: To develop a readily applicable polymerase chain reaction (PCR) based technique which would permit the identification of Mycobacterium tuberculosis complex isolates from Bactec phials at an earlier stage than currently available methods. METHODS: Mycobacterial cells cultured in Bactec 12B medium were harvested by centrifugation. The cells were lysed by heating in distilled water. Oligonucleotide primers based on the sequence of the gene coding for the immunogenic protein MPB64 were then used to amplify a 240 base pair fragment of DNA directly from the crude cell lysate. The PCR product was visualised under ultraviolet light following electrophoresis of an aliquot in an agarose gel containing ethidium bromide. The sensitivity of the PCR was adjusted so that about 600 cfu of M tuberculosis gave a positive result. The lowest growth index at which this method of identification might be applied to Bactec phials was determined and a number of routine cultures giving a positive growth index examined. RESULTS: M tuberculosis was positively identified at the lowest growth index, as determined by the Bactec system. Of 45 routine cultures examined, with growth indexes ranging from 6 to 999, the 15 confirmed by conventional means to contain M tuberculosis were correctly identified from 1 ml of culture medium. CONCLUSIONS: The method described can be used to identify M tuberculosis isolates cultured in the Bactec system at the earliest detectable rise in growth index. It may therefore allow cultured mycobacteria to be identified at an earlier stage than conventional methods or the commercially available DNA probes adapted for use with the Bactec system. Images PMID:1517460

  2. Polymerase chain reaction-free detection of hepatitis B virus DNA using a nanostructured impedance biosensor.

    PubMed

    Chen, Chun-Cheng; Lai, Zi-Lun; Wang, Gou-Jen; Wu, Chun-Ying

    2016-03-15

    A polymerase chain reaction (PCR)-free technique for the effective detection of genomic length hepatitis B virus (HBV) DNA is described in this study. The honeycomb-like barrier layer of an anodic aluminum oxide (AAO) film having a uniform nanohemisphere array was used as the substrate of the sensing electrode. A 30-nm gold film was sputtered onto the AAO barrier layer surface as the electrode, followed by electrochemical deposition of gold nanoparticles (GNPs) on the hemisphere surface. A specially designed single-strand 96-mer gene fragment of the target genomic DNA of HBV based on the genome sequences of HBV was immobilized on the nanostructured electrode as the capture probe. Target HBV DNA obtained from clinical samples was hybridized to the sensing probes. Detection results illustrate two dynamic linear ranges, 10(2)-10(3) and 10(3)-10(5.1) copies/mL, having R(2) values of 0.801 and 0.996 could be obtained, respectively. The detection limit of the proposed sending scheme was measured to be 111 copies/mL. The total of 45 target samples, including 20 samples with HBV concentration being lower than 10(2) copies/mL and 25 samples with HBV concentration being in the range of 10(3)-10(5.1) copies/mL, were used for real test. The concentration of these 45 HBV DNA samples was measured by the COBAS Ampliprep system. Comparing the measured results of the COBAS Ampliprep and our system, it was illustrated that the HBV DNA concentrations measured by the proposed method in this study had a high linear correlation with the COBAS Ampliprep, having R(2) values of 0.983. The proposed sensing scheme is highly feasible for future clinical applications. PMID:26479905

  3. National Malaria Prevalence in Cambodia: Microscopy Versus Polymerase Chain Reaction Estimates.

    PubMed

    Lek, Dysoley; Popovici, Jean; Ariey, Frederic; Vinjamuri, Seshu Babu; Meek, Sylvia; Bruce, Jan; Taylor, Walter R J; Socheat, Duong; Menard, Didier; Rogers, William O

    2016-09-01

    Accurate information regarding malaria prevalence at national level is required to design and assess malaria control/elimination efforts. Although many comparisons of microscopy and polymerase chain reaction (PCR)-based methods have been conducted, there is little published literature covering such comparisons in southeast Asia especially at the national level. Both microscopic examination and PCR detection were performed on blood films and dried blood spots samples collected from 8,067 individuals enrolled in a nationwide, stratified, multistage, cluster sampling malaria prevalence survey conducted in Cambodia in 2007. The overall malaria prevalence and prevalence rates of Plasmodium falciparum, Plasmodium vivax, and Plasmodium malariae infections estimated by microscopy (N = 8,067) were 2.74% (95% confidence interval [CI]: 2.39-3.12%), 1.81% (95% CI: 1.53-2.13%), 1.14% (95% CI: 0.92-1.40%), and 0.01% (95% CI: 0.003-0.07%), respectively. The overall malaria prevalence based on PCR detection (N = 7,718) was almost 2.5-fold higher (6.31%, 95% CI: 5.76-6.89%, P < 0.00001). This difference was significantly more pronounced for P. falciparum (4.40%, 95% CI: 3.95-4.90%, P < 0.00001) compared with P. vivax (1.89%, 95% CI: 1.60-2.22%, P < 0.001) and P. malariae infections (0.22%, 95% CI: 0.13-0.35%, P < 0.0001). The significant proportion of microscopy-negative but PCR-positive individuals (289/7,491, 3.85%) suggest microscopic examination frequently underestimated malaria infections and that active case detection based on microscopy may miss a significant reservoir of infection, especially in low-transmission settings. PMID:27402511

  4. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

    PubMed Central

    2016-01-01

    Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate) (PMMA) Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs) for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane) interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately. PMID:27230459

  5. Use of polymerase chain reaction in the quantitation of mdr-1 gene expression

    SciTech Connect

    Murphy, L.D.; Herzog, C.E.; Rudick, J.B.; Fojo, A.T.; Bates, S.E. )

    1990-11-01

    The ability of the polymerase chain reaction (PCR) to quantitate expression of mRNA was examined in the present study. The model chosen was expression of the multidrug resistance gene mdr-1/Pgp in two colon carcinoma cell lines which express mdr-1/Pgp at levels comparable to those found in many clinical samples. PCR was utilized to evaluate differences in mdr-1/Pgp expression in the two cell lines after modulation by sodium butyrate. Thus, comparisons were made across a range of mdr-1/Pgp expression as well as comparisons of small differences. The PCR was found to be both sensitive and quantitative. Accurate quantitation requires demonstration of an exponential range which varies among samples. The exponential range can be determined by carrying out the PCR for a fixed number of cycles on serial dilutions of the RNA reverse transcription product, or by performing the reaction with a varying number of cycles on a fixed quantity of cDNA. By quantitation of the difference in PCR product derived from a given amount of RNA from the sodium butyrate treated and untreated cells, the difference in mRNA expression between samples can be determined. Normalization of the results can be achieved by independent amplification of a control gene, such as {beta}{sub 2}-microglobulin, when the latter is also evaluated in the exponential range. Simultaneous amplification of the control and target genes results in lower levels of PCR products due to competition, which varies from sample to sample. The PCR is thus a labor-intensive but sensitive method of quantitating gene expression in small samples of RNA.

  6. Evaluation of gold nanoparticles as the additive in real-time polymerase chain reaction with SYBR Green I dye

    NASA Astrophysics Data System (ADS)

    Yang, Wenchao; Mi, Lijuan; Cao, Xueyan; Zhang, Xiaodong; Fan, Chunhai; Hu, Jun

    2008-06-01

    Gold nanoparticles (AuNPs) have been proven to be able to improve the specificity or increase the efficiency of a polymerase chain reaction (PCR) when a suitable amount of AuNPs was used. However, there is still a lack of systematic evaluation of AuNPs in real-time PCR. In this study, DNA degradation and the fluorescence quenching effect of AuNPs were first tested in real-time PCR. Then two different kinds of Taq DNA polymerase, native and recombinant Taq polymerase, were employed to evaluate the AuNPs' effect on the threshold cycle (CT) values, standard curves and melting curves in real-time PCR. Different ratios of the amount of native Taq DNA polymerase to the amount of AuNPs were also tested. It was found that AuNPs could be applied in real-time PCR with correlation coefficient R2>0.989. The combination of 2.09 nM AuNPs with 3.75 U of native Taq DNA polymerase could make the amplification curves shift to the left and enhance the efficiency of the real-time PCR (0.628 39 without AuNPs compared with 0.717 89 with 2.09 nM AuNPs), thus enabling faster detection in comparison with those of control samples. However, no improvement ability of AuNPs was found in real-time PCR based on recombinant rTaq DNA polymerase. Besides, the results suggest that a complex interaction exists between AuNPs and native Taq DNA polymerase.

  7. Multiplex detection of Solenopsis invicta viruses -1, -2, and -3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multiplex polymerase chain reaction (PCR) method was developed to detect simultaneously Solenopsis invicta viruses -1, -2, and -3 in their host, the red imported fire ant, Solenopsis invicta. cDNA synthesis was conducted in a single reaction containing three oligonucleotide primers specific for ...

  8. Clinical application of a polymerase chain reaction assay in the diagnosis of pneumonia caused by Rhodococcus equi in a horse.

    PubMed

    Vivrette, S L; Sellon, D C; Gibbons, D S

    2000-11-01

    Diagnosis of pneumonia caused by Rhodococcus equi can be made more rapidly by use of a polymerase chain reaction (PCR) assay than by use of conventional bacteriologic culture techniques. Use of a PCR assay aids in the differentiation between virulent and avirulent strains of R equi, and the assay may be used to identify R equi in feces and soil of breeding farms. PMID:11061388

  9. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia

    PubMed Central

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Introduction Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. Objective The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Methods Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan–Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Results Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1 × 10−3 for precursor B-cell acute lymphoblastic leukemia and 1 × 10−2 for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1% ± 5.6% versus 41.7% ± 17.3%, respectively; p-value = 0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Conclusion Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. PMID:26670399

  10. Determination of the cytokine profile in American cutaneous leishmaniasis using the polymerase chain reaction.

    PubMed Central

    Cáceres-Dittmar, G; Tapia, F J; Sánchez, M A; Yamamura, M; Uyemura, K; Modlin, R L; Bloom, B R; Convit, J

    1993-01-01

    The lymphokine profiles were determined in the skin lesions of the three distinct clinical forms of American cutaneous leishmaniasis (ACL), using a reverse transcriptase polymerase chain reaction (RT-PCR) and primers for various lymphokines. The message for interferon-gamma (IFN-gamma), tumour necrosis factor-beta (TNF-beta), and IL-8 was expressed in the three clinical forms of ACL. IL-1 beta mRNA was expressed in most localized (LCL) and mucocutaneous (MCL) leishmaniasis, but in only few of the diffuse cutaneous leishmaniasis (DCL). IL-2 mRNA was detected in about half of the lesions, with more prominent values for MCL. IL-4 mRNA was present in most lesions from the three clinical forms, but markedly increased in DCL. IL-5 and IL-10 mRNAs were expressed in all MCL and in half of the DCL lesions and weakly expressed in LCL lesions. IL-10 mRNA was more abundant in MCL lesions. In contrast, IL-6 and TNF-alpha mRNAs were expressed in a large number of LCL. In MCL, IL-6 mRNA was expressed in most cases and TNF-alpha mRNA in all the cases. In DCL, IL-6 mRNA was absent and TNF-alpha mRNA was weakly expressed. These results suggest that most T cells present in the MCL and DCL lesions secrete a mixture of type 1 and type 2 cytokine patterns, but in DCL granulomas type 2 cytokines predominate. In LCL the cytokine patterns show a mixture of type 1 and type 0 with a preponderance of IFN-gamma over IL-4, and low levels of IL-5 and IL-10. The lack of IL-6 and TNF-alpha mRNAs, and the low expression of IL-1 beta in DCL lesions suggest a defect in the antigen-processing cells that may account for the state of unresponsiveness in these patients. Images Fig. 3 PMID:8443970

  11. Saliva Polymerase-Chain-Reaction Assay for Cytomegalovirus Screening in Newborns

    PubMed Central

    Boppana, Suresh B.; Ross, Shannon A.; Shimamura, Masako; Palmer, April L.; Ahmed, Amina; Michaels, Marian G.; Sánchez, Pablo J.; Bernstein, David I.; Tolan, Robert W.; Novak, Zdenek; Chowdhury, Nazma; Britt, William J.; Fowler, Karen B.

    2011-01-01

    BACKGROUND Congenital cytomegalovirus (CMV) infection is an important cause of hearing loss, and most infants at risk for CMV-associated hearing loss are not identified early in life because of failure to test for the infection. The standard assay for newborn CMV screening is rapid culture performed on saliva specimens obtained at birth, but this assay cannot be automated. Two alternatives — real-time polymerase-chain-reaction (PCR)–based testing of a liquid-saliva or dried-saliva specimen obtained at birth — have been developed. METHODS In our prospective, multicenter screening study of newborns, we compared real-time PCR assays of liquid-saliva and dried-saliva specimens with rapid culture of saliva specimens obtained at birth. RESULTS A total of 177 of 34,989 infants (0.5%; 95% confidence interval [CI], 0.4 to 0.6) were positive for CMV, according to at least one of the three methods. Of 17,662 newborns screened with the use of the liquid-saliva PCR assay, 17,569 were negative for CMV, and the remaining 85 infants (0.5%; 95% CI, 0.4 to 0.6) had positive results on both culture and PCR assay. The sensitivity and specificity of the liquid-saliva PCR assay were 100% (95% CI, 95.8 to 100) and 99.9% (95% CI, 99.9 to 100), respectively, and the positive and negative predictive values were 91.4% (95% CI, 83.8 to 96.2) and 100% (95% CI, 99.9 to 100), respectively. Of 17,327 newborns screened by means of the dried-saliva PCR assay, 74 were positive for CMV, whereas 76 (0.4%; 95% CI, 0.3 to 0.5) were found to be CMV-positive on rapid culture. Sensitivity and specificity of the dried-saliva PCR assay were 97.4% (95% CI, 90.8 to 99.7) and 99.9% (95% CI, 99.9 to 100), respectively. The positive and negative predictive values were 90.2% (95% CI, 81.7 to 95.7) and 99.9% (95% CI, 99.9 to 100), respectively. CONCLUSIONS Real-time PCR assays of both liquid- and dried-saliva specimens showed high sensitivity and specificity for detecting CMV infection and should be

  12. Quantitative Polymerase Chain Reaction Analysis of the Mouse Cyp2j Subfamily: Tissue Distribution and Regulation.

    PubMed

    Graves, Joan P; Gruzdev, Artiom; Bradbury, J Alyce; DeGraff, Laura M; Li, Huiling; House, John S; Hoopes, Samantha L; Edin, Matthew L; Zeldin, Darryl C

    2015-08-01

    Members of the cytochrome P450 CYP2J subfamily are expressed in multiple tissues in mice and humans. These enzymes are active in the metabolism of fatty acids to generate bioactive compounds. Herein we report new methods and results for quantitative polymerase chain reaction (qPCR) analysis for the seven genes (Cyp2j5, Cyp2j6, Cyp2j8, Cyp2j9, Cyp2j11, Cyp2j12, and Cyp2j13) of the mouse Cyp2j subfamily. SYBR Green primer sets were developed and compared with commercially available TaqMan primer/probe assays for specificity toward mouse Cyp2j cDNA, and analysis of tissue distribution and regulation of Cyp2j genes. Each TaqMan primer/probe set and SYBR Green primer set were shown to be specific for their intended mouse Cyp2j cDNA. Tissue distribution of the mouse Cyp2j isoforms confirmed similar patterns of expression between the two qPCR methods. Cyp2j5 and Cyp2j13 were highly expressed in male kidneys, and Cyp2j11 was highly expressed in both male and female kidneys. Cyp2j6 was expressed in multiple tissues, with the highest expression in the small intestine and duodenum. Cyp2j8 was detected in various tissues, with highest expression found in the skin. Cyp2j9 was highly expressed in the brain, liver, and lung. Cyp2j12 was predominately expressed in the brain. We also determined the Cyp2j isoform expression in Cyp2j5 knockout mice to determine whether there was compensatory regulation of other Cyp2j isoforms, and we assessed Cyp2j isoform regulation during various inflammatory models, including influenza A, bacterial lipopolysaccharide, house dust mite allergen, and corn pollen. Both qPCR methods detected similar suppression of Cyp2j6 and Cyp2j9 during inflammation in the lung. PMID:25994032

  13. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    PubMed Central

    Thabit, Abrar K; Nicolau, David P

    2016-01-01

    Background Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated. Aim We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day), length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting. Methods Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest. Results The most common ribotypes were 027 (38%), 014/020 (21%), and 106/174 (21%). Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2). The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively). Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6). Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters), although the degree of nausea/vomiting did not differ between the three groups (P=0.3). A serum creatinine level ≥1.5 times the premorbid level was seen in only three patients, each infected with a different ribotype. Conclusion Although these data provide a baseline assessment of outcomes to aid in the design of future studies, the diversity of C. difficile ribotypes within the population must be considered, and additional work with other ribotypes

  14. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications.

    PubMed

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai

    2013-11-19

    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  15. A Fast-and-Robust Profiler for Improving Polymerase Chain Reaction Diagnostics

    PubMed Central

    Besseris, George J.

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technology in molecular genetics that progressively amplifies minimal copies of short DNA sequences in a fast and inexpensive manner. However, PCR performance is sensitive to suboptimal processing conditions. Compromised PCR conditions lead to artifacts and bias that downgrade the discriminatory power and reproducibility of the results. Promising attempts to resolve the PCR performance optimization issue have been guided by quality improvement tactics adopted in the past for industrial trials. Thus, orthogonal arrays (OAs) have been employed to program quick-and-easy structured experiments. Profiling of influences facilitates the quantification of effects that may counteract the detectability of amplified DNA fragments. Nevertheless, the attractive feature of reducing greatly the amount of work and expenditures by planning trials with saturated-unreplicated OA schemes is known to be relinquished in the subsequent analysis phase. This is because of an inherent incompatibility of ordinary multi-factorial comparison techniques to convert small yet dense datasets. Treating unreplicated-saturated data with either the analysis of variance (ANOVA) or regression models destroys the information extraction process. Both of those mentioned approaches are rendered blind to error since the examined effects absorb all available degrees of freedom. Therefore, in lack of approximating an experimental uncertainty, any outcome interpretation is rendered subjective. We propose a profiling method that permits the non-linear maximization of amplicon resolution by eliminating the necessity for direct error estimation. Our approach is distribution-free, calibration-free, simulation-free and sparsity-free with well-known power properties. It is also user-friendly by promoting rudimentary analytics. Testing our method on published amplicon count data, we found that the preponderant effect is the concentration of MgCl2 (p<0.05) followed by the

  16. One-heater flow-through polymerase chain reaction device by heat pipes cooling

    PubMed Central

    Chen, Jyh Jian; Liao, Ming Huei; Li, Kun Tze; Shen, Chia Ming

    2015-01-01

    This study describes a novel microfluidic reactor capable of flow-through polymerase chain reactions (PCR). For one-heater PCR devices in previous studies, comprehensive simulations and experiments for the chip geometry and the heater arrangement were usually needed before the fabrication of the device. In order to improve the flexibility of the one-heater PCR device, two heat pipes with one fan are used to create the requisite temperature regions in our device. With the integration of one heater onto the chip, the high temperature required for the denaturation stage can be generated at the chip center. By arranging the heat pipes on the opposite sides of the chip, the low temperature needed for the annealing stage is easy to regulate. Numerical calculations and thermal measurements have shown that the temperature distribution in the five-temperature-region PCR chip would be suitable for DNA amplification. In order to ensure temperature uniformity at specific reaction regions, the Re of the sample flow is less than 1. When the microchannel width increases and then decreases gradually between the denaturation and annealing regions, the extension region located in the enlarged part of the channel can be observed numerically and experimentally. From the simulations, the residence time at the extension region with the enlarged channel is 4.25 times longer than that without an enlarged channel at a flow rate of 2 μl/min. The treated surfaces of the flow-through microchannel are characterized using the water contact angle, while the effects of the hydrophilicity of the treated polydimethylsiloxane (PDMS) microchannels on PCR efficiency are determined using gel electrophoresis. By increasing the hydrophilicity of the channel surface after immersing the PDMS substrates into Tween 20 (20%) or BSA (1 mg/ml) solutions, efficient amplifications of DNA segments were proved to occur in our chip device. To our knowledge, our group is the first to introduce heat pipes into

  17. Elimination of contaminating DNA within polymerase chain reaction reagents: implications for a general approach to detection of uncultured pathogens.

    PubMed Central

    Meier, A; Persing, D H; Finken, M; Böttger, E C

    1993-01-01

    Analysis based on comparisons of 16S rRNA sequences provides a rapid and reliable approach to identifying human pathogens. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, bacterial 16S ribosomal DNA sequences of virtually any member of the eubacterial kingdom can be amplified by polymerase chain reaction and subsequently analyzed by sequence determination. Indeed, automated systems for broad-range amplification, sequencing, and data analysis are now feasible and may form the basis of the next generation of automated microbial identification systems. However, identification of pathogens by this strategy is hampered by the frequent contamination of reagents used for the amplification reaction, in particular Taq polymerase, with exogenous bacterial DNA. Here, we describe detailed investigations on the use of 8-methoxypsoralen and long-wave UV light to eliminate contaminating DNA in polymerase chain reaction reagents. The clinical utility of the developed procedure was demonstrated in a case of paucibacillary osteomyelitis, for which no specific bacterial agent had been cultured. Images PMID:8458958

  18. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  19. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    PubMed

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  20. [The use of polymerase chain reaction in laboratory diagnosis of dermatophytosis].

    PubMed

    Tiryaki, Yasin; Gültekin Korkmazgil, Berna; Eyigör, Mete; Aydın, Neriman

    2015-04-01

    Dermatophytes are among the common causes of fungal infections in the community. Classical diagnostic tests for dermatophytosis have some disadvantages such as failure of direct microscopy in species differentiation and culture methods being time consuming and having low sensitivity. The aim of this study was to investigate the performance of polymerase chain reaction (PCR) in the identification of dermatophytes directly from the clinical samples and the cultures. A total of 123 samples that comprise 63 skin and 60 nail scrapings obtained from 110 patients (69 female, 41 male; age range: 4-82 years) who were prediagnosed as dermatophytosis, were included in the study. Samples were examined with routine direct microscopy, culture and two different nested PCR (nPCR) protocols. The first was a pan-dermatophyte nPCR protocol targeting chitin synthase gene (CHS-1) of dermatophytes and the second was a nPCR protocol which targets specific ITS-1 genes of Trichophyton rubrum and T.mentagrophytes. Similar PCR methods were also applied to cultivated strains. Sequence analysis was performed for the samples that yielded positive results in pan-dermatophyte nPCR and negative results in T.rubrum/T.mentagrophytes - specific nPCR. Hyphae and/or spore structures were observed in 62 (50%) samples with direct microscopic examination and dermatophytes were isolated in 30 (24%) samples. Twenty-eight of the isolates grown in culture were identified as T.rubrum, and two as T.mentagrophytes with T.rubrum/T.mentagrophytes-specific nPCR protocol. In direct application, 67 (55%) of the clinical samples were found positive with pan-dermatophyte nPCR and 65 (53%) were positive with T.rubrum/T.mentagrophytes-specific nPCR. Samples which were negative in direct microscopic examination were also negative in culture. Nine of them were found positive with pan-dermatophyte nPCR and eight were positive with T.rubrum/T.mentagrophytes-specific nPCR. Two of the 30 samples which were positive in culture

  1. Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.

    PubMed

    Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W

    2014-12-01

    We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. PMID:26625461

  2. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided. PMID:27408919

  3. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  4. Ribosomal RNA-based panbacterial polymerase chain reaction for rapid diagnosis of septicaemia in Intensive Care Unit patients.

    PubMed

    Gupta, Mahua Das; Kaur, Harsimran; Ray, Pallab; Gautam, Vikas; Puri, G D

    2016-01-01

    Early diagnosis and treatment of sepsis by appropriate antibiotics is of utmost importance. Therefore, we evaluated 16S rRNA panbacterial polymerase chain reaction (PCR) for rapid diagnosis of sepsis in 49 adult patients in Intensive Care Units (ICUs) and compared it with an automated blood culture. 8 ml of 10 ml blood collected was inoculated into BACTEC® aerobic bottle and the remaining 2 ml was used for DNA extraction and PCR. 109 of 115 (93%) episodes of suspected sepsis showed concordant results between automated culture and PCR. Six episodes were positive by PCR only. Panbacterial PCR reduces turnaround time with rapid differentiation between systemic inflammatory response syndrome and sepsis. PMID:27080778

  5. Discrimination among thermophilic Campylobacter species by polymerase chain reaction amplification of 23S rRNA gene fragments.

    PubMed Central

    Eyers, M; Chapelle, S; Van Camp, G; Goossens, H; De Wachter, R

    1993-01-01

    By comparing nucleic acid sequences determined for one of the most variable areas of 23S rRNA genes of 23 Campylobacter strains, we were able to identify regions specific for thermophilic Campylobacter strains. Oligonucleotide primers corresponding to these unique regions were synthesized and used in the polymerase chain reaction. One primer pair selectively detected all thermophilic Campylobacter species, while four other primer pairs allowed discrimination among the thermophilic species Campylobacter coli, Campylobacter jejuni subsp. jejuni, Campylobacter lari, and Campylobacter upsaliensis. All primer sets were tested successfully on a large number of clinical isolates. Images PMID:7508460

  6. Multiplex genotype determination at a DNA sequence polymorphism cluster in the human immunoglobulin heavy-chain region

    SciTech Connect

    Li, H.; Hood, L.

    1995-03-20

    We have developed a method for multilocus genotype determination. The method involves using restriction fragment length polymorphisms (RFLPs) for allele discrimination. If a polymorphism is not an RFLP, it is converted into an RFLP during the polymerase chain reaction (PCR). After amplification and restriction enzyme digestion, samples are analyzed by sequential gel loading during electrophoresis. The efficiency of this method was demonstrated by determining the genotypes of 108 semen samples at seven DNA sequence polymorphic sites identified in the human immunoglobulin heavy-chain variable region. It was shown that more than 1000 PCR products could be easily analyzed per day per investigator. To show the reliability of this method, some of the typing results were confirmed by DNA sequence analysis. By computer simulation, most (98%) polymorphisms were shown to be natural or convertible (by changing 1 bp close to or next to each polymorphic site) RFLPs for the commercially available 4-base cutters. 47 refs., 4 figs., 3 tabs.

  7. Total integrated slidable and valveless solid phase extraction-polymerase chain reaction-capillary electrophoresis microdevice for mini Y chromosome short tandem repeat genotyping.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Sim, Jeong Eun; Woo, Kwang Man; Kim, Do Hyun; Im, Sung Gap; Seo, Tae Seok

    2016-04-15

    A fully integrated slidable and valveless microsystem, which performs solid phase DNA extraction (SPE), micro-polymerase chain reaction (μPCR) and micro-capillary electrophoresis (μCE) coupled with a portable genetic analyser, has been developed for forensic genotyping. The use of a slidable chip, in which a 1 μL-volume of the PCR chamber was patterned at the center, does not necessitate any microvalves and tubing systems for fluidic control. The functional micro-units of SPE, μPCR, and μCE were fabricated on a single glass wafer by conventional photolithography, and the integrated microdevice consists of three layers: from top to bottom, a slidable chip, a channel wafer in which a SPE chamber, a mixing microchannel, and a CE microchannel were fabricated, and a Ti/Pt resistance temperature detector (RTD) wafer. The channel glass wafer and the RTD glass wafer were thermally bonded, and the slidable chip was placed on the designated functional unit. The entire process from the DNA extraction using whole human blood sample to identification of target Y chromosomal short tandem repeat (STR) loci was serially carried out with simply sliding the slidable chamber from one to another functional unit. Monoplex and multiplex detection of amelogenin and mini Y STR loci were successfully analysed on the integrated slidable SPE-μPCR-μCE microdevice by using 1 μL whole human blood within 60 min. The proposed advanced genetic analysis microsystem is capable of point-of-care DNA testing with sample-in-answer-out capability, more importantly, without use of complicated microvalves and microtubing systems for liquid transfer. PMID:26657593

  8. Evaluation of canine and feline leishmaniasis by the association of blood culture, immunofluorescent antibody test and polymerase chain reaction

    PubMed Central

    2014-01-01

    Background This study aimed to evaluate the occurrence of Leishmania spp. in dogs and cats from Botucatu, São Paulo state, and Campo Grande, Mato Grosso do Sul state, Brazil, by the association of three diagnostic tests: blood culture in liver infusion tryptose medium, immunofluorescent antibody test and polymerase chain reaction. Fifty blood samples of dogs and cats from the Center for Zoonosis Control in Campo Grande, an area endemic for canine visceral leishmaniasis, were collected randomly, as well as canine and feline blood samples from the Municipal Kennel and Animal Protection Association in Botucatu, currently considered a transmission-free, non-endemic area. Results Of the 50 dog blood cultures from Botucatu, three (6%) were positive and of the 50 cats, two (4%) were positive. In Campo Grande, 29 dog blood cultures (58%) were positive and all (100%) cats negative by this test. Polymerase chain reaction detected Leishmania spp. in 100% of dog and cat samples from Botucatu but found all the cats from Campo Grande to be negative. On the other hand, 36 dogs from Campo Grande were positive (72%) by the same technique. Immunofluorescent antibody test in Botucatu found 100% of dogs and cats non-reactive, while in Campo Grande, it detected positivity in 32 dogs (64%) and 15 cats (30%). Conclusions The results show the importance of not only continuous epidemiological surveillance in areas not endemic for leishmaniasis, but also research for accurate diagnosis of this zoonosis. PMID:24565284

  9. Rapid identification of dengue virus by reverse transcription-polymerase chain reaction using field-deployable instrumentation.

    PubMed

    McAvin, James C; Escamilla, Elizabeth M; Blow, Jamie A; Turell, Michael J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lohman, Kenton L; Atchley, Daniel H; Hickman, John R; Niemeyer, Debra M

    2005-12-01

    Dengue virus universal and dengue serotype 1 to 4, fluorogenic probe hydrolysis (TaqMan), reverse transcription-polymerase chain reaction assays were developed for screening and serotype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler. Dengue universal and dengue 1 to 4 serotype assay in vitro sensitivity and specificity results were 100% concordant when tested with total nucleic acid extracts of multiple strains of dengue serotype 1 to 4, yellow fever, Japanese encephalitis, West Nile, and St. Louis encephalitis viruses. The in vitro sensitivity and specificity results for all five assays were concordant when tested with a blind panel of 27 dengue virus-infected mosquitoes, 21 non-dengue (yellow fever, West Nile, or St. Louis encephalitis) flavivirus-infected mosquitoes, and 11 uninfected mosquitoes and with clinical specimens consisting of a human serum panel of eight dengue viremic and 31 non-dengue-infected febrile patient serum samples. No cross-reaction occurred with vector species or human genomic DNA. Sample processing and polymerase chain reaction required <2 hours. PMID:16491947

  10. Detection of Mycobacterium leprae DNA from Archaeological Skeletal Remains in Japan Using Whole Genome Amplification and Polymerase Chain Reaction

    PubMed Central

    Suzuki, Koichi; Takigawa, Wataru; Tanigawa, Kazunari; Nakamura, Kazuaki; Ishido, Yuko; Kawashima, Akira; Wu, Huhehasi; Akama, Takeshi; Sue, Mariko; Yoshihara, Aya; Mori, Shuichi; Ishii, Norihisa

    2010-01-01

    Background Identification of pathogen DNA from archaeological human remains is a powerful tool in demonstrating that the infectious disease existed in the past. However, it is very difficult to detect trace amounts of DNA remnants attached to the human skeleton, especially from those buried in a humid atmosphere with a relatively high environmental temperature such as in Asia. Methodology/Principal Findings Here we demonstrate Mycobacterium leprae DNA from archaeological skeletal remains in Japan by polymerase chain reaction, DNA sequencing and single nucleotide polymorphism (SNP) analysis. In addition, we have established a highly sensitive method of detecting DNA using a combination of whole genome amplification and polymerase chain reaction, or WGA-PCR, which provides superior sensitivity and specificity in detecting DNA from trace amounts of skeletal materials. Conclusion/Significance We have detected M. leprae DNA in archaeological skeletal remains for the first time in the Far East. Its SNP genotype corresponded to type 1; the first detected case worldwide of ancient M. leprae DNA. We also developed a highly sensitive method to detect ancient DNA by utilizing whole genome amplification. PMID:20865042

  11. Combining Real-Time Polymerase Chain Reaction Using SYBR Green I Detection and Sequencing to Identify Vertebrate Bloodmeals in Fleas

    PubMed Central

    GRAHAM, CHRISTINE B.; BLACK, WILLIAM C.; BOEGLER, KAREN A.; MONTENIERI, JOHN A.; HOLMES, JENNIFER L.; GAGE, KENNETH L.; EISEN, REBECCA J.

    2015-01-01

    Programs that aim to control vector-borne zoonotic diseases require information on zoonotic hosts and on the feeding behavior of bridging vectors that are capable of transmitting pathogens from those hosts to humans. Here we describe an assay developed to identify bloodmeals in field-collected cat fleas (Ctenocephalides felis Bouché) to assess this species’ potential role as a Yersinia pestis bridging vector in a plague-endemic region of Uganda. Our assay uses a single primer set and SYBR Green I-based real-time polymerase chain reaction to amplify a segment of the 12S mitochondrial ribosomal RNA gene for identification by sequencing. The assay capitalizes on the sensitivity of real-time polymerase chain reaction and the specificity of sequencing and can be used to differentiate vertebrate bloodmeals to the genus or species level without a priori knowledge of the host community. Because real-time assays that detect vertebrate DNA are highly sensitive to human DNA contamination, we analyzed detection in artificially fed and unfed fleas to establish a Ct cutoff that optimized specificity without completely sacrificing sensitivity. Using the established cutoff, our assay detected human, rat, and goat DNA in artificially fed C. felis up to 72 h postfeeding. PMID:23270174

  12. Interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction as a diagnostic aid for synovial sarcoma.

    PubMed Central

    Shipley, J.; Crew, J.; Birdsall, S.; Gill, S.; Clark, J.; Fisher, C.; Kelsey, A.; Nojima, T.; Sonobe, H.; Cooper, C.; Gusterson, B.

    1996-01-01

    Identification of the t(X;18)(p11.2;q11.2) that is associated with a high proportion of synovial sarcoma can be a useful diagnostic aid. The translocation results in fusion of the SYT gene on chromosome 18 to either the SSX1 or the SSX2 gene, two homologous genes within Xp11.2. Two-color interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction were assessed as approaches to identify the rearrangement in well characterized cases. The presence of the translocation, and the specific chromosome X gene disrupted, were inferred from the configuration of signals from chromosome-specific centromere probes, paints, and markers flanking each gene in preparations of interphase nuclei. Rearrangement was found in two cell lines and eight of nine tumor samples, including analysis of five touch imprints. This was consistent with cytogenetic data in four cases and reverse transcription polymerase chain reaction analysis using primers known to amplify both SYT-SSX1 and SYT-SSX2 transcripts. The transcripts were distinguished by restriction with LspI and SmaI. Contrary to previous suggestions, there was no obvious correlation between histological subtype and involvement of the SSX1 or SSX2 gene. These approaches could also be applied to the identification of tumor-free margins and metastatic disease. Images Figure 1 Figure 3 PMID:8579118

  13. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  14. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples.

    PubMed

    Cho, Pyo Yun; Na, Byoung-Kuk; Choi, Kyung Mi; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-07-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  15. Triplex DNA: A new platform for polymerase chain reaction – based biosensor

    PubMed Central

    Li, Yubin; Miao, Xiangmin; Ling, Liansheng

    2015-01-01

    Non - specific PCR amplification and DNA contamination usually accompany with PCR process, to overcome these problems, here we establish a sensor for thrombin by sequence - specific recognition of the PCR product with molecular beacon through triplex formation. Probe A and probe B were designed for the sensor, upon addition of thrombin, two probes hybridized to each other and the probe B was extended in the presence of Klenow Fragment polymerase and dNTPs. The PCR amplification occurred with further addition of Taq DNA Polymerase and two primers, the PCR product was recognized by molecular beacon through triplex formation. The fluorescence intensity increased with the logarithm of the concentration of thrombin over the range from 1.0 × 10−12 M to 1.0 × 10−7 M, with a detection limit of 261 fM. Moreover, the effect of DNA contamination and non - specific amplification could be ignored completely in the proposed strategy. PMID:26268575

  16. Triplex DNA: A new platform for polymerase chain reaction-based biosensor.

    PubMed

    Li, Yubin; Miao, Xiangmin; Ling, Liansheng

    2015-01-01

    Non-specific PCR amplification and DNA contamination usually accompany with PCR process, to overcome these problems, here we establish a sensor for thrombin by sequence-specific recognition of the PCR product with molecular beacon through triplex formation. Probe A and probe B were designed for the sensor, upon addition of thrombin, two probes hybridized to each other and the probe B was extended in the presence of Klenow Fragment polymerase and dNTPs. The PCR amplification occurred with further addition of Taq DNA Polymerase and two primers, the PCR product was recognized by molecular beacon through triplex formation. The fluorescence intensity increased with the logarithm of the concentration of thrombin over the range from 1.0 × 10(-12) M to 1.0 × 10(-7) M, with a detection limit of 261 fM. Moreover, the effect of DNA contamination and non - specific amplification could be ignored completely in the proposed strategy. PMID:26268575

  17. Metal nanoparticle assisted polymerase chain reaction for strain typing of Salmonella Typhi.

    PubMed

    Rehman, Asma; Sarwar, Yasra; Raza, Zulfiqar Ali; Hussain, Syed Zajif; Mustafa, Tanveer; Khan, Waheed S; Ghauri, Muhammad Afzal; Haque, Abdul; Hussain, Irshad

    2015-11-01

    Salmonella enterica serotype Typhi (S. Typhi) is the causative agent of typhoid fever and remains a major health threat in most of the developing countries. The prompt diagnosis of typhoid directly from the patient's blood requires high level of sensitivity and specificity. Some of us were the first to report PCR based diagnosis of typhoid. This approach has since then been reported by many scientists using different genomic targets. Since the number of bacteria circulating in the blood of a patient can be as low as 0.3 cfu ml(-1), there is always a room for improvement in diagnostic PCR. In the present study, the role of different types of nanoparticles was investigated to improve the existing PCR based methods for diagnosis and strain typing of S. Typhi (targeting Variable Number of Tandem Repeats [VNTR]) by using optimized PCR systems. Three different types of nanoparticles were used i.e., citrate stabilized gold nanoparticles, rhamnolipid stabilized gold and silver nanoparticles, and magnetic iron oxide nanoparticles. The non-specific amplification was significantly reduced in VNTR typing when gold and silver nanoparticles were used in an appropriate concentration. More importantly, the addition of nanoparticles decreased the non-specificity to a significant level in the case of multiplex PCR thus further validating the reliability of PCR for the diagnosis of typhoid. PMID:26381602

  18. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  19. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    NASA Astrophysics Data System (ADS)

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou

    2009-11-01

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  20. Rapid identification of Aedes albopictus, Aedes scutellaris, and Aedes aegypti life stages using real-time polymerase chain reaction assays.

    PubMed

    Hill, Lydia A; Davis, Joseph B; Hapgood, George; Whelan, Peter I; Smith, Greg A; Ritchie, Scott A; Cooper, R D; van den Hurk, Andrew F

    2008-12-01

    In 2005, a widespread infestation of Aedes albopictus was discovered in the Torres Strait, the region between northern Australia and New Guinea. To contain this species, an eradication program was implemented in 2006. However, the progress of this program is impeded by the difficulty of morphologically separating Ae. albopictus larvae from the endemic species Aedes scutellaris. In this study, three real-time TaqMan polymerase chain reaction assays that target the ribosomal internal transcribed spacer 1 region were developed to rapidly identify Aedes aegypti, Ae. albopictus, and Ae. scutellaris from northern Australia. Individual eggs, larvae, pupae, and adults, as well as the species composition of mixed pools were accurately identified. The assay method was validated using 703 field-collected specimens from the Torres Strait. PMID:19052295

  1. Development of a polymerase chain reaction diagnostic assay for Ceratomyxa shasta, a myxosporean parasite of salmonid fish.

    PubMed

    Palenzuela, O; Trobridge, G; Bartholomew, J L

    1999-04-15

    A diagnostic procedure based on the polymerase chain reaction (PCR) was developed for the myxosporean parasite Ceratomyxa shasta. Three sets of oligonucleotide primers were designed to specifically amplify C. shasta ribosomal RNA genes and several parameters of the assay were tested and optimised. A simple protocol for the processing of fish tissue samples was also developed. In a single round, 20 microliters volume reaction the optimised procedure allows the detection of 50 fg of purified C. shasta genomic DNA, or 0.01 spore from a seeded fish intestine sample. This protocol is considerably faster, cheaper and more reliable than any previous diagnostic procedure for a myxosporean parasite, and can be an invaluable tool for the monitoring of early and/or subclinical C. shasta infections in wild and cultured salmon populations. PMID:10349552

  2. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    PubMed

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  3. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    USGS Publications Warehouse

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  4. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 ?? 10 4 cells per 0.25 g material or 1.9 ?? 10 3 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well. ?? Wildlife Disease Association 2004.

  5. Detection of Mycobacterium tuberculosis with nested polymerase chain reaction analysis in enucleated eye ball in Eales' disease.

    PubMed

    Verma, Aditya; Biswas, Jyotirmay; Dhanurekha, L; Gayathri, R; Lily Therese, K

    2016-06-01

    Nested polymerase chain reaction (nPCR) was performed on enucleated eyeball for detection of Mycobacterium tuberculosis (M. tb) genome in a patient with Eales' disease. PCR analysis in all previous studies has been done mainly using aqueous, vitreous and epiretinal membranes from these patients. Paraffin wax embedded tissue section of the enucleated eyeball was analyzed by histopathology and nPCR targeting MPB64 gene and IS6110 region of M. tb genome. Lymphocytic infiltration was seen in the vitreous, iris and the retinal tissue. Ziehl Neelsen stain was negative for acid fast bacilli. Caseation necrosis was not seen in any section. Agarose gel electrophoretogram showed positive results with 200 bp specific amplified product targeting MPB64 gene, whereas nPCR targeting IS6110 region was negative. Since biopsy proven M. tb is extremely difficult in ocular tissues due to extensive necrosis, the nPCR technique aided in the diagnosis. PMID:26499903

  6. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  7. Detection of minimal residual disease by polymerase chain reaction in patients with different hematologic diseases treated by bone marrow transplantation.

    PubMed

    Stuppia, L; Calabrese, G; Guanciali Franchi, P; Di Bartolomeo, P; Antonucci, A; Peila, R; Torlontano, G; Palka, G

    1993-02-01

    Thirteen male patients affected by different hematologic diseases who underwent bone marrow transplantation (BMT) with female donors were investigated by cytogenetic analysis and polymerase chain reaction (PCR) amplification of a DNA sequence specific for the Y chromosome. In six of these patients, PCR showed the presence of the Y chromosome-related sequence; in only three of these did cytogenetic analysis confirm the presence of mixed chimerism. In the remaining three patients, the results of the PCR were confirmed by in situ hybridization on cell nuclei with a probe for the alpha-satellite of the Y chromosome. We compare results obtained with the two methods and discuss the meaning of the minimal residual disease detected by PCR in patients submitted to BMT. PMID:8453609

  8. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach.

    PubMed

    Iñiguez, Alena M; Araújo, Adauto; Ferreira, Luiz Fernando; Vicente, Ana Carolina P

    2003-01-01

    The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA) present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR) inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences. PMID:12687765

  9. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis.

    PubMed

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi

    2012-08-01

    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406

  10. Real-time polymerase chain reaction of immunoglobulin rearrangements for quantitative evaluation of minimal residual disease in myeloma.

    PubMed

    Compagno, Mara; Mantoan, Barbara; Astolfi, Monica; Boccadoro, Mario; Ladetto, Marco

    2005-01-01

    The evaluation of minimal residual disease (MRD) is critical in the evaluation of treatments aimed at maximal cytoreduction in multiple myeloma (MM). Qualitative evaluation of MRD now has a 10-yr-long history, but it remains a relatively sophisticated procedure. More recently, real-time quantitative approaches have also been developed. These approaches allow a very effective monitoring of disease but introduce additional complexity and costs to the procedure. This chapter describes how we currently perform real-time polymerase chain reaction (PCR) in MM. Compared to the first description of the assay in June 2000, significant improvements have been made. Although real-time PCR is the main focus of the chapter, most of the information suitable for a proper setup of a qualitative approach is also provided. PMID:15968100

  11. The detection of Escherichia coli DNA in the ancient remains of Lindow Man using the polymerase chain reaction.

    PubMed

    Fricker, E J; Spigelman, M; Fricker, C R

    1997-05-01

    The polymerase chain reaction has been applied to the detection of Escherichia coli DNA in the upper gut contents of Lindow Man, an Iron Age bog body dated to ca 300 BC. With sets of primers from the uidA and lacZ genes, E. coli DNA could be detected reproducibly. Initial attempts at detecting DNA from freshly voided faeces from a healthy volunteer were unsuccessful due to inhibition of the reaction. Development of a method, based on guanidine thiocyanate and silica extraction and purification of the DNA fragments, facilitated the detection of the E. coli DNA in both freshly voided faeces and the upper gut contents of Lindow Man. These findings indicate that it may be possible to study the existence of infectious diseases in ancient civilizations and to learn more about the evolution of microbes. PMID:9172441

  12. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

    PubMed

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

    2002-01-01

    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system. PMID:12083257

  13. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods.

    PubMed

    Shearer, Karen E; Harte, Michael J; Ojkic, Davor; Delay, Josepha; Campbell, Douglas

    2014-03-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans. PMID:24587507

  14. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. PMID:27072123

  15. Thermal denaturation of double-stranded nucleic acids: prediction of temperatures critical for gradient gel electrophoresis and polymerase chain reaction.

    PubMed

    Steger, G

    1994-07-25

    A program is described which calculates the thermal stability and the denaturation behaviour of double-stranded DNAs and RNAs up to a length of 1000 base pairs. The algorithm is based on recursive generation of conditional and a priori probabilities for base stacking. Output of the program may be compared directly to experimental results; thus the program may be used to optimize the nucleic acid fragments, the primers and the experimental conditions prior to experiments like polymerase chain reactions, temperature-gradient gel electrophoresis, denaturing-gradient gel electrophoresis and hybridizations. The program is available in three versions; the first version runs interactively on VAXstations producing graphics output directly, the second is implemented as part of the HUSAR package at GENIUSnet, the third runs on any computer producing text output which serves as input to available graphics programs. PMID:8052531

  16. Genetic relationships among Aedes aegypti (Diptera: Culicidae) populations from Argentina using random amplified polymorphic DNA polymerase chain reaction markers.

    PubMed

    de Sousa, G B; Blanco, A; Gardenal, C N

    2001-05-01

    Random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR) polymorphism was analyzed in five Aedes aegypti (L.) populations from Argentina and one from Puerto Rico to estimate levels of intraspecific polymorphism and genetic relatedness. Allele frequencies were estimated assuming that RAPD products segregate as dominants and that genotype frequencies at those loci are in Hardy-Weinberg equilibrium. Mean expected heterozygosity (He) was 0.350; F(ST) values were significant at all loci except one, supporting the usefulness of the fragments used here to discriminate among populations. Rogers' genetic similarity between samples ranged from 0.806 to 0.621. The population from Puerto Rico was the most different from the Argentina populations. Considering that Ae. aegypti eggs, larvae, and pupae can be transported easily, relationships among the Argentinian populations may reflect the routes and intensity of commercial transit. PMID:11372960

  17. A pentaplex real-time polymerase chain reaction assay for detection of four species of soil-transmitted helminths.

    PubMed

    Basuni, Madihah; Muhi, Jamail; Othman, Nurulhasanah; Verweij, Jaco J; Ahmad, Maimunah; Miswan, Noorizan; Rahumatullah, Anizah; Aziz, Farhanah Abdul; Zainudin, Nurul Shazalina; Noordin, Rahmah

    2011-02-01

    Soil-transmitted helminth infections remain a major public health burden in low- and middle-income countries. The traditional diagnosis by microscopic examination of fecal samples is insensitive and time-consuming. In this study, a pentaplex real-time polymerase chain reaction (PCR) was evaluated for the simultaneous detection of Ancylostoma, Necator americanus, Ascaris lumbricoides, and Strongyloides stercoralis. The results were compared with those obtained by conventional parasitological diagnostic methods. Real-time PCR was positive in 48 of 77 samples (62.3%) and microscopic examination was positive in six samples (7.8%) only (P < 0.05). In conclusion, the real-time PCR assay described in this study provides a specific and sensitive diagnostic tool for the detection of these four helminth species in epidemiological studies and monitoring of treatment programs. PMID:21292911

  18. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction.

    PubMed

    Şakalar, Ergün; Mol, Sühendan

    2016-05-01

    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  19. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    PubMed Central

    Lunkenheimer, K; Hufert, F T; Schmitz, H

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specimens of patients with acute Lassa fever, viral RNA could be demonstrated. Negative results were obtained with all serum and urine specimens of healthy subjects. Our data suggest that PCR may be applied as an alternative to virus isolation in the rapid diagnosis of Lassa fever. Images PMID:2279999

  20. Improvement of polymerase chain reaction-based Bt11 maize detection method by reduction of non-specific amplification.

    PubMed

    Mano, Junichi; Yanaka, Yuka; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Kitta, Kazumi

    2010-01-01

    The Bt11 maize-specific qualitative detection method based on polymerase chain reaction (PCR) in the JAS analytical test handbook has been widely used for administrative monitoring of GM crops and quality control of commercially distributed grains. In the present investigation, some apparently false-positive detections were observed in assays using the Bt11 maize-specific method, and these erroneous results were proved to have been caused by non-specific DNA amplification. We improved the detection method to reduce non-specific amplification by decreasing the concentration of magnesium ions in the PCR mixture. The subsequent evaluation of analytical performance demonstrated no marked difference between the currently used and the improved methods, except for the reduced non-specific amplification. We conclude that the currently used standard method should be replaced with the improved method for the reliable detection of Bt11 maize. PMID:20208407

  1. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    PubMed Central

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  2. Utility of Quantitative Polymerase Chain Reaction in Leptospirosis Diagnosis: Association of Level of Leptospiremia and Clinical Manifestations in Sri Lanka

    PubMed Central

    Agampodi, Suneth B.; Matthias, Michael A.; Moreno, Angelo C.

    2012-01-01

    (See the Editorial Commentary by Katz, on pages 1256–8.) Background. Quantitative polymerase chain reaction (qPCR), despite cost and logistical challenges, has the potential to provide accurate and timely diagnosis for leptospirosis at the point-of-care in endemic areas. We studied optimal sample types for qPCR, timing of sampling, and clinical manifestations in relation to quantitative leptospiremia. Methods. A new qPCR assay using pathogenic Leptospira-specific 16S ribosomal RNA (rRNA) gene Taqman primers and an optimized temperature stepdown protocol was used to analyze patient blood samples. Serum was compared with whole blood as sample source. Quantitative leptospiremia was compared with clinical manifestations of leptospirosis and outcome. Results. The diagnostic sensitivity of qPCR of whole blood and serum was 18.4% (95% confidence interval [CI]: 9.97%–31.4%) and 51.0% (95% CI: 37.5%–64.4%) respectively. The qPCR on suspected cases confirmed infection in 58 of 381 cases (15.2%). Of these, 6 cases confirmed by nested polymerase chain reaction (PCR) and sequencing were serologically negative using a standard but not regionally optimized microscopic agglutination test panel. The bacterial load in serum/blood ranged from 102 to 106 Leptospira/mL. Median leptospiral load for uncomplicated, renal failure, myocarditis, and multi-organ failure patients were 8616, 11007, 36100, and 15882 Leptospira/mL respectively. The qPCR window of positivity ranged from day 2 to day 15; sensitivity of qPCR was not affected by the length of the interval between the onset of symptoms and sample collection (P = .328). Conclusions. Quantitative PCR shows potential as a valid diagnostic test with a wider window of positivity than previously thought. Quantitative leptospiremia in serum/whole blood samples did not directly correlate with clinical manifestations of outcome in this patient population. PMID:22354922

  3. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    PubMed

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  4. Differential diagnosis of fowlpox and infectious laryngotracheitis viruses in chicken diphtheritic manifestations by mono and duplex real-time polymerase chain reaction.

    PubMed

    Davidson, Irit; Raibstein, Israel; Altory, Amira

    2015-01-01

    Infectious laryngotracheitis virus (ILTV) and fowlpox virus (FPV) cause diphtheritic lesions in chicken tracheas and can simultaneously infect the same bird. A differential molecular diagnostic test, the duplex real-time polymerase chain reaction, is now reported using ILTV and FPV vaccine viruses and clinical samples from chickens, either uninfected or naturally infected with ILTV or FPV, or with both viruses. The dual virus amplification by real-time polymerase chain reaction was demonstrated to behave similarly to monoplex amplification, in spite of the fact that the real-time exponential amplification plots of the vaccine viruses were more illustrative than those of the clinical samples. PMID:25317604

  5. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

    PubMed Central

    2010-01-01

    Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes. PMID:20534175

  6. Detection of target site resistance to pyrethroids and organophosphates in the horn fly using multiplex polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans L., is an obligate blood-feeding fly and the primary insect pest parasitizing cattle in the United States. Pesticide resistance has become a huge problem for cattle producers and although several mechanisms of resistance are possible, target site resistance is the m...

  7. COMPARISON OF THE TEMPORAL VARIABILITY OF ENTEROCOCCAL CLUSTERS IN IMPACTED STREAMS USING A MULTIPLEX POLYMERASE CHAIN REACTION PROCEDURE

    EPA Science Inventory

    Understanding how fecal indicator bacteria and/or fecal indicator genotypes vary over time is important to determine the sources of fecal contamination. Enterococcus is one of the two indicators recommended by the EPA to monitor freshwaters for fecal contamination. Along with E...

  8. Field Evaluation of a Multiplex Real-Time Reverse Transcription Polymerase Chain Reaction Assay for Detection of Vesicular Stomatitis Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sporadic outbreaks of vesicular stomatitis (VS) in the United States result in significant economic losses for the US livestock industries because VS is an OIE reportable disease and also clinically mimics foot-and-mouth disease. Rapid and accurate differentiation of these two diseases is critical ...

  9. Multiplex Polymerase Chain Reaction in the Horn Fly: Detection of Pyrethroid, Organophosphate and Cyclodiene Target Site Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans irritans, is an important pest to the livestock industry that causes economic losses of approximately US$1 billion in the U.S. and a similar value in Latin America. Horn fly control efforts still relies mainly on direct application of insecticides although horn fly ...

  10. Quantification of HIV-1 using multiple quantitative polymerase chain reaction standards and bioluminometric detection.

    PubMed

    Nygren, M; Ronaghi, M; Nyrén, P; Albert, J; Lundeberg, J

    2001-01-01

    A non-gel-based quantification assay based on competitive PCR and bioluminometric detection has been developed. Samples containing human immunodeficiency virus type 1 (HIV-1) DNA and three quantitative standards at discrete concentrations were coamplified by PCR with primers annealing in the polymerase gene region. The quantitative standards contained the same primer binding sequences and had the same amplicon length as the wild-type DNA, but differed in an internal homopolymeric stretch (A, C, or T) over three base pairs. The PCR products were captured onto a solid support and treated with NaOH to separate the strands. Discrimination between the wild-type DNA and the three quantitative standard amplicons was achieved on the solid support by four parallel extension reactions with 3'-end specific primers. Inorganic pyrophosphate (PPi) released as a result of successful extension was converted to ATP by ATP sulfurylase and the level of ATP was sensed by firefly luciferase, generating a proportional amount of visible light which was detected by a luminometer. Here, we show that the obtained calibration curves, using the signal intensities of the three quantitative standards, enabled determination of the amount of target HIV-1 DNA. PMID:11141303

  11. Detection of short tandem repeat polymorphisms from human nails using direct polymerase chain reaction method.

    PubMed

    Tie, Jian; Uchigasaki, Seisaku

    2014-11-01

    Human nail is an important forensic material for parental testing and individual identification in large-scale disasters. Detection of STR polymorphism from hard tissues generally requires DNA purification, which is technically complicated and time consuming. In the present study, we attempted to detect STR polymorphisms from untreated human nail samples by direct PCR amplification method using the primer mixture supplied with the GenePrint® SilverSTR® III System or the AmpFℓSTR® Identifiler® PCR Amplification Kit, and Tks Gflex DNA polymerase known to be effective for amplification from crude samples. A nail fragment measuring approximately 1.5 mm in breadth and 0.5 mm in length was placed directly into a PCR tube, and various PCR conditions were tested. The PCR products were analyzed by denaturing acrylamide gel electrophoresis or CE. Multiple STR polymorphisms were detected successfully. This method that detects STR polymorphisms not only from fresh human fingernails, but also from old nail fragments stored at room temperature for up to 10 years is expected to become a novel DNA analytical method in forensic medicine and genetic studies. PMID:24934775

  12. Polymerase chain reaction analysis of hepatitis B virus DNA in formalin-fixed, paraffin-embedded liver biopsies from alcoholics using a simplified and standardized amplification protocol.

    PubMed

    von Weizsäcker, F; Blum, H E; Wands, J R

    1994-05-01

    Sixty-seven formalin-fixed and paraffin-embedded liver biopsies from HBsAg-negative alcoholics without previous blood transfusions or intravenous drug abuse were analyzed for the presence of low-level hepatitis B virus DNA by the polymerase chain reaction. To simplify and standardize the amplification procedure, aliquots of a complete polymerase chain reaction mix were prepared and frozen for storage; random samples were tested prior to analysis of clinical material. Freezing and storage of the aliquots did not affect the activity of Taq polymerase. One large batch of ready-to-use aliquots could thus be used as a standardized polymerase chain reaction kit for all experiments. The suitability of the extracted material for polymerase chain reaction analysis was tested in two ways. First, the absence of nonspecific polymerase chain reaction inhibitors was demonstrated in all samples by amplifying cloned hepatitis B virus DNA in the presence of extracted material. Second, the integrity of the extracted DNA was tested by amplifying a segment of the beta-globin gene. Twenty-three samples were beta-globin DNA positive and thus contained sufficient amounts of nondegraded DNA. These results emphasize the importance of testing both the absence of nonspecific inhibitors and DNA integrity in DNA samples extracted from fixed tissue. Among the 23 beta-globin positive samples, 12 had cirrhosis (52.1%). Two of these samples were hepatitis B virus DNA positive (8.7%); one of these cases had cirrhosis. Thus, even in the absence of common risk factors, the incidence of hepatitis B virus in this alcoholic population was increased compared to the general population. PMID:8071542

  13. [Use of the nested polymerase chain reaction in the differential diagnosis of human herpes simplex virus].

    PubMed

    Glukhov, A I; Gordeev, S A; Al'tshuler, M L; Severin, S E

    2003-02-01

    Herpes is one of the most widespread human viral pathologies. The article depicts a special modification of polymerized chain reaction--(PCR)--(referred to as "nested"), which has a higher sensitivity, specificity and reliability as compared to the ordinary PCR, and which is designed to detect the herpes viruses. The method was initially tested at purified preparation of viral DNA, and later--at clinical materials obtained from patients and healthy donors. Secretions from the urogenital tract (smears), scrapes from the urogenital tracts and urinal cellular samples were examined in patients. Herpes simplex was detected in all cases. As for the healthy people, the identical examinations produced in them mainly the negative findings. Therefore, the nested PCR is a simple, sensitive and effective instrument in the diagnostics and prevention of herpes; it can be recommended for a comprehensive usage in medical practice. PMID:12688217

  14. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  15. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  16. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  17. Detection of Newcastle disease virus RNA by reverse transcription polymerase chain reaction using formalin-fixed, paraffin-embedded tissue and comparison with immunohistochemistry and in situ hybridization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The usefulness of reverse transcription polymerase chain reaction (RT-PCR) from formalin-fixed, paraffin-embedded (FFPE) tissues was examined and compared to the immunohistochemistry (IHC) and in situ hybridization (ISH) assays for detection of Newcastle disease virus (NDV). Spleen and lung tissues...

  18. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis. PMID:24712177

  19. A 23S rDNA-targeted polymerase chain reaction-based system for detection of Staphylococcus aureus in meat starter cultures and dairy products.

    PubMed

    Straub, J A; Hertel, C; Hammes, W P

    1999-10-01

    A polymerase chain reaction-based system for detection of Staphylococcus aureus was developed. The system consisted of the following components: (i) selective enrichment, (ii) DNA isolation, (iii) amplification of DNA with primers targeted against the 23S rRNA gene, and (iv) evaluation of the specificity of the polymerase chain reaction by Southern hybridization and nested polymerase chain reaction. The method achieved a high degree of sensitivity and unambiguity as required for the detection of contaminants in food starter preparations. The method permitted detection of Staphylococcus aureus in preparations of meat starter cultures containing Staphylococcus carnosus either alone or in combination with lactobacilli, pediococci, and/or Kocuria varians. Detection limits were sufficiently low to show within 12 h the presence of 10(0) CFU of S. aureus in starter preparations containing 10(10) CFU of S. carnosus. The system was also applied to dried skim milk and cream. For detection without selective enrichment, a protocol was developed and permitted detection of 120 CFU of S. aureus in 1 ml of cream within 6 h. With nested polymerase chain reaction, the detection limit was decreased by one order of magnitude. PMID:10528718

  20. A Capsid Gene-Based Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Detection of Marine Vesiviruses in the Caliciviridae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A real-time reverse transcription polymerase chain reaction (rtRT-PCR) assay was developed for the identification of marine vesiviruses. The primers were designed to target a 176-nucleotide fragment within a highly conserved region of the San Miguel sea lion viruses (SMSVs) capsid gene. The assay de...

  1. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers

  2. Amplification and analysis of specific DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction.

    PubMed Central

    Sherman, M P; Ehrlich, G D; Ferrer, J F; Sninsky, J J; Zandomeni, R; Dock, N L; Poiesz, B

    1992-01-01

    Bovine leukemia virus (BLV) is the etiologic agent of leukemia in cattle and is believed to cause decreases in milk productivity, fertility, and life span in infected cows. BLV is a type C retrovirus in the Oncovirinae subfamily. It is most closely related to human T-cell lymphoma/leukemia virus type I (HTLV-I) and type II (HTLV-II). Since the polymerase chain reaction (PCR) provides rapid and efficient amplification of DNA sequences, primers were designed to amplify regions of the polymerase (pol) and pX genes specific for BLV targets. These sets of primers consistently amplified as few as 10 copies of BLV DNA contained in a plasmid in the background of 1 microgram of either human or bovine chromosomal DNA. In addition, no amplification products were detected from cell lines infected with HTLV-I, HTLV-II, or human immunodeficiency virus type 1 or 2 by the BLV PCR systems. Samples of peripheral blood mononuclear cells from 18 cows, previously determined to be serologically positive or negative, were correctly identified in a blind study as containing proviral DNA by use of the BLV primers and probes. Cloning and sequencing of amplified products revealed finite sequence variations among a previously cloned BLV isolate, the wild-type virus, and the published genome. Reverse transcriptase-directed PCR with the primers for both BLV pol and BLV pX was performed on plasma from a BLV-infected cow and detected in vivo BLV RNA expression. In summary, we have developed a specific and sensitive assay using PCR for the detection and identification of BLV infections; this assay can now be applied to clinical and basic research questions in veterinary medicine. Images PMID:1370847

  3. Ultrasensitive Multiplexed Immunoassay for Tumor Biomarkers Based on DNA Hybridization Chain Reaction Amplifying Signal.

    PubMed

    Guo, Jinjin; Wang, Junchun; Zhao, Junqing; Guo, Zilin; Zhang, Yuzhong

    2016-03-23

    In this work, a novel electrochemical immunoassay protocol has been reported for simultaneous determination of multiple tumor biomarkers based on DNA hybridization chain reaction (HCR) for signal amplification. Alpha-fetoprotein (AFP) and prostate specific antigen (PSA) were selected as model biomarkers. The immunoassay protocol contained primary antibodies immobilized on gold nanoparticles (Au NPs), secondary antibodies conjugated with DNA concatemer from HCR of primer, auxiliary probe, and signal probe labeled with signal molecules (methyleneblue (MB) and ferrocene (Fc)). In the presence of target biomarkers, the sandwich immunocomplex was formed between the primary antibodies and secondary antibodies bioconjugates carrying numerous signal molecules. As a result, two well-resolved reduction peaks, one was at -0.35 V (corresponding to MB) and other was at 0.33 V (corresponding to Fc; both vs SCE), were obtained in differential pulse voltammetry, and peak currents changed were related to the level of biomarkers. Under optimal conditions, the electrochemical immunoassay exhibited a wide linear response range (0.5 pg mL(-1) to 50 ng mL(-1)) and low detection limits (PSA, 0.17 pg mL(-1); AFP, 0.25 pg mL(-1)) (at S/N = 3). In addition, the immunoassay was evaluated by analyzing simulate human serum sample, and the recoveries obtained were within 99.4-107.6% for PSA and 97.9-108.2% for AFP, indicating the immnuoassay could be applied to the simultaneous detection of AFP and PSA in human serum samples. PMID:26937717

  4. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    PubMed Central

    Gupta, Pooja H.; Patel, Nirmal A.; Rank, D. N.; Joshi, C. G.

    2015-01-01

    Aim: An attempt has been made to study the toll-like receptors 4 (TLR4) gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR), respectively from Kankrej (22) and Triple cross (24) cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B) of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p<0.05). Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS) indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05). Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance. PMID:27047144

  5. Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia

    PubMed Central

    2012-01-01

    Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E

  6. Can rapid integrated polymerase chain reaction-based diagnostics for gastrointestinal pathogens improve routine hospital infection control practice? A diagnostic study.

    PubMed Central

    Pankhurst, Louise; Macfarlane-Smith, Louissa; Buchanan, James; Anson, Luke; Davies, Kerrie; O'Connor, Lily; Ashwin, Helen; Pike, Graham; Dingle, Kate E; Peto, Timothy Ea; Wordsworth, Sarah; Walker, A Sarah; Wilcox, Mark H; Crook, Derrick W

    2014-01-01

    BACKGROUND Every year approximately 5000-9000 patients are admitted to a hospital with diarrhoea, which in up to 90% of cases has a non-infectious cause. As a result, single rooms are 'blocked' by patients with non-infectious diarrhoea, while patients with infectious diarrhoea are still in open bays because of a lack of free side rooms. A rapid test for differentiating infectious from non-infectious diarrhoea could be very beneficial for patients. OBJECTIVE To evaluate MassCode multiplex polymerase chain reaction (PCR) for the simultaneous diagnosis of multiple enteropathogens directly from stool, in terms of sensitivity/specificity to detect four common important enteropathogens: Clostridium difficile, Campylobacter spp., Salmonella spp. and norovirus. DESIGN A retrospective study of fixed numbers of samples positive for C. difficile (n = 200), Campylobacter spp. (n = 200), Salmonella spp. (n = 100) and norovirus (n = 200) plus samples negative for all these pathogens (n = 300). Samples were sourced from NHS microbiology laboratories in Oxford and Leeds where initial diagnostic testing was performed according to Public Health England methodology. Researchers carrying out MassCode assays were blind to this information. A questionnaire survey, examining current practice for infection control teams and microbiology laboratories managing infectious diarrhoea, was also carried out. SETTING MassCode assays were carried out at Oxford University Hospitals NHS Trust. Further multiplex assays, carried out using Luminex, were run on the same set of samples at Leeds Teaching Hospitals NHS Trust. The questionnaire was completed by various NHS trusts. MAIN OUTCOME MEASURES Sensitivity and specificity to detect C. difficile, Campylobacter spp., Salmonella spp., and norovirus. RESULTS Nucleic acids were extracted from 948 clinical samples using an optimised protocol (200 Campylobacter spp., 199 C. difficile, 60 S. enterica, 199 norovirus and 295 negative

  7. Identification of mRNAs with enhanced expression in ripening strawberry fruit using polymerase chain reaction differential display.

    PubMed

    Wilkinson, J Q; Lanahan, M B; Conner, T W; Klee, H J

    1995-03-01

    Fruit ripening is a complex developmental process that involves specific changes in gene expression and cellular metabolism. In climateric fruits these events are coordinated by the gaseous hormone ethylene, which is synthesized autocatalytically in the early stages of ripening. Nonclimacteric fruits do not synthesize or respond to ethylene in this manner, yet undergo many of the same physiological and biochemical changes associated with the production of a ripe fruit. To gain insight into the molecular determinants associated with nonclimacteric fruit ripening, we examined mRNA populations in ripening strawberry fruit using polymerase chain reaction (PCR) differential display. Five mRNAs with ripening-enhanced expression were identified using this approach. Three of the mRNAs appear to be fruit-specific, with little or no expression detected in vegetative tissues. Sequence analysis of cDNA clones revealed positive identities for three of the five mRNAs based on homology to known proteins. These results indicate that the differential display technique can be a useful tool to study fruit ripening and other developmental processes in plants at the RNA level. PMID:7766892

  8. Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

    PubMed

    Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

    2015-08-01

    HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget. PMID:26176813

  9. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology. PMID:18346452

  10. Detection of Merkel cell polyomavirus in the human tissues from 41 Japanese autopsy cases using polymerase chain reaction.

    PubMed

    Matsushita, Michiko; Kuwamoto, Satoshi; Iwasaki, Takeshi; Higaki-Mori, Hiromi; Yashima, Shoji; Kato, Masako; Murakami, Ichiro; Horie, Yasushi; Kitamura, Yukisato; Hayashi, Kazuhiko

    2013-01-01

    It has recently been shown that approximately 80% of Merkel cell carcinomas harbor a novel polyomavirus named Merkel cell polyomavirus (MCPyV). MCPyV has been detected in human tissue samples. However, detailed distribution of MCPyV in non-neoplastic Japanese human tissues remains unclear. To address this, we used single or real-time quantitative polymerase chain reaction (PCR) for 41 autopsy cases. PCR revealed MCPyV-DNA in non-neoplastic samples: total, 29/41 (71%); adult, 29/39 (74%); fetus or infant, 0/2; men, 24/28 (86%); women, 5/13 (38%); total human tissues, 66/572 (12%); skin, 8/15 (53%); adrenal gland, 9/33 (27%), and other 16 organs (4-25%). This study first reported the presence of MCPyV-DNA in non-neoplastic tissues of thyroid gland, adrenal gland, spleen, bone marrow, stomach, gallbladder, pancreas, heart, and aorta. PCR revealed that viral load ranged from 0.00026 to 0.22 in all MCPyV-positive tissues compared with Merkel cell carcinoma samples. These detailed PCR data showed higher prevalence of MCPyV infection in Japanese men than women (p = 0.004) and broad distribution of MCPyV with low viral load in more non-neoplastic human tissues than in the previous reports. These data provide valuable insights for further studies of MCPyV infection and MCPyV-related diseases. PMID:22986833

  11. Comparative evaluation of effect of different irrigation solutions against Enterococcus faecalis: A polymerase chain reaction-based study

    PubMed Central

    Seelan, R. Gnana; Kumar, Arvind; Jonathan, R.; Maheswari, Uma; Raja, Jacob; Chelliah, P.

    2015-01-01

    Enterococcus faecalis is the most isolated or detected species from oral infections including marginal periodontitis, infected root canals, periradicular abscesses and also detected in cases of failed endodontic therapy. To prevent endodontic treatment failure irrigation is mandatory for the effective removal of smear layer, pulp tissue, and microorganisms. Cultivation and other traditional identification methods have been demonstrated to have several limitations when it comes to microbiological identification. Polymerase chain reaction was selected because it has an added advantage over traditional microbiological methods. Materials and Methods: Twenty single rooted premolars were taken were taken stored in 0.1% thymol solution at 4°C decoronated to obtain 12 mm length, teeth were autoclaved at 121°C, canals were instrumented up to 35k file (International Organization for Standardization). The samples were randomly divided into three groups Group I - 5.25% sodium hypochlorite (NaOCL) and 17% ethylenediaminetetraacetic acid (EDTA), Group - II 5.25% NaOCL and 2% chlorhexidine (CHX), Group III - 5.25% NaOCL and 17% EDTA and 2% CHX. Results: The results showed that Group III which is 5% NaOCl followed by 17% EDTA and followed by 2% CHX showed maximum antimicrobial activity in all the three different time intervals. PMID:26538921

  12. Detection of viable antibiotic-resistant/sensitive Acinetobacter baumannii in indoor air by propidium monoazide quantitative polymerase chain reaction.

    PubMed

    Tseng, C-C; Hsiao, P-K; Chang, K-C; Cheng, C-C; Yiin, L-M; Hsieh, C-J

    2015-10-01

    Acinetobacter baumannii represents a significant cause of nosocomial infections. Therefore, we combined real-time quantitative polymerase chain reaction (PCR) with the propidium monoazide (PMA-qPCR) to assess the feasibility of detecting viable, airborne A. baumannii. The biological collection efficiencies of three samplers for collecting airborne A. baumannii were evaluated by PMA-qPCR in a chamber study. After sampling, the effects of storage in collection fluid on A. baumannii were evaluated. The results showed that the culturable ratio of A. baumannii measured using the culture method was significantly correlated with the viable ratio measured using PMA-qPCR, but was not significantly correlated with the qPCR results. It was indicated that the AGI-30 impinger and the BioSampler were much more effective than the Nuclepore filter sampler for collecting airborne A. baumannii. The storage temperature was critical for aerosol samples, as the loss of viable A. baumannii was minimized when the PMA-bound DNA was stored at -20°C or if the collected cells were stored at 4°C and subsequently processed by PMA-qPCR within 1 month. The PMA-qPCR method was also to distinguish between colistin-sensitive and colistin-resistant A. baumannii, and no colistin-sensitive A. baumannii was detected by PMA-qPCR upon treatment of the BioSampler collection medium with 2 μg/ml colistin for 5 min. PMID:25283547

  13. Vaginal micropapillary lesions are not related to human papillomavirus infection: in situ hybridization and polymerase chain reaction detection techniques.

    PubMed

    Garzetti, G G; Ciavattini, A; Goteri, G; Menzo, S; De Nictolis, M; Clementi, M; Brugia, M; Romanini, C

    1994-01-01

    The objective of this study was to assess the human papillomavirus DNA presence in vaginal papillary lesions, with particular regard to micropapillomatosis to better define their clinical significance. Prospective study: the study population was composed of 62 women who were recruited consecutively from the Colposcopy Centre of the Ancona University, Department of Obstetrics and Gynecology, on the grounds of vaginal papillomatosis or/and typical acuminata warts. Biopsies for routine histology, and for human papillomavirus (HPV) DNA detection by means of in situ hybridization and polymerase chain reaction (PCR) were taken from the papillary lesions and from 24 healthy women, who were selected as controls. Macroscopically, vaginal micropapillomatosis was ascertained in 51 cases (82.3%), while in 11 cases (17.7%) the colposcopic diagnosis was condyloma acuminatum. During in situ hybridization, HPV DNA positivity was observed in 8 (9.4%) out of 85 samples of squamous papillae and in 11 (64.7%) out of 17 samples of condylomata; in control specimens, HPV DNA was detected in 2 (8.3%) out of 24 bioptic samples. The correspondence between in situ hybridization and PCR was 96.1%, with 17.4% more diagnosis obtained by PCR. Vaginal micropapillomatosis may be regarded as a variation in the normal anatomy of the lower genital tract without any significant relationship with HPV infection, and as a lesion easily distinguishable from condylomata acuminata by clinical examination alone. PMID:7959342

  14. Polymerase chain reaction-based diagnosis of rhabdomyosarcomas: comparison of fetal type acetylcholine receptor subunits and myogenin.

    PubMed

    Gattenlöhner, S; Müller-Hermelink, H K; Marx, A

    1998-06-01

    The diagnosis of rhabdomyosarcoma (RMS) is usually straight-forward when light microscopy and immunohistochemistry are used. However, tumors that exhibit a low degree of differentiation and small biopsies can lead to confusion. In such patients and for the detection of minimal (residual) disease, a polymerase chain reaction (PCR)-based approach would be a valuable diagnostic adjunct. This type of approach would be highly sensitive and should be free from the risk for contamination of the tumor sample with normal tissue. Because myogenin and the alpha and gamma subunit of the fetal type acetylcholine receptor (AChR) are specific immunohistochemical markers for RMS, their expression on the mRNA level in RMS, other childhood and adult tumors, and normal tissues was studied. Although the sensitivity of both approaches was 100% in embryonal and alveolar RMS, detection of myogenin mRNA was not specific for RMS but occurred in normal muscle and the majority of the other normal tissues and childhood tumors. Conversely, detection of fetal AChR mRNA as defined by an alpha/tau ratio of < 1 was encountered only in RMS and denervated muscle. The authors conclude that mRNA of the fetal type AChR but not myogenin is a highly specific and sensitive target for the PCR-based diagnosis of RMS. PMID:9836066

  15. A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells

    PubMed Central

    Soejima, Takashi; Xiao, Jin-zhong; Abe, Fumiaki

    2016-01-01

    Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 100 cfu/ml for the test sample compared with a detection limit of 1.6 × 103 cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research. PMID:27334801

  16. Capillary-based fully integrated and automated system for nanoliter polymerase chain reaction analysis directly from cheek cells.

    PubMed

    He, Y; Zhang, Y H; Yeung, E S

    2001-07-27

    A miniaturized, integrated and automated system based on capillary fluidics has been developed for nanoliter DNA analysis directly from cheek cells. All steps for DNA analysis, including injecting aqueous reagents and DNA samples, mixing the solutions together, thermal cell lysis, polymerase chain reaction (PCR), transfer and injection of PCR product, separation, sizing and detection of those products are performed in a capillary-based integrated system. A small amount of cheek cells collected by a plastic toothpick is directly dissolved in the PCR cocktail in a plastic vial or mixed on-line with a small volume of PCR cocktail (125 nl) in the capillary. After thermal cell lysis and PCR in a microthermal cycler, the DNA fragments are mixed with DNA size standards and transferred to a micro-cross for injection and separation by capillary gel electrophoresis. Programmable syringe pumps, switching valves, multiposition and freeze-thaw valves are used for microfluidic control in the entire system. This work establishes the feasibility of performing all the steps of DNA analysis from real samples in a capillary-based nanoliter integrated system. PMID:11521874

  17. Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius.

    PubMed

    Mamidala, Praveen; Rajarapu, Swapna P; Jones, Susan C; Mittapalli, Omprakash

    2011-07-01

    Quantitative real-time polymerase chain reaction (qRT-PCR) has emerged as robust methodology for gene expression studies, but reference genes are crucial for accurate normalization. Commonly used reference genes are housekeeping genes that are thought to be nonregulated; however, their expression can be unstable across different experimental conditions. We report the identification and validation of suitable reference genes in the bed bug, Cimex lectularius, by using qRT-PCR. The expression stability of eight reference genes in different tissues (abdominal cuticle, midgut, Malpighian tubules, and ovary) and developmental stages (early instar nymphs, late instar nymphs, and adults) of pesticide-susceptible and pesticide-exposed C. lectularius were analyzed using geNorm, NormFinder, and BestKeeper. Overall expression analysis of the eight reference genes revealed significant variation among samples, indicating the necessity of validating suitable reference genes for accurate quantification of mRNA transcripts. Ribosomal protein (RPL18) exhibited the most stable gene expression across all the tissue and developmental-stage samples; a-tubulin revealed the least stability across all of the samples examined. Thus, we recommend RPL18 as a suitable reference gene for normalization in gene expression studies of C. lectularius. PMID:21845960

  18. Molecular typing of Paenibacillus larvae strains isolated from Bulgarian apiaries based on repetitive element polymerase chain reaction (Rep-PCR).

    PubMed

    Rusenova, Nikolina; Parvanov, Parvan; Stanilova, Spaska

    2013-06-01

    The aim of the present study was to perform molecular typing of Paenibacillus larvae (P. larvae) isolates from Bulgarian apiaries with repetitive element polymerase chain reaction (rep-PCR) using BOX A1R, MBO REP1, and ERIC primers. A total of 96 isolates collected from brood combs with clinical symptoms of American foulbrood originating from apiaries located in different geographical regions of Bulgaria, a reference strain P. larvae NBIMCC 8478 and 30 commercial honey samples with Bulgarian origin were included in the study. Rep-PCR fingerprinting analysis revealed two genotypes ab and AB of P. larvae isolates from brood combs and honey samples. A combination of genotypes ab/AB was detected in one apiary and honey sample. The prevailing genotype ab was found in 78.1 % of brood combs isolates as well as in the reference strain whereas genotype AB was determined in 21.9 % of isolates. The examination of honey samples confirmed the preponderance of ab genotype which was demonstrated in 20 of 30 samples analyzed. In conclusion, the genetic epidemiology of P. larvae revealed two genotypes--ab and AB for Bulgarian strains. Developed protocols for molecular typing of P. larvae are reliable and may be used to trace the source of infection. PMID:23361165

  19. Confirmation of Borrelia burgdorferi spirochetes by polymerase chain reaction in placentas of women with reactive serology for Lyme antibodies.

    PubMed

    Figueroa, R; Bracero, L A; Aguero-Rosenfeld, M; Beneck, D; Coleman, J; Schwartz, I

    1996-01-01

    The purpose of our study was to determine whether Borrelia burgdorferi spirochetes were present in placentas of asymptomatic women with reactive Lyme serology using a silver stain, and to confirm the identity of the spirochetes by polymerase chain reaction (PCR). Sixty placentas of asymptomatic women with ELISA-positive or-equivocal serology for Lyme antibodies during pregnancy were examined for spirochetes using a silver stain. The results of the ELISA serology were confirmed by Western blot analysis. PCR amplification for B. burgdorferi was performed on placentas identified to have spirochetes and on a group of placentas negative for spirochetes. Spirochetes were identified by silver staining in 3 (5%) of the 60 placentas. PCR confirmed B. burgdorferi nucleotide sequences in 2 of the placentas. The 5 women had equivocal Lyme ELISA and negative syphilis serology. The results of the Western blot analysis were negative in 2 cases and indeterminate in 1 case. Six controls were negative for spirochetes by silver staining and PCR. A normal perinatal outcome was observed in all cases. Spirochetes identified in placental tissue of pregnancies with reactive Lyme serology were confirmed by PCR to be B. burgdorferi. There was no relationship between the presence of placental spirochetes and the results of Lyme serology or the pregnancy outcome. PMID:8793493

  20. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism.

    PubMed

    Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

    2014-07-01

    A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin. PMID:24936911

  1. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  2. Comparative field analyses of rapid analyte measurement platform and reverse transcriptase polymerase chain reaction assays for West Nile virus surveillance.

    PubMed

    Williges, Eric; Farajollahi, Ary; Nelder, Mark P; Gaugler, Randy

    2009-12-01

    Rapid detection of West Nile virus (WNV) in mosquito pools is essential for predicting epizootics and epidemics. We compare the efficiency and sensitivity of the Rapid Analyte Measurement Platform (RAMP) to reverse transcriptase polymerase chain reaction (RT-PCR) from 2005 to 2008 from field mosquito populations in Mercer County, NJ. Overall, 316 pools tested negative and 115 pools tested positive for WNV. Eighty-nine pools tested positive using RAMP and all were confirmed by RT-PCR; 26 pools were WNV-negative using RAMP but positive using RT-PCR. False-positives from RAMP were not detected in our four-year study, indicating that RAMP is a reliable tool when used to augment existing RT-PCR-based WNV surveillance programs. Local mosquito control programs using RAMP will benefit from its ease of use, quick results, and lack of false positives but should understand the sensitivity of this test when compared to RT-PCR. Used with standard methods, RAMP will enhance existing mosquito control and WNV surveillance by providing rapid results and improved mosquito management decisions. PMID:20836836

  3. Randomly amplified polymorphic DNA-polymerase chain reaction analysis of two different populations of cultured Korean catfish Silurus asotus.

    PubMed

    Yoon, J M; Kim, G W

    2001-12-01

    Genetic similarity and diversity of cultured catfish Silurus asotus populations collected from two areas in western Korea were examined using randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR). Out of 20 random primers tested, 5 produced 1344 RAPD bands ranging from 8.2 to 13.6 polymorphic bands per primer. The polymorphic bands in these populations ranged from 56.4% to 59.6%. Polymorphic bands per lane within populations ranged from 4.9% to 5.3%. The similarity within the Kunsan population varied from 0.39 to 0.82 with a mean (+/- SD) of 0.56 +/- 0.08. The level of bandsharing values was 0.59 +/- 0.07 within the catfish population from Yesan. The genetic similarity in cultured catfish populations may have been caused because individuals from two populations were reared in the same environmental conditions or by inbreeding during several generations. However, in view of bandsharing values, polymorphic bands and also the specific major bands that were inter-population-specific, significant genetic differentiation between these populations were present even if bandsharing (BS) values were somewhat numerically different. Therefore, the number of RAPD polymorphisms identified in this study may be sufficient to permit estimating genetic similarity and diversity. However, in future, additional populations, sampling sites and individuals will be necessary to make up for these weak points. PMID:11807294

  4. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    PubMed Central

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.

    2016-01-01

    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  5. Evaluation of four DNA extraction methods for the detection of Tritrichomonas foetus in feline stool specimens by polymerase chain reaction.

    PubMed

    Stauffer, Stephen H; Birkenheuer, Adam J; Levy, Michael G; Marr, Henry; Gookin, Jody L

    2008-09-01

    Feces are increasingly valued as practical samples for molecular diagnosis of infectious disease. However, extraction of polymerase chain reaction (PCR) quality DNA from fecal samples can be challenging because of coextraction of PCR inhibitors. Because the type and quantity of PCR inhibitors is influenced by diet, endogenous flora, and concurrent disease, it is unlikely that extraction method performance with human feces can be directly extrapolated to that of domestic cats. In the present study, 4 commercially available DNA extraction methods were examined for their influence on the sensitivity of PCR for the detection of Tritrichomonas foetus in feline stool. DNA was extracted from serially diluted feline-origin T. foetus trophozoites in the absence or presence of feline feces. The ZR Fecal DNA kit was identified as affording the greatest analytical sensitivity and reproducibility and was able to detect >or=10 T. foetus organisms per 100 mg feces in 100% of PCR reactions. Further, the identified extraction method could be completed in the shortest time of all kits tested. PMID:18776100

  6. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.

    PubMed

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A

    2004-12-15

    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  7. Rapid detection of Newcastle disease virus replication in embryonated chicken eggs using quantitative real time polymerase chain reaction.

    PubMed

    Gopinath, V P; Raj, Gopal Dhinakar; Raja, A; Kumanan, K; Elankumaran, Subbiah

    2011-01-01

    Newcastle disease virus (NDV), an avian paramyxovirus, is an economically important disease of poultry globally. Rapid methods to detect and differentiate the virus are important to curtail the spread of this virus. Nucleic acid based detection methods are routinely employed for diagnosis that suffer from the disadvantage of failure to discriminate viable virus and non-infectious genome. However, virus isolation remains the gold standard for diagnosis of field outbreaks. The sensitivity of virus isolation was combined with nucleic acid based detection methods so that the time taken for confirmatory diagnosis could be considerably reduced while increasing sensitivity. Quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) and conventional RT-PCR techniques were compared for the detection of NDV genome replication in 9-11-day-old embryonated chicken eggs (ECE) using the nucleoprotein (NP) gene of the virus as a target. The results suggest that at least two to fourfold increase in cycle threshold (C(t)) values over the baseline C(t) value of samples lacking infectious virus, would indicate live NDV replication. The limit of detection of NDV replication using qRT-PCR was 1×10(4.0) mean embryo infective doses (EID(50)). The earliest time point when live virus replication was detectable by qRT-PCR or RT-PCR was 30h post-inoculation in ECE. PMID:20951166

  8. Detection of gastrin mRNA in fresh human colonic carcinomas by reverse transcription-polymerase chain reaction.

    PubMed

    Monges, G; Biagini, P; Cantaloube, J F; Chicheportiche, C; Frances, V; Brandini, D; Parc, P; Seitz, J F; Giovannini, M; Sauvan, R

    1993-10-01

    To investigate the hypothesis that gastrin might be synthesized by tumour tissues in cancer of the colon, samples from six human colon tumours, one hepatic metastasis, four normal colonic mucosal samples and two antral and one fundic gastric mucosal samples from nine patients were analysed to determine whether gastrin mRNA was present. RNA was extracted from surgical specimens by ultracentrifugation on a CsCl cushion, purified using the guanidinium thiocyanate method, reverse-transcribed and amplified by polymerase chain reaction. Gastrin mRNA was detected in each colonic carcinoma sample (including the hepatic metastasis), while no such signal was observed in normal colon biopsies. Positive and negative controls (gastric antrum and fundus respectively) gave the expected results. In each of the positive samples, the chemiluminescent revelation of amplified products after Southern blotting corresponded to gastrin mRNA without the intron. These findings demonstrate the ability of primary and metastatic human colonic tumours to produce gastrin mRNA. Since malignant cell lines have been reported to produce gastrin peptide, and since gastrin receptors were present in some cases, our results support the idea that gastrin may be involved in an autocrine mechanism. PMID:7507679

  9. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. PMID:26025458

  10. Factors affecting detection of PVY in dormant tubers by reverse transcription polymerase chain reaction and nucleic acid spot hybridization.

    PubMed

    Singh, M; Singh, R P

    1996-06-01

    A reverse transcription polymerase chain reaction (RT-PCR) protocol was developed using two 20-mer primers located in nuclear inclusion genes NIa and NIb of potato virus Y (PVY). A 1017 bp PCR-product was detected in dormant potato tubers, infected with PVY(O), but not in tubers from healthy plants. The PCR product was specific to PVY, as determined by Southern blot detection by hybridization with a PVY(O)-specific probe. As little as 1 pg of purified PVY(O)-RNA can be detected after RT-PCR amplification. The presence of phenolics or polysaccharides in tuber nucleic acids inhibited PVY(O) amplification, which was eliminated by diluting nucleic acid preparations prior to cDNA synthesis, modifying the nucleic acid extraction procedure by isopropanol precipitation and using phosphate-buffered saline-Tween in the cDNA mix. Potato cultivars differed in PVY(O) concentration in tubers as much as 128-fold. Tuber parts used for nucleic acid extractions were important in potato cultivars with low virus titres and did not result in reduced detection of PVY(O) by both nucleic acid spot hybridization and RT-PCR, but RT-PCR band intensity was lower at longer storage periods. The primer pair developed in this study exhibited broad specificities with field isolates from Peru, Scotland and North America. PMID:8795005

  11. Evaluation of in-house polymerase chain reaction assay sensitivity, can it be utilized in limited-resources settings?

    PubMed Central

    Dorudinia, Atosa; Shamaei, Masoud; Karimi, Shirin; Javadi, Alireza; Mohammadi Ziazi, Leila; Pourabdollah, Mihan

    2014-01-01

    Background: Polymerase chain reaction (PCR) assay has widely used for the detection of tuberculosis (TB). This study tried to compare in-house PCR with some well-known commercial PCR kits for detection of TB agent. Methods: Clinical samples obtained from 620 TB suspected patients were analyzed for the diagnosis of Mycobacterium tuberculosis complex (MTC) by in-house PCR. All samples were obtained through pulmonary specimens consisted of 384 sputum, 148 bronchial aspirates and 88 pleural effusions. Results: Considering culture as a golden criterion, in which its diagnostic sensitivity and specificity of PCR assay were 87.7% and 85.6%, respectively. The findings of this study also indicate 22.1% (137/620) of the specimens were detected as MTC by PCR. Both PCR and culture confirmed presence of MTC in 57 of the samples. In comparison to culture, the diagnostic sensitivity of PCR for sputum was 87.5% (42/48), bronchial aspirates 100% (12/12), and 60% (3/5) for pleural effusions. The sensitivity of in-house PCR method is comparable with the sensitivity of Amplicor and Cobas TaqMan for MTC. Conclusion: The study illustrates the in-house PCR assay for detection of MTC has high sensitivity and specificity versus approved commercial kits. This could be reliable test in the diagnosis of MTC in resource-limited countries. PMID:25679005

  12. A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

    PubMed

    Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-01-01

    Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research. PMID:27334801

  13. Clinical evaluation of salivary periodontal pathogen levels by real-time polymerase chain reaction in patients before dental implant treatment

    PubMed Central

    Ito, Taichi; Yasuda, Masaaki; Kaneko, Hajime; Sasaki, Hodaka; Kato, Tetsuo; Yajima, Yasutomo

    2014-01-01

    Objective Periodontal pathogens in dental plaque are the main causative agents of periodontitis and peri-implantitis. Detection of the presence of such periodontal pathogens early would serve as a useful tool in the diagnosis and treatment of this disease. Therefore, the purpose of this study was to investigate whether the periodontal pathogen levels in saliva were correlated with the periodontal status of patients receiving implant treatment. Materials and Methods A total of 291 patients visiting Tokyo Dental College Chiba Hospital were divided into four groups: a no-periodontitis (np) group, a mild-periodontitis (mip) group, a moderate-periodontitis (mop) group, and a severe-periodontitis (sp) group. The levels of the following five periodontal pathogens in saliva were evaluated using real-time polymerase chain reaction: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Treponema denticola, and Prevotella intermedia. Results The levels of P. gingivalis and T. forsythia were significantly higher in mop group than in np group (P <  0.05). The levels of all periodontal pathogens tested except A. actinomycetemcomitans were significantly higher in sp group than in np group (P <  0.05). Conclusion The detection levels of the periodontal pathogens targeted in saliva samples were correlated with the periodontal status. This suggests that using saliva to screen for periodontopathic bacteria offers an easier-to-use clinical tool than the paper point method in the diagnosis and treatment of periodontitis and peri-implantitis. PMID:23745964

  14. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

    2014-01-01

    A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin. PMID:24936911

  15. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    PubMed Central

    Muhammad, T. M. Nabeel; Sreedevi, B.

    2015-01-01

    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7%) for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9%) and 9 nasal swabs (40.9%) out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination. PMID:27047005

  16. Investigation on natural diets of larval marine animals using peptide nucleic acid-directed polymerase chain reaction clamping.

    PubMed

    Chow, Seinen; Suzuki, Sayaka; Matsunaga, Tadashi; Lavery, Shane; Jeffs, Andrew; Takeyama, Haruko

    2011-04-01

    The stomach contents of the larvae of marine animals are usually very small in quantity and amorphous, especially in invertebrates, making morphological methods of identification very difficult. Nucleotide sequence analysis using polymerase chain reaction (PCR) is a likely approach, but the large quantity of larval (host) DNA present may mask subtle signals from the prey genome. We have adopted peptide nucleic acid (PNA)-directed PCR clamping to selectively inhibit amplification of host DNA for this purpose. The Japanese spiny lobster (Panulirus japonicus) and eel (Anguilla japonica) were used as model host and prey organisms, respectively. A lobster-specific PNA oligomer (20 bases) was designed to anneal to the sequence at the junction of the 18 S rDNA gene and the internal transcribed spacer 1 (ITS1) of the lobster. PCR using eukaryote universal primers for amplifying the ITS1 region used in conjunction with the lobster-specific PNA on a mixed DNA template of lobster and eel demonstrated successful inhibition of lobster ITS1 amplification while allowing efficient amplification of eel ITS1. This method was then applied to wild-caught lobster larvae of P. japonicus and P. longipes bispinosus collected around Ryukyu Archipelago, Japan. ITS1 sequences of a wide variety of animals (Ctenophora, Cnidaria, Crustacea, Teleostei, Mollusca, and Chaetognatha) were detected. PMID:20535520

  17. Molecular Epidemiology of Leptospirosis in Northern Iran by Nested Polymerase Chain Reaction/Restriction Fragment Length Polymorphism and Sequencing Methods

    PubMed Central

    Zakeri, Sedigheh; Sepahian, Neda; Afsharpad, Mandana; Esfandiari, Behzad; Ziapour, Peyman; Djadid, Navid D.

    2010-01-01

    This study was conducted to investigate the prevalence of Leptospira species in Mazandaran Province of Iran by using nested polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP) methods and sequencing analysis. Blood samples (n = 119) were collected from humans suspected of having leptospirosis from different parts of the province in 2007. By using an indirect immunofluorescent antibody test (IFAT), we determined that 35 (29.4%) of 119 suspected cases had leptospiral antibody titers ≥ 1:80, which confirmed the diagnosis of leptospirosis. Nested PCR assay also determined that 60 (50.4%) of 119 samples showed Leptospira infection. Furthermore, 44 (73.3%) of 60 confirmed leptospirosis amplified products were subjected to sequencing analysis. Sequence alignment identified L. interrogans, L. kirschneri, and L. wolffii species. All positive cases diagnosed by IFAT or PCR were in patients who reported contact with animals, high-risk occupational activities, and exposure to contaminated water. Therefore, it is important to increase attention about this disease among physicians and to strengthen laboratory capacity for its diagnosis in infected patients in Iran. PMID:20439973

  18. Detection of HTLV-1 by polymerase chain reaction in situ hybridization in adult T-cell leukemia/lymphoma.

    PubMed

    Setoyama, M; Kerdel, F A; Elgart, G; Kanzaki, T; Byrnes, J J

    1998-03-01

    A method for nonradioactive polymerase chain reaction in situ hybridization was developed and used to determine the distribution of human T-lymphotropic virus type I (HTLV-I) proviral DNA in paraffin-embedded surgical specimens of adult T-cell leukemia/lymphoma (ATLL). As controls, we used biopsy samples of five cases of mycosis fungoides, cells of an HTLV-I-infected cell line (MT2), as well as HTLV-1-negative cells (YAS). We successfully detected the amplicon of the HTLV-1 tax sequence in the nuclei of the cutaneous infiltrating lymphoid cells in 90% (9/10) of ATLL cases. Studies also revealed the existence of HTLV-1 provirus DNA in nuclei of sweat gland epithelial cells and vascular endothelial cells as well as lymphoid cells in ATLL patients. Mycosis fungoides and YAS cells were negative for the HTLV-I tax sequence, but MT2 cells were strongly positive. The results indicated that this technique was more sensitive in detecting intracellular amplicons than was the previous in situ hybridization method. Through its use, we were able to easily determine the distribution of HTLV-I-positive cells among the various cells and tissues of paraffin-embedded archival materials. PMID:9502410

  19. Coccidial infections in commercial broilers: epidemiological aspects and comparison of Eimeria species identification by morphometric and polymerase chain reaction techniques.

    PubMed

    Haug, Anita; Gjevre, Anne-Gerd; Thebo, Per; Mattsson, Jens G; Kaldhusdal, Magne

    2008-04-01

    The objective of this study was to add to existing knowledge of the epidemiology and the aetiology of coccidial infections in commercial broiler flocks. Polymerase chain reaction (PCR) and morphometric identification of the Eimeria species were compared as means of differentiation in the field samples of faeces and litter. For morphometry, the Eimeria species were categorized into three groups based on lengths of the oocysts. Two random samples of commercial broilers were studied, one during 2000/01 and the other during 2003/04. The prophylactic regime (in-feed narasin), husbandry and methods applied were broadly the same for both subpopulations. Coccidial infection prevalence increased from approximately 45% to approximately 75% during this period, but infection levels (oocysts per gram of faeces) did not significantly change. There were substantial geographical differences in both prevalence and infection levels. A change in Eimeria species profile occurred during the study period. Five Eimeria species were identified at slaughter, by PCR targeting the ITS-1 region of the genome; Eimeria acervulina (100%), Eimeria tenella (77%), Eimeria maxima (25%), Eimeria praecox (10%) and Eimeria necatrix (2%). PCR and morphometric tentative identification were in complete agreement in only 49% of the cases. PMID:18393094

  20. A polymerase chain reaction-based method for constructing a linear vector with site-specific DNA methylation.

    PubMed

    Arakawa, Toshiya; Ohta, Tohru; Abiko, Yoshihiro; Okayama, Miki; Mizoguchi, Itaru; Takuma, Taishin

    2011-09-15

    DNA methylation is an important epigenetic modification that leads to a wide variety of biological functions, including transcription, growth and development, and diseases associated with altered gene expression such as cancers. However, tools to insert site-specific methylation into DNA for analyzing epigenetic functions are limited. Here we describe a novel polymerase chain reaction (PCR)-based approach to provide site-specific DNA methylation at any site, including CpG or CpNpG islands. This method is simple and versatile, and it consists of four steps to construct the DNA methylation vector: (I) design and synthesis of methylated primers, (II) PCR amplification, (III) isolation of single-stranded DNA, and (IV) annealing and ligation of isolated single-stranded DNAs. First we produced and validated a linear green fluorescence protein (GFP) vector by this method. Next we applied this method to introduce methyl groups into the promoter of the cyclooxygenase-2 (COX-2) gene and found that site-specific DNA methylation at the CRE element significantly altered COX-2 gene expression. These results demonstrate that this PCR-based approach is useful for the analysis of biological functions that depend on DNA methylation. PMID:21669180

  1. An improved polymerase chain reaction-restriction fragment length polymorphism assay for the detection of a PON2 gene polymorphism

    PubMed Central

    DUAN, XIAORAN; YANG, YONGLI; WANG, TUANWEI; FENG, XIAOLEI; YAO, WU; YAN, ZHEN; WANG, WEI

    2016-01-01

    In recent research, it has been shown that there have been variants of rs12026 within the paraoxonase 2 (PON2) gene, which have been associated with cardiovascular disease, cerebrovascular disease, diabetes and other diseases. The isochizomers, such as the BsoFI enzyme, required for the detection of this polymorphism are expensive. Therefore, an improved and less expensive polymerase chain reaction (PCR)-restriction fragment length polymorphism method was established for the detection of the single-nucleotide polymorphism rs12026 in the exon 5 of chromosome 7 of the human PON2 gene using the method of amplification-created restriction site. Subsequent to assessing 302 individuals, the genotype frequencies were 68.9% for CC, 29.8% for CG and 1.3% for GG, and the allelic frequencies were 83.8% for C and 16.2% for G. The PCR results were confirmed by DNA sequencing. The χ2 test showed that the genotype and allele frequencies of PON2-148 do not deviate from Hardy-Weinberg equilibrium, and the sequences of amplified products were consistent with the sequence published in GenBank with the exception of a mismatched base. PMID:27330753

  2. Evaluation of Virulence Gene Expression Patterns in Acinetobacter baumannii Using Quantitative Real-Time Polymerase Chain Reaction Array.

    PubMed

    Lannan, Ford M; O'conor, Daniel K; Broderick, Joseph C; Tate, Jamison F; Scoggin, Jacob T; Moran, Nicholas A; Husson, Christopher M; Hegeman, Erik M; Ogrydziak, Cole E; Singh, Sneha A; Vafides, Andrew G; Brinkley, Carl C; Goodin, Jeremy L

    2016-09-01

    According to the Centers for Disease Control's recently devised National Strategy for Combating Antibiotic-Resistant Bacteria, Acinetobacter baumannii is a "serious" threat level pathogen. A. baumannii's notoriety stems from the fact that a large number of modern strains are multidrug resistant and persist in the hospital setting, thus causing numerous deaths per year. It is imperative that research focus on a more fundamental understanding of the factors responsible for the success of A. baumannii. Toward this end, our group investigated virulence gene expression patterns in a recently characterized wound isolate, AB5075, using quantitative real-time polymerase chain reaction array. Notably, several genes showed statistically significant upregulation at 37°C compared to 25°C; MviM, Wbbj, CarO, and certain genes of the Bas, Bar, and Csu operons. Additionally, we found that in vitro biofilm formation by Csu transposon insertion mutant strains is attenuated. These findings validate previous reports that suggest a link between the Csu operon and biofilm formation. More importantly, our results demonstrate a successful method for evaluating the significance of previously identified virulence factors in a modern and clinically relevant strain of A. baumannii, thereby providing a path toward a more fundamental understanding of the pathogenicity of A. baumannii. PMID:27612361

  3. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  4. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  5. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    PubMed Central

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-01-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection. PMID:25424447

  6. Error propagation in relative real-time reverse transcription polymerase chain reaction quantification models: the balance between accuracy and precision.

    PubMed

    Nordgård, Oddmund; Kvaløy, Jan Terje; Farmen, Ragne Kristin; Heikkilä, Reino

    2006-09-15

    Real-time reverse transcription polymerase chain reaction (RT-PCR) has gained wide popularity as a sensitive and reliable technique for mRNA quantification. The development of new mathematical models for such quantifications has generally paid little attention to the aspect of error propagation. In this study we evaluate, both theoretically and experimentally, several recent models for relative real-time RT-PCR quantification of mRNA with respect to random error accumulation. We present error propagation expressions for the most common quantification models and discuss the influence of the various components on the total random error. Normalization against a calibrator sample to improve comparability between different runs is shown to increase the overall random error in our system. On the other hand, normalization against multiple reference genes, introduced to improve accuracy, does not increase error propagation compared to normalization against a single reference gene. Finally, we present evidence that sample-specific amplification efficiencies determined from individual amplification curves primarily increase the random error of real-time RT-PCR quantifications and should be avoided. Our data emphasize that the gain of accuracy associated with new quantification models should be validated against the corresponding loss of precision. PMID:16899212

  7. Detection of Mycobacterium tuberculosis in clinical specimens by polymerase chain reaction and Gen-Probe Amplified Mycobacterium Tuberculosis Direct Test.

    PubMed Central

    Abe, C; Hirano, K; Wada, M; Kazumi, Y; Takahashi, M; Fukasawa, Y; Yoshimura, T; Miyagi, C; Goto, S

    1993-01-01

    The polymerase chain reaction (PCR) using oligonucleotides based on the repetitive sequence (IS986) of Mycobacterium tuberculosis as a primer and the Gen-Probe Amplified Mycobacterium Tuberculosis Direct Test (MTD), which combines an M. tuberculosis rRNA amplification method with the hybridization protection assay format, were evaluated for detection of M. tuberculosis in clinical samples. The detection limits of these two assay systems based on nucleic acid amplification for cultured M. tuberculosis were less than 10 cells per reaction. A total of 135 sputum specimens were examined by the two assay systems. The PCR and the MTD systems for detection of M. tuberculosis gave overall positivity rates of 84.2% (32 of 38) and 91.9% (34 of 37), respectively, as compared with 71.9% (23 of 32) by smear and 96.9% (31 of 32) by culture in the liquid medium MB-Check. Procedures for sample preparation used in the two methods were different. Although the sensitivities of the PCR and MTD appeared to be similar to that of culture with the MB-Check system, the two methods based on nucleic acid amplification should be very useful for rapid detection of M. tuberculosis infections without the long time required for culture of M. tuberculosis. Images PMID:8308121

  8. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus.

    PubMed

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H

    2011-06-01

    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos. PMID:21711182

  9. Detection of Avian bornavirus in multiple tissues of infected psittacine birds using real-time reverse transcription polymerase chain reaction.

    PubMed

    Delnatte, Pauline; Mak, Matthew; Ojkic, Davor; Raghav, Raj; DeLay, Josepha; Smith, Dale A

    2014-03-01

    Avian bornavirus (ABV), the cause of proventricular dilation disease in psittacine birds, has been detected in multiple tissues of infected birds using immunohistochemical staining (IHC) and reverse transcription polymerase chain reaction (RT-PCR). In the current study, real-time RT-PCR, using primers targeting the ABV matrix gene, was used to detect ABV in 146 tissues from 7 ABV-infected psittacine birds. Eighty-six percent of the samples tested positive, with crossing point values ranging from 13.82 to 37.82 and a mean of 22.3. These results were compared to the findings of a previous study using gel-based RT-PCR and IHC on the same samples. The agreement between the 2 RT-PCR techniques was 91%; when tests disagreed it was because samples were negative using gel-based RT-PCR but positive on real-time RT-PCR. Agreement with IHC was 77%; 16 out of 74 samples were negative using IHC but positive on real-time RT-PCR. The results suggest that real-time RT-PCR is a more sensitive technique than gel-based RT-PCR and IHC to detect ABV in tissues. The tissues that were ranked most frequently as having a high amount of viral RNA were proventriculus, kidney, colon, cerebrum, and cerebellum. Skeletal muscle, on the other hand, was found to have a consistently low amount of viral RNA. PMID:24518276

  10. Vaccination with polymerase chain reaction-generated linear expression cassettes protects mice against lethal influenza A challenge.

    PubMed

    Vilalta, Adrián; Jimenez, Gretchen; Rusalov, Denis; Planchon, Rodrick; Lalor, Peggy; Carner, Kristin; Chaplin, Jennifer A; Komai, Michael; Manthorpe, Marston; Kaslow, David C; Rolland, Alain

    2007-08-01

    The feasibility of a linear expression cassette (LEC)-based influenza A DNA vaccine was demonstrated in mice, using a lethal dose (LD90) of a mouse-adapted A/Hong Kong/8/68 (H3N2) influenza strain. LECs expressing hemagglutinin (HA) from either the homotypic H3N2 or the heterotypic H1N1 (A/Puerto Rico/8/34) influenza virus were produced by polymerase chain reaction and either phosphodiester- or phosphorothioate-modified oligonucleotide primers. Survival subsequent to lethal viral challenge was used as a primary end point; weight loss was the secondary end point. Survival and weight loss data showed that protection can be achieved in mice with 50 microg of phosphate-buffered saline-formulated LEC DNA or 2 microg of Vaxfectin-formulated LEC DNA. Survival correlated with neutralizing antibody titers (hemagglutination inhibition, HAI); titers obtained after vaccination with LEC were equivalent to those obtained with HA (H3N2) plasmid DNA control. Vaccination with heterotypic H1 HA-LEC DNA provided no protection against viral challenge. PMID:17705698

  11. Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

    PubMed

    Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

    2001-01-01

    A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of <5% (w/w) guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%. PMID:11234856

  12. Antimicrobial efficacy of different root canal sealers by using real-time polymerase chain reaction: An ex vivo study

    PubMed Central

    Seelan, R Gnana; Kumar, A Arvind; Emil Sam, R Jonathan; Maheswari, S Uma

    2015-01-01

    Background: Root canal sealers help to minimize leakage, provides antimicrobial activity to reduce the possibility of residual bacteria, and to resolve periapical lesion. Aim: To compare five different root canal sealers against Enterococcus faecalis in an infected root canal model by using real-time polymerase chain reaction (RT-PCR). Settings and Design: Sixty human mandibular premolars were sectioned to standardize a uniform length of 14 mm. Fifty microliters of the inoculum containing E. faecalis were transferred into each microcentrifuge tube (n = 60). The samples were divided into six groups Tubli-Seal, Apexit Plus, Fillapex, AH Plus, RoekoSeal, and Positive control, respectively. Materials and Methods: Five groups after the incubation with the microorganism E. faecalis were coated with different root canal sealers and obturated using F3 ProTaper Gutta-percha point. The dentinal shavings were collected and analyzed for RT-PCR. Statistical Analysis: The mean difference between six groups was calculated using analysis of variance and post-hoc test. Results: The highest antibacterial activity was achieved with Tubli-Seal (1938.13 DNA in pictogram [pg]) and least by RoekoSeal (3034.54 DNA in pg). Conclusion: The maximum antimicrobial activity was achieved AH Plus and Tubli-Seal. RT-PCR can be used as a valuable and accurate tool for testing antimicrobial activity. PMID:26752843

  13. Molecular characterization of Trichinella genotypes by inter-simple sequence repeat polymerase chain reaction (ISSR-PCR).

    PubMed

    Fonseca-Salamanca, F; Nogal-Ruiz, J J; Benito, C; Camachot, M V; Martínez-Fernández, A R

    2006-06-01

    A bulk analysis of inter-simple sequence repeat-polymerase chain reaction (ISSR-PCR) provides a quick, reliable, and highly informative system for DNA banding patterns that permit species identification. The present study evaluates the applicability of this system to Trichinella species identification. After a single amplification carried out on a single larva with the primer 816([CA]nRY) under high stringency conditions, which provide high reproducibility, we were able to identify by consistent banding patterns 5 sibling species: Trichinella spiralis (ISS48), 2 Trichinella britovi isolates (ISS11 and ISS86), Trichinella murrelli (ISS35), Trichinella nativa (ISS71), Trichinella nelsoni (ISS29); 3 additional Trichinella genotypes: T8 (ISS149), T9 (ISS408 and ISS409), and T6 (ISS34); and the nonencapsulated species Trichinella pseudospiralis (ISS13). Moreover, 33 new Trichinella isolates from 2 zoogeographical regions were unequivocally identified. All Trichinella isolates have shown an identical pattern with those produced by the reference strain. According to these data, we have demonstrated that ISSR-PCR is a robust technique that emerges as a useful new application for the molecular identification of Trichinella isolates in epidemiological studies. PMID:16884006

  14. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method. PMID:25429503

  15. Nasal Methicillin-Resistant Staphylococcus aureus Polymerase Chain Reaction: A Potential Use in Guiding Antibiotic Therapy for Pneumonia

    PubMed Central

    Johnson, Jennifer A; Wright, Michael E; Sheperd, Lyndsay A; Musher, Daniel M; Dang, Bich N

    2015-01-01

    Context: The role at admission of nasal polymerase chain reaction (PCR) for patients with methicillin-resistant Staphylococcus aureus (MRSA) in guiding antibiotic therapy for lower respiratory tract infection is unknown. Objective: To determine whether nasal MRSA PCR at admission can predict the absence of MRSA in lower respiratory tract secretions. Design: We performed a retrospective study of adult patients admitted to a large urban hospital. Patients had a nasal MRSA PCR test and a lower respiratory tract culture obtained within 48 hours of admission and the culture yielded S aureus. Main outcome measures: Sensitivity, specificity, and positive and negative predictive values. Results: Our results showed high sensitivity (93.3%) and negative predictive value (95.2%) of nasal PCR for MRSA in the lower respiratory tract. Conclusion: With its high sensitivity and negative predictive value, a nasal MRSA PCR test performed within 48 hours of hospital admission could help guide the discontinuation of MRSA-directed empiric antibiotic therapy in patients who are unlikely to be infected with this organism. A prospective study is needed to confirm these findings. PMID:25432002

  16. Assessment of Clinical Diagnosis, Microscopy, Rapid Diagnostic Tests, and Polymerase Chain Reaction in the Diagnosis of Plasmodium falciparum in Nigeria

    PubMed Central

    Ojurongbe, Olusola; Adegbosin, Olunike Olayeni; Taiwo, Sunday Samuel; Alli, Oyebode Armstrong Terry; Olowe, Olugbenga Adekunle; Ojurongbe, Taiwo Adetola; Bolaji, Oloyede Samuel; Adeyeba, Oluwaseyi Adegboyega

    2013-01-01

    This study compares the performance of clinical diagnosis and three laboratory diagnostic methods (thick film microscopy (TFM), rapid diagnostic test (RDT), and polymerase chain reaction (PCR)) for the diagnosis of Plasmodium falciparum in Nigeria. Using clinical criteria, 217 children were recruited into the study out of which 106 (48.8%) were positive by TFM, 84 (38.7%) by RDT, and 125 (57.6%) by PCR. Using a composite reference method generated from the three diagnostic methods, 71 (32.7%) patients were found to be truly infected and 90 (41.5%) truly uninfected, while 56 (25.8%) were misidentified as infected or noninfected. When each of the 3 diagnostic methods was compared with the composite reference, PCR had sensitivity of 97.3%, specificity of 62.5%, positive predictive value (PPV) of 56.8%, and negative predictive value (NPV) of 97.8%; microscopy had sensitivity of 77.2%, specificity of 72%, PPV of 66.9%, and NPV of 81.1%, while RDT had sensitivity of 62.3%, specificity of 87.4%, PPV of 67.7%, and NPV of 84.5%. PCR test performed best among the three methods followed by TFM and RDT in that order. The result of this study shows that clinical diagnosis cannot be relied upon for accurate diagnosis of P. falciparum in endemic areas. PMID:24371538

  17. Use of the polymerase chain reaction to investigate the dynamics of pyrethroid resistance in Haematobia irritans irritans (Diptera: Muscidae).

    PubMed

    Guerrero, Felix D; Alison, M W; Kammlah, Diane M; Foil, Lane D

    2002-09-01

    A field study was conducted from 1991 through 1997 to evaluate the use of pyrethroid and organophosphate (OP) ear tags, alternated yearly, for the control of a pyrethroid resistant horn fly, Haematobia irritans (L.), population in Louisiana. Fly resistance was monitored by weekly fly counts, filter paper bioassays and diagnostic polymerase chain reaction (PCR) assays for the presence of pyrethroid resistance-associated mutations in the sodium channel gene coding region. Fly control in the first study year was poor, as pyrethroid ear tags were effective for only 7 wk. The following year, OP ear tags provided 15 wk of fly control. However, in all subsequent years, fly control was poor with both types of ear tags. The PCR assays showed that there were very few female flies homozygous for the pyrethroid susceptible sodium channel allele, never rising above 10% of the total females in the population. A fitness cost appeared to be associated with the pyrethroid resistant allele, as the resistant form was selected against in the absence of the pyrethroid ear tags. Despite this selection in favor of the susceptible allele and the annual alternation of pyrethroid and OP ear tags, the percentage of homozygous susceptible flies never reached over 19% of the population, resistant alleles of the sodium channel remained at high levels in the population, and horn fly control on cattle with either type of tag quickly became minimal. PMID:12349858

  18. Development of a rapid and sensitive polymerase chain reaction assay for detection of bovine herpesvirus type 1 in bovine semen.

    PubMed Central

    van Engelenburg, F A; Maes, R K; van Oirschot, J T; Rijsewijk, F A

    1993-01-01

    We developed a polymerase chain reaction (PCR) assay to detect bovine herpesvirus type 1 (BHV-1) in bovine semen. Since bovine semen contains components that inhibit PCR amplification, a protocol was developed to purify BHV-1 DNA from bovine semen. To identify failures of PCR amplification, we used an internal control template that was coamplified by the same PCR primers. When separated fractions of BHV-1-contaminated semen were analyzed by the PCR, we found that more than 90% of the BHV-1 DNA was present in a pooled fraction consisting of seminal fluid, nonsperm cells, and virus adsorbed to spermatozoa. By using this fraction, three to five molecules of BHV-1 DNA in 50 microliters of bovine semen could be detected. A pilot study to compare this PCR assay with the routinely used virus isolation method showed that this PCR assay is 2- to 100-fold more sensitive. In addition, the results of the PCR assay are available in 1 day, whereas the virus isolation method takes 7 days. Therefore, the PCR assay may be a good alternative to the virus isolation method. Images PMID:8308103

  19. Concordant clonal delineation of methicillin-resistant Staphylococcus aureus by macrorestriction analysis and polymerase chain reaction genome fingerprinting.

    PubMed Central

    Struelens, M J; Bax, R; Deplano, A; Quint, W G; Van Belkum, A

    1993-01-01

    Pulsed-field gel electrophoresis of DNA macrorestriction fragments (macrorestriction analysis) allows epidemiologic typing and delineation of genetic relatedness of methicillin-resistant Staphylococcus aureus (MRSA) by indexing variations in the global chromosome architecture. Polymerase chain reaction (PCR)-mediated genome fingerprinting can also discriminate MRSA strains by detecting locally variable DNA motifs. To assess the correlation between these methods, 48 epidemic MRSA strains collected from 20 hospitals over a 10-year period were tested in a blind comparison by (i) macrorestriction analysis with SstII or SmaI endonuclease and (ii) PCR fingerprinting with four primer sets aimed at the mecA gene, enterobacterial repetitive intergenic consensus sequences, and arbitrary sequences. Isolates were discriminated into 22 macrorestriction patterns and 15 PCR fingerprints. MRSA strains belonging to 12 distinct clones by macrorestriction analysis showed 11 distinct PCR genotypes distinguished by multiple band differences. In contrast, 34 of 37 MRSA strains found to be clonally related by macrorestriction analysis clustered in two highly related PCR genotypes that differed by a single DNA fragment (P < 0.0001). These data demonstrate concordant clonal delineation of epidemic MRSA by macrorestriction analysis and PCR fingerprinting and thereby indicate that the rapid PCR assay may be an efficient epidemiologic typing system. Images PMID:8370721

  20. Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

    PubMed

    Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

    1999-10-01

    Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time. PMID:10528725

  1. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis.

    PubMed

    Chase, Dorothy M; Elliott, Diane G; Pascho, Ronald J

    2006-07-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids. PMID:16921877

  2. Improvement in the Thermal Stability of Pyrophosphatase by Conjugation to Poly(N-isopropylacrylamide): Application to the Polymerase Chain Reaction.

    PubMed

    Cui, Yuecheng; Liu, Feng; Li, Xin; Wang, Lei; Wang, Hongwei; Chen, Gaojian; Yuan, Lin; Brash, John L; Chen, Hong

    2015-10-01

    Polymerase chain reaction (PCR) is a powerful method for nucleic acid amplification. However, the PCR is inhibited in its yield due to its byproduct, pyrophosphate (PPi), a byproduct of the reaction; the yield is thereby limited. The conventional method for hydrolysis of PPi by pyrophosphatase (PPase) is not well adapted for operation at elevated temperatures over long times as required during the PCR. In this work, we reported a strategy to improve the PCR yield using a conjugate of the enzyme with the thermally responsive polymer poly(N-isopropylacrylamide) (PNIPAM). Pyrophosphatase (PPase) was conjugated to PNIPAM site-specifically near the active center. As compared to the free enzyme, the optimum temperature of the conjugate was shown to increase from 45 to 60 °C. For the conjugate, about 77% enzyme activity was retained after incubation at 60 °C for 3 h, representing a 6.8-fold increase as compared to the unconjugated enzyme. For the PCR using the conjugate, the yield was 1.5-fold greater than using the unconjugated enzyme. As well as improving the yield of the PCR (and possibly other biological reactions) at elevated temperature, polymer conjugation may also provide a strategy to improve the heat resistance of proteins more generally. PMID:26373436

  3. Importance of housekeeping gene selection for accurate reverse transcription-quantitative polymerase chain reaction in a wound healing model.

    PubMed

    Turabelidze, Anna; Guo, Shujuan; DiPietro, Luisa A

    2010-01-01

    Studies in the field of wound healing have utilized a variety of different housekeeping genes for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. However, nearly all of these studies assume that the selected normalization gene is stably expressed throughout the course of the repair process. The purpose of our current investigation was to identify the most stable housekeeping genes for studying gene expression in mouse wound healing using RT-qPCR. To identify which housekeeping genes are optimal for studying gene expression in wound healing, we examined all articles published in Wound Repair and Regeneration that cited RT-qPCR during the period of January/February 2008 until July/August 2009. We determined that ACTβ, GAPDH, 18S, and β2M were the most frequently used housekeeping genes in human, mouse, and pig studies. We also investigated nine commonly used housekeeping genes that are not generally used in wound healing models: GUS, TBP, RPLP2, ATP5B, SDHA, UBC, CANX, CYC1, and YWHAZ. We observed that wounded and unwounded tissues have contrasting housekeeping gene expression stability. The results demonstrate that commonly used housekeeping genes must be validated as accurate normalizing genes for each individual experimental condition. PMID:20731795

  4. Real-time fluorogenic reverse transcription polymerase chain reaction assay for the specific detection of Bagaza virus.

    PubMed

    Buitrago, Dolores; Rocha, Ana; Tena-Tomás, Cristina; Vigo, Marta; Agüero, Montserrat; Jiménez-Clavero, Miguel Angel

    2012-09-01

    In September 2010, an outbreak of disease in 2 wild bird species (red-legged partridge, Alectoris rufa; ring-necked pheasant, Phasianus colchicus) occurred in southern Spain. Bagaza virus (BAGV) was identified as the etiological agent of the outbreak. BAGV had only been reported before in Western Africa (Central African Republic, Senegal) and in India. The first occurrence of BAGV in Spain stimulated a demand for rapid, reliable, and efficacious diagnostic methods to facilitate the surveillance of this disease in the field. This report describes a real-time reverse transcription polymerase chain reaction (RT-PCR) method based on a commercial 5'-Taq nuclease-3' minor groove binder DNA probe and primers targeting the Bagaza NS5 gene. The method allowed the detection of BAGV with a high sensitivity, whereas other closely related flaviviruses (Usutu virus, West Nile virus, and Japanese encephalitis virus) were not detected. The assay was evaluated using field samples of red-legged partridges dead during the outbreak (n = 11), as well as samples collected from partridges during surveillance programs (n = 81). The results were compared to those obtained with a pan-flaviviral hemi-nested RT-PCR followed by nucleotide sequencing, which was employed originally to identify the virus involved in the outbreak. The results obtained with both techniques were 100% matching, indicating that the newly developed real-time RT-PCR is a valid technique for BAGV genome detection, useful in both diagnosis and surveillance studies. PMID:22807508

  5. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    SciTech Connect

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  6. Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

    PubMed

    Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

    2015-06-01

    Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria. PMID:25913425

  7. Automation and integration of polymerase chain reaction with capillary electrophoresis for high throughput genotyping and disease diagnosis

    SciTech Connect

    Zhang, N.

    1999-02-12

    Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.

  8. A TaqMan-based real-time polymerase chain reaction for the detection of porcine parvovirus.

    PubMed

    Chen, Hong-Ying; Li, Xiao-Kang; Cui, Bao-An; Wei, Zhan-Yong; Li, Xin-Sheng; Wang, Yan-Bin; Zhao, Li; Wang, Zhen-Ya

    2009-03-01

    A real-time polymerase chain reaction (PCR) using a TaqMan probe was developed to detect porcine parvovirus (PPV). Real-time PCR was optimized to quantify PPV using a detection system (Rotor Gene 2000 detector) and a dual-labeled fluorogenic probe. The gene-specific labeled fluorogenic probe for the VP2 gene of PPV was used to detect PPV. Quantitation of PPV was accomplished by a standard curve plotting cycle threshold values (Ct) against each dilution of standard plasmids. When the specificity of the assay using specific PPV primers was evaluated by testing the PPV standard strain and other viruses, no cross-reactions were detected with non-PPV reference viruses. The detection limit of real-time PCR for PPV was 2.08log10 genome copy equivalent (gce). In this study, a real-time PCR assay was performed on 80 clinical samples and compared with a conventional PCR assay. In 48 of 80 samples, PPV DNA was detected by the conventional PCR assay. All samples positive for PPV DNA by the conventional PCR assay were also positive by the real-time PCR assay, and 12 of 32 samples that tested negative for PPV DNA by the conventional method tested positive by the real-time PCR assay. Using the real-time PCR assay, the number of samples in which PPV was detected increased by 15%. Therefore, it is considered to be a useful tool for the detection of PPV. PMID:19041671

  9. Validation of a polymerase chain reaction assay for monitoring the therapeutic efficacy of diminazene aceturate in trypanosome-infected sheep.

    PubMed

    Bengaly, Z; Kasbari, M; Desquesnes, M; Sidibé, I

    2001-03-20

    The diagnostic performance of a polymerase chain reaction assay (PCR) for monitoring the effectiveness of aceturate diminazene treatment was compared with those of an antibody-detection ELISA test and the buffy-coat technique using sheep experimentally infected with either savannah-type or forest-type Trypanosoma congolense or T. vivax. Within the period of infection, the PCR using specific savannah-type T. congolense primers showed a significant higher diagnostic sensitivity (p<0.05) than the buffy-coat technique. Both techniques gave closed results for detecting forest-type T. congolense or T. vivax infections. Following trypanocidal treatment, the PCR showed that specific product disappeared definitively 1 or 2 days later in animals in which a decrease of the antibody level and a significant improvement of the red packed cell volume were observed. The occurrence of relapse infection was detected by the PCR in one animal infected by T. vivax on day 19 post-treatment and confirmed by the persistence and increasing antibody level whereas the buffy-coat technique detected parasites 42 days later. Then, the PCR signals remained positive on several occasions while parasitaemia was detected only two times.The application of PCR combined with the antibody detection appeared to provide a useful tool as compared to the buffy-coat technique for monitoring the effectiveness of trypanocidal treatment. PMID:11230917

  10. Polymerase chain reaction (PCR) identification of rodent blood meals confirms host sharing by flea vectors of plague.

    PubMed

    Franklin, Heather A; Stapp, Paul; Cohen, Amybeth

    2010-12-01

    Elucidating feeding relationships between hosts and parasites remains a significant challenge in studies of the ecology of infectious diseases, especially those involving small or cryptic vectors. Black-tailed prairie dogs (Cynomys ludovicianus) are a species of conservation importance in the North American Great Plains whose populations are extirpated by plague, a flea-vectored, bacterial disease. Using polymerase chain reaction (PCR) assays, we determined that fleas (Oropsylla hirsuta) associated with prairie dogs feed upon northern grasshopper mice (Onychomys leucogaster), a rodent that has been implicated in the transmission and maintenance of plague in prairie-dog colonies. Our results definitively show that grasshopper mice not only share fleas with prairie dogs during plague epizootics, but also provide them with blood meals, offering a mechanism by which the pathogen, Yersinia pestis, may be transmitted between host species and maintained between epizootics. The lack of identifiable host DNA in a significant fraction of engorged Oropsylla hirsuta collected from animals (47%) and prairie-dog burrows (100%) suggests a rapid rate of digestion and feeding that may facilitate disease transmission during epizootics but also complicate efforts to detect feeding on alternative hosts. Combined with other analytical approaches, e.g., stable isotope analysis, molecular genetic techniques can provide novel insights into host-parasite feeding relationships and improve our understanding of the role of alternative hosts in the transmission and maintenance of disease. PMID:21175944

  11. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    PubMed

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  12. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies.

    PubMed Central

    Kwok, S; Kellogg, D E; McKinney, N; Spasic, D; Goda, L; Levenson, C; Sninsky, J J

    1990-01-01

    We investigated the effects of various primer-template mismatches on DNA amplification of an HIV-1 gag region by the polymerase chain reaction (PCR). Single internal mismatches had no significant effect on PCR product yield while those at the 3'-terminal base had varied effects. A:G, G:A, and C:C mismatches reduced overall PCR product yield about 100-fold, A:A mismatches about 20-fold. All other 3'-terminal mismatches were efficiently amplified, although the G:G mismatches appeared to be more sensitive to sequence context and dNTP concentrations than other mismatches. It should be noted that mismatches of T with either G, C, or T had a minimal effect on PCR product yield. Double mismatches within the last four bases of a primer-template duplex where one of the mismatches is at the 3' terminal nucleotide, in general, reduced PCR product yield dramatically. The presence of a mismatched T at the 3'-terminus, however, allowed significant amplification even when coupled with an adjacent mismatch. Furthermore, even two mismatched Ts at the 3'-terminus allowed efficient amplification. Images PMID:2179874

  13. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

  14. Molecular typing among beef isolates of Escherichia coli using consensus repetitive intergenic enterobacteria-polymerase chain reaction (ERIC-PCR)

    NASA Astrophysics Data System (ADS)

    Zoolkifli, Nurliyana Wan; Mutalib, Sahilah Abd

    2013-11-01

    Genomic DNA of Escherichia coli were characterized by enterobacterial repetitive intergenic consensus-Polymerase chain reaction (ERIC-PCR) and the presence of Shiga toxin gene-I (Stx1) and Shiga toxin gene-2 (Stx2). These isolates were originated from imported raw beef which are come from two countries namely Australia and India. The isolation of E. coli was conducted by using Eosin Methylene Blue Agar (EMBA). A total of 94 strains had been isolated from 30 samples of imported raw beefand 42 strains had been detected positively E. coli by doing biochemical tests. All strains had been tested and the results of biochemical tests showed that 3 strains were from Australia samples while the other 39 strains were from India samples. The biochemical tests used are Indole test, Methyl Red test, Voges-Proskauer test and Citrate test. All the 42 strains were examined for Shiga toxin (stx1 and stx2) gene detection by two pair primers which are stx2F (5'-TTCTTCGGTATCCTATTCCC-3'), stx2R (5'-ATGCATCTCTGGTCATTGTA-3'), stx1F (5'-CAGTTAATGTGGTGGCGAAG-3'), and stx1R (5'-CTGTCACAGTAACAACCGT-3'). The results showed that none of the strains are positive for Shiga toxin gene. Application of ERIC-PCR method towards E. coli had successfully shown the high diversity polymorphism in 21 different genome types of DNA with primers ERIC1R (5'- CACTTAGGGGTCCTCGAATGTA- 3') and ERIC2R (5'- AAGTAAGTGACTGGGGTGACGC- 3').

  15. MULTIPLEX PCR ANALYSIS OF IN VIVO-ARISING DELETION MUTATIONS IN THE HPRT GENE OF HUMAN T-LYMPHOCYTES

    EPA Science Inventory

    A multiplex polymerase chain reaction (PCR) procedure was adapted for the rapid and efficient evaluation of the hypoxanthine guanine phosphoribosyltransferase (hprt) gene in human T-lymphocytes for deletions. he hprt clonal assay was used to isolate in-vivo-arising hprt-deficient...

  16. A polymerase chain reaction method for the amplification of full-length envelope genes of HIV-1 from DNA samples containing single molecules of HIV-1 provirus.

    PubMed

    McClure, P; Curran, R; Boneham, S; Ball, J K

    2000-07-01

    Polymerase chain reaction (PCR) amplification of full-length envelope genes from the human immunodeficiency virus type 1 (HIV-1) directly from uncultured clinical samples is difficult. This paper describes a comparative assessment of the performance of three thermostable polymerases in an HIV-1 full-length envelope gene PCR. The PCR method utilising Expand HiFi polymerase was successful when using DNA samples extracted from a variety of sources including blood, semen and various tissues. This method generated high and specific yields of product from samples containing as little as one copy of HIV-1 proviral DNA. The resulting PCR products were suitable for a variety of downstream analytical methods including DNA sequence analysis. PMID:10921844

  17. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction.

    PubMed

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy

    2016-09-01

    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  18. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    PubMed

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. PMID:23000800

  19. Identification of raw and heat-processed meats from game bird species by polymerase chain reaction-restriction fragment length polymorphism of the mitochondrial D-loop region.

    PubMed

    Rojas, M; González, I; Fajardo, V; Martín, I; Hernández, P E; García, T; Martín, R

    2009-03-01

    Polymerase chain reaction-RFLP analysis has been applied to the identification of meats from quail (Coturnix coturnix), pheasant (Phasianus colchicus), red-legged partridge (Alectoris rufa), chukar partridge (Alectoris chukar), guinea fowl (Numida meleagris), capercaillie (Tetrao urogallus), Eurasian woodcock (Scolopax rusticola), and woodpigeon (Columba palumbus). Polymerase chain reaction amplification was carried out using a set of primers flanking a conserved region of approximately 310 bp from the mitochondrial D-loop region. Restriction site analysis based on sequence data from this DNA fragment permitted the selection of HinfI, MboII, and Hpy188III endonucleases for species identification. The restriction profiles obtained when amplicons were digested with the chosen enzymes allowed the unequivocal identification of all game bird species analyzed. Consistent results were obtained with both raw and heat-processed meats. PMID:19211540

  20. Decapitation Improves Detection of Wolbachia pipientis (Rickettsiales: Anaplasmataceae) in Culex pipiens (Diptera: Culicidae) Mosquitoes by the Polymerase Chain Reaction

    PubMed Central

    BECKMANN, J. F.; FALLON, A. M.

    2013-01-01

    Polymerase chain reaction (PCR) is often used to detect microorganisms, pathogens, or both, including the reproductive parasite Wolbachia pipientis (Rickettsiales: Anaplasmataceae), in mosquitoes. Natural populations of Culex pipiens L. (Diptera: Culicidae) mosquitoes are infected with one or more strains of W. pipientis, and crosses between mosquitoes harboring different Wolbachia strains provide one of the best-known examples of cytoplasmic incompatibililty (CI). When we used PCR to monitor Wolbachia in the Buckeye strain of Culex pipiens, and in a Wolbachia-cured sister colony obtained by tetracycline treatment, we noted false negative PCR reactions with DNA samples from infected mosquitoes; these results were inconsistent with direct microscopic observation of Wolbachia-like particles in gonads dissected from mosquitoes in the same population. Assays with diluted template often improved detection of positive samples, suggesting that DNA prepared from whole mosquitoes contained an inhibitor of the PCR reaction. We reconciled discrepancies between PCR and microscopy by systematic measurement of the PCR reaction in the presence of an internal standard. Mosquito decapitation before DNA extraction restored the reliability of the PCR reaction, allowing accurate determination of Wolbachia infection status in infected and tetracycline-cured mosquito populations, consistent with microscopic examination. Using PCR primers based on the Tr1 gene, we confirmed that the Wolbachia infection in the Buckeye strain of Culex pipiens belongs to the genotype designated wPip1. Finally, to explore more widely the distribution of PCR inhibitors, we demonstrated that DNA isolated from the cricket, Acheta domesticus (L.); the beetle, Tenebrio molitor L.; the honey bee, Apis mellifera L.; and the mosquito, Anopheles punctipennis Say also contained PCR inhibitors. These results underscore the importance of measuring the presence of inhibitors in PCR templates by using a known positive