Science.gov

Sample records for mycobacterium smegmatis strain

  1. Viability, morphology, and proteome of Mycobacterium smegmatis MSMEG_0319 knockout strain.

    PubMed

    Sha, Shanshan; Shi, Xiaoxia; Xu, Liming; Wen, Jiabin; Xin, Yi; Ma, Yufang

    2016-04-01

    Mycobacterium tuberculosis Rv0228, a membrane protein, is predicted as a drug target through computational methods. MSMEG_0319 (MS0319) in Mycobacterium smegmatis mc(2) 155 is the ortholog of Rv0228. To study the effect of MS0319 protein on M. smegmatis, an MS0319 gene knockout strain (ΔMS0319) was generated via a homologous recombination technique in this study. The results showed that the lack of MS0319 protein in mc(2) 155 cells led to the loss of viability at nonpermissive temperature. Scanning electron microscopy and transmission electron microscopy observations showed drastic changes in cellular shape especially cell wall disruption in ΔMS0319 cells. Proteomic analysis of ΔMS0319 cells through LC-MS/MS revealed that 462 proteins had changes in their expressions by lacking MS0319 protein. The M. tuberculosis orthologs of these 462 proteins were found through BLASTp search and functional clustering and metabolic pathway enrichment were performed on the orthologs. The results revealed that most of them were enzymes involved in metabolism of carbohydrates and amino acids, indicating that Rv0228 played an important role in cellular metabolism. All these results suggested Rv0228 as a potential target for development of antituberculosis drugs. PMID:26833451

  2. Acanthamoeba polyphaga-Enhanced Growth of Mycobacterium smegmatis

    PubMed Central

    Lamrabet, Otmane; Medie, Felix Mba; Drancourt, Michel

    2012-01-01

    Background Mycobacterium smegmatis is a rapidly-growing mycobacterium causing rare opportunistic infections in human patients. It is present in soil and water environments where free-living amoeba also reside, but data regarding M. smegmatis-amoeba relationships have been contradictory from mycobacteria destruction to mycobacteria survival. Methodology/Principal Findings Using optic and electron microscopy and culture-based microbial enumeration we investigated the ability of M. smegmatis mc2 155, M. smegmatis ATCC 19420T and M. smegmatis ATCC 27204 organisms to survive into Acanthamoeba polyphaga trophozoites and cysts. We observed that M. smegmatis mycobacteria penetrated and survived in A. polyphaga trophozoites over five-day co-culture resulting in amoeba lysis and the release of viable M. smegmatis mycobacteria without amoebal cyst formation. We further observed that amoeba-co-culture, and lysed amoeba and supernatant and pellet, significantly increased five-day growth of the three tested M. smegmatis strains, including a four-fold increase in intra-amoebal growth. Conclusions/Significance Amoebal co-culture increases the growth of M. smegmatis resulting in amoeba killing by replicating M. smegmatis mycobacteria. This amoeba-M. smegmatis co-culture system illustrates an unusual paradigm in the mycobacteria-amoeba interactions as mycobacteria have been mainly regarded as amoeba-resistant organisms. Using these model organisms, this co-culture system could be used as a simple and rapid model to probe mycobacterial factors implicated in the intracellular growth of mycobacteria. PMID:22253795

  3. Microwell hybridization assay for detection of PCR products from Mycobacterium tuberculosis complex and the recombinant Mycobacterium smegmatis strain 1008 used as an internal control.

    PubMed Central

    Kox, L F; Noordhoek, G T; Kunakorn, M; Mulder, S; Sterrenburg, M; Kolk, A H

    1996-01-01

    A microwell hybridization assay was developed for the detection of the PCR products from both Mycobacterium tuberculosis complex bacteria and the recombinant Mycobacterium smegmatis strain 1008 that is used as an internal control to monitor inhibition in the PCR based on the M. tuberculosis complex-specific insertion sequence IS6110. The test is based on specific detection with digoxigenin-labeled oligonucleotide probes of biotinylated PCR products which are captured in a microtiter plate coated with streptavidin. The captured PCR products are hybridized separately with two probes, one specific for the PCR product from IS6110 from M. tuberculosis complex and the other specific for the PCR fragment from the modified IS6110 fragment from the recombinant M. smegmatis 1008. The microwell hybridization assay discriminates perfectly between the two types of amplicon. The amount of PCR product that can be detected by this assay is 10 times less than that which can be detected by agarose gel electrophoresis. The test can be performed in 2 h. It is much faster and less laborious than Southern blot hybridization. Furthermore, the interpretation of results is objective. The assay was used with 172 clinical samples in a routine microbiology laboratory, and the results were in complete agreement with those of agarose gel electrophoresis and Southern blot hybridization. PMID:8862568

  4. Selective targeting of Mycobacterium smegmatis with trehalose-functionalized nanoparticles†

    PubMed Central

    Jayawardana, Kalana W.; Jayawardena, H. Surangi N.; Wijesundera, Samurdhi A.; De Zoysa, Thareendra; Sundhoro, Madanodaya

    2015-01-01

    Silica and iron oxide nanoparticles with sizes ranging from 6 to 40 nm were functionalized with trehalose. The trehalose-conjugated nanoparticles showed strong interactions with Mycobacterium smegmatis (M. smegmatis) and minimal interactions with macrophage (RAW 264.7) or A549 cells. In addition, trehalose-conjugated silica nanoparticles selectively interacted with M. smegmatis on M. smegmatis-treated A549 cells, demonstrating high potential of trehalose in developing targeted therapy for treating mycobacterial infection. PMID:26121049

  5. Methylation of GPLs in Mycobacterium smegmatis and Mycobacterium avium

    PubMed Central

    Jeevarajah, Dharshini; Patterson, John H.; Taig, Ellen; Sargeant, Tobias; McConville, Malcolm J.; Billman-Jacobe, Helen

    2004-01-01

    Several species of mycobacteria express abundant glycopeptidolipids (GPLs) on the surfaces of their cells. The GPLs are glycolipids that contain modified sugars including acetylated 6-deoxy-talose and methylated rhamnose. Four methyltransferases have been implicated in the synthesis of the GPLs of Mycobacterium smegmatis and Mycobacterium avium. A rhamnosyl 3-O-methytransferase and a fatty acid methyltransferase of M. smegmatis have been previously characterized. In this paper, we characterize the methyltransferases that are responsible for modifying the hydroxyl groups at positions 2 and 4 of rhamnose and propose the biosynthetic sequence of GPL trimethylrhamnose formation. The analysis of M. avium genes through the creation of specific mutants is technically difficult; therefore, an alternative approach to determine the function of putative methyltransferases of M. avium was undertaken. Complementation of M. smegmatis methyltransferase mutants with M. avium genes revealed that MtfC and MtfB of the latter species have 4-O-methyltransferase activity and that MtfD is a 3-O-methyltransferase which can modify rhamnose of GPLs in M. smegmatis. PMID:15466031

  6. Noncanonical SMC protein in Mycobacterium smegmatis restricts maintenance of Mycobacterium fortuitum plasmids

    PubMed Central

    Panas, Michael W.; Jain, Paras; Yang, Hui; Mitra, Shimontini; Biswas, Debasis; Wattam, Alice Rebecca; Letvin, Norman L.; Jacobs, William R.

    2014-01-01

    Research on tuberculosis and leprosy was revolutionized by the development of a plasmid transformation system in the fast-growing surrogate, Mycobacterium smegmatis. This transformation system was made possible by the successful isolation of a M. smegmatis mutant strain mc2155, whose efficient plasmid transformation (ept) phenotype supported the replication of Mycobacterium fortuitum pAL5000 plasmids. In this report, we identified the EptC gene, the loss of which confers the ept phenotype. EptC shares significant amino acid sequence homology and domain structure with the MukB protein of Escherichia coli, a structural maintenance of chromosomes (SMC) protein. Surprisingly, M. smegmatis has three paralogs of SMC proteins: EptC and MSMEG_0370 both share homology with Gram-negative bacterial MukB; and MSMEG_2423 shares homology with Gram-positive bacterial SMCs, including the single SMC protein predicted for Mycobacterium tuberculosis and Mycobacterium leprae. Purified EptC was shown to bind ssDNA and stabilize negative supercoils in plasmid DNA. Moreover, an EptC–mCherry fusion protein was constructed and shown to bind to DNA in live mycobacteria, and to prevent segregation of plasmid DNA to daughter cells. To our knowledge, this is the first report of impaired plasmid maintenance caused by a SMC homolog, which has been canonically known to assist the segregation of genetic materials. PMID:25197070

  7. Proteogenomic Analysis of Mycobacterium smegmatis Using High Resolution Mass Spectrometry

    PubMed Central

    Potgieter, Matthys G.; Nakedi, Kehilwe C.; Ambler, Jon M.; Nel, Andrew J. M.; Garnett, Shaun; Soares, Nelson C.; Mulder, Nicola; Blackburn, Jonathan M.

    2016-01-01

    Biochemical evidence is vital for accurate genome annotation. The integration of experimental data collected at the proteome level using high resolution mass spectrometry allows for improvements in genome annotation by providing evidence for novel gene models, while validating or modifying others. Here, we report the results of a proteogenomic analysis of a reference strain of Mycobacterium smegmatis (mc2155), a fast growing model organism for the pathogenic Mycobacterium tuberculosis—the causative agent for Tuberculosis. By integrating high throughput LC/MS/MS proteomic data with genomic six frame translation and ab initio gene prediction databases, a total of 2887 ORFs were identified, including 2810 ORFs annotated to a Reference protein, and 63 ORFs not previously annotated to a Reference protein. Further, the translational start site (TSS) was validated for 558 Reference proteome gene models, while upstream translational evidence was identified for 81. In addition, N-terminus derived peptide identifications allowed for downstream TSS modification of a further 24 gene models. We validated the existence of six previously described interrupted coding sequences at the peptide level, and provide evidence for four novel frameshift positions. Analysis of peptide posterior error probability (PEP) scores indicates high-confidence novel peptide identifications and shows that the genome of M. smegmatis mc2155 is not yet fully annotated. Data are available via ProteomeXchange with identifier PXD003500. PMID:27092112

  8. Biosynthesis of Glycosyldiglycerides in Mycobacterium smegmatis

    PubMed Central

    Schultz, John C.; Elbein, Alan D.

    1974-01-01

    A particulate enzyme preparation from Mycobacterium smegmatis catalyzes the transfer of [14C]galactose from uridine 5′-diphosphate (UDP)-[14C]galactose and of [14C]glucose from UDP-[14C]glucose into chloroform-soluble products. The radioactive neutral lipids were purified by passage through diethylaminoethyl-cellulose, followed by thin-layer chromatography. When UDP-glucose was used as substrate, two major radioactive lipids were obtained; one had a hexose-glucose-glycerol ratio of 1:1:1. The second product had a hexose-glycerol ratio of 2:1 and, in addition to glucose, contained lesser amounts of mannose and galactose. With UDP-galactose as substrate, two radioactive products were observed that were chromatographically indistinguishable from the [14C]glucosyl-labeled mono- and diglycosyldiglyceride. Palmitate and oleate were the predominant fatty acid constituents in these lipids and were present in equimolar amounts in all of the products examined. The products have thus been identified as monoglycosyldiglyceride and a diglycosyldiglyceride containing glucose as the major hexose along with mannose and galactose. Properties of the galactosyl and glucosyl transferases are described. Images PMID:4808895

  9. Prime–Boost with Mycobacterium smegmatis Recombinant Vaccine Improves Protection in Mice Infected with Mycobacterium tuberculosis

    PubMed Central

    Junqueira-Kipnis, Ana Paula; de Oliveira, Fábio Muniz; Trentini, Monalisa Martins; Tiwari, Sangeeta; Chen, Bing; Resende, Danilo Pires; Silva, Bruna D. S.; Chen, Mei; Tesfa, Lydia; Jacobs, William R.; Kipnis, André

    2013-01-01

    The development of a new vaccine as a substitute for Bacillus Calmette–Guerin or to improve its efficacy is one of the many World Health Organization goals to control tuberculosis. Mycobacterial vectors have been used successfully in the development of vaccines against tuberculosis. To enhance the potential utility of Mycobacterium smegmatis as a vaccine, it was transformed with a recombinant plasmid containing the partial sequences of the genes Ag85c, MPT51, and HspX (CMX) from M. tuberculosis. The newly generated recombinant strain mc2-CMX was tested in a murine model of infection. The recombinant vaccine induced specific IgG1 or IgG2a responses to CMX. CD4+ and CD8+ T cells from the lungs and spleen responded ex vivo to CMX, producing IFN-γ, IL17, TNF-α, and IL2. The vaccine thus induced a significant immune response in mice. Mice vaccinated with mc2-CMX and challenged with M. tuberculosis showed better protection than mice immunized with wild-type M. smegmatis or BCG. To increase the safety and immunogenicity of the CMX antigens, we used a recombinant strain of M. smegmatis, IKE (immune killing evasion), to express CMX. The recombinant vaccine IKE-CMX induced a better protective response than mc2-CMX. The data presented here suggest that the expression of CMX antigens improves the immune response and the protection induced in mice when M. smegmatis is used as vaccine against tuberculosis. PMID:24250805

  10. Hetero-oligomeric MspA pores in Mycobacterium smegmatis.

    PubMed

    Pavlenok, Mikhail; Niederweis, Michael

    2016-04-01

    The porin MspA of Mycobacterium smegmatis is a biological nanopore used for DNA sequencing. The octameric MspA pore can be isolated from M. smegmatis in milligram quantities, is extremely stable against denaturation and rapidly inserts into lipid membranes. Here, we show that MspA pores composed of different Msp subunits are formed in M. smegmatis and that hetero-oligomers of different Msp monomers increase the heterogeneity of MspA pores designed for DNA sequencing. To improve the quality of preparations of mutant MspA proteins, all four msp genes were deleted from the M. smegmatis genome after insertion of an inducible porin gene from M. tuberculosis. In the msp quadruple mutant M. smegmatis ML712 no Msp porins were detected and mutant MspA proteins were produced at wild-type levels. Lipid bilayer experiments demonstrated that MspA pores isolated from ML712 formed functional channels and had a narrower conductance distribution than pores purified from M. smegmatis with background msp expression. Thus, the M. smegmatis msp quadruple mutant improves the homogeneity of MspA pores designed for DNA sequencing and might also facilitate the identification and functional characterization of other mycobacterial pore proteins. PMID:26912121

  11. Use of Mycobacterium smegmatis Deficient in ADP-Ribosyltransferase as Surrogate for Mycobacterium tuberculosis in Drug Testing and Mutation Analysis

    PubMed Central

    Agrawal, Priyanka; Miryala, Sandeep; Varshney, Umesh

    2015-01-01

    Rifampicin (Rif) is a first line drug used for tuberculosis treatment. However, the emergence of drug resistant strains has necessitated synthesis and testing of newer analogs of Rif. Mycobacterium smegmatis is often used as a surrogate for M. tuberculosis. However, the presence of an ADP ribosyltransferase (Arr) in M. smegmatis inactivates Rif, rendering it impractical for screening of Rif analogs or other compounds when used in conjunction with them (Rif/Rif analogs). Rifampicin is also used in studying the role of various DNA repair enzymes by analyzing mutations in RpoB (a subunit of RNA polymerase) causing Rif resistance. These analyses use high concentrations of Rif when M. smegmatis is used as model. Here, we have generated M. smegmatis strains by deleting arr (Δarr). The M. smegmatis Δarr strains show minimum inhibitory concentration (MIC) for Rif which is similar to that for M. tuberculosis. The MICs for isoniazid, pyrazinamide, ethambutol, ciprofloxacin and streptomycin were essentially unaltered for M. smegmatis Δarr. The growth profiles and mutation spectrum of Δarr and, Δarr combined with ΔudgB (udgB encodes a DNA repair enzyme that excises uracil) strains were similar to their counterparts wild-type for arr. However, the mutation spectrum of ΔfpgΔarr strain differed somewhat from that of the Δfpg strain (fpg encodes a DNA repair enzyme that excises 8-oxo-G). Our studies suggest M. smegmatis Δarr strain as an ideal model system in drug testing and mutation spectrum determination in DNA repair studies. PMID:25874691

  12. Photodynamic inactivation of the models Mycobacterium phlei and Mycobacterium smegmatis in vitro

    NASA Astrophysics Data System (ADS)

    Bruce-Micah, R.; Gamm, U.; Hüttenberger, D.; Cullum, J.; Foth, H.-J.

    2009-07-01

    Photodynamic inactivation (PDI) of bacterial strains presents an attractive potential alternative to antibiotic therapies. Success is dependent on the effective accumulation in bacterial cells of photochemical substances called photosensitizers, which are usually porphyrins or their derivatives. The kinetics of porphyrin synthesis after treatment with the precursor ALA and the accumulation of the Chlorin e6 and the following illumination were studied. The goal was to estimate effectivity of the destructive power of these PS in vitro in respect of the physiological states of Mycobacteria. So the present results examine the cell destruction by PDI using ALA-induced Porphyrins and Chlorin e6 accumulated in Mycobacterium phlei and Mycobacterium smegmatis, which serve as models for the important pathogens Mycobacterium tuberculosis, Mycobacterium leprae and Mycobacterium bovis. We could show that both Mycobacterium after ALA and Chlorin e6 application were killed by illumination with light of about 662 nm. A reduction of about 97% could be reached by using a lightdose of 70 mW/cm2.

  13. Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis

    PubMed Central

    Ravishankar, Sudha; Ambady, Anisha; Swetha, Rayapadi G.; Anbarasu, Anand; Ramaiah, Sudha; Sambandamurthy, Vasan K.

    2016-01-01

    Discovery of mupirocin, an antibiotic that targets isoleucyl-tRNA synthetase, established aminoacyl-tRNA synthetase as an attractive target for the discovery of novel antibacterial agents. Despite a high degree of similarity between the bacterial and human aminoacyl-tRNA synthetases, the selectivity observed with mupirocin triggered the possibility of targeting other aminoacyl-tRNA synthetases as potential drug targets. These enzymes catalyse the condensation of a specific amino acid to its cognate tRNA in an energy-dependent reaction. Therefore, each organism is expected to encode at least twenty aminoacyl-tRNA synthetases, one for each amino acid. However, a bioinformatics search for genes encoding aminoacyl-tRNA synthetases from Mycobacterium smegmatis returned multiple genes for glutamyl (GluRS), cysteinyl (CysRS), prolyl (ProRS) and lysyl (LysRS) tRNA synthetases. The pathogenic mycobacteria, namely, Mycobacterium tuberculosis and Mycobacterium leprae, were also found to possess two genes each for CysRS and LysRS. A similar search indicated the presence of additional genes for LysRS in gram negative bacteria as well. Herein, we describe sequence and structural analysis of the additional aminoacyl-tRNA synthetase genes found in M. smegmatis. Characterization of conditional expression strains of Cysteinyl and Lysyl-tRNA synthetases generated in M. smegmatis revealed that the canonical aminoacyl-tRNA synthetase are essential, while the additional ones are not essential for the growth of M. smegmatis. PMID:26794499

  14. Role of porins for uptake of antibiotics by Mycobacterium smegmatis.

    PubMed

    Danilchanka, Olga; Pavlenok, Mikhail; Niederweis, Michael

    2008-09-01

    The outer membrane of mycobacteria presents an effective permeability barrier for many antibiotics. Transport pathways across this membrane are unknown for most drugs. Here, we examined which antibiotics utilize the porin pathway across the outer membrane of the model organism Mycobacterium smegmatis. Deletion of the porins MspA and MspC drastically increased the resistance of M. smegmatis ML10 to beta-lactam antibiotics, while its beta-lactamase activity remained unchanged. These results are consistent with the ninefold-reduced outer membrane permeability of the M. smegmatis porin mutants for cephaloridine and strongly indicate that beta-lactam antibiotics rely on the porin pathway. The porin mutant ML10 accumulated less chloramphenicol and norfloxacin and was less susceptible to these antibiotics than wild-type M. smegmatis. These results demonstrated that small and hydrophilic antibiotics use the Msp porins for entering the cell. In contrast to norfloxacin, the hydrophobic moxifloxacin was 32-fold more effective in inhibiting the growth of M. smegmatis, presumably because it was able to diffuse through the lipid membrane. Structural models indicated that erythromycin, kanamycin, and vancomycin are too large to move through the MspA channel. This study presents the first experimental evidence that hydrophilic fluoroquinolones and chloramphenicol diffuse through porins in mycobacteria. Thus, mutations resulting in less efficient porins or lower porin expression levels are likely to represent a mechanism for the opportunistic pathogens M. avium, M. chelonae, and M. fortuitum, which have Msp-like porins, to acquire resistance to fluoroquinolones. PMID:18559650

  15. Involvement of Mycobacterium smegmatis undecaprenyl phosphokinase in biofilm and smegma formation.

    PubMed

    Röse, Lars; Kaufmann, Stefan H E; Daugelat, Sabine

    2004-09-01

    We describe a Mycobacterium smegmatis mutant with impaired biofilm and smegma formation. A gene homologous to Escherichia coli bacA, which has been proposed to play a role as undecaprenyl phosphokinase (Upk) was unmarked in-frame deleted from M. smegmatis. Though Upk is involved in cell wall synthesis, the surface of the mutant strain appeared virtually comparable to that of the wild type by electron microscopy. The absence of Upk influenced colony morphology and bacitracin resistance. The M. smegmatis Deltaupk mutant developed a biofilm characterized by scattered islands of bacteria distinct from the completely covered biofilm surface observed for wild-type bacteria. We further demonstrate biological consequences of upk deletion for smegma development in an in vivo model. These results suggest the upk gene to be essential in biofilm and smegma development. PMID:15345226

  16. Ribosomal RNA methylation in Mycobacterium smegmatis SN2.

    PubMed

    Srivastava, R; Gopinathan, K P

    1987-12-01

    Ribosomal RNA (rRNA) from a fast growing nonpathogenic strain of mycobacteria, Mycobacterium smegmatis SN2, was analyzed for the presence of minor nucleotides. Of the sixteen modified nucleotides detected, the identity of twelve has been established and their molar ratios were determined. These nucleotides include m1A, m2A, m6A, m6(2)A, m7G, m5C, rT, CmpC, CmpG, GmpG, UmpG and UmpU. The distinct features of the mycobacterial rRNA modifications include: (i) relatively substantial level of methylation, a feature distinct from that of the tRNA species which are unique in being under methylated in these bacteria, (ii) N1 methyl adenine representing the bulk of the modified bases, (iii) the lack of ribose methylation on any two successive nucleotides, and (iv) the presence of N6,N6-dimethyl adenosines, which are the target sites of the antibiotic kasugamycin, although the bacterial growth is insensitive to the drug. PMID:3440025

  17. Mycobacterium smegmatis infection of a prosthetic total knee arthroplasty.

    PubMed

    Saffo, Zaid; Ognjan, Anthony

    2016-01-01

    The most common organisms causing prosthetic knee joint infections are staphylococci. However, arthroplasty infections with atypical microbial pathogens, such as Mycobacteria can occur. Due to the rarity of mycobacterial prosthetic joint infections, diagnosis, treatment, and management of these atypical infections represent a clinical challenge. A 71-year old female post-operative day 40 after a left total knee arthroplasty was hospitalized secondary to left knee pain and suspected arthroplasty infection. She had failed outpatient oral antimicrobial treatment for superficial stitch abscess; and outpatient IV/Oral antimicrobials for a clinical postoperative septic bursitis. Ultimately, resection arthroplasty with operative tissue acid fast bacterial cultures demonstrated growth of the Mycobacterium smegmatis group. Post-operatively, she completed a combination course of oral doxycycline and levofloxacin and successfully completed a replacement arthroplasty with clinical and microbial resolution of the infection. To our knowledge, literature review demonstrates three case of knee arthroplasty infection caused by the Mycobacterium smegmatis group. Correspondingly, optimal surgical procedures and antimicrobial management including antimicrobial selection, treatment duration are not well defined. Presently, the best treatment options consists of two step surgical management including prosthesis hardware removal followed by extended antimicrobial therapy, followed by consideration for re-implantation arthroplasty. Our case illustrates importance of considering atypical mycobacterial infections in post-operative arthroplasty infections not responding to traditional surgical manipulations and antimicrobials. For an arthroplasty infection involving the atypical Mycobacterium smegmatis group, two step arthroplasty revision, including arthroplasty resection, with a combination of oral doxycycline and levofloxacin can lead to successful infection resolution, allowing for a

  18. Importance of porins for biocide efficacy against Mycobacterium smegmatis.

    PubMed

    Frenzel, Elrike; Schmidt, Stefan; Niederweis, Michael; Steinhauer, Katrin

    2011-05-01

    Mycobacteria are among the microorganisms least susceptible to biocides but cause devastating diseases, such as tuberculosis, and increasingly opportunistic infections. The exceptional resistance of mycobacteria to toxic solutes is due to an unusual outer membrane, which acts as an efficient permeability barrier, in synergy with other resistance mechanisms. Porins are channel-forming proteins in the outer membrane of mycobacteria. In this study we used the alamarBlue assay to show that the deletion of Msp porins in isogenic mutants increased the resistance of Mycobacterium smegmatis to isothiazolinones (methylchloroisothiazolinone [MCI]/methylisothiazolinone [MI] and octylisothiazolinone [2-n-octyl-4-isothiazolin-3-one; OIT]), formaldehyde-releasing biocides {hexahydrotriazine [1,3,5-tris (2-hydroxyethyl)-hexahydrotriazine; HHT] and methylenbisoxazolidine [N,N'-methylene-bis-5-(methyloxazolidine); MBO]}, and the lipophilic biocides polyhexamethylene biguanide and octenidine dihydrochloride 2- to 16-fold. Furthermore, the susceptibility of the porin triple mutant against a complex disinfectant was decreased 8-fold compared to wild-type (wt) M. smegmatis. Efficacy testing in the quantitative suspension test EN 14348 revealed 100-fold improved survival of the porin mutant in the presence of this biocide. These findings underline the importance of porins for the susceptibility of M. smegmatis to biocides. PMID:21398489

  19. Adhesion of Mycobacterium smegmatis to Charged Surfaces and Diagnostics Implications

    NASA Astrophysics Data System (ADS)

    Gorse, Diane; Dhinojwala, Ali; Moore, Francisco

    Pulmonary tuberculosis (PTB) causes more than 1 million deaths annually. Smear microscopy is a primary rapid detection tool in areas where 95 % of PTB cases occur. This technique, in which the sputum of a symptomatic patient is stained and examined using a light microscope for Mycobacterium tuberculosis (MTB) shows sensitivity between 20 and 60 %. Insufficient bacterial isolation during sample preparation may be a reason for low sensitivity. We are optimizing a system to capture bacteria on the basis of electrostatic interactions to more thoroughly isolate bacteria from suspension and facilitate more accurate detection. Silica supports coated with positively-charged polyelectrolyte, poly(diallyldimethylammonium chloride), captured approximately 4.1 times more Mycobacterium smegmatis, a model organism for MTB, than was captured on negatively-charged silica substrates. Future experimentation will employ branched polymer systems and seek to justify the use of colloidal stability theories to describe initial capture. Supported by University of Akron, Department of Polymer Science, Department of Biology; LORD Corporation.

  20. Analogous Mechanisms of Resistance to Benzothiazinones and Dinitrobenzamides in Mycobacterium smegmatis

    PubMed Central

    Buroni, Silvia; Incandela, Maria Loreto; Chiarelli, Laurent R.; Mori, Giorgia; Kim, Jaeseung; Contreras-Dominguez, Monica; Park, Young-Sam; Han, Sung-Jun; Brodin, Priscille; Valentini, Giovanna; Rizzi, Menico; Riccardi, Giovanna; Pasca, Maria Rosalia

    2011-01-01

    Tuberculosis is still a leading cause of death worldwide. The selection and spread of Mycobacterium tuberculosis multidrug-resistant (MDR-TB) and extensively drug-resistant strains (XDR-TB) is a severe public health problem. Recently, two different classes of chemical series, the benzothiazinones (BTZ) and the dinitrobenzamide (DNB) derivatives have been found to be highly active against M. tuberculosis, including XDR-TB strains. The target of BTZs is DprE1 protein which works in concert with DprE2 to form the heteromeric decaprenylphosphoryl-β-D-ribose 2′-epimerase, involved in Decaprenyl-Phospho-Arabinose (DPA) biosynthesis. Interestingly, it has been shown that the DNBs block the same pathway thus suggesting that both drugs could share the same target. Moreover, in Mycobacterium smegmatis the overexpression of the NfnB nitroreductase led to the inactivation of the BTZs by reduction of a critical nitro-group to an amino-group. In this work several spontaneous M. smegmatis mutants resistant to DNBs were isolated. Sixteen mutants, showing high levels of DNB resistance, exhibited a mutation in the Cys394 of DprE1. Using fluorescence titration and mass spectrometry it has been possible to monitor the binding between DprE1 and DNBs, achieving direct evidence that MSMEG_6382 is the cellular target of DNBs in mycobacteria. Additionally, M. smegmatis mutants having low levels of resistance to DNBs harbor various mutations in MSMEG_6503 gene encoding the transcriptional repressor of the nitroreductase NfnB. By LC/MS2 analysis it has been demonstrated that NfnB is responsible for DNB inactivation. Taken together, our data demonstrate that both DNB and BTZ drugs share common resistance mechanisms in M. smegmatis. PMID:22069462

  1. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  2. A moonlighting function of Mycobacterium smegmatis Ku in zinc homeostasis?

    PubMed

    Kushwaha, Ambuj K; Deochand, Dinesh K; Grove, Anne

    2015-02-01

    Ku protein participates in DNA double-strand break repair via the nonhomologous end-joining pathway. The three-dimensional structure of eukaryotic Ku reveals a central core consisting of a β-barrel domain and pillar and bridge regions that combine to form a ring-like structure that encircles DNA. Homologs of Ku are encoded by a subset of bacterial species, and they are predicted to conserve this core domain. In addition, the bridge region of Ku from some bacteria is predicted from homology modeling and sequence analyses to contain a conventional HxxC and CxxC (where x is any residue) zinc-binding motif. These potential zinc-binding sites have either deteriorated or been entirely lost in Ku from other organisms. Using an in vitro metal binding assay, we show that Mycobacterium smegmatis Ku binds two zinc ions. Zinc binding modestly stabilizes the Ku protein (by ∼3°C) and prevents cysteine oxidation, but it has little effect on DNA binding. In vivo, zinc induces significant upregulation of the gene encoding Ku (∼sixfold) as well as a divergently oriented gene encoding a predicted zinc-dependent MarR family transcription factor. Notably, overexpression of Ku confers zinc tolerance on Escherichia coli. We speculate that zinc-binding sites in Ku proteins from M. smegmatis and other mycobacterial species have been evolutionarily retained to provide protection against zinc toxicity without compromising the function of Ku in DNA double-strand break repair. PMID:25450225

  3. Active efflux of fluoroquinolones in Mycobacterium smegmatis mediated by LfrA, a multidrug efflux pump.

    PubMed Central

    Liu, J; Takiff, H E; Nikaido, H

    1996-01-01

    The lfrA gene cloned from chromosomal DNA of quinolone-resistant Mycobacterium smegmatis mc2-552 conferred low-level resistance to fluoroquinolones when present on multicopy plasmids. Sequence analysis suggested that lfrA encodes a membrane efflux pump of the major facilitator family (H. E. Takiff, M. Cimino, M. C. Musso, T. Weisbrod, R. Martinez, M. B. Delgado, L Salazar, B. R. Bloom, and W. R. Jacbos, Jr., Proc. Natl. Acad. Sci. USA 93:362-366, 1996). In this work, we studied the role of LfrA in the accumulation of fluoroquinolones by M. smegmatis. The steady-state accumulation level of a hydrophilic quinolone, norfloxacin, by M. smegmatis harboring a plasmid carrying the lfrA gene was about 50% of that by the parent strain but was increased to the same level as that of the parent strain by addition of a proton conductor, carbonyl cyanide m-chorophenylhydrazone. Norfloxacin efflux mediated by LfrA was competed for strongly by ciprofloxacin but not by nalidixic acid. Furthermore, we showed that portions of norfloxacin accumulated by starved cells were pumped out upon reenergization of the cells, and the rates of this efflux showed evidence of saturation at higher intracellular concentrations of the drug. These results suggest that the LfrA polypeptide catalyzes the active efflux of several quinolones. PMID:8682782

  4. Genetic alteration of Mycobacterium smegmatis to improve mycobacterium-mediated transfer of plasmid DNA into mammalian cells and DNA immunization.

    PubMed

    Mo, Yongkai; Quanquin, Natalie M; Vecino, William H; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M; Letvin, Norman L; Jacobs, William R; Fennelly, Glenn J

    2007-10-01

    Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant-albeit only 1.7-fold-increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120(h)(E)) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude

  5. Genetic Alteration of Mycobacterium smegmatis To Improve Mycobacterium-Mediated Transfer of Plasmid DNA into Mammalian Cells and DNA Immunization▿

    PubMed Central

    Mo, Yongkai; Quanquin, Natalie M.; Vecino, William H.; Ranganathan, Uma Devi; Tesfa, Lydia; Bourn, William; Derbyshire, Keith M.; Letvin, Norman L.; Jacobs, William R.; Fennelly, Glenn J.

    2007-01-01

    Mycobacteria target and persist within phagocytic monocytes and are strong adjuvants, making them attractive candidate vectors for DNA vaccines. We characterized the ability of mycobacteria to deliver transgenes to mammalian cells and the effects of various bacterial chromosomal mutations on the efficiency of transfer in vivo and in vitro. First, we observed green fluorescent protein expression via microscopy and fluorescence-activated cell sorting analysis after infection of phagocytic and nonphagocytic cell lines by Mycobacterium smegmatis or M. bovis BCG harboring a plasmid encoding the fluorescence gene under the control of a eukaryotic promoter. Next, we compared the efficiencies of gene transfer using M. smegmatis or BCG containing chromosomal insertions or deletions that cause early lysis, hyperconjugation, or an increased plasmid copy number. We observed a significant—albeit only 1.7-fold—increase in the level of plasmid transfer to eukaryotic cells infected with M. smegmatis hyperconjugation mutants. M. smegmatis strains that overexpressed replication proteins (Rep) of pAL5000, a plasmid whose replicon is incorporated in many mycobacterial constructs, generated a 10-fold increase in plasmid copy number and 3.5-fold and 3-fold increases in gene transfer efficiency to HeLa cells and J774 cells, respectively. Although BCG strains overexpressing Rep could not be recovered, BCG harboring a plasmid with a copy-up mutation in oriM resulted in a threefold increase in gene transfer to J774 cells. Moreover, M. smegmatis strains overexpressing Rep enhanced gene transfer in vivo compared with a wild-type control. Immunization of mice with mycobacteria harboring a plasmid (pgp120hE) encoding human immunodeficiency virus gp120 elicited gp120-specific CD8 T-cell responses among splenocytes and peripheral blood mononuclear cells that were up to twofold (P < 0.05) and threefold (P < 0.001) higher, respectively, in strains supporting higher copy numbers. The magnitude

  6. Nonadherent cultures of human monocytes kill Mycobacterium smegmatis, but adherent cultures do not.

    PubMed Central

    Barker, K; Fan, H; Carroll, C; Kaplan, G; Barker, J; Hellmann, W; Cohn, Z A

    1996-01-01

    Human peripheral blood monocytes are permissive for the growth of Mycobacterium tuberculosis, but the fate of nonpathogenic Mycobacterium smegmatis in these cells is not known. Since M. smegmatis may be used as a host with which to express and screen for M. tuberculosis genes needed for survival in monocytes, we determined whether human peripheral blood monocytes could restrict the growth of Mycobacterium smegmatis. Adherent human peripheral blood monocytes were permissive for the growth of M. smegmatis, as measured by ex vivo [3H]uracil uptake. However, human peripheral blood monocytes which were cultured nonadherently in Teflon wells were able to restrict the growth of M. smegmatis while remaining permissive for the growth of M. tuberculosis H37Ra. The loss of viability of M. smegmatis in nonadherent cells was correlated with an increase in nonspacious phagocytic vacuoles. The killing of M. smegmatis was not blocked by NG-monomethyl-L-arginine, suggesting that it was not due to the production of reactive nitrogen intermediates. Incubation of the monocytes for 1 to 7 days before infection had no effect on the fate of M. smegmatis, suggesting that adherence versus nonadherence, and not differentiation, was the key determinant for the difference in functional ability. Nonadherent human peripheral blood monocytes may be a more appropriate model than adherent cells for the study of factors employed by bacterial to survive within monocytes and for selection screening of bacterial genes needed for intracellular survival. PMID:8550187

  7. Structure of Mycobacterium smegmatis Eis in complex with paromomycin

    PubMed Central

    Kim, Kyoung Hoon; An, Doo Ri; Yoon, Hye Jin; Yang, Jin Kuk; Suh, Se Won

    2014-01-01

    The Rv2416c gene of Mycobacterium tuberculosis (Mtb) encodes the enhanced intracellular survival (Eis) protein that enhances intracellular survival of the pathogen in host macrophages during infection. The Mtb Eis protein is released into the cytoplasm of the phagocyte during intracellular infection and modulates the host immune response. It also contributes to drug resistance by acetylating multiple amine groups of aminoglycosides. Interestingly, the nonpathogenic M. smegmatis (Msm) contains a homologous eis gene (MSMEG_3513). The overall structures of Mtb Eis and Msm Eis are highly similar to each other, reflecting the high level (58%) of amino-acid sequence identity between them. Both Mtb Eis and Msm Eis are active as aminoglycoside acetyltransferases, while only Mtb Eis functions as an N ∊-acetyltransferase to acetylate Lys55 of dual-specificity protein phosphatase 16 (DUSP16)/mitogen-activated protein kinase phosphatase 7 (MKP-7), leading to the suppression of host immune responses. Here, the crystal structure of Msm Eis in the paromomycin-bound form is reported, revealing detailed interactions between an aminoglycoside antibiotic and Msm Eis. The crystal structure of Msm Eis in the paromomycin-bound form has been determined at 3.3 Å resolution. This work provides potentially useful information for structure-guided discovery of Eis inhibitors as a novel antituberculosis drug against drug-resistant Mtb. PMID:25195887

  8. Chromosome Organization and Replisome Dynamics in Mycobacterium smegmatis

    PubMed Central

    McKinney, John D.

    2015-01-01

    ABSTRACT Subcellular organization of the bacterial nucleoid and spatiotemporal dynamics of DNA replication and segregation have been studied intensively, but the functional link between these processes remains poorly understood. Here we use quantitative time-lapse fluorescence microscopy for single-cell analysis of chromosome organization and DNA replisome dynamics in Mycobacterium smegmatis. We report that DNA replication takes place near midcell, where, following assembly of the replisome on the replication origin, the left and right replication forks colocalize throughout the replication cycle. From its initial position near the cell pole, a fluorescently tagged chromosomal locus (attB, 245° from the origin) moves rapidly to the replisome complex just before it is replicated. The newly duplicated attB loci then segregate to mirror-symmetric positions relative to midcell. Genetic ablation of ParB, a component of the ParABS chromosome segregation system, causes marked defects in chromosome organization, condensation, and segregation. ParB deficiency also results in mislocalization of the DNA replication machinery and SMC (structural maintenance of chromosome) protein. These observations suggest that ParB and SMC play important and overlapping roles in chromosome organization and replisome dynamics in mycobacteria. PMID:25691587

  9. Identification of a multidrug efflux pump in Mycobacterium smegmatis.

    PubMed

    Bansal, Ankita; Mallik, Dhriti; Kar, Debasish; Ghosh, Anindya S

    2016-07-01

    Cell wall impermeability and active efflux of drugs are among the primary reasons for drug resistance in mycobacteria. Efflux pumps are tripartite membrane localized transport proteins that expel drug molecules outside the cells. Several of such efflux pumps are annotated in mycobacteria, but few have been characterized, like MSMEG_2991, a putative efflux pump permease of Mycobacterium smegmatis To substantiate this, we overexpressed MSMEG_2991 protein in Escherichia coli 2443. Expression of MSMEG_2991 elevated the resistance towards structurally unrelated groups of antibiotics. An active antibiotic efflux pump nature of MSMEG_2991 was revealed by assessing the acquisition of ciprofloxacin in the absence and presence of the efflux pump inhibitor, carbonyl cyanide m-chlorophenyl hydrazone, indicating the involvement of proton-motive force (pmf) during the efflux activity. MSMEG_2991 expression elevated biofilm formation in E. coli by 4-fold, keeping parity to some of the earlier reported efflux pumps. In silico analysis suggested the presence of 12 transmembrane helices in MSMEG_2991 resembling EmrD efflux pump of E. coli Based on in vivo and in silico analyses, MSMEG_2991 may be designated as a pmf-mediated multidrug efflux pump protein that expels diverse groups of antibiotics and might as well be involved in the biofilm enhancement. PMID:27190152

  10. Pneumonia caused by Mycobacterium smegmatis in a patient with a previous gastrectomy

    PubMed Central

    Driks, Michael; Weinhold, Frank; Cokingtin, Quintin

    2011-01-01

    Mycobacterium smegmatis pneumonia is rare, with only five cases reported in literature. The authors report a case in an adult male with a history that includes total gastrectomy. A transbronchial biopsy revealed non-caseating granuloma. Broncho-alveolar lavage culture identified M smegmatis. This case meets all 2007 American Thoracic Society criteria for the diagnosis of atypical mycobacterial pneumonia. The patient responded to a long course of trimethoprim/sulfamethoxazole and ciprofloxacin. PMID:22715276

  11. Site-specific integration of mycobacteriophage L5: integration-proficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis, and bacille Calmette-Guérin.

    PubMed Central

    Lee, M H; Pascopella, L; Jacobs, W R; Hatfull, G F

    1991-01-01

    Mycobacteriophage L5, a temperate phage of mycobacteria, integrates site-specifically into the Mycobacterium smegmatis chromosome. We have identified the int gene and attP site of L5, characterized the chromosomal attachment site (attB), and constructed plasmid vectors that efficiently transform M. smegmatis through stable site-specific integration of the plasmid into the bacterial genome. These integration-proficient plasmids also efficiently transform slow-growing mycobacteria such as the pathogen Mycobacterium tuberculosis and the vaccine strain bacille Calmette-Guérin (BCG). The ability to easily generate stable recombinants in these slow-growing mycobacteria without the requirement for continual selection is of particular importance for the construction of recombinant BCG vaccines and for the isolation and characterization of mycobacterial pathogenic determinants in animal model systems. Integration vectors of this type should be of general use in a number of additional bacterial systems where temperate phages have been identified. Images PMID:1901654

  12. Participation of fad and mbt Genes in Synthesis of Mycobactin in Mycobacterium smegmatis

    PubMed Central

    LaMarca, B. Babbette D.; Zhu, Wenming; Arceneaux, Jean E. L.; Rowe Byers, B.; Lundrigan, Michael D.

    2004-01-01

    Colonies of Mycobacterium smegmatis LR222 on iron-limiting (0.1 μM Fe) minimal medium agar fluoresce under UV light due to the accumulation in the cells of the deferri form of the siderophore mycobactin. Two mutants with little or no fluorescence, designated LUN8 and LUN9, were isolated by screening colonies of transposon (Tn611)-mutagenized M. smegmatis. Ferrimycobactin prepared from iron-restricted cells of the wild type had an Rf of 0.62 on high-performance thin-layer chromatography (HPTLC) and a characteristic visible absorption spectrum with a peak near 450 nm. Similar extracts from LUN8 cells contained a small amount of ferrimycobactin with an Rf of 0.58 on HPTLC and an absorption spectrum with the peak shifted to a wavelength lower than that of the wild-type ferrimycobactin. Nuclear magnetic resonance spectroscopy studies suggested that the LUN8 mycobactin may have an altered fatty acid side chain. Mutant strain LUN9 produced no detectable mycobactin. Neither mutant strain produced measurable amounts of excreted mycobactin, although both excreted exochelin (the mycobacterial peptido-hydroxamate siderophore), and both mutants were more sensitive than the wild-type strain to growth inhibition by the iron chelator ethylenediamine-di(o-hydroxyphenylacetic acid). The transposon insertion sites were identified, and sequence analyses of the cloned flanking chromosome regions showed that the mutated gene in LUN9 was an orthologue of the Mycobacterium tuberculosis mycobactin biosynthetic gene mbtE. The mutated gene in LUN8 had homology with M. tuberculosis fadD33 (Rv1345), a gene that may encode an acyl-coenzyme A synthase and which previously was not known to participate in synthesis of mycobactin. PMID:14702306

  13. Targeted Mutagenesis of the Mycobacterium smegmatis mca Gene, Encoding a Mycothiol-Dependent Detoxification Protein

    PubMed Central

    Rawat, Mamta; Uppal, Mandeep; Newton, Gerald; Steffek, Micah; Fahey, Robert C.; Av-Gay, Yossef

    2004-01-01

    Mycothiol (MSH), a functional analogue of glutathione (GSH) that is found exclusively in actinomycetes, reacts with electrophiles and toxins to form MSH-toxin conjugates. Mycothiol S-conjugate amidase (Mca) then catalyzes the hydrolysis of an amide bond in the S conjugates, producing a mercapturic acid of the toxin, which is excreted from the bacterium, and glucosaminyl inositol, which is recycled back to MSH. In this study, we have generated and characterized an allelic exchange mutant of the mca gene of Mycobacterium smegmatis. The mca mutant accumulates the S conjugates of the thiol-specific alkylating agent monobromobimane and the antibiotic rifamycin S. Introduction of M. tuberculosis mca epichromosomally or introduction of M. smegmatis mca integratively resulted in complementation of Mca activity and reduced levels of S conjugates. The mutation in mca renders the mutant strain more susceptible to electrophilic toxins, such as N-ethylmalemide, iodoacetamide, and chlorodinitrobenzene, and to several oxidants, such as menadione and plumbagin. Additionally we have shown that the mca mutant is also more susceptible to the antituberculous antibiotic streptomycin. Mutants disrupted in genes belonging to MSH biosynthesis are also more susceptible to streptomycin, providing further evidence that Mca detoxifies streptomycin in the mycobacterial cell in an MSH-dependent manner. PMID:15342574

  14. Organic hydroperoxide resistance protein and ergothioneine compensate for loss of mycothiol in Mycobacterium smegmatis mutants.

    PubMed

    Ta, Philong; Buchmeier, Nancy; Newton, Gerald L; Rawat, Mamta; Fahey, Robert C

    2011-04-01

    The mshA::Tn5 mutant of Mycobacterium smegmatis does not produce mycothiol (MSH) and was found to markedly overproduce both ergothioneine and an ~15-kDa protein determined to be organic hydroperoxide resistance protein (Ohr). An mshA(G32D) mutant lacking MSH overproduced ergothioneine but not Ohr. Comparison of the mutant phenotypes with those of the wild-type strain indicated the following: Ohr protects against organic hydroperoxide toxicity, whereas ergothioneine does not; an additional MSH-dependent organic hydroperoxide peroxidase exists; and elevated isoniazid resistance in the mutant is associated with both Ohr and the absence of MSH. Purified Ohr showed high activity with linoleic acid hydroperoxide, indicating lipid hydroperoxides as the likely physiologic targets. The reduction of oxidized Ohr by NADH was shown to be catalyzed by lipoamide dehydrogenase and either lipoamide or DlaT (SucB). Since free lipoamide and lipoic acid levels were shown to be undetectable in M. smegmatis, the bound lipoyl residues of DlaT are the likely source of the physiological dithiol reductant for Ohr. The pattern of occurrence of homologs of Ohr among bacteria suggests that the ohr gene has been distributed by lateral transfer. The finding of multiple Ohr homologs with various sequence identities in some bacterial genomes indicates that there may be multiple physiologic targets for Ohr proteins. PMID:21335456

  15. Mutation analysis of mycobacterial rpoB genes and rifampin resistance using recombinant Mycobacterium smegmatis.

    PubMed

    Nakata, Noboru; Kai, Masanori; Makino, Masahiko

    2012-04-01

    Rifampin is a major drug used to treat leprosy and tuberculosis. The rifampin resistance of Mycobacterium leprae and Mycobacterium tuberculosis results from a mutation in the rpoB gene, encoding the β subunit of RNA polymerase. A method for the molecular determination of rifampin resistance in these two mycobacteria would be clinically valuable, but the relationship between the mutations and susceptibility to rifampin must be clarified before its use. Analyses of mutations responsible for rifampin resistance using clinical isolates present some limitations. Each clinical isolate has its own genetic variations in some loci other than rpoB, which might affect rifampin susceptibility. For this study, we constructed recombinant strains of Mycobacterium smegmatis carrying the M. leprae or M. tuberculosis rpoB gene with or without mutation and disrupted their own rpoB genes on the chromosome. The rifampin and rifabutin susceptibilities of the recombinant bacteria were measured to examine the influence of the mutations. The results confirmed that several mutations detected in clinical isolates of these two pathogenic mycobacteria can confer rifampin resistance, but they also suggested that some mutations detected in M. leprae isolates or rifampin-resistant M. tuberculosis isolates are not involved in rifampin resistance. PMID:22252831

  16. Iron transport in Mycobacterium smegmatis: uptake of iron from ferric citrate

    SciTech Connect

    Messenger, A.J.M.; Ratledge, C.

    1982-01-01

    In mycobacterial growth medium 40 to 400 ..mu..M citrate was required to solubilize 2 ..mu..M /sup 55/Fe. This solubilized /sup 55/Fe was taken up into both iron-deficient and iron-sufficient washed cell suspensions of Mycobacterium smegmatis and Mycobacterium bovis BCG. Although the /sup 55/Fe was taken up into the cell, the citrate was not. The uptake system with M. smegmatis was not inhibited by electron transport inhibitors, uncouplers of oxidative phosphorylation, or thiol reagents and was saturable with iron at approximately 35 ..mu..M. The system was independent of the iron transport systems already known to exist in M. smegmatis: i.e., the two exochelin routes of assimilation as well as the mycobactin-salicylate system. It was not induced by the presence of 400 ..mu..M citrate in the growth medium, nor did the presence of citrate in the medium affect the production of either exochelin or mycobactin.

  17. Production of recombinant proteins in Mycobacterium smegmatis for structural and functional studies

    PubMed Central

    Bashiri, Ghader; Baker, Edward N

    2015-01-01

    Protein production using recombinant DNA technology has a fundamental impact on our understanding of biology through providing proteins for structural and functional studies. Escherichia coli (E. coli) has been traditionally used as the default expression host to over-express and purify proteins from many different organisms. E. coli does, however, have known shortcomings for obtaining soluble, properly folded proteins suitable for downstream studies. These shortcomings are even more pronounced for the mycobacterial pathogen Mycobacterium tuberculosis, the bacterium that causes tuberculosis, with typically only one third of proteins expressed in E. coli produced as soluble proteins. Mycobacterium smegmatis (M. smegmatis) is a closely related and non-pathogenic species that has been successfully used as an expression host for production of proteins from various mycobacterial species. In this review, we describe the early attempts to produce mycobacterial proteins in alternative expression hosts and then focus on available expression systems in M. smegmatis. The advantages of using M. smegmatis as an expression host, its application in structural biology and some practical aspects of protein production are also discussed. M. smegmatis provides an effective expression platform for enhanced understanding of mycobacterial biology and pathogenesis and for developing novel and better therapeutics and diagnostics. PMID:25303009

  18. A Mycobacterium smegmatis mutant with a defective inositol monophosphate phosphatase gene homolog has altered cell envelope permeability.

    PubMed Central

    Parish, T; Liu, J; Nikaido, H; Stoker, N G

    1997-01-01

    A bacteriophage infection mutant (strain LIMP7) of Mycobacterium smegmatis was isolated following transposon mutagenesis. The mutant showed an unusual phenotype, in that all phages tested produced larger plaques on this strain compared to the parent strain. Other phenotypic characteristics of the mutant were slower growth, increased clumping in liquid culture, increased resistance to chloramphenicol and erythromycin, and increased sensitivity to isoniazid and several beta-lactam antibiotics. Permeability studies showed decreases in the accumulation of lipophilic molecules (norfloxacin and chenodeoxycholate) and a small increase with hydrophilic molecules (cephaloridine); taken together, these characteristics indicate an altered cell envelope. The DNA adjacent to the transposon in LIMP7 was cloned and was shown to be highly similar to genes encoding bacterial and mammalian inositol monophosphate phosphatases. Inositol is important in mycobacteria as a component of the major thiol mycothiol and also in the cell wall, with phosphatidylinositol anchoring lipoarabinomannan (LAM) in the cell envelope. In LIMP7, levels of phosphatidylinositol dimannoside, the precursor of LAM, were less than half of those in the wild-type strain, confirming that the mutation had affected the synthesis of inositol-containing molecules. The impA gene is located within the histidine biosynthesis operon in both M. smegmatis and Mycobacterium tuberculosis, lying between the hisA and hisF genes. PMID:9401044

  19. Precise null deletion mutations of the mycothiol synthesis genes reveal their role in isoniazid and ethionamide resistance in Mycobacterium smegmatis.

    PubMed

    Xu, Xia; Vilchèze, Catherine; Av-Gay, Yossef; Gómez-Velasco, Anaximandro; Jacobs, William R

    2011-07-01

    Mycothiol (MSH; AcCys-GlcN-Ins) is the glutathione analogue for mycobacteria. Mutations in MSH biosynthetic genes have been associated with resistance to isoniazid (INH) and ethionamide (ETH) in mycobacteria, but rigorous genetic studies are lacking, and those that have been conducted have yielded different results. In this study, we constructed independent null deletion mutants for all four genes involved in the MSH biosynthesis pathway (mshA, mshB, mshC, and mshD) in Mycobacterium smegmatis and made complementing constructs in integrating plasmids. The resulting set of strains was analyzed for levels of MSH, INH resistance, and ETH resistance. The mshA and mshC single deletion mutants were devoid of MSH production and resistant to INH, whereas the mshB deletion mutant produced decreased levels of MSH yet was sensitive to INH, suggesting that MSH biosynthesis is essential for INH susceptibility in M. smegmatis. Further evidence supporting this conclusion was generated by deleting the gene encoding the MSH S-conjugate amidase (mca) from the ΔmshB null mutant. This double mutant, ΔmshB Δmca, completely abolished MSH production and was resistant to INH. The mshA, mshC, and mshB single deletion mutants were also resistant to ETH, indicating that ETH resistance is modulated by the level of MSH in M. smegmatis. Surprisingly, the mshD deletion mutant lacked MSH production but was sensitive to both INH and ETH. The drug sensitivity was likely mediated by the compensated synthesis of N-formyl-Cys-GlcN-Ins, previously demonstrated to substitute for MSH in an mshD mutant of M. smegmatis. We conclude that MSH or N-formyl-Cys-GlcN-Ins is required for susceptibility to INH or ETH in M. smegmatis. PMID:21502624

  20. Role in metal homeostasis of CtpD, a Co2+ transporting P1B4-ATPase of Mycobacterium smegmatis

    PubMed Central

    Raimunda, Daniel; Long, Jarukit E.; Sassetti, Christopher M.; Argüello, José M.

    2012-01-01

    Summary Genetic studies in the tuberculosis mouse model have suggested that mycobacterial metal efflux systems, such as the P1B4-ATPase CtpD, are important for pathogenesis. The specificity for substrate metals largely determines the function of these ATPases; however, various substrates have been reported for bacterial and plant P1B4-ATPases leaving their function uncertain. Here we describe the functional role of the CtpD protein of Mycobacterium smegmatis. An M. smegmatis mutant strain lacking the ctpD gene was hypersensitive to Co2+ and Ni2+ and accumulated these metals in the cytoplasm. ctpD transcription was induced by both Co2+ and superoxide stress. Biochemical characterization of heterologously expressed, affinity purified CtpD showed that this ATPase is activated by Co2+, Ni2+ and to a lesser extend Zn2+ (20% of maximum activity). The protein was also able to bind one Co2+, Ni2+ or Zn2+ to its transmembrane transport site. These observations indicate that CtpD is important for Co2+ and Ni2+ homeostasis in M. smegmatis, and that M. tuberculosis CtpD ortholog could be involved in metal detoxification and resisting cellular oxidative stress by modulating the intracellular concentration of these metals. PMID:22591178

  1. Reduction in DNA topoisomerase I level affects growth, phenotype and nucleoid architecture of Mycobacterium smegmatis.

    PubMed

    Ahmed, Wareed; Menon, Shruti; Karthik, Pullela V; Nagaraja, Valakunja

    2015-02-01

    The steady-state negative supercoiling of eubacterial genomes is maintained by the action of DNA topoisomerases. Topoisomerase distribution varies in different species of mycobacteria. While Mycobacterium tuberculosis (Mtb) contains a single type I (TopoI) and a single type II (Gyrase) enzyme, Mycobacterium smegmatis (Msm) and other members harbour additional relaxases. TopoI is essential for Mtb survival. However, the necessity of TopoI or other relaxases in Msm has not been investigated. To recognize the importance of TopoI for growth, physiology and gene expression of Msm, we have developed a conditional knock-down strain of TopoI in Msm. The TopoI-depleted strain exhibited extremely slow growth and drastic changes in phenotypic characteristics. The cessation of growth indicates the essential requirement of the enzyme for the organism in spite of having additional DNA relaxation enzymes in the cell. Notably, the imbalance in TopoI level led to the altered expression of topology modulatory proteins, resulting in a diffused nucleoid architecture. Proteomic and transcript analysis of the mutant indicated reduced expression of the genes involved in central metabolic pathways and core DNA transaction processes. RNA polymerase (RNAP) distribution on the transcription units was affected in the TopoI-depleted cells, suggesting global alteration in transcription. The study thus highlights the essential requirement of TopoI in the maintenance of cellular phenotype, growth characteristics and gene expression in mycobacteria. A decrease in TopoI level led to altered RNAP occupancy and impaired transcription elongation, causing severe downstream effects. PMID:25516959

  2. Molecular Analysis of the Gene Encoding F420-Dependent Glucose-6-Phosphate Dehydrogenase from Mycobacterium smegmatis

    PubMed Central

    Purwantini, Endang; Daniels, Lacy

    1998-01-01

    The gene fgd, which codes for F420-dependent glucose-6-phosphate dehydrogenase (FGD), was cloned from Mycobacterium smegmatis, and its sequence was determined and analyzed. A homolog of FGD which has a very high similarity to the M. smegmatis FGD-derived amino acid sequence was identified in Mycobacterium tuberculosis. FGD showed significant homology with F420-dependent N5,N10-methylene-tetrahydromethanopterin reductase (MER) from methanogenic archaea and with several hypothetical proteins from M. tuberculosis and Archaeoglobus fulgidus, but FGD showed no significant homology with NADP-dependent glucose-6-phosphate dehydrogenases. Multiple alignment of FGD and MER proteins revealed four conserved consensus sequences. Multiple alignment of FGD with the hypothetical proteins also revealed portions of the same conserved sequences. Moderately high levels of FGD were expressed in Escherichia coli BL21(DE3) carrying fgd in pBluescript. PMID:9555906

  3. Efficient and simple generation of multiple unmarked gene deletions in Mycobacterium smegmatis

    PubMed Central

    Mao, Xu-Jian; Yan, Mei-Yi; Zhu, Hui; Guo, Xiao-Peng; Sun, Yi-Cheng

    2016-01-01

    Research on mycobacterial genetics relies heavily on techniques for directed gene mutation, but genetic studies are often hampered by the difficulty of generating gene deletions in mycobacteria. We developed an efficient and improved deletion system, described here in detail, which can be used to construct multiple unmarked recombinants in mycobacteria. We tested this system by using it to sequentially delete four pairs of toxin-antitoxin genes in Mycobacterium smegmatis. PMID:26972108

  4. Multiple small RNAs identified in Mycobacterium bovis BCG are also expressed in Mycobacterium tuberculosis and Mycobacterium smegmatis

    PubMed Central

    DiChiara, Jeanne M.; Contreras-Martinez, Lydia M.; Livny, Jonathan; Smith, Dorie; McDonough, Kathleen A.; Belfort, Marlene

    2010-01-01

    Tuberculosis (TB) is a major global health problem, infecting millions of people each year. The causative agent of TB, Mycobacterium tuberculosis, is one of the world’s most ancient and successful pathogens. However, until recently, no work on small regulatory RNAs had been performed in this organism. Regulatory RNAs are found in all three domains of life, and have already been shown to regulate virulence in well-known pathogens, such as Staphylococcus aureus and Vibrio cholera. Here we report the discovery of 34 novel small RNAs (sRNAs) in the TB-complex M. bovis BCG, using a combination of experimental and computational approaches. Putative homologues of many of these sRNAs were also identified in M. tuberculosis and/or M. smegmatis. Those sRNAs that are also expressed in the non-pathogenic M. smegmatis could be functioning to regulate conserved cellular functions. In contrast, those sRNAs identified specifically in M. tuberculosis could be functioning in mediation of virulence, thus rendering them potential targets for novel antimycobacterials. Various features and regulatory aspects of some of these sRNAs are discussed. PMID:20181675

  5. Quantitative Mass Spectrometry Reveals Plasticity of Metabolic Networks in Mycobacterium smegmatis *

    PubMed Central

    Chopra, Tarun; Hamelin, Romain; Armand, Florence; Chiappe, Diego; Moniatte, Marc; McKinney, John D.

    2014-01-01

    Mycobacterium tuberculosis has a remarkable ability to persist within the human host as a clinically inapparent or chronically active infection. Fatty acids are thought to be an important carbon source used by the bacteria during long term infection. Catabolism of fatty acids requires reprogramming of metabolic networks, and enzymes central to this reprogramming have been targeted for drug discovery. Mycobacterium smegmatis, a nonpathogenic relative of M. tuberculosis, is often used as a model system because of the similarity of basic cellular processes in these two species. Here, we take a quantitative proteomics-based approach to achieve a global view of how the M. smegmatis metabolic network adjusts to utilization of fatty acids as a carbon source. Two-dimensional liquid chromatography and mass spectrometry of isotopically labeled proteins identified a total of 3,067 proteins with high confidence. This number corresponds to 44% of the predicted M. smegmatis proteome and includes most of the predicted metabolic enzymes. Compared with glucose-grown cells, 162 proteins showed differential abundance in acetate- or propionate-grown cells. Among these, acetate-grown cells showed a higher abundance of proteins that could constitute a functional glycerate pathway. Gene inactivation experiments confirmed that both the glyoxylate shunt and the glycerate pathway are operational in M. smegmatis. In addition to proteins with annotated functions, we demonstrate carbon source-dependent differential abundance of proteins that have not been functionally characterized. These proteins might play as-yet-unidentified roles in mycobacterial carbon metabolism. This study reveals several novel features of carbon assimilation in M. smegmatis, which suggests significant functional plasticity of metabolic networks in this organism. PMID:24997995

  6. Nitrogen starvation-induced transcriptome alterations and influence of transcription regulator mutants in Mycobacterium smegmatis

    PubMed Central

    2013-01-01

    Background As other bacteria, Mycobacterium smegmatis needs adaption mechanisms to cope with changing nitrogen sources and to survive situations of nitrogen starvation. In the study presented here, transcriptome analyses were used to characterize the response of the bacterium to nitrogen starvation and to elucidate the role of specific transcriptional regulators. Results In response to nitrogen deprivation, a general starvation response is induced in M. smegmatis. This includes changes in the transcription of several hundred genes encoding e.g. transport proteins, proteins involved in nitrogen metabolism and regulation, energy generation and protein turnover. The specific nitrogen-related changes at the transcriptional level depend mainly on the presence of GlnR, while the AmtR protein controls only a small number of genes. Conclusions M. smegmatis is able to metabolize a number of different nitrogen sources and nitrogen control in M. smegmatis is similar to control mechanisms characterized in streptomycetes, while the master regulator of nitrogen control in corynebacteria, AmtR, is plays a minor role in this regulatory network. PMID:24266988

  7. Qualitative and quantitative proteomic analysis of Vitamin C induced changes in Mycobacterium smegmatis

    PubMed Central

    Mishra, Abhishek; Sarkar, Dhiman

    2015-01-01

    Vitamin C is a critical dietary nutrient in human which has a wide range of regulatory effects on gene expression and physiology of Mycobacterium tuberculosis that leads to a dormant drug-tolerant phenotype. In the presence of iron, vitamin C shows a high bactericidal activity even in the drug resistant phenotype of M. tuberculosis. The regulatory mechanisms underlying vitamin C induced adaptations are largely unknown due to lack of functional genomics data in this field. In this study, we attempt to characterize the direct effect of vitamin C treatment on the physiology of actively growing Mycobacterium smegmatis. The study chose M. smegmatis as it is a fast-growing bacterium and a non-pathogenic model system which shares many physiological features with the pathogenic M. tuberculosis including dormancy and its regulation. The proteomic adaptation of M. smegmatis on vitamin C treatment demonstrates the important changes in cellular and metabolic process such as reversal of tricarboxylic acid cycle, decrease in ATP synthesis, decrease in iron acquisition and storage, and induction of dormancy regulators WhiB3, PhoP, and Lsr2. PMID:26042100

  8. Rel Is Required for Morphogenesis of Resting Cells in Mycobacterium smegmatis

    PubMed Central

    Wu, Mu-Lu; Chan, Chuu Ling; Dick, Thomas

    2016-01-01

    Recently we showed that upon transfer of growing Mycobacterium smegmatis into saline, the bacilli exited the canonical cell division cycle and formed septated multi-nucleoided cells. Under shock starvation (i.e., in saline without any carbon source), differentiation terminated at this stage with internally remodeled Large Resting Cells (LARCs). Whereas under gentle starvation (i.e., in saline with trace amounts of a carbon source), the septated multi-nucleoided bacilli completed cell division and separated into mono-nucleoided Small Resting Cells (SMRCs). This demonstrated that the non-sporulating mycobacteria are in fact capable of forming morphologically differentiated resting cells when exposed to starvation. Depending on the specific starvation conditions they can form two different resting cell types, LARCs or SMRCs, which share a common cellular differentiation pathway. The mRNA encoding the (p)ppGpp synthetase Rel was found to be transiently upregulated immediately upon starvation under both conditions, suggesting a role for the stringent response factor in both LARC and SMRC development. Here, we disrupted Rel function by generating two types of mutant M. smegmatis strains: a rel nonsense mutant (relE4TAG) in which translation is prematurely terminated at codon 4, and a rel deletion mutant (Δrel) in which the entire coding sequence was deleted. Both mutants showed identical phenotypes: sparse septum formation, less DNA compaction, and failure in formation of both the septated multi-nucleoided LARCs and the small-cell morphotype SMRC under starvation conditions. All phenotypes were rescued through the introduction of a wild-type copy of rel. Therefore, we conclude that loss-of-function mutations in rel block the development of both LARCs and SMRCs by preventing the first morphogenetic step in mycobacterial resting cell development, the formation of septated multi-nucleoided cells. Interestingly, in contrast to Rel’s role in most other bacteria, starvation

  9. MS_RHII-RSD, a Dual-Function RNase HII-(p)ppGpp Synthetase from Mycobacterium smegmatis

    PubMed Central

    Murdeshwar, Maya S.

    2012-01-01

    In the noninfectious soil saprophyte Mycobacterium smegmatis, intracellular levels of the stress alarmones guanosine tetraphosphate and guanosine pentaphosphate, together termed (p)ppGpp, are regulated by the enzyme RelMsm. This enzyme consists of a single, bifunctional polypeptide chain that is capable of both synthesizing and hydrolyzing (p)ppGpp. The relMsm knockout strain of M. smegmatis (ΔrelMsm) is expected to show a (p)ppGpp null [(p)ppGpp0] phenotype. Contrary to this expectation, the strain is capable of synthesizing (p)ppGpp in vivo. In this study, we identify and functionally characterize the open reading frame (ORF), MSMEG_5849, that encodes a second functional (p)ppGpp synthetase in M. smegmatis. In addition to (p)ppGpp synthesis, the 567-amino-acid-long protein encoded by this gene is capable of hydrolyzing RNA·DNA hybrids and bears similarity to the conventional RNase HII enzymes. We have classified this protein as actRelMsm in accordance with the recent nomenclature proposed and have named it MS_RHII-RSD, indicating the two enzymatic activities present [RHII, RNase HII domain, originally identified as domain of unknown function 429 (DUF429), and RSD, RelA_SpoT nucleotidyl transferase domain, the SYNTH domain responsible for (p)ppGpp synthesis activity]. MS_RHII-RSD is expressed and is constitutively active in vivo and behaves like a monofunctional (p)ppGpp synthetase in vitro. The occurrence of the RNase HII and (p)ppGpp synthetase domains together on the same polypeptide chain is suggestive of an in vivo role for this novel protein as a link connecting the essential life processes of DNA replication, repair, and transcription to the highly conserved stress survival pathway, the stringent response. PMID:22636779

  10. Decaprenylphosphoryl-β-D-Ribose 2′-Epimerase, the Target of Benzothiazinones and Dinitrobenzamides, Is an Essential Enzyme in Mycobacterium smegmatis

    PubMed Central

    Crellin, Paul K.; Brammananth, Rajini; Coppel, Ross L.

    2011-01-01

    Background The unique cell wall of bacteria of the suborder Corynebacterineae is essential for the growth and survival of significant human pathogens including Mycobacterium tuberculosis and Mycobacterium leprae. Drug resistance in mycobacteria is an increasingly common development, making identification of new antimicrobials a priority. Recent studies have revealed potent anti-mycobacterial compounds, the benzothiazinones and dinitrobenzamides, active against DprE1, a subunit of decaprenylphosphoribose 2′ epimerase which forms decaprenylphosphoryl arabinose, the arabinose donor for mycobacterial cell wall biosynthesis. Despite the exploitation of Mycobacterium smegmatis in the identification of DprE1 as the target of these new antimicrobials and its use in the exploration of mechanisms of resistance, the essentiality of DprE1 in this species has never been examined. Indeed, direct experimental evidence of the essentiality of DprE1 has not been obtained in any species of mycobacterium. Methodology/Principal Findings In this study we constructed a conditional gene knockout strain targeting the ortholog of dprE1 in M. smegmatis, MSMEG_6382. Disruption of the chromosomal copy of MSMEG_6382 was only possible in the presence of a plasmid-encoded copy of MSMEG_6382. Curing of this “rescue” plasmid from the bacterial population resulted in a cessation of growth, demonstrating gene essentiality. Conclusions/Significance This study provides the first direct experimental evidence for the essentiality of DprE1 in mycobacteria. The essentiality of DprE1 in M. smegmatis, combined with its conservation in all sequenced mycobacterial genomes, suggests that decaprenylphosphoryl arabinose synthesis is essential in all mycobacteria. Our findings indicate a lack of redundancy in decaprenylphosphoryl arabinose synthesis in M. smegmatis, despite the relatively large coding capacity of this species, and suggest that no alternative arabinose donors for cell wall biosynthesis exist

  11. The crystal structure of FdxA, a 7Fe ferredoxin from Mycobacterium smegmatis

    SciTech Connect

    Ricagno, Stefano; De Rosa, Matteo; Aliverti, Alessandro; Zanetti, Giuliana; Bolognesi, Martino . E-mail: martino.bolognesi@unimi.it

    2007-08-17

    Mycobacterium smegmatis ferredoxin FdxA, which has an orthologue ferredoxin in Mycobacterium tuberculosis, FdxC, contains both one [3Fe-4S] and one [4Fe-4S] cluster. M. smegmatis FdxA has been shown to be a preferred ferredoxin substrate of FprA [F. Fischer, D. Raimondi, A. Aliverti, G. Zanetti, Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase, Eur. J. Biochem. 269 (2002) 3005-3013], an adrenodoxin reductase-like flavoprotein of M. tuberculosis, suggesting that M. tuberculosis FdxC could be the physiological partner of the enzyme in providing reducing power to the cytochromes P450. We report here the crystal structure of FdxA at 1.6 A resolution (R {sub factor} 16.5%, R {sub free} 20.2%). Besides providing an insight on protein architecture for this 106-residue ferredoxin, our crystallographic investigation highlights lability of the [4Fe-4S] center, which is shown to loose a Fe atom during crystal growth. Due to their high similarity (87% sequence identity), the structure here reported can be considered a valuable model for M. tuberculosis FdxC, thus representing a step forward in the study of the complex mycobacterial redox pathways.

  12. The effect of Mycobacterium tuberculosis CRISPR-associated Cas2 (Rv2816c) on stress response genes expression, morphology and macrophage survival of Mycobacterium smegmatis.

    PubMed

    Huang, Qinqin; Luo, Hongping; Liu, Minqiang; Zeng, Jie; Abdalla, Abualgasim Elgaili; Duan, Xiangke; Li, Qiming; Xie, Jianping

    2016-06-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are present in the genome of 40% bacteria and 90% archaea. CRISPR and accompanying Cas proteins constitute an adaptive immune system against disruptive mobile genetic elements. Two CRISPRs and 9 genes encoding CRISPR-associated proteins have been found in the genome of Mycobacterium tuberculosis. The CRISPR-associated Cas2 is an endoribonuclease required for the acquisition of new spacers. In this study, Cas2 encoded by Rv2816c was expressed in Mycobacterium smegmatis lacking CRISPR-Cas system and its role in stress responses of M. smegmatis in vitro and within macrophages was studied. We found that Cas2 mediated M. smegmatis stress response changes were associated with the altered expression of sigma factors which involved in mycobacterial stress response and virulence. We also found that Cas2 decreased the survival of M. smegmatis within macrophages. This study provides new insights on the role of Cas2. PMID:26498723

  13. Involvement of Holliday Junction Resolvase in Fluoroquinolone-Mediated Killing of Mycobacterium smegmatis

    PubMed Central

    Long, Quanxin; Du, Qinglin; Fu, Tiwei; Drlica, Karl

    2014-01-01

    The absence of the Holliday-junction Ruv resolvase of Mycobacterium smegmatis increased the bacteriostatic and bactericidal activities of the fluoroquinolone moxifloxacin, an important antituberculosis agent. The treatment of ruvAB-deficient cells with thiourea and 2,2′-bipyridyl lowered moxifloxacin lethality to wild-type levels, indicating that the absence of ruvAB stimulates a lethal pathway involving reactive oxygen species. A hexapeptide that traps the Holliday junction substrate of RuvAB potentiated moxifloxacin-mediated lethality, supporting the development of small-molecule enhancers for moxifloxacin activity against mycobacteria. PMID:25534729

  14. Mycobacterium smegmatis in Skin Biopsy Specimens from Patients with Suppurative Granulomatous Inflammation

    PubMed Central

    Xu, Zhe; Lu, Di; Zhang, Xia; Li, Haijing; Meng, Shufang; Pan, Yue-Song; Boyd, Alan S.

    2013-01-01

    Formalin-fixed, paraffin-embedded skin biopsy specimens, including 72 suppurative granulomatous inflammation (SGI) and 47 non-SGI controls, were tested for mycobacteria by using a broad-range PCR and a suspension array identification system. Mycobacterium smegmatis was detected in 13 (18.1%) of the SGI skin biopsy specimens, which was significantly more than 2 (4.3%) in the controls (odds ratio, 5.73; 95% confidence interval, 1.21 to 27.06; P = 0.028). PMID:23303491

  15. Ca2+/calmodulin dependent protein kinase from Mycobacterium smegmatis ATCC 607.

    PubMed

    Sharma, S; Giri, S; Khuller, G K

    1998-06-01

    A soluble Ca2+/calmodulin dependent protein kinase has been partially purified (approximately 400 fold) from Mycobacterium smegmatis ATCC 607 using several purification steps like ammonium sulphate precipitation (30-60%), Sepharose CL-6B gel filtration, DEAE-cellulose and finally calmodulin-agarose affinity chromatography. On SDS-PAGE, this enzyme preparation showed a major protein band of molecular mass 35 kD and its activity was dependent on calcium, calmodulin and ATP when measured under saturating histone IIs (exogenous substrate) concentration. Phosphorylation of histone IIs was inhibited by W-7 (calmodulin inhibitor) and KN-62 (CaM-kinase inhibitor) with IC50 of 1.5 and 0.25 microm respectively, but was not affected by inhibitors of PKA (Sigma P5015) and PKC (H-7). All these results confirm that purified enzyme is Ca2+/calmodulin dependent protein kinase of M. smegmatis. The protein kinase of M. smegmatis demonstrated a narrow substrate specificity for both exogenous as well as endogenous substrates. These results suggest that purified CaM-kinase must be involved in regulating specific function(s) in this organism. PMID:9655195

  16. Synthesis of isonicotinoylhydrazones from anacardic acid and their in vitro activity against Mycobacterium smegmatis.

    PubMed

    Swamy, B Narayana; Suma, T K; Rao, G Venkateswara; Reddy, G Chandrasekara

    2007-03-01

    Isonicotinoylhydrazones were synthesized from a natural product anacardic acid, a major constituent of cashew nut shell liquid. The unsaturated side chain in anacardic acid and its 5-nitro derivative were converted into C(8')-aldehydes by oxidative cleavage. C(8')-aldehydes are then coupled with isoniazid (an anti-TB drug) to obtain N-isonicotinoyl-N'-8-[(2'-carbohydroxy-3'-hydroxy) phenyl] octanal hydrazone (5) and N-isonicotinoyl-N'-8-[(2'-carbohydroxy-3'-hydroxy-6-nitro) phenyl] octanal hydrazone (6). These isonicotinoylhydrazones of anacardic aldehydes showed potent antimycobacterial activity against Mycobacterium smegmatis mc(2)155. The synergistic studies of 5 and 6 with isoniazid showed more inhibitory activities than isoniazid alone. Compounds 5 and 6 also showed activity against Mycobacterium tuberculosis H(37)Rv. PMID:17112641

  17. Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis

    PubMed Central

    Liu, Huicong; Yang, Min; He, Zheng-Guo

    2016-01-01

    Transport-related genes significantly affect bacterial antibiotic resistance. However, the effects of these genes and their regulation of bacterial drug resistance in several mycobacterial species, including the fast-growing Mycobacterium smegmatis, the pathogen M. tuberculosis and M. avium have not been clearly characterized. We identified Ms4022 (MSMEG_4022) as a novel TetR family regulator that activates the expression of seven transport-related genes and affects drug resistance in M. smegmatis. Overexpression of Ms4022 inhibited M. smegmatis growth and enhanced mycobacterial resistance to the anti-tuberculosis drug rifampicin (RIF). By contrast, the Ms4022-deleted mycobacterial strain has shown sensitive to RIF. Ms4022 recognized three 19 bp non-palindromic motifs containing a 9 bp conserved region at their 5′ end and it directly regulated seven transport-related genes, which affects mycobacterial resistance to RIF. Overexpression of three of seven transport-related genes (Ms1448, Ms1613, and Ms5278) inhibited the growth of M. smegmatis. This study improves our understanding of the function of mycobacterial transport-related genes and their regulation of bacterial drug resistance. PMID:27271013

  18. Genome-Wide Transcriptome Profiling of Mycobacterium smegmatis MC2 155 Cultivated in Minimal Media Supplemented with Cholesterol, Androstenedione or Glycerol

    PubMed Central

    Li, Qun; Ge, Fanglan; Tan, Yunya; Zhang, Guangxiang; Li, Wei

    2016-01-01

    Mycobacterium smegmatis strain MC2 155 is an attractive model organism for the study of M. tuberculosis and other mycobacterial pathogens, as it can grow well using cholesterol as a carbon resource. However, its global transcriptomic response remains largely unrevealed. In this study, M. smegmatis MC2 155 cultivated in androstenedione, cholesterol and glycerol supplemented media were collected separately for a RNA-Sequencing study. The results showed that 6004, 6681 and 6348 genes were expressed in androstenedione, cholesterol and glycerol supplemented media, and 5891 genes were expressed in all three conditions, with 237 specially expressed in cholesterol added medium. A total of 1852 and 454 genes were significantly up-regulated by cholesterol compared with the other two supplements. Only occasional changes were observed in basic carbon and nitrogen metabolism, while almost all of the genes involved in cholesterol catabolism and mammalian cell entry (MCE) were up-regulated by cholesterol, but not by androstenedione. Eleven and 16 gene clusters were induced by cholesterol when compared with glycerol or androstenedione, respectively. This study provides a comprehensive analysis of the cholesterol responsive transcriptome of M. smegmatis. Our results indicated that cholesterol induced many more genes and increased the expression of the majority of genes involved in cholesterol degradation and MCE in M. smegmatis, while androstenedione did not have the same effect. PMID:27164097

  19. Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis.

    PubMed

    Liu, Huicong; Yang, Min; He, Zheng-Guo

    2016-01-01

    Transport-related genes significantly affect bacterial antibiotic resistance. However, the effects of these genes and their regulation of bacterial drug resistance in several mycobacterial species, including the fast-growing Mycobacterium smegmatis, the pathogen M. tuberculosis and M. avium have not been clearly characterized. We identified Ms4022 (MSMEG_4022) as a novel TetR family regulator that activates the expression of seven transport-related genes and affects drug resistance in M. smegmatis. Overexpression of Ms4022 inhibited M. smegmatis growth and enhanced mycobacterial resistance to the anti-tuberculosis drug rifampicin (RIF). By contrast, the Ms4022-deleted mycobacterial strain has shown sensitive to RIF. Ms4022 recognized three 19 bp non-palindromic motifs containing a 9 bp conserved region at their 5' end and it directly regulated seven transport-related genes, which affects mycobacterial resistance to RIF. Overexpression of three of seven transport-related genes (Ms1448, Ms1613, and Ms5278) inhibited the growth of M. smegmatis. This study improves our understanding of the function of mycobacterial transport-related genes and their regulation of bacterial drug resistance. PMID:27271013

  20. Identifying novel mycobacterial stress associated genes using a random mutagenesis screen in Mycobacterium smegmatis.

    PubMed

    Viswanathan, Gopinath; Joshi, Shrilaxmi V; Sridhar, Aditi; Dutta, Sayantanee; Raghunand, Tirumalai R

    2015-12-10

    Cell envelope associated components of Mycobacterium tuberculosis (M.tb) have been implicated in stress response, immune modulation and in vivo survival of the pathogen. Although many such factors have been identified, there is a large disparity between the number of genes predicted to be involved in functions linked to the envelope and those described in the literature. To identify and characterise novel stress related factors associated with the mycobacterial cell envelope, we isolated colony morphotype mutants of Mycobacterium smegmatis (M. smegmatis), based on the hypothesis that mutants with unusual colony morphology may have defects in the biosynthesis of cell envelope components. On testing their susceptibility to stress conditions relevant to M.tb physiology, multiple mutants were found to be sensitive to Isoniazid, Diamide and H2O2, indicative of altered permeability due to changes in cell envelope composition. Two mutants showed defects in biofilm formation implying possible roles for the target genes in antibiotic tolerance and/or virulence. These assays identified novel stress associated roles for several mycobacterial genes including sahH, tatB and aceE. Complementation analysis of selected mutants with the M. smegmatis genes and their M.tb homologues showed phenotypic restoration, validating their link to the observed phenotypes. A mutant carrying an insertion in fhaA encoding a forkhead associated domain containing protein, showed reduced survival in THP-1 macrophages, providing in vivo validation to this screen. Taken together, these results suggest that the M.tb homologues of a majority of the identified genes may play significant roles in the pathogenesis of tuberculosis. PMID:26211627

  1. Inactivation of the organic hydroperoxide stress resistance regulator OhrR enhances resistance to oxidative stress and isoniazid in Mycobacterium smegmatis.

    PubMed

    Saikolappan, Sankaralingam; Das, Kishore; Dhandayuthapani, Subramanian

    2015-01-01

    The organic hydroperoxide stress resistance regulator (OhrR) is a MarR type of transcriptional regulator that primarily regulates the expression of organic hydroperoxide reductase (Ohr) in bacteria. In mycobacteria, the genes encoding these proteins exist in only a few species, which include the fast-growing organism Mycobacterium smegmatis. To delineate the roles of Ohr and OhrR in defense against oxidative stress in M. smegmatis, strains lacking the expression of these proteins were constructed by deleting the ohrR and ohr genes, independently and together, through homologous recombination. The OhrR mutant strain (MSΔohrR) showed severalfold upregulation of Ohr expression, which could be observed at both the transcript and protein levels. Similar upregulation of Ohr expression was also noticed in an M. smegmatis wild-type strain (MSWt) induced with cumene hydroperoxide (CHP) and t-butyl hydroperoxide (t-BHP). The elevated Ohr expression in MSΔohrR correlated with heightened resistance to oxidative stress due to CHP and t-BHP and to inhibitory effects due to the antituberculosis drug isoniazid (INH). Further, this mutant strain exhibited significantly enhanced survival in the intracellular compartments of macrophages. In contrast, the strains lacking either Ohr alone (MSΔohr) or both Ohr and OhrR (MSΔohr-ohrR) displayed limited or no resistance to hydroperoxides and INH. Additionally, these strains showed no significant differences in intracellular survival from the wild type. Electrophoretic mobility shift assays (EMSAs) revealed that the overexpressed and purified OhrR interacts with the ohr-ohrR intergenic region with a greater affinity and this interaction is contingent upon the redox state of the OhrR. These findings suggest that Ohr-OhrR is an important peroxide stress response system in M. smegmatis. PMID:25313389

  2. Inactivation of the Organic Hydroperoxide Stress Resistance Regulator OhrR Enhances Resistance to Oxidative Stress and Isoniazid in Mycobacterium smegmatis

    PubMed Central

    Saikolappan, Sankaralingam; Das, Kishore

    2014-01-01

    The organic hydroperoxide stress resistance regulator (OhrR) is a MarR type of transcriptional regulator that primarily regulates the expression of organic hydroperoxide reductase (Ohr) in bacteria. In mycobacteria, the genes encoding these proteins exist in only a few species, which include the fast-growing organism Mycobacterium smegmatis. To delineate the roles of Ohr and OhrR in defense against oxidative stress in M. smegmatis, strains lacking the expression of these proteins were constructed by deleting the ohrR and ohr genes, independently and together, through homologous recombination. The OhrR mutant strain (MSΔohrR) showed severalfold upregulation of Ohr expression, which could be observed at both the transcript and protein levels. Similar upregulation of Ohr expression was also noticed in an M. smegmatis wild-type strain (MSWt) induced with cumene hydroperoxide (CHP) and t-butyl hydroperoxide (t-BHP). The elevated Ohr expression in MSΔohrR correlated with heightened resistance to oxidative stress due to CHP and t-BHP and to inhibitory effects due to the antituberculosis drug isoniazid (INH). Further, this mutant strain exhibited significantly enhanced survival in the intracellular compartments of macrophages. In contrast, the strains lacking either Ohr alone (MSΔohr) or both Ohr and OhrR (MSΔohr-ohrR) displayed limited or no resistance to hydroperoxides and INH. Additionally, these strains showed no significant differences in intracellular survival from the wild type. Electrophoretic mobility shift assays (EMSAs) revealed that the overexpressed and purified OhrR interacts with the ohr-ohrR intergenic region with a greater affinity and this interaction is contingent upon the redox state of the OhrR. These findings suggest that Ohr-OhrR is an important peroxide stress response system in M. smegmatis. PMID:25313389

  3. Expression of Mycobacterium tuberculosis NLPC/p60 family protein Rv0024 induce biofilm formation and resistance against cell wall acting anti-tuberculosis drugs in Mycobacterium smegmatis.

    PubMed

    Padhi, Avinash; Naik, Sumanta Kumar; Sengupta, Srabasti; Ganguli, Geetanjali; Sonawane, Avinash

    2016-04-01

    Bacterial species are capable of living as biofilm and/or planktonic forms. Role of biofilms in the pathogenesis of several human pathogens is well established. However, in case of Mycobacterium tuberculosis (Mtb) infection the role of biofilms and the genetic requirements for biofilm formation remains largely unknown. We herein report that ectopic expression of Mtb Rv0024, encoding a putative peptidoglycan amidase, in non-pathogenic Mycobacterium smegmatis(Msm) strain (MsmRv0024) confer at least 10-fold increase in resistance against two prominent anti-tuberculosis drugs isoniazid and pyrazinamide. We further report that the development of resistance was due to significant increase in biofilm formation by Rv0024. Transmission electron microscopy revealed differences in cell surface architecture of MsmRv0024 when compared with Msm wild-type (WT) and vector control Msm pSMT3 (pSMT3) strains and this aggregation pattern was due to increased cell wall hydrophobicity, as determined by Bacterial adhesion to hydrocarbons assay (BATH). Confocal microscopy study showed increased adherence of MsmRv0024 bacteria to lung epithelial cells as compared to pSMT3 strain. However, infection studies showed no differences in host cell invasion and intracellular survival in mouse macrophages. We envision that Rv0024 may play a critical role in initial infection process, adherence to host cells and drug resistance. Thus, Rv0024 may be considered as a potential drug target for the treatment of tuberculosis. PMID:26706821

  4. Protective Effect of a Lipid-Based Preparation from Mycobacterium smegmatis in a Murine Model of Progressive Pulmonary Tuberculosis

    PubMed Central

    García, Maria de los Angeles; Lanio, Maria E.; Tirado, Yanely; Alvarez, Nadine; Puig, Alina; Aguilar, Alicia; Canet, Liem; Mata Espinoza, Dulce; Barrios Payán, Jorge; Sarmiento, María Elena; Hernández-Pando, Rogelio; Norazmi, Mohd-Nor; Acosta, Armando

    2014-01-01

    A more effective vaccine against tuberculosis (TB) is urgently needed. Based on its high genetic homology with Mycobacterium tuberculosis (Mtb), the nonpathogenic mycobacteria, Mycobacterium smegmatis (Ms), could be an attractive source of potential antigens to be included in such a vaccine. We evaluated the capability of lipid-based preparations obtained from Ms to provide a protective response in Balb/c mice after challenge with Mtb H37Rv strain. The intratracheal model of progressive pulmonary TB was used to assess the level of protection in terms of bacterial load as well as the pathological changes in the lungs of immunized Balb/c mice following challenge with Mtb. Mice immunized with the lipid-based preparation from Ms either adjuvanted with Alum (LMs-AL) or nonadjuvanted (LMs) showed significant reductions in bacterial load (P < 0.01) compared to the negative control group (animals immunized with phosphate buffered saline (PBS)). Both lipid formulations showed the same level of protection as Bacille Calmette and Guerin (BCG). Regarding the pathologic changes in the lungs, mice immunized with both lipid formulations showed less pneumonic area when compared with the PBS group (P < 0.01) and showed similar results compared with the BCG group. These findings suggest the potential of LMs as a promising vaccine candidate against TB. PMID:25548767

  5. Crystal Structure of a Monomeric Thiolase-Like Protein Type 1 (TLP1) from Mycobacterium smegmatis

    PubMed Central

    Janardan, Neelanjana; Harijan, Rajesh K.; Wierenga, Rikkert K.; Murthy, Mathur R. N.

    2012-01-01

    An analysis of the Mycobacterium smegmatis genome suggests that it codes for several thiolases and thiolase-like proteins. Thiolases are an important family of enzymes that are involved in fatty acid metabolism. They occur as either dimers or tetramers. Thiolases catalyze the Claisen condensation of two acetyl-Coenzyme A molecules in the synthetic direction and the thiolytic cleavage of 3-ketoacyl-Coenzyme A molecules in the degradative direction. Some of the M. smegmatis genes have been annotated as thiolases of the poorly characterized SCP2-thiolase subfamily. The mammalian SCP2-thiolase consists of an N-terminal thiolase domain followed by an additional C-terminal domain called sterol carrier protein-2 or SCP2. The M. smegmatis protein selected in the present study, referred to here as the thiolase-like protein type 1 (MsTLP1), has been biochemically and structurally characterized. Unlike classical thiolases, MsTLP1 is a monomer in solution. Its structure has been determined at 2.7 Å resolution by the single wavelength anomalous dispersion method. The structure of the protomer confirms that the N-terminal domain has the thiolase fold. An extra C-terminal domain is indeed observed. Interestingly, it consists of six β-strands forming an anti-parallel β-barrel which is completely different from the expected SCP2-fold. Detailed sequence and structural comparisons with thiolases show that the residues known to be essential for catalysis are not conserved in MsTLP1. Consistent with this observation, activity measurements show that MsTLP1 does not catalyze the thiolase reaction. This is the first structural report of a monomeric thiolase-like protein from any organism. These studies show that MsTLP1 belongs to a new group of thiolase related proteins of unknown function. PMID:22844533

  6. The Role of fadD19 and echA19 in Sterol Side Chain Degradation by Mycobacterium smegmatis.

    PubMed

    Wrońska, Natalia; Brzostek, Anna; Szewczyk, Rafał; Soboń, Adrian; Dziadek, Jarosław; Lisowska, Katarzyna

    2016-01-01

    Mycobacteria are able to degrade natural sterols and use them as a source of carbon and energy. Several genes which play an important role in cholesterol ring degradation have been described in Mycobacterium smegmatis. However, there are limited data describing the molecular mechanism of the aliphatic side chain degradation by Mycobacterium spp. In this paper, we analyzed the role of the echA19 and fadD19 genes in the degradation process of the side chain of cholesterol and β-sitosterol. We demonstrated that the M. smegmatis fadD19 and echA19 genes are not essential for viability. FadD19 is required in the initial step of the biodegradation of C-24 branched sterol side chains in Mycobacterium smegmatis mc²155, but not those carrying a straight chain like cholesterol. Additionally, we have shown that echA19 is not essential in the degradation of either substrate. This is the first report, to our knowledge, on the molecular characterization of the genes playing an essential role in C-24 branched side chain sterol degradation in M. smegmatis mc²155. PMID:27164074

  7. Regulation of the ahpC Gene Encoding Alkyl Hydroperoxide Reductase in Mycobacterium smegmatis

    PubMed Central

    Lee, Ha-Na; Lee, Na-On; Han, Seung J.; Ko, In-Jeong; Oh, Jeong-Il

    2014-01-01

    The ahpC (MSMEG_4891) gene encodes alkyl hydroperoxide reductase C in Mycobacterium smegmatis mc2155 and its expression is induced under oxidative stress conditions. Two well-defined inverted repeat sequences (IR1 and IR2) were identified in the upstream region of ahpC. Using a crp (cAMP receptor protein: MSMEG_6189) mutant and in vitro DNA-binding assay, it was demonstrated that the IR1 sequence serves as a Crp-binding site and that Crp functions as an activator in the regulation of ahpC expression. The expression level of ahpC was shown to be proportional to intracellular cAMP levels. Intracellular levels of cAMP were increased in M. smegmatis, when it was treated with oxidative stress inducers. The IR2 sequence is very similar to the known consensus sequence of FurA-binding sites and involved in the negative regulation of ahpC expression. Taken together, these results suggest that the induction of ahpC expression under oxidative stress conditions probably results from a combinatory effect of both inactivation of FurA by oxidative stress and activation of Crp in response to increased levels of cAMP. PMID:25365321

  8. Activity against Mycobacterium smegmatis and M. tuberculosis by extract of South African medicinal plants.

    PubMed

    Mativandlela, Sannah Patience Nkami; Meyer, Jacob Jacobus Marion; Hussein, Ahmed A; Houghton, Peter J; Hamilton, Chris J; Lall, Namrita

    2008-06-01

    Seven ethnobotanically selected medicinal plants were screened for their antimycobacterial activity. The minimum inhibitory concentration (MIC) of four plants namely Artemisia afra, Dodonea angustifolia, Drosera capensis and Galenia africana ranged from 0.781 to 6.25 mg/mL against Mycobacterium smegmatis. G. africana showed the best activity exhibiting an MIC of 0.78 mg/mL and a minimum bactericidal concentration (MBC) of 1.56 mg/mL. The MICs of ethanol extracts of D. angustifolia and G. africana against M. tuberculosis were found to be 5.0 and 1.2 mg/mL respectively. The mammalian cytotoxicity IC(50) value of the most active antimycobacterial extract, from G. africana, was found to be 101.3 microg/mL against monkey kidney Vero cells. Since the ethanol G. africana displayed the best antimycobacterial activity, it was subjected to fractionation which led to the isolation of a flavone, 5,7,2'-trihydroxyflavone. The MIC of this compound was found to be 0.031 mg/mL against M. smegmatis and 0.10 mg/mL against M. tuberculosis. This study gives some scientific basis to the traditional use of these plants for TB-related symptoms. PMID:18412151

  9. Crystallization and preliminary crystallographic analysis of PimA, an essential mannosyltransferase from Mycobacterium smegmatis

    SciTech Connect

    Guerin, Marcelo E.; Buschiazzo, Alejandro; Korduláková, Jana; Jackson, Mary; Alzari, Pedro M.

    2005-05-01

    Mycobacterial PimA is an essential enzyme that catalyses the first mannosylation step in phosphatidyl-myo-inositol mannoside (PIM) biosynthesis. Crystals of the enzyme from M. smegmatis, obtained in the presence of GDP and myo-inositol, are orthorhombic (P2{sub 1}2{sub 1}2{sub 1}) and diffract X-rays to 2.4 Å resolution. Phosphatidylinositol mannosyltransferase (PimA) is an essential enzyme for mycobacterial growth that catalyses the first mannosylation step in phosphatidyl-myo-inositol mannoside (PIM) biosynthesis. The enzyme belongs to the large GT4 family of glycosyltransferases, for which no structure is currently available. Recombinant purified PimA from Mycobacterium smegmatis has been crystallized in the presence of GDP and myo-inositol. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 37.2, b = 72.4, c = 138.2 Å, and diffract to 2.4 Å resolution.

  10. The ftsZ Gene of Mycobacterium smegmatis is expressed Through Multiple Transcripts

    PubMed Central

    Roy, Sougata; Anand, Deepak; Vijay, Srinivasan; Gupta, Prabuddha; Ajitkumar, Parthasarathi

    2011-01-01

    The principal essential bacterial cell division gene ftsZ is differentially expressed through multiple transcripts in diverse genera of bacteria in order to meet cell division requirements in compliance with the physiological niche of the organism under different environmental conditions. We initiated transcriptional analyses of ftsZ gene of the fast growing saprophytic mycobacterium, Mycobacterium smegmatis, as the first step towards understanding the requirements for FtsZ for cell division under different growth phases and stress conditions. Primer extension analyses identified four transcripts, T1, T2, T3, and T4. Transcriptional fusion studies using gfp showed that the respective putative promoter regions, P1, P2, P3, and P4, possessed promoter activity. T1, T2, and T3 were found to originate from the intergenic region between ftsZ and the upstream gene, ftsQ. T4 was initiated from the 3’ portion of the open reading frame of ftsQ. RT-PCR analyses indicated co-transcription of ftsQ and ftsZ. The four transcripts were present in the cells at all growth phases and at different levels in the cells exposed to a variety of stress conditions in vitro. T2 and T3 were absent under hypoxia and nutrient-depleted stationary phase conditions, while the levels of T1 and T4 remained unaffected. These studies showed that ftsZ gene expression through multiple transcripts and differential expression of the transcripts at different growth phases and under stress conditions are conserved in M. smegmatis, like in other Actinomycetes. PMID:21772930

  11. Distinct Responses of Mycobacterium smegmatis to Exposure to Low and High Levels of Hydrogen Peroxide

    PubMed Central

    Li, Xiaojing; Wu, Jun; Han, Jiao; Hu, Yongfei; Mi, Kaixia

    2015-01-01

    Hydrogen peroxide (H2O2) is a natural oxidant produced by aerobic organisms and gives rise to oxidative damage, including DNA mutations, protein inactivation and lipid damage. The genus Mycobacterium utilizes redox sensors and H2O2 scavenging enzymes for the detoxification of H2O2. To date, the precise response to oxidative stress has not been fully elucidated. Here, we compared the effects of different levels of H2O2 on transcription in M. smegmatis using RNA-sequencing. A 0.2 mM H2O2 treatment had little effect on the growth and viability of M. smegmatis whereas 7 mM H2O2 was lethal. Analysis of global transcription showed that 0.2 mM H2O2 induced relatively few changes in gene expression, whereas a large proportion of the mycobacterial genome was found to be differentially expressed after treatment with 7 mM H2O2. Genes differentially expressed following treatment with 0.2 mM H2O2 included those coding for proteins involved in glycolysis-gluconeogenesis and fatty acid metabolism pathways, and expression of most genes encoding ribosomal proteins was lower following treatment with 7 mM H2O2. Our analysis shows that M. smegmatis utilizes the sigma factor MSMEG_5214 in response to 0.2 mM H2O2, and the RpoE1 sigma factors MSMEG_0573 and MSMEG_0574 in response to 7 mM H2O2. In addition, different transcriptional regulators responded to different levels of H2O2: MSMEG_1919 was induced by 0.2 mM H2O2, while high-level induction of DevR occurred in response to 7 mM H2O2. We detected the induction of different detoxifying enzymes, including genes encoding KatG, AhpD, TrxB and Trx, at different levels of H2O2 and the detoxifying enzymes were expressed at different levels of H2O2. In conclusion, our study reveals the changes in transcription that are induced in response to different levels of H2O2 in M. smegmatis. PMID:26225431

  12. PE11 (Rv1169c) selectively alters fatty acid components of Mycobacterium smegmatis and host cell interleukin-6 level accompanied with cell death

    PubMed Central

    Deng, Wanyan; Zeng, Jie; Xiang, Xiaohong; Li, Ping; Xie, Jianping

    2015-01-01

    PE/PPE family proteins, named after their conserved PE (Pro-Glu) and PPE (Pro-Pro-Glu) domains of N-terminal, are most intriguing aspects of pathologic mycobacterial genome. The roles of most members of this family remain unknown, although selected genes of this family are related to the virulence of Mycobacterium tuberculosis. In order to decipher the role of Rv1169c, the Mycobacterium smegmatis strain heterologous expressed this ORF was constructed and identified that Rv1169c was a cell wall associated protein with a novel function in modifying the cell wall fatty acids. The growth of Rv1169c expressing strain was affected under surface stress, acidic condition and antibiotics treatment. M. smegmatis expressing Rv1169c induced necrotic cell death of macrophage after infection and significantly decreased interlukin-6 production compared to controls. In general, these results underscore a proposing role of Rv1169c in virulence of M. tuberculosis, as it's role in the susceptibility of anti-mycobacteria factors caused by modified cell wall fatty acid, and the induced necrotic cell death by Rv1169c is crucial for M. tuberculosis virulence during infection. PMID:26157429

  13. Transcriptomic Characterization of an Infection of Mycobacterium smegmatis by the Cluster A4 Mycobacteriophage Kampy

    PubMed Central

    Saha, Margaret

    2015-01-01

    The mycobacteriophages, phages that infect the genus Mycobacterium, display profound genetic diversity and widespread geographical distribution, and possess significant medical and ecological importance. However, most of the majority of functions of mycobacteriophage proteins and the identity of most genetic regulatory elements remain unknown. We characterized the gene expression profile of Kampy, a cluster A4 mycobacteriophage, during infection of its host, Mycobacterium smegmatis, using RNA-Seq and mass spectrometry. We show that mycobacteriophage Kampy transcription occurs in roughly two phases, an early phase consisting of genes for metabolism, DNA synthesis, and gene regulation, and a late phase consisting of structural genes and lysis genes. Additionally, we identify the earliest genes transcribed during infection, along with several other possible regulatory units not obvious from inspection of Kampy's genomic structure. The transcriptional profile of Kampy appears similar to that of mycobacteriophage TM4 but unlike that of mycobacteriophage Giles, a result which further expands our understanding of the diversity of mycobacteriophage gene expression programs during infection. PMID:26513661

  14. Functions of the Periplasmic Loop of the Porin MspA from Mycobacterium smegmatis*

    PubMed Central

    Huff, Jason; Pavlenok, Mikhail; Sukumaran, Suja; Niederweis, Michael

    2009-01-01

    MspA is the major porin of Mycobacterium smegmatis and mediates diffusion of small and hydrophilic solutes across the outer membrane. The octameric structure of MspA, its sharply defined constriction zone, and a large periplasmic loop L6 represent novel structural features. L6 consists of 13 amino acids and is directly adjacent to the constriction zone. Deletion of 3, 5, 7, 9, and 11 amino acids of the L6 loop resulted in functional pores that restored glucose uptake and growth of a porin mutant of M. smegmatis. Lipid bilayer experiments revealed that all mutant channels were noisier than wild type (wt) MspA, indicating that L6 is required for pore stability in vitro. Voltage gating of the Escherichia coli porin OmpF was attributed to loops that collapse into the channel in response to a strong electrical field. Here, we show that deletion mutants Δ7, Δ9, and Δ11 had critical voltages similar to wt MspA. This demonstrated that the L6 loop is not the primary voltage-dependent gating mechanism of MspA. Surprisingly, large deletions in L6 resulted in 3-6-fold less extractable pores, whereas small deletions did not alter expression levels of MspA. Pores with large deletions in L6 were more permissive for glucose than smaller deletion mutants, whereas their single channel conductance was similar to that of wt MspA. These results indicate that translocation of ions through the MspA pore is governed by different mechanisms than that of neutral solutes. This is the first study identifying a molecular determinant of solute translocation in a mycobacterial porin. PMID:19208627

  15. Functions of the periplasmic loop of the porin MspA from Mycobacterium smegmatis.

    PubMed

    Huff, Jason; Pavlenok, Mikhail; Sukumaran, Suja; Niederweis, Michael

    2009-04-10

    MspA is the major porin of Mycobacterium smegmatis and mediates diffusion of small and hydrophilic solutes across the outer membrane. The octameric structure of MspA, its sharply defined constriction zone, and a large periplasmic loop L6 represent novel structural features. L6 consists of 13 amino acids and is directly adjacent to the constriction zone. Deletion of 3, 5, 7, 9, and 11 amino acids of the L6 loop resulted in functional pores that restored glucose uptake and growth of a porin mutant of M. smegmatis. Lipid bilayer experiments revealed that all mutant channels were noisier than wild type (wt) MspA, indicating that L6 is required for pore stability in vitro. Voltage gating of the Escherichia coli porin OmpF was attributed to loops that collapse into the channel in response to a strong electrical field. Here, we show that deletion mutants Delta7, Delta9, and Delta11 had critical voltages similar to wt MspA. This demonstrated that the L6 loop is not the primary voltage-dependent gating mechanism of MspA. Surprisingly, large deletions in L6 resulted in 3-6-fold less extractable pores, whereas small deletions did not alter expression levels of MspA. Pores with large deletions in L6 were more permissive for glucose than smaller deletion mutants, whereas their single channel conductance was similar to that of wt MspA. These results indicate that translocation of ions through the MspA pore is governed by different mechanisms than that of neutral solutes. This is the first study identifying a molecular determinant of solute translocation in a mycobacterial porin. PMID:19208627

  16. Overexpression of Mycobacterium tuberculosis manB, a phosphomannomutase that increases phosphatidylinositol mannoside biosynthesis in Mycobacterium smegmatis and mycobacterial association with human macrophages.

    PubMed

    McCarthy, Travis R; Torrelles, Jordi B; MacFarlane, Amanda Shearer; Katawczik, Melanie; Kutzbach, Beth; Desjardin, Lucy E; Clegg, Steven; Goldberg, Joanna B; Schlesinger, Larry S

    2005-11-01

    Mycobacterium tuberculosis (M. tb) pathogenesis involves the interaction between the mycobacterial cell envelope and host macrophage, a process mediated, in part, by binding of the mannose caps of M. tb lipoarabinomannan (ManLAM) to the macrophage mannose receptor (MR). A presumed critical step in the biosynthesis of ManLAM, and other mannose-containing glycoconjugates, is the conversion of mannose-6-phosphate to mannose-1-phosphate, by a phosphomannomutase (PMM), to produce GDP-mannose, the primary mannose-donor in mycobacteria. We have identified four M. tb H37Rv genes with similarity to known PMMs. Using in vivo complementation of PMM and phosphoglucomutase (PGM) deficient strains of Pseudomonas aeruginosa, and an in vitro enzyme assay, we have identified both PMM and PGM activity from one of these genes, Rv3257c (MtmanB). MtmanB overexpression in M. smegmatis produced increased levels of LAM, lipomannan, and phosphatidylinositol mannosides (PIMs) compared with control strains and led to a 13.3 +/- 3.9-fold greater association of mycobacteria with human macrophages, in a mannan-inhibitable fashion. This increased association was mediated by the overproduction of higher order PIMs that possess mannose cap structures. We conclude that MtmanB encodes a functional PMM involved in the biosynthesis of mannosylated lipoglycans that participate in the association of mycobacteria with macrophage phagocytic receptors. PMID:16238626

  17. The Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis, a Bacterium Naturally Devoid of the Postreplicative Mismatch Repair Pathway.

    PubMed

    Kucukyildirim, Sibel; Long, Hongan; Sung, Way; Miller, Samuel F; Doak, Thomas G; Lynch, Michael

    2016-01-01

    Mycobacterium smegmatis is a bacterium that is naturally devoid of known postreplicative DNA mismatch repair (MMR) homologs, mutS and mutL, providing an opportunity to investigate how the mutation rate and spectrum has evolved in the absence of a highly conserved primary repair pathway. Mutation accumulation experiments of M. smegmatis yielded a base-substitution mutation rate of 5.27 × 10(-10) per site per generation, or 0.0036 per genome per generation, which is surprisingly similar to the mutation rate in MMR-functional unicellular organisms. Transitions were found more frequently than transversions, with the A:T→G:C transition rate significantly higher than the G:C→A:T transition rate, opposite to what is observed in most studied bacteria. We also found that the transition-mutation rate of M. smegmatis is significantly lower than that of other naturally MMR-devoid or MMR-knockout organisms. Two possible candidates that could be responsible for maintaining high DNA fidelity in this MMR-deficient organism are the ancestral-like DNA polymerase DnaE1, which contains a highly efficient DNA proofreading histidinol phosphatase (PHP) domain, and/or the existence of a uracil-DNA glycosylase B (UdgB) homolog that might protect the GC-rich M. smegmatis genome against DNA damage arising from oxidation or deamination. Our results suggest that M. smegmatis has a noncanonical Dam (DNA adenine methylase) methylation system, with target motifs differing from those previously reported. The mutation features of M. smegmatis provide further evidence that genomes harbor alternative routes for improving replication fidelity, even in the absence of major repair pathways. PMID:27194804

  18. The Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis, a Bacterium Naturally Devoid of the Postreplicative Mismatch Repair Pathway

    PubMed Central

    Kucukyildirim, Sibel; Long, Hongan; Sung, Way; Miller, Samuel F.; Doak, Thomas G.; Lynch, Michael

    2016-01-01

    Mycobacterium smegmatis is a bacterium that is naturally devoid of known postreplicative DNA mismatch repair (MMR) homologs, mutS and mutL, providing an opportunity to investigate how the mutation rate and spectrum has evolved in the absence of a highly conserved primary repair pathway. Mutation accumulation experiments of M. smegmatis yielded a base-substitution mutation rate of 5.27 × 10−10 per site per generation, or 0.0036 per genome per generation, which is surprisingly similar to the mutation rate in MMR-functional unicellular organisms. Transitions were found more frequently than transversions, with the A:T→G:C transition rate significantly higher than the G:C→A:T transition rate, opposite to what is observed in most studied bacteria. We also found that the transition-mutation rate of M. smegmatis is significantly lower than that of other naturally MMR-devoid or MMR-knockout organisms. Two possible candidates that could be responsible for maintaining high DNA fidelity in this MMR-deficient organism are the ancestral-like DNA polymerase DnaE1, which contains a highly efficient DNA proofreading histidinol phosphatase (PHP) domain, and/or the existence of a uracil-DNA glycosylase B (UdgB) homolog that might protect the GC-rich M. smegmatis genome against DNA damage arising from oxidation or deamination. Our results suggest that M. smegmatis has a noncanonical Dam (DNA adenine methylase) methylation system, with target motifs differing from those previously reported. The mutation features of M. smegmatis provide further evidence that genomes harbor alternative routes for improving replication fidelity, even in the absence of major repair pathways. PMID:27194804

  19. Antibiotic Bactericidal Activity Is Countered by Maintaining pH Homeostasis in Mycobacterium smegmatis

    PubMed Central

    Bartek, I. L.; Reichlen, M. J.; Honaker, R. W.; Leistikow, R. L.; Clambey, E. T.; Scobey, M. S.; Hinds, A. B.; Born, S. E.; Covey, C. R.; Schurr, M. J.; Lenaerts, A. J.

    2016-01-01

    ABSTRACT Antibiotics target specific biosynthetic processes essential for bacterial growth. It is intriguing that several commonalities connect the bactericidal activity of seemingly disparate antibiotics, such as the numerous conditions that confer broad-spectrum antibiotic tolerance. Whether antibiotics kill in a manner unique to their specific targets or by a universal mechanism is a critical and contested subject. Herein, we demonstrate that the bactericidal activity of diverse antibiotics against Mycobacterium smegmatis and four evolutionarily divergent bacterial pathogens was blocked by conditions that worked to maintain intracellular pH homeostasis. Single-cell pH analysis demonstrated that antibiotics increased the cytosolic pH of M. smegmatis, while conditions that promoted proton entry into the cytosol prevented intracellular alkalization and antibiotic killing. These findings led to a hypothesis that posits antibiotic lethality occurs when antibiotics obstruct ATP-consuming biosynthetic processes while metabolically driven proton efflux is sustained despite the loss of proton influx via ATP synthase. Consequently, without a concomitant reduction in respiratory proton efflux, cell death occurs due to intracellular alkalization. Our findings indicate the effects of antibiotics on pH homeostasis should be considered a potential mechanism contributing to antibiotic lethality. IMPORTANCE Since the discovery of antibiotics, mortality due to bacterial infection has decreased dramatically. However, infections from difficult to treat bacteria such as Mycobacterium tuberculosis and multidrug-resistant pathogens have been on the rise. An understanding of the cascade of events that leads to cell death downstream of specific drug-target interactions is not well understood. We have discovered that killing by several classes of antibiotics was stopped by maintaining pH balance within the bacterial cell, consistent with a shared mechanism of antibiotic killing. Our

  20. Antibiotic Bactericidal Activity Is Countered by Maintaining pH Homeostasis in Mycobacterium smegmatis.

    PubMed

    Bartek, I L; Reichlen, M J; Honaker, R W; Leistikow, R L; Clambey, E T; Scobey, M S; Hinds, A B; Born, S E; Covey, C R; Schurr, M J; Lenaerts, A J; Voskuil, M I

    2016-01-01

    Antibiotics target specific biosynthetic processes essential for bacterial growth. It is intriguing that several commonalities connect the bactericidal activity of seemingly disparate antibiotics, such as the numerous conditions that confer broad-spectrum antibiotic tolerance. Whether antibiotics kill in a manner unique to their specific targets or by a universal mechanism is a critical and contested subject. Herein, we demonstrate that the bactericidal activity of diverse antibiotics against Mycobacterium smegmatis and four evolutionarily divergent bacterial pathogens was blocked by conditions that worked to maintain intracellular pH homeostasis. Single-cell pH analysis demonstrated that antibiotics increased the cytosolic pH of M. smegmatis, while conditions that promoted proton entry into the cytosol prevented intracellular alkalization and antibiotic killing. These findings led to a hypothesis that posits antibiotic lethality occurs when antibiotics obstruct ATP-consuming biosynthetic processes while metabolically driven proton efflux is sustained despite the loss of proton influx via ATP synthase. Consequently, without a concomitant reduction in respiratory proton efflux, cell death occurs due to intracellular alkalization. Our findings indicate the effects of antibiotics on pH homeostasis should be considered a potential mechanism contributing to antibiotic lethality. IMPORTANCE Since the discovery of antibiotics, mortality due to bacterial infection has decreased dramatically. However, infections from difficult to treat bacteria such as Mycobacterium tuberculosis and multidrug-resistant pathogens have been on the rise. An understanding of the cascade of events that leads to cell death downstream of specific drug-target interactions is not well understood. We have discovered that killing by several classes of antibiotics was stopped by maintaining pH balance within the bacterial cell, consistent with a shared mechanism of antibiotic killing. Our findings

  1. Biosynthesis of d-arabinose in Mycobacterium smegmatis: specific labeling from d-glucose.

    PubMed

    Klutts, J Stacey; Hatanaka, Kenichi; Pan, Y T; Elbein, Alan D

    2002-02-15

    d-Arabinose is a major sugar in the cell wall polysaccharides of Mycobacterium tuberculosis and other mycobacterial species. The reactions involved in the biosynthesis and activation of d-arabinose represent excellent potential sites for drug intervention since d-arabinose is not found in mammalian cells, and the cell wall arabinomannan and/or arabinogalactan appear to be essential for cell survival. Since the pathway involved in conversion of d-glucose to d-arabinose is unknown, we incubated cells of Mycobacterium smegmatis individually with [1-(14)C]glucose, [3,4-(14)C]glucose, and [6-(14)C]glucose and compared the specific activities of the cell wall-bound arabinose. Although the specific activity of the arabinose was about 25% lower with [6-(14)C]glucose than with other labels, there did not appear to be selective loss of either carbon 1 or carbon 6, suggesting that arabinose was not formed by loss of carbon 1 of glucose via the oxidative step of the pentose phosphate pathway, or by loss of carbon 6 in the uronic acid pathway. Similar labeling patterns were observed with ribose isolated from the nucleic acid fraction. Since these results suggested an unusual pathway of pentose formation, labeling studies were also done with [1-(13)C]glucose, [2-(13)C]glucose, and [6-(13)C]glucose and the cell wall arabinose was examined by NMR analysis. This method allows one to determine the relative (13)C content in each carbon of the arabinose. The labeling patterns suggested that the most likely pathway was condensation of carbons 1 and 2 of fructose 6-phosphate produced by the transaldolase reaction with carbons 4, 5, and 6 (i.e., glyceraldehyde 3-phosphate) formed by fructose-1,6 bisphosphate aldolase. Cell-free enzyme extracts of M. smegmatis were incubated with ribose 5-phosphate, xylulose 5-phosphate, and d-arabinose 5-phosphate under a variety of experimental conditions. Although the ribose 5-phosphate and xylulose 5-phosphate were converted to other pentoses and

  2. C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding

    PubMed Central

    Kushwaha, Ambuj K.; Grove, Anne

    2012-01-01

    Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins. PMID:23167261

  3. Comparison of the Construction of Unmarked Deletion Mutations in Mycobacterium smegmatis, Mycobacterium bovis Bacillus Calmette-Guérin, and Mycobacterium tuberculosis H37Rv by Allelic Exchange

    PubMed Central

    Pavelka, Martin S.; Jacobs, William R.

    1999-01-01

    Until recently, genetic analysis of Mycobacterium tuberculosis, the causative agent of tuberculosis, was hindered by a lack of methods for gene disruptions and allelic exchange. Several groups have described different methods for disrupting genes marked with antibiotic resistance determinants in the slow-growing organisms Mycobacterium bovis bacillus Calmette-Guérin (BCG) and M. tuberculosis. In this study, we described the first report of using a mycobacterial suicidal plasmid bearing the counterselectable marker sacB for the allelic exchange of unmarked deletion mutations in the chromosomes of two substrains of M. bovis BCG and M. tuberculosis H37Rv. In addition, our comparison of the recombination frequencies in these two slow-growing species and that of the fast-growing organism Mycobacterium smegmatis suggests that the homologous recombination machinery of the three species is equally efficient. The mutants constructed here have deletions in the lysA gene, encoding meso-diaminopimelate decarboxylase, an enzyme catalyzing the last step in lysine biosynthesis. We observed striking differences in the lysine auxotrophic phenotypes of these three species of mycobacteria. The M. smegmatis mutant can grow on lysine-supplemented defined medium or complex rich medium, while the BCG mutants grow only on lysine-supplemented defined medium and are unable to form colonies on complex rich medium. The M. tuberculosis lysine auxotroph requires 25-fold more lysine on defined medium than do the other mutants and is dependent upon the detergent Tween 80. The mutants described in this work are potential vaccine candidates and can also be used for studies of cell wall biosynthesis and amino acid metabolism. PMID:10438745

  4. A single point mutation in the embB gene is responsible for resistance to ethambutol in Mycobacterium smegmatis.

    PubMed Central

    Lety, M A; Nair, S; Berche, P; Escuyer, V

    1997-01-01

    Ethambutol [EMB; dextro-2,2'-(ethylenediimino)-di-1-butanol] is an effective drug when used in combination with isoniazid for the treatment of tuberculosis. It inhibits the polymerization of arabinan in the arabinogalactan and lipoarabinomannan of the mycobacterial cell wall. Recent studies have shown that arabinosyltransferases could be targets of EMB. These enzymes are encoded by the emb locus that was identified in Mycobacterium smegmatis, Mycobacterium leprae, Mycobacterium avium, and Mycobacterium tuberculosis. We demonstrate that a missense mutation in the M. smegmatis embB gene, one of the genes of the emb locus, confers resistance to EMB. The level of resistance is not dependent on the number of copies of the mutated embB gene, indicating that this is a true mechanism of resistance. The mutation is located in a region of the EmbB protein that is highly conserved among the different mycobacterial species. We also identified in this region two other independent mutations that confer EMB resistance. Furthermore, mutations have recently been described in the same region of the EmbB protein from clinical EMB-resistant M. tuberculosis isolates. Together, these data strongly suggest that one of the mechanisms of resistance to EMB consists of missense mutations in a particular region of the EmbB protein that could be directly involved in the interaction with the EMB molecule. PMID:9420031

  5. S-nitrosomycothiol reductase and mycothiol are required for survival under aldehyde stress and biofilm formation in Mycobacterium smegmatis.

    PubMed

    Vargas, Derek; Hageman, Samantha; Gulati, Megha; Nobile, Clarissa J; Rawat, Mamta

    2016-08-01

    We show that Mycobacterium smegmatis mutants disrupted in mscR, coding for a dual function S-nitrosomycothiol reductase and formaldehyde dehydrogenase, and mshC, coding for a mycothiol ligase and lacking mycothiol (MSH), are more susceptible to S-nitrosoglutathione (GSNO) and aldehydes than wild type. MSH is a cofactor for MscR, and both mshC and mscR are induced by GSNO and aldehydes. We also show that a mutant disrupted in egtA, coding for a γ-glutamyl cysteine synthetase and lacking in ergothioneine, is sensitive to nitrosative stress but not to aldehydes. In addition, we find that MSH and S-nitrosomycothiol reductase are required for normal biofilm formation in M. smegmatis, suggesting potential new therapeutic pathways to target to inhibit or disrupt biofilm formation. © 2016 IUBMB Life, 68(8):621-628, 2016. PMID:27321674

  6. Purification, crystallization, and properties of D-ribose isomerase from Mycobacterium smegmatis.

    PubMed

    Izumori, K; Rees, A W; Elbein, A D

    1975-10-25

    D-Ribose isomerase, which catalyzes the conversion of D-ribose to D-ribulose, was purified from extracts of Mycobacterium smegmatis grown on D-ribose. The purified enzyme crystalized as hexagonal plates from a 44% solution of ammonium sulfate. The enzyme was homogenous by disc gel electrophoresis and ultracentrifugal analysis. The molecular weight of the enzyme was between 145,000 and 174,000 by sedimentation equilibrium analysis. Its sedimentation constant of 8.7 S indicates it is globular. On the basis of sodium dodecyl sulfate gel electrophoresis in the presence of Mn2+, the enzyme is probably composed of 4 identical subunits of molecular weight about 42,000 to 44,000. The enzyme was specific for sugars having the same configuration as D-ribose at carbon atoms 1 to 3. Thus, the enzyme could also utilize L-lyxose, D-allose, and L-rhamnose as substrates. The Km for D-ribose was 4 mM and for L-lyxose it was 5.3 mM. The enzyme required a divalent cation for activity with optimum activity being shown with Mn2+. the Km for the various cations was as follows: Mn2+, 1 times 10(-7) M, Co2+, 4 times 10(-7) M, and Mg2+, 1.8 times 10(-5) M. The pH optimum for the enzyme was 7.5 to 8.5. Polyols did not inhibit the enzyme to any great extent. The product of the reaction was identified as D-ribulose by thin layer chromatography and by preparation of the O-nitrophenylhydrazone derivative. PMID:240851

  7. A Histidine Aspartate Ionic Lock Gates the Iron Passage in Miniferritins from Mycobacterium smegmatis*

    PubMed Central

    Williams, Sunanda Margrett; Chandran, Anu V.; Vijayabaskar, Mahalingam S.; Roy, Sourav; Balaram, Hemalatha; Vishveshwara, Saraswathi; Vijayan, Mamannamana; Chatterji, Dipankar

    2014-01-01

    Dps (DNA-binding protein from starved cells) are dodecameric assemblies belonging to the ferritin family that can bind DNA, carry out ferroxidation, and store iron in their shells. The ferritin-like trimeric pore harbors the channel for the entry and exit of iron. By representing the structure of Dps as a network we have identified a charge-driven interface formed by a histidine aspartate cluster at the pore interface unique to Mycobacterium smegmatis Dps protein, MsDps2. Site-directed mutagenesis was employed to generate mutants to disrupt the charged interactions. Kinetics of iron uptake/release of the wild type and mutants were compared. Crystal structures were solved at a resolution of 1.8–2.2 Å for the various mutants to compare structural alterations vis à vis the wild type protein. The substitutions at the pore interface resulted in alterations in the side chain conformations leading to an overall weakening of the interface network, especially in cases of substitutions that alter the charge at the pore interface. Contrary to earlier findings where conserved aspartate residues were found crucial for iron release, we propose here that in the case of MsDps2, it is the interplay of negative-positive potentials at the pore that enables proper functioning of the protein. In similar studies in ferritins, negative and positive patches near the iron exit pore were found to be important in iron uptake/release kinetics. The unique ionic cluster in MsDps2 makes it a suitable candidate to act as nano-delivery vehicle, as these gated pores can be manipulated to exhibit conformations allowing for slow or fast rates of iron release. PMID:24573673

  8. Functional characterization of EngA(MS), a P-loop GTPase of Mycobacterium smegmatis.

    PubMed

    Agarwal, Nisheeth; Pareek, Madhu; Thakur, Preeti; Pathak, Vibha

    2012-01-01

    Bacterial P-loop GTPases belong to a family of proteins that selectively hydrolyze a small molecule guanosine tri-phosphate (GTP) to guanosine di-phosphate (GDP) and inorganic phosphate, and regulate several essential cellular activities such as cell division, chromosomal segregation and ribosomal assembly. A comparative genome sequence analysis of different mycobacterial species indicates the presence of multiple P-loop GTPases that exhibit highly conserved motifs. However, an exact function of most of these GTPases in mycobacteria remains elusive. In the present study we characterized the function of a P-loop GTPase in mycobacteria by employing an EngA homologue from Mycobacterium smegmatis, encoded by an open reading frame, designated as MSMEG_3738. Amino acid sequence alignment and phylogenetic analysis suggest that MSMEG_3738 (termed as EngA(MS)) is highly conserved in mycobacteria. Homology modeling of EngA(MS) reveals a cloverleaf structure comprising of α/β fold typical to EngA family of GTPases. Recombinant EngA(MS) purified from E. coli exhibits a GTP hydrolysis activity which is inhibited by the presence of GDP. Interestingly, the EngA(MS) protein is co-eluted with 16S and 23S ribosomal RNA during purification and exhibits association with 30S, 50S and 70S ribosomal subunits. Further studies demonstrate that GTP is essential for interaction of EngA(MS) with 50S subunit of ribosome and specifically C-terminal domains of EngA(MS) are required to facilitate this interaction. Moreover, EngA(MS) devoid of N-terminal region interacts well with 50S even in the absence of GTP, indicating a regulatory role of the N-terminal domain in EngA(MS)-50S interaction. PMID:22506030

  9. Differential roles of the hemerythrin-like proteins of Mycobacterium smegmatis in hydrogen peroxide and erythromycin susceptibility

    PubMed Central

    Li, Xiaojing; Li, Jingjing; Hu, Xinling; Huang, Lige; Xiao, Jing; Chan, John; Mi, Kaixia

    2015-01-01

    Hemerythrin-like proteins are oxygen-carrying non-heme di-iron binding proteins and their functions have effect on oxidation-reduction regulation and antibiotic resistance. Recent studies using bioinformatic analyses suggest that multiple hemerythrin-like protein coding sequences might have been acquired by lateral gene transfer and the number of hemerythrin-like proteins varies amongst different species. Mycobacterium smegmatis contains three hemerythrin-like proteins, MSMEG_3312, MSMEG_2415 and MSMEG_6212. In this study, we have systematically analyzed all three hemerythrin-like proteins in M. smegmatis and our results identified and characterized two functional classes: MSMEG_2415 plays an important role in H2O2 susceptibility, and MSMEG_3312 and MSMEG_6212 are associated with erythromycin susceptibility. Phylogenetic analysis indicated that these three proteins have different evolutionary origins, possibly explaining their different physiological functions. Here, combined with biological and phylogenetic analyses, our results provide new insights into the evolutionary divergence of the hemerythrin-like proteins in M. smegmatis. PMID:26607739

  10. Overexpression of inhA, but not kasA, confers resistance to isoniazid and ethionamide in Mycobacterium smegmatis, M. bovis BCG and M. tuberculosis.

    PubMed

    Larsen, Michelle H; Vilchèze, Catherine; Kremer, Laurent; Besra, Gurdyal S; Parsons, Linda; Salfinger, Max; Heifets, Leonid; Hazbon, Manzour H; Alland, David; Sacchettini, James C; Jacobs, William R

    2002-10-01

    The inhA and kasA genes of Mycobacterium tuberculosis have each been proposed to encode the primary target of the antibiotic isoniazid (INH). Previous studies investigating whether overexpressed inhA or kasA could confer resistance to INH yielded disparate results. In this work, multicopy plasmids expressing either inhA or kasA genes were transformed into M. smegmatis, M. bovis BCG and three different M. tuberculosis strains. The resulting transformants, as well as previously published M. tuberculosis strains with multicopy inhA or kasAB plasmids, were tested for their resistance to INH, ethionamide (ETH) or thiolactomycin (TLM). Mycobacteria containing inhA plasmids uniformly exhibited 20-fold or greater increased resistance to INH and 10-fold or greater increased resistance to ETH. In contrast, the kasA plasmid conferred no increased resistance to INH or ETH in any of the five strains, but it did confer resistance to thiolactomycin, a known KasA inhibitor. INH is known to increase the expression of kasA in INH-susceptible M. tuberculosis strains. Using molecular beacons, quantified inhA and kasA mRNA levels showed that increased inhA mRNA levels corre--lated with INH resistance, whereas kasA mRNA levels did not. In summary, analysis of strains harbouring inhA or kasA plasmids yielded the same conclusion: overexpressed inhA, but not kasA, confers INH and ETH resistance to M. smegmatis, M. bovis BCG and M. tuberculosis. Therefore, InhA is the primary target of action of INH and ETH in all three species. PMID:12406221

  11. Comparative Ser/Thr/Tyr phosphoproteomics between two mycobacterial species: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG

    PubMed Central

    Nakedi, Kehilwe C.; Nel, Andrew J. M.; Garnett, Shaun; Blackburn, Jonathan M.; Soares, Nelson C.

    2015-01-01

    Ser/Thr/Tyr protein phosphorylation plays a critical role in regulating mycobacterial growth and development. Understanding the mechanistic link between protein phosphorylation signaling network and mycobacterial growth rate requires a global view of the phosphorylation events taking place at a given time under defined conditions. In the present study we employed a phosphopeptide enrichment and high throughput mass spectrometry-based strategy to investigate and qualitatively compare the phosphoproteome of two mycobacterial model organisms: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG. Cells were harvested during exponential phase and our analysis detected a total of 185 phospho-sites in M. smegmatis, of which 106 were confidently localized [localization probability (LP) = 0.75; PEP = 0.01]. By contrast, in M. bovis BCG the phosphoproteome comprised 442 phospho-sites, of which 289 were confidently localized. The percentage distribution of Ser/Thr/Tyr phosphorylation was 39.47, 57.02, and 3.51% for M. smegmatis and 35, 61.6, and 3.1% for M. bovis BCG. Moreover, our study identified a number of conserved Ser/Thr phosphorylated sites and conserved Tyr phosphorylated sites across different mycobacterial species. Overall a qualitative comparison of the fast and slow growing mycobacteria suggests that the phosphoproteome of M. smegmatis is a simpler version of that of M. bovis BCG. In particular, M. bovis BCG exponential cells exhibited a much more complex and sophisticated protein phosphorylation network regulating important cellular cycle events such as cell wall biosynthesis, elongation, cell division including immediately response to stress. The differences in the two phosphoproteomes are discussed in light of different mycobacterial growth rates. PMID:25904896

  12. Comparative Ser/Thr/Tyr phosphoproteomics between two mycobacterial species: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG.

    PubMed

    Nakedi, Kehilwe C; Nel, Andrew J M; Garnett, Shaun; Blackburn, Jonathan M; Soares, Nelson C

    2015-01-01

    Ser/Thr/Tyr protein phosphorylation plays a critical role in regulating mycobacterial growth and development. Understanding the mechanistic link between protein phosphorylation signaling network and mycobacterial growth rate requires a global view of the phosphorylation events taking place at a given time under defined conditions. In the present study we employed a phosphopeptide enrichment and high throughput mass spectrometry-based strategy to investigate and qualitatively compare the phosphoproteome of two mycobacterial model organisms: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG. Cells were harvested during exponential phase and our analysis detected a total of 185 phospho-sites in M. smegmatis, of which 106 were confidently localized [localization probability (LP) = 0.75; PEP = 0.01]. By contrast, in M. bovis BCG the phosphoproteome comprised 442 phospho-sites, of which 289 were confidently localized. The percentage distribution of Ser/Thr/Tyr phosphorylation was 39.47, 57.02, and 3.51% for M. smegmatis and 35, 61.6, and 3.1% for M. bovis BCG. Moreover, our study identified a number of conserved Ser/Thr phosphorylated sites and conserved Tyr phosphorylated sites across different mycobacterial species. Overall a qualitative comparison of the fast and slow growing mycobacteria suggests that the phosphoproteome of M. smegmatis is a simpler version of that of M. bovis BCG. In particular, M. bovis BCG exponential cells exhibited a much more complex and sophisticated protein phosphorylation network regulating important cellular cycle events such as cell wall biosynthesis, elongation, cell division including immediately response to stress. The differences in the two phosphoproteomes are discussed in light of different mycobacterial growth rates. PMID:25904896

  13. MmpL11 Protein Transports Mycolic Acid-containing Lipids to the Mycobacterial Cell Wall and Contributes to Biofilm Formation in Mycobacterium smegmatis*

    PubMed Central

    Pacheco, Sophia A.; Hsu, Fong-Fu; Powers, Katelyn M.; Purdy, Georgiana E.

    2013-01-01

    A growing body of evidence indicates that MmpL (mycobacterial membrane protein large) transporters are dedicated to cell wall biosynthesis and transport mycobacterial lipids. How MmpL transporters function and the identities of their substrates have not been fully elucidated. We report the characterization of Mycobacterium smegmatis MmpL11. We showed previously that M. smegmatis lacking MmpL11 has reduced membrane permeability that results in resistance to host antimicrobial peptides. We report herein the further characterization of the M. smegmatis mmpL11 mutant and identification of the MmpL11 substrates. We found that biofilm formation by the M. smegmatis mmpL11 mutant was distinct from that by wild-type M. smegmatis. Analysis of cell wall lipids revealed that the mmpL11 mutant failed to export the mycolic acid-containing lipids monomeromycolyl diacylglycerol and mycolate ester wax to the bacterial surface. In addition, analysis of total lipids indicated that the mycolic acid-containing precursor molecule mycolyl phospholipid accumulated in the mmpL11 mutant compared with wild-type mycobacteria. MmpL11 is encoded at a chromosomal locus that is conserved across pathogenic and nonpathogenic mycobacteria. Phenotypes of the M. smegmatis mmpL11 mutant are complemented by the expression of M. smegmatis or M. tuberculosis MmpL11, suggesting that MmpL11 plays a conserved role in mycobacterial cell wall biogenesis. PMID:23836904

  14. Growth inhibition of Mycobacterium smegmatis by prodrugs of deoxyxylulose phosphate reducto-isomerase inhibitors, promising anti-mycobacterial agents.

    PubMed

    Ponaire, Sarah; Zinglé, Catherine; Tritsch, Denis; Grosdemange-Billiard, Catherine; Rohmer, Michel

    2012-05-01

    Since Mycobacterium tuberculosis sets up several multiple anti-tuberculosis drug resistance mechanisms, development of new drugs with innovative target is urgent. The methylerythritol phosphate pathway (MEP) involved in the biosynthesis of essential metabolites for the survival of mycobacteria, represents such a target. Fosmidomycin 1a and FR900098 1b, two inhibitors of DXR, do not affect the viability of M. tuberculosis cells, due to a lack of uptake. To overcome the absence of the mycobacterial cell wall crossing of these compounds, we synthesized and tested the inhibition potency of acyloxymethyl phosphonate esters as prodrugs of fosmidomycin 1a, FR900098 1b and their analogs 2a and 2b on Mycobacterium smegmatis. Only the prodrugs 4b-6b inhibit the bacterial growth and could be effective anti-mycobacterial agents. PMID:22405649

  15. Short, Synthetic Cationic Peptides Have Antibacterial Activity against Mycobacterium smegmatis by Forming Pores in Membrane and Synergizing with Antibiotics

    PubMed Central

    Gupta, Kajal; Singh, Sameer; van Hoek, Monique L.

    2015-01-01

    Multicellular organisms are constantly exposed to a multitude of pathogenic microbes. Infection is inhibited in vivo by the innate and adaptive immune system. Mycobacterium species have emerged that are resistant to most antibiotics. We identified several naturally occurring cationic antimicrobial peptides that were active at low micromolar concentrations against Mycobacterium smegmatis. Human-derived cathelicidin LL-37 is well characterized and studied against M. smegmatis; we compared LL-37 with Chinese cobra-derived cathelicidin NA-CATH and mouse cathelicidin (mCRAMP). Two synthetic 11-residue peptides (ATRA-1A and ATRA-2) containing variations of a repeated motif within NA-CATH were tested for their activity against M. smegmatis along with a short synthetic peptide derivative from the human beta-defensin hBD3 (hBD3-Pep4). We hypothesized that these smaller synthetic peptides may demonstrate antimicrobial effectiveness with shorter length (and at less cost), making them strong potential candidates for development into broad-spectrum antimicrobial compounds or use in combination with antibiotics. These peptides have antimicrobial activity with EC50 ranging from 0.05 to 1.88 μg/mL against Mycobacterium smegmatis. The ATRA-1A short peptide was found to be the most effective antimicrobial peptide (AMP) (EC50 = 0.05 μg/mL). High bactericidal activity correlated with bacterial membrane depolarization and permeabilization activities. The efficacy of the peptides was further analyzed through Minimal Inhibitory Concentration (MIC) assays. The MICs were determined by the microdilution method. The peptide mCRAMP showed the best MIC activity at 15.6 μg/mL. Neither of the effective short synthetic peptides demonstrated synergy with the antibiotic rifampicin, although both demonstrated synergy with the cyclic peptide antibiotic polymyxin B. The peptides LL-37 and mCRAMP displayed synergism with rifampicin in MIC assays, whereas antibiotic polymyxin B displayed synergism

  16. Regulation Mechanism of the ald Gene Encoding Alanine Dehydrogenase in Mycobacterium smegmatis and Mycobacterium tuberculosis by the Lrp/AsnC Family Regulator AldR

    PubMed Central

    Jeong, Ji-A; Hyun, Jaekyung

    2015-01-01

    ABSTRACT In the presence of alanine, AldR, which belongs to the Lrp/AsnC family of transcriptional regulators and regulates ald encoding alanine dehydrogenase in Mycobacterium smegmatis, changes its quaternary structure from a homodimer to an octamer with an open-ring conformation. Four AldR-binding sites (O2, O1, O4, and O3) with a consensus sequence of GA/T-N2-NWW/WWN-N2-A/TC were identified upstream of the M. smegmatis ald gene by means of DNase I footprinting analysis. O2, O1, and O4 are required for the induction of ald expression by alanine, while O3 is directly involved in the repression of ald expression. In addition to O3, both O1 and O4 are also necessary for full repression of ald expression in the absence of alanine, due to cooperative binding of AldR dimers to O1, O4, and O3. Binding of a molecule of the AldR octamer to the ald control region was demonstrated to require two AldR-binding sites separated by three helical turns between their centers and one additional binding site that is in phase with the two AldR-binding sites. The cooperative binding of AldR dimers to DNA requires three AldR-binding sites that are aligned with a periodicity of three helical turns. The aldR gene is negatively autoregulated independently of alanine. Comparative analysis of ald expression of M. smegmatis and Mycobacterium tuberculosis in conjunction with sequence analysis of both ald control regions led us to suggest that the expression of the ald genes in both mycobacterial species is regulated by the same mechanism. IMPORTANCE In mycobacteria, alanine dehydrogenase (Ald) is the enzyme required both to utilize alanine as a nitrogen source and to grow under hypoxic conditions by maintaining the redox state of the NADH/NAD+ pool. Expression of the ald gene was reported to be regulated by the AldR regulator that belongs to the Lrp/AsnC (feast/famine) family, but the underlying mechanism was unknown. This study revealed the regulation mechanism of ald in Mycobacterium

  17. Isolation and Characterization of a Hybrid Respiratory Supercomplex Consisting of Mycobacterium tuberculosis Cytochrome bcc and Mycobacterium smegmatis Cytochrome aa3*

    PubMed Central

    Kim, Mi-Sun; Jang, Jichan; AB Rahman, Nurlilah Binte; Pethe, Kevin; Berry, Edward A.; Huang, Li-Shar

    2015-01-01

    Recently, energy production pathways have been shown to be viable antitubercular drug targets to combat multidrug-resistant tuberculosis and eliminate pathogen in the dormant state. One family of drugs currently under development, the imidazo[1,2-a]pyridine derivatives, is believed to target the pathogen's homolog of the mitochondrial bc1 complex. This complex, denoted cytochrome bcc, is highly divergent from mitochondrial Complex III both in subunit structure and inhibitor sensitivity, making it a good target for drug development. There is no soluble cytochrome c in mycobacteria to transport electrons from the bcc complex to cytochrome oxidase. Instead, the bcc complex exists in a “supercomplex” with a cytochrome aa3-type cytochrome oxidase, presumably allowing direct electron transfer. We describe here purification and initial characterization of the mycobacterial cytochrome bcc-aa3 supercomplex using a strain of M. smegmatis that has been engineered to express the M. tuberculosis cytochrome bcc. The resulting hybrid supercomplex is stable during extraction and purification in the presence of dodecyl maltoside detergent. It is hoped that this purification procedure will potentiate functional studies of the complex as well as crystallographic studies of drug binding and provide structural insight into a third class of the bc complex superfamily. PMID:25861988

  18. Expression, Purification And Crystallization of Native And Selenomethionine Labeled Mycobacterium Tuberculosis FDG1 (Rv0407) Using a Mycobacterium Smegmatis Expression System

    SciTech Connect

    Bashiri, G.; Squire, C.J.; Baker, E.N.; Moreland, N.J.

    2009-06-01

    FGD1 is an F{sub 420}-dependent glucose-6-phosphate dehydrogenase from Mycobacterium tuberculosis that has been shown to be essential for activation of the anti-TB compound PA-824. Initial attempts to produce recombinant FGD1 using Escherichia coli as a host was unsuccessful, but when the alternative host Mycobacterium smegmatis was used, soluble protein yields of 7 mg/L of culture were achieved. Both native and selenomethionine-substituted FGD1 were obtained by culturing M. smegmatis in autoinduction media protocols originally developed for E. coli. Using these media afforded the advantages of decreased handling, as cultures did not require monitoring of optical density and induction, and reduced cost by removing the need for expensive ADC enrichment normally used in mycobacterial cultures. Selenomethionine was efficiently incorporated at levels required for multiwavelength anomalous diffraction experiments used in crystal structure determination. As far as we are aware this is the first protocol for preparation of selenomethionine-substituted protein in mycobacteria. Native and selenomethionine-labeled FGD1 were successfully crystallized by vapor diffusion, with the crystals diffracting to 2.1 AA resolution.

  19. Crystal Structure of PhnF, a GntR-Family Transcriptional Regulator of Phosphate Transport in Mycobacterium smegmatis

    PubMed Central

    Busby, Jason N.; Fritz, Georg; Moreland, Nicole J.; Cook, Gregory M.; Lott, J. Shaun; Baker, Edward N.

    2014-01-01

    Bacterial uptake of phosphate is usually accomplished via high-affinity transporters that are commonly regulated by two-component systems, which are activated when the concentration of phosphate is low. Mycobacterium smegmatis possesses two such transporters, the widely distributed PstSCAB system and PhnDCE, a transporter that in other bacteria mediates the uptake of alternative phosphorus sources. We previously reported that the transcriptional regulator PhnF controls the production of the Phn system, acting as a repressor under high-phosphate conditions. Here we show that the phnDCE genes are common among environmental mycobacteria, where they are often associated with phnF-like genes. In contrast, pathogenic mycobacteria were not found to encode Phn-like systems but instead were found to possess multiple copies of the pst genes. A detailed biochemical analysis of PhnF binding to its identified binding sites in the phnD-phnF intergenic region of M. smegmatis has allowed us to propose a quantitative model for repressor binding, which shows that a PhnF dimer binds independently to each site. We present the crystal structure of M. smegmatis PhnF at 1.8-Å resolution, showing a homodimer with a helix-turn-helix N-terminal domain and a C-terminal domain with a UbiC transcription regulator-associated fold. The C-terminal domain crystallized with a bound sulfate ion instead of the so far unidentified physiological ligand, allowing the identification of residues involved in effector binding. Comparison of the positioning of the DNA binding domains in PhnF with that in homologous proteins suggests that its DNA binding activity is regulated via a conformational change in the linker region, triggering a movement of the N-terminal domains. PMID:25049090

  20. Characterization of the KstR2 regulator responsible of the lower cholesterol degradative pathway in Mycobacterium smegmatis.

    PubMed

    García-Fernández, Julia; Galán, Beatriz; Medrano, Francisco J; García, José L

    2015-02-01

    The interaction of KstR2-dependent promoters of the divergon constituted by the MSMEG_6000-5999 and MSMEG_6001-6004 operons of Mycobacterium smegmatis which encode the genes involved in the lower cholesterol degradative pathway has been characterized. Footprint analyses have demonstrated experimentally for the first time that KstR2 specifically binds to an operator region of 29 nucleotides containing the palindromic sequence AAGCAAGNNCTTGCTT. This region overlaps with the -10 and -35 boxes of the putative P(6000) and P(6001) divergent promoters, suggesting that KstR2 represses their transcription by preventing the binding of the ribonucleic acid polymerase. A three-dimensional model of the KstR2 protein revealed a typical TetR-type regulator folding with two domains, a deoxyribonucleic acid (DNA)-binding N-terminal domain and a regulator-binding C-terminal domain composed by three and six helices respectively. KstR2 is an all alpha protein as confirmed by circular dichroism. We have determined that M. smegmatis is able to grow using sitolactone (HIL) as the only carbon source and that this compound induces the kstR2 regulon in vivo. HIL or its open form 5OH-HIP were unable to release in vitro the KstR2-DNA operator interaction, suggesting that 5OH-HIP-CoA or a further derivative would induce the lower cholesterol catabolic pathway. PMID:25511435

  1. Comprehensive Proteomic Analysis of Nitrogen-Starved Mycobacterium smegmatis Δpup Reveals the Impact of Pupylation on Nitrogen Stress Response.

    PubMed

    Fascellaro, Giuseppina; Petrera, Agnese; Lai, Zon Weng; Nanni, Paolo; Grossmann, Jonas; Burger, Sibylle; Biniossek, Martin L; Gomez-Auli, Alejandro; Schilling, Oliver; Imkamp, Frank

    2016-08-01

    Pupylation is a bacterial ubiquitin-like protein modification pathway, which results in the attachment of the small protein Pup to specific lysine residues of cellular targets. Pup was shown to serve as a degradation signal, directing proteins toward the bacterial proteasome for turnover. Recently, it was hypothesized that pupylation and proteasomal protein degradation support the survival of Mycobacterium smegmatis (Msm) during nitrogen starvation by supplying recycled amino acids. In the present study we generated a Pup deletion strain to investigate the influence of pupylation on Msm proteome in the absence of nitrogen sources. Quantitative proteomic analyses revealed a relatively low impact of Pup on MsmΔpup proteome immediately after exposure to growth medium lacking nitrogen. Less than 5.4% of the proteins displayed altered cellular levels when compared to Msm wild type. In contrast, post 24 h of nitrogen starvation 501 proteins (41% of the total quantified proteome) of Msm pup deletion strain showed significant changes in abundance. Noteworthy, important players involved in nitrogen assimilation were significantly affected in MsmΔpup. Furthermore, we quantified pupylated proteins of nitrogen-starved Msm to gain more detailed insights in the role of pupylation in surviving and overcoming the lack of nitrogen. PMID:27378031

  2. Biological and structural characterization of the Mycobacterium smegmatis nitroreductase NfnB, and its role in benzothiazinone resistance.

    PubMed

    Manina, Giulia; Bellinzoni, Marco; Pasca, Maria Rosalia; Neres, João; Milano, Anna; Ribeiro, Ana Luisa De Jesus Lopes; Buroni, Silvia; Skovierová, Henrieta; Dianišková, Petronela; Mikušová, Katarína; Marák, Jozef; Makarov, Vadim; Giganti, David; Haouz, Ahmed; Lucarelli, Anna Paola; Degiacomi, Giulia; Piazza, Aurora; Chiarelli, Laurent R; De Rossi, Edda; Salina, Elena; Cole, Stewart T; Alzari, Pedro M; Riccardi, Giovanna

    2010-09-01

    Tuberculosis is still a leading cause of death in developing countries, for which there is an urgent need for new pharmacological agents. The synthesis of the novel antimycobacterial drug class of benzothiazinones (BTZs) and the identification of their cellular target as DprE1 (Rv3790), a component of the decaprenylphosphoryl-β-d-ribose 2'-epimerase complex, have been reported recently. Here, we describe the identification and characterization of a novel resistance mechanism to BTZ in Mycobacterium smegmatis. The overexpression of the nitroreductase NfnB leads to the inactivation of the drug by reduction of a critical nitro-group to an amino-group. The direct involvement of NfnB in the inactivation of the lead compound BTZ043 was demonstrated by enzymology, microbiological assays and gene knockout experiments. We also report the crystal structure of NfnB in complex with the essential cofactor flavin mononucleotide, and show that a common amino acid stretch between NfnB and DprE1 is likely to be essential for the interaction with BTZ. We performed docking analysis of NfnB-BTZ in order to understand their interaction and the mechanism of nitroreduction. Although Mycobacterium tuberculosis seems to lack nitroreductases able to inactivate these drugs, our findings are valuable for the design of new BTZ molecules, which may be more effective in vivo. PMID:20624223

  3. The Non-Essential Mycolic Acid Biosynthesis Genes hadA and hadC Contribute to the Physiology and Fitness of Mycobacterium smegmatis

    PubMed Central

    Jamet, Stevie; Slama, Nawel; Domingues, Joana; Laval, Françoise; Texier, Pauline; Eynard, Nathalie; Quémard, Annaik; Peixoto, Antonio; Lemassu, Anne; Daffé, Mamadou; Cam, Kaymeuang

    2015-01-01

    Gram positive mycobacteria with a high GC content, such as the etiological agent of tuberculosis Mycobacterium tuberculosis, possess an outer membrane mainly composed of mycolic acids (MAs), the so-called mycomembrane, which is essential for the cell. About thirty genes are involved in the biosynthesis of MAs, which include the hadA, hadB and hadC genes that encode the dehydratases Fatty Acid Synthase type II (FAS-II) known to function as the heterodimers HadA-HadB and HadB-HadC. The present study shows that M. smegmatis cells remain viable in the absence of either HadA and HadC or both. Inactivation of HadC has a dramatic effect on the physiology and fitness of the mutant strains whereas that of HadA exacerbates the phenotype of a hadC deletion. The hadC mutants exhibit a novel MA profile, display a distinct colony morphology, are less aggregated, are impaired for sliding motility and biofilm development and are more resistant to detergent. Conversely, the hadC mutants are significantly more susceptible to low- and high-temperature and to selective toxic compounds, including several current anti-tubercular drugs. PMID:26701652

  4. Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis.

    PubMed

    Uhía, Iria; Galán, Beatriz; Medrano, Francisco Javier; García, José Luis

    2011-09-01

    The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P₅₂₂₈ promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P₅₂₂₈ promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P₅₂₂₈-β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P₅₂₂₈ promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism. PMID:21565928

  5. Crystal Structure of Reduced MsAcg, a Putative Nitroreductase from Mycobacterium smegmatis and a Close Homologue of Mycobacterium tuberculosis Acg

    PubMed Central

    Chauviac, François-Xavier; Bommer, Martin; Yan, Jun; Parkin, Gary; Daviter, Tina; Lowden, Philip; Raven, Emma L.; Thalassinos, Konstantinos; Keep, Nicholas H.

    2012-01-01

    This paper presents the structure of MsAcg (MSMEG_5246), a Mycobacterium smegmatis homologue of Mycobacterium tuberculosis Acg (Rv2032) in its reduced form at 1.6 Å resolution using x-ray crystallography. Rv2032 is one of the most induced genes under the hypoxic model of tuberculosis dormancy. The Acg family turns out to be unusual flavin mononucleotide (FMN)-binding proteins that have probably arisen by gene duplication and fusion from a classical homodimeric nitroreductase such that the monomeric protein resembles a classical nitroreductase dimer but with one active site deleted and the other active site covered by a unique lid. The FMN cofactor is not reduced by either NADH or NADPH, but the chemically reduced enzyme is capable of reduction of nitro substrates, albeit at no kinetic advantage over free FMN. The reduced enzyme is rapidly oxidized by oxygen but without any evidence for a radical state commonly seen in oxygen-sensitive nitroreductases. The presence of the unique lid domain, the lack of reduction by NAD(P)H, and the slow rate of reaction of the chemically reduced protein raises a possible alternative function of Acg proteins in FMN storage or sequestration from other biochemical pathways as part of the bacteria's adaptation to a dormancy state. PMID:23148223

  6. The Mechanism of Mycobacterium smegmatis PafA Self-Pupylation

    PubMed Central

    Chen, Xuejie; Li, Chandan; Wang, Li; Liu, Yi; Li, Chuanyou; Zhang, Junjie

    2016-01-01

    PafA, the prokaryotic ubiquitin-like protein (Pup) ligase, catalyzes the Pup modification of bacterial proteins and targets the substrates for proteasomal degradation. It has been reported that that M. smegmatis PafA can be poly-pupylated. In this study, the mechanism of PafA self-pupylation is explored. We found that K320 is the major target residue for the pupylation of PafA. During the self-pupylation of PafA, the attachment of the first Pup to PafA is catalyzed by the other PafA molecule through an intermolecular reaction, while the formation of the polymeric Pup chain is carried out in an intramolecular manner through the internal ligase activity of the already pupylated PafA. Among the three lysine residues, K7, K31 and K61, in M. smegmatis Pup, K7 and K31 are involved in the formation of the poly-Pup chain in PafA poly-pupylation. Poly-pupylation of PafA can be reversibly regulated by depupylase Dop. The polymeric Pup chain formed through K7/K31 linkage is much more sensitive to Dop than the mono-Pup directly attached to PafA. Moreover, self-pupylation of PafA is involved in the regulation of its stability in vivo in a proteasome-dependent manner, suggesting that PafA self-pupylation functions as a mechanism in the auto-regulation of the Pup-proteasome system. PMID:26953889

  7. Novel Polyoxyethylene-Containing Glycolipids Are Synthesized in Corynebacterium matruchotii and Mycobacterium smegmatis Cultured in the Presence of Tween 80

    PubMed Central

    Wang, Cindy; Mahrous, Engy A.; Lee, Richard E.; Vestling, Martha M.; Takayama, Kuni

    2011-01-01

    The addition of polyoxyethylene sorbitan monooleate (Tween 80) to a culture of mycobacteria greatly influences cell permeability and sensitivity to antibiotics but very little is known regarding the underlying mechanism. Here we show that Corynebacterium matruchotii (surrogate of mycobacteria) converts Tween 80 to a structural series of polyoxyethylenic acids which are then used to form novel series-2A and series-2B glycolipids. Minor series-3 glycolipids were also synthesized. The polyoxyethylenic acids replaced corynomycolic acids in the cell wall. Correspondingly the trehalose dicorynomycolate content was reduced. MALDI mass spectrometry, MS-MS, 1H-NMR, and 13C-NMR were used to characterize the series-2 glycolipids. Series-2A glycolipid is trehalose 6-C36:2-corynomycolate-6′-polyoxyethylenate and series-2B glycolipid is trehalose 6-C36:2-corynomycolate-6′-furan ring-containing polyoxyethylenate. Mycobacterium smegmatis grown in the presence of Tween 80 also synthesizes series-2 type glycolipids. The synthesis of these novel glycolipids in corynebacteria and mycobacteria should result in gross changes in the cell wall permeability and drug sensitivity. PMID:21490808

  8. Iron transport in Mycobacterium smegmatis: occurrence of iron-regulated envelope proteins as potential receptors for iron uptake.

    PubMed

    Hall, R M; Sritharan, M; Messenger, A J; Ratledge, C

    1987-08-01

    Cell-envelope fractions were isolated from the rapidly growing saprophyte Mycobacterium smegmatis following growth in glycerol/asparagine medium under both iron-limited (0.02 microgram Fe ml-1) and iron-sufficient (2.0 to 4.0 micrograms Fe ml-1) conditions. Examination of these preparations by SDS-PAGE demonstrated the production of at least four additional proteins when iron was limiting. These iron-regulated envelope proteins (IREPs) were ascribed apparent molecular masses of 180 kDa (protein I), 84 kDa (protein II), 29 kDa (protein III) and 25 kDa (protein IV). All four proteins were present in both cell-wall and membrane preparations but spheroplast preparations were devoid of the 29 kDa protein. Attempts at labelling the proteins with 55FeCl3 or 55Fe-exochelin, the siderophore for iron uptake, were unsuccessful, though this was attributed to the denatured state of the proteins following electrophoresis. Antibodies were raised to each of the four proteins: the one raised to protein III inhibited exochelin-mediated iron uptake into iron-deficiently grown cells by 70% but was ineffective against iron uptake into iron-sufficiently grown cells. As exochelin is taken up into both types of cells by a similar process, protein III may not be a simple receptor for iron uptake though the results imply some function connected with this process. The role of the other IREPs is less certain. PMID:3127539

  9. Adaptation of Mycobacterium smegmatis to an Industrial Scale Medium and Isolation of the Mycobacterial PorinMspA.

    PubMed

    Wendel, Sebastian O; Perera, Ayomi S; Pfromm, Peter H; Czermak, Peter; Bossmann, Stefan H

    2013-01-01

    The adaptation of the organism to a simple and cost-effective growth medium is mandatory in developing a process for large scale production of the octamericporinMspA, which is isolated from Mycobacterium smegmatis. A fermentation optimization with the minimal nutrients required for growth has been performed. During the fermentation, the iron- and ammonium chloride concentrations in the medium were varied to determine their impact on the observed growth rates and cell mass yields. Common antibiotics to control contamination were eliminated in favor of copper sulfate to reduce costs. MspA has been successfully isolated from the harvested M. smegmatisusing aqueous nOPOE (n-octyloligooxyethylene) at 65°C. Because of the extraordinary stability of MspA, it is possible to denature and precipitate virtually all other proteins and contaminants by following this approach. To further purify the product, acetone is used for precipitation. Gel electrophoresis confirmed the presence and purity of MspA. A maximum of 840µg (via Bradford assay) of pure MspA per liter of the optimized simple growth medium has been obtained. This is a 40% increase with respect to the previously reported culture medium for MspA. PMID:23802026

  10. The cytochrome bd-type quinol oxidase is important for survival of Mycobacterium smegmatis under peroxide and antibiotic-induced stress.

    PubMed

    Lu, Ping; Heineke, Marieke H; Koul, Anil; Andries, Koen; Cook, Gregory M; Lill, Holger; van Spanning, Rob; Bald, Dirk

    2015-01-01

    Targeting respiration and ATP synthesis has received strong interest as a new strategy for combatting drug-resistant Mycobacterium tuberculosis. Mycobacteria employ a respiratory chain terminating with two branches. One of the branches includes a cytochrome bc1 complex and an aa3-type cytochrome c oxidase while the other branch terminates with a cytochrome bd-type quinol oxidase. In this communication we show that genetic inactivation of cytochrome bd, but not of cytochrome bc1, enhances the susceptibility of Mycobacterium smegmatis to hydrogen peroxide and antibiotic-induced stress. The type-II NADH dehydrogenase effector clofazimine and the ATP synthase inhibitor bedaquiline were bacteriostatic against wild-type M. smegmatis, but strongly bactericidal against a cytochrome bd mutant. We also demonstrated that the quinone-analog aurachin D inhibited mycobacterial cytochrome bd at sub-micromolar concentrations. Our results identify cytochrome bd as a key survival factor in M. smegmatis during antibiotic stress. Targeting the cytochrome bd respiratory branch therefore appears to be a promising strategy that may enhance the bactericidal activity of existing tuberculosis drugs. PMID:26015371

  11. Evaluation of specific humoral immune response and cross reactivity against Mycobacterium tuberculosis antigens induced in mice immunized with liposomes composed of total lipids extracted from Mycobacterium smegmatis.

    PubMed

    de los Angeles García, María; Borrero, Reinier; Marrón, Reynel; Lanio, María E; Canet, Lien; Otero, Oscar; Kadir, Ramlah; Suraiya, Siti; Zayas, Caridad; López, Yamilé; Nor Norazmi, Mohd; Sarmiento, Maria E; Acosta, Armando

    2013-01-01

    The development of a new tuberculosis (TB) vaccine has become one of the main objectives of the scientific community. Protein antigens have been widely explored as subunit TB vaccines, however lipid antigens could be equally important to be used or included in such a vaccine. The aim of this study was to demonstrate the potential of a liposome formulation composed of an extract of lipids from Mycobacterium smegmatis (Ms) as a TB vaccine candidate. We evaluated the immunogenicity of this formulation as well as the cross reactive response against antigens from Mycobacterium tuberculosis (MTb) in BALB/c mice. We determined the anti-liposome IgG response in sera from TB patients and from healthy subjects who displayed a positive (PPD+) or negative (PPD-) tuberculin skin test. A significant increase in anti-liposome IgG (p<0.05) was detected in animals immunized with Bacille Calmette-Guérin (BCG) compared with all groups, and in the group immunized with liposomes from Ms (LMs) compared to animals immunized with either LMs adjuvanted with aluminium (LMs-A) or the negative control group (phosphate buffered saline, PBS) respectively. With respect to the cross reactive response against a cocktail of cell wall antigens (CWA) from MTb, significantly higher IgG levels were observed in animals immunized with BCG and LMs compared to negative controls and either, aluminium-adjuvanted liposomes (LMs-A) or montanide (LMs-M) (p<0.05). Furthermore, the anti-liposome IgG response was significantly superior in sera from pulmonary TB patients compared to PPD+ and PPD- healthy subjects (p<0.001) suggesting the expression of these antigens in vivo during active MTb infection. The results obtained provide some evidence for the potential use of liposomes containing total lipid extracts of Ms as a TB vaccine candidate. PMID:23458421

  12. Central metabolism in Mycobacterium smegmatis during the transition from O2-rich to O2-poor conditions as studied by isotopomer-assisted metabolite analysis.

    PubMed

    Tang, Yinjie J; Shui, Wenqing; Myers, Samuel; Feng, Xueyang; Bertozzi, Carolyn; Keasling, Jay D

    2009-08-01

    Isotopomer-assisted metabolite analysis was used to investigate the central metabolism of Mycobacterium smegmatis and its transition from normal growth to a non-replicating state under a hypoxic environment. Tween 80 significantly promoted aerobic growth by improving O(2) transfer, while only small amount was degraded and metabolized via the TCA cycle for biomass synthesis. As the bacillus encountered hypoxic stress, isotopomer analysis suggested: (1) isocitrate lyase activity increased, which further induced glyoxylate pathway and glycine dehydrogenase for replenishing NAD(+); (2) the relative amount of acetyl-CoA entering the TCA cycle was doubled, whereas little entered the glycolytic and pentose phosphate pathways. PMID:19357814

  13. A General Strategy for the Discovery of Metabolic Pathways: d-Threitol, l-Threitol, and Erythritol Utilization in Mycobacterium smegmatis.

    PubMed

    Huang, Hua; Carter, Michael S; Vetting, Matthew W; Al-Obaidi, Nawar; Patskovsky, Yury; Almo, Steven C; Gerlt, John A

    2015-11-25

    We describe a general integrated bioinformatic and experimental strategy to discover the in vitro enzymatic activities and in vivo functions (metabolic pathways) of uncharacterized enzymes discovered in microbial genome projects using the ligand specificities of the solute binding proteins (SBPs) for ABC transporters. Using differential scanning fluorimetry, we determined that the SBP for an ABC transporter encoded by the genome of Mycobacterium smegmatis is stabilized by d-threitol. Using sequence similarity networks and genome neighborhood networks to guide selection of target proteins for pathway enzymes, we applied both in vitro and in vivo experimental approaches to discover novel pathways for catabolism of d-threitol, l-threitol, and erythritol. PMID:26560079

  14. Essentiality of Succinate Dehydrogenase in Mycobacterium smegmatis and Its Role in the Generation of the Membrane Potential Under Hypoxia

    PubMed Central

    Pecsi, Ildiko; Hards, Kiel; Ekanayaka, Nandula; Berney, Michael; Hartman, Travis; Jacobs, William R.

    2014-01-01

    ABSTRACT Succinate:quinone oxidoreductase (Sdh) is a membrane-bound complex that couples the oxidation of succinate to fumarate in the cytoplasm to the reduction of quinone to quinol in the membrane. Mycobacterial species harbor genes for two putative sdh operons, but the individual roles of these two operons are unknown. In this communication, we show that Mycobacterium smegmatis mc2155 expresses two succinate dehydrogenases designated Sdh1 and Sdh2. Sdh1 is encoded by a five-gene operon (MSMEG_0416-MSMEG_0420), and Sdh2 is encoded by a four-gene operon (MSMEG_1672-MSMEG_1669). These two operons are differentially expressed in response to carbon limitation, hypoxia, and fumarate, as monitored by sdh promoter-lacZ fusions. While deletion of the sdh1 operon did not yield any growth phenotypes on succinate or other nonfermentable carbon sources, the sdh2 operon could be deleted only in a merodiploid background, demonstrating that Sdh2 is essential for growth. Sdh activity and succinate-dependent proton pumping were detected in cells grown aerobically, as well as under hypoxia. Fumarate reductase activity was absent under these conditions, indicating that neither Sdh1 nor Sdh2 could catalyze the reverse reaction. Sdh activity was inhibited by the Sdh inhibitor 3-nitroproprionate (3NP), and treatment with 3NP dissipated the membrane potential of wild-type or Δsdh1 mutant cells under hypoxia but not that of cells grown aerobically. These data imply that Sdh2 is the generator of the membrane potential under hypoxia, an essential role for the cell. PMID:25118234

  15. The role of iron in Mycobacterium smegmatis biofilm formation: the exochelin siderophore is essential in limiting iron conditions for biofilm formation but not for planktonic growth

    PubMed Central

    Ojha, Anil; Hatfull, Graham F

    2007-01-01

    Many species of mycobacteria form structured biofilm communities at liquid–air interfaces and on solid surfaces. Full development of Mycobacterium smegmatis biofilms requires addition of supplemental iron above 1 μM ferrous sulphate, although addition of iron is not needed for planktonic growth. Microarray analysis of the M. smegmatis transcriptome shows that iron-responsive genes – especially those involved in siderophore synthesis and iron uptake – are strongly induced during biofilm formation reflecting a response to iron deprivation, even when 2 μM iron is present. The acquisition of iron under these conditions is specifically dependent on the exochelin synthesis and uptake pathways, and the strong defect of an iron–exochelin uptake mutant suggests a regulatory role of iron in the transition to biofilm growth. In contrast, although the expression of mycobactin and iron ABC transport operons is highly upregulated during biofilm formation, mutants in these systems form normal biofilms in low-iron (2 μM) conditions. A close correlation between iron availability and matrix-associated fatty acids implies a possible metabolic role in the late stages of biofilm maturation, in addition to the early regulatory role. M. smegmatis surface motility is similarly dependent on iron availability, requiring both supplemental iron and the exochelin pathway to acquire it. PMID:17854402

  16. Cloning, expression, purification, crystallization and preliminary X-ray studies of a pyridoxine 5′-phosphate oxidase from Mycobacterium smegmatis

    SciTech Connect

    Jackson, Colin J. Taylor, Matthew C.; Tattersall, David B.; French, Nigel G.; Carr, Paul D.; Ollis, David L.; Russell, Robyn J.; Oakeshott, John G.

    2008-05-01

    Good-quality crystals of selenomethionine-substituted Msmeg-3380 were obtained by the hanging-drop vapour-diffusion technique and diffracted to 1.2 Å using synchrotron radiation. Pyridoxine 5′-phosphate oxidases (PNPOxs) are known to catalyse the terminal step in pyridoxal 5′-phosphate biosynthesis in a flavin mononucleotide-dependent manner in humans and Escherichia coli. Recent reports of a putative PNPOx from Mycobacterium tuberculosis, Rv1155, suggest that the cofactor or catalytic mechanism may differ in Mycobacterium species. To investigate this, a putative PNPOx from M. smegmatis, Msmeg-3380, has been cloned. This enzyme has been recombinantly expressed in E. coli and purified to homogeneity. Good-quality crystals of selenomethionine-substituted Msmeg-3380 were obtained by the hanging-drop vapour-diffusion technique and diffracted to 1.2 Å using synchrotron radiation.

  17. A role for the class A penicillin-binding protein PonA2 in the survival of Mycobacterium smegmatis under conditions of nonreplication.

    PubMed

    Patru, Maria-Magdalena; Pavelka, Martin S

    2010-06-01

    Class A penicillin-binding proteins (PBPs) are large, bifunctional proteins that are responsible for glycan chain assembly and peptide cross-linking of bacterial peptidoglycan. Bacteria in the genus Mycobacterium have been reported to have only two class A PBPs, PonA1 and PonA2, that are encoded in their genomes. We report here that the genomes of Mycobacterium smegmatis and other soil mycobacteria contain an additional gene encoding a third class A penicillin-binding protein, PonA3, which is a paralog of PonA2. Both the PonA2 and PonA3 proteins contain a penicillin-binding protein and serine/threonine protein kinase-associated (PASTA) domain that we propose may be involved in sensing the cell cycle and a C-terminal proline-rich region (PRR) that may have a role in protein-protein or protein-carbohydrate interactions. We show here that an M. smegmatis Delta ponA2 mutant has an unusual antibiotic susceptibility profile, exhibits a spherical morphology and an altered cell surface in stationary phase, and is defective for stationary-phase survival and recovery from anaerobic culture. In contrast, a Delta ponA3 mutant has no discernible phenotype under laboratory conditions. We demonstrate that PonA2 and PonA3 can bind penicillin and that PonA3 can partially substitute for PonA2 when ponA3 is expressed from a constitutive promoter on a multicopy plasmid. Our studies suggest that PonA2 is involved in adaptation to periods of nonreplication in response to starvation or anaerobiosis and that PonA3 may have a similar role. However, the regulation of PonA3 is likely different, suggesting that its importance could be related to stresses encountered in the environmental niches occupied by M. smegmatis and other soil-dwelling mycobacteria. PMID:20400545

  18. Immunogenicity of a Recombinant Mycobacterium smegmatis Vaccine Expressing the Fusion Protein CMX in Cattle from Goiás State, Brazil

    PubMed Central

    ALVES DA SILVA, Duanne; CAVALCANTI, Marcos Antônio Rocha; MUNIZ DE OLIVEIRA, Fábio; TRENTINI, Monalisa Martins; JUNQUEIRA-KIPNIS, Ana Paula; KIPNIS, André

    2014-01-01

    ABSTRACT This study aimed to evaluate the immunogenicity of a recombinant Mycobacterium smegmatis vaccine expressing the CMX fusion protein composed of immunodominant epitopes Ag85C, MPT51 and HspX of Mycobacterium tuberculosis, which are important mycobacteria virulence factors. A group of Nelore heifers that were 10 to 12 months of age and negative for the tuberculin skin test (TST) were immunized with four doses of the recombinant vaccine mc2-CMX (M. smegmatis-Ag85C-MPT51-HspX) during a period of one year. Before each immunization, blood was collected to obtain sera for antibody analysis. Serological analysis demonstrated that mc2-CMX was able to induce a humoral response with increased levels of specific IgG antibodies against CMX, despite minimum antibody levels being detected for individual Ag85C, MPT51 or HspX recombinant antigens. However, there was no significant increase in specific CD4+ IFN-γ-positive T cells. Lymphadenomegaly was observed in superficial cervical lymph nodes adjacent to the site of vaccination among mc2-CMX-vaccinated bovines, and the histopathological analysis demonstrated follicular hyperplasia without inflammatory infiltrate or granuloma formation. Animals remained negative for the TST until the end of the experiments, showing no cross-reactivity with the recombinant vaccine and tuberculin proteins. We discuss the potential of mc2-CMX to induce an immune response in cattle. PMID:24681608

  19. Genome-wide mapping of the distribution of CarD, RNAP σA, and RNAP β on the Mycobacterium smegmatis chromosome using chromatin immunoprecipitation sequencing

    PubMed Central

    Landick, Robert; Krek, Azra; Glickman, Michael S.; Socci, Nicholas D.; Stallings, Christina L.

    2014-01-01

    CarD is an essential mycobacterial protein that binds the RNA polymerase (RNAP) and affects the transcriptional profile of Mycobacterium smegmatis and Mycobacterium tuberculosis [6]. We predicted that CarD was directly regulating RNAP function but our prior experiments had not determined at what stage of transcription CarD was functioning and at which genes CarD interacted with the RNAP. To begin to address these open questions, we performed chromatin immunoprecipitation sequencing (ChIP-seq) to survey the distribution of CarD throughout the M. smegmatis chromosome. The distribution of RNAP subunits β and σA were also profiled. We expected that RNAP β would be present throughout transcribed regions and RNAP σA would be predominantly enriched at promoters based on work in Escherichia coli [3], however this had yet to be determined in mycobacteria. The ChIP-seq analyses revealed that CarD was never present on the genome in the absence of RNAP, was primarily associated with promoter regions, and was highly correlated with the distribution of RNAP σA. The colocalization of σA and CarD led us to propose that in vivo, CarD associates with RNAP initiation complexes at most promoters and is therefore a global regulator of transcription initiation. Here we describe in detail the data from the ChIP-seq experiments associated with the study published by Srivastava and colleagues in the Proceedings of the National Academy of Science in 2013 [5] as well as discuss the findings from this dataset in relation to both CarD and mycobacterial transcription as a whole. The ChIP-seq data have been deposited in the Gene Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE48164). PMID:25089258

  20. Intranasal Administration of Recombinant Mycobacterium smegmatis Inducing IL-17A Autoantibody Attenuates Airway Inflammation in a Murine Model of Allergic Asthma

    PubMed Central

    Guo, Sheng; Wu, Liangxia; Zhang, Jianhua

    2016-01-01

    Asthma is a chronic inflammatory disorder, previous studies have shown that IL-17A contributes to the development of asthma, and there is a positive correlation between the level of IL-17A and the severity of disease. Here, we constructed recombinant Mycobacterium smegmatis expressing fusion protein Ag85A-IL-17A (rMS-Ag85a-IL-17a) and evaluated whether it could attenuate allergic airway inflammation, and further investigated the underlying mechanism. In this work, the murine model of asthma was established with ovalbumin, and mice were intranasally vaccinated with rMS-Ag85a-IL-17a. Autoantibody of IL-17A in sera was detected, and the airway inflammatory cells infiltration, the local cytokines and chemokines production and the histopathological changes of lung tissue were investigated. We found that the administration of rMS-Ag85a-IL-17a induced the autoantibody of IL-17A in sera. The vaccination of rMS-Ag85a-IL-17a remarkably reduced the infiltration of inflammatory cells and the secretion of mucus in lung tissue and significantly decreased the numbers of the total cells, eosinophils and neutrophils in BALF. Th1 cells count in spleen, Th1 cytokine levels in BALF and supernatant of splenocytes and mediastinal lymph nodes, and T-bet mRNA in lung tissue were significantly increased with rMS-Ag85a-IL-17a administration. Meanwhile, rMS-Ag85a-IL-17a vaccination markedly decreased Th2 cells count, Th2 cytokine and Th17 cytokine levels in BALF and supernatant of splenocytes and mediastinal lymph nodes, and chemokines mRNA expression in lung tissue. These data confirmed that recombinant Mycobacterium smegmatis in vivo could induce autoantibody of IL-17A, which attenuated asthmatic airway inflammation. PMID:26974537

  1. Genome-Wide Mapping of the Distribution of CarD, RNAP σ(A), and RNAP β on the Mycobacterium smegmatis Chromosome using Chromatin Immunoprecipitation Sequencing.

    PubMed

    Landick, Robert; Krek, Azra; Glickman, Michael S; Socci, Nicholas D; Stallings, Christina L

    2014-12-01

    CarD is an essential mycobacterial protein that binds the RNA polymerase (RNAP) and affects the transcriptional profile of Mycobacterium smegmatis and Mycobacterium tuberculosis (6). We predicted that CarD was directly regulating RNAP function but our prior experiments had not determined at what stage of transcription CarD was functioning and at which genes CarD interacted with the RNAP. To begin to address these open questions, we performed Chromatin Immunoprecipitation sequencing (ChIP-seq) to survey the distribution of CarD throughout the M. smegmatis chromosome. The distribution of RNAP subunits β and σ(A) were also profiled. We expected that RNAP β would be present throughout transcribed regions and RNAP σ(A) would be predominantly enriched at promoters based on work in Escherichia coli (3), however this had yet to be determined in mycobacteria. The ChIP-seq analyses revealed that CarD was never present on the genome in the absence of RNAP, was primarily associated with promoter regions, and was highly correlated with the distribution of RNAP σ(A). The colocalization of σ(A) and CarD led us to propose that in vivo, CarD associates with RNAP initiation complexes at most promoters and is therefore a global regulator of transcription initiation. Here we describe in detail the data from the ChIP-seq experiments associated with the study published by Srivastava and colleagues in the Proceedings of the National Academy of Science in 2013 (5) as well as discuss the findings from this dataset in relation to both CarD and mycobacterial transcription as a whole. The ChIP-seq data have been deposited in the Gene Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE48164). PMID:25089258

  2. Strain Variation in Mycobacterium marinum Fish Isolates

    PubMed Central

    Ucko, M.; Colorni, A.; Kvitt, H.; Diamant, A.; Zlotkin, A.; Knibb, W. R.

    2002-01-01

    A molecular characterization of two Mycobacterium marinum genes, 16S rRNA and hsp65, was carried out with a total of 21 isolates from various species of fish from both marine and freshwater environments of Israel, Europe, and the Far East. The nucleotide sequences of both genes revealed that all M. marinum isolates from fish in Israel belonged to two different strains, one infecting marine (cultured and wild) fish and the other infecting freshwater (cultured) fish. A restriction enzyme map based on the nucleotide sequences of both genes confirmed the divergence of the Israeli marine isolates from the freshwater isolates and differentiated the Israeli isolates from the foreign isolates, with the exception of one of three Greek isolates from marine fish which was identical to the Israeli marine isolates. The second isolate from Greece exhibited a single base alteration in the 16S rRNA sequence, whereas the third isolate was most likely a new Mycobacterium species. Isolates from Denmark and Thailand shared high sequence homology to complete identity with reference strain ATCC 927. Combined analysis of the two gene sequences increased the detection of intraspecific variations and was thus of importance in studying the taxonomy and epidemiology of this aquatic pathogen. Whether the Israeli M. marinum strain infecting marine fish is endemic to the Red Sea and found extremely susceptible hosts in the exotic species imported for aquaculture or rather was accidentally introduced with occasional imports of fingerlings from the Mediterranean Sea could not be determined. PMID:12406715

  3. DarR, a TetR-like transcriptional factor, is a cyclic di-AMP-responsive repressor in Mycobacterium smegmatis.

    PubMed

    Zhang, Lei; Li, Weihui; He, Zheng-Guo

    2013-02-01

    Cyclic dinucleotides, including cyclic di-AMP (c-di-AMP), are known to be ubiquitous second messengers involved in bacterial signal transduction. However, no transcriptional regulator has been characterized as a c-di-AMP receptor/effector to date. In the present study, using a c-di-AMP/transcription factor binding screen, we identified Ms5346, a TetR family regulator in Mycobacterium smegmatis, as a c-di-AMP receptor in bacteria. Ms5346 could specifically bind c-di-AMP with K(d) of 2.3 ± 0.5 μM. Using EMSA and DNase I footprinting assays, c-di-AMP was found to stimulate the DNA binding activity of Ms5346 and to enhance its ability to protect its target DNA sequence. A conserved 14-bp palindromic motif was identified as the DNA-binding site for Ms5346. Further, Ms5346 was found to negatively regulate expression of three target genes including Ms5347 (encoding a major facilitator family transporter), Ms5348 (encoding a medium chain fatty acyl-CoA ligase), and Ms5696 (encoding a cold shock protein, CspA). Ms5346 is the first cyclic di-AMP receptor regulator to be identified in bacteria, and we have designated it as DarR. Our findings enhance our understanding of the function and regulatory mechanism of the second messenger c-di-AMP in bacteria. PMID:23250743

  4. Vitamin C induced DevR-dependent synchronization of Mycobacterium smegmatis growth and its effect on the proliferation of mycobacteriophage D29.

    PubMed

    Kirtania, Prithwiraj; Ghosh, Shreya; Bhawsinghka, Niketa; Chakladar, Madhumita; Das Gupta, Sujoy K

    2016-06-01

    Vitamin C is known to inhibit mycobacterial growth by acting as a hypoxia inducing agent. While investigating how mycobacteriophage growth is influenced by hypoxic conditions induced by vitamin C, using Mycobacterium smegmatis- mycobacteriophage D29 as a model system, it was observed that prior exposure of the host to such conditions resulted in increased burst size of the phage. Vitamin C pre-exposure was also found to induce synchronous growth of the host. A mutant defective in DevR, the response regulator that controls hypoxic responses in mycobacteria, neither supported higher phage bursts nor was it able to undergo synchronized growth following vitamin C pre-exposure, indicating thereby that the two phenomena are interrelated. Further evidence supporting such an interrelationship was obtained from the observation that phage burst sizes varied depending on the stage of synchronous growth that the host cells were in, at the time of infection-higher bursts were observed in the resting/synthetic phases and lower in the dividing ones. The effects were specific in nature as synchronization by an unrelated method, known as 'crowding', did not lead to the same consequence. The results indicate that growth synchronization induced by vitamin C treatment is a DevR-dependent phenomenon which is exploited by mycobacteriophage D29 to grow in larger numbers. PMID:27190284

  5. Iron-sparing Response of Mycobacterium avium subsp. paratuberculosis is strain dependent

    PubMed Central

    2010-01-01

    Background Two genotypically and microbiologically distinct strains of Mycobacterium avium subsp. paratuberculosis (MAP) exist - S and C MAP strains that primarily infect sheep and cattle, respectively. Concentration of iron in the cultivation medium has been suggested as one contributing factor for the observed microbiologic differences. We recently demonstrated that S strains have defective iron storage systems, leading us to propose that these strains might experience iron toxicity when excess iron is provided in the medium. To test this hypothesis, we carried out transcriptional and proteomic profiling of these MAP strains under iron-replete or -deplete conditions. Results We first complemented M. smegmatisΔideR with IdeR of C MAP or that derived from S MAP and compared their transcription profiles using M. smegmatis mc2155 microarrays. In the presence of iron, sIdeR repressed expression of bfrA and MAP2073c, a ferritin domain containing protein suggesting that transcriptional control of iron storage may be defective in S strain. We next performed transcriptional and proteomic profiling of the two strain types of MAP under iron-deplete and -replete conditions. Under iron-replete conditions, C strain upregulated iron storage (BfrA), virulence associated (Esx-5 and antigen85 complex), and ribosomal proteins. In striking contrast, S strain downregulated these proteins under iron-replete conditions. iTRAQ (isobaric tag for relative and absolute quantitation) based protein quantitation resulted in the identification of four unannotated proteins. Two of these were upregulated by a C MAP strain in response to iron supplementation. The iron-sparing response to iron limitation was unique to the C strain as evidenced by repression of non-essential iron utilization enzymes (aconitase and succinate dehydrogenase) and upregulation of proteins of essential function (iron transport, [Fe-S] cluster biogenesis and cell division). Conclusions Taken together, our study revealed

  6. Characterization of the MSMEG_2631 gene (mmp) encoding a multidrug and toxic compound extrusion (MATE) family protein in Mycobacterium smegmatis and exploration of its polyspecific nature using biolog phenotype microarray.

    PubMed

    Mishra, Mukti Nath; Daniels, Lacy

    2013-04-01

    In Mycobacterium, multidrug efflux pumps can be associated with intrinsic drug resistance. Comparison of putative mycobacterial transport genes revealed a single annotated open reading frame (ORF) for a multidrug and toxic compound extrusion (MATE) family efflux pump in all sequenced mycobacteria except Mycobacterium leprae. Since MATE efflux pumps function as multidrug efflux pumps by conferring resistance to structurally diverse antibiotics and DNA-damaging chemicals, we studied this gene (MSMEG_2631) in M. smegmatis mc(2)155 and determined that it encodes a MATE efflux system that contributes to intrinsic resistance of Mycobacterium. We propose that the MSMEG_2631 gene be named mmp, for mycobacterial MATE protein. Biolog Phenotype MicroArray data indicated that mmp deletion increased susceptibility for phleomycin, bleomycin, capreomycin, amikacin, kanamycin, cetylpyridinium chloride, and several sulfa drugs. MSMEG_2619 (efpA) and MSMEG_3563 mask the effect of mmp deletion due to overlapping efflux capabilities. We present evidence that mmp is a part of an MSMEG_2626-2628-2629-2630-2631 operon regulated by a strong constitutive promoter, initiated from a single transcription start site. All together, our results show that M. smegmatis constitutively encodes an Na(+)-dependent MATE multidrug efflux pump from mmp in an operon with putative genes encoding proteins for apparently unrelated functions. PMID:23292779

  7. The 1.6 Astroms Crystal Structure of Mycobacterium smegmatis MshC: The Penultimate Enzyme in the Mycothiol Biosynthetic Pathway

    SciTech Connect

    Tremblay, L.; Fan, F; Vetting, M; Blanchard, J

    2008-01-01

    Mycobacterium smegmatis MshC catalyzes the ATP-dependent condensation of GlcN-Ins and l-cysteine to form l-Cys-GlcN-Ins, the penultimate step in mycothiol biosynthesis. Attempts to crystallize the native, full-length MshC have been unsuccessful. However, incubation of the enzyme with the cysteinyl adenylate analogue, 5?-O-[N-(l-cysteinyl)-sulfamonyl]adenosine (CSA), followed by a 24-h limited trypsin proteolysis yielded an enzyme preparation that readily crystallized. The three-dimensional structure of MshC with CSA bound in the active site was solved and refined to 1.6 A. The refined structure exhibited electron density corresponding to the entire 47 kDa MshC molecule, with the exception of the KMSKS loop (residues 285-297), a loop previously implicated in the formation of the adenylate in related tRNA synthases. The overall tertiary fold of MshC is similar to that of cysteinyl-tRNA synthetase, with a Rossmann fold catalytic domain. The interaction of the thiolate of CSA with a zinc ion at the base of the active site suggests that the metal ion participates in amino acid binding and discrimination. A number of active site residues were observed to interact with the ligand, suggesting a role in substrate binding and catalysis. Analysis utilizing modeling of the proteolyzed loop and GlcN-Ins docking, as well as the examination of sequence conservation in the active site suggests similarities and differences between cysteinyl-tRNA synthetases and MshC in recognition of the substrates for their respective reactions.

  8. Complete Genome Sequence of Mycobacterium bovis Strain BCG-1 (Russia)

    PubMed Central

    Shitikov, Egor A.; Malakhova, Maja V.; Kostryukova, Elena S.; Ilina, Elena N.; Atrasheuskaya, Alena V.; Ignatyev, Georgy M.; Vinokurova, Nataliya V.; Gorbachyov, Vyacheslav Y.

    2016-01-01

    Mycobacterium bovis BCG (Bacille Calmette-Guérin) is a vaccine strain used for protection against tuberculosis. Here, we announce the complete genome sequence of M. bovis strain BCG-1 (Russia). Extensive use of this strain necessitates the study of its genome stability by comparative analysis. PMID:27034492

  9. Mass Spectrometric Analysis of Mycothiol levels in Wild-Type and Mycothiol Disulfide Reductase Mutant Mycobacterium smegmatis

    PubMed Central

    Holsclaw, Cynthia M.; Muse, Wilson B.; Carroll, Kate S.; Leary, Julie A.

    2010-01-01

    Mycothiol (MSH), the primary low-molecular weight thiol produced in mycobacteria, acts to protect the cell from oxidative stress and to maintain redox homeostasis, notably in the pathogenic Mycobacterium tuberculosis in the course of human infection. The mycothiol disulfide reductase (Mtr) enzyme reduces the oxidized form of mycothiol, mycothione (MSSM), back to MSH, however its role in bacterial viability is not clear. In this study, we sought to determine the MSH levels of wild-type (WT) and Mtr mutant mycobacteria during oxidative stress. We describe a rapid method for the relative quantification of MSH using high-sensitivity mass spectrometry (MS) with selected ion monitoring (SIM). This method uses only minimal sample cleanup, and does not require advanced chromatographic equipment or fluorescent compounds. MSH levels decreased in the Mtr mutant only upon treatment with peroxide, and the results were consistent between our method and previously-described thiol quantification methods. Our results indicate that our MS-based method is a useful, high-throughput alternative tool for the quantification of MSH from mycobacteria. PMID:21857792

  10. Novel pppGpp binding site at the C-terminal region of the Rel enzyme from Mycobacterium smegmatis.

    PubMed

    Syal, Kirtimaan; Joshi, Himanshu; Chatterji, Dipankar; Jain, Vikas

    2015-10-01

    Mycobacterium tuberculosis elicits the stringent response under unfavorable growth conditions, such as those encountered by the pathogen inside the host. The hallmark of this response is production of guanosine tetra- and pentaphosphates, collectively termed (p)ppGpp, which have pleiotropic effects on the bacterial physiology. As the stringent response is connected to survival under stress, it is now being targeted for developing inhibitors against bacterial persistence. The Rel enzyme in mycobacteria has two catalytic domains at its N-terminus that are involved in the synthesis and hydrolysis of (p)ppGpp, respectively. However, the function of the C-terminal region of the protein remained unknown. Here, we have identified a binding site for pppGpp in the C-terminal region of Rel. The binding affinity of pppGpp was quantified by isothermal titration calorimetry. The binding site was determined by crosslinking using the nucleotide analog azido-pppGpp, and examining the crosslink product by mass spectrometry. Additionally, mutations in the Rel protein were created to confirm the site of pppGpp binding by isothermal titration calorimetry. These mutants showed increased pppGpp synthesis and reduced hydrolytic activity. We believe that binding of pppGpp to Rel provides a feedback mechanism that allows the protein to detect and adjust the (p)ppGpp level in the cell. Our work suggests that such sites should also be considered while designing inhibitors to target the stringent response. PMID:26179484

  11. Genome Sequencing and Annotation of Mycobacterium tuberculosis PR08 strain.

    PubMed

    Jaafar, Mohammad Maaruf; Halim, Mohd Zakihalani A; Ismail, Mohamad Izwan; Shien, Lee Lian; Kek, Teh Lay; Fong, Ngeow Yun; Nor, Norazmi Mohd; Zainuddin, Zainul Fadziruddin; Hock, Tang Thean; Najimudin, Mohd Nazalan Mohd; Salleh, Mohd Zaki

    2016-03-01

    Mycobacterium tuberculosis is an acid fast bacterial species in the family Mycobacteriaceae and is the causative agent of most cases of tuberculosis. Here, we report the genomic features of Mycobacterium tuberculosis isolated from the cerebrospinal fluid (CSF) of a patient diagnosed with both pulmonary and extrapulmonary tuberculosis (TB). The isolated strain was identified as Mycobacterium tuberculosis PR08 (MTB PR08). Genomic DNA of the MTB PR08 strain was extracted and subjected to whole genome sequencing using MiSeq (Illumina, CA,USA). The draft genome size of MTB PR08 strain is 4,292,364 bp with a G + C content of 65.2%. This strain was annotated to have 4723 genes and 48 RNAs. This whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010895. PMID:26981383

  12. Complete Genome Sequence of Mycobacterium bovis Strain BCG-1 (Russia).

    PubMed

    Sotnikova, Evgeniya A; Shitikov, Egor A; Malakhova, Maja V; Kostryukova, Elena S; Ilina, Elena N; Atrasheuskaya, Alena V; Ignatyev, Georgy M; Vinokurova, Nataliya V; Gorbachyov, Vyacheslav Y

    2016-01-01

    Mycobacterium bovisBCG (Bacille Calmette-Guérin) is a vaccine strain used for protection against tuberculosis. Here, we announce the complete genome sequence ofM. bovisstrain BCG-1 (Russia). Extensive use of this strain necessitates the study of its genome stability by comparative analysis. PMID:27034492

  13. Low Molecular Weight Glucosamine/L-lactide Copolymers as Potential Carriers for the Development of a Sustained Rifampicin Release System: Mycobacterium Smegmatis as a Tuberculosis Model

    NASA Astrophysics Data System (ADS)

    Ragusa, Jorge Alejandro

    Tuberculosis, a highly contagious disease, ranks as the second leading cause of death from an infectious disease, and remains a major global health problem. In 2013, 9 million new cases were diagnosed and 1.5 million people died worldwide from tuberculosis. This dissertation aims at developing a new, ultrafine particle-based efficient antibiotic delivery system for the treatment of tuberculosis. The carrier material to make the rifampicin (RIF)-loaded particles is a low molecular weight star-shaped polymer produced from glucosamine (molecular core building unit) and L-lactide (GluN-LLA). Stable particles with a very high 50% drug loading capacity were made via electrohydrodynamic atomization. Prolonged release (>14 days) of RIF from these particles is demonstrated. Drug release data fits the Korsmeyer-Peppas equation, which suggests the occurrence of a modified diffusion-controlled RIF release mechanism, and is also supported by differential scanning calorimetry and drug leaching tests. Cytotoxicity tests on Mycobacterium smegmatis showed that antibiotic-free GluN-LLA and polylactides (PLA) (reference material) particles did not show any significant anti-bacterial activity. The minimum inhibitory concentration and minimum bactericidal concentration values obtained for RIF-loaded particles showed 2- to 4-fold improvements in the anti-bacterial activity relative to the free drug. Cytotoxicity tests on macrophages indicated an increment in cell death as particle dose increased, but was not significantly affected by material type or particle size. Confocal microscopy was used to track internalization and localization of particles in the macrophages. GluN-LLA particles led to higher uptakes than the PLA particles. In addition, after phagocytosis, the GluN-LLA particles stayed in the cytoplasm and the particles showed a favorable long term drug release effect in killing intracellular bacteria compared to free RIF. The studies presented and discussed in this dissertation

  14. n-Alkane assimilation and tert-butyl alcohol (TBA) oxidation capacity in Mycobacterium austroafricanum strains.

    PubMed

    Lopes Ferreira, Nicolas; Mathis, Hugues; Labbé, Diane; Monot, Frédéric; Greer, Charles W; Fayolle-Guichard, Françoise

    2007-06-01

    Mycobacterium austroafricanum IFP 2012, which grows on methyl tert-butyl ether (MTBE) and on tert-butyl alcohol (TBA), the main intermediate of MTBE degradation, also grows on a broad range of n-alkanes (C2 to C16). A single alkB gene copy, encoding a non-heme alkane monooxygenase, was partially amplified from the genome of this bacterium. Its expression was induced after growth on n-propane, n-hexane, n-hexadecane and on TBA but not after growth on LB. The capacity of other fast-growing mycobacteria to grow on n-alkanes (C1 to C16) and to degrade TBA after growth on n-alkanes was compared to that of M. austroafricanum IFP 2012. We studied M. austroafricanum IFP 2012 and IFP 2015 able to grow on MTBE, M. austroafricanum IFP 2173 able to grow on isooctane, Mycobacterium sp. IFP 2009 able to grow on ethyl tert-butyl ether (ETBE), M. vaccae JOB5 (M. austroaafricanum ATCC 29678) able to degrade MTBE and TBA and M. smegmatis mc2 155 with no known degradation capacity towards fuel oxygenates. The M. austroafricanum strains grew on a broad range of n-alkanes and three were able to degrade TBA after growth on propane, hexane and hexadecane. An alkB gene was partially amplified from the genome of all mycobacteria and a sequence comparison demonstrated a close relationship among the M. austroafricanum strains. This is the first report suggesting the involvement of an alkane hydroxylase in TBA oxidation, a key step during MTBE metabolism. PMID:17347817

  15. Inactivation of the inhA-encoded fatty acid synthase II (FASII) enoyl-acyl carrier protein reductase induces accumulation of the FASI end products and cell lysis of Mycobacterium smegmatis.

    PubMed

    Vilchèze, C; Morbidoni, H R; Weisbrod, T R; Iwamoto, H; Kuo, M; Sacchettini, J C; Jacobs, W R

    2000-07-01

    The mechanism of action of isoniazid (INH), a first-line antituberculosis drug, is complex, as mutations in at least five different genes (katG, inhA, ahpC, kasA, and ndh) have been found to correlate with isoniazid resistance. Despite this complexity, a preponderance of evidence implicates inhA, which codes for an enoyl-acyl carrier protein reductase of the fatty acid synthase II (FASII), as the primary target of INH. However, INH treatment of Mycobacterium tuberculosis causes the accumulation of hexacosanoic acid (C(26:0)), a result unexpected for the blocking of an enoyl-reductase. To test whether inactivation of InhA is identical to INH treatment of mycobacteria, we isolated a temperature-sensitive mutation in the inhA gene of Mycobacterium smegmatis that rendered InhA inactive at 42 degrees C. Thermal inactivation of InhA in M. smegmatis resulted in the inhibition of mycolic acid biosynthesis, a decrease in hexadecanoic acid (C(16:0)) and a concomitant increase of tetracosanoic acid (C(24:0)) in a manner equivalent to that seen in INH-treated cells. Similarly, INH treatment of Mycobacterium bovis BCG caused an inhibition of mycolic acid biosynthesis, a decrease in C(16:0), and a concomitant accumulation of C(26:0). Moreover, the InhA-inactivated cells, like INH-treated cells, underwent a drastic morphological change, leading to cell lysis. These data show that InhA inactivation, alone, is sufficient to induce the accumulation of saturated fatty acids, cell wall alterations, and cell lysis and are consistent with InhA being a primary target of INH. PMID:10869086

  16. An Unusual Mutation Results in the Replacement of Diaminopimelate with Lanthionine in the Peptidoglycan of a Mutant Strain of Mycobacterium smegmatis†

    PubMed Central

    Consaul, Sandra A.; Wright, Lori F.; Mahapatra, Sebabrata; Crick, Dean C.; Pavelka, Martin S.

    2005-01-01

    Mycobacterial peptidoglycan contains l-alanyl-d-iso-glutaminyl-meso-diaminopimelyl-d-alanyl-d-alanine peptides, with the exception of the peptidoglycan of Mycobacterium leprae, in which glycine replaces the l-alanyl residue. The third-position amino acid of the peptides is where peptidoglycan cross-linking occurs, either between the meso-diaminopimelate (DAP) moiety of one peptide and the penultimate d-alanine of another peptide or between two DAP residues. We previously described a collection of spontaneous mutants of DAP-auxotrophic strains of Mycobacterium smegmatis that can grow in the absence of DAP. The mutants are grouped into seven classes, depending on how well they grow without DAP and whether they are sensitive to DAP, temperature, or detergent. Furthermore, the mutants are hypersusceptible to β-lactam antibiotics when grown in the absence of DAP, suggesting that these mutants assemble an abnormal peptidoglycan. In this study, we show that one of these mutants, M. smegmatis strain PM440, utilizes lanthionine, an unusual bacterial metabolite, in place of DAP. We also demonstrate that the abilities of PM440 to grow without DAP and use lanthionine for peptidoglycan biosynthesis result from an unusual mutation in the putative ribosome binding site of the cbs gene, encoding cystathionine β-synthase, an enzyme that is a part of the cysteine biosynthetic pathway. PMID:15716431

  17. Characterization of Mycobacterium smegmatis PolD2 and PolD1 as RNA/DNA polymerases homologous to the POL domain of bacterial DNA ligase D

    PubMed Central

    Zhu, Hui; Bhattarai, Hitesh; Yan, Han-Guang; Shuman, Stewart; Glickman, Michael S.

    2013-01-01

    Mycobacteria exploit nonhomologous end-joining (NHEJ) to repair DNA double-strand breaks. The core NHEJ machinery comprises the homodimeric DNA end-binding protein Ku and DNA ligase D (LigD), a modular enzyme composed of a C-terminal ATP-dependent ligase domain (LIG), a central 3’-phosphoesterase domain (PE), and an N-terminal polymerase domain (POL). LigD POL is proficient at adding templated and nontemplated deoxynucleotide and ribonucleotides to DNA ends in vitro and is the catalyst in vivo of unfaithful NHEJ events involving nontemplated single-nucleotide additions to blunt DSB ends. Here, we identify two mycobacterial proteins, PolD1 and PolD2, as stand-alone homologs of the LigD POL domain. Biochemical characterization of PolD1 and PolD2 shows that they resemble LigD POL in their monomeric quaternary structures, their ability to add templated and nontemplated nucleotides to primer-templates and blunt ends, and their preference for rNTPs versus dNTPs. Deletion of polD1, polD2, or both, in an M. smegmatis strain carrying an inactivating mutation in LigD POL failed to reveal a role for PolD1 or PolD2 in templated nucleotide additions during NHEJ of 5’-overhang DSBs or in clastogen resistance. Whereas our results document the existence and characteristics of new stand-alone members of the LigD POL family of RNA/DNA polymerases, they imply that other polymerases can perform fill-in synthesis during mycobacterial NHEJ. PMID:23198659

  18. Phospholipase C in Beijing strains of Mycobacterium tuberculosis

    PubMed Central

    Mirsamadi, ES; Farnia, P; Jahani Sherafat, S; Esfahani, M; Faramarzi, N

    2010-01-01

    Background and Objectives Phospholipase of Mycobacterium tuberculosis plays an important role in pathogenesis through breaking up phospholipids and production of diacylglycerol. In this study, we examined the Beijing strains of Mycobacterium tuberculosis isolated from Iranian patients for the genes encoding this enzyme. Materials and Methods DNA extraction was performed using CTAB (cetyltrimethylammonium bromide) from positive culture specimens in tuberculosis patients. PCR was then used to amplify the plcA, plcB, plcC genes of Beijing strain, and non-Beijing strains were identified by spoligotyping. Results Of 200 specimens, 19 (9.5%) were Beijing strain and 181 (90.5%) were non-Beijing strains. The results of PCR for Beijing strains were as follows: 16 strains (84.2%) were positive for plcA, 17 (89.4%) were positive for plcB and 17 (89.4%) were positive for plcC genes. The standard strain (H37RV) was used as control. Conclusion The majority of Beijing strains have phospholipase C genes which can contribute to their pathogenesis but we need complementary studies to confirm the role of phospholipase C in pathogenecity of Mycobacterium tuberculosis. PMID:22347572

  19. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains

    PubMed Central

    Coll, Francesc; McNerney, Ruth; Guerra-Assunção, José Afonso; Glynn, Judith R.; Perdigão, João; Viveiros, Miguel; Portugal, Isabel; Pain, Arnab; Martin, Nigel; Clark, Taane G.

    2014-01-01

    Strain-specific genomic diversity in the Mycobacterium tuberculosis complex (MTBC) is an important factor in pathogenesis that may affect virulence, transmissibility, host response and emergence of drug resistance. Several systems have been proposed to classify MTBC strains into distinct lineages and families. Here, we investigate single-nucleotide polymorphisms (SNPs) as robust (stable) markers of genetic variation for phylogenetic analysis. We identify ~92k SNP across a global collection of 1,601 genomes. The SNP-based phylogeny is consistent with the gold-standard regions of difference (RD) classification system. Of the ~7k strain-specific SNPs identified, 62 markers are proposed to discriminate known circulating strains. This SNP-based barcode is the first to cover all main lineages, and classifies a greater number of sublineages than current alternatives. It may be used to classify clinical isolates to evaluate tools to control the disease, including therapeutics and vaccines whose effectiveness may vary by strain type. PMID:25176035

  20. Identification of proteins from Mycobacterium tuberculosis missing in attenuated Mycobacterium bovis BCG strains.

    PubMed

    Mattow, J; Jungblut, P R; Schaible, U E; Mollenkopf, H J; Lamer, S; Zimny-Arndt, U; Hagens, K; Müller, E C; Kaufmann, S H

    2001-08-01

    A proteome approach, combining high-resolution two-dimensional electrophoresis (2-DE) with mass spectrometry, was used to compare the cellular protein composition of two virulent strains of Mycobacterium tuberculosis with two attenuated strains of Mycobacterium bovis Bacillus Calmette-Guerin (BCG), in order to identify unique proteins of these strains. Emphasis was given to the identification of M. tuberculosis specific proteins, because we consider these proteins to represent putative virulence factors and interesting candidates for vaccination and diagnosis of tuberculosis. The genome of M. tuberculosis strain H37Rv comprises nearly 4000 predicted open reading frames. In contrast, the separation of proteins from whole mycobacterial cells by 2-DE resulted in silver-stained patterns comprising about 1800 distinct protein spots. Amongst these, 96 spots were exclusively detected either in the virulent (56 spots) or in the attenuated (40 spots) mycobacterial strains. Fifty-three of these spots were analyzed by mass spectrometry, of which 41 were identified, including 32 M. tuberculosis specific spots. Twelve M. tuberculosis specific spots were identified as proteins, encoded by genes previously reported to be deleted in M. bovis BCG. The remaining 20 spots unique for M. tuberculosis were identified as proteins encoded by genes that are not known to be missing in M. bovis BCG. PMID:11565788

  1. Characterization of a Mycobacterium intracellulare Variant Strain by Molecular Techniques

    PubMed Central

    Menendez, M. C.; Palenque, E.; Navarro, M. C.; Nuñez, M. C.; Rebollo, M. J.; Garcia, M. J.

    2001-01-01

    This paper describes a Mycobacterium intracellulare variant strain causing an unusual infection. Several isolates obtained from an immunocompromised patient were identified as members of the Mycobacterium avium complex (MAC) by the commercial AccuProbe system and biochemical standard identification. Further molecular approaches were undertaken for a more accurate characterization of the bacteria. Up to seven different genomic sequences were analyzed, ranging from conserved mycobacterial genes such as 16S ribosomal DNA to MAC-specific genes such as mig (macrophage-induced gene). The results obtained identify the isolates as a variant of M. intracellulare, an example of the internal variability described for members of the MAC, particularly within that species. The application of other molecular approaches is recommended for more accurate identification of bacteria described as MAC members. PMID:11724827

  2. Accurate Detection of Rifampicin-Resistant Mycobacterium Tuberculosis Strains.

    PubMed

    Song, Keum-Soo; Nimse, Satish Balasaheb; Kim, Hee Jin; Yang, Jeongseong; Kim, Taisun

    2016-01-01

    In 2013 alone, the death rate among the 9.0 million people infected with Mycobacterium tuberculosis (TB) worldwide was around 14%, which is unacceptably high. An empiric treatment of patients infected with TB or drug-resistant Mycobacterium tuberculosis (MDR-TB) strain can also result in the spread of MDR-TB. The diagnostic tools which are rapid, reliable, and have simple experimental protocols can significantly help in decreasing the prevalence rate of MDR-TB strain. We report the evaluation of the 9G technology based 9G DNAChips that allow accurate detection and discrimination of TB and MDR-TB-RIF. One hundred and thirteen known cultured samples were used to evaluate the ability of 9G DNAChip in the detection and discrimination of TB and MDR-TB-RIF strains. Hybridization of immobilized probes with the PCR products of TB and MDR-TB-RIF strains allow their detection and discrimination. The accuracy of 9G DNAChip was determined by comparing its results with sequencing analysis and drug susceptibility testing. Sequencing analysis showed 100% agreement with the results of 9G DNAChip. The 9G DNAChip showed very high sensitivity (95.4%) and specificity (100%). PMID:26999135

  3. Accurate Detection of Rifampicin-Resistant Mycobacterium Tuberculosis Strains

    PubMed Central

    Song, Keum-Soo; Nimse, Satish Balasaheb; Kim, Hee Jin; Yang, Jeongseong; Kim, Taisun

    2016-01-01

    In 2013 alone, the death rate among the 9.0 million people infected with Mycobacterium tuberculosis (TB) worldwide was around 14%, which is unacceptably high. An empiric treatment of patients infected with TB or drug-resistant Mycobacterium tuberculosis (MDR-TB) strain can also result in the spread of MDR-TB. The diagnostic tools which are rapid, reliable, and have simple experimental protocols can significantly help in decreasing the prevalence rate of MDR-TB strain. We report the evaluation of the 9G technology based 9G DNAChips that allow accurate detection and discrimination of TB and MDR-TB-RIF. One hundred and thirteen known cultured samples were used to evaluate the ability of 9G DNAChip in the detection and discrimination of TB and MDR-TB-RIF strains. Hybridization of immobilized probes with the PCR products of TB and MDR-TB-RIF strains allow their detection and discrimination. The accuracy of 9G DNAChip was determined by comparing its results with sequencing analysis and drug susceptibility testing. Sequencing analysis showed 100% agreement with the results of 9G DNAChip. The 9G DNAChip showed very high sensitivity (95.4%) and specificity (100%). PMID:26999135

  4. Complete Genome Sequence of the Mycobacterium immunogenum Type Strain CCUG 47286

    PubMed Central

    Jaén-Luchoro, Daniel; Seguí, Carolina; Aliaga-Lozano, Francisco; Salvà-Serra, Francisco; Busquets, Antonio; Gomila, Margarita; Ramírez, Antonio; Ruiz, Mikel; Lalucat, Jorge

    2016-01-01

    Here, we report the complete genome sequence of Mycobacterium immunogenum type strain CCUG 47286, a nontuberculous mycobacterium. The whole genome has 5,573,781 bp and covers as many as 5,484 predicted genes. This genome contributes to the task of closing the still-existing gap of genomes of rapidly growing mycobacterial type strains. PMID:27231356

  5. Resistance to cellular autophagy by Mycobacterium tuberculosis Beijing strains.

    PubMed

    Haque, Md Fazlul; Boonhok, Rachasak; Prammananan, Therdsak; Chaiprasert, Angkana; Utaisincharoen, Pongsak; Sattabongkot, Jetsumon; Palittapongarnpim, Prasit; Ponpuak, Marisa

    2015-10-01

    Autophagy represents a key pathway in innate immune defense to restrict Mycobacterium tuberculosis growth inside host macrophages. Induction of autophagy has been shown to promote mycobacterial phagosome acidification and acquisition of lysosomal hydrolases, resulting in the elimination of intracellular M. tuberculosis reference strains such as H37Rv. The notorious Beijing genotype has been previously shown to be hyper-virulent and associated with increased survival in host cells and a high mortality rate in animal models, but the underlying mechanism that renders this family to have such advantages remains unclear. We hypothesize that autophagic control against M. tuberculosis Beijing strains may be altered. Here, we discovered that the Beijing strains can resist autophagic killing by host cells compared with that of the reference strain H37Rv and a strain belonging to the East African Indian genotype. Moreover, we have determined a possible underlying mechanism and found that the greater ability to evade autophagic elimination possessed by the Beijing strains stems from their higher capacity to inhibit autophagolysosome biogenesis upon autophagy induction. In summary, a previously unrecognized ability of the M. tuberculosis Beijing strains to evade host autophagy was identified, which may have important implications for tuberculosis treatment, especially in regions prevalent by the Beijing genotype. PMID:26160686

  6. Characterization of IS1245 for Strain Typing of Mycobacterium avium

    PubMed Central

    Pestel-Caron, Martine; Arbeit, Robert D.

    1998-01-01

    IS1245 is an insertion element widely prevalent among isolates of Mycobacterium avium. We used PvuII Southern blots to analyze IS1245 polymorphisms among 159 M. avium isolates (141 clinical isolates from 40 human immunodeficiency virus-infected patients plus 18 epidemiologically related environmental isolates) that represented 40 distinct M. avium strains, as resolved by previous studies by pulsed-field gel electrophoresis (PFGE). All 40 strains carried DNA homologous to IS1245 and thus were typeable. Twenty-five (63%) strains had ≥10 copies of the element, 6 (15%) had 4 to 9 copies, and 9 (23%) had only 1 to 3 copies. Among the last group of nine strains (each of which was distinct by PFGE analysis), IS1245 typing resolved only four patterns and thus provided poor discriminatory power. To evaluate the in vivo stability of IS1245, we analyzed 32 strains for which sets of 2 to 19 epidemiologically related isolates were available. For 19 (59%) of these sets, all isolates representing the same strain had indistinguishable IS1245 patterns. Within eight (25%) sets, one or more isolates had IS1245 patterns that differed by one or two fragments from the modal pattern for the isolates of that strain. Five (16%) sets included isolates whose patterns differed by three or more fragments; on the basis of IS1245 typing those isolates would have been designated distinct strains. IS1245 was stable during in vitro passage, suggesting that the variations observed represented natural translocations of the element. IS1245 provides a useful tool for molecular strain typing of M. avium but may have limitations for analyzing strains with low copy numbers or for resolving extended epidemiologic relationships. PMID:9650925

  7. Genotyping of ancient Mycobacterium tuberculosis strains reveals historic genetic diversity

    PubMed Central

    Müller, Romy; Roberts, Charlotte A.; Brown, Terence A.

    2014-01-01

    The evolutionary history of the Mycobacterium tuberculosis complex (MTBC) has previously been studied by analysis of sequence diversity in extant strains, but not addressed by direct examination of strain genotypes in archaeological remains. Here, we use ancient DNA sequencing to type 11 single nucleotide polymorphisms and two large sequence polymorphisms in the MTBC strains present in 10 archaeological samples from skeletons from Britain and Europe dating to the second–nineteenth centuries AD. The results enable us to assign the strains to groupings and lineages recognized in the extant MTBC. We show that at least during the eighteenth–nineteenth centuries AD, strains of M. tuberculosis belonging to different genetic groups were present in Britain at the same time, possibly even at a single location, and we present evidence for a mixed infection in at least one individual. Our study shows that ancient DNA typing applied to multiple samples can provide sufficiently detailed information to contribute to both archaeological and evolutionary knowledge of the history of tuberculosis. PMID:24573854

  8. Biochemical characteristics of various strains of Mycobacterium paratuberculosis.

    PubMed

    Chiodini, R J

    1986-07-01

    Biochemical activities of 20 wild-type strains and of 2 laboratory strains of Mycobacterium paratuberculosis were evaluated. Biochemical activities evaluated were growth at 30 C, 37 C, and 42 C; production of urease, niacin, pyrazinamidase, arylsulfatase, and catalase; hydrolyzation of Tween 80; reduction of nitrate and tellurite; and growth in 5% NaCl. Antimicrobial susceptibility to thiophene-2-carboxylic acid hydrazide (10 micrograms/ml), neotetrazolium chloride (1:40,000), streptomycin (2 micrograms/ml), rifampin (0.25 micrograms/ml), and isoniazid (10 micrograms/ml) also was determined. Generally, M paratuberculosis was biochemically inactive, with only a few strains producing pyrazinamidase and maintaining catalase activity after heating. All strains grew optimally at 37 C, grew slightly at 30 C, and did not grow at 42 C. Wild-type strains did not grow in the presence of neotetrazolium chloride, streptomycin, and rifampin, and grew in the presence of thiophene-2-carboxylic acid hydrazide and isoniazid. Although biochemical evaluation can be used as an aid in the identification of M paratuberculosis, growth rate, and mycobactin dependency remain major criteria for positive identification. PMID:3740613

  9. The Mycobacterium phlei Genome: Expectations and Surprises

    PubMed Central

    Das, Sarbashis; Pettersson, B. M. Fredrik; Behra, Phani Rama Krishna; Ramesh, Malavika; Dasgupta, Santanu; Bhattacharya, Alok; Kirsebom, Leif A.

    2016-01-01

    Mycobacterium phlei, a nontuberculosis mycobacterial species, was first described in 1898–1899. We present the complete genome sequence for the M. phlei CCUG21000T type strain and the draft genomes for four additional strains. The genome size for all fiveis 5.3 Mb with 69.4% Guanine-Cytosine content. This is ≈0.35 Mbp smaller than the previously reported M. phlei RIVM draft genome. The size difference is attributed partly to large bacteriophage sequence fragments in the M. phlei RIVM genome. Comparative analysis revealed the following: 1) A CRISPR system similar to Type 1E (cas3) in M. phlei RIVM; 2) genes involved in polyamine metabolism and transport (potAD, potF) that are absent in other mycobacteria, and 3) strain-specific variations in the number of σ-factor genes. Moreover, M. phlei has as many as 82 mce (mammalian cell entry) homologs and many of the horizontally acquired genes in M. phlei are present in other environmental bacteria including mycobacteria that share similar habitat. Phylogenetic analysis based on 693 Mycobacterium core genes present in all complete mycobacterial genomes suggested that its closest neighbor is Mycobacterium smegmatis JS623 and Mycobacterium rhodesiae NBB3, while it is more distant to M. smegmatis mc2 155. PMID:26941228

  10. Virulence of two strains of Mycobacterium bovis in cattle following aerosol infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Over the past two decades, highly virulent strains of Mycobacterium tuberculosis have emerged and spread rapidly in humans, suggesting a selective advantage based upon virulence. A similar scenario has not been described for Mycobacterium bovis infection in cattle (i.e., Bovine Tuberculos...

  11. How does a Mycobacterium change its spots? Applying molecular tools to track diverse strains of Mycobacterium avium subspecies paratuberculosis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Defining genetic diversity in the wake of the release of several Mycobacterium avium subsp. paratuberculosis (MAP) genome sequences has become a major emphasis in the molecular biology and epidemiology of Johne’s disease research. These data can now be used to define the extent of strain diversity ...

  12. Draft Genome Sequence of a New Zealand Rangipo Strain of Mycobacterium tuberculosis

    PubMed Central

    Gautam, Sanjay S.; Bower, James E.; Basu, Indira

    2016-01-01

    The Rangipo genotype of the Mycobacterium tuberculosis complex has been associated with a number of tuberculosis (TB) outbreaks in New Zealand. We report here the draft whole-genome sequence of a representative isolate of this strain. PMID:27389273

  13. Draft Genome Sequence of Mycobacterium peregrinum Strain CSUR P2098

    PubMed Central

    Asmar, Shady; Rascovan, Nicolás; Robert, Catherine

    2015-01-01

    Mycobacterium peregrinum is a nonpigmented rapid growing nontuberculosis species belonging to the Mycobacterium fortuitum group. The draft genome of M. peregrinum type I CSUR P2098 comprises 7,109,836 bp exhibiting a 66.23% G+C content, 6,894 protein-coding genes, and 100 predicted RNA genes. Its genome analysis suggests this species differs from Mycobacterium senegalense. PMID:26543113

  14. Association of missense mutations in epoxyalkane coenzyme M transferase with adaptation of Mycobacterium sp. strain JS623 to growth on vinyl chloride.

    PubMed

    Jin, Yang Oh; Cheung, Samantha; Coleman, Nicholas V; Mattes, Timothy E

    2010-06-01

    Vinyl chloride (VC) is a toxic groundwater pollutant associated with plastic manufacture and chlorinated solvent use. Aerobic bacteria that grow on VC as a carbon and energy source can evolve in the laboratory from bacteria that grow on ethene, but the genetic changes involved are unknown. We investigated VC adaptation in two variants (JS623-E and JS623-T) of the ethene-oxidizing Mycobacterium strain JS623. Missense mutations in the EtnE gene developed at two positions (W243 and R257) in cultures exposed to VC but not in cultures maintained on ethene. Epoxyalkane-coenzyme M transferase (EaCoMT) activities in cell extracts of JS623-E and JS623-T (150 and 645 nmol/min/mg protein, respectively) were higher than that of wild-type JS623 (74 nmol/min/mg protein), and in both variant cultures epoxyethane no longer accumulated during growth on ethene. The heterologous expression of two variant etnE alleles (W243G [etnE1] and R257L [etnE2]) from strain JS623 in Mycobacterium smegmatis showed that they had 42 to 59% higher activities than the wild type. Recombinant JS623 cultures containing mutant EtnE genes cloned in the vector pMV261 adapted to growth on VC more rapidly than the wild-type JS623 strain, with incubation times of 60 days (wild type), 1 day (pMVetnE1), and 35 days (pMVetnE2). The JS623(pMVetnE) culture did not adapt to VC after more than 60 days of incubation. Adaptation to VC in strain JS623 is consistently associated with two particular missense mutations in the etnE gene that lead to higher EaCoMT activity. This is the first report to pinpoint a genetic change associated with the transition from cometabolic to growth-linked VC oxidation in bacteria. PMID:20363787

  15. Mycobacterium tuberculosis is resistant to streptolydigin.

    PubMed

    Speer, Alexander; Rowland, Jennifer L; Niederweis, Michael

    2013-07-01

    Drug resistant strains of Mycobacterium tuberculosis (Mtb) undermine tuberculosis (TB) control. Streptolydigin is a broadly effective antibiotic which inhibits RNA polymerase, similarly to rifampicin, a key drug in current TB chemotherapeutic regimens. Due to a vastly improved chemical synthesis streptolydigin and derivatives are being promoted as putative TB drugs. The microplate Alamar Blue assay revealed that Streptococcus salivarius and Mycobacterium smegmatis were susceptible to streptolydigin with minimum inhibitory concentrations (MICs) of 1.6 mg/L and 6.25 mg/L, respectively. By contrast, the MICs of streptolydigin and two derivatives, streptolydiginone and dihydrostreptolydigin, against Mtb were ≥ 100 mg/L demonstrating that Mtb is resistant to streptolydigin in contrast to previous reports. Further, a porin mutant of M. smegmatis is resistant to streptolydigin indicating that porins mediate uptake of streptolydigin across the outer membrane. Since the RNA polymerase is a validated drug target in Mtb and porins are required for susceptibility of M. smegmatis, the absence of MspA-like porins probably contributes to the resistance of Mtb to streptolydigin. This study shows that streptolydigin is not a suitable drug in TB treatment regimens. PMID:23591156

  16. Emergence of potential superbug mycobacterium tuberculosis, lessons from new delhi mutant-1 bacterial strains.

    PubMed

    Nazir, Taha; Abraham, Suraj; Islam, Azharul

    2012-01-01

    Recent reports have shown that certain bacterial strains attain the New Delhi Metallo-beta-lactamase-1 (NDM-1) enzyme and become resistant to a broad range of antibiotics. Similarly, more dangerous "superbugs" of multi-drug resistant (MDR) and extensive drug resistant (XDR) Mycobacterium tuberculosis strains are gradually emerging through rapid genetic mutation caused by prescription non-compliance or unsupervised indiscriminate use of anti-tubercular drugs or other antibiotics. Mycobacterium tuberculosis cases have been reported in highly susceptible population groups including the aboriginal communities of US and Canada. In Canada alone, the total number of reported tuberculosis cases has decreased over the past decade. However, there is a steady increase in HIV cases in certain communities including the aboriginal communities. Reintroduction of MDR/XDR strains of tuberculosis is possible in these susceptible communities, which in turn may pose serious public health situation. MDR/XDR strains of tuberculosis are virtually untreatable using current anti-tubercular medication protocols. Thus, MDR/XDR tuberculosis presents a grave global public health threat. The unpredictable genetic mechanism involved in generating MDR/XDR resistant strains of Mycobacterium tuberculosis may pose greater challenges in developing appropriate treatment strategies. In this article, we briefly review potential genetic mechanism of emerging NDM-1 bacterial strains and draw a rationale parallel to the underlying genetic mechanism of MDR/XDR Mycobacterium tuberculosis strain development. PMID:23267308

  17. Annotated Genome Sequence of Mycobacterium massiliense Strain M154, Belonging to the Recently Created Taxon Mycobacterium abscessus subsp. bolletii comb. nov.

    PubMed Central

    Wong, Yan Ling; Tan, Joon Liang; Ong, Chia Sui; Wong, Guat Jah; Ng, Kee Peng

    2012-01-01

    Mycobacterium massiliense has recently been proposed as a member of Mycobacterium abscessus subsp. bolletii comb. nov. Strain M154, a clinical isolate from the bronchoalveolar lavage fluid of a Malaysian patient presenting with lower respiratory tract infection, was subjected to shotgun DNA sequencing with the Illumina sequencing technology to obtain whole-genome sequence data for comparison with other genetically related strains within the M. abscessus species complex. PMID:22887675

  18. Whole-Genome Sequence of Fish-Pathogenic Mycobacterium sp. Strain 012931, Isolated from Yellowtail (Seriola quinqueradiata).

    PubMed

    Kurokawa, Satoru; Kabayama, Jun; Nho, Seong Won; Hwang, Seong Don; Hikima, Jun-Ichi; Jung, Tae Sung; Kondo, Hidehiro; Hirono, Ikuo; Takeyama, Haruko; Aoki, Takashi

    2013-01-01

    The genus Mycobacterium comprises a large number of well-characterized species, several of which are human and animal pathogens. Here, we report the whole-genome sequence of Mycobacterium sp. strain 012931, a fish pathogen responsible for huge losses in aquaculture farms in Japan. The strain was isolated from a marine fish, yellowtail (Seriola quinqueradiata). PMID:23929466

  19. Rapid discrimination of Mycobacterium avium strains from AIDS patients by randomly amplified polymorphic DNA analysis.

    PubMed Central

    Matsiota-Bernard, P; Waser, S; Tassios, P T; Kyriakopoulos, A; Legakis, N J

    1997-01-01

    A randomly amplified polymorphic DNA (RAPD) analysis was performed for the molecular typing of Mycobacterium avium strains. This method was applied to epidemiologically unrelated M. avium strains isolated from the blood of 10 different AIDS patients and to strains that were considered epidemiologically related, as they had been isolated from the same patient but from different body locations (4 patients, 10 strains). Three oligonucleotide primers among the six tested were found to generate RAPD profiles with DNA from all M. avium strains and to successfully type them. This method for the typing of M. avium strains is rapid and easy to perform. PMID:9163488

  20. Draft Genome Sequence of Mycobacterium acapulcensis Strain CSURP1424

    PubMed Central

    Asmar, Shady; Rascovan, Nicolás; Robert, Catherine

    2016-01-01

    Mycobacterium acapulcensis is a rapidly growing scotochromogenic acid-fast bacillus. The draft genome of M. acapulcensis CSURP1424 comprises 5,290,974 bp, exhibiting a 66.67% G+C content, 4,870 protein-coding genes, and 71 predicted RNA genes. PMID:27516522

  1. Draft Genome Sequence of Mycobacterium interjectum Strain ATCC 51457T

    PubMed Central

    Levasseur, Anthony; Asmar, Shady; Robert, Catherine

    2016-01-01

    Mycobacterium interjectum is a nontuberculosis species rarely responsible for human infection. The draft genome of M. interjectum ATCC 51457T comprises 5,927,979 bp, exhibiting 67.91% G+C content, 5,314 protein-coding genes, and 51 predicted RNA genes. PMID:27231376

  2. Draft Genome Sequence of Mycobacterium houstonense Strain ATCC 49403T

    PubMed Central

    Levasseur, Anthony; Asmar, Shady; Robert, Catherine

    2016-01-01

    Mycobacterium houstonense is a nontuberculous species rarely responsible for human infection. The draft genome of M. houstonense ATCC 49403T comprises 6,451,020 bp, exhibiting a 66.96% G+C content, 5,881 protein-coding genes, and 65 predicted RNA genes. PMID:27231371

  3. SmoXYB1C1Z of Mycobacterium sp. strain NBB4: a soluble methane monooxygenase (sMMO)-like enzyme, active on C2 to C4 alkanes and alkenes.

    PubMed

    Martin, Kiri E; Ozsvar, Jazmin; Coleman, Nicholas V

    2014-09-01

    Monooxygenase (MO) enzymes initiate the aerobic oxidation of alkanes and alkenes in bacteria. A cluster of MO genes (smoXYB1C1Z) of thus-far-unknown function was found previously in the genomes of two Mycobacterium strains (NBB3 and NBB4) which grow on hydrocarbons. The predicted Smo enzymes have only moderate amino acid identity (30 to 60%) to their closest homologs, the soluble methane and butane MOs (sMMO and sBMO), and the smo gene cluster has a different organization from those of sMMO and sBMO. The smoXYB1C1Z genes of NBB4 were cloned into pMycoFos to make pSmo, which was transformed into Mycobacterium smegmatis mc(2)-155. Cells of mc(2)-155(pSmo) metabolized C2 to C4 alkanes, alkenes, and chlorinated hydrocarbons. The activities of mc(2)-155(pSmo) cells were 0.94, 0.57, 0.12, and 0.04 nmol/min/mg of protein with ethene, ethane, propane, and butane as substrates, respectively. The mc(2)-155(pSmo) cells made epoxides from ethene, propene, and 1-butene, confirming that Smo was an oxygenase. Epoxides were not produced from larger alkenes (1-octene and styrene). Vinyl chloride and 1,2-dichloroethane were biodegraded by cells expressing Smo, with production of inorganic chloride. This study shows that Smo is a functional oxygenase which is active against small hydrocarbons. M. smegmatis mc(2)-155(pSmo) provides a new model for studying sMMO-like monooxygenases. PMID:25015887

  4. SmoXYB1C1Z of Mycobacterium sp. Strain NBB4: a Soluble Methane Monooxygenase (sMMO)-Like Enzyme, Active on C2 to C4 Alkanes and Alkenes

    PubMed Central

    Martin, Kiri E.; Ozsvar, Jazmin

    2014-01-01

    Monooxygenase (MO) enzymes initiate the aerobic oxidation of alkanes and alkenes in bacteria. A cluster of MO genes (smoXYB1C1Z) of thus-far-unknown function was found previously in the genomes of two Mycobacterium strains (NBB3 and NBB4) which grow on hydrocarbons. The predicted Smo enzymes have only moderate amino acid identity (30 to 60%) to their closest homologs, the soluble methane and butane MOs (sMMO and sBMO), and the smo gene cluster has a different organization from those of sMMO and sBMO. The smoXYB1C1Z genes of NBB4 were cloned into pMycoFos to make pSmo, which was transformed into Mycobacterium smegmatis mc2-155. Cells of mc2-155(pSmo) metabolized C2 to C4 alkanes, alkenes, and chlorinated hydrocarbons. The activities of mc2-155(pSmo) cells were 0.94, 0.57, 0.12, and 0.04 nmol/min/mg of protein with ethene, ethane, propane, and butane as substrates, respectively. The mc2-155(pSmo) cells made epoxides from ethene, propene, and 1-butene, confirming that Smo was an oxygenase. Epoxides were not produced from larger alkenes (1-octene and styrene). Vinyl chloride and 1,2-dichloroethane were biodegraded by cells expressing Smo, with production of inorganic chloride. This study shows that Smo is a functional oxygenase which is active against small hydrocarbons. M. smegmatis mc2-155(pSmo) provides a new model for studying sMMO-like monooxygenases. PMID:25015887

  5. Molecular Drug Susceptibility Testing and Genotyping of Mycobacterium leprae Strains from South America▿

    PubMed Central

    Singh, Pushpendra; Busso, Philippe; Paniz-Mondolfi, Alberto; Aranzazu, Nacarid; Monot, Marc; Honore, Nadine; de Faria Fernandes Belone, Andrea; Virmond, Marcos; Villarreal-Olaya, Maria Esther; Rivas, Carlos; Cole, Stewart T.

    2011-01-01

    Possible drug resistance in Mycobacterium leprae strains from Venezuela and three other South American countries was surveyed by molecular methods. None of the 230 strains from new leprosy cases exhibited drug resistance-associated mutations. However, two of the three strains from relapsed cases contained dapsone resistance mutations, and one strain also harbored a rifampin resistance mutation. Single nucleotide polymorphism analysis of these strains revealed five subtypes: 3I (73.8%), 4P (11.6%), 1D (6.9%), 4N (6%), and 4O (1.7%). PMID:21444694

  6. Molecular drug susceptibility testing and genotyping of Mycobacterium leprae strains from South America.

    PubMed

    Singh, Pushpendra; Busso, Philippe; Paniz-Mondolfi, Alberto; Aranzazu, Nacarid; Monot, Marc; Honore, Nadine; de Faria Fernandes Belone, Andrea; Virmond, Marcos; Villarreal-Olaya, Maria Esther; Rivas, Carlos; Cole, Stewart T

    2011-06-01

    Possible drug resistance in Mycobacterium leprae strains from Venezuela and three other South American countries was surveyed by molecular methods. None of the 230 strains from new leprosy cases exhibited drug resistance-associated mutations. However, two of the three strains from relapsed cases contained dapsone resistance mutations, and one strain also harbored a rifampin resistance mutation. Single nucleotide polymorphism analysis of these strains revealed five subtypes: 3I (73.8%), 4P (11.6%), 1D (6.9%), 4N (6%), and 4O (1.7%). PMID:21444694

  7. Mycobacterium tuberculosis Rv1096 protein: gene cloning, protein expression, and peptidoglycan deacetylase activity

    PubMed Central

    2014-01-01

    Background Many bacteria modulate and evade the immune defenses of their hosts through peptidoglycan (PG) deacetylation. The PG deacetylases from Streptococcus pneumonia, Listeria monocytogenes and Lactococcus lactis have been characterized. However, thus far, the PG deacetylase of Mycobacterium tuberculosis has not been identified. Results In this study, we cloned the Rv1096 gene from the M. tuberculosis H37Rv strain and expressed Rv1096 protein in both Escherichia coli and M. smegmatis. The results showed that the purified Rv1096 protein possessed metallo-dependent PG deacetylase activity, which increased in the presence of Co2+. The kinetic parameters of the PG deacetylase towards M. smegmatis PG as a substrate were as follows: Km, 0.910 ± 0.007 mM; Vmax, 0.514 ± 0.038 μMmin-1; and Kcat = 0.099 ± 0.007 (S-1). Additionally, the viability of M. smegmatis in the presence of over-expressed Rv1096 protein was 109-fold higher than that of wild-type M. smegmatis after lysozyme treatment. Additionally, light microscopy and scanning electron microscopy showed that in the presence of over-expressed Rv1096 protein, M. smegmatis kept its regular shape, with an undamaged cell wall and smooth surface. These results indicate that Rv1096 caused deacetylation of cell wall PG, leading to lysozyme resistance in M. smegmatis. Conclusion We have determined that M. tuberculosis Rv1096 is a PG deacetylase. The PG deacetylase activity of Rv1096 contributed to lysozyme resistance in M. smegmatis. Our findings suggest that deacetylation of cell wall PG may be involved in evasion of host immune defenses by M. tuberculosis. PMID:24975018

  8. High Extracellular Levels of Mycobacterium tuberculosis Glutamine Synthetase and Superoxide Dismutase in Actively Growing Cultures Are Due to High Expression and Extracellular Stability Rather than to a Protein-Specific Export Mechanism

    PubMed Central

    Tullius, Michael V.; Harth, Günter; Horwitz, Marcus A.

    2001-01-01

    Glutamine synthetase (GS) and superoxide dismutase (SOD), large multimeric enzymes that are thought to play important roles in the pathogenicity of Mycobacterium tuberculosis, are among the bacterium's major culture filtrate proteins in actively growing cultures. Although these proteins lack a leader peptide, their presence in the extracellular medium during early stages of growth suggested that they might be actively secreted. To understand their mechanism of export, we cloned the homologous genes (glnA1 and sodA) from the rapid-growing, nonpathogenic Mycobacterium smegmatis, generated glnA1 and sodA mutants of M. smegmatis by allelic exchange, and quantitated expression and export of both mycobacterial and nonmycobacterial GSs and SODs in these mutants. We also quantitated expression and export of homologous and heterologous SODs from M. tuberculosis. When each of the genes was expressed from a multicopy plasmid, M. smegmatis exported comparable proportions of both the M. tuberculosis and M. smegmatis GSs (in the glnA1 strain) or SODs (in the sodA strain), in contrast to previous observations in wild-type strains. Surprisingly, recombinant M. smegmatis and M. tuberculosis strains even exported nonmycobacterial SODs. To determine the extent to which export of these large, leaderless proteins is expression dependent, we constructed a recombinant M. tuberculosis strain expressing green fluorescent protein (GFP) at high levels and a recombinant M. smegmatis strain coexpressing the M. smegmatis GS, M. smegmatis SOD, and M. tuberculosis BfrB (bacterioferritin) at high levels. The recombinant M. tuberculosis strain exported GFP even in early stages of growth and at proportions very similar to those of the endogenous M. tuberculosis GS and SOD. Similarly, the recombinant M. smegmatis strain exported bacterioferritin, a large (∼500-kDa), leaderless, multimeric protein, in proportions comparable to GS and SOD. In contrast, high-level expression of the large, leaderless

  9. Draft Genome Sequence of the Vaccination Strain Mycobacterium bovis BCG S4-Jena.

    PubMed

    Wibberg, Daniel; Winkler, Anika; Straube, Eberhard; Karrasch, Matthias; Keller, Peter M; Kalinowski, Jörn

    2016-01-01

    Here, we present the draft genome sequence of ITALIC! Mycobacterium bovisBCG S4-Jena, a tuberculosis vaccine strain. The genome of S4-Jena is represented by 48 scaffolds, consisting of 132 scaffolded contigs and amounting to a size of about 4.2 Mb. New genes potentially encoding a phage fragment were identified in the genome. PMID:27103721

  10. Clinical Impact of Mycobacterium tuberculosis W-Beijing Genotype Strain Infection on Aged Patients in Taiwan▿

    PubMed Central

    Feng, Jia-Yih; Su, Wei-Juin; Tsai, Cheng-Chien; Chang, Shi-Chuan

    2008-01-01

    The impact of W-Beijing genotype Mycobacterium tuberculosis on treatment outcome was evaluated in 249 newly diagnosed tuberculosis patients. No significant difference in the treatment outcome was found between the W-Beijing and non-W-Beijing groups. However, a poor outcome was more common in the elderly patients (≥65 years) infected with the W-Beijing strain. PMID:18596137

  11. Study of Biochemical Pathways and Enzymes Involved in Pyrene Degradation by Mycobacterium sp. Strain KMS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pyrene degradation is known in bacteria. In this study, Mycobacterium sp. Strain KMS was used to study the metabolites produced during, and enzymes involved in, pyrene degradation. Several key metabolites, including pyrene-4,5-dione, cis-4,5-pyrene-dihydrodiol, phenanthrene-4,5-dicarboxylic acid, ...

  12. Draft Genome Sequence of the Vaccination Strain Mycobacterium bovis BCG S4-Jena

    PubMed Central

    Wibberg, Daniel; Winkler, Anika; Straube, Eberhard; Karrasch, Matthias; Keller, Peter M.

    2016-01-01

    Here, we present the draft genome sequence of Mycobacterium bovis BCG S4-Jena, a tuberculosis vaccine strain. The genome of S4-Jena is represented by 48 scaffolds, consisting of 132 scaffolded contigs and amounting to a size of about 4.2 Mb. New genes potentially encoding a phage fragment were identified in the genome. PMID:27103721

  13. Sliding Motility, Biofilm Formation, and Glycopeptidolipid Production in Mycobacterium colombiense Strains

    PubMed Central

    Maya-Hoyos, Milena; Leguizamón, John; Mariño-Ramírez, Leonardo; Soto, Carlos Y.

    2015-01-01

    Mycobacterium colombiense is a novel member of the Mycobacterium avium complex, which produces respiratory and disseminated infections in immunosuppressed patients. Currently, the morphological and genetic bases underlying the phenotypic features of M. colombiense strains remain unknown. In the present study, we demonstrated that M. colombiense strains displaying smooth morphology show increased biofilm formation on hydrophobic surfaces and sliding on motility plates. Thin-layer chromatography experiments showed that M. colombiense strains displaying smooth colonies produce large amounts of glycolipids with a chromatographic behaviour similar to that of the glycopeptidolipids (GPLs) of M. avium. Conversely, we observed a natural rough variant of M. colombiense (57B strain) lacking pigmentation and exhibiting impaired sliding, biofilm formation, and GPL production. Bioinformatics analyses revealed a gene cluster that is likely involved in GPL biosynthesis in M. colombiense CECT 3035. RT-qPCR experiments showed that motile culture conditions activate the transcription of genes possibly involved in key enzymatic activities of GPL biosynthesis. PMID:26180799

  14. Sliding Motility, Biofilm Formation, and Glycopeptidolipid Production in Mycobacterium colombiense Strains.

    PubMed

    Maya-Hoyos, Milena; Leguizamón, John; Mariño-Ramírez, Leonardo; Soto, Carlos Y

    2015-01-01

    Mycobacterium colombiense is a novel member of the Mycobacterium avium complex, which produces respiratory and disseminated infections in immunosuppressed patients. Currently, the morphological and genetic bases underlying the phenotypic features of M. colombiense strains remain unknown. In the present study, we demonstrated that M. colombiense strains displaying smooth morphology show increased biofilm formation on hydrophobic surfaces and sliding on motility plates. Thin-layer chromatography experiments showed that M. colombiense strains displaying smooth colonies produce large amounts of glycolipids with a chromatographic behaviour similar to that of the glycopeptidolipids (GPLs) of M. avium. Conversely, we observed a natural rough variant of M. colombiense (57B strain) lacking pigmentation and exhibiting impaired sliding, biofilm formation, and GPL production. Bioinformatics analyses revealed a gene cluster that is likely involved in GPL biosynthesis in M. colombiense CECT 3035. RT-qPCR experiments showed that motile culture conditions activate the transcription of genes possibly involved in key enzymatic activities of GPL biosynthesis. PMID:26180799

  15. Buruli Ulcer Disease in Travelers and Differentiation of Mycobacterium ulcerans Strains from Northern Australia

    PubMed Central

    Lavender, Caroline J.; Globan, Maria; Johnson, Paul D. R.; Charles, Patrick G. P.; Jenkin, Grant A.; Ghosh, Niladri; Clark, Benjamin M.; Martinello, Marianne

    2012-01-01

    Buruli ulcer (BU) is a necrotizing infection of skin and soft tissue caused by Mycobacterium ulcerans. In Australia, most cases of BU are linked to temperate, coastal Victoria and tropical, northern Queensland, and strains from these regions are distinguishable by variable-number tandem repeat (VNTR) typing. We present an epidemiological investigation of five patients found to have been infected during interstate travel and describe two nucleotide polymorphisms that differentiate M. ulcerans strains from northern Australia. PMID:22875890

  16. Ultrafast Assessment of the Presence of a High-Risk Mycobacterium tuberculosis Strain in a Population.

    PubMed

    Pérez-Lago, Laura; Herranz, Marta; Comas, Iñaki; Ruiz-Serrano, María Jesús; López Roa, Paula; Bouza, Emilio; García-de-Viedma, Darío

    2016-03-01

    A persistent 8-year infection by a Beijing Mycobacterium tuberculosis strain from a previous outbreak after importation from West Africa obliged us to investigate secondary cases. We developed a multiplex PCR method based on whole-genome sequencing to target strain-specific single nucleotide polymorphisms (SNPs). In 1 week, we analyzed 868 isolates stored over 6 years. Only 2 cases (immigrants from Guinea Conakry) harbored the strain, which ruled out transmission-despite opportunities-and challenged some of the advantages associated with Beijing strains. PMID:26719445

  17. Draft Genome Sequences of Six Mycobacterium immunogenum Strains Obtained from a Chloraminated Drinking Water Distribution System Simulator.

    PubMed

    Gomez-Alvarez, Vicente; Revetta, Randy P

    2016-01-01

    We report here the draft genome sequences of six Mycobacterium immunogenum strains isolated from a chloraminated drinking water distribution system simulator subjected to changes in operational parameters. M. immunogenum, a rapidly growing mycobacterium previously reported to be the cause of hypersensitivity pneumonitis from contaminated metalworking fluid aerosols, is becoming a public health concern. PMID:26744376

  18. Rhodococcus sp. strain TM1 plays a synergistic role in the degradation of piperidine by Mycobacterium sp. strain THO100.

    PubMed

    Kim, Yong-Hak; Kang, Un-Beom; Konishi, Kyoko; Lee, Cheolju

    2006-09-01

    Mycobacterium sp. strain THO100 and Rhodococcus sp. strain TM1 were isolated from a morpholine-containing enrichment culture of activated sewage sludge. Strain THO100, but not strain TM1, was able to degrade alicyclic amines such as morpholine, piperidine, and pyrrolidine. The mixed strains THO100 and TM1 showed a better growth on piperidine as the substrate than the pure strain THO100 because strain TM1 was able to reduce the level of glutaraldehyde (GA) produced during piperidine degradation. GA was toxic to strain THO100 (IC(50) = 28.3 microM) but less toxic to strain TM1 (IC(50) = 215 microM). Strain THO100 possessed constitutive semialdehyde dehydrogenases, namely Sad1 and Sad2, whose activities toward succinic semialdehyde (SSA) were strongly inhibited by GA. The two isozymes were identified as catalase-peroxidase (KatG = Sad1) and semialdehyde dehydrogenase (Sad2) based on mass spectrometric analyses of tryptic peptides and database searches of the partial DNA sequences of their genes. In contrast, strain TM1 containing another constitutive enzyme Gad1 could oxidize both SSA and GA. This study suggested that strain TM1 possessing Gad1 played a synergistic role in reducing the toxic and inhibitory effects of GA produced in the degradation of piperidine by strain THO100. PMID:16832627

  19. Two New Mycobacterium Strains and Their Role in Toluene Degradation in a Contaminated Stream

    PubMed Central

    Tay, Stephen T.-L.; Hemond, Harold F.; Polz, Martin F.; Cavanaugh, Colleen M.; Dejesus, Indhira; Krumholz, Lee R.

    1998-01-01

    Two toluene-degrading strains, T103 and T104, were isolated from rock surface biomass in a freshwater stream contaminated with toluene. The strains exhibit different capacities for degradation of toluene and other aromatic compounds and have characteristics of the genus Mycobacterium. Both are aerobic, rod-shaped, gram-positive, nonmotile, and acid-alcohol fast and produce yellow pigments. They have mainly straight-chain saturated and monounsaturated fatty acids with 10 to 20 carbon atoms and large amounts of tuberculostearic acid that are typical of mycobacteria. Fatty acid analyses indicate that T103 and T104 are different mycobacterial strains that are related at the subspecies level. Their identical 16S rDNA sequences are most similar to Mycobacterium aurum and Mycobacterium komossense, and they constitute a new species of fast-growing mycobacteria. Ecological studies reveal that toluene contamination has enriched for toluene-degrading bacteria in the epilithic microbial community. Strains T103 and T104 play only a small role in toluene degradation in the stream, although they are present in the habitat and can degrade toluene. Other microorganisms are consequently implicated in the biodegradation. PMID:9572941

  20. Four decades of transmission of a multidrug-resistant Mycobacterium tuberculosis outbreak strain

    PubMed Central

    Eldholm, Vegard; Monteserin, Johana; Rieux, Adrien; Lopez, Beatriz; Sobkowiak, Benjamin; Ritacco, Viviana; Balloux, Francois

    2015-01-01

    The rise of drug-resistant strains is a major challenge to containing the tuberculosis (TB) pandemic. Yet, little is known about the extent of resistance in early years of chemotherapy and when transmission of resistant strains on a larger scale became a major public health issue. Here we reconstruct the timeline of the acquisition of antimicrobial resistance during a major ongoing outbreak of multidrug-resistant TB in Argentina. We estimate that the progenitor of the outbreak strain acquired resistance to isoniazid, streptomycin and rifampicin by around 1973, indicating continuous circulation of a multidrug-resistant TB strain for four decades. By around 1979 the strain had acquired additional resistance to three more drugs. Our results indicate that Mycobacterium tuberculosis (Mtb) with extensive resistance profiles circulated 15 years before the outbreak was detected, and about one decade before the earliest documented transmission of Mtb strains with such extensive resistance profiles globally. PMID:25960343

  1. Examining the sublineage structure of Mycobacterium tuberculosis complex strains with multiple-biomarker tensors.

    PubMed

    Ozcaglar, Cagri; Shabbeer, Amina; Vandenberg, Scott; Yener, Bülent; Bennett, Kristin P

    2010-01-01

    Strains of the Mycobacterium tuberculosis complex (MTBC) can be classified into coherent lineages of similar traits based on their genotype. We present a tensor clustering framework to group MTBC strains into sublineages of the known major lineages based on two biomarkers: spacer oligonucleotide type (spoligotype) and mycobacterial interspersed repetitive units (MIRU). We represent genotype information of MTBC strains in a high-dimensional array in order to include information about spoligotype, MIRU, and their coexistence using multiple-biomarker tensors. We use multiway models to transform this multidimensional data about the MTBC strains into two-dimensional arrays and use the resulting score vectors in a stable partitive clustering algorithm to classify MTBC strains into sublineages. We validate clusterings using cluster stability and accuracy measures, and find stabilities of each cluster. Based on validated clustering results, we present a sublineage structure of MTBC strains and compare it to the sublineage structures of SpolDB4 and MIRU-VNTRplus. PMID:22466374

  2. A Web-Based Platform for Designing Vaccines against Existing and Emerging Strains of Mycobacterium tuberculosis

    PubMed Central

    Dhanda, Sandeep Kumar; Vir, Pooja; Singla, Deepak; Gupta, Sudheer; Kumar, Shailesh

    2016-01-01

    Development of an effective vaccine against drug-resistant Mycobacterium tuberculosis (Mtb) is crucial for saving millions of premature deaths every year due to tuberculosis. This paper describes a web portal developed for assisting researchers in designing vaccines against emerging Mtb strains using traditional and modern approaches. Firstly, we annotated 59 genomes of Mycobacterium species to understand similarity/dissimilarity between tuberculoid, non-tuberculoid and vaccine strains at genome level. Secondly, antigen-based vaccine candidates have been predicted in each Mtb strain. Thirdly, epitopes-based vaccine candidates were predicted/discovered in above antigen-based vaccine candidates that can stimulate all arms of immune system. Finally, a database of predicted vaccine candidates at epitopes as well at antigen level has been developed for above strains. In order to design vaccine against a newly sequenced genome of Mtb strain, server integrates three modules for identification of strain-, antigen-, epitope-specific vaccine candidates. We observed that 103522 unique peptides (9mers) had the potential to induce an antibody response and/or promiscuous binder to MHC alleles and/or have the capability to stimulate T lymphocytes. In summary, this web-portal will be useful for researchers working on designing vaccines against Mtb including drug-resistant strains. Availability: The database is available freely at http://crdd.osdd.net/raghava/mtbveb/. PMID:27096425

  3. Characterization of exochelins of the Mycobacterium bovis type strain and BCG substrains.

    PubMed

    Gobin, J; Wong, D K; Gibson, B W; Horwitz, M A

    1999-04-01

    Pathogenic mycobacteria must acquire iron in the host in order to multiply and cause disease. To do so, they release abundant quantities of siderophores called exochelins, which have the capacity to scavenge iron from host iron-binding proteins and deliver it to the mycobacteria. In this study, we have characterized the exochelins of Mycobacterium bovis, the causative agent of bovine and occasionally of human tuberculosis, and the highly attenuated descendant of M. bovis, bacillus Calmette-Guérin (BCG), widely used as a vaccine against human tuberculosis. The M. bovis type strain, five substrains of M. bovis BCG (Copenhagen, Glaxo, Japanese, Pasteur, and Tice), and two strains of virulent Mycobacterium tuberculosis all produce the same set of exochelins, although the relative amounts of individual exochelins may differ. Among these mycobacteria, the total amount of exochelins produced is greatest in M. tuberculosis, intermediate in M. bovis, and smallest in M. bovis BCG. PMID:10085056

  4. Unsuspected and extensive transmission of a drug-susceptible Mycobacterium tuberculosis strain

    PubMed Central

    López-Calleja, Ana Isabel; Gavín, Patricia; Lezcano, Ma Antonia; Vitoria, Ma Asunción; Iglesias, Ma José; Guimbao, Joaquín; Lázaro, Ma Ángeles; Rastogi, Nalin; Revillo, Ma José; Martín, Carlos; Samper, Sofia

    2009-01-01

    Background A large and unsuspected tuberculosis outbreak involving 18.7% of the total of the tuberculosis cases studied, was detected in a population-based molecular epidemiological study performed in Zaragoza (Spain) from 2001 to 2004. Methods The Mycobacterium tuberculosis drug-susceptible strain, named MTZ strain, was genetically characterized by IS6110-RFLP, Spoligotyping and by MIRU-VNTR typing and the genetic patterns obtained were compared with those included in international databases. The characteristics of the affected patients, in an attempt to understand why the MTZ strain was so highly transmitted among the population were also analyzed. Results The genetic profile of the MTZ strain was rare and not widely distributed in our area or elsewhere. The patients affected did not show any notable risk factor for TB. Conclusion The M. tuberculosis strain MTZ, might have particular transmissibility or virulence properties, and we believe that greater focus should be placed on stopping its widespread dissemination. PMID:19144198

  5. Insights from the complete genome sequence of Mycobacterium marinum on the evolution of Mycobacterium tuberculosis

    PubMed Central

    Stinear, Timothy P.; Seemann, Torsten; Harrison, Paul F.; Jenkin, Grant A.; Davies, John K.; Johnson, Paul D.R.; Abdellah, Zahra; Arrowsmith, Claire; Chillingworth, Tracey; Churcher, Carol; Clarke, Kay; Cronin, Ann; Davis, Paul; Goodhead, Ian; Holroyd, Nancy; Jagels, Kay; Lord, Angela; Moule, Sharon; Mungall, Karen; Norbertczak, Halina; Quail, Michael A.; Rabbinowitsch, Ester; Walker, Danielle; White, Brian; Whitehead, Sally; Small, Pamela L.C.; Brosch, Roland; Ramakrishnan, Lalita; Fischbach, Michael A.; Parkhill, Julian; Cole, Stewart T.

    2008-01-01

    Mycobacterium marinum, a ubiquitous pathogen of fish and amphibia, is a near relative of Mycobacterium tuberculosis, the etiologic agent of tuberculosis in humans. The genome of the M strain of M. marinum comprises a 6,636,827-bp circular chromosome with 5424 CDS, 10 prophages, and a 23-kb mercury-resistance plasmid. Prominent features are the very large number of genes (57) encoding polyketide synthases (PKSs) and nonribosomal peptide synthases (NRPSs) and the most extensive repertoire yet reported of the mycobacteria-restricted PE and PPE proteins, and related-ESX secretion systems. Some of the NRPS genes comprise a novel family and seem to have been acquired horizontally. M. marinum is used widely as a model organism to study M. tuberculosis pathogenesis, and genome comparisons confirmed the close genetic relationship between these two species, as they share 3000 orthologs with an average amino acid identity of 85%. Comparisons with the more distantly related Mycobacterium avium subspecies paratuberculosis and Mycobacterium smegmatis reveal how an ancestral generalist mycobacterium evolved into M. tuberculosis and M. marinum. M. tuberculosis has undergone genome downsizing and extensive lateral gene transfer to become a specialized pathogen of humans and other primates without retaining an environmental niche. M. marinum has maintained a large genome so as to retain the capacity for environmental survival while becoming a broad host range pathogen that produces disease strikingly similar to M. tuberculosis. The work described herein provides a foundation for using M. marinum to better understand the determinants of pathogenesis of tuberculosis. PMID:18403782

  6. Stability of Insertion Sequence IS1245, a Marker for Differentiation of Mycobacterium avium Strains

    PubMed Central

    Bauer, Jeanett; Andersen, Åse Bengård

    1999-01-01

    Recently a novel insertion element, IS1245, has been described and suggested for use as a probe in restriction fragment length polymorphism studies of Mycobacterium avium strains. An important issue in this context is the stability of the insertion element. We analyzed single colonies of M. avium cultures and found frequent small one- to two-band changes. However, following repeated in vitro passages over 1 year, similar one- to two-band changes were observed in the IS1245 patterns of only six M. avium strains investigated. PMID:9889238

  7. Prevalence of Mycobacterium tuberculosis in Taiwan: A Model for Strain Evolution Linked to Population Migration

    PubMed Central

    Dou, Horng-Yunn; Huang, Shu-Chen; Su, Ih-Jen

    2011-01-01

    The global evolution and spread of Mycobacterium tuberculosis (MTB), one of the most successful bacterial pathogens, remain a mystery. Advances in molecular technology in the past decade now make it possible to understand MTB strain evolution and transmission in the context of human population migration. Taiwan is a relatively isolated island, serving as a mixing vessel over the past four centuries as colonization by different waves of ethnic groups occurred. By using mycobacterial tandem repeat sequences as genetic markers, the prevalence of MTB strains in Taiwan revealed an interesting association with historical migrations of different ethnic populations, thus providing a good model to explore the global evolution and spread of MTB. PMID:21350639

  8. A Mycobacterium Strain with Extended Capacities for Degradation of Gasoline Hydrocarbons

    PubMed Central

    Solano-Serena, Floriane; Marchal, Rémy; Casarégola, Serge; Vasnier, Christelle; Lebeault, Jean-Michel; Vandecasteele, Jean-Paul

    2000-01-01

    A bacterial strain (strain IFP 2173) was selected from a gasoline-polluted aquifer on the basis of its capacity to use 2,2,4-trimethylpentane (isooctane) as a sole carbon and energy source. This isolate, the first isolate with this capacity to be characterized, was identified by 16S ribosomal DNA analysis, and 100% sequence identity with a reference strain of Mycobacterium austroafricanum was found. Mycobacterium sp. strain IFP 2173 used an unusually wide spectrum of hydrocarbons as growth substrates, including n-alkanes and multimethyl-substituted isoalkanes with chains ranging from 5 to 16 carbon atoms long, as well as substituted monoaromatic hydrocarbons. It also attacked ethers, such as methyl t-butyl ether. During growth on gasoline, it degraded 86% of the substrate. Our results indicated that strain IFP 2173 was capable of degrading 3-methyl groups, possibly by a carboxylation and deacetylation mechanism. Evidence that it attacked the quaternary carbon atom structure by an as-yet-undefined mechanism during growth on 2,2,4-trimethylpentane and 2,2-dimethylpentane was also obtained. PMID:10831416

  9. Iron-regulated envelope proteins of mycobacteria grown in vitro and their occurrence in Mycobacterium avium and Mycobacterium leprae grown in vivo.

    PubMed

    Sritharan, M; Ratledge, C

    1990-01-01

    Several iron-regulated envelope proteins (IREPs), 11-180 kDa, have been detected in preparations of walls and membranes of Mycobacterium smegmatis, in an armadillo-derived mycobacterium (ADM) and in M. avium. The same sized proteins from M. vacae appeared under both iron-deficient and iron-sufficient growth conditions. Two larger proteins, of 240 and 250 kDa, appeared in the membranes of M. smegmatis and M. avium only when grown iron-sufficiently but were constitutively present in both ADM and M. vaccae. The IREPs from M. smegmatis were not induced under zinc-deficient growth conditions. Three of the four IREPs (14, 21 and 29 kDa) recognized in M. avium grown in vitro were also recovered from membrane fractions of the same strain grown in mice. In addition, these membranes contained both the high-molecular-mass proteins associated with iron-sufficient growth conditions. Membranes of M. leprae, recovered from infected armadillos, showed the faint presence of a possible IREP at 29 kDa and wall preparations showed the presence of a 21-kDa protein. Membranes also contained the two larger proteins at 240 and 250 kDa. An explanation for the simultaneous occurrence of both low-iron-regulated and high-iron-regulated proteins is offered. PMID:2202378

  10. Heminested inverse PCR for IS6110 fingerprinting of Mycobacterium tuberculosis strains.

    PubMed Central

    Patel, S; Wall, S; Saunders, N A

    1996-01-01

    A heminested inverse PCR (HIP) for the amplification of sequences flanking the Mycobacterium tuberculosis insertion sequence IS6110 has been developed. The method depends upon primers that anneal to IS6110 at sites between its 5' end and the closest BsrFI site. The accuracy of HIP was demonstrated by the amplification of sequences within plasmid constructs carrying one or two copies of the insertion sequence IS986 in different orientations. The identities of the amplicons produced from strains carrying a single copy of IS6110 were verified by nucleotide sequencing. Analyses of 204 M. tuberculosis strains including those involved in outbreaks showed that IS6110 HIP is highly discriminatory and reproducible. HIP fingerprinting of these 204 strains generated 136 distinct types, and its discriminatory power was equivalent to that of standard restriction fragment length polymorphism analysis. The method is therefore of value for the rapid fingerprinting of M. tuberculosis strains for epidemiological purposes. PMID:8784570

  11. Rapid discrimination of Mycobacterium tuberculosis strains by random amplified polymorphic DNA analysis.

    PubMed Central

    Linton, C J; Jalal, H; Leeming, J P; Millar, M R

    1994-01-01

    Investigations of the epidemiology of tuberculosis have been hampered by the lack of strain-specific markers that can be used to differentiate isolates of Mycobacterium tuberculosis. We report the development of a rapid protocol for random amplified polymorphic DNA analysis which included the use of a commercially available DNA extraction kit (GeneReleaser). This was applied to 14 strains of M. tuberculosis, including strains associated with temporal and geographical clusters of tuberculosis in the United Kingdom and those from India, Africa, and Saudi Arabia. Strains of M. tuberculosis could be discriminated in about 8 h by this method, which is therefore a rapid and simple alternative to restriction fragment length polymorphism analysis. Images PMID:7814542

  12. The Mechanism for Type I Interferon Induction by Mycobacterium tuberculosis is Bacterial Strain-Dependent.

    PubMed

    Wiens, Kirsten E; Ernst, Joel D

    2016-08-01

    Type I interferons (including IFNαβ) are innate cytokines that may contribute to pathogenesis during Mycobacterium tuberculosis (Mtb) infection. To induce IFNβ, Mtb must gain access to the host cytosol and trigger stimulator of interferon genes (STING) signaling. A recently proposed model suggests that Mtb triggers STING signaling through bacterial DNA binding cyclic GMP-AMP synthase (cGAS) in the cytosol. The aim of this study was to test the generalizability of this model using phylogenetically distinct strains of the Mtb complex (MTBC). We infected bone marrow derived macrophages with strains from MTBC Lineages 2, 4 and 6. We found that the Lineage 6 strain induced less IFNβ, and that the Lineage 2 strain induced more IFNβ, than the Lineage 4 strain. The strains did not differ in their access to the host cytosol and IFNβ induction by each strain required both STING and cGAS. We also found that the three strains shed similar amounts of bacterial DNA. Interestingly, we found that the Lineage 6 strain was associated with less mitochondrial stress and less mitochondrial DNA (mtDNA) in the cytosol compared with the Lineage 4 strain. Treating macrophages with a mitochondria-specific antioxidant reduced cytosolic mtDNA and inhibited IFNβ induction by the Lineage 2 and 4 strains. We also found that the Lineage 2 strain did not induce more mitochondrial stress than the Lineage 4 strain, suggesting that additional pathways contribute to higher IFNβ induction. These results indicate that the mechanism for IFNβ by Mtb is more complex than the established model suggests. We show that mitochondrial dynamics and mtDNA contribute to IFNβ induction by Mtb. Moreover, we show that the contribution of mtDNA to the IFNβ response varies by MTBC strain and that additional mechanisms exist for Mtb to induce IFNβ. PMID:27500737

  13. The Mechanism for Type I Interferon Induction by Mycobacterium tuberculosis is Bacterial Strain-Dependent

    PubMed Central

    Wiens, Kirsten E.; Ernst, Joel D.

    2016-01-01

    Type I interferons (including IFNαβ) are innate cytokines that may contribute to pathogenesis during Mycobacterium tuberculosis (Mtb) infection. To induce IFNβ, Mtb must gain access to the host cytosol and trigger stimulator of interferon genes (STING) signaling. A recently proposed model suggests that Mtb triggers STING signaling through bacterial DNA binding cyclic GMP-AMP synthase (cGAS) in the cytosol. The aim of this study was to test the generalizability of this model using phylogenetically distinct strains of the Mtb complex (MTBC). We infected bone marrow derived macrophages with strains from MTBC Lineages 2, 4 and 6. We found that the Lineage 6 strain induced less IFNβ, and that the Lineage 2 strain induced more IFNβ, than the Lineage 4 strain. The strains did not differ in their access to the host cytosol and IFNβ induction by each strain required both STING and cGAS. We also found that the three strains shed similar amounts of bacterial DNA. Interestingly, we found that the Lineage 6 strain was associated with less mitochondrial stress and less mitochondrial DNA (mtDNA) in the cytosol compared with the Lineage 4 strain. Treating macrophages with a mitochondria-specific antioxidant reduced cytosolic mtDNA and inhibited IFNβ induction by the Lineage 2 and 4 strains. We also found that the Lineage 2 strain did not induce more mitochondrial stress than the Lineage 4 strain, suggesting that additional pathways contribute to higher IFNβ induction. These results indicate that the mechanism for IFNβ by Mtb is more complex than the established model suggests. We show that mitochondrial dynamics and mtDNA contribute to IFNβ induction by Mtb. Moreover, we show that the contribution of mtDNA to the IFNβ response varies by MTBC strain and that additional mechanisms exist for Mtb to induce IFNβ. PMID:27500737

  14. Complete Genome Sequence of Mycobacterium chelonae Type Strain CCUG 47445, a Rapidly Growing Species of Nontuberculous Mycobacteria

    PubMed Central

    Jaén-Luchoro, Daniel; Salvà-Serra, Francisco; Aliaga-Lozano, Francisco; Seguí, Carolina; Busquets, Antonio; Ramírez, Antonio; Ruíz, Mikel; Gomila, Margarita; Lalucat, Jorge

    2016-01-01

    Mycobacterium chelonae strains are ubiquitous rapidly growing mycobacteria associated with skin and soft tissue infections, cellulitis, abscesses, osteomyelitis, catheter infections, disseminated diseases, and postsurgical infections after implants with prostheses, transplants, and even hemodialysis procedures. Here, we report the complete genome sequence of M. chelonae type strain CCUG 47445. PMID:27284158

  15. Complete Genome Sequence of Mycobacterium chelonae Type Strain CCUG 47445, a Rapidly Growing Species of Nontuberculous Mycobacteria.

    PubMed

    Jaén-Luchoro, Daniel; Salvà-Serra, Francisco; Aliaga-Lozano, Francisco; Seguí, Carolina; Busquets, Antonio; Ramírez, Antonio; Ruíz, Mikel; Gomila, Margarita; Lalucat, Jorge; Bennasar-Figueras, Antoni

    2016-01-01

    Mycobacterium chelonae strains are ubiquitous rapidly growing mycobacteria associated with skin and soft tissue infections, cellulitis, abscesses, osteomyelitis, catheter infections, disseminated diseases, and postsurgical infections after implants with prostheses, transplants, and even hemodialysis procedures. Here, we report the complete genome sequence of M. chelonae type strain CCUG 47445. PMID:27284158

  16. Proteome and Differential Expression Analysis of Membrane and Cytosolic Proteins from Mycobacterium avium subsp. paratuberculosis Strains K-10 and 187.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Little is known of the protein expression in Mycobacterium avium subspecies paratuberculosis (MAP) and how this contributes to pathogenesis. In the present study, proteins from both outer membranes and cytosol were prepared from two strains of MAP; a laboratory-adapted strain K-10 and a recent isola...

  17. Alternative genotyping of drug-resistant Mycobacterium tuberculosis strains.

    PubMed

    Antonenko, Petro B; Kresyun, Valentin I; Antonenko, Kate O

    2014-01-01

    The aim of the present research was to study the capability of a genotyping method for M. tuberculosis through detection of six VNTR-loci (MIRU10, MIRU26, MIRU31, MIRU39, MIRU40, ETR-A). Loci MIRU10, MIRU26, MIRU40 and ETR-A have exhibited high polymorphism in group non-Beijing, while loci MIRU26 and MIRU31 - in the Beijing family. A combined detection of all six loci for fingerprinting of the isolates both from Beijing and non-Beijing was highly effective (Hunter-Gaston index was 0.88 and 0.93 correspondently), especially in areas with limited financial resources and high prevalence of multidrug resistant M. tuberculosis strains. PMID:25115121

  18. High-level relatedness among Mycobacterium abscessus subsp. massiliense strains from widely separated outbreaks.

    PubMed

    Tettelin, Hervé; Davidson, Rebecca M; Agrawal, Sonia; Aitken, Moira L; Shallom, Shamira; Hasan, Nabeeh A; Strong, Michael; de Moura, Vinicius Calado Nogueira; De Groote, Mary Ann; Duarte, Rafael S; Hine, Erin; Parankush, Sushma; Su, Qi; Daugherty, Sean C; Fraser, Claire M; Brown-Elliott, Barbara A; Wallace, Richard J; Holland, Steven M; Sampaio, Elizabeth P; Olivier, Kenneth N; Jackson, Mary; Zelazny, Adrian M

    2014-03-01

    Three recently sequenced strains isolated from patients during an outbreak of Mycobacterium abscessus subsp. massiliense infections at a cystic fibrosis center in the United States were compared with 6 strains from an outbreak at a cystic fibrosis center in the United Kingdom and worldwide strains. Strains from the 2 cystic fibrosis outbreaks showed high-level relatedness with each other and major-level relatedness with strains that caused soft tissue infections during an epidemic in Brazil. We identified unique single-nucleotide polymorphisms in cystic fibrosis and soft tissue outbreak strains, separate single-nucleotide polymorphisms only in cystic fibrosis outbreak strains, and unique genomic traits for each subset of isolates. Our findings highlight the necessity of identifying M. abscessus to the subspecies level and screening all cystic fibrosis isolates for relatedness to these outbreak strains. We propose 2 diagnostic strategies that use partial sequencing of rpoB and secA1 genes and a multilocus sequence typing protocol. PMID:24565502

  19. High-level Relatedness among Mycobacterium abscessus subsp. massiliense Strains from Widely Separated Outbreaks

    PubMed Central

    Tettelin, Hervé; Davidson, Rebecca M.; Agrawal, Sonia; Aitken, Moira L.; Shallom, Shamira; Hasan, Nabeeh A.; Strong, Michael; Nogueira de Moura, Vinicius Calado; De Groote, Mary Ann; Duarte, Rafael S.; Hine, Erin; Parankush, Sushma; Su, Qi; Daugherty, Sean C.; Fraser, Claire M.; Brown-Elliott, Barbara A.; Wallace, Richard J.; Holland, Steven M.; Sampaio, Elizabeth P.; Olivier, Kenneth N.; Jackson, Mary

    2014-01-01

    Three recently sequenced strains isolated from patients during an outbreak of Mycobacterium abscessus subsp. massiliense infections at a cystic fibrosis center in the United States were compared with 6 strains from an outbreak at a cystic fibrosis center in the United Kingdom and worldwide strains. Strains from the 2 cystic fibrosis outbreaks showed high-level relatedness with each other and major-level relatedness with strains that caused soft tissue infections during an epidemic in Brazil. We identified unique single-nucleotide polymorphisms in cystic fibrosis and soft tissue outbreak strains, separate single-nucleotide polymorphisms only in cystic fibrosis outbreak strains, and unique genomic traits for each subset of isolates. Our findings highlight the necessity of identifying M. abscessus to the subspecies level and screening all cystic fibrosis isolates for relatedness to these outbreak strains. We propose 2 diagnostic strategies that use partial sequencing of rpoB and secA1 genes and a multilocus sequence typing protocol. PMID:24565502

  20. Mycobacterium tuberculosis Strains Potentially Involved in the TB Epidemic in Sweden a Century Ago

    PubMed Central

    Groenheit, Ramona; Ghebremichael, Solomon; Pennhag, Alexandra; Jonsson, Jerker; Hoffner, Sven; Couvin, David; Koivula, Tuija; Rastogi, Nalin; Källenius, Gunilla

    2012-01-01

    A hundred years ago the prevalence of tuberculosis (TB) in Sweden was one of the highest in the world. In this study we conducted a population-based search for distinct strains of Mycobacterium tuberculosis complex isolated from patients born in Sweden before 1945. Many of these isolates represent the M. tuberculosis complex population that fueled the TB epidemic in Sweden during the first half of the 20th century. Methods Genetic relationships between strains that caused the epidemic and present day strains were studied by spoligotyping and restriction fragment length polymorphism. Results The majority of the isolates from the elderly population were evolutionary recent Principal Genetic Group (PGG)2/3 strains (363/409 or 88.8%), and only a low proportion were ancient PGG1 strains (24/409 or 5.9%). Twenty-two were undefined. The isolates demonstrated a population where the Euro-American superlineage dominated; in particular with Haarlem (41.1%) and T (37.7%) spoligotypes and only 21.2% belonged to other spoligotype families. Isolates from the elderly population clustered much less frequently than did isolates from a young control group population. Conclusions A closely knit pool of PGG2/3 strains restricted to Sweden and its immediate neighbours appears to have played a role in the epidemic, while PGG1 strains are usually linked to migrants in todaýs Sweden. Further studies of these outbreak strains may give indications of why the epidemic waned. PMID:23056484

  1. Isolation and characterization of a new Mycobacterium austroafricanum strain, IFP 2015, growing on MTBE.

    PubMed

    Lopes Ferreira, Nicolas; Maciel, Helena; Mathis, Hugues; Monot, Frédéric; Fayolle-Guichard, Françoise; Greer, Charles W

    2006-04-01

    A new Mycobacterium austroafricanum strain, IFP 2015, growing on methyl tert-butyl ether (MTBE) as a sole carbon source was isolated from an MTBE-degrading microcosm inoculated with drain water of an MTBE-supplemented gasoline storage tank. M. austroafricanum IFP 2015 was able to grow on tert-butyl formate, tert-butyl alcohol (TBA) and alpha-hydroxyisobutyrate. 2-Methyl-1,2-propanediol was identified as the TBA oxidation product in M. austroafricanum IFP 2015 and in the previously isolated M. austroafricanum IFP 2012. M. austroafricanum IFP 2015 also degraded ethyl tert-butyl ether more rapidly than M. austroafricanum IFP 2012. Specific primers designed to monitor the presence of M. austroafricanum strains could be used as molecular tools to detect similar strains in MTBE-contaminated environment. PMID:16028043

  2. Monocarbonyl analogs of curcumin inhibit growth of antibiotic sensitive and resistant strains of Mycobacterium tuberculosis

    PubMed Central

    Baldwin, Patrick R.; Reeves, Analise Z.; Powell, Kimberly R.; Napier, Ruth J.; Swimm, Alyson I.; Sun, Aiming; Giesler, Kyle; Bommarius, Bettina; Shinnick, Thomas M.; Snyder, James P.; Liotta, Dennis C.; Kalman, Daniel

    2016-01-01

    Tuberculosis (TB) is a major public health concern worldwide with over 2 billion people currently infected. The rise of strains of Mycobacterium tuberculosis (Mtb) that are resistant to some or all first and second line antibiotics, including multidrug-resistant (MDR), extensively drug resistant (XDR) and totally drug resistant (TDR) strains, is of particular concern and new anti-TB drugs are urgently needed. Curcumin, a natural product used in traditional medicine in India, exhibits anti-microbial activity that includes Mtb, however it is relatively unstable and suffers from poor bioavailability. To improve activity and bioavailability, mono-carbonyl analogs of curcumin were synthesized and screened for their capacity to inhibit the growth of Mtb and the related Mycobacterium marinum (Mm). Using disk diffusion and liquid culture assays, we found several analogs that inhibit in vitro growth of Mm and Mtb, including rifampicin-resistant strains. Structure activity analysis of the analogs indicated that Michael acceptor properties are critical for inhibitory activity. However, no synergistic effects were evident between the monocarbonyl analogs and rifampicin on inhibiting growth. Together, these data provide a structural basis for the development of analogs of curcumin with pronounced anti-mycobacterial activity and provide a roadmap to develop additional structural analogs that exhibit more favorable interactions with other anti-TB drugs. PMID:25618016

  3. The mtp40 gene is not present in all strains of Mycobacterium tuberculosis.

    PubMed Central

    Weil, A; Plikaytis, B B; Butler, W R; Woodley, C L; Shinnick, T M

    1996-01-01

    A multiple PCR-based assay that targets IS6110 and the mtp40 gene was evaluated for the rapid differentiation of Mycobacterium bovis and M. tuberculosis, two of the causative agents of tuberculosis. The IS6110 target is present in both species, whereas the mtp40 gene was thought to be specific for M.tuberculosis (P.Del Portillo, L.A. Murillo, and M.E. Patarroyo, J. Clin. Microbiol. 29:2163-2168, 1991). However, the mtp-40 gene is not present in all M. tuberculosis strains and, hence, is not useful for differentiating M.tuberculosis and M.bovis. PMID:8862608

  4. Molecular epidemiology of Mycobacterium tuberculosis strains isolated from different regions of Italy and Pakistan.

    PubMed Central

    Sechi, L A; Zanetti, S; Delogu, G; Montinaro, B; Sanna, A; Fadda, G

    1996-01-01

    The use of the (GTG)5 oligonucleotide, a repetitive marker in the Mycobacterium tuberculosis chromosome, as a primer in association with an IS6110 outlooking primer has been successfully applied to a PCR-based fingerprinting method. This method classified 62 strains of M. tuberculosis, isolated from human immunodeficiency virus-seropositive and -seronegative patients in different regions of Italy and Pakistan, as having 53 different patterns. The results were compared with traditional IS6110 fingerprinting, by which 47 distinct patterns were observed. PMID:8784602

  5. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB) PR10 strain

    PubMed Central

    Halim, Mohd Zakihalani A.; Jaafar, Mohammad Maaruf; Teh, Lay Kek; Ismail, Mohamad Izwan; Lee, Lian Shien; Ngeow, Yun Fong; Nor, Norazmi Mohd; Zainuddin, Zainul Fadziruddin; Tang, Thean Hock; Najimudin, Mohd Nazalan Mohd; Salleh, Mohd Zaki

    2016-01-01

    Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10) isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. PMID:26981419

  6. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB) PR10 strain.

    PubMed

    Halim, Mohd Zakihalani A; Jaafar, Mohammad Maaruf; Teh, Lay Kek; Ismail, Mohamad Izwan; Lee, Lian Shien; Ngeow, Yun Fong; Nor, Norazmi Mohd; Zainuddin, Zainul Fadziruddin; Tang, Thean Hock; Najimudin, Mohd Nazalan Mohd; Salleh, Mohd Zaki

    2016-03-01

    Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10) isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. PMID:26981419

  7. Comparative analysis of Mycobacterium tuberculosis Beijing strains isolated in three remote areas of Japan.

    PubMed

    Yokoyama, Eiji; Hachisu, Yushi; Iwamoto, Tomotada; Nakanishi, Noriko; Arikawa, Kentaro; Wada, Takayuki; Seto, Junji; Kishida, Kazunori

    2015-08-01

    A quantitative and qualitative comparison was carried out of Mycobacterium tuberculosis Beijing strains isolated in three remote areas of Japan. A total of 452 strains from Chiba Prefecture, 75 from Yamagata Prefecture, and 315 from Kobe City were analyzed for 24 loci by variable number of tandem repeats typing (24(Beijing)-VNTR). All strains were classified in six Beijing subgroups (B(SUB)), B1 to B5 and T, based on a minimum spanning tree reconstructed using data of a standard set of 15 VNTR loci. No significant difference was found in the distribution of strains in the B(SUB) in the three areas, with one exception due to a B5 outbreak in Yamagata, indicating no significant quantitative difference in the B(SUB) in the three areas (P<0.01, Chi-square test). In addition, when strains in each B(SUB) isolated in the three areas were mixed and standardized index of association (I(A)(s)) and variance (Φ(PT)) values were calculated, no significant qualitative difference in the B(SUB) in the three areas was found. These results suggested that the B(SUB) diverged prior to the introduction of M. tuberculosis Beijing strains into Japan. Differences in the distribution of strains in each B(SUB) between Japan and continental Asian countries suggested there had been genetic drift in the continental Asian countries in which B4 had been dominant. PMID:26096775

  8. Effects of genetic variability of Mycobacterium tuberculosis strains on the presentation of disease.

    PubMed

    Malik, Aeesha N J; Godfrey-Faussett, Peter

    2005-03-01

    The nature of the variability in the clinical and epidemiological consequences of Mycobacterium tuberculosis infection remains poorly understood. Environmental and host factors that contribute to the outcome of infection and disease presentation are well recognised, but the role of bacterial factors has been more elusive. The rapid increase in the understanding of the molecular basis of M tuberculosis over the past decades has revived research into its pathogenesis. DNA fingerprinting techniques have been used to distinguish between strains of M tuberculosis, and efforts to characterise the strains present within populations have led to increased understanding of their global distribution. This research has shown that in certain areas a small number of strains are causing a disproportionate number of cases of the disease. The sequencing of the complete genome of M tuberculosis has accelerated the development of molecular techniques to differentiate strains according to their genetic polymorphisms. Investigation into the reasons why some strains are predominant by genetic strain-typing techniques may clarify which bacterial factors contribute to disease. This knowledge has the potential to influence control and prevention strategies for tuberculosis in the future. However, there are still limitations in these techniques and their results. This review discusses molecular epidemiology and genetic studies, and their contribution to the understanding of the links between genotypic and phenotypic characteristics of M tuberculosis strains. PMID:15766652

  9. Multiplex PCR assay specific for the multidrug-resistant strain W of Mycobacterium tuberculosis.

    PubMed

    Plikaytis, B B; Marden, J L; Crawford, J T; Woodley, C L; Butler, W R; Shinnick, T M

    1994-06-01

    In 1991, a multidrug-resistant strain of Mycobacterium tuberculosis was isolated from eight people with tuberculosis at a state correctional facility in New York. This strain, which is designated strain W (IS6110 restriction fragment length polymorphism type 212072), was resistant to isoniazid, rifampin, ethambutol, streptomycin, kanamycin, ethionamide, and rifabutin. Since that outbreak, the W strain has been associated with outbreaks in five hospitals in the New York City area and is a continuing public health problem in the area. To be able to identify this strain rapidly, we developed a multiplex PCR assay which targets a direct repeat of IS6110 with a 556-bp intervening sequence (NTF-1). The amplification generates two amplicons from strain W, which indicate the presence and orientation of the NTF-1 sequence between the direct repeat of IS6110, and a third amplicon, which serves as an internal PCR control. The assay was evaluated with 193 isolates of M. tuberculosis, and all 48 strain W isolates among those 193 isolates were correctly identified. PMID:7915723

  10. [A chromatographic analysis of the Mycobacterium tuberculosis strains isolated from an outbreak in HIV patients in Cuba].

    PubMed

    Mederos, L M; Quiñones, Y; Ruiz, A; Teja, I; Valdivia, J A

    1998-01-01

    A group of strains of Mycobacterium tuberculosis isolated from an outbreak in HIV-infected patients was studied by chromatographic techniques. A group of strains of M. Tuberculosis from symptomatic respiratory patients (SR+ 14) and patterns strains from the laboratory collection were used as a reference aimed at making a qualitative comparison of the chromatographic patterns described by the strains isolated from patients. The chromatographic profiles of the strains isolated from patients (SR+) and fro HIV+ were obtained and compared by thin layer chromatography (TLC). Each of the present fatty acids was identified by using the gas chromatography technique (GC) coupled to mass spectrum analysis. All the studied strains were classified as Mycobacterium tuberculosis. According to the results attained, the usefulness of the chromatographic techniques as alternative techniques for the mycobacterial diagnosis is demonstrated. PMID:10349430

  11. Evaluation of the Antimicrobial Properties of the Essential Oil of Myrtus communis L. against Clinical Strains of Mycobacterium spp.

    PubMed Central

    Zanetti, Stefania; Cannas, Sara; Molicotti, Paola; Bua, Alessandra; Cubeddu, Marina; Porcedda, Silvia; Marongiu, Bruno; Sechi, Leonardo Antonio

    2010-01-01

    Mycobacterium tuberculosis is the etiological agent of tuberculosis. The World Health Organization has estimated that 8 million of people develop active TB every year and the situation is complicated by an increase of Mycobacterium tuberculosis strains resistant to drugs used in antitubercular therapy: MDR and XDR-TB. Myrtle leaf extracts, used as an antiseptic in Sardinian traditional medicine, have strong antibacterial activity as several investigations showed. In this study we investigated the antimicrobial properties of the essential oil of Myrtus communis against clinical strains of M. tuberculosis and M. paratuberculosis. PMID:20706606

  12. Predominance of modern Mycobacterium tuberculosis strains and active transmission of Beijing sublineage in Jayapura, Indonesia Papua.

    PubMed

    Chaidir, Lidya; Sengstake, Sarah; de Beer, Jessica; Oktavian, Antonius; Krismawati, Hana; Muhapril, Erfin; Kusumadewi, Inri; Annisa, Jessi; Anthony, Richard; van Soolingen, Dick; Achmad, Tri Hanggono; Marzuki, Sangkot; Alisjahbana, Bachti; van Crevel, Reinout

    2016-04-01

    Mycobacterium tuberculosis genotype distribution is different between West and Central Indonesia, but there are no data on the most Eastern part, Papua. We aimed to identify the predominant genotypes of M. tuberculosis responsible for tuberculosis in coastal Papua, their transmission, and the association with patient characteristics. A total of 199 M. tuberculosis isolates were collected. Spoligotyping was applied to describe the population structure of M. tuberculosis, lineage identification was performed using a combination of lineage-specific markers, and genotypic clusters were identified using a combination of 24-locus-MIRU-VNTR and spoligotyping. A high degree of genetic diversity was observed among isolates based on their spoligopatterns. Strains from modern lineage 4 made up almost half of strains (46.9%), being more abundant than the ancient lineage 1 (33.7%), and modern lineage 2 (19.4%). Thirty-five percent of strains belonged to genotypic clusters, especially strains in the Beijing genotype. Previous TB treatment and mutations associated with drug resistance were more common in patients infected with strains of the Beijing genotype. Papua shows a different distribution of M. tuberculosis genotypes compared to other parts of Indonesia. Clustering and drug resistance of modern strains recently introduced to Papua may contribute to the high tuberculosis burden in this region. PMID:26825253

  13. IS6110 fingerprinting of drug-resistant Mycobacterium tuberculosis strains isolated in Germany during 1995.

    PubMed Central

    Niemann, S; Rüsch-Gerdes, S; Richter, E

    1997-01-01

    The epidemiological relatedness of drug-resistant Mycobacterium tuberculosis strains isolated in Germany in 1995 was evaluated by the standardized IS6110 fingerprinting method. Altogether, 196 M. tuberculosis isolates from 167 patients were analyzed. A large degree of IS6110 polymorphism was found, ranging from 1 to 20 copies. Multiple isolates from one patient generally remained stable over a period of up to 1 year. However, one strain showed an additional fragment 7 months after the first isolate was obtained. Isolates from 55 patients (33%) showed identical fingerprint patterns or fingerprint patterns that differed only in one band, and thus they were clustered in 22 fingerprint groups. Specific transmission links could be established between members of four groups, e.g., transmission by family contacts. In one case, transmission of a multidrug-resistant strain to a patient initially infected with a drug-susceptible strain could be shown. Besides these fingerprint groups, 30 of the 167 isolates (approximately 18%) could be grouped in two fingerprint clusters with a similarity of at least 78%. Approximately 60% of the patients of these two clusters were known to be immigrants from the former Soviet Union, and one patient is still living in Belarus. In conclusion, our results indicate that (i) transmission of drug-resistant strains contributes substantially to the emergence of drug-resistant tuberculosis in Germany and (ii) drug-resistant M. tuberculosis strains were presumably carried over from the former Soviet Union to Germany by immigrants. PMID:9399486

  14. Genomic Stability over 9 Years of an Isoniazid Resistant Mycobacterium tuberculosis Outbreak Strain in Sweden

    PubMed Central

    Sandegren, Linus; Groenheit, Ramona; Koivula, Tuija; Ghebremichael, Solomon; Advani, Abdolreza; Castro, Elsie; Pennhag, Alexandra; Hoffner, Sven; Mazurek, Jolanta; Pawlowski, Andrzej; Kan, Boris; Bruchfeld, Judith; Melefors, Öjar; Källenius, Gunilla

    2011-01-01

    In molecular epidemiological studies of drug resistant Mycobacterium tuberculosis (TB) in Sweden a large outbreak of an isoniazid resistant strain was identified, involving 115 patients, mainly from the Horn of Africa. During the outbreak period, the genomic pattern of the outbreak strain has stayed virtually unchanged with regard to drug resistance, IS6110 restriction fragment length polymorphism and spoligotyping patterns. Here we present the complete genome sequence analyses of the index isolate and two isolates sampled nine years after the index case as well as experimental data on the virulence of this outbreak strain. Even though the strain has been present in the community for nine years and passaged between patients at least five times in-between the isolates, we only found four single nucleotide polymorphisms in one of the later isolates and a small (4 amino acids) deletion in the other compared to the index isolate. In contrast to many other evolutionarily successful outbreak lineages (e.g. the Beijing lineage) this outbreak strain appears to be genetically very stable yet evolutionarily successful in a low endemic country such as Sweden. These findings further illustrate that the rate of genomic variation in TB can be highly strain dependent, something that can have important implications for epidemiological studies as well as development of resistance. PMID:21304944

  15. Mycobacterium avium subsp. paratuberculosis sheep strains isolated from Cyprus sheep and goats.

    PubMed

    Liapi, M; Botsaris, G; Slana, I; Moravkova, M; Babak, V; Avraam, M; Di Provvido, A; Georgiadou, S; Pavlik, I

    2015-04-01

    Paratuberculosis, caused by Mycobacterium avium subsp. paratuberculosis (Map), is a chronic incurable infection of intestinal tract of animals. Molecular characterization of Map isolates classifies them into two major groups, 'Cattle' or Type II and 'Sheep' or Type I/III with a different phenotype, epidemiology, virulence and pathogenesis. The aim of this study was to examine 192 Map ELISA-positive sheep and goats from Cyprus using faecal culture and genotype Map isolates using IS1311 PCR and restriction endonuclease analysis (IS1311 PCR-REA) with HinfI restriction enzyme. Map was isolated from only four (4.6%) faecal samples out of 88 sheep and 15 (14.4%) faecal samples out of 104 goats. Genotyping of the isolates using IS1311 PCR-REA revealed that sheep and goat populations on the island are infected primarily by 'Sheep' strains. Only three Map isolates from goats originated from one farm were characterized as 'Cattle' strains. PMID:23683358

  16. TLR2-Modulating Lipoproteins of the Mycobacterium tuberculosis Complex Enhance the HIV Infectivity of CD4+ T Cells.

    PubMed

    Skerry, Ciaran; Klinkenberg, Lee G; Page, Kathleen R; Karakousis, Petros C

    2016-01-01

    Co-infection with Mycobacterium tuberculosis accelerates progression from HIV to AIDS. Our previous studies showed that M. tuberculosis complex, unlike M. smegmatis, enhances TLR2-dependent susceptibility of CD4+ T cells to HIV. The M. tuberculosis complex produces multiple TLR2-stimulating lipoproteins, which are absent in M. smegmatis. M. tuberculosis production of mature lipoproteins and TLR2 stimulation is dependent on cleavage by lipoprotein signal peptidase A (LspA). In order to determine the role of potential TLR2-stimulating lipoproteins on mycobacterial-mediated HIV infectivity of CD4+ T cells, we generated M. smegmatis recombinant strains overexpressing genes encoding various M. bovis BCG lipoproteins, as well as a Mycobacterium bovis BCG strain deficient in LspA (ΔlspA). Exposure of human peripheral blood mononuclear cells (PBMC) to M. smegmatis strains overexpressing the BCG lipoproteins, LprF (p<0.01), LprH (p<0.05), LprI (p<0.05), LprP (p<0.001), LprQ (p<0.005), MPT83 (p<0.005), or PhoS1 (p<0.05), resulted in increased HIV infectivity of CD4+ T cells isolated from these PBMC. Conversely, infection of PBMC with ΔlspA reduced HIV infectivity of CD4+ T cells by 40% relative to BCG-infected cells (p<0.05). These results may have important implications for TB vaccination programs in areas with high mother-to-child HIV transmission. PMID:26807859

  17. TLR2-Modulating Lipoproteins of the Mycobacterium tuberculosis Complex Enhance the HIV Infectivity of CD4+ T Cells

    PubMed Central

    Skerry, Ciaran; Klinkenberg, Lee G.; Page, Kathleen R.; Karakousis, Petros C.

    2016-01-01

    Co-infection with Mycobacterium tuberculosis accelerates progression from HIV to AIDS. Our previous studies showed that M. tuberculosis complex, unlike M. smegmatis, enhances TLR2-dependent susceptibility of CD4+ T cells to HIV. The M. tuberculosis complex produces multiple TLR2-stimulating lipoproteins, which are absent in M. smegmatis. M. tuberculosis production of mature lipoproteins and TLR2 stimulation is dependent on cleavage by lipoprotein signal peptidase A (LspA). In order to determine the role of potential TLR2-stimulating lipoproteins on mycobacterial-mediated HIV infectivity of CD4+ T cells, we generated M. smegmatis recombinant strains overexpressing genes encoding various M. bovis BCG lipoproteins, as well as a Mycobacterium bovis BCG strain deficient in LspA (ΔlspA). Exposure of human peripheral blood mononuclear cells (PBMC) to M. smegmatis strains overexpressing the BCG lipoproteins, LprF (p<0.01), LprH (p<0.05), LprI (p<0.05), LprP (p<0.001), LprQ (p<0.005), MPT83 (p<0.005), or PhoS1 (p<0.05), resulted in increased HIV infectivity of CD4+ T cells isolated from these PBMC. Conversely, infection of PBMC with ΔlspA reduced HIV infectivity of CD4+ T cells by 40% relative to BCG-infected cells (p<0.05). These results may have important implications for TB vaccination programs in areas with high mother-to-child HIV transmission. PMID:26807859

  18. Comparative Proteomic Analyses of Avirulent, Virulent, and Clinical Strains of Mycobacterium tuberculosis Identify Strain-specific Patterns*

    PubMed Central

    Jhingan, Gagan Deep; Kumari, Sangeeta; Jamwal, Shilpa V.; Kalam, Haroon; Arora, Divya; Jain, Neharika; Kumaar, Lakshmi Krishna; Samal, Areejit; Rao, Kanury V. S.; Kumar, Dhiraj; Nandicoori, Vinay Kumar

    2016-01-01

    Mycobacterium tuberculosis is an adaptable intracellular pathogen, existing in both dormant as well as active disease-causing states. Here, we report systematic proteomic analyses of four strains, H37Ra, H37Rv, and clinical isolates BND and JAL, to determine the differences in protein expression patterns that contribute to their virulence and drug resistance. Resolution of lysates of the four strains by liquid chromatography, coupled to mass spectrometry analysis, identified a total of 2161 protein groups covering ∼54% of the predicted M. tuberculosis proteome. Label-free quantification analysis of the data revealed 257 differentially expressed protein groups. The differentially expressed protein groups could be classified into seven K-means cluster bins, which broadly delineated strain-specific variations. Analysis of the data for possible mechanisms responsible for drug resistance phenotype of JAL suggested that it could be due to a combination of overexpression of proteins implicated in drug resistance and the other factors. Expression pattern analyses of transcription factors and their downstream targets demonstrated substantial differential modulation in JAL, suggesting a complex regulatory mechanism. Results showed distinct variations in the protein expression patterns of Esx and mce1 operon proteins in JAL and BND strains, respectively. Abrogating higher levels of ESAT6, an important Esx protein known to be critical for virulence, in the JAL strain diminished its virulence, although it had marginal impact on the other strains. Taken together, this study reveals that strain-specific variations in protein expression patterns have a meaningful impact on the biology of the pathogen. PMID:27151218

  19. Repeated Aerosolized-Boosting with Gamma-Irradiated Mycobacterium bovis BCG Confers Improved Pulmonary Protection against the Hypervirulent Mycobacterium tuberculosis Strain HN878 in Mice

    PubMed Central

    Kim, Jong-Seok; Kim, Hongmin; Kwon, Kee Woong; Han, Seung Jung; Eum, Seok-Yong; Cho, Sang-Nae; Shin, Sung Jae

    2015-01-01

    Mycobacterium bovis bacillus Calmette-Guerin (BCG), the only licensed vaccine, shows limited protection efficacy against pulmonary tuberculosis (TB), particularly hypervirulent Mycobacterium tuberculosis (Mtb) strains, suggesting that a logistical and practical vaccination strategy is urgently required. Boosting the BCG-induced immunity may offer a potentially advantageous strategy for advancing TB vaccine development, instead of replacing BCG completely. Despite the improved protection of the airway immunization by using live BCG, the use of live BCG as an airway boosting agent may evoke safety concerns. Here, we analyzed the protective efficacy of γ-irradiated BCG as a BCG-prime boosting agent for airway immunization against a hypervirulent clinical strain challenge with Mycobacterium tuberculosis HN878 in a mouse TB model. After the aerosol challenge with the HN878 strain, the mice vaccinated with BCG via the parenteral route exhibited only mild and transient protection, whereas BCG vaccination followed by multiple aerosolized boosting with γ-irradiated BCG efficiently maintained long-lasting control of Mtb in terms of bacterial reduction and pathological findings. Further immunological investigation revealed that this approach resulted in a significant increase in the cellular responses in terms of a robust expansion of antigen (PPD and Ag85A)-specific CD4+ T cells concomitantly producing IFN-γ, TNF-α, and IL-2, as well as a high level of IFN-γ-producing recall response via both the local and systemic immune systems upon further boosting. Collectively, aerosolized boosting of γ-irradiated BCG is able to elicit strong Th1-biased immune responses and confer enhanced protection against a hypervirulent Mycobacterium tuberculosis HN878 infection in a boosting number-dependent manner. PMID:26509812

  20. Repeated Aerosolized-Boosting with Gamma-Irradiated Mycobacterium bovis BCG Confers Improved Pulmonary Protection against the Hypervirulent Mycobacterium tuberculosis Strain HN878 in Mice.

    PubMed

    Cha, Seung Bin; Kim, Woo Sik; Kim, Jong-Seok; Kim, Hongmin; Kwon, Kee Woong; Han, Seung Jung; Eum, Seok-Yong; Cho, Sang-Nae; Shin, Sung Jae

    2015-01-01

    Mycobacterium bovis bacillus Calmette-Guerin (BCG), the only licensed vaccine, shows limited protection efficacy against pulmonary tuberculosis (TB), particularly hypervirulent Mycobacterium tuberculosis (Mtb) strains, suggesting that a logistical and practical vaccination strategy is urgently required. Boosting the BCG-induced immunity may offer a potentially advantageous strategy for advancing TB vaccine development, instead of replacing BCG completely. Despite the improved protection of the airway immunization by using live BCG, the use of live BCG as an airway boosting agent may evoke safety concerns. Here, we analyzed the protective efficacy of γ-irradiated BCG as a BCG-prime boosting agent for airway immunization against a hypervirulent clinical strain challenge with Mycobacterium tuberculosis HN878 in a mouse TB model. After the aerosol challenge with the HN878 strain, the mice vaccinated with BCG via the parenteral route exhibited only mild and transient protection, whereas BCG vaccination followed by multiple aerosolized boosting with γ-irradiated BCG efficiently maintained long-lasting control of Mtb in terms of bacterial reduction and pathological findings. Further immunological investigation revealed that this approach resulted in a significant increase in the cellular responses in terms of a robust expansion of antigen (PPD and Ag85A)-specific CD4+ T cells concomitantly producing IFN-γ, TNF-α, and IL-2, as well as a high level of IFN-γ-producing recall response via both the local and systemic immune systems upon further boosting. Collectively, aerosolized boosting of γ-irradiated BCG is able to elicit strong Th1-biased immune responses and confer enhanced protection against a hypervirulent Mycobacterium tuberculosis HN878 infection in a boosting number-dependent manner. PMID:26509812

  1. Genomic variations associated with attenuation in Mycobacterium avium subsp. paratuberculosis vaccine strains

    PubMed Central

    2013-01-01

    Background Mycobacterium avium subspecies paratuberculosis (MAP) whole cell vaccines have been widely used tools in the control of Johne’s disease in animals despite being unable to provide complete protection. Current vaccine strains derive from stocks created many decades ago; however their genotypes, underlying mechanisms and relative degree of their attenuation are largely unknown. Results Using mouse virulence studies we confirm that MAP vaccine strains 316 F, II and 2e have diverse but clearly attenuated survival and persistence characteristics compared with wild type strains. Using a pan genomic microarray we characterise the genomic variations in a panel of vaccine strains sourced from stocks spanning over 40 years of maintenance. We describe multiple genomic variations specific for individual vaccine stocks in both deletion (26–32 Kbp) and tandem duplicated (11–40 Kbp) large variable genomic islands and insertion sequence copy numbers. We show individual differences suitable for diagnostic differentiation between vaccine and wild type genotypes and provide evidence for functionality of some of the deleted MAP-specific genes and their possible relation to attenuation. Conclusions This study shows how culture environments have influenced MAP genome diversity resulting in large tandem genomic duplications, deletions and transposable element activity. In combination with classical selective systematic subculture this has led to fixation of specific MAP genomic alterations in some vaccine strain lineages which link the resulting attenuated phenotypes with deficiencies in high reactive oxygen species handling. PMID:23339684

  2. [Investigation of Mycobacterium bovis subsp. bovis among the strains of Mycobacterium tuberculosis complex isolated in Düzce Province, Turkey].

    PubMed

    Öztürk, Cihadiye Elif; Şahin, İdris; Öksüz, Şükrü; Kılıç, Nida; Kılınçel, Özge; Aydın, Leyla; Atik, Dursun; Afşin, Emine

    2016-07-01

    Throughout the history of mankind, tuberculosis (TB) has caused serious illness and still continues to do so. Archaeobiological studies indicated that TB in humans dates back to 4000-8000 BC, and cases were shown to be due to Mycobacterium bovis subsp.bovis rather than Mycobacterium tuberculosis. Moreover, this situation was thought to begin with domestication of animals, consumption of their milk, and living together in the same environment with them. Over time, with the consumption of boiled milk and with the establishment of separate animal shelters, M.bovis subsp. bovis infection began to be seen rarely. Today, M.bovis infection is mostly transmitted from animals to humans and very rarely from humans to other humans. The most significant means of transmission of the infection are to the gastrointestinal tract via consumption of raw milk and to the respiratory system via droplet infection from the animals with disease. In this study, it was planned to investigate the cause of occurrence of TB in cattles in Düzce in the past few years along with the presence of bovine type TB in cases of human tuberculosis. We aimed to carry out subtype determination of the M.tuberculosis complex (MTBC) strains isolated in our mycobacteriology laboratory between the years 2004-2014, and evaluate the clinical and sociodemographic data of patients in whom M.bovis subsp. bovis was detected. The strains that were selected for the study have been isolated from radiometric BACTEC™ 12B broth and/or Löwenstein-Jensen (LJ) media between 2004-2009, and BACTEC™ MGIT™ (Mycobacteria Growth Indicator Tube) and/or LJ media between 2009-2014 periods. The GenoType MTBC Kit (Hain-Lifescience GmbH, Germany) was used in the study for determination of the subspecies. Extraction and amplification of DNA and hybridizations were performed according to test procedure in order to investigate the presence of subtypes of the MTBC species in skimmed milk from collections stored at -20°C. In the

  3. Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains.

    PubMed

    Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

    2011-02-01

    Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536(T), M. massiliense CIP 108297(T), and M. bolletii CIP 108541(T)) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the

  4. Isolation and Characterization of a Novel Imidacloprid-Degrading Mycobacterium sp. Strain MK6 from an Egyptian Soil.

    PubMed

    Kandil, Mahrous M; Trigo, Carmen; Koskinen, William C; Sadowsky, Michael J

    2015-05-20

    Thus far, only a small number and types of bacteria with limited ability in degrading imidacloprid have been reported. Also, genes regulating imidacloprid (IMDA) degradation have yet to be discovered. To study this in more detail, an enrichment technique was used to isolate consortia and pure cultures of IMDA-degrading bacteria. Through this approach, we successfully isolated a novel bacterium capable of completely degrading IMDA as a sole nitrogen source. The bacterium was subsequently identified as Mycobacterium sp. strain MK6 by sequence analysis of its 16S rRNA gene (Genbank accession number KR052814 ). BLASTn searches indicated that 16S rRNA gene from Mycobacterium sp. strain MK6 was 99% identical to several Mycobacterium spp. Mycobacterium sp. strain MK6 transformed 99.7% added IMDA (150 μg mL(-1)) in <2 weeks (t1/2 = 1.6 days) to 6-chloronicotinic acid (6-CNA) as its major metabolite. Although the isolated strain and mixed bacterial consortia were able to degrade IMDA, they failed to grow further on 6-CNA, indicating a lack of IMDA mineralization to carbon dioxide. Small amounts of the desnitro-olefin and desnitro-degradates of IMDA were observed during the incubation but did not accumulate in culture medium. PMID:25932751

  5. Whole-Genome Sequences of Mycobacterium bovis Strain MbURU-001, Isolated from Fresh Bovine Infected Samples

    PubMed Central

    Lasserre, Moira; Berná, Luisa; Greif, Gonzalo; Díaz-Viraqué, Florencia; Iraola, Gregorio; Naya, Hugo; Castro-Ramos, Miguel; Juambeltz, Arturo

    2015-01-01

    Bovine tuberculosis in cattle has a high incidence in Uruguay, where it is considered a disease of national importance. We present the genome sequence of Mycobacterium bovis strain MbURU-001, isolated from pectoral lymph nodes of a bovine host from a cattle farm. PMID:26543108

  6. Draft Genome Sequences of Mycobacterium kansasii Strains 1010001454, 1010001458, 1010001468, 1010001493, 1010001495, and 1010001469, Isolated from Environmental Sources.

    PubMed

    Strapagiel, Dominik; Borówka, Paulina; Marciniak, Błażej; Bakuła, Zofia; van Ingen, Jakko; Safianowska, Aleksandra; Brzostek, Anna; Dziadek, Jarosław; Jagielski, Tomasz

    2016-01-01

    Mycobacterium kansasii belongs to the nontuberculous mycobacteria (NTM) and causes opportunistic infections with both pulmonary and extrapulmonary manifestations. Here, we report the draft genome sequences of six environmental M. kansasii strains, designated 1010001495 (type I), 1010001469 (type II), 1010001468 (type III), 1010001458 (type IV), 1010001454 (type V), and 1010001493 (type V), originally isolated in five different European countries. PMID:27257194

  7. Draft Genome Sequences of Mycobacterium kansasii Strains 1010001454, 1010001458, 1010001468, 1010001493, 1010001495, and 1010001469, Isolated from Environmental Sources

    PubMed Central

    Strapagiel, Dominik; Borówka, Paulina; Marciniak, Błażej; Bakuła, Zofia; Safianowska, Aleksandra; Brzostek, Anna; Dziadek, Jarosław

    2016-01-01

    Mycobacterium kansasii belongs to the nontuberculous mycobacteria (NTM) and causes opportunistic infections with both pulmonary and extrapulmonary manifestations. Here, we report the draft genome sequences of six environmental M. kansasii strains, designated 1010001495 (type I), 1010001469 (type II), 1010001468 (type III), 1010001458 (type IV), 1010001454 (type V), and 1010001493 (type V), originally isolated in five different European countries. PMID:27257194

  8. Characterization to species level of Mycobacterium avium complex strains from human immunodeficiency virus-positive and -negative patients.

    PubMed Central

    Kyriakopoulos, A M; Tassios, P T; Matsiota-Bernard, P; Marinis, E; Tsaousidou, S; Legakis, N J

    1997-01-01

    Forty human clinical Mycobacterium avium-M. intracellulare complex strains isolated in Greece were characterized to the species level by PCR with three sets of primers specific for one or both species. M. avium predominated in both human immunodeficiency virus-positive and -negative patients, but the frequency of M. intracellulare isolation appeared to be higher in the latter. PMID:9350780

  9. Prevention of Mycobacterium avium subsp. paratuberculosis Infection in BALB/c Mice by Feeding Lactobacillus acidophilus Strain NP-51

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The immune responses of 390 BALB/c mice fed the probiotic Lactobacillus acidophilus strain NP51® and infected with Mycobacterium avium subspecies paratuberculosis (MAP) were evaluated in a 6-month trial. Mice were randomized to nine treatment groups fed either viable- or heat-killed NP51 and inocula...

  10. ISOLATION OF THE GENOME SEQUENCE STRAIN MYCOBACTERIUM AVIUM 104 FROM MULTIPLE PATIENTS OVER A 17-YEAR PERIOD

    EPA Science Inventory

    The genome sequence strain 104 of the opportunistic pathogen Mycobacterium avium was isolated form an adult AIDS patient in Southern California in 1983. Isolates of non-paratuberculosis M. avium from 207 other patients in Southern California and elsewhere were examined for genoty...

  11. Immunological findings associated with Argentinean strains of Mycobacterium avium subsp. paratuberculosis in bovine models.

    PubMed

    Colavecchia, Silvia B; Fernández, Bárbara; Jolly, Ana; Minatel, Leonardo; Hajos, Silvia E; Paolicchi, Fernando A; Mundo, Silvia L

    2016-08-01

    Mycobacterium avium subspecies paratuberculosis (MAP) is the causative agent of ruminant paratuberculosis. The aim of this study was to evaluate the biological behavior of different Argentinean strains of MAP in two bovine infection models: macrophage (in vitro) and calf (in vivo) through the evaluation of early immune responses at the peripheral and local levels. Two MAP strains (A and C) were selected taking into account the different patterns of TNF-α and IL-10 secretion displayed by infected bovine macrophages in vitro. Two groups of calves were infected with 250mg of total wet weight live MAP: strain A infected group (MA, n=3), strain C infected group (MC, n=2). Another group of animals was mock-infected (MI, n=3). Infection was confirmed by MAP culture of feces and microscopic observation of granulomatous lesions in the gut tissue. All infected calves showed positive results in the DTH skin test. A significant increase in peripheral CD4CD25(+) cells in MC group on day 150 was detected. The specific cellular immune response developed allowed the identification of the infection as early as 30days in the MA group. However, the percentage of CD8CD25(+) cells was significantly increased on day 120 in MC group. Significant differences between groups in proliferation and cellular responses were also detected in ileocecal lymph node samples. In summary, the strains of MAP employed herein induced differential immune responses in peripheral cells, in the proliferative responses and in cell functionality at the local level. Our findings support the hypotheses that the in vitro behavior displayed by macrophages could be a tool to identify differences among MAP strains infecting bovines and that the host-pathogen interactions occurring upon infection are dependent on the strain of MAP involved. PMID:27138443

  12. Volatile Emissions from Mycobacterium avium subsp. paratuberculosis Mirror Bacterial Growth and Enable Distinction of Different Strains

    PubMed Central

    Trefz, Phillip; Koehler, Heike; Klepik, Klaus; Moebius, Petra; Reinhold, Petra; Schubert, Jochen K.; Miekisch, Wolfram

    2013-01-01

    Control of paratuberculosis in livestock is hampered by the low sensitivity of established direct and indirect diagnostic methods. Like other bacteria, Mycobacterium avium subsp. paratuberculosis (MAP) emits volatile organic compounds (VOCs). Differences of VOC patterns in breath and feces of infected and not infected animals were described in first pilot experiments but detailed information on potential marker substances is missing. This study was intended to look for characteristic volatile substances in the headspace of cultures of different MAP strains and to find out how the emission of VOCs was affected by density of bacterial growth. One laboratory adapted and four field strains, three of MAP C-type and one MAP S-type were cultivated on Herrold’s egg yolk medium in dilutions of 10-0, 10-2, 10-4 and 10-6. Volatile substances were pre-concentrated from the headspace over the MAP cultures by means of Solid Phase Micro Extraction (SPME), thermally desorbed from the SPME fibers and separated and identified by means of GC-MS. Out of the large number of compounds found in the headspace over MAP cultures, 34 volatile marker substances could be identified as potential biomarkers for growth and metabolic activity. All five MAP strains could clearly be distinguished from blank culture media by means of emission patterns based on these 34 substances. In addition, patterns of volatiles emitted by the reference strain were significantly different from the field strains. Headspace concentrations of 2-ethylfuran, 2-methylfuran, 3-methylfuran, 2-pentylfuran, ethyl acetate, 1-methyl-1-H-pyrrole and dimethyldisulfide varied with density of bacterial growth. Analysis of VOCs emitted from mycobacterial cultures can be used to identify bacterial growth and, in addition, to differentiate between different bacterial strains. VOC emission patterns may be used to approximate bacterial growth density. In a perspective volatile marker substances could be used to diagnose MAP

  13. Comparative proteomic analysis of virulent Korean Mycobacterium tuberculosis K-strain with other mycobacteria strain following infection of U-937 macrophage.

    PubMed

    Ryoo, Sung Weon; Park, Young Kil; Park, Sue-Nie; Shim, Young Soo; Liew, Hyunjeong; Kang, Seongman; Bai, Gill-Han

    2007-06-01

    In Korea, the Mycobacterium tuberculosis K-strain is the most prevalent clinical isolates and belongs to the Beijing family. In this study, we conducted comparative porteomics of expressed proteins of clinical isolates of the K-strain with H37Rv, H37Ra as well as the vaccine strain of Mycobacterium bovis BCG following phagocytosis by the human monocytic cell line U-937. Proteins were analyzed by 2-D PAGE and MALDITOF-MS. Two proteins, Mb1363 (probable glycogen phosphorylase GlgP) and MT2656 (Haloalkane dehalogenase LinB) were most abundant after phagocytosis of M. tuberculosis K-strain. This approach provides a method to determine specific proteins that may have critical roles in tuberculosis pathogenesis. PMID:17618234

  14. Whole genome sequencing identifies circulating Beijing-lineage Mycobacterium tuberculosis strains in Guatemala and an associated urban outbreak

    PubMed Central

    Saelens, Joseph W.; Lau-Bonilla, Dalia; Moller, Anneliese; Medina, Narda; Guzmán, Brenda; Calderón, Maylena; Herrera, Raúl; Sisk, Dana M.; Xet-Mull, Ana M.; Stout, Jason E.; Arathoon, Eduardo; Samayoa, Blanca; Tobin, David M.

    2015-01-01

    Summary Limited data are available regarding the molecular epidemiology of Mycobacterium tuberculosis (Mtb) strains circulating in Guatemala. Beijing-lineage Mtb strains have gained prevalence worldwide and are associated with increased virulence and drug resistance, but there have been only a few cases reported in Central America. Here we report the first whole genome sequencing of Central American Beijing-lineage strains of Mtb. We find that multiple Beijing-lineage strains, derived from independent founding events, are currently circulating in Guatemala, but overall still represent a relatively small proportion of disease burden. Finally, we identify a specific Beijing-lineage outbreak centered on a poor neighborhood in Guatemala City. PMID:26542222

  15. Whole genome sequencing identifies circulating Beijing-lineage Mycobacterium tuberculosis strains in Guatemala and an associated urban outbreak.

    PubMed

    Saelens, Joseph W; Lau-Bonilla, Dalia; Moller, Anneliese; Medina, Narda; Guzmán, Brenda; Calderón, Maylena; Herrera, Raúl; Sisk, Dana M; Xet-Mull, Ana M; Stout, Jason E; Arathoon, Eduardo; Samayoa, Blanca; Tobin, David M

    2015-12-01

    Limited data are available regarding the molecular epidemiology of Mycobacterium tuberculosis (Mtb) strains circulating in Guatemala. Beijing-lineage Mtb strains have gained prevalence worldwide and are associated with increased virulence and drug resistance, but there have been only a few cases reported in Central America. Here we report the first whole genome sequencing of Central American Beijing-lineage strains of Mtb. We find that multiple Beijing-lineage strains, derived from independent founding events, are currently circulating in Guatemala, but overall still represent a relatively small proportion of disease burden. Finally, we identify a specific Beijing-lineage outbreak centered on a poor neighborhood in Guatemala City. PMID:26542222

  16. Degradation of Phenanthrene and Anthracene by Cell Suspensions of Mycobacterium sp. Strain PYR-1

    PubMed Central

    Moody, Joanna D.; Freeman, James P.; Doerge, Daniel R.; Cerniglia, Carl E.

    2001-01-01

    Cultures of Mycobacterium sp. strain PYR-1 were dosed with anthracene or phenanthrene and after 14 days of incubation had degraded 92 and 90% of the added anthracene and phenanthrene, respectively. The metabolites were extracted and identified by UV-visible light absorption, high-pressure liquid chromatography retention times, mass spectrometry, 1H and 13C nuclear magnetic resonance spectrometry, and comparison to authentic compounds and literature data. Neutral-pH ethyl acetate extracts from anthracene-incubated cells showed four metabolites, identified as cis-1,2-dihydroxy-1,2-dihydroanthracene, 6,7-benzocoumarin, 1-methoxy-2-hydroxyanthracene, and 9,10-anthraquinone. A novel anthracene ring fission product was isolated from acidified culture media and was identified as 3-(2-carboxyvinyl)naphthalene-2-carboxylic acid. 6,7-Benzocoumarin was also found in that extract. When Mycobacterium sp. strain PYR-1 was grown in the presence of phenanthrene, three neutral metabolites were identified as cis- and trans-9,10-dihydroxy-9,10-dihydrophenanthrene and cis-3,4-dihydroxy-3,4-dihydrophenanthrene. Phenanthrene ring fission products, isolated from acid extracts, were identified as 2,2′-diphenic acid, 1-hydroxynaphthoic acid, and phthalic acid. The data point to the existence, next to already known routes for both gram-negative and gram-positive bacteria, of alternative pathways that might be due to the presence of different dioxygenases or to a relaxed specificity of the same dioxygenase for initial attack on polycyclic aromatic hydrocarbons. PMID:11282593

  17. Draft Genome Sequence of the Fish Pathogen Mycobacterium pseudoshottsii Strain JCM15466, a Species Closely Related to M. marinum

    PubMed Central

    Hikima, Jun-ichi; Sakai, Masahiro; Takeyama, Haruko; Hawke, John; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru

    2016-01-01

    Mycobacterium pseudoshottsii is a slowly growing photochromogenic mycobacterium and fish pathogen isolated from wild marine fishes. M. pseudoshottsii closely resembles M. marinum, which is a human and animal pathogen. Here, we report the draft genome sequence of M. pseudoshottsii strain JCM15466, originally isolated from striped bass, Morone saxatilis. PMID:26868383

  18. Exploitation of Mycobacterium tuberculosis Reporter Strains to Probe the Impact of Vaccination at Sites of Infection

    PubMed Central

    Aldridge, Bree B.; Russell, David G.

    2014-01-01

    Mycobacterium tuberculosis (Mtb) remains a major public health problem, with an effective vaccine continuing to prove elusive. Progress in vaccination strategies has been hampered by a lack of appreciation of the bacterium's response to dynamic changes in the host immune environment. Here, we utilize reporter Mtb strains that respond to specific host immune stresses such as hypoxia and nitric oxide (hspX′::GFP), and phagosomal maturation (rv2390c′::GFP), to investigate vaccine-induced alterations in the environmental niche during experimental murine infections. While vaccination undoubtedly decreased bacterial burden, we found that it also appeared to accelerate Mtb's adoption of a phenotype better equipped to survive in its host. We subsequently utilized a novel replication reporter strain of Mtb to demonstrate that, in addition to these alterations in host stress response, there is a decreased percentage of actively replicating Mtb in vaccinated hosts. This observation was supported by the differential sensitivity of recovered bacteria to the front-line drug isoniazid. Our study documents the natural history of the impact that vaccination has on Mtb's physiology and replication and highlights the value of reporter Mtb strains for probing heterogeneous Mtb populations in the context of a complex, whole animal model. PMID:25233380

  19. Degradation of Morpholine by an Environmental Mycobacterium Strain Involves a Cytochrome P-450

    PubMed Central

    Poupin, P.; Truffaut, N.; Combourieu, B.; Besse, P.; Sancelme, M.; Veschambre, H.; Delort, A. M.

    1998-01-01

    A Mycobacterium strain (RP1) was isolated from a contaminated activated sludge collected in a wastewater treatment unit of a chemical plant. It was capable of utilizing morpholine and other heterocyclic compounds, such as pyrrolidine and piperidine, as the sole source of carbon, nitrogen, and energy. The use of in situ 1H nuclear magnetic resonance (1H NMR) spectroscopy allowed the determination of two intermediates in the biodegradative pathway, 2-(2-aminoethoxy)acetate and glycolate. The inhibitory effects of metyrapone on the degradative abilities of strain RP1 indicated the involvement of a cytochrome P-450 in the biodegradation of morpholine. This observation was confirmed by spectrophotometric analysis and 1H NMR. Reduced cell extracts from morpholine-grown cultures, but not succinate-grown cultures, gave rise to a carbon monoxide difference spectrum with a peak near 450 nm, which indicated the presence of a soluble cytochrome P-450. 1H NMR allowed the direct analysis of the incubation medium containing metyrapone, a specific inhibitor of cytochrome P-450. The inhibition of morpholine degradation was dependent on the morpholine/metyrapone ratio. The heme-containing monooxygenase was also detected in pyrrolidine- and piperidine-grown cultures. The abilities of different compounds to support strain growth or the induction of a soluble cytochrome P-450 were assayed. The results suggest that this enzyme catalyzes the cleavage of the C—N bond of the morpholine ring. PMID:9435074

  20. High Affinity Inha Inhibitors with Activity Against Drug-Resistant Strains of Mycobacterium Tuberculosis

    SciTech Connect

    Sullivan,T.; Truglio, J.; Boyne, M.; Novichenok, P.; Zhang, X.; Stratton, C.; Li, H.; Kaur, T.; Amin, A.; et al.

    2006-01-01

    Novel chemotherapeutics for treating multidrug-resistant (MDR) strains of Mycobacterium tuberculosis (MTB) are required to combat the spread of tuberculosis, a disease that kills more than 2 million people annually. Using structure-based drug design, we have developed a series of alkyl diphenyl ethers that are uncompetitive inhibitors of InhA, the enoyl reductase enzyme in the MTB fatty acid biosynthesis pathway. The most potent compound has a Ki{prime} value of 1 nM for InhA and MIC{sub 99} values of 2-3 {micro}g mL{sup -1} (6-10 {micro}M) for both drug-sensitive and drug-resistant strains of MTB. Overexpression of InhA in MTB results in a 9-12-fold increase in MIC{sub 99}, consistent with the belief that these compounds target InhA within the cell. In addition, transcriptional response studies reveal that the alkyl diphenyl ethers fail to upregulate a putative efflux pump and aromatic dioxygenase, detoxification mechanisms that are triggered by the lead compound triclosan. These diphenyl ether-based InhA inhibitors do not require activation by the mycobacterial KatG enzyme, thereby circumventing the normal mechanism of resistance to the front line drug isoniazid (INH) and thus accounting for their activity against INH-resistant strains of MTB.

  1. Degradation of morpholine by an environmental Mycobacterium strain involves a cytochrome P-450.

    PubMed

    Poupin, P; Truffaut, N; Combourieu, B; Besse, P; Sancelme, M; Veschambre, H; Delort, A M

    1998-01-01

    A Mycobacterium strain (RP1) was isolated from a contaminated activated sludge collected in a wastewater treatment unit of a chemical plant. It was capable of utilizing morpholine and other heterocyclic compounds, such as pyrrolidine and piperidine, as the sole source of carbon, nitrogen, and energy. The use of in situ 1H nuclear magnetic resonance (1H NMR) spectroscopy allowed the determination of two intermediates in the biodegradative pathway, 2-(2-aminoethoxy)acetate and glycolate. The inhibitory effects of metyrapone on the degradative abilities of strain RP1 indicated the involvement of a cytochrome P-450 in the biodegradation of morpholine. This observation was confirmed by spectrophotometric analysis and 1H NMR. Reduced cell extracts from morpholine-grown cultures, but not succinate-grown cultures, gave rise to a carbon monoxide difference spectrum with a peak near 450 nm, which indicated the presence of a soluble cytochrome P-450. 1H NMR allowed the direct analysis of the incubation medium containing metyrapone, a specific inhibitor of cytochrome P-450. The inhibition of morpholine degradation was dependent on the morpholine/metyrapone ratio. The heme-containing monooxygenase was also detected in pyrrolidine- and piperidine-grown cultures. The abilities of different compounds to support strain growth or the induction of a soluble cytochrome P-450 were assayed. The results suggest that this enzyme catalyzes the cleavage of the C-N bond of the morpholine ring. PMID:9435074

  2. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology.

    PubMed Central

    Kamerbeek, J; Schouls, L; Kolk, A; van Agterveld, M; van Soolingen, D; Kuijper, S; Bunschoten, A; Molhuizen, H; Shaw, R; Goyal, M; van Embden, J

    1997-01-01

    Widespread use of DNA restriction fragment length polymorphism (RFLP) to differentiate strains of Mycobacterium tuberculosis to monitor the transmission of tuberculosis has been hampered by the need to culture this slow-growing organism and by the level of technical sophistication needed for RFLP typing. We have developed a simple method which allows simultaneous detection and typing of M. tuberculosis in clinical specimens and reduces the time between suspicion of the disease and typing from 1 or several months to 1 or 3 days. The method is based on polymorphism of the chromosomal DR locus, which contains a variable number of short direct repeats interspersed with nonrepetitive spacers. The method is referred to as spacer oligotyping or "spoligotyping" because it is based on strain-dependent hybridization patterns of in vitro-amplified DNA with multiple spacer oligonucleotides. Most of the clinical isolates tested showed unique hybridization patterns, whereas outbreak strains shared the same spoligotype. The types obtained from direct examination of clinical samples were identical to those obtained by using DNA from cultured M. tuberculosis. This novel preliminary study shows that the novel method may be a useful tool for rapid disclosure of linked outbreak cases in a community, in hospitals, or in other institutions and for monitoring of transmission of multidrug-resistant M. tuberculosis. Unexpectedly, spoligotyping was found to differentiate M. bovis from M. tuberculosis, a distinction which is often difficult to make by traditional methods. PMID:9157152

  3. Metabolism of 2-Methylpropene (Isobutylene) by the Aerobic Bacterium Mycobacterium sp. Strain ELW1

    PubMed Central

    Kottegoda, Samanthi; Waligora, Elizabeth

    2015-01-01

    An aerobic bacterium (Mycobacterium sp. strain ELW1) that utilizes 2-methylpropene (isobutylene) as a sole source of carbon and energy was isolated and characterized. Strain ELW1 grew on 2-methylpropene (growth rate = 0.05 h−1) with a yield of 0.38 mg (dry weight) mg 2-methylpropene−1. Strain ELW1 also grew more slowly on both cis- and trans-2-butene but did not grow on any other C2 to C5 straight-chain, branched, or chlorinated alkenes tested. Resting 2-methylpropene-grown cells consumed ethene, propene, and 1-butene without a lag phase. Epoxyethane accumulated as the only detected product of ethene oxidation. Both alkene consumption and epoxyethane production were fully inhibited in cells exposed to 1-octyne, suggesting that alkene oxidation is initiated by an alkyne-sensitive, epoxide-generating monooxygenase. Kinetic analyses indicated that 1,2-epoxy-2-methylpropane is rapidly consumed during 2-methylpropene degradation, while 2-methyl-2-propen-1-ol is not a significant metabolite of 2-methylpropene catabolism. Degradation of 1,2-epoxy-2-methylpropane by 2-methylpropene-grown cells led to the accumulation and further degradation of 2-methyl-1,2-propanediol and 2-hydroxyisobutyrate, two sequential metabolites previously identified in the aerobic microbial metabolism of methyl tert-butyl ether (MTBE) and tert-butyl alcohol (TBA). Growth of strain ELW1 on 2-methylpropene, 1,2-epoxy-2-methylpropane, 2-methyl-1,2-propanediol, and 2-hydroxyisobutyrate was fully inhibited when cobalt ions were omitted from the growth medium, while growth on 3-hydroxybutyrate and other substrates was unaffected by the absence of added cobalt ions. Our results suggest that, like aerobic MTBE- and TBA-metabolizing bacteria, strain ELW1 utilizes a cobalt/cobalamin-dependent mutase to transform 2-hydroxyisobutyrate. Our results have been interpreted in terms of their impact on our understanding of the microbial metabolism of alkenes and ether oxygenates. PMID:25576605

  4. Comparative Genomic Analysis of Mycobacterium tuberculosis Drug Resistant Strains from Russia

    PubMed Central

    Ilina, Elena N.; Shitikov, Egor A.; Ikryannikova, Larisa N.; Alekseev, Dmitry G.; Kamashev, Dmitri E.; Malakhova, Maja V.; Parfenova, Tatjana V.; Afanas’ev, Maxim V.; Ischenko, Dmitry S.; Bazaleev, Nikolai A.; Smirnova, Tatjana G.; Larionova, Elena E.; Chernousova, Larisa N.; Beletsky, Alexey V.; Mardanov, Andrei V.; Ravin, Nikolai V.; Skryabin, Konstantin G.; Govorun, Vadim M.

    2013-01-01

    Tuberculosis caused by multidrug-resistant (MDR) and extensively drug-resistant (XDR) Mycobacterium tuberculosis (MTB) strains is a growing problem in many countries. The availability of the complete nucleotide sequences of several MTB genomes allows to use the comparative genomics as a tool to study the relationships of strains and differences in their evolutionary history including acquisition of drug-resistance. In our work, we sequenced three genomes of Russian MTB strains of different phenotypes – drug susceptible, MDR and XDR. Of them, MDR and XDR strains were collected in Tomsk (Siberia, Russia) during the local TB outbreak in 1998–1999 and belonged to rare KQ and KY families in accordance with IS6110 typing, which are considered endemic for Russia. Based on phylogenetic analysis, our isolates belonged to different genetic families, Beijing, Ural and LAM, which made the direct comparison of their genomes impossible. For this reason we performed their comparison in the broader context of all M. tuberculosis genomes available in GenBank. The list of unique individual non-synonymous SNPs for each sequenced isolate was formed by comparison with all SNPs detected within the same phylogenetic group. For further functional analysis, all proteins with unique SNPs were ascribed to 20 different functional classes based on Clusters of Orthologous Groups (COG). We have confirmed drug resistant status of our isolates that harbored almost all known drug-resistance associated mutations. Unique SNPs of an XDR isolate CTRI-4XDR, belonging to a Beijing family were compared in more detail with SNPs of additional 14 Russian XDR strains of the same family. Only type specific mutations in genes of repair, replication and recombination system (COG category L) were found common within this group. Probably the other unique SNPs discovered in CTRI-4XDR may have an important role in adaptation of this microorganism to its surrounding and in escape from antituberculosis drugs

  5. Genome Sequences of Four Strains of Mycobacterium avium subsp. hominissuis, Isolated from Swine and Humans, Differing in Virulence in a Murine Intranasal Infection Model.

    PubMed

    Bruffaerts, N; Vluggen, C; Duytschaever, L; Mathys, V; Saegerman, C; Chapeira, O; Huygen, K

    2016-01-01

    This paper announces the genome sequences of four strains of Mycobacterium avium subsp. hominissuis, isolated from cases of lymphadenopathy in swine and humans, differing in virulence in a murine intranasal infection model. PMID:27313293

  6. Genome Sequences of Four Strains of Mycobacterium avium subsp. hominissuis, Isolated from Swine and Humans, Differing in Virulence in a Murine Intranasal Infection Model

    PubMed Central

    Bruffaerts, N.; Vluggen, C.; Duytschaever, L.; Mathys, V.; Saegerman, C.; Chapeira, O.

    2016-01-01

    This paper announces the genome sequences of four strains of Mycobacterium avium subsp. hominissuis, isolated from cases of lymphadenopathy in swine and humans, differing in virulence in a murine intranasal infection model. PMID:27313293

  7. Mycobacterium thermoresistibile as a source of thermostable orthologs of Mycobacterium tuberculosis proteins.

    PubMed

    Edwards, Thomas E; Liao, Reiling; Phan, Isabelle; Myler, Peter J; Grundner, Christoph

    2012-07-01

    The genus Mycobacterium comprises major human pathogens such as the causative agent of tuberculosis, Mycobacterium tuberculosis (Mtb), and many environmental species. Tuberculosis claims ~1.5 million lives every year, and drug resistant strains of Mtb are rapidly emerging. To aid the development of new tuberculosis drugs, major efforts are currently under way to determine crystal structures of Mtb drug targets and proteins involved in pathogenicity. However, a major obstacle to obtaining crystal structures is the generation of well-diffracting crystals. Proteins from thermophiles can have better crystallization and diffraction properties than proteins from mesophiles, but their sequences and structures are often divergent. Here, we establish a thermophilic mycobacterial model organism, Mycobacterium thermoresistibile (Mth), for the study of Mtb proteins. Mth tolerates higher temperatures than Mtb or other environmental mycobacteria such as M. smegmatis. Mth proteins are on average more soluble than Mtb proteins, and comparison of the crystal structures of two pairs of orthologous proteins reveals nearly identical folds, indicating that Mth structures provide good surrogates for Mtb structures. This study introduces a thermophile as a source of protein for the study of a closely related human pathogen and marks a new approach to solving challenging mycobacterial protein structures. PMID:22544630

  8. [Rifampicin-resistant Mycobacterium bovis BCG strain isolated from an infant with NEMO mutation].

    PubMed

    Çavuşoğlu, Cengiz; Edeer Karaca, Neslihan; Azarsız, Elif; Ulusoy, Ezgi; Kütükçüler, Necil

    2015-04-01

    It is well known that disseminated Mycobacterium bovis BCG infection is developed after BCG vaccination in infants with congenital cellular immune deficiencies such as mutations in genes along the interleukin (IL)-12/interferon (IFN)-γ pathway and mutations in nuclear factor-kB essential modulator (NEMO). In this report, a rifampicin-resistant M.bovis BCG strain isolated from an infant with NEMO defect was presented. An 8-month-old male infant with NEMO defect admitted to the pediatric outpatient clinic of our hospital with fever, generalized lymphadenopathy and hepatosplenomegaly. Microscopic examination of the smears prepared from lymph node and liver biopsy specimens revealed abundant amount (3+) of acid-fast bacilli (AFB). Rifampicin-susceptible Mycobacterium tuberculosis complex (MTC) was detected by real-time PCR (GeneXpert MTB/RIF; Cepheid, USA) in the samples. The growth of mycobacteria was determined on the 20th day of culture performed in MGIT960 system (Becton Dickinson, USA). The isolate was identified as M.bovis BCG by GenoType MTBC kit (Hain Lifescience, Germany) and defined as M.bovis BCG [SIT 482 (BOV_1)] by spoligotyping. In the primary anti-tuberculosis drug susceptibility test performed by MGIT960 system, the isolate was found susceptible to rifampicin (RIF), isoniazid (INH), streptomycin (STM) and ethambutol (EMB). Then anti-tuberculosis treatment was started to the patient. However, the patient at the age of 2 years, re-admitted to the hospital with the complaint of hepatosplenomegaly. Smear of spontaneously draining abscess material obtained from subcutaneous nodules revealed intensive AFB positivity (3+) once again. In the present instance RIF-resistant MTC was detected with GeneXpert system in the specimen. The growth of mycobacteria was determined on the 13th day of culture and isolate was identified as M.bovis BCG. The present isolate was found susceptible to INH, STM and EMB but resistant to RIF. A mutation in the rpoB gene (codon 531, S

  9. Genotyping of Mycobacterium leprae strains from a region of high endemic leprosy prevalence in India.

    PubMed

    Lavania, Mallika; Jadhav, Rupendra; Turankar, Ravindra P; Singh, Itu; Nigam, Astha; Sengupta, U

    2015-12-01

    Leprosy is still a major health problem in India which has the highest number of cases. Multiple locus variable number of tandem repeat analysis (MLVA) and single nucleotide polymorphism (SNP) have been proposed as tools of strain typing for tracking the transmission of leprosy. However, empirical data for a defined population from scale and duration were lacking for studying the transmission chain of leprosy. Seventy slit skin scrapings were collected from Purulia (West Bengal), Miraj (Maharashtra), Shahdara (Delhi), and Naini (UP) hospitals of The Leprosy Mission (TLM). SNP subtyping and MLVA on 10 VNTR loci were applied for the strain typing of Mycobacterium leprae. Along with the strain typing conventional epidemiological investigation was also performed to trace the transmission chain. In addition, phylogenetic analysis was done on variable number of tandem repeat (VNTR) data sets using sequence type analysis and recombinational tests (START) software. START software performs analyses to aid in the investigation of bacterial population structure using multilocus sequence data. These analyses include data summary, lineage assignment, and tests for recombination and selection. Diversity was observed in the cross-sectional survey of isolates obtained from 70 patients. Similarity in fingerprinting profiles observed in specimens of cases from the same family or neighborhood locations indicated a possible common source of infection. The data suggest that these VNTRs including subtyping of SNPs can be used to study the sources and transmission chain in leprosy, which could be very important in monitoring of the disease dynamics in high endemic foci. The present study strongly indicates that multi-case families might constitute epidemic foci and the main source of M. leprae in villages, causing the predominant strain or cluster infection leading to the spread of leprosy in the community. PMID:26444583

  10. Detection and Strain Typing of Ancient Mycobacterium leprae from a Medieval Leprosy Hospital

    PubMed Central

    Taylor, G. Michael; Tucker, Katie; Butler, Rachel; Pike, Alistair W. G.; Lewis, Jamie; Roffey, Simon; Marter, Philip; Lee, Oona Y-C; Wu, Houdini H. T.; Minnikin, David E.; Besra, Gurdyal S.; Singh, Pushpendra; Cole, Stewart T.; Stewart, Graham R.

    2013-01-01

    Nine burials excavated from the Magdalen Hill Archaeological Research Project (MHARP) in Winchester, UK, showing skeletal signs of lepromatous leprosy (LL) have been studied using a multidisciplinary approach including osteological, geochemical and biomolecular techniques. DNA from Mycobacterium leprae was amplified from all nine skeletons but not from control skeletons devoid of indicative pathology. In several specimens we corroborated the identification of M. leprae with detection of mycolic acids specific to the cell wall of M. leprae and persistent in the skeletal samples. In five cases, the preservation of the material allowed detailed genotyping using single-nucleotide polymorphism (SNP) and multiple locus variable number tandem repeat analysis (MLVA). Three of the five cases proved to be infected with SNP type 3I-1, ancestral to contemporary M. leprae isolates found in southern states of America and likely carried by European migrants. From the remaining two burials we identified, for the first time in the British Isles, the occurrence of SNP type 2F. Stable isotope analysis conducted on tooth enamel taken from two of the type 3I-1 and one of the type 2F remains revealed that all three individuals had probably spent their formative years in the Winchester area. Previously, type 2F has been implicated as the precursor strain that migrated from the Middle East to India and South-East Asia, subsequently evolving to type 1 strains. Thus we show that type 2F had also spread westwards to Britain by the early medieval period. PMID:23638071

  11. PE_PGRS30 of Mycobacterium tuberculosis mediates suppression of proinflammatory immune response in macrophages through its PGRS and PE domains.

    PubMed

    Chatrath, Shweta; Gupta, Vineet Kumar; Dixit, Aparna; Garg, Lalit C

    2016-09-01

    The success of Mycobacterium tuberculosis as a pathogen relies on its ability to survive inside macrophages and evade host immune mechanisms. M. tuberculosis employs multiple strategies to confer resistance against immune system including inhibition of phago-lysosomal fusion, modulation of cytokine responses and granuloma formation. PE_PGRS proteins, uniquely present in pathogenic mycobacteria, are cell surface molecules that are suggested to interact with host cells. PE_PGRS proteins have also been implicated in its pathogenesis. In the present study, immuno-regulatory property of Rv1651c-encoded PE_PGRS30 protein was explored. Infection of PMA-differentiated human THP-1 macrophages with Mycobacterium smegmatis harbouring pVV(1651c) resulted in reduced production of IL-12, TNF-α and IL-6, as compared to infection with M. smegmatis harbouring the control plasmid pVV16. No differential effect was observed on bacterial persistence inside macrophages or on macrophage mortality upon infection with the two recombinant strains. Infection of THP-1 macrophages with recombinant M. smegmatis expressing deletion variants of PE_PGRS30 indicated that anti-inflammatory function of the protein is possessed by its PGRS and PE domains while the C-terminal domain, when expressed alone, displayed antagonistic effect in terms of TNF-α secretion. These results suggest that PE_PGRS30 interferes with macrophage immune functions important for activation of adaptive T-cell responses. PMID:27129781

  12. Mycobacterium avium Genes Associated with the Ability To Form a Biofilm

    PubMed Central

    Yamazaki, Yoshitaka; Danelishvili, Lia; Wu, Martin; MacNab, Molly; Bermudez, Luiz E.

    2006-01-01

    Mycobacterium avium is widely distributed in the environment, and it is chiefly found in water and soil. M. avium, as well as Mycobacterium smegmatis, has been recognized to produce a biofilm or biofilm-like structure. We screened an M. avium green fluorescent protein (GFP) promoter library in M. smegmatis for genes involved in biofilm formation on polyvinyl chloride (PVC) plates. Clones associated with increased GFP expression ≥2.0-fold over the baseline were sequenced. Seventeen genes, most encoding proteins of the tricarboxylic acid (TCA) cycle and GDP-mannose and fatty acid biosynthesis, were identified. Their regulation in M. avium was confirmed by examining the expression of a set of genes by real-time PCR after incubation on PVC plates. In addition, screening of 2,000 clones of a transposon mutant bank constructed using M. avium strain A5, a mycobacterial strain with the ability to produce large amounts of biofilm, revealed four mutants with an impaired ability to form biofilm. Genes interrupted by transposons were homologues of M. tuberculosis 6-oxodehydrogenase (sucA), enzymes of the TCA cycle, protein synthetase (pstB), enzymes of glycopeptidolipid (GPL) synthesis, and Rv1565c (a hypothetical membrane protein). In conclusion, it appears that GPL biosynthesis, including the GDP-mannose biosynthesis pathway, is the most important pathway involved in the production of M. avium biofilm. PMID:16391123

  13. Conserved hypothetical protein Rv1977 in Mycobacterium tuberculosis strains contains sequence polymorphisms and might be involved in ongoing immune evasion

    PubMed Central

    Jiang, Yi; Liu, Haican; Wang, Xuezhi; Li, Guilian; Qiu, Yan; Dou, Xiangfeng; Wan, Kanglin

    2015-01-01

    Host immune pressure and associated parasite immune evasion are key features of host-pathogen co-evolution. A previous study showed that human T cell epitopes of Mycobacterium tuberculosis are evolutionarily hyperconserved and thus it was deduced that M. tuberculosis lacks antigenic variation and immune evasion. Here, we selected 151 clinical Mycobacterium tuberculosis isolates from China, amplified gene encoding Rv1977 and compared the sequences. The results showed that Rv1977, a conserved hypothetical protein, is not conserved in M. tuberculosis strains and there are polymorphisms existed in the protein. Some mutations, especially one frameshift mutation, occurred in the antigen Rv1977, which is uncommon in M.tb strains and may lead to the protein function altering. Mutations and deletion in the gene all affect one of three T cell epitopes and the changed T cell epitope contained more than one variable position, which may suggest ongoing immune evasion. PMID:26261576

  14. Molecular Cloning, Nucleotide Sequence, and Expression of Genes Encoding a Polycyclic Aromatic Ring Dioxygenase from Mycobacterium sp. Strain PYR-1

    PubMed Central

    Khan, Ashraf A.; Wang, Rong-Fu; Cao, Wei-Wen; Doerge, Daniel R.; Wennerstrom, David; Cerniglia, Carl E.

    2001-01-01

    Mycobacterium sp. strain PYR-1 degrades high-molecular-weight polycyclic hydrocarbons (PAHs) primarily through the introduction of both atoms of molecular oxygen by a dioxygenase. To clone the dioxygenase genes involved in PAH degradation, two-dimensional (2D) gel electrophoresis of PAH-induced proteins from cultures of Mycobacterium sp. strain PYR-1 was used to detect proteins that increased after phenanthrene, dibenzothiophene, and pyrene exposure. Comparison of proteins from induced and uninduced cultures on 2D gels indicated that at least six major proteins were expressed (105, 81, 52, 50, 43, and 13 kDa). The N-terminal sequence of the 50-kDa protein was similar to those of other dioxygenases. A digoxigenin-labeled oligonucleotide probe designed from this protein sequence was used to screen dioxygenase-positive clones from a genomic library of Mycobacterium sp. strain PYR-1. Three clones, each containing a 5,288-bp DNA insert with three genes of the dioxygenase system, were obtained. The genes in the DNA insert, from the 5′ to the 3′ direction, were a dehydrogenase, the dioxygenase small (β)-subunit, and the dioxygenase large (α)-subunit genes, arranged in a sequence different from those of genes encoding other bacterial dioxygenase systems. Phylogenetic analysis showed that the large α subunit did not cluster with most of the known α-subunit sequences but rather with three newly described α subunits of dioxygenases from Rhodococcus spp. and Nocardioides spp. The genes from Mycobacterium sp. strain PYR-1 were subcloned and overexpressed in Escherichia coli with the pBAD/ThioFusion system. The functionality of the genes for PAH degradation was confirmed in a phagemid clone containing all three genes, as well as in plasmid subclones containing the two genes encoding the dioxygenase subunits. PMID:11472934

  15. Subspecies Identification and Significance of 257 Clinical Strains of Mycobacterium avium

    PubMed Central

    Tran, Quynh T.

    2014-01-01

    Mycobacterium avium is abundant in the environment. It has four subspecies of three types: the human or porcine type, M. avium subsp. hominissuis; the bird type, including M. avium subsp. avium serotype 1 and serotype 2, 3 (also M. avium subsp. silvaticum); and the ruminant type, M. avium subsp. paratuberculosis. We determined the subspecies of 257 M. avium strains isolated from patients at the M.D. Anderson Cancer Center from 2001 to 2010 and assessed their clinical significance. An assay of multiplex PCR was used for the typing. Results showed M. avium subsp. hominissuis to be most common (n = 238, 92.6%), followed by M. avium subsp. avium serotype 1 (n = 12, 4.7%) and serotype 2, 3 (n = 7, 2.7%). No strains of M. avium subsp. paratuberculosis were found. Of the 238 patients with M. avium subsp. hominissuis, 65 (27.3%) showed evidence of definite or probable infections, mostly in the respiratory tract, whereas the rest had weak evidence of infection. The bird-type subspecies, despite being infrequently isolated, caused relatively more definite and probable infections (10 of 19 strains, 52.6%). Overall, women of 50 years of age or older were more prone to M. avium infection than younger women or men of all ages were. We therefore conclude that M. avium subsp. hominissuis is the dominant M. avium subspecies clinically, that the two bird-type subspecies do cause human infections, and that M. avium infects mainly postmenopausal women. The lack of human clinical isolation of the ruminant type subspecies may need further investigation. PMID:24501026

  16. Substrate range and enantioselectivity of epoxidation reactions mediated by the ethene-oxidising Mycobacterium strain NBB4.

    PubMed

    Cheung, Samantha; McCarl, Victoria; Holmes, Andrew J; Coleman, Nicholas V; Rutledge, Peter J

    2013-02-01

    Mycobacterium strain NBB4 is an ethene-oxidising micro-organism isolated from estuarine sediments. In pursuit of new systems for biocatalytic epoxidation, we report the capacity of strain NBB4 to convert a diverse range of alkene substrates to epoxides. A colorimetric assay based on 4-(4-nitrobenzyl)pyridine) has been developed to allow the rapid characterisation and quantification of biocatalytic epoxide synthesis. Using this assay, we have demonstrated that ethene-grown NBB4 cells epoxidise a wide range of alkenes, including terminal (propene, 1-butene, 1-hexene, 1-octene and 1-decene), cyclic (cyclopentene, cyclohexene), aromatic (styrene, indene) and functionalised substrates (allyl alcohol, dihydropyran and isoprene). Apparent specific activities have been determined and range from 2.5 to 12.0 nmol min(-1) per milligram of cell protein. The enantioselectivity of epoxidation by Mycobacterium strain NBB4 has been established using styrene as a test substrate; (R)-styrene oxide is produced in enantiomeric excesses greater than 95%. Thus, the ethene monooxygenase of Mycobacterium NBB4 has a broad substrate range and promising enantioselectivity, confirming its potential as a biocatalyst for alkene epoxidation. PMID:22410742

  17. Degradation of 2,3-Diethyl-5-Methylpyrazine by a Newly Discovered Bacterium, Mycobacterium sp. Strain DM-11†

    PubMed Central

    Rappert, Sugima; Botsch, Kathrin Caroline; Nagorny, Stephanie; Francke, Wittko; Müller, Rudolf

    2006-01-01

    A bacterium was isolated from the waste gas treatment plant at a fishmeal processing company on the basis of its capacity to use 2,3-diethyl-5-methylpyrazine (DM) as a sole carbon and energy source. The strain, designated strain DM-11, grew optimally at 25°C and had a doubling time of 29.2 h. The strain did not grow on complex media like tryptic soy broth, Luria-Bertani broth, or nutrient broth or on simple carbon sources like glucose, acetate, oxoglutarate, succinate, or citrate. Only on Löwenstein-Jensen medium was growth observed. The 16S rRNA gene sequence of strain DM-11 showed the highest similarity (96.2%) to Mycobacterium poriferae strain ATCC 35087T. Therefore, strain DM-11 merits recognition as a novel species within the genus Mycobacterium. DM also served as a sole nitrogen source for the growth of strain DM-11. The degradation of DM by strain DM-11 requires molecular oxygen. The first intermediate was identified as 5,6-diethyl-2-hydroxy-3-methylpyrazine (DHM). Its disappearance was accompanied by the release of ammonium into the culture medium. No other metabolite was detected. We conclude that ring fission occurred directly after the formation of DHM and ammonium was eliminated after ring cleavage. Molecular oxygen was essential for the degradation of DHM. The expression of enzymes involved in the degradation of DM and DHM was regulated. Only cells induced by DM or DHM converted these compounds. Strain DM-11 also grew on 2-ethyl-5(6)-methylpyrazine (EMP) and 2,3,5-trimethylpyrazine (TMP) as a sole carbon, nitrogen, and energy source. In addition, the strain converted many pyrazines found in the waste gases of food industries cometabolically. PMID:16461697

  18. Purification and properties of the NADH reductase component of alkene monooxygenase from Mycobacterium strain E3.

    PubMed Central

    Weber, F J; van Berkel, W J; Hartmans, S; de Bont, J A

    1992-01-01

    Alkene monooxygenase, a multicomponent enzyme system which catalyzes the epoxidation of short-chain alkenes, is induced in Mycobacterium strain E3 when it is grown on ethene. We purified the NADH reductase component of this enzyme system to homogeneity. Recovery of the enzyme was 19%, with a purification factor of 920-fold. The enzyme is a monomer with a molecular mass of 56 kDa as determined by gel filtration and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. It is yellow-red with absorption maxima at 384, 410, and 460 nm. Flavin adenine dinucleotide (FAD) was identified as a prosthetic group at a FAD-protein ratio of 1:1. Tween 80 prevented irreversible dissociation of FAD from the enzyme during chromatographic purification steps. Colorimetric analysis revealed 2 mol each of iron and acid-labile sulfide, indicating the presence of a [2Fe-2S] cluster. The presence of this cluster was confirmed by electron paramagnetic resonance spectroscopy (g values at 2.011, 1.921, and 1.876). Anaerobic reduction of the reductase by NADH resulted in formation of a flavin semiquinone. Images PMID:1315734

  19. Sublineages of Mycobacterium tuberculosis Beijing genotype strains and unfavorable outcomes of anti-tuberculosis treatment.

    PubMed

    Hang, Nguyen T L; Maeda, Shinji; Keicho, Naoto; Thuong, Pham H; Endo, Hiroyoshi

    2015-05-01

    The influence of Mycobacterium tuberculosis (MTB) lineages/sublineages on unfavorable tuberculosis (TB) treatment outcomes is poorly understood. We investigated the effects of Beijing genotype sublineages and other factors contributing to treatment outcome. Patients newly diagnosed with sputum smear-positive and culture-positive TB in Hanoi, Vietnam, participated in the study. After receiving anti-TB treatment, they were intensively followed up for the next 16 months. MTB isolates collected before treatment were subjected to drug susceptibility testing, and further analyzed to determine MTB (sub) lineages and their clonal similarities. Of 430 patients, 17 had treatment failure and 30 had TB recurrence. Rifampicin resistance was associated with treatment failure {adjusted odds ratio = 6.64 [95% confidence interval (CI), 1.48-29.73]}. The modern Beijing genotype was significantly associated with recurrent TB within 16 months [adjusted hazard ratio = 3.29 (95% CI, 1.17-9.27)], particularly after adjustment for the relevant antibiotic resistance. Human immunodeficiency virus coinfection and severity on chest radiographs were not significantly associated with unfavorable outcomes. Our findings provide further understanding of the influence of MTB strains on unfavorable treatment outcomes. Multiple risk factors should be considered for the optimal management of TB. PMID:25732626

  20. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    PubMed

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. PMID:26319139

  1. Molecular Typing of Mycobacterium Tuberculosis Strains: A Fundamental Tool for Tuberculosis Control and Elimination

    PubMed Central

    Cannas, Angela; Mazzarelli, Antonio; Di Caro, Antonino; Delogu, Giovanni; Girardi, Enrico

    2016-01-01

    Tuberculosis (TB) is still an important cause of morbidity and mortality worldwide. An improvement of the strategies for disease control is necessary in both low- and high-incidence TB countries. Clinicians, epidemiologists, laboratory specialists, and public health players should work together in order to achieve a significant reduction in TB transmission and spread of drug-resistant strains. Effective TB surveillance relies on early diagnosis of new cases, appropriate therapy, and accurate detection of outbreaks in the community, in order to implement proper TB control strategies. To achieve this goal, information from classical and molecular epidemiology, together with patient clinical data need to be combined. In this review, we summarize the methodologies currently used in molecular epidemiology, namely molecular typing. We will discuss their efficiency to phylogenetically characterize Mycobacterium tuberculosis isolates, and their ability to provide information that can be useful for disease control. We will also introduce next generation sequencing as the methodology that potentially could provide in a short time both, detection of new outbreaks and identification of resistance patterns. This could envision a potential of next generation sequencing as an important tool for accurate patient management and disease control. PMID:27403266

  2. Human Alveolar Macrophage Gene Responses to Mycobacterium tuberculosis Strains H37Ra and H37Rv

    PubMed Central

    Silver, Richard F.; Walrath, Jessica; Lee, Hung; Jacobson, Bruce A.; Horton, Heidi; Bowman, Michael R.; Nocka, Karl; Sypek, Joseph P.

    2009-01-01

    H37Rv and H37Ra have been widely used as models of virulent and avirulent strains, respectively, of Mycobacterium tuberculosis. Since the sequencing of H37Rv, microarrays have been used to investigate gene expression of M. tuberculosis strains under various conditions, and to compare gene expression of specific isolates of the organism. Because differences in the virulence of these organisms could also be manifest via their differential induction of host genes, we used Affymetrix Human Genome Arrays U133A and U133B to evaluate human alveolar macrophage (AM) responses to infection with H37Rv and H37Ra. H37Rv altered expression of far more genes than did H37Ra. Moreover, the genes induced by H37Rv to a greater extent than by H37Ra were predominantly associated with the development of effective immunity. H37Rv markedly increased expression of IL-23 p19, whereas neither organism significantly induced IL-12 p35 expression. Quantitative PCR confirmed that H37Rv induced significantly more AM p19 expression than did H37Ra. After low-level infection of both AM and peripheral blood monocytes (MN) with H37Rv, neither cell type produced IL-12 (by ELISA). In contrast, AM displayed significant IL-23 production in response to H37Rv, whereas MN did not. Our findings thus suggest an important role for IL-23 in human host responses to pulmonary infection with M. tuberculosis, and are consistent with epidemiologic and genetic studies that imply that H37Rv may not have unusual capacity to cause human disease. PMID:18787177

  3. Protection by novel vaccine candidates, Mycobacterium tuberculosis ΔmosR and ΔechA7, against challenge with a Mycobacterium tuberculosis Beijing strain.

    PubMed

    Marcus, Sarah A; Steinberg, Howard; Talaat, Adel M

    2015-10-13

    Mycobacterium tuberculosis, the etiological agent of tuberculosis (TB), infects over two billion people, claiming around 1.5 million lives annually. The only vaccine approved for clinical use against this disease is the Bacillus Calmette-Guérin (BCG) vaccine. Unfortunately, BCG has limited efficacy against the adult, pulmonary form of tuberculosis. This vaccine was developed from M. bovis with antigen expression and host specificity that differ from M. tuberculosis. To address these problems, we have designed two novel, live attenuated vaccine (LAV) candidates on an M. tuberculosis background: ΔmosR and ΔechA7. These targeted genes are important to M. tuberculosis pathogenicity during infection. To examine the efficacy of these strains, C57BL/6 mice were vaccinated subcutaneously with either LAV, BCG, or PBS. Both LAV strains persisted up to 16 weeks in the spleens or lungs of vaccinated mice, while eliciting minimal pathology prior to challenge. Following challenge with a selected, high virulence M. tuberculosis Beijing strain, protection was notably greater for both groups of LAV vaccinated animals as compared to BCG at both 30 and 60 days post-challenge. Additionally, vaccination with either ΔmosR or ΔechA7 elicited an immune response similar to BCG. Although these strains require further development to meet safety standards, this first evidence of protection by these two new, live attenuated vaccine candidates shows promise. PMID:26363381

  4. Comprehensive Insights in the Mycobacterium avium subsp. paratuberculosis Genome Using New WGS Data of Sheep Strain JIII-386 from Germany

    PubMed Central

    Möbius, Petra; Hölzer, Martin; Felder, Marius; Nordsiek, Gabriele; Groth, Marco; Köhler, Heike; Reichwald, Kathrin; Platzer, Matthias; Marz, Manja

    2015-01-01

    Mycobacterium avium (M. a.) subsp. paratuberculosis (MAP)—the etiologic agent of Johne’s disease—affects cattle, sheep, and other ruminants worldwide. To decipher phenotypic differences among sheep and cattle strains (belonging to MAP-S [Type-I/III], respectively, MAP-C [Type-II]), comparative genome analysis needs data from diverse isolates originating from different geographic regions of the world. This study presents the so far best assembled genome of a MAP-S-strain: Sheep isolate JIII-386 from Germany. One newly sequenced cattle isolate (JII-1961, Germany), four published MAP strains of MAP-C and MAP-S from the United States and Australia, and M. a. subsp. hominissuis (MAH) strain 104 were used for assembly improvement and comparisons. All genomes were annotated by BacProt and results compared with NCBI (National Center for Biotechnology Information) annotation. Corresponding protein-coding sequences (CDSs) were detected, but also CDSs that were exclusively determined by either NCBI or BacProt. A new Shine–Dalgarno sequence motif (5′-AGCTGG-3′) was extracted. Novel CDSs including PE-PGRS family protein genes and about 80 noncoding RNAs exhibiting high sequence conservation are presented. Previously found genetic differences between MAP-types are partially revised. Four of ten assumed MAP-S-specific large sequence polymorphism regions (LSPSs) are still present in MAP-C strains; new LSPSs were identified. Independently of the regional origin of the strains, the number of individual CDSs and single nucleotide variants confirms the strong similarity of MAP-C strains and shows higher diversity among MAP-S strains. This study gives ambiguous results regarding the hypothesis that MAP-S is the evolutionary intermediate between MAH and MAP-C, but it clearly shows a higher similarity of MAP to MAH than to Mycobacterium intracellulare. PMID:26384038

  5. Typing of Clinical Mycobacterium avium Complex Strains Cultured during a 2-Year Period in Denmark by Using IS1245

    PubMed Central

    Bauer, Jeanett; Andersen, Åse B.; Askgaard, Dorthe; Giese, Sten B.; Larsen, Birger

    1999-01-01

    In the present study restriction fragment length polymorphism analyses with the recently described insertion sequence IS1245 as a probe was performed with clinical Mycobacterium avium complex strains cultured in Denmark during a 2-year period. The overall aim of the study was to disclose potential routes of transmission of these microorganisms. As a first step, the genetic diversity among isolates from AIDS patients and non-human immunodeficiency virus (HIV)-infected patients was described. In addition, a number of isolates from nonhuman sources cultured during the same period were analyzed and compared to the human isolates. A total of 203 isolates from AIDS patients (n = 90), non-HIV-infected patients (n = 91), and nonhuman sources (n = 22) were analyzed. The presence of IS1245 was restricted to Mycobacterium avium subsp. avium isolates. The majority of human isolates had large numbers of IS1245 copies, while nonhuman isolates could be divided into a high-copy-number group and a low-copy-number group. Groups of identical strains were found to be geographically widespread, comprising strains from AIDS patients as well as strains from non-HIV-infected patients. Samples of peat (to be used as potting soil) and veterinary samples were found to contain viable M. avium isolates belonging to genotypes also found in humans. PMID:9986819

  6. Polyclonal Mycobacterium avium infections in patients with AIDS: variations in antimicrobial susceptibilities of different strains of M. avium isolated from the same patient.

    PubMed Central

    von Reyn, C F; Jacobs, N J; Arbeit, R D; Maslow, J N; Niemczyk, S

    1995-01-01

    Broth microdilution MICs were determined for pairs of strains isolated from five AIDS patients with polyclonal Mycobacterium avium infection. Four (80%) of the five patients were infected simultaneously with strains having different antimicrobial susceptibility patterns. These findings have implications for the interpretation of susceptibility data in M. avium prophylaxis and treatment trials. PMID:7790424

  7. Genomic Diversity of Mycobacterium tuberculosis Complex Strains in Cantabria (Spain), a Moderate TB Incidence Setting

    PubMed Central

    Pérez del Molino Bernal, Inmaculada C.; Lillebaek, Troels; Pedersen, Mathias K.; Martinez-Martinez, Luis; Folkvardsen, Dorte B.; Agüero, Jesús; Rasmussen, E. Michael

    2016-01-01

    Background Tuberculosis (TB) control strategies are focused mainly on prevention, early diagnosis, compliance to treatment and contact tracing. The objectives of this study were to explore the frequency and risk factors of recent transmission of clinical isolates of Mycobacterium tuberculosis complex (MTBC) in Cantabria in Northern Spain from 2012 through 2013 and to analyze their clonal complexity for better understanding of the transmission dynamics in a moderate TB incidence setting. Methods DNA from 85 out of 87 isolates from bacteriologically confirmed cases of MTBC infection were extracted directly from frozen stocks and genotyped using the mycobacterial interspersed repetitive units-variable number tandem repeat (MIRU-VNTR) method. The MIRU-VNTRplus database tool was used to identify clusters and lineages and to build a neighbor joining (NJ) phylogenetic tree. In addition, data were compared to the SITVIT2 database at the Pasteur Institute of Guadeloupe. Results The rate of recent transmission was calculated to 24%. Clustering was associated with being Spanish-born. A high prevalence of isolates of the Euro-American lineage was found. In addition, MIRU-VNTR profiles of the studied isolates corresponded to previously found MIRU-VNTR types in other countries, including Spain, Belgium, Great Britain, USA, Croatia, South Africa and The Netherlands. Six of the strains analyzed represented clonal variants. Conclusion Transmission of MTBC is well controlled in Cantabria. The majority of TB patients were born in Spain. The population structure of MTBC in Cantabria has a low diversity of major clonal lineages with the Euro-American lineage predominating. PMID:27315243

  8. Human IL-32 expression protects mice against a hypervirulent strain of Mycobacterium tuberculosis

    PubMed Central

    Bai, Xiyuan; Shang, Shaobin; Henao-Tamayo, Marcela; Basaraba, Randall J.; Ovrutsky, Alida R.; Matsuda, Jennifer L.; Takeda, Katsuyuki; Chan, Mallory M.; Dakhama, Azzeddine; Kinney, William H.; Trostel, Jessica; Bai, An; Honda, Jennifer R.; Achcar, Rosane; Hartney, John; Joosten, Leo A. B.; Kim, Soo-Hyun; Orme, Ian; Dinarello, Charles A.; Ordway, Diane J.; Chan, Edward D.

    2015-01-01

    Silencing of interleukin-32 (IL-32) in a differentiated human promonocytic cell line impairs killing of Mycobacterium tuberculosis (MTB) but the role of IL-32 in vivo against MTB remains unknown. To study the effects of IL-32 in vivo, a transgenic mouse was generated in which the human IL-32γ gene is expressed using the surfactant protein C promoter (SPC-IL-32γTg). Wild-type and SPC-IL-32γTg mice were infected with a low-dose aerosol of a hypervirulent strain of MTB (W-Beijing HN878). At 30 and 60 d after infection, the transgenic mice had 66% and 85% fewer MTB in the lungs and 49% and 68% fewer MTB in the spleens, respectively; the transgenic mice also exhibited greater survival. Increased numbers of host-protective innate and adaptive immune cells were present in SPC-IL-32γTg mice, including tumor necrosis factor-alpha (TNFα) positive lung macrophages and dendritic cells, and IFN-gamma (IFNγ) and TNFα positive CD4+ and CD8+ T cells in the lungs and mediastinal lymph nodes. Alveolar macrophages from transgenic mice infected with MTB ex vivo had reduced bacterial burden and increased colocalization of green fluorescent protein-labeled MTB with lysosomes. Furthermore, mouse macrophages made to express IL-32γ but not the splice variant IL-32β were better able to limit MTB growth than macrophages capable of producing both. The lungs of patients with tuberculosis showed increased IL-32 expression, particularly in macrophages of granulomas and airway epithelial cells but also B cells and T cells. We conclude that IL-32γ enhances host immunity to MTB. PMID:25820174

  9. Low induction of proinflammatory cytokines parallels evolutionary success of modern strains within the Mycobacterium tuberculosis Beijing genotype.

    PubMed

    van Laarhoven, Arjan; Mandemakers, Jornt J; Kleinnijenhuis, Johanneke; Enaimi, Mimount; Lachmandas, Ekta; Joosten, Leo A B; Ottenhoff, Tom H M; Netea, Mihai G; van Soolingen, Dick; van Crevel, Reinout

    2013-10-01

    One of the most widespread clades of Mycobacterium tuberculosis worldwide, the Beijing genotype family, consists of ancient (atypical) and modern (typical) strains. Modern Beijing strains outcompete ancient strains in terms of prevalence, while reserving a higher degree of genetic conservation. We hypothesize that their selective advantage lies in eliciting a different host immune response. Bead-disrupted lysates of a collection of different M. tuberculosis strains of the modern (n = 7) or ancient (n = 7) Beijing genotype, as well as the Euro-American lineage (n = 6), were used for induction of ex vivo cytokine production in peripheral blood mononuclear cells (PBMCs) from 10 healthy individuals. Hierarchical clustering and multivariate regression analyses were used to study possible differences in production of nine cytokines. Modern and ancient M. tuberculosis Beijing genotypes induced different cytokine signatures. Overall induction of interleukin-1β (IL-1β), gamma interferon (IFN-γ), and IL-22 was 38 to 40% lower after stimulation with modern Beijing strains (corrected P values of <0.0001, 0.0288, and 0.0002, respectively). Euro-American reactivation strains induced 2-fold more TNF-α production than both types of Beijing strains. The observed differences in cytokine induction point to a reduction in proinflammatory cytokine response as a possible contributing factor to the evolutionary success of modern Beijing strains. PMID:23897611

  10. Decreased capacity of recombinant 45/47-kDa molecules (Apa) of Mycobacterium tuberculosis to stimulate T lymphocyte responses related to changes in their mannosylation pattern.

    PubMed

    Horn, C; Namane, A; Pescher, P; Rivière, M; Romain, F; Puzo, G; Bârzu, O; Marchal, G

    1999-11-01

    The Apa molecules secreted by Mycobacterium tuberculosis, Mycobacterium bovis, or BCG have been identified as major immunodominant antigens. Mass spectrometry analysis indicated similar mannosylation, a complete pattern from 1 up to 9 hexose residues/mole of protein, of the native species from the 3 reference strains. The recombinant antigen expressed in M. smegmatis revealed a different mannosylation pattern: species containing 7 to 9 sugar residues/mole of protein were in the highest proportion, whereas species bearing a low number of sugar residues were almost absent. The 45/47-kDa recombinant antigen expressed in E. coli was devoid of sugar residues. The proteins purified from M. tuberculosis, M. bovis, or BCG have a high capacity to elicit in vivo potent delayed-type hypersensitivity (DTH) reactions and to stimulate in vitro sensitized T lymphocytes of guinea pigs immunized with living BCG. The recombinant Apa expressed in Mycobacterium smegmatis was 4-fold less potent in vivo in the DTH assay and 10-fold less active in vitro to stimulate sensitized T lymphocytes than the native proteins. The recombinant protein expressed in Escherichia coli was nearly unable to elicit DTH reactions in vivo or to stimulate T lymphocytes in vitro. Thus the observed biological effects were related to the extent of glycosylation of the antigen. PMID:10542234

  11. [Efficacy and safety of vaccines against tuberculosis in the relation to genetic variability of Mycobacterium bovis BCG strains].

    PubMed

    Prygiel, Marta; Janaszek-Seydlitz, Wiesława; Bucholc, Bozena

    2011-01-01

    All vaccines against tuberculosis used actually over the world contain Mycobacterium bovis BCG strains (Bacillus Calmette-Guerin) as active substance. Strain BCG, that was obtained in 1921 by Calmette and Guerin after 13 years ofpassaging on the potato-glicerol medium with addition of bile, was distributed to many laboratories for vaccine production. The repeated passages of M. bovis BCG strain in different culture conditions caused the numerous mutations and formation of many BCG substrains that differed according to efficacy and safety. The review of many publications related to genetic differences between BCG substrains was performed for identify the genes responsible for their virulence and protective characteristics. Possibility of development of new generation vaccines against tuberculosis is discussed. PMID:22390050

  12. Epidemiological Analysis of Mycobacterium tuberculosis Strains Isolated from Patients of Small Communities Living in the South-East of Poland.

    PubMed

    Zaczek, Anna; Szwaja, Iwona; Skiba, Monika; Brzostek, Anna; Puchalski, Czesław; Lewandowska, Karolina; Dziadek, Jarosław

    2015-01-01

    The diversity of Mycobacterium tuberculosis clinical isolates, collected from a single hospital, was analyzed by ligation-mediated PCR techniques: FLiP and FLAP, and hybridization technique, IS6110-RFLP. The isolated strains were divided in terms of location (3 towns of Podkarpackie voivodeship differing in population size) and relationship (8 members of 4 families, each represented by 2 patients). Within each family identical DNA profiles, as well as drug resistance patterns were identified indicating a great chance of transmission of strains within the same family. Identical, or very similar patterns were also shared by strains isolated from unrelated patients living in a very small town (1 200 inhabitants) or hospitalized in the same place and time. PMID:26638538

  13. Rv2358 and FurB: Two Transcriptional Regulators from Mycobacterium tuberculosis Which Respond to Zinc

    PubMed Central

    Canneva, Fabio; Branzoni, Manuela; Riccardi, Giovanna; Provvedi, Roberta; Milano, Anna

    2005-01-01

    In a previous work, we demonstrated that the Mycobacterium tuberculosis Rv2358-furB operon is induced by zinc. In this study, the orthologous genes from Mycobacterium smegmatis mc2155 were inactivated and mutants analyzed. Rv2358 protein was purified and found to bind upstream of the Rv2358 gene. Binding was inhibited by Zn2+ ions. PMID:16077132

  14. A Comprehensive Survey of Single Nucleotide Polymorphisms (SNPs) across Mycobacterium bovis Strains and M. bovis BCG Vaccine Strains Refines the Genealogy and Defines a Minimal Set of SNPs That Separate Virulent M. bovis Strains and M. bovis BCG Strains▿ †

    PubMed Central

    Garcia Pelayo, M. Carmen; Uplekar, Swapna; Keniry, Andrew; Mendoza Lopez, Pablo; Garnier, Thierry; Nunez Garcia, Javier; Boschiroli, Laura; Zhou, Xiangmei; Parkhill, Julian; Smith, Noel; Hewinson, R. Glyn; Cole, Stewart T.; Gordon, Stephen V.

    2009-01-01

    To further unravel the mechanisms responsible for attenuation of the tuberculosis vaccine Mycobacterium bovis BCG, comparative genomics was used to identify single nucleotide polymorphisms (SNPs) that differed between sequenced strains of Mycobacterium bovis and M. bovis BCG. SNPs were assayed in M. bovis isolates from France and the United Kingdom and from different BCG vaccines in order to identify those that arose during the attenuation process which gave rise to BCG. Informative data sets were obtained for 658 SNPs from 21 virulent M. bovis strains and 13 BCG strains; these SNPs showed phylogenetic clustering that was consistent with the geographical origin of the strains and previous schemes for BCG genealogies. The data revealed a closer relationship between BCG Tice and BCG Pasteur than was previously appreciated, while we were able to position BCG Beijing within a grouping of BCG Denmark-derived strains. Only 186 SNPs were identified between virulent M. bovis strains and all BCG strains, with 115 nonsynonymous SNPs affecting important functions such as global regulators, transcriptional factors, and central metabolism, which might impact on virulence. We therefore refine previous genealogies of BCG vaccines and define a minimal set of SNPs between virulent M. bovis strains and the attenuated BCG strain that will underpin future functional analyses. PMID:19289514

  15. Canonical pathways, networks and transcriptional factor regulation by clinical strains of Mycobacterium tuberculosis in pulmonary alveolar epithelial cells.

    PubMed

    Mvubu, Nontobeko E; Pillay, Balakrishna; Gamieldien, Junaid; Bishai, William; Pillay, Manormoney

    2016-03-01

    Limited knowledge exists on pathways, networks and transcriptional factors regulated within epithelial cells by diverse Mycobacterium tuberculosis genotypes. This study aimed to elucidate these mechanisms induced in A549 epithelial cells by dominant clinical strains in KwaZulu-Natal, South Africa. RNA for sequencing was extracted from epithelial cells at 48 h post-infection with 5 strains at a multiplicity of infection of approximately 10:1. Bioinformatics analysis performed with the RNA-Seq Tuxedo pipeline identified differentially expressed genes. Changes in pathways, networks and transcriptional factors were identified using Ingenuity Pathway Analysis (IPA). The interferon signalling and hepatic fibrosis/hepatic stellate cell activation pathways were among the top 5 canonical pathways in all strains. Hierarchical clustering for enrichment of cholesterol biosynthesis and immune associated pathways revealed similar patterns for Beijing and Unique; F15/LAM4/KZN and F11; and, F28 and H37Rv strains, respectively. However, the induction of top scoring networks varied among the strains. Among the transcriptional factors, only EHL, IRF7, PML, STAT1, STAT2 and VDR were induced by all clinical strains. Activation of the different pathways, networks and transcriptional factors revealed in the current study may be an underlying mechanism that results in the differential host response by clinical strains of M. tuberculosis. PMID:26980499

  16. Dehalogenation of haloalkanes by Mycobacterium tuberculosis H37Rv and other mycobacteria

    SciTech Connect

    Jesenska, A.; Sedlacek, I.; Damborsky, J.

    2000-01-01

    Haloalkane dehalogenases convert haloalkanes to their corresponding alcohols by a hydrolytic mechanism. To date, various haloalkane dehalogenases have been isolated from bacteria colonizing environments that are contaminated with halogenated compounds. A search of current databases with the sequences of these known haloalkane dehalogenases revealed the presence of three different genes encoding putative haloalkane dehalogenases in the genome of the human parasite Mycobacterium tuberculosis H37Rv. The ability of M. tuberculosis and several other mycobacterial strains to dehalogenate haloaliphatic compounds was therefore studied. Intact cells of M. tuberculosis H37Rv were found to dehalogenate 1-chlorobutane, 1-chlorodecane, 1-bromobutane, and 1,2-dibromoethane. Nine isolates of mycobacteria from clinical material and four strains from a collection of microorganisms were found to be capable of dehalogenating 1,2-dibromoethane. Crude extracts prepared from two of these strains, Mycobacterium avium MU1 and Mycobacterium smegmatis CCM 4622, showed broad substrate specificity toward a number of halogenated substrates. Dehalogenase activity in the absence of oxygen and the identification of primary alcohols as the products of the reaction suggest a hydrolytic dehalogenation mechanism. The presence of dehalogenases in bacterial isolates from clinical material, including the species colonizing both animal tissues and free environment, indicates a possible role of parasitic microorganisms in the distribution of degradation genes in the environment.

  17. Conditional Gene Expression in Mycobacterium abscessus

    PubMed Central

    Cortes, Mélanie; Singh, Anil Kumar; Gaillard, Jean-Louis; Nassif, Xavier; Herrmann, Jean-Louis

    2011-01-01

    Mycobacterium abscessus is an emerging human pathogen responsible for lung infections, skin and soft-tissue infections and disseminated infections in immunocompromised patients. It may exist either as a smooth (S) or rough (R) morphotype, the latter being associated with increased pathogenicity in various models. Genetic tools for homologous recombination and conditional gene expression are desperately needed to allow the study of M. abscessus virulence. However, descriptions of knock-out (KO) mutants in M. abscessus are rare, with only one KO mutant from an S strain described so far. Moreover, of the three major tools developed for homologous recombination in mycobacteria, only the one based on expression of phage recombinases is working. Several conditional gene expression tools have recently been engineered for Mycobacterium tuberculosis and Mycobacterium smegmatis, but none have been tested yet in M. abscessus. Based on previous experience with genetic tools allowing homologous recombination and their failure in M. abscessus, we evaluated the potential interest of a conditional gene expression approach using a system derived from the two repressors system, TetR/PipOFF. After several steps necessary to adapt TetR/PipOFF for M. abscessus, we have shown the efficiency of this system for conditional expression of an essential mycobacterial gene, fadD32. Inhibition of fadD32 was demonstrated for both the S and R isotypes, with marginally better efficiency for the R isotype. Conditional gene expression using the dedicated TetR/PipOFF system vectors developed here is effective in S and R M. abscessus, and may constitute an interesting approach for future genetic studies in this pathogen. PMID:22195042

  18. Rapid and simple identification of Beijing genotype strain of Mycobacterium tuberculosis using a loop-mediated isothermal amplification assay.

    PubMed

    Nagai, Yuhki; Iwade, Yoshito; Nakano, Manabu; Akachi, Shigehiro; Kobayashi, Takashi; Nishinaka, Takamichi

    2016-07-01

    Beijing genotype strains of Mycobacterium tuberculosis are geographically widespread and pose a notorious public health problem, these strains causing outbreaks of multidrug-resistant tuberculosis (TB); some studies have reported an association with drug resistance. Because the prevalence of Beijing strain has a substantial impact on TB control programs, the availability of a rapid and reliable method for detecting these strains is important for epidemiological monitoring of their circulation. The main methods currently used to identify Beijing genotype strains are IS6110 DNA fingerprinting, spoligotyping and PCR to detect specific deletions such as region of difference (RD)207. More recently, multiplex PCR assay using a Beijing-specific single nucleotide polymorphism (SNP) has been developed for detecting Beijing lineage strains. However, these methods are time-consuming and technically demanding. In the present study, a loop-mediated isothermal amplification (LAMP) assay that allows specific identification of Beijing genotype strain was developed. This Beijing genotype strain-identifying LAMP assay was performed 214 clinical isolates and the results compared with those of conventional PCR that targeted RD207 and Rv0679c-targreting multiplex PCR for Beijing lineage identification. LAMP assay showed 100% sensitivity and specificity compared with RD207-PCR. Furthermore, the sensitivity and specificity were 99.3% and 100%, respectively, compared with Rv0679c-multiplex PCR. This LAMP assay could be used routinely in local laboratories to monitor the prevalence of the Beijing genotype strain and thereby used to help control the spread of these potentially highly virulent and drug resistant strains. PMID:27213686

  19. In-depth analysis of the genome sequence of a clinical, extensively drug-resistant Mycobacterium bovis strain.

    PubMed

    Sagasti, Sara; Millán-Lou, María Isabel; Soledad Jiménez, María; Martín, Carlos; Samper, Sofía

    2016-09-01

    Although human-to-human transmission of Mycobacterium bovis strains and other members of the animal lineage of the tubercle bacilli is a rare event, an extensively drug resistant (XDR) strain, named M. bovis B strain, caused a lethal outbreak in the nineties in Spain. The genome of M. bovis B strain was re-sequenced by SOLiD platform and mapped to the reference M. bovis AF2122/97. The genetic polymorphisms detected have been analysed in depth. One hundred and fifty-eight specific non-synonymous SNPs were detected; ninety-two of these were non-conservative. In addition, one specific 3195-bp insertion could be identified as an ABC transporter gene by homology with tbd2 gene, which was found to be present in other clinical M. bovis strains. Its peculiar phenotype profile of resistance was explained by molecular characteristics, including a 5685-bp specific deletion that revealed a novel polymorphism associated with resistance to paraminosalicilic acid. From a phylogenetical point of view, according to the SNPs detected, M. bovis B could be included into the clonal complex M. bovis European 2. This is the first time that a deep analysis of the whole-genome sequencing of an extensively drug-resistant M. bovis strain is detailed. It offers the explanation for the resistance and found several data to be incorporated for future research. PMID:27553409

  20. Molecular analysis and MIRU-VNTR typing of Mycobacterium avium subsp. avium, 'hominissuis' and silvaticum strains of veterinary origin.

    PubMed

    Rónai, Zsuzsanna; Csivincsik, Ágnes; Dán, Ádám; Gyuranecz, Miklós

    2016-06-01

    Besides Mycobacterium avium subsp. paratuberculosis (MAP), M. avium subsp. avium (MAA), M. avium subsp. silvaticum (MAS), and 'M. avium subsp. hominissuis' (MAH) are equally important members of M. avium complex, with worldwide distribution and zoonotic potential. Genotypic discrimination is a prerequisite to epidemiological studies which can facilitate disease prevention through revealing infection sources and transmission routes. The primary aim of this study was to identify the genetic diversity within 135 MAA, 62 MAS, and 84 MAH strains isolated from wild and domestic mammals, reptiles and birds. Strains were tested for the presence of large sequence polymorphism LSP(A)17 and were submitted to Mycobacterial interspersed repetitive units-variable-number tandem repeat (MIRU-VNTR) analysis at 8 loci, including MIRU1, 2, 3, and 4, VNTR25, 32, and 259, and MATR9. In 12 strains hsp65 sequence code type was also determined. LSP(A)17 was present only in 19.9% of the strains. All LSP(A)17 positive strains belonged to subspecies MAH. The discriminatory power of the MIRU-VNTR loci set used reached 0.9228. Altogether 54 different genotypes were detected. Within MAH, MAA, and MAS strains 33, 16, and 5 different genotypes were observed. The described genotypes were not restricted to geographic regions or host species, but proved to be subspecies specific. Our knowledge about MAS is limited due to isolation and identification difficulties. This is the first study including a large number of MAS field strains. Our results demonstrate the high diversity of MAH and MAA strains and the relative uniformity of MAS strains. PMID:26964909

  1. Experimental infection of lambs with C and S-type strains of Mycobacterium avium subspecies paratuberculosis: immunological and pathological findings

    PubMed Central

    2014-01-01

    The two main genotypes of recognized isolates of Mycobacterium avium subsp. paratuberculosis (Map) are cattle (C) and sheep (S) strains. An experimental infection was conducted to establish the effect of Map strain on the pathogenesis of ovine paratuberculosis. Twenty-four out of thirty 1.5-month-old Assaf lambs were divided into 4 groups of 6 and infected orally with three low passage field isolates, two of S- (22G and the pigmented Ovicap49) and one of C– (764) type, and the reference K-10 strain (C type). The remaining six animals were unchallenged controls. Animals were euthanized at 150 and 390 days post-infection (dpi). Throughout the experiment, the peripheral immune response was assessed and histological and molecular (PCR) studies were conducted on samples of intestine and related lymphoid tissue. Specific antibody and IFN-γ production was significantly higher in animals infected with the C strains, while no consistent IFN- γ responses were observed in the S-type strain infected groups. A positive intradermal skin test response was detected in all infected groups. Lambs infected with S-type strains had granulomatous lesions restricted to the lymphoid tissue with no differences in the lesion intensity over time. In both C–type strain groups, lesions were more severe at 150 dpi while at 390 dpi lesions, characterized by well-demarcated granulomas with fibrosis, decreased in severity. Only infected lambs were positive to PCR. These results suggest that the strain of Map has a strong influence over the immune and pathological responses developed by the host. Lesions induced by C–type strains in lambs show a regressive character and tend to decrease as the infection progresses. PMID:24428881

  2. A novel method for the rapid and prospective identification of Beijing Mycobacterium tuberculosis strains by high-resolution melting analysis.

    PubMed

    Alonso, M; Navarro, Y; Barletta, F; Martínez Lirola, M; Gotuzzo, E; Bouza, E; García de Viedma, D

    2011-03-01

    Genotypic analysis of Mycobacterium tuberculosis (MTB) has enabled the definition of several lineages. The Beijing family, which is considered highly virulent and transmissible, has been associated with resistance in certain settings and involved in severe outbreaks, making it one of the most closely-monitored lineages. Therefore, rapid prospective identification of Beijing MTB strains could be relevant. In the present study, we evaluate a real-time PCR followed by high-resolution melting (HRM) based on the identification of a single nucleotide polymorphism (SNP) in the Rv2629 gene which defines Beijing lineage (A191C for Beijing genotype and A191A for non-Beijing genotype). This combined methodology efficiently differentiated Beijing and non-Beijing strains in 100% of the isolates from a collection of reference strains without requiring specific DNA probes. Additionally, HRM was able to assign a Beijing/non-Beijing genotype in 90.9% of the respiratory specimens assayed. Its applicability was tested on a Peruvian sample of circulating MTB strains, in which it identified 10.7% as belonging to the Beijing genotype; this proportion reached 20% in the North Lima area. HRM analysis of the A191C SNP is a rapid, reliable, and sensitive method for the efficient prospective survey of high-risk Beijing MTB strains, even in developing settings where MTB culture is often not available. PMID:20384709

  3. Multidrug-resistant strains of Mycobacterium tuberculosis isolated from patients in Tehran belong to a genetically distinct cluster.

    PubMed

    Feizabadi, M M; Shahriari, M; Safavi, M; Gharavi, S; Hamid, M

    2003-01-01

    Restriction fragment length polymorphism (RFLP) analysis was used to study the molecular epidemiology of tuberculosis (TB) in certain areas of Tehran. 120 isolates of Mycobacterium tuberculosis, including drug-resistant strains (n = 23), were analysed using polymorphic GC-rich sequence (PGRS) and IS6110 probes. There was considerable diversity among the strains cultured from patients from certain areas. The results of RFLP showed that multidrug resistant (MDR) isolates of M. tuberculosis in Tehran belong to a group of strains with low copies of IS6110 and PGRS. The degree of clustering was higher for the drug-resistant strains than for the susceptible ones (65% vs 20%). Based on the demographic data and results of RFLP, it appears that recent transmissions of TB from old patients have occurred in Tehran. However, drug-resistant TB in the city is mainly caused by strains that look different from those cultured from such patients. The majority of MDR isolates (85%) in this study contained a low copy number of IS6110 and PGRS in RFLP, and were mostly recovered from immigrants and refugees. PMID:12685884

  4. Comparative Evaluation of Ligation-Mediated PCR and Spoligotyping as Screening Methods for Genotyping of Mycobacterium tuberculosis Strains

    PubMed Central

    Bonora, Stefano; Gutierrez, M. Cristina; Di Perri, Giovanni; Brunello, Francesca; Allegranzi, Benedetta; Ligozzi, Marco; Fontana, Roberta; Concia, Ercole; Vincent, Veronique

    1999-01-01

    Spoligotyping has been suggested as a screening test in multistep genotyping of Mycobacterium tuberculosis strains. Relying on restriction fragment length polymorphism (RFLP) analysis with IS6110 (IS6110 RFLP analysis) as a “gold standard,” we performed a comparative evaluation of spoligotyping and ligation-mediated PCR (LMPCR), a recently described PCR-based typing method, as rapid screening tests for fingerprinting of 158 M. tuberculosis strains collected in Verona, Italy. LMPCR seemed to be comparable to spoligotyping in terms both of feasibility with rapidly extracted DNA and of generation of software-analyzable images. Moreover, LMPCR grouped considerably fewer strains than spoligotyping (38 versus 67%) and was found to reduce the cluster overestimation rate (26.3 versus 58%) and to give a better discriminatory index (0.992 versus 0.970) compared to spoligotyping. In our geographical region, where there was no evidence of clustered strains carrying fewer than six IS6110 copies, LMPCR was found to be more discriminatory than spoligotyping. We also evaluated two models of three-step typing strategies, involving the use of spoligotyping and LMPCR as screening methods and IS6110 RFLP analysis as a further supporting test. LMPCR proved to be a more effective first-step test than spoligotyping, significantly reducing the need for subtyping. LMPCR should be considered an alternative to spoligotyping as a rapid screening method for M. tuberculosis fingerprinting, particularly in areas with a low prevalence of M. tuberculosis strains carrying few copies of IS6110. PMID:10488164

  5. Whole-Genome Sequences of Four Strains Closely Related to Members of the Mycobacterium chelonae Group, Isolated from Biofilms in a Drinking Water Distribution System Simulator

    EPA Science Inventory

    We report the draft genome sequences of four Mycobacterium chelonae group strains from biofilms obtained after a ‘chlorine burn’ in a chloraminated drinking water distribution system simulator. These opportunistic pathogens have been detected in drinking and hospital water distr...

  6. Use of GeneXpert Mycobacterium tuberculosis/rifampicin for rapid detection of rifampicin resistant Mycobacterium tuberculosis strains of clinically suspected multi-drug resistance tuberculosis cases

    PubMed Central

    Guenaoui, Kheira; Ouardi, Aissa; Zeggai, Soumia; Sellam, Feriel; Bekri, Farid; Cherif Touil, Sakina

    2016-01-01

    Background Multi-drug resistance (MDR) TB is defined as tuberculosis (TB) disease caused by a strain of Mycobacterium tuberculosis (MTB) that was resistant to at least isoniazid and rifampicin (RIF). Emerging Multidrug-Resistant TB is one of the major concerns of health policy and rapid detection of M. tuberculosis and detection of RIF resistance in infected patients are essential for disease management. The aim of this study was to evaluate patterns of RIF resistance in cases of sputum positive pulmonary TB by using GeneXpert MTB/RIF and comparing between phenotypic and genotypic testing of RIF resistance in MTB strains of clinically suspected MDR-TB isolated cases in western Algeria. Methods In this study 50 sputum positive cases of pulmonary TB who were potential MDR suspect were included. Their sputum samples were collected and subjected to sputum smear microscopy, culture and conventional MTB/RIF test followed by GeneXpert MTB/RIF assay. Results Of total 50 cases included in this study, MTB was detected in all patients (100%) by GeneXpert MTB/RIF. However, RIF’s resistance was detected in only 21 cases (42%) by GeneXpert MTB/RIF. All RIF resistant strains detected by GeneXpert MTB/RIF were phenotypically confirmed as MDR strains. 42.85% of cases were retreatment failure cases, retreatment cases smear positive at 4 months were 23.82%. While 19.05% of cases were retreatment cases smear positive at diagnosis, and 14.28% patient had history of contact with MDR-TB. Sensitivity, specificity, positive predictive value and negative predictive value of Xpert MTB/RIF to detect RIF resistance in comparison to conventional phenotypic drug susceptibility technique were found equal to the rates of 100%, 100%, 100% and 100%, respectively. Conclusions GeneXpert MTB/RIF assay is efficient and reliable technique for the rapid diagnostic of TB. It’s simplicity, high sensitivity and specificity for RIF resistance detection make this technique a very attractive tool for

  7. Degradation of pyrene, benz[a]anthracene, and benzo[a]pyrene by Mycobacterium sp. strain RJGII-135, isolated from a former coal gasification site.

    PubMed

    Schneider, J; Grosser, R; Jayasimhulu, K; Xue, W; Warshawsky, D

    1996-01-01

    The degradation of three polycyclic aromatic hydrocarbons (PAH), pyrene (PYR), benz[a]anthracene (BAA), and benzo[a]pyrene (BaP), by Mycobacterium sp. strain RJGII-135 was studied. The bacterium was isolated from an abandoned coal gasification site soil by analog enrichment techniques and found to mineralize [14C]PYR. Further degradation studies with PYR showed three metabolites formed by Mycobacterium sp. strain RJGII-135, including 4,5-phenanthrene-dicarboxylic acid not previously isolated, 4-phenanthrene-carboxylic acid, and 4,5-pyrene-dihydrodiol. At least two dihydrodiols, 5,6-BAA-dihydrodiol and 10,11-BAA-dihydrodiol, were confirmed by high-resolution mass spectral and fluorescence analyses as products of the biodegradation of BAA by Mycobacterium sp. strain RJGII-135. Additionally, a cleavage product of BAA was also isolated. Mass spectra and fluorescence data support two different routes for the degradation of BaP by Mycobacterium sp. strain RJGII-135. The 7,8-BaP-dihydrodiol and three cleavage products of BaP, including 4,5-chrysene-dicarboxylic acid and a dihydro-pyrene-carboxylic acid metabolite, have been isolated and identified as degradation products formed by Mycobacterium sp. strain RJGII-135. These latter results represent the first example of the isolation of BaP ring fission products formed by a bacterial isolate. We propose that while this bacterium appears to attack only one site of the PYR molecule, it is capable of degrading different sites of the BAA and BaP molecules, and although the sites of attack may be different, the ability of this bacterium to degrade these PAH is well supported. The proposed pathways for biodegradation of these compounds by this Mycobacterium sp. strain RJGII-135 support the dioxygenase enzymatic processes reported previously for other bacteria. Microorganisms like Mycobacterium sp. strain RJGII-135 will be invaluable in attaining the goal of remediation of sites containing mixtures of these PAH. PMID:8572690

  8. Cloning and sequence analysis of a class A beta-lactamase from Mycobacterium tuberculosis H37Ra.

    PubMed Central

    Hackbarth, C J; Unsal, I; Chambers, H F

    1997-01-01

    A cosmid library from Mycobacterium tuberculosis H37Ra was introduced into Mycobacterium smegmatis, and eight recombinant clones with increased resistance to cefoxitin were identified. Isoelectric focusing detected an M. tuberculosis-derived beta-lactamase in one of these recombinant clones. A sequence analysis identified it as a class A beta-lactamase whose expression correlated with the increased resistance phenotype. PMID:9145897

  9. Closely Related Mycobacterial Strains Demonstrate Contrasting Levels of Efficacy as Antitumor Vaccines and Are Processed for Major Histocompatibility Complex Class I Presentation by Multiple Routes in Dendritic Cells

    PubMed Central

    Cheadle, Eleanor J.; O'Donnell, Dearbhaile; Selby, Peter J.; Jackson, Andrew M.

    2005-01-01

    Mycobacteria expressing recombinant antigens are already being developed as vaccines against both infections and tumors. Little is known about how dendritic cells might process such antigens. Two different mycobacterial species, the fast-growing Mycobacterium smegmatis and the slow-growing M. bovis M. bovis BCG, were engineered to express a model tumor antigen, the Kb-restricted dominant cytotoxic T-lymphocyte epitope OVA257-264. Recombinant M. bovis BCG but not recombinant M. smegmatis conferred protection to mice challenged with the B16-OVA tumor cell line. We went on to investigate whether the contrast in antitumor efficacy could be due to differences in how dendritic cells process antigen from the two mycobacterial strains for class I presentation. Both strains of mycobacteria caused phenotypic maturation of dendritic cells, but recombinant M. smegmatis infection led to a greater degree of dendritic cell maturation than recombinant M. bovis BCG infection. Antigen from recombinant M. smegmatis was processed and presented as OVA257-264 on Kb molecules by the dendritic cell line DC2.4 but not by bone marrow-derived dendritic cells (BMDC) or splenic dendritic cells. In contrast, antigen from recombinant M. bovis BCG was presented by all three dendritic cell types as long as the mycobacteria were viable. Such presentation was dependent on proteasome function and nascent major histocompatibility complex (MHC) class I molecules in DC2.4 cells but independent of the proteasome and transporter associated with antigen processings (TAP) in BMDC and splenic dendritic cells. These data demonstrate for the first time that antigen vectored by the slow-growing M. bovis BCG but not that vectored by fast-growing, readily destroyed M. smegmatis is processed and presented on MHC class I by in vitro-generated dendritic cells, which has implications for recombinant microbial vaccine development. PMID:15664917

  10. Molecular epidemiology of Mycobacterium tuberculosis strains isolated from patients in a human immunodeficiency virus cohort in Switzerland.

    PubMed Central

    Strässle, A; Putnik, J; Weber, R; Fehr-Merhof, A; Wüst, J; Pfyffer, G E

    1997-01-01

    From 1989 to 1995, 46 patients infected with the human immunodeficiency virus were diagnosed with tuberculosis at the University Hospital in Zurich. Using the IS6110 insertion sequence as a genetic marker, restriction fragment length polymorphism analyses were done for 52 Mycobacterium tuberculosis isolates. We have found a large degree of IS6110 polymorphism, ranging from 1 to 16 copies. For isolates from patients from whom multiple isolates had been available, the IS6110 pattern remained virtually stable over a period of up to 4 years, as well as during emerging drug resistance. In none of the cases was a reinfection of a patient with another strain detected. For isolates from 10 patients we detected identical patterns which could be associated with four clusters. In one of these, the strains exhibited a low IS6110 copy number (four bands), and the strains were further analyzed by hybridizing with (i) the polymorphic GC-rich repetitive sequence (PGRS) and (ii) the 36-bp direct-repeat (DR) cluster sequence. One of these isolates had a different pattern with the PGRS as well as with the DR sequence and could therefore be safely excluded from that cluster. These findings point to the importance of applying more than one genetic criterion in the molecular biological study of strain relatedness. PMID:9003599

  11. Genotyping and strain distribution of Mycobacterium avium subspecies hominissuis isolated from humans and pigs in Belgium, 2011-2013.

    PubMed

    Vluggen, Christelle; Soetaert, Karine; Duytschaever, Lucille; Denoël, Joseph; Fauville-Dufaux, Maryse; Smeets, François; Bruffaerts, Nicolas; Huygen, Kris; Fretin, David; Rigouts, Leen; Saegerman, Claude; Mathys, Vanessa

    2016-01-01

    Mycobacterium avium represents a health concern for both humans and pigs. The characterisation of its subspecies is an important step improving the understanding of the epidemiology and the control of this pathogen. Ninety-two human M. avium strains were selected for a retrospective study. Subspecies determination by rpoB sequencing and IS1245/IS901 analysis showed that 98.9% of Belgian human M. avium strains belong to the subspecies hominissuis (MAH). Some of these MAH strains present particular IS1245/IS901 profiles (absence of IS1245 and false IS901 detection provoked by the presence of ISMav6). In addition, 54 MAH strains isolated from submandibular lymph nodes of Belgian pigs with lymphadenitis were included in this study. Genotyping of human and porcine isolates was performed using multispacer sequence typing (MST). In total, 49 different MST types were identified among pig (n = 11) and human (n = 43) MA isolates, with only five shared by both hosts. Among these MST types, 34 were newly identified. Our findings demonstrate the extensive genetic diversity among MAH isolates. Some genotypes were more prevalent in human or pigs but no correlation was observed between MST type and place of residence or the farm of origin for human and porcine isolates respectively, suggesting an environmental source of infection. PMID:26835872

  12. Comparison between spoligotyping and IS6110 restriction fragment length polymorphisms in molecular genotyping analysis of Mycobacterium tuberculosis strains.

    PubMed

    Gori, Andrea; Esposti, Anna Degli; Bandera, Alessandra; Mezzetti, Maura; Sola, Christophe; Marchetti, Giulia; Ferrario, Giulio; Salerno, Franco; Goyal, Madhu; Diaz, Raul; Gazzola, Lidia; Codecasa, Luigi; Penati, Valeria; Rastogi, Nalin; Moroni, Mauro; Franzetti, Fabio

    2005-08-01

    Spoligotyping was compared with RFLP fingerprinting analysis in the identification of Mycobacterium tuberculosis strains. Spoligotyping sensitivity was 97.6% with a specificity of 47%. The global probability for two strains clustered with spoligotyping to be clustered also with RFLP analysis was 33%; the probability for two strains clustered with RFLP analysis to be clustered also with spoligotyping analysis was 95%. However, comparing the two methods in five outbreak episodes, full concordance was evidenced between spoligotyping and RFLP. Moreover, we evaluated the presence of our 17 largest spoligotyping clusters in spoligotyping databases from Caribbean countries, London and Cuba. Only five out of 17 patterns were present in all the cohorts. The conditional probability comparing spoligotyping and RFLP methods related to these patterns resulted in very low concordance (range from 2 to 38%). In conclusion, we confirm that spoligotyping when used alone overestimates the number of recent transmission and does not represent a suitable method for wide clinical practice application. However, it allows to get a first good picture of strain identity in a new setting and in more localized or confined settings, the probability of reaching the same result compared to RFLP was 100% confirming the usefulness of spoligotyping in the management of epidemic events, especially in hospitals, prisons and close communities. PMID:16038791

  13. [Preparation of androsta-1,4-diene-3,17-dione from sterols using Mycobacterium neoaurum VKPM As-1656 strain].

    PubMed

    Molchanova, M A; Andriushina, V A; Savinova, T S; Stytsenko, T S; Rodina, N V; Voĭshvillo, N E

    2007-01-01

    A product of microbiological cleavage of the sterols side chain, androsta-1,4-diene-3,17-dione, is toxic for bacteria, in particular, actinobacteria of the genera Mycobacterium and Arthrobacter. Sterols were transformed into androsta-1,4-diene-3,17-dione by culturing the M. neoaurum VKPM An-1656 strain in a high yield, provided that a sorbent was used for elimination of contact between the bacterial cells and the product. Unlike the cholesterol side chain, the more branched chains of phytosterols were cleaved in the presence of M. neoaurum at a high rate only under turbulent stirring of the culture medium, which intensified the formation of hydrocarbonate ion from NaNI3 in situ. PMID:17682396

  14. 2-(Quinolin-4-yloxy)acetamides Are Active against Drug-Susceptible and Drug-Resistant Mycobacterium tuberculosis Strains.

    PubMed

    Pissinate, Kenia; Villela, Anne Drumond; Rodrigues-Junior, Valnês; Giacobbo, Bruno Couto; Grams, Estêvão Silveira; Abbadi, Bruno Lopes; Trindade, Rogério Valim; Roesler Nery, Laura; Bonan, Carla Denise; Back, Davi Fernando; Campos, Maria Martha; Basso, Luiz Augusto; Santos, Diógenes Santiago; Machado, Pablo

    2016-03-10

    2-(Quinolin-4-yloxy)acetamides have been described as potent in vitro inhibitors of Mycobacterium tuberculosis growth. Herein, additional chemical modifications of lead compounds were carried out, yielding highly potent antitubercular agents with minimum inhibitory concentration (MIC) values as low as 0.05 μM. Further, the synthesized compounds were active against drug-resistant strains and were devoid of apparent toxicity to Vero and HaCat cells (IC50s ≥ 20 μM). In addition, the 2-(quinolin-4-yloxy)acetamides showed intracellular activity against the bacilli in infected macrophages with action similar to rifampin, low risk of drug-drug interactions, and no sign of cardiac toxicity in zebrafish (Danio rerio) at 1 and 5 μM. Therefore, these data indicate that this class of compounds may furnish candidates for future development to, hopefully, provide drug alternatives for tuberculosis treatment. PMID:26985307

  15. A novel insertion element from Mycobacterium avium, IS1245, is a specific target for analysis of strain relatedness.

    PubMed Central

    Guerrero, C; Bernasconi, C; Burki, D; Bodmer, T; Telenti, A

    1995-01-01

    The insertion sequence IS1245 is a novel mycobacterial repetitive element identified in Mycobacterium avium. It encodes a transposase which exhibits a 64% amino acid similarity with IS1081, an insertion element present in the M. tuberculosis complex. The host range of IS1245 appears limited to M. avium as this element was not identified in M. intracellulare or in any other of 18 mycobacteria species tested. When IS1245 was used for restriction fragment length polymorphism (RFLP) analysis, human isolates characteristically presented a high number of copies (median, 16; range, 3 to 27) and a diversity of RFLP patterns comparable to that found by pulsed-field gel electrophoresis. Isolates from nonhuman sources differed both in number of copies and in RFLP pattern diversity: while swine isolates shared the characteristics of human strains, those from several avian sources exhibited a very low copy number of IS1245 and appeared clonal on the basis of RFLP. PMID:7714183

  16. Characterisation of porin genes from Mycobacterium fortuitum and their impact on growth

    PubMed Central

    2009-01-01

    Background Highly pathogenic mycobacteria like Mycobacterium tuberculosis are characterised by their slow growth and their ability to reside and multiply in the very hostile phagosomal environment and a correlation between the growth rate of mycobacteria and their pathogenicity has been hypothesised. Here, porin genes from M. fortuitum were cloned and characterised to address their impact on the growth rate of fast-growing and pathogenic mycobacteria. Results Two genes encoding porins orthologous to MspA from M. smegmatis, porM1 and porM2, were cloned from M. fortuitum strains, which were originally isolated from human patients. Both porin genes were at least partially able to complement the mutations of a M. smegmatis mutant strain lacking the genes mspA and mspC with respect to the growth rate. PorM1 and porM2 were present in different strains of M. fortuitum including the type strain. Comparative expression analysis of porM genes revealed divergent porin expression among analysed M. fortuitum strains. Repression of the expression of porins by antisense technique decreased the growth rates of different M. fortuitum. The effects of over-expression of porM1 as well as porM2 varied depending on the strain and the concentration of antibiotic added to the medium and indicated that PorM1 and PorM2 enhance the growth of M. fortuitum strains, but also the diffusion of the antibiotic kanamycin into the cells. Conclusion This study demonstrates the important role of porin expression in growth as well as antibiotic susceptibility of the opportunistic bacterium M. fortuitum. PMID:19203364

  17. Compensatory Mutations of Rifampin Resistance Are Associated with Transmission of Multidrug-Resistant Mycobacterium tuberculosis Beijing Genotype Strains in China.

    PubMed

    Li, Qin-Jing; Jiao, Wei-Wei; Yin, Qing-Qin; Xu, Fang; Li, Jie-Qiong; Sun, Lin; Xiao, Jing; Li, Ying-Jia; Mokrousov, Igor; Huang, Hai-Rong; Shen, A-Dong

    2016-05-01

    Mycobacterium tuberculosis can acquire resistance to rifampin (RIF) through mutations in the rpoB gene. This is usually accompanied by a fitness cost, which, however, can be mitigated by secondary mutations in the rpoA or rpoC gene. This study aimed to identify rpoA and rpoC mutations in clinical M. tuberculosis isolates in northern China in order to clarify their role in the transmission of drug-resistant tuberculosis (TB). The study collection included 332 RIF-resistant and 178 RIF-susceptible isolates. The majority of isolates belonged to the Beijing genotype (95.3%, 486/510 isolates), and no mutation was found in rpoA or rpoC of the non-Beijing genotype strains. Among the Beijing genotype strains, 27.8% (89/320) of RIF-resistant isolates harbored nonsynonymous mutations in the rpoA (n = 6) or rpoC (n = 83) gene. The proportion of rpoC mutations was significantly higher in new cases (P = 0.023) and in strains with the rpoB S531L mutation (P < 0.001). In addition, multidrug-resistant (MDR) strains with rpoC mutations were significantly associated with 24-locus mycobacterial interspersed repetitive-unit-variable-number tandem-repeat clustering (P = 0.016). In summary, we believe that these findings indirectly suggest an epistatic interaction of particular mutations related to RIF resistance and strain fitness and, consequently, the role of such mutations in the spread of MDR M. tuberculosis strains. PMID:26902762

  18. Whole Genome Sequencing of Mycobacterium africanum Strains from Mali Provides Insights into the Mechanisms of Geographic Restriction

    PubMed Central

    Maiga, Mamoudou; Abeel, Thomas; Shea, Terrance; Desjardins, Christopher A.; Diarra, Bassirou; Baya, Bocar; Sanogo, Moumine; Diallo, Souleymane; Earl, Ashlee M.; Bishai, William R.

    2016-01-01

    Background Mycobacterium africanum, made up of lineages 5 and 6 within the Mycobacterium tuberculosis complex (MTC), causes up to half of all tuberculosis cases in West Africa, but is rarely found outside of this region. The reasons for this geographical restriction remain unknown. Possible reasons include a geographically restricted animal reservoir, a unique preference for hosts of West African ethnicity, and an inability to compete with other lineages outside of West Africa. These latter two hypotheses could be caused by loss of fitness or altered interactions with the host immune system. Methodology/Principal Findings We sequenced 92 MTC clinical isolates from Mali, including two lineage 5 and 24 lineage 6 strains. Our genome sequencing assembly, alignment, phylogeny and average nucleotide identity analyses enabled us to identify features that typify lineages 5 and 6 and made clear that these lineages do not constitute a distinct species within the MTC. We found that in Mali, lineage 6 and lineage 4 strains have similar levels of diversity and evolve drug resistance through similar mechanisms. In the process, we identified a putative novel streptomycin resistance mutation. In addition, we found evidence of person-to-person transmission of lineage 6 isolates and showed that lineage 6 is not enriched for mutations in virulence-associated genes. Conclusions This is the largest collection of lineage 5 and 6 whole genome sequences to date, and our assembly and alignment data provide valuable insights into what distinguishes these lineages from other MTC lineages. Lineages 5 and 6 do not appear to be geographically restricted due to an inability to transmit between West African hosts or to an elevated number of mutations in virulence-associated genes. However, lineage-specific mutations, such as mutations in cell wall structure, secretion systems and cofactor biosynthesis, provide alternative mechanisms that may lead to host specificity. PMID:26751217

  19. Use of a PCR method based on IS6110 polymorphism for typing Mycobacterium tuberculosis strains from BACTEC cultures.

    PubMed Central

    Otal, I; Samper, S; Asensio, M P; Vitoria, M A; Rubio, M C; Gómez-Lus, R; Martín, C

    1997-01-01

    Two PCR typing methods, based on polymorphism of the insertion sequence IS6110, were compared with Mycobacterium tuberculosis strains by using a single primer complementary to the inverted repeats of IS6110. Total M. tuberculosis DNA either was amplified directly (IS6110-PCR) or was amplified following digestion and ligation (IS6110-inverse-PCR). Both PCR techniques showed a similar degree of discrimination. Because of its simplicity, IS6110-PCR was chosen to confirm that a single M. tuberculosis strain was responsible for an outbreak of tuberculosis in a secondary school. IS6110-PCR was used to study the degree of differentiation in 85 clinical M. tuberculosis isolates from BACTEC 12B broth cultures. Results were consistent with those of the standardized IS6110 restriction fragment length polymorphism (RFLP) analysis method, showing identical PCR types for identical RFLPs, although the degree of discrimination was greater by RFLP analysis. The study concludes that due to its simplicity, IS6110-PCR is a good screening method when quick differentiation between M. tuberculosis strains is needed because BACTEC cultures may be used directly. PMID:8968924

  20. Antigenic characterization of dimorphic surface protein in Mycobacterium tuberculosis.

    PubMed

    Matsuba, Takashi; Siddiqi, Umme Ruman; Hattori, Toshio; Nakajima, Chie; Fujii, Jun; Suzuki, Yasuhiko

    2016-05-01

    The Mycobacterium tuberculosis Rv0679c protein is a surface protein that contributes to host cell invasion. We previously showed that a single nucleotide transition of the Rv0679c gene leads to a single amino acid substitution from asparagine to lysine at codon 142 in the Beijing genotype family. In this study, we examined the immunological effect of this substitution. Several recombinant proteins were expressed in Escherichia coli and Mycobacterium smegmatis and characterized with antisera and two monoclonal antibodies named 5D4-C2 and 8G10-H2. A significant reduction of antibody binding was detected by enzyme-linked immunosorbent assay (ELISA) and western blot analysis in the Lys142-type protein. This reduction of 8G10-H2 binding was more significant, with the disappearance of a signal in the proteins expressed by recombinant mycobacteria in western blot analysis. In addition, epitope mapping analysis of the recombinant proteins showed a linear epitope by 5D4-C2 and a discontinuous epitope by 8G10-H2. The antibody recognizing the conformational epitope detected only mycobacterial Asn142-type recombinant protein. Our results suggest that a single amino acid substitution of Rv0679c has potency for antigenic change in Beijing genotype strains. PMID:27190237

  1. In vitro inhibition of drug-resistant and drug-sensitive strains of Mycobacterium tuberculosis by ethnobotanically selected South African plants.

    PubMed

    Lall, N; Meyer, J J

    1999-09-01

    Twenty South African medicinal plants used to treat pulmonary diseases were screened for activity against drug-resistant and drug-sensitive strains of Mycobacterium tuberculosis. A preliminary screening of acetone and water plant extracts against a drug-sensitive strain of Mycobacterium tuberculosis, H37Rv, was done by the agar plate method. Fourteen of the 20 acetone extracts showed inhibitory activity at a concentration of 0.5 mg/ml against this strain. Acetone as well as water extracts of Cryptocarya latifolia, Euclea natalensis, Helichrysum melanacme, Nidorella anomala and Thymus vulgaris inhibited the growth of M. tuberculosis. Given the activity of 14 acetone extracts at 0.5 mg/ml against the drug-sensitive strain by the agar plate method, a further study was done employing a rapid radiometric method to confirm the inhibitory activity. These active acetone extracts were screened against the H37Rv strain as well as a strain resistant to the drugs isoniazid and rifampin. The minimal inhibitory concentration of Croton pseudopulchellus, Ekebergia capensis, Euclea natalensis, Nidorella anomala and Polygala myrtifolia was 0.1 mg/ml against the H37Rv strain by the radiometric method. Extracts of Chenopodium ambrosioides, Ekebergia capensis, Euclea natalensis, Helichrysum melanacme, Nidorella anomala and Polygala myrtifolia were active against the resistant strain at 0.1 mg/ml. Eight plants showed activity against both strains at a concentration of 1.0 mg/ml. PMID:10473184

  2. Spacer oligonucleotide typing of Mycobacterium bovis strains from cattle and other animals: a tool for studying epidemiology of tuberculosis.

    PubMed Central

    Aranaz, A; Liébana, E; Mateos, A; Dominguez, L; Vidal, D; Domingo, M; Gonzolez, O; Rodriguez-Ferri, E F; Bunschoten, A E; Van Embden, J D; Cousins, D

    1996-01-01

    The spacer oligonucleotide typing (spoligotyping) method was evaluated for its ability to differentiate Mycobacterium bovis strains. This method detects the presence or absence of spacers of the direct repeat locus of the M. bovis genome. The spacers in the direct repeat locus are amplified by PCR and are detected by hybridization of the biotin-labelled PCR product with a membrane containing oligonucleotides derived from spacer sequences that have previously been bound to a membrane. One hundred eighty-two M. bovis isolates from domestic animals (cattle, goat, sheep, and cats) and wild animals (deer and wild boar) were spoligotyped, and the results were compared with those obtained by IS6110 restriction fragment length polymorphism analysis. Two rather homogeneous clusters of isolates containing 20 and 4 types, respectively, were identified by spoligotyping. The first cluster included isolates from cattle, cats, and feral animals. By spoligotyping, isolates from the Spanish wild boar and deer had the same pattern as some bovine isolates, suggesting transmission between these animals and cattle and highlighting the importance of the study of these reservoirs. The second cluster included all the caprine and ovine isolates. Within each cluster, the patterns of the different strains differed only slightly, suggesting that the spoligotypes may be characteristic of strains from particular animal species. Spoligotyping proved to be useful for studying the epidemiology of bovine M. bovis isolates, especially of those isolates containing only a single copy of IS6110. In view of our results, we suggest fingerprinting all M. bovis strains by the spoligotyping method initially and then by IS6110 restriction fragment length polymorphism typing of the strains belonging to the most common spoligotypes. PMID:8897175

  3. Distinctive western blot antibody patterns induced by infection of mice with individual strains of the Mycobacterium avium complex.

    PubMed Central

    Elsaghier, A; Nolan, A; Allen, B; Ivanyi, J

    1992-01-01

    Systemic infection of mice with organisms of the Mycobacterium avium complex (MAC) induced antibody responses, characteristic for each of the three tested individual strains. The influence of host genetic factors was reflected up to 3 months after infection by the finding of generally oligobanded and multibanded Western blot patterns in C57B1/6 and BALB/c mice, respectively. Nevertheless, more bands developed at 6 months in C57BL/6 mice. The response to three antigens of 18,000, 38,000 and 24,000 MW was analysed in greater detail. Antibodies to a protease-resistant 18,000 MW band produced only by BALB/c mice were either strain specific, following infection with M. avium, strain Maa-B2, or cross-reactive within MAC, following infection with M. avium strain Maa-A6 and M. paratuberculosis, strain Map-203. Another protease-resistant antigen of 38,000 MW was immunogenic only in Maa-B2 infected mice. This constituent was found to be related to the protease-sensitive antigen of corresponding molecular weight from M. tuberculosis. Two 24,000 MW proteins of M. paratuberculosis were separated by two-dimensional gel electrophoresis: antibodies to the anodic band were induced by Map-203 infection, whilst the cathodic band was revealed by heteroclitic antibodies from Maa-B2-infected mice. The latter antigen is apparently expressed during in vivo replication, but not during in vitro culture of Maa-B2 bacteria. We generally conclude, that the selective antibody patterns after live infection, could be attributed to differences in the release of native antigens within mycobacterial lesions. In view of a high degree of species specificity, some of the immunogenic constituents identified may also be useful for serodiagnostic application. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:1526646

  4. Mycobacterium tuberculosis Rv1152 is a Novel GntR Family Transcriptional Regulator Involved in Intrinsic Vancomycin Resistance and is a Potential Vancomycin Adjuvant Target.

    PubMed

    Zeng, Jie; Deng, Wanyan; Yang, Wenmin; Luo, Hongping; Duan, Xiangke; Xie, Longxiang; Li, Ping; Wang, Rui; Fu, Tiwei; Abdalla, Abualgasim Elgaili; Xie, Jianping

    2016-01-01

    Novel factors involved in Mycobacteria antibiotics resistance are crucial for better targets to combat the ever-increasing drug resistant strains. Mycobacterium tuberculosis Rv1152, a novel GntR family transcriptional regulator and a promising vancomycin adjuvant target, was firstly characterized in our study. Overexpression of Rv1152 in Mycobacterium smegmatis decreased bacterial susceptibility to vancomycin. Moreover, a deficiency in MSMEG_5174, an Rv1152 homolog made M. smegmatis more sensitive to vancomycin, which was reverted by complementing the MSMEG_5174 deficiency with Rv1152 of M. tuberculosis. Rv1152 negatively regulated four vancomycin responsive genes, namely genes encoding the ribosome binding protein Hsp, small unit of sulfate adenylyltransferase CysD, L-lysine-epsilon aminotransferase Lat, and protease HtpX. Taken together, Rv1152 controls the expression of genes required for the susceptibility to vancomycin. This is the first report that links the GntR family transcriptional factor with vancomycin susceptibility. Inhibitors of Rv1152 might be ideal vancomycin adjuvants for controlling multi-drug resistant Mycobacterial infections. PMID:27349953

  5. Mycobacterium tuberculosis Rv1152 is a Novel GntR Family Transcriptional Regulator Involved in Intrinsic Vancomycin Resistance and is a Potential Vancomycin Adjuvant Target

    PubMed Central

    Zeng, Jie; Deng, Wanyan; Yang, Wenmin; Luo, Hongping; Duan, Xiangke; Xie, Longxiang; Li, Ping; Wang, Rui; Fu, Tiwei; Abdalla, Abualgasim Elgaili; Xie, Jianping

    2016-01-01

    Novel factors involved in Mycobacteria antibiotics resistance are crucial for better targets to combat the ever-increasing drug resistant strains. Mycobacterium tuberculosis Rv1152, a novel GntR family transcriptional regulator and a promising vancomycin adjuvant target, was firstly characterized in our study. Overexpression of Rv1152 in Mycobacterium smegmatis decreased bacterial susceptibility to vancomycin. Moreover, a deficiency in MSMEG_5174, an Rv1152 homolog made M. smegmatis more sensitive to vancomycin, which was reverted by complementing the MSMEG_5174 deficiency with Rv1152 of M. tuberculosis. Rv1152 negatively regulated four vancomycin responsive genes, namely genes encoding the ribosome binding protein Hsp, small unit of sulfate adenylyltransferase CysD, L-lysine-epsilon aminotransferase Lat, and protease HtpX. Taken together, Rv1152 controls the expression of genes required for the susceptibility to vancomycin. This is the first report that links the GntR family transcriptional factor with vancomycin susceptibility. Inhibitors of Rv1152 might be ideal vancomycin adjuvants for controlling multi-drug resistant Mycobacterial infections. PMID:27349953

  6. Differential Immune Responses and Protective Effects in Avirulent Mycobacterial Strains Vaccinated BALB/c Mice.

    PubMed

    Liu, Laicheng; Fu, Ruiling; Yuan, Xuefeng; Shi, Chunwei; Wang, Shuling; Lu, Xianyu; Ma, Zhao; Zhang, Xiaoming; Qin, Weiyan; Fan, Xionglin

    2015-07-01

    Screening live mycobacterial vaccine candidates is the important strategy to develop new vaccines against adult tuberculosis (TB). In this study, the immunogenicity and protective efficacy of several avirulent mycobacterial strains including Mycobacterium smegmatis, M. vaccae, M. terrae, M. phlei, M. trivial, and M. tuberculosis H37Ra were compared with M. bovis BCG in BALB/c mice. Our results demonstrated that differential immune responses were induced in different mycobacterial species vaccinated mice. As BCG-vaccinated mice did, M. terrae immunization resulted in Th1-type responses in the lung, as well as splenocytes secreting IFN-γ against a highly conserved mycobacterial antigen Ag85A. M. smegmatis also induced the same splenocytes secreting IFN-γ as BCG and M. terrae did. In addition, M. terrae and M. smegmatis-immunized mice predominantly increased expression of IL-10 and TGF-β in the lung. Most importantly, mice vaccinated with H37Ra and M. vaccae could provide the same protection in the lung against virulent M. tuberculosis challenge as BCG. The result may have important implications in developing adult TB vaccine. PMID:25995039

  7. Molecular basis for the exquisite sensitivity of Mycobacterium tuberculosis to isoniazid.

    PubMed

    Zhang, Y; Dhandayuthapani, S; Deretic, V

    1996-11-12

    The exceptional sensitivity of Mycobacterium tuberculosis to isonicotinic acid hydrazide (INH) lacks satisfactory definition. M. tuberculosis is a natural mutant in oxyR, a central regulator of peroxide stress response. The ahpC gene, which encodes a critical subunit of alkyl hydroperoxide reductase, is one of the targets usually controlled by oxyR in bacteria. Unlike in mycobacterial species less susceptible to INH, the expression of ahpC was below detection limits at the protein level in INH-sensitive M. tuberculosis and Mycobacterium bovis strains. In contrast, AhpC was detected in several series of isogenic INH-resistant (INHr) derivatives. In a demonstration of the critical role of ahpC in sensitivity to INH, insertional inactivation of ahpC on the chromosome of Mycobacterium smegmatis, a species naturally insensitive to INH, dramatically increased its susceptibility to this compound. These findings suggest that AhpC counteracts the action of INH and that the levels of its expression may govern the intrinsic susceptibility of mycobacteria to this front-line antituberculosis drug. PMID:8917570

  8. The seal tuberculosis agent, Mycobacterium pinnipedii, infects domestic cattle in New Zealand: epidemiologic factors and DNA strain typing.

    PubMed

    Loeffler, Scott H; de Lisle, Geoffrey W; Neill, Mark A; Collins, Desmond M; Price-Carter, Marian; Paterson, Brent; Crews, Kevin B

    2014-04-01

    The fur seal (Arctocephalus forsteri), which is abundant in coastal areas of New Zealand, harbors several zoonotic pathogens, including Mycobacterium pinnipedii, a member of the Mycobacterium tuberculosis complex. We describe the microbiology and epidemiology of seven cases of M. pinnipedii infection in beef cattle (Bos primigenius) in coastal areas of New Zealand in 1991-2011. Epidemiologic factors were analyzed on six case farms and a telephone survey of 55 neighboring farms. A DNA-strain typing, using analysis of variable number tandem repeats and the direct repeats (VNTR/DR) of those isolates, was used to compare them to M. bovis isolates commonly found in New Zealand cattle and wildlife. In all cases of M. pinnipedii in cattle, only one animal in the herd was found to be infected. In six of seven cases, the lesions were in the thoracic lymph nodes, indicating a likely aerosol pathway. The lack of multiple cases within a herd suggests that cow-to-cow transmission is uncommon, if it occurs at all. There was no significant difference between case and control farms in distance to sea, herd size, herd type, or farming practice. The odds ratio for access to the beach for cattle on the Chatham Islands was significantly higher than it was for farms on the mainland coastal areas (odds ratio [OR] = 3.6, 95% CI = 1.1-11.4) Likewise, the odds ratio for acquiring tuberculosis was increased when farmers had seen seals on the property (OR =  9, 95% CI = 1.4-56.1 ). In all case farms, cattle had access to seals by beach grazing areas or waterways connecting directly with the ocean. The VNTR/DR typing of the isolates showed some variation in the M. pinnipedii isolates, with only two being identical; all isolates were easily distinguishable from M. bovis isolates. PMID:24484478

  9. Genome Sequencing of Mycobacterium abscessus Isolates from Patients in the United States and Comparisons to Globally Diverse Clinical Strains

    PubMed Central

    Davidson, Rebecca M.; Hasan, Nabeeh A.; Reynolds, Paul R.; Totten, Sarah; Garcia, Benjamin; Levin, Adrah; Ramamoorthy, Preveen; Heifets, Leonid; Daley, Charles L.

    2014-01-01

    Nontuberculous mycobacterial infections caused by Mycobacterium abscessus are responsible for a range of disease manifestations from pulmonary to skin infections and are notoriously difficult to treat, due to innate resistance to many antibiotics. Previous population studies of clinical M. abscessus isolates utilized multilocus sequence typing or pulsed-field gel electrophoresis, but high-resolution examinations of genetic diversity at the whole-genome level have not been well characterized, particularly among clinical isolates derived in the United States. We performed whole-genome sequencing of 11 clinical M. abscessus isolates derived from eight U.S. patients with pulmonary nontuberculous mycobacterial infections, compared them to 30 globally diverse clinical isolates, and investigated intrapatient genomic diversity and evolution. Phylogenomic analyses revealed a cluster of closely related U.S. and Western European M. abscessus subsp. abscessus isolates that are genetically distinct from other European isolates and all Asian isolates. Large-scale variation analyses suggested genome content differences of 0.3 to 8.3%, relative to the reference strain ATCC 19977T. Longitudinally sampled isolates showed very few single-nucleotide polymorphisms and correlated genomic deletion patterns, suggesting homogeneous infection populations. Our study explores the genomic diversity of clinical M. abscessus strains from multiple continents and provides insight into the genome plasticity of an opportunistic pathogen. PMID:25056330

  10. Molecular epidemiology of Mycobacterium tuberculosis strains isolated during a 3-year period (1993 to 1995) in Seville, Spain.

    PubMed Central

    Safi, H; Aznar, J; Palomares, J C

    1997-01-01

    The genetic polymorphism of Mycobacterium tuberculosis strains isolated in Seville, Spain, was studied by using computer-assisted analysis of the IS6110 fingerprint in order to determine the current situation and to evaluate the human-to-human transmission of this pathogen. One hundred seventy-six isolates from 175 patients among the 205 patients diagnosed with tuberculosis (TB) during a 3-year period (1993 to 1995) were cultured and analyzed. One hundred nine patients (62%) were infected with genetically different isolates, and 67 isolates (38%) were grouped into 19 clusters. These results demonstrate that the level of clustering of strains in Seville is intermediate between those in developed and developing countries. Epidemiological relatedness was shown for isolates from only 10 of these clusters. Active and high transmission rates exist in children and in human immunodeficiency virus (HIV)-infected adults, while in non-HIV-infected adults this transmission rate is moderate. Although transmission from children to adults is uncommon, the probability of transmission from HIV-infected patients to young adults not infected with HIV may be higher. On the basis of these observations, we predict a constant rise in the rate of TB transmission among HIV-infected patients and probably in young adult patients not infected with HIV if measures for the effective prevention of TB among the HIV-infected population are not implemented. PMID:9316891

  11. Identification of rifampin-resistant mycobacterium tuberculosis strains by hybridization, PCR, and ligase detaction reaction on oligonucleotide microchips.

    SciTech Connect

    Mikhailovich, V.; Lapa, S.; Gryadunov, D.; Sobolev, A.; Strizhkov, B.; Chernyh, N.; Skotnikova, O.; Irtuganova, O.; Moroz, A.; Litvinov, V.; Vladimirskii, M.; Perelman, M.; Chernousova, L.; Erokhin, V.; Mirzabekov, A.; Biochip Technology Center; Russian Academy of Sciences; Moscow Antituberculosis Center; Moscow Medical Academy; Russian Academy of Medical Sciences

    2001-07-01

    Three new molecular approaches were developed to identify drug-resistant strains of Mycobacterium tuberculosis using biochips with oligonucleotides immobilized in polyacrylamide gel pads. These approaches are significantly faster than traditional bacteriological methods. All three approaches -- hybridization, PCR, and ligase detection reaction -- were designed to analyze an 81-bp fragment of the gene rpoB encoding the {beta}-subunit of RNA polymerase, where most known mutations of rifampin resistance are located. The call set for hybridization analysis consisted of 42 immobilized oligonucleotides and enabled us to identify 30 mutant variants of the rpoB gene within 24 h. These variants are found in 95% of all mutants whose rifampin resistance is caused by mutations in the 81-bp fragment. Using the second approach, allele-specific on-chip PCR, it was possible to directly identify mutations in clinical samples within 1.5 h. The third approach, on-chip ligase detection reaction, was sensitive enough to reveal rifampin-resistant strains in a model mixture containing 1% of resistant and 99% of susceptible bacteria. This level of sensitivity is comparable to that from the determination of M. tuberculosis drug resistance by using standard bacteriological tests.

  12. Detection of RD(Rio) strain of Mycobacterium tuberculosis in tapirs (Tapirus terrestris) from a zoo in Brazil.

    PubMed

    Murakami, Patricia Sayuri; Monego, Fernanda; Ho, John L; Gibson, Andrea; Javorouski, Manoel Lucas; Bonat, Marcelo; Lacerda, Oneida; Brockelt, Sonia Regina; Biesdorf, Sonia Maria; Nakatani, Sueli Massumi; Riediger, Irina Nastassja; Fuverki, Renata Benício Neves; Biava, Janaína Socolovski; Vieira, Rafael Felipe Costa; do Santos, Andrea Pires; de Barros Filho, Ivan Roque; Biondo, Alexander Welker

    2012-12-01

    Tuberculosis is a chronic infection caused by strains of the Mycobacterium tuberculosis complex and occurs in both animal and human populations. The death of a tapir showing purulent material and a hard mass in the lungs at necropsy raised suspicion of a potential disease caused by mycobacteria species in a Brazilian zoo. Later, two other tapirs with similar signs died and were further investigated. Polymerase chain reaction (PCR) from bronco-alveolar lavages was performed, and both animals tested positive for the RD(Rio) strain of M. tuberculosis, which is a recently discovered Latin American-Mediterranean sublineage and the main cause of human tuberculosis in Rio de Janeiro, Brazil. To investigate the possibility of human infection and the source of transmission, all 50 zoo employees underwent tuberculin skin testing; four were reactive, but radiographic exams and direct sample staining did not suggest tuberculosis. Thus, direct human to animal transmission was not proven. However, the presence of RD(Rio) M. tuberculosis in tapirs highlights the lack of attention to diseases that human beings may transmit to wildlife. PMID:23272356

  13. First Worldwide Proficiency Study on Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Complex Strains

    PubMed Central

    de Beer, Jessica L.; Kremer, Kristin; Ködmön, Csaba; Supply, Philip

    2012-01-01

    Although variable-number tandem-repeat (VNTR) typing has gained recognition as the new standard for the DNA fingerprinting of Mycobacterium tuberculosis complex (MTBC) isolates, external quality control programs have not yet been developed. Therefore, we organized the first multicenter proficiency study on 24-locus VNTR typing. Sets of 30 DNAs of MTBC strains, including 10 duplicate DNA samples, were distributed among 37 participating laboratories in 30 different countries worldwide. Twenty-four laboratories used an in-house-adapted method with fragment sizing by gel electrophoresis or an automated DNA analyzer, nine laboratories used a commercially available kit, and four laboratories used other methods. The intra- and interlaboratory reproducibilities of VNTR typing varied from 0% to 100%, with averages of 72% and 60%, respectively. Twenty of the 37 laboratories failed to amplify particular VNTR loci; if these missing results were ignored, the number of laboratories with 100% interlaboratory reproducibility increased from 1 to 5. The average interlaboratory reproducibility of VNTR typing using a commercial kit was better (88%) than that of in-house-adapted methods using a DNA analyzer (70%) or gel electrophoresis (50%). Eleven laboratories using in-house-adapted manual typing or automated typing scored inter- and intralaboratory reproducibilities of 80% or higher, which suggests that these approaches can be used in a reliable way. In conclusion, this first multicenter study has documented the worldwide quality of VNTR typing of MTBC strains and highlights the importance of international quality control to improve genotyping in the future. PMID:22170917

  14. Lymphadenitis caused by infection with an isoniazid- and rifampin-resistant strain of Mycobacterium bovis BCG in an infant with IFN-γ/IL-12 pathway defect*

    PubMed Central

    Diniz, Lilian Martins Oliveira; Guimarães, Tiago; de Oliveira, Maria das Graças Rodrigues; Pinto, Jorge Andrade; de Miranda, Silvana Spindola

    2014-01-01

    We report a rare case in a female infant (age, 3.5 months) with primary immunodeficiency (IFN-γ/IL-12 pathway defect) who presented with suppurative lymphadenitis after Mycobacterium bovis BCG vaccination. The strain of M. bovis BCG identified was found to be resistant to isoniazid and rifampin. The patient was treated with a special pharmacological regimen involving isoniazid (in a limited, strategic manner), ethambutol, streptomycin, and IFN-γ, after which there was complete resolution of the lesions. PMID:24831405

  15. Vaccination with Mycobacterium bovis BCG Strains Danish and Pasteur in White-tailed Deer (Odocoileus virginianus) Experimentally Challenged with Mycobacterium bovis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wildlife reservoirs of Mycobacterium bovis represent serious obstacles to the eradication of tuberculosis in domestic livestock. The cause for many faltering eradication programs is the presence of wildlife reservoirs of M. bovis. One approach in dealing with this wildlife reservoir is to vaccinate ...

  16. Spoligotype profile of Mycobacterium tuberculosis complex strains from HIV-positive and -negative patients in Nigeria: a comparative analysis.

    PubMed

    Cadmus, Simeon; Hill, Véronique; van Soolingen, Dick; Rastogi, Nalin

    2011-01-01

    We ran a comparative analysis of all patients for whom a positive culture of Mycobacterium tuberculosis complex was available between April 2004 and October 2005 and whose HIV serology results were known, with spoligotyping results (n = 163) split into 49 HIV-positive patients and 114 HIV-negative patients. Spoligotype international type 373 (SIT373) (T1 lineage), which was highly prevalent among the HIV(+) patients, was totally absent from the HIV(-) population, suggesting that we had a specific clone affecting nearly 1/3 of all HIV-tuberculosis (TB)-coinfected patients. Among the LAM10-CAM sublineage strains, we had only a single strain of SIT403 among HIV(-) patients (0.88%), as opposed to 12.25% of the HIV(+) population (χ(2) = 10.77; P < 0.01), indicating a strong association between the strain and the HIV(+) population. The LAM10-CAM lineage spoligotype SIT61 was prevalent among the 2 subsets (37.72% in HIV(-) versus 12.24% in HIV(+) populations), though, with a significant difference between the 2 groups (χ(2) = 10.53; P < 0.01). However, there was no significant difference for SIT53 (T1 lineage) in the 2 subsets: 6.14 versus 8.2% (χ(2) = 0.22; P > 0.05). A total of 7/49, or 14.3%, other SITs among HIV(+) patients were not found among the HIV(-) patients. When added to the most prevalent SIT among HIV(+) patients (SIT373; n = 16), 23/49, or 47%, isolates among HIV-TB-coinfected patients were unique. We conclude that further studies should be carried out to investigate the evolution of these genotypes and others in the emergence of multidrug resistance and control of tuberculosis in Nigeria. PMID:21048016

  17. Whole Genome Sequencing Reveals Complex Evolution Patterns of Multidrug-Resistant Mycobacterium tuberculosis Beijing Strains in Patients

    PubMed Central

    Merker, Matthias; Kohl, Thomas A.; Roetzer, Andreas; Truebe, Leona; Richter, Elvira; Rüsch-Gerdes, Sabine; Fattorini, Lanfranco; Oggioni, Marco R.; Cox, Helen; Varaine, Francis; Niemann, Stefan

    2013-01-01

    Multidrug-resistant (MDR) Mycobacterium tuberculosis complex (MTBC) strains represent a major threat for tuberculosis (TB) control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR) variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS) to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A) and nine (Patient B) polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and molecular drug

  18. Virulent Mycobacterium bovis Beijing Strain Activates the NLRP7 Inflammasome in THP-1 Macrophages

    PubMed Central

    Zhou, Yang; Shah, Syed Zahid Ali; Yang, Lifeng; Zhang, Zhongqiu; Zhou, Xiangmei; Zhao, Deming

    2016-01-01

    Mycobacterium bovis is the causative agent of tuberculosis in a wide range of mammals, including humans. Macrophages are the first line of host defense. They secrete proinflammatory cytokines, such as interleukin-1 beta (IL-1β), in response to mycobacterial infection, but the underlying mechanisms by which human macrophages are activated and release IL-1β following M. bovis infection are poorly understood. Here we show that the ‘nucleotide binding and oligomerization of domain-like receptor (NLR) family pyrin domain containing 7 protein’ (NLRP7) inflammasome is involved in IL-1β secretion and caspase-1 activation induced by M. bovis infection in THP-1 macrophages. NLRP7 inflammasome activation promotes the induction of pyroptosis as well as the expression of tumor necrosis factor alpha (TNF-α), Chemokine (C-C motif) ligand 3 (CCL3) and IL-1β mRNAs. Thus, the NLRP7 inflammasome contributes to IL-1β secretion and induction of pyroptosis in response to M. bovis infection in THP-1 macrophages. PMID:27043315

  19. Strain variations in the murine cellular immune response to the phenolic glycolipid I antigen of Mycobacterium leprae.

    PubMed Central

    Koster, F T; Teuscher, C; Matzner, P; Umland, E; Yanagihara, D; Brennan, P J; Tung, K S

    1986-01-01

    The cellular immune response to the Mycobacterium leprae-specific phenolic glycolipid I was examined in inbred mice immunized with M. leprae by in vivo delayed cutaneous hypersensitivity and in vitro lymphocyte proliferation. Whereas all mouse strains responded to M.leprae-induced delayed-type hypersensitivity and lymphocyte proliferation, only BALB.K was responsive in both assays to the glycolipid. Responsiveness was determined in part by non-H-2 genes, while the influence of H-2 genes was not apparent. Among congenic BALB/c mice differing only at Igh-C allotype loci, variations in responsiveness were found in both delayed-type hypersensitivity and lymphocytes proliferation assays, indicating a possible role for Igh-C loci-linked genes. Unresponsiveness in the lymphocyte proliferation assay to the glycolipid was inherited as a dominant trait in one set of responder X nonresponder F1 progeny. We conclude that after immunization with M. leprae organisms, the cell-mediated responses to the glycolipid, endowed with a single carbohydrate epitope, are under polygenic control, predominantly non-H-2-linked genes. PMID:3510979

  20. Drug resistant strains of Mycobacterium tuberculosis identified through PCR-RFLP from patients of Central Punjab, Pakistan.

    PubMed

    Riaz, Muhammad; Mahmood, Zahed; Javed, Muhammad Tariq; Javed, Irum; Shahid, Muhammad; Abbas, Mazhar; Ehtisham-Ul-Haque, Syed

    2016-09-01

    The study was carried out to determine, by PCR-RFLP, the magnitude of drug resistance in Mycobacterium tuberculosis The study was carried out on 221 random sputum samples collected from patients and 120 suspected cases of drug resistance. Genetic variation in drug-resistant strains was evaluated through PCR-RFLP for isoniazid, ethambutol, streptomycin, and ofloxacin. Out of 341 patients, 91.5% were confirmed as M. tuberculosis complex infected on the basis of PCR. The random samples revealed resistance in 8.2% cases, while 73.3% of those with suspected drug resistance were found resistant. Among drug-resistant isolates, 56.1% were resistant to a single drug, 33.3% to two drugs, and 10.6% to more than two drugs. Ofloxacin resistance was observed along with isoniazid, ethambutol, and streptomycin in 6.5% cases. Resistance to isoniazid was observed in 61% cases, to ethambutol in 50.4%, and to streptomycin in 43.1% cases. It was concluded that PCR-RFLP is a useful molecular technique for the rapid detection of mutations in drug-resistant tuberculosis patients and may be used to diagnose drug resistance at the earliest. PMID:27069023

  1. Mechanisms of Phenotypic Rifampicin Tolerance in Mycobacterium tuberculosis Beijing Genotype Strain B0/W148 Revealed by Proteomics.

    PubMed

    de Keijzer, Jeroen; Mulder, Arnout; de Beer, Jessica; de Ru, Arnoud H; van Veelen, Peter A; van Soolingen, Dick

    2016-04-01

    The "successful" Russian clone B0/W148 of Mycobacterium tuberculosis Beijing is well-known for its capacity to develop antibiotic resistance. During treatment, resistant mutants can occur that have inheritable resistance to specific antibiotics. Next to mutations, M. tuberculosis has several mechanisms that increase their tolerance to a variety of antibiotics. Insights in the phenotypic mechanisms that contribute to drug tolerance will increase our understanding of how antibiotic resistance develops in M. tuberculosis. In this study, we examined the (phospho)proteome dynamics in M. tuberculosis Beijing strain B0/W148 when exposed to a high dose of rifampicin; one of the most potent first-line antibiotics. A total of 2,534 proteins and 191 phosphorylation sites were identified, and revealed the differential regulation of DosR regulon proteins, which are necessary for the development of a dormant phenotype that is less susceptible to antibiotics. By examining independent phenotypic markers of dormancy, we show that persisters of in vitro rifampicin exposure entered a metabolically hypoactive state, which yields rifampicin and other antibiotics largely ineffective. These new insights in the role of protein regulation and post-translational modifications during the initial phase of rifampicin treatment reveal a shortcoming in the antituberculosis regimen that is administered to 8-9 million individuals annually. PMID:26930559

  2. Whole genome analysis of an MDR Beijing/W strain of Mycobacterium tuberculosis with large genomic deletions associated with resistance to isoniazid.

    PubMed

    Zhang, Qiufen; Wan, Baoshan; Zhou, Aiping; Ni, Jinjing; Xu, Zhihong; Li, Shuxian; Tao, Jing; Yao, YuFeng

    2016-05-15

    Mycobacterium tuberculosis (M.tb) is one of the most prevalent bacterial pathogens in the world. With geographical wide spread and hypervirulence, Beijing/W family is the most successful M.tb lineage. China is a country of high tuberculosis (TB) and high multiple drug-resistant TB (MDR-TB) burden, and the Beijing/W family strains take the largest share of MDR strains. To study the genetic basis of Beijing/W family strains' virulence and drug resistance, we performed the whole genome sequencing of M.tb strain W146, a clinical Beijing/W genotype MDR isolated from Wuxi, Jiangsu province, China. Compared with genome sequence of M.tb strain H37Rv, we found that strain W146 lacks three large fragments and the missing of furA-katG operon confers isoniazid resistance. Besides the missing of furA-katG operon, strain W146 harbored almost all known drug resistance-associated mutations. Comparison analysis of single nucleotide polymorphisms (SNPs) and indels between strain W146 and Beijing/W genotype strains and non-Beijing/W genotype strains revealed that strain W146 possessed some unique mutations, which may be related to drug resistance, transmission and pathogenicity. These findings will help to understand the large sequence polymorphisms (LSPs) and the transmission and drug resistance related genetic characteristics of the Beijing/W genotype of M.tb. PMID:26854371

  3. Two markers, IS901-IS902 and p40, identified by PCR and by using monoclonal antibodies in Mycobacterium avium strains.

    PubMed Central

    Ahrens, P; Giese, S B; Klausen, J; Inglis, N F

    1995-01-01

    The occurrence of two markers, a newly identified 40-kDa protein (p40) and the insertion sequence IS901-IS902, in strains of Mycobacterium avium subspp. was evaluated. Analysis of 184 type and field strains of the M. avium complex from human, animal, and environmental sources by PCR specific to IS901 and by a monoclonal antibody specific to p40 demonstrated the presence of the two molecular markers in all of the M. avium subsp. silvaticum strains examined and also in a number of M. avium subsp. avium strains (the latter isolated mainly from pigs). The appearance of the two markers was completely concurrent in all strains. Further, the marker-positive M. avium subsp. avium strains were mainly serotype 2, whereas M. avium complex strains of serotypes 4, 6, 8, 9, and 10 were marker negative. The M. avium subsp. avium type strains ATCC 25291 and approximately 50% of the M. avium subsp. avium field strains isolated from animals contained the markers, while only one strain of human origin was found to be marker positive. Therefore, IS901 and p40 appear to have substantial potential to differentiate among isolates of the M. avium complex. This observation raises new issues regarding classification of strains, since the presence of the markers was found to be inconsistent with the present taxonomic grouping of M. avium subspp. PMID:7615703

  4. [Epidural abscess due to a Mycobacterium tuberculosis strain with primary resistance to isoniazid and ethambutol].

    PubMed

    Sener, Alper; Akçalı, Alper; Karatağ, Ozan; Koşar, Sule; Değirmenci, Yıldız; Akman, Tarık

    2012-10-01

    Tuberculosis is primarily characterized by pulmonary involvement, however, one third of the cases exhibit extrapulmonary tuberculosis. In this report, a case of epidural abscess due to Mycobacterium tuberculosis with primary resistance to isoniazid and ethambutol was presented. A 57-year-old male patient was admitted to emergency service with ten days history of weakness in legs, disability of walking and fever. Neurological examination revealed paraplegia of lower extremities, numbness distal to T2 disc level and hyperactivity of deep tendon reflexes indicating transverse myelitis. Laboratory findings were as follows; ESR: 74 mm/hour, CRP: 22 g/L, ALT: 42 IU/L, AST: 45 IU/L and white blood cell count 23.000/mm3 (45% polymorphonuclear leukocyte, 45% lymphocyte, 10% monocyte). Spinal magnetic resonance imaging showed a fusiform abscess localized at anterior epidural space and extending along levels of C5-6 and C6-7. The longitudinal dimension of the abscess was 3 cm. The lesion was hypointense on T1 and hyperintense on T2 weighted MRI images with prominent rim shaped contrast enhancement on contrast-enhanced T1-weighted images. At fourth day of hospitalization the patient underwent neurosurgical management. M.tuberculosis was isolated from the cultures of operation material by Mycobacteria Growth Incubator Tube system (MGIT, BBL; BD, USA) on the 12th day. The isolate was found susceptible to streptomycin and rifampisin, but resistant to isoniazid and ethambutol. The treatment was initiated with rifampicin 600 mg/day, pyrazinamid 2 g/day, ethambutol 1.5 g/day and levofloxacin 500 mg/day. At the end of second month levofloxacin 500 mg/day and rifampisin 600 mg/day combination was sustained and total treatment period was planned as nine months. As far as the national literature was considered, this was the first case of extrapulmonary tuberculosis with primary resistance to isoniazid and ethambutol. PMID:23188583

  5. Isolation and characterization of Mycobacterium bovis strains from indigenous Zambian cattle using Spacer oligonucleotide typing technique

    PubMed Central

    2009-01-01

    Background Bovine tuberculosis (BTB), caused by Mycobacterium bovis, has remained a major source of concern to public health officials in Zambia. Previous investigations have used traditional epidemiological methods that are unable to identify the causative agent and from which dynamics of disease dispersion is difficult to discern. The objective of this study was to isolate, characterize and determine the genetic diversity and relatedness of M. bovis from major cattle rearing districts in Zambia by spoligotyping. A total of 695 carcasses were examined and 98 tissues had gross post-mortem lesions compatible with BTB. Results Forty-two out of the ninety-eight suspected tissues examined had culture properties characteristic of mycobacteria from which 31 isolates yielded interpretable spoligotypes. This technique showed good discriminatory power (HGDI = 0.98), revealing 10 different spoligotype patterns. Twenty-seven isolates belonged to one cluster with more than 95% similarity and inside the cluster, one predominant spoligotype was found in 20 (64.5%) of the isolates tested. The highest number of spoligotypes was observed among samples from Namwala district. Spoligotypes from 26 (83.9%) of the isolates belonged to five spoligotypes that have been reported before while the remaining 5 (16.1%) isolates had unique spoligotypes that are being reported for the first time; these have been assigned numbers SB1763 to SB1767. Five of the 6 districts had the predominant spoligotype (SB0120). Conclusion The study has described the dispersion patterns of M. bovis in Zambian cattle for the first time and has identified 5 spoligotype patterns specific to Zambia. The observation of an overlap in the spoligotype pattern SB0120 in 5 of the 6 districts suggests the probability of sharing a common source of infection. PMID:19619309

  6. Molecular Epidemiology of Mycobacterium Tuberculosis Strains in the North-West and West of Iran

    PubMed Central

    Sahebi, L; Ansarin, K; Hoffner, S; Farajnia, S; Seyyedi, M; Khalili, M; Monfaredan, A

    2015-01-01

    Background: Identifying Mycobacterium tuberculosis (MTB) transmission type is a key step in the control of this disease. Aim: This study aimed to determine the path and transmission type of MTB and the insertion sequence IS6110 band number and verify their relationship to demographic and clinical risk factors. Subjects and Methods: In this cross-sectional study, 64 MTB patients from three border provinces of Iran were selected after full clinical history and physical evaluation design. The drug susceptibility testing was carried out using the standard proportion technique on sputum samples. Isolates tested with restriction fragment length polymorphism technique used IS6110. Results: Recent transmission of disease was 33/50 (66%) based on clustering rate. The IS6110 band number had a significant relationship with drug resistance detected in proportion method tested by univariate linear regression (P < 0.01). Furthermore, the IS6110 band number had association with Bacillus Calmette–Guérin vaccination history (P = 0.02), sex (P < 0.01), and purified protein derivative (PPD) reaction size (P < 0.01) tested by multiple analysis. The risk of recent transmission inferred from the clustering rate was significantly higher in patients from Western provinces compared to those from the North-West province (P = 0.048). However, age (P = 0.39), gender (P = 0.16), vaccination history (P = 0.57), drug susceptibility, and PPD (P < 0.6) were independent of clustering. The largest cluster of up to six subjects was found in the Western provinces. Conclusion: Recent MTB transmission was much more common in the West compared to the North-West of Iran. Large MTB clusters with strong epidemiological links may be reflective of a disease outbreak. Correlation noted between the IS6110 band number and vaccination history; PPD size and female gender necessitates further studies. PMID:26500790

  7. Biodegradation of methyl tert-butyl ether and other fuel oxygenates by a new strain, Mycobacterium austroafricanum IFP 2012.

    PubMed

    François, Alan; Mathis, Hugues; Godefroy, Davy; Piveteau, Pascal; Fayolle, Françoise; Monot, Frédéric

    2002-06-01

    A strain that efficiently degraded methyl tert-butyl ether (MTBE) was obtained by initial selection on the recalcitrant compound tert-butyl alcohol (TBA). This strain, a gram-positive methylotrophic bacterium identified as Mycobacterium austroafricanum IFP 2012, was also able to degrade tert-amyl methyl ether and tert-amyl alcohol. Ethyl tert-butyl ether was weakly degraded. tert-Butyl formate and 2-hydroxy isobutyrate (HIBA), two intermediates in the MTBE catabolism pathway, were detected during growth on MTBE. A positive effect of Co2+ during growth of M. austroafricanum IFP 2012 on HIBA was demonstrated. The specific rate of MTBE degradation was 0.6 mmol/h/g (dry weight) of cells, and the biomass yield on MTBE was 0.44 g (dry weight) per g of MTBE. MTBE, TBA, and HIBA degradation activities were induced by MTBE and TBA, and TBA was a good inducer. Involvement of at least one monooxygenase during degradation of MTBE and TBA was shown by (i) the requirement for oxygen, (ii) the production of propylene epoxide from propylene by MTBE- or TBA- grown cells, and (iii) the inhibition of MTBE or TBA degradation and of propylene epoxide production by acetylene. No cytochrome P-450 was detected in MTBE- or TBA-grown cells. Similar protein profiles were obtained after sodium dodecyl sulfate-polyacrylamide gel electrophoresis of crude extracts from MTBE- and TBA-grown cells. Among the polypeptides induced by these substrates, two polypeptides (66 and 27 kDa) exhibited strong similarities with known oxidoreductases. PMID:12039730

  8. Usefulness of IS6110-restriction fragment length polymorphism typing of Brazilian strains of Mycobacterium tuberculosis and comparison with an international fingerprint database.

    PubMed

    Suffys, P N; Ivens de Araujo, M E; Rossetti, M L; Zahab, A; Barroso, E W; Barreto, A M; Campos, E; van Soolingen, D; Kremer, K; Heersma, H; Degrave, W M

    2000-06-01

    Strains of Mycobacterium tuberculosis isolated from 219 different tuberculosis patients, 115 from patients residing in Rio de Janeiro, 79 from Rio Grande do Sul and the remaining from other regions of the country, were analyzed by IS6110-restriction fragment length polymorphism fingerprinting. The IS6110-DNA patterns from these strains were highly polymorphic: 174 different patterns were observed and 25 patterns were shared by 70 isolates (32%). Most strains (93.4%) had multicopy patterns and only 17% of clustered strains had less than six IS6110 copies. Strain clustering was significantly higher for isolates from Rio Grande do Sul (36.7%) in comparison with strains from Rio de Janeiro (22.6%), but only when using high stringency during cluster analysis. Upon screening of an international database containing 3,970 fingerprints of M. tuberculosis strains, 15% of the patterns of Brazilian strains (21% of the strains) were identical to a fingerprint of an isolate from another country and one particular eight-band pattern forming the largest Brazilian cluster was detected in seven additional countries, suggesting that international transmission of tuberculosis from and to Brazil could be occurring frequently. Alternatively,preferential use of certain IS6110 integration sites could also be important in high-copy number strains, having important consequences for the use of databases for epidemiological studies on a large scale. PMID:10919514

  9. Spatio-Temporal Distribution of Mycobacterium tuberculosis Complex Strains in Ghana

    PubMed Central

    Asare, P.; Asante-Poku, A.; Otchere, I. D.; Osei-Wusu, S.; Danso, E.; Forson, A.; Koram, K. A.; Gagneux, Sebastien

    2016-01-01

    Background There is a perception that genomic differences in the species/lineages of the nine species making the Mycobacterium tuberculosis complex (MTBC) may affect the efficacy of distinct control tools in certain geographical areas. We therefore analyzed the prevalence and spatial distribution of MTBC species and lineages among isolates from pulmonary TB cases over an 8-year period, 2007–2014. Methodology Mycobacterial species isolated by culture from consecutively recruited pulmonary tuberculosis patients presenting at selected district/sub-district health facilities were confirmed as MTBC by IS6110 and rpoß PCR and further assigned lineages and sub lineages by spoligotyping and large sequence polymorphism PCR (RDs 4, 9, 12, 702, 711) assays. Patient characteristics, residency, and risks were obtained with a structured questionnaire. We used SaTScan and ArcMap analyses to identify significantly clustered MTBC lineages within selected districts and spatial display, respectively. Results Among 2,551 isolates, 2,019 (79.1%), 516 (20.2%) and 16 (0.6%) were identified as M. tuberculosis sensu stricto (MTBss), M. africanum (Maf), 15 M. bovis and 1 M. caprae, respectively. The proportions of MTBss and Maf were fairly constant within the study period. Maf spoligotypes were dominated by Spoligotype International Type (SIT) 331 (25.42%), SIT 326 (15.25%) and SIT 181 (14.12%). We found M. bovis to be significantly higher in Northern Ghana (1.9% of 212) than Southern Ghana (0.5% of 2339) (p = 0.020). Using the purely spatial and space-time analysis, seven significant MTBC lineage clusters (p< 0.05) were identified. Notable among the clusters were Ghana and Cameroon sub-lineages found to be associated with north and south, respectively. Conclusion This study demonstrated that overall, 79.1% of TB in Ghana is caused by MTBss and 20% by M. africanum. Unlike some West African Countries, we did not observe a decline of Maf prevalence in Ghana. PMID:27564240

  10. Partial characterization of a major autolysin from Mycobacterium phlei.

    PubMed

    Li, Z S; Beveridge, T J; Betts, J; Clarke, A J

    1999-01-01

    Autolytic enzyme profiles of fast- and slow-growing mycobacteria were examined using SDS-PAGE zymography with incorporated mycobacterial peptidoglycan sacculi as substrate. Each species tested (Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium aurum, Mycobacterium fortuitum and Mycobacterium kansasii) appeared to produce a different set of enzymes on the basis of differing number and molecular masses. A major autolysin from M. phlei was purified to apparent homogeneity by DEAE-cellulose chromatography, preparative gel electrophoresis and Mono Q FPLC. This enzyme had an estimated molecular mass of 38 kDa, an isoelectric point of 5.5 and a pH optimum of pH 7.5. Digestion of purified peptidoglycan by the enzyme resulted in the appearance of reducing sugars, suggesting that the 38 kDa autolysin is a beta-glycosidase. Partial internal amino acid sequence of the autolysin was determined and should facilitate identification, cloning and overexpression of the encoding gene. PMID:10206696

  11. Draft Genome Sequences of Six Mycobacterium immunogenum, Strains Obtained from a Chloraminated Drinking Water Distribution System Simulator

    EPA Science Inventory

    We report the draft genome sequences of six Mycobacterium immunogenum isolated from a chloraminated drinking water distribution system simulator subjected to changes in operational parameters. M. immunogenum, a rapidly growing mycobacteria previously reported as the cause of hyp...

  12. Human Genetic Ancestral Composition Correlates with the Origin of Mycobacterium leprae Strains in a Leprosy Endemic Population

    PubMed Central

    Cardona-Castro, Nora; Cortés, Edwin; Beltrán, Camilo; Romero, Marcela; Badel-Mogollón, Jaime E.; Bedoya, Gabriel

    2015-01-01

    Recent reports have suggested that leprosy originated in Africa, extended to Asia and Europe, and arrived in the Americas during European colonization and the African slave trade. Due to colonization, the contemporary Colombian population is an admixture of Native-American, European and African ancestries. Because microorganisms are known to accompany humans during migrations, patterns of human migration can be traced by examining genomic changes in associated microbes. The current study analyzed 118 leprosy cases and 116 unrelated controls from two Colombian regions endemic for leprosy (Atlantic and Andean) in order to determine possible associations of leprosy with patient ancestral background (determined using 36 ancestry informative markers), Mycobacterium leprae genotype and/or patient geographical origin. We found significant differences between ancestral genetic composition. European components were predominant in Andean populations. In contrast, African components were higher in the Atlantic region. M. leprae genotypes were then analyzed for cluster associations and compared with the ancestral composition of leprosy patients. Two M. leprae principal clusters were found: haplotypes C54 and T45. Haplotype C54 associated with African origin and was more frequent in patients from the Atlantic region with a high African component. In contrast, haplotype T45 associated with European origin and was more frequent in Andean patients with a higher European component. These results suggest that the human and M. leprae genomes have co-existed since the African and European origins of the disease, with leprosy ultimately arriving in Colombia during colonization. Distinct M. leprae strains followed European and African settlement in the country and can be detected in contemporary Colombian populations. PMID:26360617

  13. Human Genetic Ancestral Composition Correlates with the Origin of Mycobacterium leprae Strains in a Leprosy Endemic Population.

    PubMed

    Cardona-Castro, Nora; Cortés, Edwin; Beltrán, Camilo; Romero, Marcela; Badel-Mogollón, Jaime E; Bedoya, Gabriel

    2015-01-01

    Recent reports have suggested that leprosy originated in Africa, extended to Asia and Europe, and arrived in the Americas during European colonization and the African slave trade. Due to colonization, the contemporary Colombian population is an admixture of Native-American, European and African ancestries. Because microorganisms are known to accompany humans during migrations, patterns of human migration can be traced by examining genomic changes in associated microbes. The current study analyzed 118 leprosy cases and 116 unrelated controls from two Colombian regions endemic for leprosy (Atlantic and Andean) in order to determine possible associations of leprosy with patient ancestral background (determined using 36 ancestry informative markers), Mycobacterium leprae genotype and/or patient geographical origin. We found significant differences between ancestral genetic composition. European components were predominant in Andean populations. In contrast, African components were higher in the Atlantic region. M. leprae genotypes were then analyzed for cluster associations and compared with the ancestral composition of leprosy patients. Two M. leprae principal clusters were found: haplotypes C54 and T45. Haplotype C54 associated with African origin and was more frequent in patients from the Atlantic region with a high African component. In contrast, haplotype T45 associated with European origin and was more frequent in Andean patients with a higher European component. These results suggest that the human and M. leprae genomes have co-existed since the African and European origins of the disease, with leprosy ultimately arriving in Colombia during colonization. Distinct M. leprae strains followed European and African settlement in the country and can be detected in contemporary Colombian populations. PMID:26360617

  14. Necrosis of lung epithelial cells during infection with Mycobacterium tuberculosis is preceded by cell permeation.

    PubMed

    Dobos, K M; Spotts, E A; Quinn, F D; King, C H

    2000-11-01

    Mycobacterium tuberculosis establishes infection, progresses towards disease, and is transmitted from the alveolus of the lung. However, the role of the alveolar epithelium in any of these pathogenic processes of tuberculosis is unclear. In this study, lung epithelial cells (A549) were used as a model in which to examine cytotoxicity during infection with either virulent or avirulent mycobacteria in order to further establish the role of the lung epithelium during tuberculosis. Infection of A549 cells with M. tuberculosis strains Erdman and CDC1551 demonstrated significant cell monolayer clearing, whereas infection with either Mycobacterium bovis BCG or Mycobacterium smegmatis LR222 did not. Clearing of M. tuberculosis-infected A549 cells correlated to necrosis, not apoptosis. Treatment of M. tuberculosis-infected A549 cells with streptomycin, but not cycloheximide, demonstrated a significant reduction in the necrosis of A549 cell monolayers. This mycobacterium-induced A549 necrosis did not correlate to higher levels of intracellular or extracellular growth by the mycobacteria during infection. Staining of infected cells with propidium iodide demonstrated that M. tuberculosis induced increased permeation of A549 cell membranes within 24 h postinfection. Quantitation of lactate dehydrogenase (LDH) release from infected cells further demonstrated that cell permeation was specific to M. tuberculosis infection and correlated to A549 cellular necrosis. Inactivated M. tuberculosis or its subcellular fractions did not result in A549 necrosis or LDH release. These studies demonstrate that lung epithelial cell cytotoxicity is specific to infection by virulent mycobacteria and is caused by cellular necrosis. This necrosis is not a direct correlate of mycobacterial growth or of the expression of host cell factors, but is preceded by permeation of the A549 cell membrane and requires infection with live bacilli. PMID:11035739

  15. Thiopurine drugs azathioprine and 6-mercaptopurine inhibit Mycobacterium paratuberculosis growth in vitro.

    PubMed

    Shin, Sung Jae; Collins, Michael T

    2008-02-01

    The in vitro susceptibility of human- and bovine-origin Mycobacterium paratuberculosis to the thioupurine drugs 6-mercaptopurine (6-MP) and azathioprine (AZA) was established using conventional plate counting methods and the MGIT 960 ParaTB culture system. Both 6-MP and AZA had antibacterial activity against M. paratuberculosis; isolates from Crohn's disease patients tended to be more susceptible than were bovine-origin isolates. Isolates of Mycobacterium avium, used as controls, were generally resistant to both AZA and 6-MP, even at high concentrations (> or =64.0 microg/ml). Among rapidly growing mycobacteria, Mycobacterium phlei was susceptible to 6-MP and AZA whereas Mycobacterium smegmatis strains were not. AZA and 6-MP limited the growth of, but did not kill, M. paratuberculosis in a dose-dependent manner. Anti-inflammatory drugs in the sulfonamide family (sulfapyridine, sulfasalazine, and 5-aminosalycilic acid [mesalamine]) had little or no antibacterial activity against M. paratuberculosis. The conventional antibiotics azithromycin and ciprofloxacin, used as control drugs, were bactericidal for M. paratuberculosis, exerting their killing effects on the organism relatively quickly. Simultaneous exposure of M. paratuberculosis to 6-MP and ciprofloxacin resulted in significantly higher CFU than use of ciprofloxacin alone. These data may partially explain the paradoxical response of Crohn's disease patients infected with M. paratuberculosis to treatment with immunosuppressive thiopurine drugs, i.e., they do not worsen with anti-inflammatory treatment as would be expected with a microbiological etiologic pathogen. These findings also should influence the design of therapeutic trials to evaluate antibiotic treatments of Crohn's disease: AZA drugs may confound interpretation of data on therapeutic responses for both antibiotic-treated and control groups. PMID:18070971

  16. Persistent Infection by a Mycobacterium tuberculosis Strain That Was Theorized To Have Advantageous Properties, as It Was Responsible for a Massive Outbreak.

    PubMed

    Pérez-Lago, Laura; Navarro, Yurena; Montilla, Pedro; Comas, Iñaki; Herranz, Marta; Rodríguez-Gallego, Carlos; Ruiz Serrano, María Jesús; Bouza, Emilio; García de Viedma, Darío

    2015-11-01

    The strains involved in tuberculosis outbreaks are considered highly virulent and transmissible. We analyzed the case of a patient in Madrid, Spain, who was persistently infected over an 8-year period by the same Beijing Mycobacterium tuberculosis strain. The strain was responsible for a severe outbreak on Gran Canaria Island. The case provides us with a unique opportunity to challenge our assumptions about M. tuberculosis Beijing strains. No clinical/radiological findings consistent with a virulent strain were documented, and the in vitro growth rate of the strain in macrophages was only moderate. No secondary cases stemming from this prolonged active case were detected in the host population. The strain did not acquire resistance mutations, despite constant treatment interruptions, and it remained extremely stable, as demonstrated by the lack of single-nucleotide-polymorphism (SNP)-based differences between the sequential isolates. Our data suggest that the general assumption about M. tuberculosis Beijing strains having advantageous properties (in terms of virulence, transmissibility, and the tendency to acquire mutations and resistance) is not always accurate. PMID:26269618

  17. Persistent Infection by a Mycobacterium tuberculosis Strain That Was Theorized To Have Advantageous Properties, as It Was Responsible for a Massive Outbreak

    PubMed Central

    Pérez-Lago, Laura; Navarro, Yurena; Montilla, Pedro; Comas, Iñaki; Herranz, Marta; Rodríguez-Gallego, Carlos; Ruiz Serrano, María Jesús; Bouza, Emilio

    2015-01-01

    The strains involved in tuberculosis outbreaks are considered highly virulent and transmissible. We analyzed the case of a patient in Madrid, Spain, who was persistently infected over an 8-year period by the same Beijing Mycobacterium tuberculosis strain. The strain was responsible for a severe outbreak on Gran Canaria Island. The case provides us with a unique opportunity to challenge our assumptions about M. tuberculosis Beijing strains. No clinical/radiological findings consistent with a virulent strain were documented, and the in vitro growth rate of the strain in macrophages was only moderate. No secondary cases stemming from this prolonged active case were detected in the host population. The strain did not acquire resistance mutations, despite constant treatment interruptions, and it remained extremely stable, as demonstrated by the lack of single-nucleotide-polymorphism (SNP)-based differences between the sequential isolates. Our data suggest that the general assumption about M. tuberculosis Beijing strains having advantageous properties (in terms of virulence, transmissibility, and the tendency to acquire mutations and resistance) is not always accurate. PMID:26269618

  18. Rapid film-based determination of antibiotic susceptibilities of Mycobacterium tuberculosis strains by using a luciferase reporter phage and the Bronx Box.

    PubMed

    Riska, P F; Su, Y; Bardarov, S; Freundlich, L; Sarkis, G; Hatfull, G; Carrière, C; Kumar, V; Chan, J; Jacobs, W R

    1999-04-01

    Detecting antibiotic resistance in Mycobacterium tuberculosis is becoming increasingly important with the global recognition of drug-resistant strains and their adverse impact on clinical outcomes. Current methods of susceptibility testing are either time-consuming or costly; rapid, reliable, simple, and inexpensive methods would be highly desirable, especially in the developing world where most tuberculosis is found. The luciferase reporter phage is a unique reagent well-suited for this purpose: upon infection with viable mycobacteria, it produces quantifiable light which is not observed in mycobacterial cells treated with active antimicrobials. In this report, we describe a modification of our original assay, which allows detection of the emitted light with a Polaroid film box designated the Bronx Box. The technique has been applied to 25 M. tuberculosis reference and clinical strains, and criteria are presented which allow rapid and simple discrimination among strains susceptible or resistant to isoniazid and rifampin, the major antituberculosis agents. PMID:10074539

  19. Analysis of monolayer formation of α-mycolic acid derived from Mycobacterium bovis BCG pasteur strain by infrared reflection-absorption spectrometry with two-dimensional correlation analysis

    NASA Astrophysics Data System (ADS)

    Hasegawa, T.; Nishijo, J.; Umemura, J.; Watanabe, M.

    2000-03-01

    Monolayer formation mechanism of α-mycolic acid (α-MA) isolated from Mycobacterium bovis BCG Pasteur strain was investigated by infrared reflection-absorption (IRRA) spectrometry with two-dimensional (2D) correlation analysis. The raw IRRA spectra did not characterize the precise feature of the MA monolayer. 2D correlation analysis, however, clearly revealed that the longer or the major chain of the MA stood up earlier than the shorter chain or the α-alkyl group when the monolayer was compressed, and that the upright chains were in the form of ordered conformation.

  20. Virulence and Immune Response Induced by Mycobacterium avium Complex Strains in a Model of Progressive Pulmonary Tuberculosis and Subcutaneous Infection in BALB/c Mice

    PubMed Central

    González-Pérez, Mónica; Mariño-Ramírez, Leonardo; Parra-López, Carlos Alberto; Murcia, Martha Isabel; Marquina, Brenda; Mata-Espinoza, Dulce; Rodriguez-Míguez, Yadira; Baay-Guzman, Guillermina J.; Huerta-Yepez, Sara

    2013-01-01

    The genus Mycobacterium comprises more than 150 species, including important pathogens for humans which cause major public health problems. The vast majority of efforts to understand the genus have been addressed in studies with Mycobacterium tuberculosis. The biological differentiation between M. tuberculosis and nontuberculous mycobacteria (NTM) is important because there are distinctions in the sources of infection, treatments, and the course of disease. Likewise, the importance of studying NTM is not only due to its clinical significance but also due to the mechanisms by which some species are pathogenic while others are not. Mycobacterium avium complex (MAC) is the most important group of NTM opportunistic pathogens, since it is the second largest medical complex in the genus after the M. tuberculosis complex. Here, we evaluated the virulence and immune response of M. avium subsp. avium and Mycobacterium colombiense, using experimental models of progressive pulmonary tuberculosis and subcutaneous infection in BALB/c mice. Mice infected intratracheally with a high dose of MAC strains showed high expression of tumor necrosis factor alpha (TNF-α) and inducible nitric oxide synthase with rapid bacillus elimination and numerous granulomas, but without lung consolidation during late infection in coexistence with high expression of anti-inflammatory cytokines. In contrast, subcutaneous infection showed high production of the proinflammatory cytokines TNF-α and gamma interferon with relatively low production of anti-inflammatory cytokines such as interleukin-10 (IL-10) or IL-4, which efficiently eliminate the bacilli but maintain extensive inflammation and fibrosis. Thus, MAC infection evokes different immune and inflammatory responses depending on the MAC species and affected tissue. PMID:23959717

  1. Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis

    SciTech Connect

    Molle, Virginie; Gulten, Gulcin; Vilchèze, Catherine; Veyron-Churlet, Romain; Zanella-Cléon, Isabelle; Sacchettini, James C.; Jacobs, Jr, William R.; Kremer, Laurent

    2011-08-24

    The remarkable survival ability of Mycobacterium tuberculosis in infected hosts is related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate expression of these lipids in response to environmental changes are unknown. Here we demonstrate that the enoyl-ACP reductase activity of InhA, an essential enzyme of the mycolic acid biosynthetic pathway and the primary target of the anti-tubercular drug isoniazid, is controlled via phosphorylation. Thr-266 is the unique kinase phosphoacceptor, both in vitro and in vivo. The physiological relevance of Thr-266 phosphorylation was demonstrated using inhA phosphoablative (T266A) or phosphomimetic (T266D/E) mutants. Enoyl reductase activity was severely impaired in the mimetic mutants in vitro, as a consequence of a reduced binding affinity to NADH. Importantly, introduction of inhA{_}T266D/E failed to complement growth and mycolic acid defects of an inhA-thermosensitive Mycobacterium smegmatis strain, in a similar manner to what is observed following isoniazid treatment. This study suggests that phosphorylation of InhA may represent an unusual mechanism that allows M. tuberculosis to regulate its mycolic acid content, thus offering a new approach to future anti-tuberculosis drug development.

  2. MspA-Mycobacterium tuberculosis-transformant with reduced virulence: the "unbirthday paradigm".

    PubMed

    Lamrabet, Otmane; Ghigo, Eric; Mège, Jean-Louis; Lepidi, Hubert; Nappez, Claude; Raoult, Didier; Drancourt, Michel

    2014-11-01

    Expressing mspA porin gene from Mycobacterium smegmatis in Mycobacterium tuberculosis attenuated this pathogen. Intracellular growth of the transformants into free-living amoeba and murine and human macrophages decreased. Furthermore, transformants decreased the microbicidal program of human monocyte-derived macrophages. BALB/c mice inoculated with transformants exhibited higher weights, lower histological lesions and lower M. tuberculosis inoculum in the liver, spleen and lungs than control mice challenged with wild-type M. tuberculosis. Preliminary evaluation indicated that mice inoculated with this transformant showed higher weights and lower numbers of lung nodules and tissular mycobacteria than control mice when challenged with wild-type M. tuberculosis. Similar to the paradoxical "unbirthday" gift coined by Lewis Carroll in Alice's Adventures in Wonderland, adding mspA gene reduced the virulence of M. tuberculosis and yielded a protective effect. Lost of non-virulence genes is a mechanism for virulence in mycobacteria. Engineering non-virulence genes in M. tuberculosis may yield strains with decreased virulence and increased immunogenicity. PMID:25194334

  3. Variation in Gamma Interferon Responses to Different Infecting Strains of Mycobacterium tuberculosis in Acid-Fast Bacillus Smear-Positive Patients and Household Contacts in Antananarivo, Madagascar▿

    PubMed Central

    Rakotosamimanana, Niaina; Raharimanga, Vaomalala; Andriamandimby, Soa Fy; Soares, Jean-Louis; Doherty, T. Mark; Ratsitorahina, Maherisoa; Ramarokoto, Herimanana; Zumla, Alimuddin; Huggett, Jim; Rook, Graham; Richard, Vincent; Gicquel, Brigitte; Rasolofo-Razanamparany, Voahangy

    2010-01-01

    The majority of healthy individuals exposed to Mycobacterium tuberculosis will not develop tuberculosis (TB), though many may become latently infected. More precise measurement of the human immune response to M. tuberculosis infection may help us understand this difference and potentially identify those subjects most at risk of developing active disease. Gamma interferon (IFN-γ) production has been widely used as a proxy marker to study infection and to examine the human immune response to specific M. tuberculosis antigens. It has been suggested that genetically distinct M. tuberculosis strains may invoke different immune responses, although how these differences influence the immune responses and clinical outcome in human tuberculosis is still poorly understood. We therefore evaluated the antigen-specific IFN-γ production responses in peripheral blood mononuclear cells from two cohorts of subjects recruited in Antananarivo, Madagascar, from 2004 to 2006 and examined the influence of the infecting M. tuberculosis strains on this response. The cohorts were sputum-positive index cases and their household contacts. Clinical strains isolated from the TB patients were typed by spoligotyping. Comparison of the IFN-γ responses with the spoligotype of the infecting clinical strains showed that “modern” M. tuberculosis strains, like Beijing and Central Asian (CAS) strains, tended to induce lower IFN-γ responses than “ancient” strains, like East African-Indian (EAI) strains, in index cases and their household contacts. These results suggest that new strains may have evolved to induce a host response different from that of ancient strains. These findings could have important implications in the development of therapeutic and diagnostic strategies. PMID:20463103

  4. Immunological and Molecular Characterization of Susceptibility in Relationship to Bacterial Strain Differences in Mycobacterium avium subsp. paratuberculosis Infection in the Red Deer (Cervus elaphus)

    PubMed Central

    O'Brien, R.; Mackintosh, C. G.; Bakker, D.; Kopecna, M.; Pavlik, I.; Griffin, J. F. T.

    2006-01-01

    Johne's disease (JD) infection, caused by Mycobacterium avium subsp. paratuberculosis, represents a major disease problem in farmed ruminants. Although JD has been well characterized in cattle and sheep, little is known of the infection dynamics or immunological response in deer. In this study, typing of M. avium subsp. paratuberculosis isolates from intestinal lymphatic tissues from 74 JD-infected animals showed that clinical isolates of M. avium subsp. paratuberculosis from New Zealand farmed red deer were exclusively of the bovine strain genotype. The susceptibility of deer to M. avium subsp. paratuberculosis was further investigated by experimental oral-route infection studies using defined isolates of virulent bovine and ovine M. avium subsp. paratuberculosis strains. Oral inoculation with high (109 CFU/animal) or medium (107 CFU/animal) doses of the bovine strain of M. avium subsp. paratuberculosis established 100% infection rates, compared to 69% infection following inoculation with a medium dose of the ovine strain. The high susceptibility of deer to the bovine strain of M. avium subsp. paratuberculosis was confirmed by a 50% infection rate following experimental inoculation with a low dose of bacteria (103 CFU/animal). This study is the first to report experimental M. avium subsp. paratuberculosis infection in red deer, and it outlines the strong infectivity of bovine-strain M. avium subsp. paratuberculosis isolates for cervines. PMID:16714585

  5. Reconstitution of Protein Translation of Mycobacterium Reveals Functional Conservation and Divergence with the Gram-Negative Bacterium Escherichia coli

    PubMed Central

    Srivastava, Aashish; Asahara, Haruichi; Zhang, Meng; Zhang, Weijia; Liu, Haiying; Cui, Sheng; Jin, Qi; Chong, Shaorong

    2016-01-01

    Protein translation is essential for all bacteria pathogens. It has also been a major focus of structural and functional studies and an important target of antibiotics. Here we report our attempts to biochemically reconstitute mycobacterial protein translation in vitro from purified components. This mycobacterial translation system consists of individually purified recombinant translation factors from Mycobacterium tuberculosis (M. tuberculosis), purified tRNAs and ribosomes from Mycobacterium smegmatis (M. smegmatis), and an aminoacyl-tRNA synthetase (AARS) mixture from the cell-extract of M. smegmatis. We demonstrate that such mycobacterial translation system was efficient in in vitro protein synthesis, and enabled functional comparisons of translational components between the gram-positive Mycobacterium and the gram-negative E. coli. Although mycobacterial translation factors and ribosomes were highly compatible with their E. coli counterparts, M. smegmatis tRNAs were not properly charged by the E. coli AARSs to allow efficient translation of a reporter. In contrast, both E. coli and M. smegmatis tRNAs exhibited similar activity with the semi-purified M. smegmatis AARSs mixture for in vitro translation. We further demonstrated the use of both mycobacterial and E. coli translation systems as comparative in vitro assays for small-molecule antibiotics that target protein translation. While mycobacterial and E. coli translation were both inhibited at the same IC50 by the antibiotic spectinomycin, mycobacterial translation was preferentially inhibited by the antibiotic tetracycline, suggesting that there may be structural differences at the antibiotic binding sites between the ribosomes of Mycobacterium and E. coli. Our results illustrate an alternative approach for antibiotic discovery and functional studies of protein translation in mycobacteria and possibly other bacterial pathogens. PMID:27564552

  6. Reconstitution of Protein Translation of Mycobacterium Reveals Functional Conservation and Divergence with the Gram-Negative Bacterium Escherichia coli.

    PubMed

    Srivastava, Aashish; Asahara, Haruichi; Zhang, Meng; Zhang, Weijia; Liu, Haiying; Cui, Sheng; Jin, Qi; Chong, Shaorong

    2016-01-01

    Protein translation is essential for all bacteria pathogens. It has also been a major focus of structural and functional studies and an important target of antibiotics. Here we report our attempts to biochemically reconstitute mycobacterial protein translation in vitro from purified components. This mycobacterial translation system consists of individually purified recombinant translation factors from Mycobacterium tuberculosis (M. tuberculosis), purified tRNAs and ribosomes from Mycobacterium smegmatis (M. smegmatis), and an aminoacyl-tRNA synthetase (AARS) mixture from the cell-extract of M. smegmatis. We demonstrate that such mycobacterial translation system was efficient in in vitro protein synthesis, and enabled functional comparisons of translational components between the gram-positive Mycobacterium and the gram-negative E. coli. Although mycobacterial translation factors and ribosomes were highly compatible with their E. coli counterparts, M. smegmatis tRNAs were not properly charged by the E. coli AARSs to allow efficient translation of a reporter. In contrast, both E. coli and M. smegmatis tRNAs exhibited similar activity with the semi-purified M. smegmatis AARSs mixture for in vitro translation. We further demonstrated the use of both mycobacterial and E. coli translation systems as comparative in vitro assays for small-molecule antibiotics that target protein translation. While mycobacterial and E. coli translation were both inhibited at the same IC50 by the antibiotic spectinomycin, mycobacterial translation was preferentially inhibited by the antibiotic tetracycline, suggesting that there may be structural differences at the antibiotic binding sites between the ribosomes of Mycobacterium and E. coli. Our results illustrate an alternative approach for antibiotic discovery and functional studies of protein translation in mycobacteria and possibly other bacterial pathogens. PMID:27564552

  7. Induction of Unconventional T Cells by a Mutant Mycobacterium bovis BCG Strain Formulated in Cationic Liposomes Correlates with Protection against Mycobacterium tuberculosis Infections of Immunocompromised Mice.

    PubMed

    Derrick, Steven C; Yabe, Idalia; Morris, Sheldon; Cowley, Siobhan

    2016-07-01

    Earlier studies aimed at defining protective immunity induced by Mycobacterium bovis BCG immunization have largely focused on the induction of antituberculosis CD4(+) and CD8(+) T cell responses. Here we describe a vaccine consisting of a BCGΔmmaA4 deletion mutant formulated in dimethyl dioctadecyl-ammonium bromide (DDA) with d-(+)-trehalose 6,6'-dibehenate (TDB) (DDA/TDB) adjuvant (A4/Adj) that protected TCRδ(-/-) mice depleted of CD4(+), CD8(+), and NK1.1(+) T cells against an aerosol challenge with M. tuberculosis These mice were significantly protected relative to mice immunized with a nonadjuvanted BCGΔmmaA4 (BCG-A4) mutant and nonvaccinated controls at 2 months and 9 months postvaccination. In the absence of all T cells following treatment with anti-Thy1.2 antibody, the immunized mice lost the ability to control the infection. These results indicate that an unconventional T cell population was mediating protection in the absence of CD4(+), CD8(+), NK1.1(+), and TCRγδ T cells and could exhibit memory. Focusing on CD4(-) CD8(-) double-negative (DN) T cells, we found that these cells accumulated in the lungs postchallenge significantly more in A4/Adj-immunized mice and induced significantly greater frequencies of pulmonary gamma interferon (IFN-γ)-producing cells than were seen in the nonvaccinated or nonadjuvanted BCG control groups. Moreover, pulmonary DN T cells from the A4/Adj group exhibited significantly higher IFN-γ integrated median fluorescence intensity (iMFI) values than were seen in the control groups. We also showed that enriched DN T cells from mice immunized with A4/Adj could control mycobacterial growth in vitro significantly better than naive whole-spleen cells. These results suggest that formulating BCG in DDA/TDB adjuvant confers superior protection in immunocompromised mice and likely involves the induction of long-lived memory DN T cells. PMID:27226281

  8. Proteome and Differential Expression Analysis of Membrane and Cytosolic Proteins from Mycobacterium avium subsp. paratuberculosis Strains K-10 and 187▿†

    PubMed Central

    Radosevich, Thomas J.; Reinhardt, Timothy A.; Lippolis, John D.; Bannantine, John P.; Stabel, Judith R.

    2007-01-01

    Little is known of protein expression in Mycobacterium avium subsp. paratuberculosis and how this contributes to pathogenesis. In the present study, proteins from both membranes and cytosol were prepared from two strains of M. avium subsp. paratuberculosis, i.e., laboratory-adapted strain K-10 and a recent isolate, strain 187, obtained from a cow exhibiting clinical signs of Johne's disease. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of cytosol and membrane proteins from K-10 and 187 showed marked differences in protein expression. Relative levels of protein expression from both M. avium subsp. paratuberculosis strains were measured by using amine-reactive isobaric tagging reagents (iTRAQ) and tandem mass spectroscopy. Protein identification and relative expression data were obtained for 874 membrane and cytosolic proteins from the M. avium subsp. paratuberculosis proteome. These data showed a number of significant differences in protein expression between strain K-10 and clinical isolate 187. Examples of proteins expressed at higher levels in clinical isolate 187 compared to strain K-10 are AtpC, RpoA, and several proteins involved in fatty acid biosynthesis. In contrast, proteins such as AhpC and several proteins involved in nitrogen metabolism were expressed at higher levels in strain K-10 compared to strain 187. These data may provide insights into the proteins whose expression is important in natural infection but are modified once M. avium subsp. paratuberculosis is adapted to laboratory cultivation. Results from these studies will provide tools for developing a better understanding of M. avium subsp. paratuberculosis infection in the host and offer potential as diagnostic reagents and vaccine candidates. PMID:17142399

  9. Comparative Genomics and Proteomic Analysis of Four Non-tuberculous Mycobacterium Species and Mycobacterium tuberculosis Complex: Occurrence of Shared Immunogenic Proteins

    PubMed Central

    Gcebe, Nomakorinte; Michel, Anita; Gey van Pittius, Nicolaas C.; Rutten, Victor

    2016-01-01

    The Esx and PE/PPE families of proteins are among the most immunodominant mycobacterial antigens and have thus been the focus of research to develop vaccines and immunological tests for diagnosis of bovine and human tuberculosis, mainly caused by Mycobacterium bovis and Mycobacterium tuberculosis, respectively. In non-tuberculous mycobacteria (NTM), multiple copies of genes encoding homologous proteins have mainly been identified in pathogenic Mycobacterium species phylogenically related to Mycobacterium tuberculosis and Mycobacterium bovis. Only ancestral copies of these genes have been identified in nonpathogenic NTM species like Mycobacterium smegmatis, Mycobacterium sp. KMS, Mycobacterium sp. MCS, and Mycobacterium sp. JLS. In this study we elucidated the genomes of four nonpathogenic NTM species, viz Mycobacterium komanii sp. nov., Mycobacterium malmesburii sp. nov., Mycobacterium nonchromogenicum, and Mycobacterium fortuitum ATCC 6841. These genomes were investigated for genes encoding for the Esx and PE/PPE (situated in the esx cluster) family of proteins as well as adjacent genes situated in the ESX-1 to ESX-5 regions. To identify proteins actually expressed, comparative proteomic analyses of purified protein derivatives from three of the NTM as well as Mycobacterium kansasii ATCC 12478 and the commercially available purified protein derivatives from Mycobacterium bovis and Mycobacterium avium was performed. The genomic analysis revealed the occurrence in each of the four NTM, orthologs of the genes encoding for the Esx family, the PE and PPE family proteins in M. bovis and M. tuberculosis. The identification of genes of the ESX-1, ESX-3, and ESX-4 region including esxA, esxB, ppe68, pe5, and pe35 adds to earlier reports of these genes in nonpathogenic NTM like M. smegmatis, Mycobacterium sp. JLS and Mycobacterium KMS. This report is also the first to identify esxN gene situated within the ESX-5 locus in M. nonchromogenicum. Our proteomics analysis

  10. Mycobacterium abscessus phospholipase C expression is induced during coculture within amoebae and enhances M. abscessus virulence in mice.

    PubMed

    Bakala N'Goma, Jean Claude; Le Moigne, Vincent; Soismier, Nathalie; Laencina, Laura; Le Chevalier, Fabien; Roux, Anne-Laure; Poncin, Isabelle; Serveau-Avesque, Carole; Rottman, Martin; Gaillard, Jean-Louis; Etienne, Gilles; Brosch, Roland; Herrmann, Jean-Louis; Canaan, Stéphane; Girard-Misguich, Fabienne

    2015-02-01

    Mycobacterium abscessus is a pathogenic, rapidly growing mycobacterium involved in pulmonary and cutaneo-mucous infections worldwide, to which cystic fibrosis patients are exquisitely susceptible. The analysis of the genome sequence of M. abscessus showed that this bacterium is endowed with the metabolic pathways typically found in environmental microorganisms that come into contact with soil, plants, and aquatic environments, where free-living amoebae are frequently present. M. abscessus also contains several genes that are characteristically found only in pathogenic bacteria. One of them is MAB_0555, encoding a putative phospholipase C (PLC) that is absent from most other rapidly growing mycobacteria, including Mycobacterium chelonae and Mycobacterium smegmatis. Here, we report that purified recombinant M. abscessus PLC is highly cytotoxic to mouse macrophages, presumably due to hydrolysis of membrane phospholipids. We further showed by constructing and using an M. abscessus PLC knockout mutant that loss of PLC activity is deleterious to M. abscessus intracellular survival in amoebae. The importance of PLC is further supported by the fact that M. abscessus PLC was found to be expressed only in amoebae. Aerosol challenge of mice with M. abscessus strains that were precultured in amoebae enhanced M. abscessus lung infectivity relative to M. abscessus grown in broth culture. Our study underlines the importance of PLC for the virulence of M. abscessus. Despite the difficulties of isolating M. abscessus from environmental sources, our findings suggest that M. abscessus has evolved in close contact with environmental protozoa, which supports the argument that amoebae may contribute to the virulence of opportunistic mycobacteria. PMID:25486995

  11. Mycobacterium abscessus Phospholipase C Expression Is Induced during Coculture within Amoebae and Enhances M. abscessus Virulence in Mice

    PubMed Central

    Bakala N'Goma, Jean Claude; Le Moigne, Vincent; Soismier, Nathalie; Laencina, Laura; Le Chevalier, Fabien; Roux, Anne-Laure; Poncin, Isabelle; Serveau-Avesque, Carole; Rottman, Martin; Gaillard, Jean-Louis; Etienne, Gilles; Brosch, Roland; Canaan, Stéphane

    2014-01-01

    Mycobacterium abscessus is a pathogenic, rapidly growing mycobacterium involved in pulmonary and cutaneo-mucous infections worldwide, to which cystic fibrosis patients are exquisitely susceptible. The analysis of the genome sequence of M. abscessus showed that this bacterium is endowed with the metabolic pathways typically found in environmental microorganisms that come into contact with soil, plants, and aquatic environments, where free-living amoebae are frequently present. M. abscessus also contains several genes that are characteristically found only in pathogenic bacteria. One of them is MAB_0555, encoding a putative phospholipase C (PLC) that is absent from most other rapidly growing mycobacteria, including Mycobacterium chelonae and Mycobacterium smegmatis. Here, we report that purified recombinant M. abscessus PLC is highly cytotoxic to mouse macrophages, presumably due to hydrolysis of membrane phospholipids. We further showed by constructing and using an M. abscessus PLC knockout mutant that loss of PLC activity is deleterious to M. abscessus intracellular survival in amoebae. The importance of PLC is further supported by the fact that M. abscessus PLC was found to be expressed only in amoebae. Aerosol challenge of mice with M. abscessus strains that were precultured in amoebae enhanced M. abscessus lung infectivity relative to M. abscessus grown in broth culture. Our study underlines the importance of PLC for the virulence of M. abscessus. Despite the difficulties of isolating M. abscessus from environmental sources, our findings suggest that M. abscessus has evolved in close contact with environmental protozoa, which supports the argument that amoebae may contribute to the virulence of opportunistic mycobacteria. PMID:25486995

  12. Characterization of an exported monoglyceride lipase from Mycobacterium tuberculosis possibly involved in the metabolism of host cell membrane lipids

    PubMed Central

    Côtes, Karen; Dhouib, Rabeb; Douchet, Isabelle; Chahinian, Henri; deCaro, Alain; Carrière, Frédéric; Canaan, Stéphane

    2007-01-01

    The Rv0183 gene of the Mycobacterium tuberculosis H37Rv strain, which has been implicated as a lysophospholipase, was cloned and expressed in Escherichia coli. The purified Rv0183 protein did not show any activity when lysophospholipid substrates were used, but preferentially hydrolysed monoacylglycerol substrates with a specific activity of 290 units·mg−1 at 37 °C. Rv0183 hydrolyses both long chain di- and triacylglycerols, as determined using the monomolecular film technique, although the turnover was lower than with MAG (monoacyl-glycerol). The enzyme shows an optimum activity at pH values ranging from 7.5 to 9.0 using mono-olein as substrate and is inactivated by serine esterase inhibitors such as E600, PMSF and tetrahydrolipstatin. The catalytic triad is composed of Ser110, Asp226 and His256 residues, as confirmed by the results of site-directed mutagenesis. Rv0183 shows 35% sequence identity with the human and mouse monoglyceride lipases and well below 15% with the other bacterial lipases characterized so far. Homologues of Rv0183 can be identified in other mycobacterial genomes such as Mycobacterium bovis, Mycobacterium smegmatis, and even Mycobacterium leprae, which is known to contain a low number of genes involved in the replication process within the host cells. The results of immunolocalization studies performed with polyclonal antibodies raised against the purified recombinant Rv0183 suggested that the enzyme was present only in the cell wall and culture medium of M. tuberculosis. Our results identify Rv0183 as the first exported lipolytic enzyme to be characterized in M. tuberculosis and suggest that Rv0183 may be involved in the degradation of the host cell lipids. PMID:17784850

  13. Recombinant BCG Expressing Mycobacterium ulcerans Ag85A Imparts Enhanced Protection against Experimental Buruli ulcer.

    PubMed

    Hart, Bryan E; Hale, Laura P; Lee, Sunhee

    2015-09-01

    Buruli ulcer, an emerging tropical disease caused by Mycobacterium ulcerans (MU), is characterized by disfiguring skin necrosis and high morbidity. Relatively little is understood about the mode of transmission, pathogenesis, or host immune responses to MU infection. Due to significant reduction in quality of life for patients with extensive tissue scarring, and that a disproportionately high percentage of those affected are disadvantaged children, a Buruli ulcer vaccine would be greatly beneficial to the worldwide community. Previous studies have shown that mice inoculated with either M. bovis bacille Calmette-Guérin (BCG) or a DNA vaccine encoding the M. ulcerans mycolyl transferase, Ag85A (MU-Ag85A), are transiently protected against pathology caused by intradermal challenge with MU. Building upon this principle, we have generated quality-controlled, live-recombinant strains of BCG and M. smegmatis which express the immunodominant MU Ag85A. Priming with rBCG MU-Ag85A followed by an M. smegmatis MU-Ag85A boost strongly induced murine antigen-specific CD4+ T cells and elicited functional IFNγ-producing splenocytes which recognized MU-Ag85A peptide and whole M. ulcerans better than a BCG prime-boost vaccination. Strikingly, mice vaccinated with a single subcutaneous dose of BCG MU-Ag85A or prime-boost displayed significantly enhanced survival, reduced tissue pathology, and lower bacterial load compared to mice vaccinated with BCG. Importantly, this level of superior protection against experimental Buruli ulcer compared to BCG has not previously been achieved. These results suggest that use of BCG as a recombinant vehicle expressing MU antigens represents an effective Buruli ulcer vaccine strategy and warrants further antigen discovery to improve vaccine efficacy. PMID:26393347

  14. Recombinant BCG Expressing Mycobacterium ulcerans Ag85A Imparts Enhanced Protection against Experimental Buruli ulcer

    PubMed Central

    Hart, Bryan E.; Hale, Laura P.; Lee, Sunhee

    2015-01-01

    Buruli ulcer, an emerging tropical disease caused by Mycobacterium ulcerans (MU), is characterized by disfiguring skin necrosis and high morbidity. Relatively little is understood about the mode of transmission, pathogenesis, or host immune responses to MU infection. Due to significant reduction in quality of life for patients with extensive tissue scarring, and that a disproportionately high percentage of those affected are disadvantaged children, a Buruli ulcer vaccine would be greatly beneficial to the worldwide community. Previous studies have shown that mice inoculated with either M. bovis bacille Calmette–Guérin (BCG) or a DNA vaccine encoding the M. ulcerans mycolyl transferase, Ag85A (MU-Ag85A), are transiently protected against pathology caused by intradermal challenge with MU. Building upon this principle, we have generated quality-controlled, live-recombinant strains of BCG and M. smegmatis which express the immunodominant MU Ag85A. Priming with rBCG MU-Ag85A followed by an M. smegmatis MU-Ag85A boost strongly induced murine antigen-specific CD4+ T cells and elicited functional IFNγ-producing splenocytes which recognized MU-Ag85A peptide and whole M. ulcerans better than a BCG prime-boost vaccination. Strikingly, mice vaccinated with a single subcutaneous dose of BCG MU-Ag85A or prime-boost displayed significantly enhanced survival, reduced tissue pathology, and lower bacterial load compared to mice vaccinated with BCG. Importantly, this level of superior protection against experimental Buruli ulcer compared to BCG has not previously been achieved. These results suggest that use of BCG as a recombinant vehicle expressing MU antigens represents an effective Buruli ulcer vaccine strategy and warrants further antigen discovery to improve vaccine efficacy. PMID:26393347

  15. Mefloquine and its oxazolidine derivative compound are active against drug-resistant Mycobacterium tuberculosis strains and in a murine model of tuberculosis infection.

    PubMed

    Rodrigues-Junior, Valnês S; Villela, Anne D; Gonçalves, Raoni S B; Abbadi, Bruno Lopes; Trindade, Rogério Valim; López-Gavín, Alexandre; Tudó, Griselda; González-Martín, Julian; Basso, Luiz Augusto; de Souza, Marcus V N; Campos, Maria Martha; Santos, Diógenes Santiago

    2016-08-01

    Repurposing of drugs to treat tuberculosis (TB) has been considered an alternative to overcome the global TB epidemic, especially to combat drug-resistant forms of the disease. Mefloquine has been reported as a potent drug to kill drug-resistant strains of Mycobacterium tuberculosis. In addition, mefloquine-derived molecules have been synthesised and their effectiveness against mycobacteria has been assessed. In this work, we demonstrate for the first time the activities of mefloquine and its oxazolidine derivative compound 1E in a murine model of TB infection following administration of both drugs by the oral route. The effects of associations between mefloquine or 1E with the clinically used antituberculosis drugs isoniazid, rifampicin, ethambutol, moxifloxacin and streptomycin were also investigated. Importantly, combination of mefloquine with isoniazid and of 1E with streptomycin showed a two-fold decrease in their minimum inhibitory concentrations (MICs). Moreover, no tested combinations demonstrated antagonist interactions. Here we describe novel evidence on the activity of mefloquine and 1E against a series of quinolone-resistant M. tuberculosis strains. These data show MICs against quinolone-resistant strains (0.5-8 µg/mL) similar to or lower than those previously reported for multidrug-resistant strains. Taking these results together, we can suggest the use of mefloquine or 1E in combination with clinically available drugs, especially in the case of resistant forms of TB. PMID:27364701

  16. [Coinfection of Mycobacterium malmoense and Mycobacterium tuberculosis in a patient with acquired inmune deficiency syndrome].

    PubMed

    Mederos Cuervo, Lilian María; Reyes Pérez, Angélica; Valdes Alonso, Lidunka; Rodríguez Delgado, Francisco; Sardiñas Aragón, Misleydis; Martínez Romero, María Rosarys; Díaz Romero, Raúl

    2014-01-01

    A case is presented of coinfection with Mycobacterium malmoense and Mycobacterium tuberculosis in a Cuban patient with AIDS which produced respiratory and liver disease respectively. Cultures done from sputum samples showed the presence of a non-pigmented, slow growing mycobacterial strain belonging to Runyon group III and identified as Mycobacterium malmoense. From cultures of liver tissue removed laparoscopically, a strain was isolated and subsequently identified as Mycobacterium tuberculosis. Anatomapathologic examination confirmed the diagnosis of tuberculosis, the patient received specific treatment and had a favorable clinical course. This report of a rare case of coinfection of Mycobacterium describes the first report of hepatic tuberculosis in a patient with AIDS in Cuba. PMID:25597735

  17. Mycobacterium tuberculosis pellicles express unique proteins recognized by the host humoral response

    PubMed Central

    Kerns, Patrick W.; Ackart, David F.; Basaraba, Randall J.; Leid, Jeff; Shirtliff, Mark E.

    2014-01-01

    Mycobacterium tuberculosis (MTB) causes both acute and chronic infections in humans characterized by tolerance to antibiotics and reactivation to cause secondary tuberculosis. These characteristics have led to renewed interested in the in vitro pellicle, or biofilm mode of growth, where bacteria grow to produce a thick aggregate at the air-liquid interface and exhibit increased phenotypic resistance to antibiotics. We infected guinea pigs with the virulent H37Rv strain of MTB for 60 days at which point we collected blood. To identify antigenic proteins, membrane protein extracts of MTB H37Ra pellicles and shaken cultures grown for 3, 5, or 7 weeks were probed with the infected animals’ sera after the proteins were separated by two-dimensional gel electrophoresis (2DGE). Antigenic proteins were then identified using MALDI-TOF/TOF mass spectrometry peptide mass fingerprinting. Antigenic pellicle proteins were compared across the three timepoints to identify those that were produced consistently during pellicle growth. They were also compared to those membrane proteins identified from harvested shaken cultures to determine pellicle-specific versus universally-expressed proteins. Using this technique we identified 44 distinct antigenic proteins, nine of which were pellicle-specific. The sequence of antigenic pellicle-specific proteins was checked for sequence conservation across 15 sequenced MTB clinical isolates, three other members of the MTB complex, as well as Mycobacterium avium and Mycobacterium smegmatis. The antigenic pellicle-specific protein Rv0097 was found to have very high sequence conservation within the MTB complex but not with related mycobacteria while FabG4 was highly conserved in all mycobacteria analyzed. These conserved pellicle-specific proteins represent targets for the development of future diagnostic tests and vaccines. PMID:24453174

  18. In vivo growth characteristics of leucine and methionine auxotrophic mutants of Mycobacterium bovis BCG generated by transposon mutagenesis.

    PubMed Central

    McAdam, R A; Weisbrod, T R; Martin, J; Scuderi, J D; Brown, A M; Cirillo, J D; Bloom, B R; Jacobs, W R

    1995-01-01

    Insertional mutagenesis in Mycobacterium bovis BCG, a member of the slow-growing M. tuberculosis complex, was accomplished with transposons engineered from the Mycobacterium smegmatis insertion element IS1096. Transposons were created by placing a kanamycin resistance gene in several different positions in IS1096, and the resulting transposons were electroporated into BCG on nonreplicating plasmids. These analyses demonstrated that only one of the two open reading frames was necessary for transposition. A library of insertions was generated. Southern analysis of 23 kanamycin-resistant clones revealed that the transposons had inserted directly, with no evidence of cointegrate formation, into different restriction fragments in each clone. Sequence analysis of nine of the clones revealed junctional direct 8-bp repeats with only a slight similarity in target sites. These results suggest that IS1096-derived transposons transposed into the BCG genome in a relatively random fashion. Three auxotrophs, two for leucine and one for methionine, were isolated from the library of transposon insertions in BCG. They were characterized by sequencing and found to be homologous to the leuD gene of Escherichia coli and a sulfate-binding protein of cyanobacteria, respectively. When inoculated intravenously into C57BL/6 mice, the leucine auxotrophs, in contrast to the parent BCG strain or the methionine auxotroph, showed an inability to grow in vivo and were cleared within 7 weeks from the lungs and spleen. PMID:7868221

  19. Unique Structural Features of the Peptidoglycan of Mycobacterium leprae▿

    PubMed Central

    Mahapatra, Sebabrata; Crick, Dean C.; McNeil, Michael R.; Brennan, Patrick J.

    2008-01-01

    The peptidoglycan structure of Mycobacterium spp. has been investigated primarily with the readily cultivable Mycobacterium smegmatis and Mycobacterium tuberculosis and has been shown to contain unusual features, including the occurrence of N-glycolylated, in addition to N-acetylated, muramic acid residues and direct cross-linkage between meso-diaminopimelic acid residues. Based on results from earlier studies, peptidoglycan from in vivo-derived noncultivable Mycobacterium leprae was assumed to possess the basic structural features of peptidoglycans from other mycobacteria, other than the reported replacement of l-alanine by glycine in the peptide side chains. In the present study, we have analyzed the structure of M. leprae peptidoglycan in detail by combined liquid chromatography and mass spectrometry. In contrast to earlier reports, and to the peptidoglycans in M. tuberculosis and M. smegmatis, the muramic acid residues of M. leprae peptidoglycan are exclusively N acetylated. The un-cross-linked peptide side chains of M. leprae consist of tetra- and tripeptides, some of which contain additional glycine residues. Based on these findings and genome comparisons, it can be concluded that the massive genome decay in M. leprae does not markedly affect the peptidoglycan biosynthesis pathway, with the exception of the nonfunctional namH gene responsible for N-glycolylmuramic acid biosynthesis. PMID:18024514

  20. Efficacies of selected disinfectants against Mycobacterium tuberculosis.

    PubMed

    Best, M; Sattar, S A; Springthorpe, V S; Kennedy, M E

    1990-10-01

    The activities of 10 formulations as mycobactericidal agents in Mycobacterium tuberculosis-contaminated suspensions (suspension test) and stainless steel surfaces (carrier test) were investigated with sputum as the organic load. The quaternary ammonium compound, chlorhexidine gluconate, and an iodophor were ineffective in all tests. Ethanol (70%) was effective against M. tuberculosis only in suspension in the absence of sputum. Povidone-iodine was not as efficacious when the test organism was dried on a surface as it was in suspension, and its activity was further reduced in the presence of sputum. Sodium hypochlorite required a higher concentration of available chlorine to achieve an effective level of disinfection than did sodium dichloroisocyanurate. Phenol (5%) was effective under all test conditions, producing at least a 4-log10 reduction in CFU. The undiluted glutaraldehyde-phenate solution was effective against M. tuberculosis and a second test organism, Mycobacterium smegmatis, even in the presence of dried sputum, whereas the diluted solution (1:16) was only effective against M. smegmatis in the suspension test. A solution of 2% glutaraldehyde was effective against M. tuberculosis. This investigation presents tuberculocidal efficacy data generated by methods simulating actual practices of routine disinfection. PMID:2121783

  1. Porins increase copper susceptibility of Mycobacterium tuberculosis.

    PubMed

    Speer, Alexander; Rowland, Jennifer L; Haeili, Mehri; Niederweis, Michael; Wolschendorf, Frank

    2013-11-01

    Copper resistance mechanisms are crucial for many pathogenic bacteria, including Mycobacterium tuberculosis, during infection because the innate immune system utilizes copper ions to kill bacterial intruders. Despite several studies detailing responses of mycobacteria to copper, the pathways by which copper ions cross the mycobacterial cell envelope are unknown. Deletion of porin genes in Mycobacterium smegmatis leads to a severe growth defect on trace copper medium but simultaneously increases tolerance for copper at elevated concentrations, indicating that porins mediate copper uptake across the outer membrane. Heterologous expression of the mycobacterial porin gene mspA reduced growth of M. tuberculosis in the presence of 2.5 μM copper by 40% and completely suppressed growth at 15 μM copper, while wild-type M. tuberculosis reached its normal cell density at that copper concentration. Moreover, the polyamine spermine, a known inhibitor of porin activity in Gram-negative bacteria, enhanced tolerance of M. tuberculosis for copper, suggesting that copper ions utilize endogenous outer membrane channel proteins of M. tuberculosis to gain access to interior cellular compartments. In summary, these findings highlight the outer membrane as the first barrier against copper ions and the role of porins in mediating copper uptake in M. smegmatis and M. tuberculosis. PMID:24013632

  2. Draft Genome Sequence of Mycobacterium brumae ATCC 51384

    PubMed Central

    D'Auria, Giuseppe

    2016-01-01

    Here, we report the draft genome sequence of Mycobacterium brumae type strain ATCC 51384. This is the first draft genome sequence of M. brumae, a nonpathogenic, rapidly growing, nonchromogenic mycobacterium, with immunotherapeutic capacities. PMID:27125480

  3. Genomic insights into the emerging human pathogen Mycobacterium massiliense.

    PubMed

    Tettelin, Hervé; Sampaio, Elizabeth P; Daugherty, Sean C; Hine, Erin; Riley, David R; Sadzewicz, Lisa; Sengamalay, Naomi; Shefchek, Kent; Su, Qi; Tallon, Luke J; Conville, Patricia; Olivier, Kenneth N; Holland, Steven M; Fraser, Claire M; Zelazny, Adrian M

    2012-10-01

    Mycobacterium massiliense (Mycobacterium abscessus group) is an emerging pathogen causing pulmonary disease and skin and soft tissue infections. We report the genome sequence of the type strain CCUG 48898. PMID:22965080

  4. Real-Time PCR and High-Resolution Melt Analysis for Rapid Detection of Mycobacterium leprae Drug Resistance Mutations and Strain Types

    PubMed Central

    Li, Wei; Matsuoka, Masanori; Kai, Masanori; Thapa, Pratibha; Khadge, Saraswoti; Hagge, Deanna A.; Brennan, Patrick J.

    2012-01-01

    Drug resistance surveillance and strain typing of Mycobacterium leprae are necessary to investigate ongoing transmission of leprosy in regions of endemicity. To enable wider implementation of these molecular analyses, novel real-time PCR–high-resolution melt (RT-PCR-HRM) assays without allele-specific primers or probes and post-PCR sample handling were developed. For the detection of mutations within drug resistance-determining regions (DRDRs) of folP1, rpoB, and gyrA, targets for dapsone, rifampin, and fluoroquinolones, real-time PCR-HRM assays were developed. Wild-type and drug-resistant mouse footpad-derived strains that included three folP1, two rpoB, and one gyrA mutation types in a reference panel were tested. RT-PCR-HRM correctly distinguished the wild type from the mutant strains. In addition, RT-PCR-HRM analyses aided in recognizing samples with mixed or minor alleles and also a mislabeled sample. When tested in 121 sequence-characterized clinical strains, HRM identified all the folP1 mutants representing two mutation types, including one not within the reference panel. The false positives (<5%) could be attributed to low DNA concentration or PCR inhibition. A second set of RT-PCR-HRM assays for identification of three previously reported single nucleotide polymorphisms (SNPs) that have been used for strain typing were developed and validated in 22 reference and 25 clinical strains. Real-time PCR-HRM is a sensitive, simple, rapid, and high-throughput tool for routine screening known DRDR mutants in new and relapsed cases, SNP typing, and detection of minor mutant alleles in the wild-type background at lower costs than current methods and with the potential for quality control in leprosy investigations. PMID:22170923

  5. Targeting Drug-Sensitive and -Resistant Strains of Mycobacterium tuberculosis by Inhibition of Src Family Kinases Lowers Disease Burden and Pathology

    PubMed Central

    Chandra, Pallavi; Rajmani, R. S.; Verma, Garima; Bhavesh, Neel Sarovar

    2016-01-01

    ABSTRACT In view of emerging drug resistance among bacterial pathogens, including Mycobacterium tuberculosis, the development of novel therapeutic strategies is increasingly being sought. A recent paradigm in antituberculosis (anti-TB) drug development is to target the host molecules that are crucial for intracellular survival of the pathogen. We previously showed the importance of Src tyrosine kinases in mycobacterial pathogenesis. Here, we report that inhibition of Src significantly reduced survival of H37Rv as well as multidrug-resistant (MDR) and extremely drug-resistant (XDR) strains of M. tuberculosis in THP-1 macrophages. Src inhibition was also effective in controlling M. tuberculosis infection in guinea pigs. In guinea pigs, reduced M. tuberculosis burden due to Src inhibition also led to a marked decline in the disease pathology. In agreement with the theoretical framework of host-directed approaches against the pathogen, Src inhibition was equally effective against an XDR strain in controlling infection in guinea pigs. We propose that Src inhibitors could be developed into effective host-directed anti-TB drugs, which could be indiscriminately used against both drug-sensitive and drug-resistant strains of M. tuberculosis. IMPORTANCE The existing treatment regimen for tuberculosis (TB) suffers from deficiencies like high doses of antibiotics, long treatment duration, and inability to kill persistent populations in an efficient manner. Together, these contribute to the emergence of drug-resistant tuberculosis. Recently, several host factors were identified which help intracellular survival of Mycobacterium tuberculosis within the macrophage. These factors serve as attractive targets for developing alternate therapeutic strategies against M. tuberculosis. This strategy promises to be effective against drug-resistant strains. The approach also has potential to considerably lower the risk of emergence of new drug-resistant strains. We explored tyrosine kinase

  6. Targeting Drug-Sensitive and -Resistant Strains of Mycobacterium tuberculosis by Inhibition of Src Family Kinases Lowers Disease Burden and Pathology.

    PubMed

    Chandra, Pallavi; Rajmani, R S; Verma, Garima; Bhavesh, Neel Sarovar; Kumar, Dhiraj

    2016-01-01

    In view of emerging drug resistance among bacterial pathogens, including Mycobacterium tuberculosis, the development of novel therapeutic strategies is increasingly being sought. A recent paradigm in antituberculosis (anti-TB) drug development is to target the host molecules that are crucial for intracellular survival of the pathogen. We previously showed the importance of Src tyrosine kinases in mycobacterial pathogenesis. Here, we report that inhibition of Src significantly reduced survival of H37Rv as well as multidrug-resistant (MDR) and extremely drug-resistant (XDR) strains of M. tuberculosis in THP-1 macrophages. Src inhibition was also effective in controlling M. tuberculosis infection in guinea pigs. In guinea pigs, reduced M. tuberculosis burden due to Src inhibition also led to a marked decline in the disease pathology. In agreement with the theoretical framework of host-directed approaches against the pathogen, Src inhibition was equally effective against an XDR strain in controlling infection in guinea pigs. We propose that Src inhibitors could be developed into effective host-directed anti-TB drugs, which could be indiscriminately used against both drug-sensitive and drug-resistant strains of M. tuberculosis. IMPORTANCE The existing treatment regimen for tuberculosis (TB) suffers from deficiencies like high doses of antibiotics, long treatment duration, and inability to kill persistent populations in an efficient manner. Together, these contribute to the emergence of drug-resistant tuberculosis. Recently, several host factors were identified which help intracellular survival of Mycobacterium tuberculosis within the macrophage. These factors serve as attractive targets for developing alternate therapeutic strategies against M. tuberculosis. This strategy promises to be effective against drug-resistant strains. The approach also has potential to considerably lower the risk of emergence of new drug-resistant strains. We explored tyrosine kinase Src as a

  7. Esters of Pyrazinoic Acid Are Active against Pyrazinamide-Resistant Strains of Mycobacterium tuberculosis and Other Naturally Resistant Mycobacteria In Vitro and Ex Vivo within Macrophages.

    PubMed

    Pires, David; Valente, Emília; Simões, Marta Filipa; Carmo, Nuno; Testa, Bernard; Constantino, Luís; Anes, Elsa

    2015-12-01

    Pyrazinamide (PZA) is active against major Mycobacterium tuberculosis species (M. tuberculosis, M. africanum, and M. microti) but not against M. bovis and M. avium. The latter two are mycobacterial species involved in human and cattle tuberculosis and in HIV coinfections, respectively. PZA is a first-line agent for the treatment of human tuberculosis and requires activation by a mycobacterial pyrazinamidase to form the active metabolite pyrazinoic acid (POA). As a result of this mechanism, resistance to PZA, as is often found in tuberculosis patients, is caused by point mutations in pyrazinamidase. In previous work, we have shown that POA esters and amides synthesized in our laboratory were stable in plasma (M. F. Simões, E. Valente, M. J. Gómez, E. Anes, and L. Constantino, Eur J Pharm Sci 37:257-263, 2009, http://dx.doi.org/10.1016/j.ejps.2009.02.012). Although the amides did not present significant activity, the esters were active against sensitive mycobacteria at concentrations 5- to 10-fold lower than those of PZA. Here, we report that these POA derivatives possess antibacterial efficacy in vitro and ex vivo against several species and strains of Mycobacterium with natural or acquired resistance to PZA, including M. bovis and M. avium. Our results indicate that the resistance probably was overcome by cleavage of the prodrugs into POA and a long-chain alcohol. Although it is not possible to rule out that the esters have intrinsic activity per se, we bring evidence here that long-chain fatty alcohols possess a significant antimycobacterial effect against PZA-resistant species and strains and are not mere inactive promoieties. These findings may lead to candidate dual drugs having enhanced activity against both PZA-susceptible and PZA-resistant isolates and being suitable for clinical development. PMID:26438493

  8. Differential MicroRNA Expression in Human Macrophages with Mycobacterium tuberculosis Infection of Beijing/W and Non-Beijing/W Strain Types

    PubMed Central

    Zheng, Lin; Leung, Eric; Lee, Nelson; Lui, Grace; To, Ka-Fai; Chan, Raphael C. Y.; Ip, Margaret

    2015-01-01

    Objectives The role of microRNAs in association with Mycobacterium tuberculosis (MTB) infection and the immunology regulated by microRNAs upon MTB infection have not been fully unravelled. We examined the microRNA profiles of THP-1 macrophages upon the MTB infection of Beijing/W and non-Beijing/W clinical strains. We also studied the microRNA profiles of the host macrophages by microarray in a small cohort with active MTB disease, latent infection (LTBI), and from healthy controls. Results The results revealed that 14 microRNAs differentiated infections of Beijing/W from non-Beijing/W strains (P<0.05). A unique signature of 11 microRNAs in human macrophages was identified to differentiate active MTB disease from LTBI and healthy controls. Pathway analyses of these differentially expressed miRNAs suggest that the immune-regulatory interactions involving TGF-β signalling pathway take part in the dysregulation of critical TB processes in the macrophages, resulting in active expression of both cell communication and signalling transduction systems. Conclusion We showed for the first time that the Beijing/W TB strains repressed a number of miRNAs expressions which may reflect their virulence characteristics in altering the host response. The unique signatures of 11 microRNAs may deserve further evaluation as candidates for biomarkers in the diagnosis of MTB and Beijing/W infections. PMID:26053546

  9. Mycobacterium Lysine ε-aminotransferase is a novel alarmone metabolism related persister gene via dysregulating the intracellular amino acid level

    PubMed Central

    Duan, Xiangke; Li, Yunsong; Du, Qinglin; Huang, Qinqin; Guo, Siyao; Xu, Mengmeng; Lin, Yanping; Liu, Zhidong; Xie, Jianping

    2016-01-01

    Bacterial persisters, usually slow-growing, non-replicating cells highly tolerant to antibiotics, play a crucial role contributing to the recalcitrance of chronic infections and treatment failure. Understanding the molecular mechanism of persister cells formation and maintenance would obviously inspire the discovery of new antibiotics. The significant upregulation of Mycobacterium tuberculosis Rv3290c, a highly conserved mycobacterial lysine ε-aminotransferase (LAT) during hypoxia persistent model, suggested a role of LAT in persistence. To test this, a lat deleted Mycobacterium smegmatis was constructed. The expression of transcriptional regulator leucine-responsive regulatory protein (LrpA) and the amino acids abundance in M. smegmatis lat deletion mutants were lowered. Thus, the persistence capacity of the deletion mutant was impaired upon norfloxacin exposure under nutrient starvation. In summary, our study firstly reported the involvement of mycobacterium LAT in persister formation, and possibly through altering the intracellular amino acid metabolism balance. PMID:26806099

  10. Mycobacterium Lysine ε-aminotransferase is a novel alarmone metabolism related persister gene via dysregulating the intracellular amino acid level.

    PubMed

    Duan, Xiangke; Li, Yunsong; Du, Qinglin; Huang, Qinqin; Guo, Siyao; Xu, Mengmeng; Lin, Yanping; Liu, Zhidong; Xie, Jianping

    2016-01-01

    Bacterial persisters, usually slow-growing, non-replicating cells highly tolerant to antibiotics, play a crucial role contributing to the recalcitrance of chronic infections and treatment failure. Understanding the molecular mechanism of persister cells formation and maintenance would obviously inspire the discovery of new antibiotics. The significant upregulation of Mycobacterium tuberculosis Rv3290c, a highly conserved mycobacterial lysine ε-aminotransferase (LAT) during hypoxia persistent model, suggested a role of LAT in persistence. To test this, a lat deleted Mycobacterium smegmatis was constructed. The expression of transcriptional regulator leucine-responsive regulatory protein (LrpA) and the amino acids abundance in M. smegmatis lat deletion mutants were lowered. Thus, the persistence capacity of the deletion mutant was impaired upon norfloxacin exposure under nutrient starvation. In summary, our study firstly reported the involvement of mycobacterium LAT in persister formation, and possibly through altering the intracellular amino acid metabolism balance. PMID:26806099

  11. Genomics and Proteomics of Mycobacteriophage Patience, an Accidental Tourist in the Mycobacterium Neighborhood

    PubMed Central

    Pope, Welkin H.; Jacobs-Sera, Deborah; Russell, Daniel A.; Rubin, Daniel H. F.; Kajee, Afsana; Msibi, Zama N. P.; Larsen, Michelle H.; Jacobs, William R.; Lawrence, Jeffrey G.; Hendrix, Roger W.

    2014-01-01

    ABSTRACT Newly emerging human viruses such as Ebola virus, severe acute respiratory syndrome (SARS) virus, and HIV likely originate within an extant population of viruses in nonhuman hosts and acquire the ability to infect and cause disease in humans. Although several mechanisms preventing viral infection of particular hosts have been described, the mechanisms and constraints on viral host expansion are ill defined. We describe here mycobacteriophage Patience, a newly isolated phage recovered using Mycobacterium smegmatis mc2155 as a host. Patience has genomic features distinct from its M. smegmatis host, including a much lower GC content (50.3% versus 67.4%) and an abundance of codons that are rarely used in M. smegmatis. Nonetheless, it propagates well in M. smegmatis, and we demonstrate the use of mass spectrometry to show expression of over 75% of the predicted proteins, to identify new genes, to refine the genome annotation, and to estimate protein abundance. We propose that Patience evolved primarily among lower-GC hosts and that the disparities between its genomic profile and that of M. smegmatis presented only a minimal barrier to host expansion. Rapid adaptions to its new host include recent acquisition of higher-GC genes, expression of out-of-frame proteins within predicted genes, and codon selection among highly expressed genes toward the translational apparatus of its new host. PMID:25467442

  12. Mycobacterium tuberculosis has diminished capacity to counteract redox stress induced by elevated levels of endogenous superoxide

    PubMed Central

    Tyagi, Priyanka; Dharmaraja, Allimuthu T.; Bhaskar, Ashima; Chakrapani, Harinath; Singh, Amit

    2015-01-01

    Mycobacterium tuberculosis (Mtb) has evolved protective and detoxification mechanisms to maintain cytoplasmic redox balance in response to exogenous oxidative stress encountered inside host phagocytes. In contrast, little is known about the dynamic response of this pathogen to endogenous oxidative stress generated within Mtb. Using a noninvasive and specific biosensor of cytoplasmic redox state of Mtb, we for first time discovered a surprisingly high sensitivity of this pathogen to perturbation in redox homeostasis induced by elevated endogenous reactive oxygen species (ROS). We synthesized a series of hydroquinone-based small molecule ROS generators and found that ATD-3169 permeated mycobacteria to reliably enhance endogenous ROS including superoxide radicals. When Mtb strains including multidrug-resistant (MDR) and extensively drug-resistant (XDR) patient isolates were exposed to this compound, a dose-dependent, long-lasting, and irreversible oxidative shift in intramycobacterial redox potential was detected. Dynamic redox potential measurements revealed that Mtb had diminished capacity to restore cytoplasmic redox balance in comparison with Mycobacterium smegmatis (Msm), a fast growing nonpathogenic mycobacterial species. Accordingly, Mtb strains were extremely susceptible to inhibition by ATD-3169 but not Msm, suggesting a functional linkage between dynamic redox changes and survival. Microarray analysis showed major realignment of pathways involved in redox homeostasis, central metabolism, DNA repair, and cell wall lipid biosynthesis in response to ATD-3169, all consistent with enhanced endogenous ROS contributing to lethality induced by this compound. This work provides empirical evidence that the cytoplasmic redox poise of Mtb is uniquely sensitive to manipulation in steady-state endogenous ROS levels, thus revealing the importance of targeting intramycobacterial redox metabolism for controlling TB infection. PMID:25819161

  13. Mycobacterium tuberculosis has diminished capacity to counteract redox stress induced by elevated levels of endogenous superoxide.

    PubMed

    Tyagi, Priyanka; Dharmaraja, Allimuthu T; Bhaskar, Ashima; Chakrapani, Harinath; Singh, Amit

    2015-07-01

    Mycobacterium tuberculosis (Mtb) has evolved protective and detoxification mechanisms to maintain cytoplasmic redox balance in response to exogenous oxidative stress encountered inside host phagocytes. In contrast, little is known about the dynamic response of this pathogen to endogenous oxidative stress generated within Mtb. Using a noninvasive and specific biosensor of cytoplasmic redox state of Mtb, we for first time discovered a surprisingly high sensitivity of this pathogen to perturbation in redox homeostasis induced by elevated endogenous reactive oxygen species (ROS). We synthesized a series of hydroquinone-based small molecule ROS generators and found that ATD-3169 permeated mycobacteria to reliably enhance endogenous ROS including superoxide radicals. When Mtb strains including multidrug-resistant (MDR) and extensively drug-resistant (XDR) patient isolates were exposed to this compound, a dose-dependent, long-lasting, and irreversible oxidative shift in intramycobacterial redox potential was detected. Dynamic redox potential measurements revealed that Mtb had diminished capacity to restore cytoplasmic redox balance in comparison with Mycobacterium smegmatis (Msm), a fast growing nonpathogenic mycobacterial species. Accordingly, Mtb strains were extremely susceptible to inhibition by ATD-3169 but not Msm, suggesting a functional linkage between dynamic redox changes and survival. Microarray analysis showed major realignment of pathways involved in redox homeostasis, central metabolism, DNA repair, and cell wall lipid biosynthesis in response to ATD-3169, all consistent with enhanced endogenous ROS contributing to lethality induced by this compound. This work provides empirical evidence that the cytoplasmic redox poise of Mtb is uniquely sensitive to manipulation in steady-state endogenous ROS levels, thus revealing the importance of targeting intramycobacterial redox metabolism for controlling TB infection. PMID:25819161

  14. Uric acid utilization by Mycobacterium intracellulare and Mycobacterium scrofulaceum isolates.

    PubMed Central

    Falkinham, J O; George, K L; Parker, B C; Gruft, H

    1983-01-01

    Forty-nine human and environmental isolates of Mycobacterium intracellulare and Mycobacterium scrofulaceum were tested for their ability to grow on uric acid and a number of its degradation products. Nearly all (88 to 90%) strains used uric acid or allantoin as a sole nitrogen source; fewer (47 to 69%) used allantoate, urea, or possibly ureidoglycollate. Enzymatic activities of one representative isolate demonstrated the existence of a uric acid degradation pathway resembling that in other aerobic microorganisms. PMID:6863220

  15. A genomic library-based amplification approach (GL-PCR) for the mapping of multiple IS6110 insertion sites and strain differentiation of Mycobacterium tuberculosis.

    PubMed

    Namouchi, Amine; Mardassi, Helmi

    2006-11-01

    Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band. PMID:16725220

  16. Mycobacterial Interspersed Repetitive-Unit–Variable-Number Tandem-Repeat (MIRU-VNTR) Genotyping of Mycobacterium intracellulare for Strain Comparison with Establishment of a PCR-Based Database

    PubMed Central

    Iakhiaeva, Elena; McNulty, Steven; Brown Elliott, Barbara A.; Falkinham, Joseph O.; Williams, Myra D.; Vasireddy, Ravikiran; Wilson, Rebecca W.; Turenne, Christine

    2013-01-01

    Strain comparison is important to population genetics and to evaluate relapses in patients with Mycobacterium avium complex (MAC) lung disease, but the “gold standard” of pulsed-field gel electrophoresis (PFGE) is time-consuming and complex. We used variable-number tandem repeats (VNTR) for fingerprinting of respiratory isolates of M. intracellulare from patients with underlying bronchiectasis, to establish a nonsequence-based database for population analysis. Different genotypes identified by PFGE underwent species identification using a 16S rRNA gene multiplex PCR. Genotypes of M. intracellulare were confirmed by internal transcribed spacer 1 (ITS1) sequencing and characterized using seven VNTR primers. The pattern of VNTR amplicon sizes and repeat number defined each specific VNTR type. Forty-two VNTR types were identified among 84 genotypes. PFGE revealed most isolates with the same VNTR type to be clonal or exhibit similar grouping of bands. Repetitive sequence-based PCR (rep-PCR) showed minimal pattern diversity between VNTR types compared to PFGE. Fingerprinting of relapse isolates from 31 treated patients using VNTR combined with 16S multiplex PCR unambiguously and reliably distinguished different genotypes from the same patient, with results comparable to those of PFGE. VNTR for strain comparison is easier and faster than PFGE, is as accurate as PFGE, and does not require sequencing. Starting with a collection of 167 M. intracellulare isolates, VNTR distinguished M. intracellulare into 42 clonal groups. Comparison of isolates from different geographic areas, habitats, and clinical settings is now possible. PMID:23175249

  17. Mycobacterium bovis-infected macrophages from resistant and susceptible cattle exhibited a differential pro-inflammatory gene expression profile depending on strain virulence.

    PubMed

    Alfonseca-Silva, Edgar; Hernández-Pando, Rogelio; Gutiérrez-Pabello, José A

    2016-08-01

    Mycobacterium bovis, the causative agent of bovine tuberculosis, is an intracellular bacterium that normally persists inside host macrophages. However, the influence of bacterial virulence and host resistance on the final outcome in this interaction is not well known. In this study, we infected macrophages isolated from natural disease resistant (R) and susceptible (S) cattle donors with M. bovis strains characterized as attenuated and virulent to assess pro-inflammatory cytokine (TNFα, IL-12, IL-18, IL-1β, IL-6), chemokine (MCP-1, MCP-2, MIP-1), macrophage receptor (MSR1, TLR2, TLR4, MMR) and iNOS mRNA expression levels. Our findings identified a pro-inflammatory gene expression profile as a common feature after M. bovis infection regardless of bacterial virulence, however in S macrophages a superior expression was induced by the attenuated strain, whereas in R macrophages it was accomplished by the virulent M. bovis. A macrophage pro-inflammatory profile is intended to control M. bovis intracellular growth; however the host resistant phenotype plays a determinant role in it, since R macrophages had better intracellular bacterial control than S cells. PMID:26970816

  18. High Sequence Variability of the ppE18 Gene of Clinical Mycobacterium tuberculosis Complex Strains Potentially Impacts Effectivity of Vaccine Candidate M72/AS01E.

    PubMed

    Homolka, Susanne; Ubben, Tanja; Niemann, Stefan

    2016-01-01

    The development of an effective vaccine is urgently needed to fight tuberculosis (TB) which is still the leading cause of death from a single infectious agent worldwide. One of the promising vaccine candidates M72/AS01E consists of two proteins subunits PepA and PPE18 coded by Rv0125 and Rv1196. However, preliminary data indicate a high level of sequence variability among clinical Mycobacterium tuberculosis complex (MTBC) strains that might have an impact on the vaccine efficacy. To further investigate this finding, we determined ppE18 sequence variability in a well-characterized reference collection of 71 MTBC strains from 23 phylogenetic lineages representing the global MTBC diversity. In total, 100 sequence variations consisting of 96 single nucleotide polymorphisms (SNPs), three insertions and one deletion were detected resulting in 141 variable positions distributed over the entire gene. The majority of SNPs detected were non-synonymous (n = 68 vs. n = 28 synonymous). Strains from animal adapted lineages, e.g., M. bovis, showed a significant higher diversity than the human pathogens such as M. tuberculosis Haarlem. SNP patterns specific for different lineages as well as for deeper branches in the phylogeny could be identified. The results of our study demonstrate a high variability of the ppE18 gene even in the N-terminal domains that is normally highly conserved in ppe genes. As the N-terminal region interacts with TLR2 receptor inducing a protective anti-inflammatory immune response, genetic heterogeneity has a potential impact on the vaccine efficiency, however, this has to be investigated in future studies. PMID:27011018

  19. High Sequence Variability of the ppE18 Gene of Clinical Mycobacterium tuberculosis Complex Strains Potentially Impacts Effectivity of Vaccine Candidate M72/AS01E

    PubMed Central

    Homolka, Susanne; Ubben, Tanja; Niemann, Stefan

    2016-01-01

    The development of an effective vaccine is urgently needed to fight tuberculosis (TB) which is still the leading cause of death from a single infectious agent worldwide. One of the promising vaccine candidates M72/AS01E consists of two proteins subunits PepA and PPE18 coded by Rv0125 and Rv1196. However, preliminary data indicate a high level of sequence variability among clinical Mycobacterium tuberculosis complex (MTBC) strains that might have an impact on the vaccine efficacy. To further investigate this finding, we determined ppE18 sequence variability in a well-characterized reference collection of 71 MTBC strains from 23 phylogenetic lineages representing the global MTBC diversity. In total, 100 sequence variations consisting of 96 single nucleotide polymorphisms (SNPs), three insertions and one deletion were detected resulting in 141 variable positions distributed over the entire gene. The majority of SNPs detected were non-synonymous (n = 68 vs. n = 28 synonymous). Strains from animal adapted lineages, e.g., M. bovis, showed a significant higher diversity than the human pathogens such as M. tuberculosis Haarlem. SNP patterns specific for different lineages as well as for deeper branches in the phylogeny could be identified. The results of our study demonstrate a high variability of the ppE18 gene even in the N-terminal domains that is normally highly conserved in ppe genes. As the N-terminal region interacts with TLR2 receptor inducing a protective anti-inflammatory immune response, genetic heterogeneity has a potential impact on the vaccine efficiency, however, this has to be investigated in future studies. PMID:27011018

  20. Comparative Genomic Hybridizations Reveal Genetic Regions within the Mycobacterium avium Complex That Are Divergent from Mycobacterium avium subsp. paratuberculosis Isolates†

    PubMed Central

    Paustian, Michael L.; Kapur, Vivek; Bannantine, John P.

    2005-01-01

    Mycobacterium avium subsp. paratuberculosis is genetically similar to other members of the Mycobacterium avium complex (MAC), some of which are nonpathogenic and widespread in the environment. We have utilized an M. avium subsp. paratuberculosis whole-genome microarray representing over 95% of the predicted coding sequences to examine the genetic conservation among 10 M. avium subsp. paratuberculosis isolates, two isolates each of Mycobacterium avium subsp. silvaticum and Mycobacterium avium subsp. avium, and a single isolate each of both Mycobacterium intracellulare and Mycobacterium smegmatis. Genomic DNA from each isolate was competitively hybridized with DNA from M. avium subsp. paratuberculosis K10, and open reading frames (ORFs) were classified as present, divergent, or intermediate. None of the M. avium subsp. paratuberculosis isolates had ORFs classified as divergent. The two M. avium subsp. avium isolates had 210 and 135 divergent ORFs, while the two M. avium subsp. silvaticum isolates examined had 77 and 103 divergent ORFs. Similarly, 130 divergent ORFs were identified in M. intracellulare. A set of 97 ORFs were classified as divergent or intermediate in all of the nonparatuberculosis MAC isolates tested. Many of these ORFs are clustered together on the genome in regions with relatively low average GC content compared with the entire genome and contain mobile genetic elements. One of these regions of sequence divergence contained genes homologous to a mammalian cell entry (mce) operon. Our results indicate that closely related MAC mycobacteria can be distinguished from M. avium subsp. paratuberculosis by multiple clusters of divergent ORFs. PMID:15774884

  1. Mycobacterium tuberculosis Lineage 7 Strains Are Associated with Prolonged Patient Delay in Seeking Treatment for Pulmonary Tuberculosis in Amhara Region, Ethiopia

    PubMed Central

    Norheim, Gunnstein; Namouchi, Amine; Zegeye, Ephrem D.; Kinander, Wibeke; Tønjum, Tone; Bekele, Shiferaw; Mannsåker, Turid; Bjune, Gunnar; Aseffa, Abraham; Holm-Hansen, Carol

    2015-01-01

    Recent genotyping studies of Mycobacterium tuberculosis in Ethiopia have reported the identification of a new phylogenetically distinct M. tuberculosis lineage, lineage 7. We therefore investigated the genetic diversity and association of specific M. tuberculosis lineages with sociodemographic and clinical parameters among pulmonary TB patients in the Amhara Region, Ethiopia. DNA was isolated from M. tuberculosis-positive sputum specimens (n = 240) and analyzed by PCR and 24-locus mycobacterial interspersed repetitive unit–variable-number tandem-repeat (MIRU-VNTR) analysis and spoligotyping. Bioinformatic analysis assigned the M. tuberculosis genotypes to global lineages, and associations between patient characteristics and genotype were evaluated using logistic regression analysis. The study revealed a high diversity of modern and premodern M. tuberculosis lineages, among which approximately 25% were not previously reported. Among the M. tuberculosis strains (n = 138) assigned to seven subgroups, the largest cluster belonged to the lineage Central Asian (CAS) (n = 60; 26.0%), the second largest to lineage 7 (n = 36; 15.6%), and the third largest to the lineage Haarlem (n = 35; 15.2%). Four sublineages were new in the MIRU-VNTRplus database, designated NW-ETH3, NW-ETH1, NW-ETH2, and NW-ETH4, which included 24 (10.4%), 18 (7.8%), 8 (3.5%), and 5 (2.2%) isolates, respectively. Notably, patient delay in seeking treatment was significantly longer among patients infected with lineage 7 strains (Mann-Whitney test, P < 0.008) than in patients infected with CAS strains (adjusted odds ratio [AOR], 4.7; 95% confidence interval [CI], 1.6 to 13.5). Lineage 7 strains also grew more slowly than other M. tuberculosis strains. Cases of Haarlem (OR, 2.8; 95% CI, 1.2 to 6.6) and NW-ETH3 (OR, 2.8; 95% CI, 1.0 to 7.3) infection appeared in defined clusters. Intensified active case finding and contact tracing activities in the study region are needed to expedite diagnosis and

  2. Analysis of mycolic acid cleavage products and cellular fatty acids of Mycobacterium species by capillary gas chromatography.

    PubMed

    Lambert, M A; Moss, C W; Silcox, V A; Good, R C

    1986-04-01

    After growth and experimental conditions were established, the mycolic acid cleavage products, constituent fatty acids, and alcohols of representative strains of Mycobacterium tuberculosis, M. smegmatis, M. fortuitum complex, M. kansasii, M. gordonae, and M. avium complex were determined by capillary gas chromatography. Reproducible cleavage of mycolic acid methyl esters to tetracosanoic (24:0) or hexacosanoic (26:0) acid methyl esters was achieved by heating the sample in a high-temperature muffle furnace. The major constituent fatty acids in all species were hexadecanoic (16:0) and octadecenoic (18:1 omega 9-c, oleic) acids. With the exception of M. gordonae, 10-methyloctadecanoic acid was found in all species; moreover, M. gordonae was the only species tested which contained 2-methyltetradecanoic acid. M. kansasii was characterized by the presence of 2,4-dimethyltetradecanoic acid, M. avium complex by 2-eicosanol, and M. tuberculosis by 26:0 mycolic acid cleavage product. The mycolic acid cleavage product in the other five species tested was 24:0. Although a limited number of strains and species were tested, preliminary results indicate that this gas chromatographic method can be used to characterize mycobacterial cultures by their mycolic acid cleavage products and constituent fatty acid and alcohol content. PMID:3084554

  3. Biochemical characterization of recombinant guaA-encoded guanosine monophosphate synthetase (EC 6.3.5.2) from Mycobacterium tuberculosis H37Rv strain.

    PubMed

    Franco, Tathyana Mar A; Rostirolla, Diana C; Ducati, Rodrigo G; Lorenzini, Daniel M; Basso, Luiz A; Santos, Diógenes S

    2012-01-01

    Administration of the current tuberculosis (TB) vaccine to newborns is not a reliable route for preventing TB in adults. The conversion of XMP to GMP is catalyzed by guaA-encoded GMP synthetase (GMPS), and deletions in the Shiguella flexneri guaBA operon led to an attenuated auxotrophic strain. Here we present the cloning, expression, and purification of recombinant guaA-encoded GMPS from Mycobacterium tuberculosis (MtGMPS). Mass spectrometry data, oligomeric state determination, steady-state kinetics, isothermal titration calorimetry (ITC), and multiple sequence alignment are also presented. The homodimeric MtGMPS catalyzes the conversion of XMP, MgATP, and glutamine into GMP, ADP, PP(i), and glutamate. XMP, NH(4)(+), and Mg(2+) displayed positive homotropic cooperativity, whereas ATP and glutamine displayed hyperbolic saturation curves. The activity of ATP pyrophosphatase domain is independent of glutamine amidotransferase domain, whereas the latter cannot catalyze hydrolysis of glutamine to NH(3) and glutamate in the absence of substrates. ITC data suggest random order of binding of substrates, and PP(i) is the last product released. Sequence comparison analysis showed conservation of both Cys-His-Glu catalytic triad of N-terminal Class I amidotransferase and of amino acid residues of the P-loop of the N-type ATP pyrophosphatase family. PMID:22119138

  4. Inflammasomes-dependent regulation of IL-1β secretion induced by the virulent Mycobacterium bovis Beijing strain in THP-1 macrophages.

    PubMed

    Zhou, Yang; Zhao, Deming; Yue, Ruichao; Khan, Sher Hayat; Shah, Syed Zahid Ali; Yin, Xiaomin; Yang, Lifeng; Zhang, Zhongqiu; Zhou, Xiangmei

    2015-07-01

    Mycobacterium bovis is the causative agent of tuberculosis in cattle. Infection of macrophages with M. bovis leads to the activation of the "nucleotide binding and oligomerization, leucine-rich repeat and pyrin domains-containing protein 3" (NLRP3) and "absent in melanoma 2" (AIM2) inflammasomes, which in turn triggers release of the proinflammatory cytokine interleukin-1β (IL-1β) that contributes to bacterial clearance and plays a crucial role in the host defense. However, NLRP3 and AIM2 inflammasome activation is influenced by several factors and how IL-1β secretion by M. bovis-infected macrophages is regulated via the inflammasome pathway remains unclear. Here we found that IL-1β secretion and pro-IL-1β protein accumulation were inhibited in THP-1 macrophages upon exposure to the virulent M. bovis Beijing strain in the presence of high K(+) concentrations, cycloheximide (a protein synthesis inhibitor) and PR-619 (a deubiquitinating enzyme inhibitor). Scavenging reactive oxygen species (ROS) induced by N-acetylcysteine reduced IL-1β release independent of the mitochondrial permeability transition. Collectively, our results suggest that IL-1β secretion by M. bovis-infected THP-1 macrophages is reduced by high extracellular K(+) concentration, inhibition of new protein synthesis, deubiquitination, and ROS generation. PMID:25980833

  5. Enhanced and durable protective immune responses induced by a cocktail of recombinant BCG strains expressing antigens of multistage of Mycobacterium tuberculosis.

    PubMed

    Liang, Jinping; Teng, Xindong; Yuan, Xuefeng; Zhang, Ying; Shi, Chunwei; Yue, Tingting; Zhou, Lei; Li, Jianrong; Fan, Xionglin

    2015-08-01

    Although Bacillus Calmette-Guérin (BCG) vaccine confers protection from Mycobacterium tuberculosis infection in children, its immune protection gradually wanes over time, and consequently leads to an inability to prevent the reactivation of latent infection of M. tuberculosis. Therefore, improving BCG for better control of tuberculosis (TB) is urgently needed. We thus hypothesized that recombinant BCG overexpressing immunodominant antigens expressed at different growth stages of M. tuberculosis could provide a more comprehensive protection against primary and latent M. tuberculosis infection. Here, a novel cocktail of recombinant BCG (rBCG) strains, namely ABX, was produced by combining rBCG::85A, rBCG::85B, and rBCG::X, which overexpressed respective multistage antigens Ag85A, Ag85B, and HspX of M. tuberculosis. Our results showed that ABX was able to induce a stronger immune protection than individual rBCGs or BCG against primary TB infection in C57BL/6 mice. Mechanistically, the immune protection was attributed to stronger antigen-specific CD4(+) Th1 responses, higher numbers of IFN-γ(+) CD4(+) TEM and IL-2(+) CD8(+) TCM cells elicited by ABX. These findings thus provide a novel strategy for the improvement of BCG efficacy and potentially a promising prophylactic TB vaccine candidate, warranting further investigation. PMID:25974877

  6. Evaluation of the effect of Pulicaria gnaphalodes and Perovskia abrotanoides essential oil extracts against Mycobacterium tuberculosis strains

    PubMed Central

    Hozoorbakhsh, Fereshte; Esfahani, Bahram Nasr; Moghim, Sharareh; Asghari, Gholamreza

    2016-01-01

    Background: Mycobacterium tuberculosis (MTB) is the causative agent of tuberculosis (TB), which remains one of the major public health problems in the world. The increasing incidence of multidrug-resistant tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB) worldwide highlights the urgent need to search for alternative antimycobacterial agents. More and more people in developing countries utilize traditional medicine for their major primary health care needs. It has been determined that the medicinal plants Pulicaria gnaphalodes and Perovskia abrotanoides possess strong antibacterial effect. Materials and Methods: In this study, the antimycobacterial effects of P. gnaphalodes and P. abrotanoides essential oil on MTB were examined. Essential oil was prepared from P. gnaphalodes aerial parts and P. abrotanoides flower. The effects of six different concentrations (20 μg/ml, 40 μg/ml, 80 μg/ml, 160 μg/ml, 320 μg/ml, and 640 μg/ml) were examined against sensitive isolates of MTB and MTB H37Rv (ATCC 27294). Results: The results showed that P. gnaphalodes and P. abrotanoides essential oil extracts have strong inhibitory effects on MTB. This activity for P. gnaphalodes was observed from very low (4%) to good (70.9%) effect; meanwhile, this activity for P. abrotanoides was observed from very low (4%) to strong (86%) effect. Conclusion: The mean of inhibition percentage for P. gnaphalodes and P. abrotanoides in 640 μg/ml was 58.1% and 76.2%, respectively. So, P. abrotanoides plant is more effective against MTB than P. gnaphalodes. Identification of the effective fraction against MTB is a further step to be studied. PMID:27195252

  7. Importance of Porins for Biocide Efficacy against Mycobacterium smegmatis▿

    PubMed Central

    Frenzel, Elrike; Schmidt, Stefan; Niederweis, Michael; Steinhauer, Katrin

    2011-01-01

    Mycobacteria are among the microorganisms least susceptible to biocides but cause devastating diseases, such as tuberculosis, and increasingly opportunistic infections. The exceptional resistance of mycobacteria to toxic solutes is due to an unusual outer membrane, which acts as an efficient permeability barrier, in synergy with other resistance mechanisms. Porins are channel-forming proteins in the outer membrane of mycobacteria. In this study we used the alamarBlue assay to show that the deletion of Msp porins in isogenic mutants increased the resistance of Mycobacterium smegmatis to isothiazolinones (methylchloroisothiazolinone [MCI]/methylisothiazolinone [MI] and octylisothiazolinone [2-n-octyl-4-isothiazolin-3-one; OIT]), formaldehyde-releasing biocides {hexahydrotriazine [1,3,5-tris (2-hydroxyethyl)-hexahydrotriazine; HHT] and methylenbisoxazolidine [N,N′-methylene-bis-5-(methyloxazolidine); MBO]}, and the lipophilic biocides polyhexamethylene biguanide and octenidine dihydrochloride 2- to 16-fold. Furthermore, the susceptibility of the porin triple mutant against a complex disinfectant was decreased 8-fold compared to wild-type (wt) M. smegmatis. Efficacy testing in the quantitative suspension test EN 14348 revealed 100-fold improved survival of the porin mutant in the presence of this biocide. These findings underline the importance of porins for the susceptibility of M. smegmatis to biocides. PMID:21398489

  8. Genotype MTBDRplus for Direct Detection of Mycobacterium tuberculosis and Drug Resistance in Strains from Gold Miners in South Africa

    PubMed Central

    Chihota, Violet N.; Lewis, James J.; van der Meulen, Minty; Mathema, Barun; Beylis, Natalie; Fielding, Katherine L.; Grant, Alison D.; Churchyard, Gavin J.

    2012-01-01

    GenoType MTBDRplus is a molecular assay for detection of Mycobacterium tuberculosis and drug resistance. Assay performance as applied directly to consecutive unselected sputum samples has not been established. The objective of this study was to determine the accuracy of the MTBDRplus test for direct detection of M. tuberculosis (in sputum) and for drug resistance in consecutively submitted sputum samples. In this cross-sectional study in South Africa, one sputum specimen from each person suspected of having pulmonary tuberculosis was tested by smear microscopy, direct MTBDRplus, and Mycobacterial Growth Indicator Tube (MGIT) culture with MGIT drug susceptibility testing. MGIT results were the reference standard. We tested 2,510 sputum samples, and 529 (21.1%) were positive for M. tuberculosis by MGIT. Direct MTBDRplus identified M. tuberculosis in 256 of 529 specimens (sensitivity, 48.4%; 95% confidence interval [CI], 44.1, 52.7). The sensitivity of MTBDRplus for M. tuberculosis detection by sputum smear status was as follows: smear negative, 13.7% (95% CI, 9.8, 18.4); smear scanty, 46.2% (95% CI, 19.2, 74.9); smear 1+, 69.1% (95% CI, 55.2, 80.9); smear 2+, 86.3% (95% CI, 73.7, 94.3); smear 3+, 89.8% (95% CI, 83.7, 94.2). Direct MTBDRplus testing was negative for 1,594/1,612 sputum samples that were culture negative for M. tuberculosis (specificity, 98.9%; 95% CI, 98.2, 99.3). For specimens positive for M. tuberculosis by MTBDRplus, this assay's sensitivity and specificity for rifampin resistance were 85.7% (95% CI, 57.2, 98.2) and 96.6% (95% CI, 93.2, 98.6) and for isoniazid resistance they were 62.1% (95% CI, 42.3, 79.3) and 97.9% (95% CI, 94.8, 99.4). For sputum testing, the sensitivity of MTBDRplus is directly related to the specimen's bacillary burden. Our results support recommendations that the MTBDRplus test not be used for direct testing of smear-negative or paucibacillary sputum samples. PMID:22238443

  9. Tuberculosis in Sudan: a study of Mycobacterium tuberculosis strain genotype and susceptibility to anti-tuberculosis drugs

    PubMed Central

    2011-01-01

    Background Sudan is a large country with a diverse population and history of civil conflict. Poverty levels are high with a gross national income per capita of less than two thousand dollars. The country has a high burden of tuberculosis (TB) with an estimated 50,000 incident cases during 2009, when the estimated prevalence was 209 cases per 100,000 of the population. Few studies have been undertaken on TB in Sudan and the prevalence of drug resistant disease is not known. Methods In this study Mycobacterium tuberculosis isolates from 235 patients attending three treatment centers in Sudan were screened for susceptibility to isoniazid, rifampicin, ethambutol and streptomycin by the proportion method on Lowenstein Jensen media. 232 isolates were also genotyped by spoligotyping. Demographic details of patients were recorded using a structured questionnaire. Statistical analyses were conducted to examine the associations between drug resistance with risk ratios computed for a set of risk factors (gender, age, case status - new or relapse, geographic origin of the patient, spoligotype, number of people per room, marital status and type of housing). Results Multi drug-resistant tuberculosis (MDR-TB), being resistance to at least rifampicin and isoniazid, was found in 5% (95% CI: 2,8) of new cases and 24% (95% CI: 14,34) of previously treated patients. Drug resistance was associated with previous treatment with risk ratios of 3.51 (95% CI: 2.69-4.60; p < 0.001) for resistance to any drug and 5.23 (95% CI: 2.30-11.90; p < 0.001) for MDR-TB. Resistance was also associated with the geographic region of origin of the patient, being most frequently observed in patients from the Northern region and least in the Eastern region with risk ratios of 7.43 (95%CI:3.42,16.18; p: < 0.001) and 14.09 (95%CI:1.80,110.53; p:0.026) for resistance to any drug and MDR-TB. The major genotype observed was of the Central Asia spoligotype family (CAS1_Delhi), representing 49% of the 232 isolates

  10. MycoCAP - Mycobacterium Comparative Analysis Platform

    PubMed Central

    Choo, Siew Woh; Ang, Mia Yang; Dutta, Avirup; Tan, Shi Yang; Siow, Cheuk Chuen; Heydari, Hamed; Mutha, Naresh V. R.; Wee, Wei Yee; Wong, Guat Jah

    2015-01-01

    Mycobacterium spp. are renowned for being the causative agent of diseases like leprosy, Buruli ulcer and tuberculosis in human beings. With more and more mycobacterial genomes being sequenced, any knowledge generated from comparative genomic analysis would provide better insights into the biology, evolution, phylogeny and pathogenicity of this genus, thus helping in better management of diseases caused by Mycobacterium spp.With this motivation, we constructed MycoCAP, a new comparative analysis platform dedicated to the important genus Mycobacterium. This platform currently provides information of 2108 genome sequences of at least 55 Mycobacterium spp. A number of intuitive web-based tools have been integrated in MycoCAP particularly for comparative analysis including the PGC tool for comparison between two genomes, PathoProT for comparing the virulence genes among the Mycobacterium strains and the SuperClassification tool for the phylogenic classification of the Mycobacterium strains and a specialized classification system for strains of Mycobacterium abscessus. We hope the broad range of functions and easy-to-use tools provided in MycoCAP makes it an invaluable analysis platform to speed up the research discovery on mycobacteria for researchers. Database URL: http://mycobacterium.um.edu.my PMID:26666970

  11. MycoCAP - Mycobacterium Comparative Analysis Platform.

    PubMed

    Choo, Siew Woh; Ang, Mia Yang; Dutta, Avirup; Tan, Shi Yang; Siow, Cheuk Chuen; Heydari, Hamed; Mutha, Naresh V R; Wee, Wei Yee; Wong, Guat Jah

    2015-01-01

    Mycobacterium spp. are renowned for being the causative agent of diseases like leprosy, Buruli ulcer and tuberculosis in human beings. With more and more mycobacterial genomes being sequenced, any knowledge generated from comparative genomic analysis would provide better insights into the biology, evolution, phylogeny and pathogenicity of this genus, thus helping in better management of diseases caused by Mycobacterium spp.With this motivation, we constructed MycoCAP, a new comparative analysis platform dedicated to the important genus Mycobacterium. This platform currently provides information of 2108 genome sequences of at least 55 Mycobacterium spp. A number of intuitive web-based tools have been integrated in MycoCAP particularly for comparative analysis including the PGC tool for comparison between two genomes, PathoProT for comparing the virulence genes among the Mycobacterium strains and the SuperClassification tool for the phylogenic classification of the Mycobacterium strains and a specialized classification system for strains of Mycobacterium abscessus. We hope the broad range of functions and easy-to-use tools provided in MycoCAP makes it an invaluable analysis platform to speed up the research discovery on mycobacteria for researchers. Database URL: http://mycobacterium.um.edu.my. PMID:26666970

  12. Genes involved in the methyl tert-butyl ether (MTBE) metabolic pathway of Mycobacterium austroafricanum IFP 2012.

    PubMed

    Lopes Ferreira, Nicolas; Labbé, Diane; Monot, Frédéric; Fayolle-Guichard, Françoise; Greer, Charles W

    2006-05-01

    Methyl tert-butyl ether (MTBE) is a persistent pollutant of surface and groundwater, and the reasons for its low biodegradability are poorly documented. Using one of the rare bacterial strains able to grow in the presence of MTBE, Mycobacterium austroafricanum IFP 2012, the protein profiles of crude extracts after growth in the presence of MTBE and glucose were compared by SDS-PAGE. Ten proteins with molecular masses of 67, 64, 63, 55, 50, 27, 24, 17, 14 and 11 kDa were induced after growth in the presence of MTBE. Partial amino acid sequences of N-terminal and internal peptide fragments of the 64 kDa protein were used to design degenerate oligonucleotide primers to amplify total DNA by PCR, yielding a DNA fragment that was used as a probe for cloning. A two-step cloning procedure was performed to obtain a 10 327 bp genomic DNA fragment containing seven ORFs, including a putative regulator, mpdR, and four genes, mpdC, orf1, mpdB and orf2, in the same cluster. The MpdB protein (64 kDa) was related to a flavoprotein of the glucose-methanol-choline oxidoreductase family, and the MpdC protein (55 kDa) showed a high similarity with NAD(P) aldehyde dehydrogenases. Heterologous expression of these gene products was performed in Mycobacterium smegmatis mc2 155. The recombinant strain was able to degrade an intermediate of MTBE biodegradation, 2-methyl 1,2-propanediol, to hydroxyisobutyric acid. This is believed to be the first report of the cloning and characterization of a cluster of genes specifically involved in the MTBE biodegradation pathway of M. austroafricanum IFP 2012. PMID:16622053

  13. Tailored Polymeric Membranes for Mycobacterium Smegmatis Porin A (MspA) Based Biosensors

    PubMed Central

    Morton, Danielle; Mortezaei, Shahab; Yemenicioglu, Sukru; Isaacman, Michael J.; Nova, Ian C.; Gundlach, Jens H.; Theogarajan, Luke

    2015-01-01

    Nanopores based on protein channels inserted into lipid membranes have paved the way towards a wide-range of inexpensive biosensors, especially for DNA sequencing. A key obstacle in using these biological ion channels as nanodevices is the poor stability of lipid bilayer membranes. Amphiphilic block copolymer membranes have emerged as a robust alternative to lipid membranes. While previous efforts have shown feasibility, we demonstrate for the first time the effect of polymer composition on MspA protein functionality. We show that membrane-protein interaction depends on the hydrophobic-hydrophilic ratio (f-ratio) of the block copolymer. These effects are particularly pronounced in asymmetric protein pores like MspA compared to the cylindrical α-Hemolysin pore. A key effect of membrane-protein interaction is the increased 1/fα noise. After first showing increases in 1/fα behaviour arise from increased substate activity, the noise power spectral density S(f) was used as a qualitative tool for understanding protein-membrane interactions in polymer membranes. Polymer compositions with f-ratios close to lipid membranes caused noise behaviour not observed in lipid membranes. However, by modifying the f-ratio using a modular synthetic approach, we were able to design a block copolymer exhibiting noise properties similar to a lipid membrane, albeit with better stability. Thus, by careful optimization, block copolymer membranes can emerge as a robust alternative for protein-pore based nano-biosensors. PMID:26413301

  14. Rapid molecular detection of inducible macrolide resistance in Mycobacterium chelonae and M. abscessus strains: a replacement for 14-day susceptibility testing?

    PubMed

    Hanson, Kimberly E; Slechta, E Susan; Muir, Haleina; Barker, Adam P

    2014-05-01

    The erm(41) gene causes inducible macrolide resistance in Mycobacterium abscessus but not Mycobacterium chelonae. erm(41) sequencing of 285 M. abscessus and 45 M. chelonae isolates was compared to 14-day susceptibility; agreement percentages were 98.9% and 100%, respectively. Extended incubation may not be necessary for M. chelonae, and the erm(41) genotype is a useful adjunct for M. abscessus. PMID:24554745

  15. Effect of milk fermentation by kefir grains and selected single strains of lactic acid bacteria on the survival of Mycobacterium bovis BCG.

    PubMed

    Macuamule, C L S; Wiid, I J; van Helden, P D; Tanner, M; Witthuhn, R C

    2016-01-18

    Mycobacterium bovis that causes Bovine tuberculosis (BTB) can be transmitted to humans thought consumption of raw and raw fermented milk products from diseased animals. Lactic acid bacteria (LAB) used in popular traditional milk products in Africa produce anti-microbial compounds that inhibit some pathogenic and spoilage bacteria. M. bovis BCG is an attenuated non-pathogenic vaccine strain of M. bovis and the aim of the study was to determine the effect of the fermentation process on the survival of M. bovis BCG in milk. M. bovis BCG at concentrations of 6 log CFU/ml was added to products of kefir fermentation. The survival of M. bovis BCG was monitored at 12-h intervals for 72 h by enumerating viable cells on Middlebrook 7H10 agar plates enriched with 2% BD BACTEC PANTA™. M. bovis BCG was increasingly reduced in sterile kefir that was fermented for a period of 24h and longer. In the milk fermented with kefir grains, Lactobacillus paracasei subsp. paracasei or Lactobacillus casei, the viability of M. bovis BCG was reduced by 0.4 logs after 24h and by 2 logs after 48 h of fermentation. No viable M. bovis BCG was detected after 60 h of fermentation. Results from this study show that long term fermentation under certain conditions may have the potential to inactivate M. bovis BCG present in the milk. However, to ensure safety of fermented milk in Africa, fermentation should be combined with other hurdle technologies such as boiling and milk pasteurisation. PMID:26544204

  16. Structural basis for the inhibition of Mycobacterium tuberculosis l,d-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains

    PubMed Central

    Kim, Hyoun Sook; Kim, Jieun; Im, Ha Na; Yoon, Ji Young; An, Doo Ri; Yoon, Hye Jin; Kim, Jin Young; Min, Hye Kyeoung; Kim, Soon-Jong; Lee, Jae Young; Han, Byung Woo; Suh, Se Won

    2013-01-01

    Difficulty in the treatment of tuberculosis and growing drug resistance in Mycobacterium tuberculosis (Mtb) are a global health issue. Carbapenems inactivate l,d-transpeptidases; meropenem, when administered with clavulanate, showed in vivo activity against extensively drug-resistant Mtb strains. LdtMt2 (Rv2518c), one of two functional l,d-transpeptidases in Mtb, is predominantly expressed over LdtMt1 (Rv0116c). Here, the crystal structure of N-terminally truncated LdtMt2 (residues Leu131–Ala408) is reported in both ligand-free and meropenem-bound forms. The structure of meropenem-inhibited LdtMt2 provides a detailed structural view of the interactions between a carbapenem drug and Mtb l,d-transpeptidase. The structures revealed that the catalytic l,d-­transpeptidase domain of LdtMt2 is preceded by a bacterial immunogloblin-like Big_5 domain and is followed by an extended C-terminal tail that interacts with both domains. Furthermore, it is shown using mass analyses that meropenem acts as a suicide inhibitor of LdtMt2. Upon acylation of the catalytic Cys354 by meropenem, the ‘active-site lid’ undergoes a large conformational change to partially cover the active site so that the bound meropenem is accessible to the bulk solvent via three narrow paths. This work will facilitate structure-guided discovery of l,d-transpeptidase inhibitors as novel antituberculosis drugs against drug-resistant Mtb. PMID:23519417

  17. Biochemical and biophysical characterisation of haloalkane dehalogenases DmrA and DmrB in Mycobacterium strain JS60 and their role in growth on haloalkanes.

    PubMed

    Fung, Herman K H; Gadd, Morgan S; Drury, Thomas A; Cheung, Samantha; Guss, J Mitchell; Coleman, Nicholas V; Matthews, Jacqueline M

    2015-08-01

    Haloalkane dehalogenases (HLDs) catalyse the hydrolysis of haloalkanes to alcohols, offering a biological solution for toxic haloalkane industrial wastes. Hundreds of putative HLD genes have been identified in bacterial genomes, but relatively few enzymes have been characterised. We identified two novel HLDs in the genome of Mycobacterium rhodesiae strain JS60, an isolate from an organochlorine-contaminated site: DmrA and DmrB. Both recombinant enzymes were active against C2-C6 haloalkanes, with a preference for brominated linear substrates. However, DmrA had higher activity against a wider range of substrates. The kinetic parameters of DmrA with 4-bromobutyronitrile as a substrate were Km  = 1.9 ± 0.2 mM, kcat  = 3.1 ± 0.2 s(-1) . DmrB showed the highest activity against 1-bromohexane. DmrA is monomeric, whereas DmrB is tetrameric. We determined the crystal structure of selenomethionyl DmrA to 1.7 Å resolution. A spacious active site and alternate conformations of a methionine side-chain in the slot access tunnel may contribute to the broad substrate activity of DmrA. We show that M. rhodesiae JS60 can utilise 1-iodopropane, 1-iodobutane and 1-bromobutane as sole carbon and energy sources. This ability appears to be conferred predominantly through DmrA, which shows significantly higher levels of upregulation in response to haloalkanes than DmrB. PMID:25899475

  18. Role of the pks15/1 gene in the biosynthesis of phenolglycolipids in the Mycobacterium tuberculosis complex. Evidence that all strains synthesize glycosylated p-hydroxybenzoic methyl esters and that strains devoid of phenolglycolipids harbor a frameshift mutation in the pks15/1 gene.

    PubMed

    Constant, Patricia; Perez, Esther; Malaga, Wladimir; Lanéelle, Marie-Antoinette; Saurel, Olivier; Daffé, Mamadou; Guilhot, Christophe

    2002-10-11

    Diesters of phthiocerol and phenolphthiocerol are important virulence factors of Mycobacterium tuberculosis and Mycobacterium leprae, the two main mycobacterial pathogens in humans. They are both long-chain beta-diols, and their biosynthetic pathway is beginning to be elucidated. Although the two classes of molecules share a common lipid core, phthiocerol diesters have been found in all the strains of the M. tuberculosis complex examined although phenolphthiocerol diesters are produced by only a few groups of strains. To address the question of the origin of this diversity 8 reference strains and 10 clinical isolates of M. tuberculosis were analyzed. We report the presence of glycosylated p-hydroxybenzoic acid methyl esters, structurally related to the type-specific phenolphthiocerol glycolipids, in the culture media of all reference strains of M. tuberculosis, suggesting that the strains devoid of phenolphthiocerol derivatives are unable to elongate the putative p-hydroxybenzoic acid precursor. We also show that all the strains of M. tuberculosis examined and deficient in the production of phenolphthiocerol derivatives are natural mutants with a frameshift mutation in pks15/1 whereas a single open reading frame for pks15/1 is found in Mycobacterium bovis BCG, M. leprae, and strains of M. tuberculosis that produce phenolphthiocerol derivatives. Complementation of the H37Rv strain of M. tuberculosis, which is devoid of phenolphthiocerol derivatives, with the fused pks15/1 gene from M. bovis BCG restored phenolphthiocerol glycolipids production. Conversely, disruption of the pks15/1 gene in M. bovis BCG led to the abolition of the synthesis of type-specific phenolphthiocerol glycolipid. These data indicate that Pks15/1 is involved in the elongation of p-hydroxybenzoic acid to give p-hydroxyphenylalkanoates, which in turn are converted, presumably by the PpsA-E synthase, to phenolphthiocerol derivatives. PMID:12138124

  19. Autophagy Gene Variant IRGM −261T Contributes to Protection from Tuberculosis Caused by Mycobacterium tuberculosis but Not by M. africanum Strains

    PubMed Central

    Browne, Edmund N. L.; Amanua Chinbuah, Margaret; Enimil, Anthony; Gyapong, John; Osei, Ivy; Owusu-Dabo, Ellis; Helm, Susanne; Rüsch-Gerdes, Sabine; Horstmann, Rolf D.; Meyer, Christian G.

    2009-01-01

    The human immunity-related GTPase M (IRGM) has been shown to be critically involved in regulating autophagy as a means of disposing cytosolic cellular structures and of reducing the growth of intracellular pathogens in vitro. This includes Mycobacterium tuberculosis, which is in agreement with findings indicating that M. tuberculosis translocates from the phagolysosome into the cytosol of infected cells, where it becomes exposed to autophagy. To test whether IRGM plays a role in human infection, we studied IRGM gene variants in 2010 patients with pulmonary tuberculosis (TB) and 2346 unaffected controls. Mycobacterial clades were classified by spoligotyping, IS6110 fingerprinting and genotyping of the pks1/15 deletion. The IRGM genotype −261TT was negatively associated with TB caused by M. tuberculosis (OR 0.66, CI 0.52–0.84, Pnominal 0.0009, Pcorrected 0.0045) and not with TB caused by M. africanum or M. bovis (OR 0.95, CI 0.70–1.30. P 0.8). Further stratification for mycobacterial clades revealed that the protective effect applied only to M. tuberculosis strains with a damaged pks1/15 gene which is characteristic for the Euro-American (EUAM) subgroup of M. tuberculosis (OR 0.63, CI 0.49–0.81, Pnominal 0.0004, Pcorrected 0.0019). Our results, including those of luciferase reporter gene assays with the IRGM variants −261C and −261T, suggest a role for IRGM and autophagy in protection of humans against natural infection with M. tuberculosis EUAM clades. Moreover, they support in vitro findings indicating that TB lineages capable of producing a distinct mycobacterial phenolic glycolipid that occurs exclusively in strains with an intact pks1/15 gene inhibit innate immune responses in which IRGM contributes to the control of autophagy. Finally, they raise the possibility that the increased frequency of the IRGM −261TT genotype may have contributed to the establishment of M. africanum as a pathogen in the West African population. PMID:19750224

  20. Rv1698 of Mycobacterium tuberculosis represents a new class of channel-forming outer membrane proteins.

    PubMed

    Siroy, Axel; Mailaender, Claudia; Harder, Daniel; Koerber, Stephanie; Wolschendorf, Frank; Danilchanka, Olga; Wang, Ying; Heinz, Christian; Niederweis, Michael

    2008-06-27

    Mycobacteria contain an outer membrane composed of mycolic acids and a large variety of other lipids. Its protective function is an essential virulence factor of Mycobacterium tuberculosis. Only OmpA, which has numerous homologs in Gram-negative bacteria, is known to form channels in the outer membrane of M. tuberculosis so far. Rv1698 was predicted to be an outer membrane protein of unknown function. Expression of rv1698 restored the sensitivity to ampicillin and chloramphenicol of a Mycobacterium smegmatis mutant lacking the main porin MspA. Uptake experiments showed that Rv1698 partially complemented the permeability defect of the M. smegmatis porin mutant for glucose. These results indicated that Rv1698 provides an unspecific pore that can partially substitute for MspA. Lipid bilayer experiments demonstrated that purified Rv1698 is an integral membrane protein that indeed produces channels. The main single channel conductance is 4.5 +/- 0.3 nanosiemens in 1 M KCl. Zero current potential measurements revealed a weak preference for cations. Whole cell digestion of recombinant M. smegmatis with proteinase K showed that Rv1698 is surface-accessible. Taken together, these experiments demonstrated that Rv1698 is a channel protein that is likely involved in transport processes across the outer membrane of M. tuberculosis. Rv1698 has single homologs of unknown functions in Corynebacterineae and thus represents the first member of a new class of channel proteins specific for mycolic acid-containing outer membranes. PMID:18434314

  1. Mycobacterium saopaulense sp. nov., a rapidly growing mycobacterium closely related to members of the Mycobacterium chelonae--Mycobacterium abscessus group.

    PubMed

    Nogueira, Christiane Lourenço; Whipps, Christopher M; Matsumoto, Cristianne Kayoko; Chimara, Erica; Droz, Sara; Tortoli, Enrico; de Freitas, Denise; Cnockaert, Margo; Palomino, Juan Carlos; Martin, Anandi; Vandamme, Peter; Leão, Sylvia Cardoso

    2015-12-01

    Five isolates of non-pigmented, rapidly growing mycobacteria were isolated from three patients and,in an earlier study, from zebrafish. Phenotypic and molecular tests confirmed that these isolates belong to the Mycobacterium chelonae-Mycobacterium abscessus group, but they could not be confidently assigned to any known species of this group. Phenotypic analysis and biochemical tests were not helpful for distinguishing these isolates from other members of the M. chelonae–M.abscessus group. The isolates presented higher drug resistance in comparison with other members of the group, showing susceptibility only to clarithromycin. The five isolates showed a unique PCR restriction analysis pattern of the hsp65 gene, 100 % similarity in 16S rRNA gene and hsp65 sequences and 1-2 nt differences in rpoB and internal transcribed spacer (ITS) sequences.Phylogenetic analysis of a concatenated dataset including 16S rRNA gene, hsp65, and rpoB sequences from type strains of more closely related species placed the five isolates together, as a distinct lineage from previously described species, suggesting a sister relationship to a group consisting of M. chelonae, Mycobacterium salmoniphilum, Mycobacterium franklinii and Mycobacterium immunogenum. DNA–DNA hybridization values .70 % confirmed that the five isolates belong to the same species, while values ,70 % between one of the isolates and the type strains of M. chelonae and M. abscessus confirmed that the isolates belong to a distinct species. The polyphasic characterization of these isolates, supported by DNA–DNA hybridization results,demonstrated that they share characteristics with M. chelonae–M. abscessus members, butconstitute a different species, for which the name Mycobacterium saopaulense sp. nov. is proposed. The type strain is EPM10906T (5CCUG 66554T5LMG 28586T5INCQS 0733T). PMID:26358475

  2. Mycobacterium tuberculosis EsxO (Rv2346c) promotes bacillary survival by inducing oxidative stress mediated genomic instability in macrophages.

    PubMed

    Mohanty, Soumitra; Dal Molin, Michael; Ganguli, Geetanjali; Padhi, Avinash; Jena, Prajna; Selchow, Petra; Sengupta, Srabasti; Meuli, Michael; Sander, Peter; Sonawane, Avinash

    2016-01-01

    Mycobacterium tuberculosis (Mtb) survives inside the macrophages by modulating the host immune responses in its favor. The 6-kDa early secretory antigenic target (ESAT-6; esxA) of Mtb is known as a potent virulence and T-cell antigenic determinant. At least 23 such ESAT-6 family proteins are encoded in the genome of Mtb; however, the function of many of them is still unknown. We herein report that ectopic expression of Mtb Rv2346c (esxO), a member of ESAT-6 family proteins, in non-pathogenic Mycobacterium smegmatis strain (MsmRv2346c) aids host cell invasion and intracellular bacillary persistence. Further mechanistic studies revealed that MsmRv2346c infection abated macrophage immunity by inducing host cell death and genomic instability as evident from the appearance of several DNA damage markers. We further report that the induction of genomic instability in infected cells was due to increase in the hosts oxidative stress responses. MsmRv2346c infection was also found to induce autophagy and modulate the immune function of macrophages. In contrast, blockade of Rv2346c induced oxidative stress by treatment with ROS inhibitor N-acetyl-L-cysteine prevented the host cell death, autophagy induction and genomic instability in infected macrophages. Conversely, MtbΔRv2346c mutant did not show any difference in intracellular survival and oxidative stress responses. We envision that Mtb ESAT-6 family protein Rv2346c dampens antibacterial effector functions namely by inducing oxidative stress mediated genomic instability in infected macrophages, while loss of Rv2346c gene function may be compensated by other redundant ESAT-6 family proteins. Thus EsxO plays an important role in mycobacterial pathogenesis in the context of innate immunity. PMID:26786654

  3. The PE_PGRS Proteins of Mycobacterium tuberculosis Are Ca(2+) Binding Mediators of Host-Pathogen Interaction.

    PubMed

    Yeruva, Veena C; Kulkarni, Apoorva; Khandelwal, Radhika; Sharma, Yogendra; Raghunand, Tirumalai R

    2016-08-23

    The phenomenal success of Mycobacterium tuberculosis (M.tb) as a pathogen is primarily based on its ability to modulate host immune responses. The genome of M.tb encodes multiple immunomodulatory proteins, including several members of the multigenic PE_PPE family of which the PE_PGRS proteins are a subset. Curiously, 56 of the 61 PE_PGRS proteins contain multiple copies of the glycine-rich sequence motif GGXGXD/NXUX, a nonapeptide sequence predicted to bind Ca(2+), but the functional significance of these motifs remains a mystery. Here we provide evidence via isothermal titration calorimetry, (45)Ca blotting, fluorescence, and circular dichroism spectroscopy that Ca(2+) binds to the PE_PGRS proteins, PE_PGRS33 (Rv1818c) (10 motifs) and PE_PGRS61 (Rv3653) (one motif). Ca(2+) was observed not to bind to PE_PGRS8 (Rv0742), which lacks nonapeptide motifs. Using recombinant Mycobacterium smegmatis strains expressing Rv1818c and Rv3653 and the THP-1 macrophage model of infection, we show that the two proteins mediate Ca(2+)-dependent upregulation of the anti-inflammatory cytokine IL-10, events critical to the pathogenesis of M.tb. Both Rv1818c and Rv3653 interact with TLR2 in a Ca(2+)-dependent manner, providing a novel mechanistic basis for their immunomodulatory effects. Mutations in the nonapeptide motif of Rv3653 led to compromised Ca(2+) binding, validating the functional criticality of this motif. This study demonstrates for the first time not only their Ca(2+) binding properties but also an essential role for Ca(2+) in the functioning of the M.tb PE_PGRS proteins, opening up the possibility of developing novel anti-tuberculosis therapeutics that inhibit Ca(2+)-PE_PGRS binding. PMID:27483162

  4. Targeting Mycobacterium tuberculosis Tumor Necrosis Factor Alpha-Downregulating Genes for the Development of Antituberculous Vaccines

    PubMed Central

    Olsen, Aaron; Chen, Yong; Ji, Qingzhou; Zhu, Guofeng; De Silva, Aruna Dharshan; Vilchèze, Catherine; Weisbrod, Torin; Li, Weimin; Xu, Jiayong; Larsen, Michelle; Zhang, Jinghang; Porcelli, Steven A.; Jacobs, William R.

    2016-01-01

    ABSTRACT Tumor necrosis factor alpha (TNF) plays a critical role in the control of Mycobacterium tuberculosis, in part by augmenting T cell responses through promoting macrophage phagolysosomal fusion (thereby optimizing CD4+ T cell immunity by enhancing antigen presentation) and apoptosis (a process that can lead to cross-priming of CD8+ T cells). M. tuberculosis can evade antituberculosis (anti-TB) immunity by inhibiting host cell TNF production via expression of specific mycobacterial components. We hypothesized that M. tuberculosis mutants with an increased capacity to induce host cell TNF production (TNF-enhancing mutants) and thus with enhanced immunogenicity can be useful for vaccine development. To identify mycobacterial genes that regulate host cell TNF production, we used a TNF reporter macrophage clone to screen an H37Rv M. tuberculosis cosmid library constructed in M. smegmatis. The screen has identified a set of TNF-downregulating mycobacterial genes that, when deleted in H37Rv, generate TNF-enhancing mutants. Analysis of mutants disrupted for a subset of TNF-downregulating genes, annotated to code for triacylglycerol synthases and fatty acyl-coenzyme A (acyl-CoA) synthetase, enzymes that concern lipid biosynthesis and metabolism, has revealed that these strains can promote macrophage phagolysosomal fusion and apoptosis better than wild-type (WT) bacilli. Immunization of mice with the TNF-enhancing M. tuberculosis mutants elicits CD4+ and CD8+ T cell responses that are superior to those engendered by WT H37Rv. The results suggest that TNF-upregulating M. tuberculosis genes can be targeted to enhance the immunogenicity of mycobacterial strains that can serve as the substrates for the development of novel anti-TB vaccines. PMID:27247233

  5. Role of Metal-Dependent Regulation of ESX-3 Secretion in Intracellular Survival of Mycobacterium tuberculosis.

    PubMed

    Tinaztepe, Emir; Wei, Jun-Rong; Raynowska, Jenelle; Portal-Celhay, Cynthia; Thompson, Victor; Philips, Jennifer A

    2016-08-01

    More people die every year from Mycobacterium tuberculosis infection than from infection by any other bacterial pathogen. Type VII secretion systems (T7SS) are used by both environmental and pathogenic mycobacteria to secrete proteins across their complex cell envelope. In the nonpathogen Mycobacterium smegmatis, the ESX-1 T7SS plays a role in conjugation, and the ESX-3 T7SS is involved in metal homeostasis. In M. tuberculosis, these secretion systems have taken on roles in virulence, and they also are targets of the host immune response. ESX-3 secretes a heterodimer composed of EsxG (TB9.8) and EsxH (TB10.4), which impairs phagosome maturation in macrophages and is essential for virulence in mice. Given the importance of EsxG and EsxH during infection, we examined their regulation. With M. tuberculosis, the secretion of EsxG and EsxH was regulated in response to iron and zinc, in accordance with the previously described transcriptional response of the esx-3 locus to these metals. While iron regulated the esx-3 expression in both M. tuberculosis and M. smegmatis, there is a significant difference in the dynamics of this regulation. In M. smegmatis, the esx-3 locus behaved like other iron-regulated genes such as mbtB In M. tuberculosis, both iron and zinc modestly repressed esx-3 expression. Diminished secretion of EsxG and EsxH in response to these metals altered the interaction of M. tuberculosis with macrophages, leading to impaired intracellular M. tuberculosis survival. Our findings detail the regulatory differences of esx-3 in M. tuberculosis and M. smegmatis and demonstrate the importance of metal-dependent regulation of ESX-3 for virulence in M. tuberculosis. PMID:27245412

  6. Characterization by automated DNA sequencing of mutations in the gene (rpoB) encoding the RNA polymerase beta subunit in rifampin-resistant Mycobacterium tuberculosis strains from New York City and Texas.

    PubMed Central

    Kapur, V; Li, L L; Iordanescu, S; Hamrick, M R; Wanger, A; Kreiswirth, B N; Musser, J M

    1994-01-01

    Automated DNA sequencing was used to characterize mutations associated with rifampin resistance in a 69-bp region of the gene, rpoB, encoding the beta subunit of RNA polymerase in Mycobacterium tuberculosis. The data confirmed that greater than 90% of rifampin-resistant strains have sequence alterations in this region and showed that most are missense mutations. The analysis also identified several mutant rpoB alleles not previously associated with resistant organisms and one short region of rpoB that had an unusually high frequency of insertions and deletions. Although many strains with an identical IS6110 restriction fragment length polymorphism pattern have the same variant rpoB allele, some do not, a result that suggests the occurrence of evolutionary divergence at the clone level. PMID:8027320

  7. Utilization of Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-MS) to Identify environmental Strains of Mycobacterium Complex

    EPA Science Inventory

    Species within the Mycobacterium avium Complex (MAC) group are found to be both prevalent and persistent in drinking water distribution systems. The MAC is composed of two predominant species: M. avium and M. intracellulare. These species have the ability to survive drinking ...

  8. Complete genome sequence of Burkholderia caribensis Bcrs1W (NBRC110739), a strain co-residing with phenanthrene degrader Mycobacterium sp. EPa45.

    PubMed

    Ohtsubo, Yoshiyuki; Nonoyama, Shouta; Ogawa, Natsumi; Kato, Hiromi; Nagata, Yuji; Tsuda, Masataka

    2016-06-20

    Complete genome sequence of Burkholderia caribensis Bcrs1W, isolated from a phenanthrene-degrading mixed culture, was determined. The genomic information of Bcrs1W will be beneficial to elucidating the mechanisms of its positive effects on phenanthrene degradation by co-residing Mycobacterium sp. Epa45, and to exploiting their degradation potentials. PMID:27130496

  9. Complete Genome Sequence of a Phenanthrene Degrader, Mycobacterium sp. Strain EPa45 (NBRC 110737), Isolated from a Phenanthrene-Degrading Consortium

    PubMed Central

    Kato, Hiromi; Ogawa, Natsumi; Ohtsubo, Yoshiyuki; Oshima, Kenshiro; Toyoda, Atsushi; Mori, Hiroshi; Nagata, Yuji; Kurokawa, Ken; Hattori, Masahira; Fujiyama, Asao

    2015-01-01

    A phenanthrene degrader, Mycobacterium sp. EPa45, was isolated from a phenanthrene-degrading consortium. Here, we report the complete genome sequence of EPa45, which has a 6.2-Mb single circular chromosome. We propose a phenanthrene degradation pathway in EPa45 based on the complete genome sequence. PMID:26184940

  10. Analysis of the structure of mycolic acids of Mycobacterium simiae reveals a particular composition of alpha-mycolates in strain 'habana' TMC 5135, considered as immunogenic in tuberculosis and leprosy.

    PubMed

    Mederos, Lilian; Valdivia, José A; Valero-Guillén, Pedro L

    2007-12-01

    Structural analysis of mycolic acids from Mycobacterium simiae (including some 'habana' strains) was carried out using (1)H-NMR and MS. Results indicated that this species presents a general pattern of alpha-, alpha'- and keto-mycolates. alpha-Mycolates were composed of a complex mixture of 82 to 89 carbon atoms (C82-C89), with the predominant molecular species containing two di-substituted cyclopropane rings. Among keto-mycolates (C84-C89), those containing one trans di-substituted cyclopropane ring were the most abundant. The alpha'-mycolates were monounsaturated (C64, C66). According to MS and (1)H-NMR data, the strains studied differed in fine structural details of alpha-mycolates and keto-mycolates. Notably, strain 'habana' TMC 5135 (belonging to the 'habana' group, and considered as highly immunogenic in tuberculosis and leprosy) presented a particular composition of alpha-mycolates, with a major component (C87) containing one cis plus one trans di-substituted cyclopropane ring, unlike the type strain of M. simiae and other strains of the 'habana' group (IPK-220 and IPK-337R), in which the major component (C84) contained two cis di-substituted cyclopropane rings. In spite of this finding, the 'habana' strains were closely related to each other and mainly differed from the type strain of M. simiae in some details of the fine structure of keto-mycolates. The present work indicated that within an identical general pattern of mycolic acids, there is a complex composition in M. simiae and structural variation among different strains, as reported for pathogenic species of the genus. Noteworthy was the particular composition of alpha-mycolates in strain 'habana' TMC 5135. PMID:18048929

  11. Identification of a Novel Metabolite in the Degradation of Pyrene by Mycobacterium sp. Strain AP1: Actions of the Isolate on Two- and Three-Ring Polycyclic Aromatic Hydrocarbons

    PubMed Central

    Vila, Joaquim; López, Zaira; Sabaté, Jordi; Minguillón, Cristina; Solanas, Anna M.; Grifoll, Magdalena

    2001-01-01

    Mycobacterium sp. strain AP1 grew with pyrene as a sole source of carbon and energy. The identification of metabolites accumulating during growth suggests that this strain initiates its attack on pyrene by either monooxygenation or dioxygenation at its C-4, C-5 positions to give trans- or cis-4,5-dihydroxy-4,5-dihydropyrene, respectively. Dehydrogenation of the latter, ortho cleavage of the resulting diol to form phenanthrene 4,5-dicarboxylic acid, and subsequent decarboxylation to phenanthrene 4-carboxylic acid lead to degradation of the phenanthrene 4-carboxylic acid via phthalate. A novel metabolite identified as 6,6′-dihydroxy-2,2′-biphenyl dicarboxylic acid demonstrates a new branch in the pathway that involves the cleavage of both central rings of pyrene. In addition to pyrene, strain AP1 utilized hexadecane, phenanthrene, and fluoranthene for growth. Pyrene-grown cells oxidized the methylenic groups of fluorene and acenaphthene and catalyzed the dihydroxylation and ortho cleavage of one of the rings of naphthalene and phenanthrene to give 2-carboxycinnamic and diphenic acids, respectively. The catabolic versatility of strain AP1 and its use of ortho cleavage mechanisms during the degradation of polycyclic aromatic hydrocarbons (PAHs) give new insight into the role that pyrene-degrading bacterial strains may play in the environmental fate of PAH mixtures. PMID:11722898

  12. The Global Reciprocal Reprogramming between Mycobacteriophage SWU1 and Mycobacterium Reveals the Molecular Strategy of Subversion and Promotion of Phage Infection

    PubMed Central

    Fan, Xiangyu; Duan, Xiangke; Tong, Yan; Huang, Qinqin; Zhou, Mingliang; Wang, Huan; Zeng, Lanying; Young, Ry F.; Xie, Jianping

    2016-01-01

    Bacteriophages are the viruses of bacteria, which have contributed extensively to our understanding of life and modern biology. The phage-mediated bacterial growth inhibition represents immense untapped source for novel antimicrobials. Insights into the interaction between mycobacteriophage and Mycobacterium host will inform better utilizing of mycobacteriophage. In this study, RNA sequencing technology (RNA-seq) was used to explore the global response of Mycobacterium smegmatis mc2155 at an early phase of infection with mycobacteriophage SWU1, key host metabolic processes of M. smegmatis mc2155 shut off by SWU1, and the responsible phage proteins. The results of RNA-seq were confirmed by Real-time PCR and functional assay. 1174 genes of M. smegmatis mc2155 (16.9% of the entire encoding capacity) were differentially regulated by phage infection. These genes belong to six functional categories: (i) signal transduction, (ii) cell energetics, (iii) cell wall biosynthesis, (iv) DNA, RNA, and protein biosynthesis, (v) iron uptake, (vi) central metabolism. The transcription patterns of phage SWU1 were also characterized. This study provided the first global glimpse of the reciprocal reprogramming between the mycobacteriophage and Mycobacterium host. PMID:26858712

  13. Protein Kinase B (PknB) of Mycobacterium tuberculosis Is Essential for Growth of the Pathogen in Vitro as well as for Survival within the Host*

    PubMed Central

    Chawla, Yogesh; Upadhyay, Sandeep; Khan, Shazia; Nagarajan, Sathya Narayanan; Forti, Francesca; Nandicoori, Vinay Kumar

    2014-01-01

    The Mycobacterium tuberculosis protein kinase B (PknB) comprises an intracellular kinase domain, connected through a transmembrane domain to an extracellular region that contains four PASTA domains. The present study describes the comprehensive analysis of different domains of PknB in the context of viability in avirulent and virulent mycobacteria. We find stringent regulation of PknB expression necessary for cell survival, with depletion or overexpression of PknB leading to cell death. Although PknB-mediated kinase activity is essential for cell survival, active kinase lacking the transmembrane or extracellular domain fails to complement conditional mutants not expressing PknB. By creating chimeric kinases, we find that the intracellular kinase domain has unique functions in the virulent strain, which cannot be substituted by other kinases. Interestingly, we find that although the presence of the C-terminal PASTA domain is dispensable in the avirulent M. smegmatis, all four PASTA domains are essential in M. tuberculosis. The differential behavior of PknB vis-à-vis the number of essential PASTA domains and the specificity of kinase domain functions suggest that PknB-mediated growth and signaling events differ in virulent compared with avirulent mycobacteria. Mouse infection studies performed to determine the role of PknB in mediating pathogen survival in the host demonstrate that PknB is not only critical for growth of the pathogen in vitro but is also essential for the survival of the pathogen in the host. PMID:24706757

  14. Insights into the distribution and functions of the eukaryotic GPI-like anchored genes among Mycobacterium from a comparative genomic perspective.

    PubMed

    Deng, Wanyan; Zeng, Jie; Xiang, Xiaohong; Xie, Jianping

    2012-01-01

    Glycosylphosphatidylinositol (GPI)-anchored proteins range from small peptides to larger antigens and fulfill a variety of cellular functions in eukaryotes. We speculated there should be such molecules in intracellular pathogens such as Mycobacterium due to their complex interplay with the host. However, no prior publications have touched this topic. To explore the existence and distribution of GPI-like molecules among Mycobacterium, we exhaustively analyzed all publicly available Mycobacterium genomes and found that the GPI-like signal sequences are prevalent among Mycobacterium, and a significant dichotomy between nonpathogenic Mycobacterium (exemplified by Mycobacterium smegmatis) and pathogenic Mycobacterium (exemplified by Mycobacterium tuberculosis), through genome-wide GPI-SOM analysis. Some well-documented anti-tuberculosis drug targets are predicted to have GPI-like anchored signals, such as KasA and atpE. Interestingly, Pro-Glu (PE) and Pro-Pro-Glu (PPE) proteins predicted to have GPI-anchoring sequence are unique to pathogenic Mycobacterium. These results can be further explored for better control measures against tuberculosis. PMID:23272800

  15. Draft Genome Sequence of Mycobacterium vulneris DSM 45247T

    PubMed Central

    Croce, Olivier; Robert, Catherine; Raoult, Didier

    2014-01-01

    We report the draft genome sequence of Mycobacterium vulneris DSM 45247T strain, an emerging, opportunistic pathogen of the Mycobacterium avium complex. The genome described here is composed of 6,981,439 bp (with a G+C content of 67.14%) and has 6,653 protein-coding genes and 84 predicted RNA genes. PMID:24812218

  16. Draft Genome Sequence of Mycobacterium vulneris DSM 45247T.

    PubMed

    Croce, Olivier; Robert, Catherine; Raoult, Didier; Drancourt, Michel

    2014-01-01

    We report the draft genome sequence of Mycobacterium vulneris DSM 45247(T) strain, an emerging, opportunistic pathogen of the Mycobacterium avium complex. The genome described here is composed of 6,981,439 bp (with a G+C content of 67.14%) and has 6,653 protein-coding genes and 84 predicted RNA genes. PMID:24812218

  17. A Mycobacterium avium subsp. paratuberculosis Predicted Serine Protease Is Associated with Acid Stress and Intraphagosomal Survival.

    PubMed

    Kugadas, Abirami; Lamont, Elise A; Bannantine, John P; Shoyama, Fernanda M; Brenner, Evan; Janagama, Harish K; Sreevatsan, Srinand

    2016-01-01

    The ability to maintain intra-cellular pH is crucial for bacteria and other microbes to survive in diverse environments, particularly those that undergo fluctuations in pH. Mechanisms of acid resistance remain poorly understood in mycobacteria. Although, studies investigating acid stress in M. tuberculosis are gaining traction, few center on Mycobacterium avium subsp. paratuberculosis (MAP), the etiological agent of chronic enteritis in ruminants. We identified a MAP acid stress response network involved in macrophage infection. The central node of this network was MAP0403, a predicted serine protease that shared an 86% amino acid identity with MarP in M. tuberculosis. Previous studies confirmed MarP as a serine protease integral to maintaining intra-bacterial pH and survival in acid in vitro and in vivo. We show that MAP0403 is upregulated in infected macrophages and MAC-T cells that coincided with phagosome acidification. Treatment of mammalian cells with bafilomcyin A1, a potent inhibitor of phagosomal vATPases, diminished MAP0403 transcription. MAP0403 expression was also noted in acidic medium. A surrogate host, M. smegmatis mc(2) 155, was designed to express MAP0403 and when exposed to either macrophages or in vitro acid stress had increased bacterial cell viability, which corresponds to maintenance of intra-bacterial pH in acidic (pH = 5) conditions, compared to the parent strain. These data suggest that MAP0403 may be the equivalent of MarP in MAP. Future studies confirming MAP0403 as a serine protease and exploring its structure and possible substrates are warranted. PMID:27597934

  18. Characterization of a putative alpha-mannosyltransferase involved in phosphatidylinositol trimannoside biosynthesis in Mycobacterium tuberculosis.

    PubMed

    Kremer, Laurent; Gurcha, Sudagar S; Bifani, Pablo; Hitchen, Paul G; Baulard, Alain; Morris, Howard R; Dell, Anne; Brennan, Patrick J; Besra, Gurdyal S

    2002-05-01

    Phosphatidyl-myo-inositol mannosides (PIMs), lipomannan (LM) and lipoarabinomannan (LAM) are an important class of bacterial factors termed modulins that are found in tuberculosis and leprosy. Although their structures are well established, little is known with respect to the molecular aspects of the biosynthetic machinery involved in the synthesis of these glycolipids. On the basis of sequence similarity to other glycosyltransferases and our previous studies defining an alpha-mannosyltransferase from Mycobacterium tuberculosis, named PimB [Schaeffer, Khoo, Besra, Chatterjee, Brennan, Belisle and Inamine (1999) J. Biol. Chem. 274, 31625-31631], which catalysed the formation of triacyl (Ac(3))-PIM(2) (i.e. the dimannoside), we have identified a related gene from M. tuberculosis CDC1551, now designated pimC. The use of a cell-free assay containing GDP-[(14)C]mannose, amphomycin and membranes from Myobacterium smegmatis overexpressing PimC led to the synthesis of a new alkali-labile PIM product. Fast-atom-bombardment MS established the identity of the new enzymically synthesized product as Ac(3)PIM(3) (i.e. the trimannoside). The results indicate that pimC encodes an alpha-mannosyltransferase involved in Ac(3)PIM(3) biosynthesis. However, inactivation of pimC in Myobacterium bovis Bacille Calmette-Guérin (BCG) did not affect the production of higher PIMs, LM and LAM when compared with wild-type M. bovis BCG, suggesting the existence of redundant gene(s) or an alternate pathway that may compensate for this PimC deficiency. Further analyses, which compared the distribution of pimC in a panel of M. tuberculosis strains, revealed that pimC was present in only 22% of the clinical isolates examined. PMID:11964144

  19. A Mycobacterium avium subsp. paratuberculosis Predicted Serine Protease Is Associated with Acid Stress and Intraphagosomal Survival

    PubMed Central

    Kugadas, Abirami; Lamont, Elise A.; Bannantine, John P.; Shoyama, Fernanda M.; Brenner, Evan; Janagama, Harish K.; Sreevatsan, Srinand

    2016-01-01

    The ability to maintain intra-cellular pH is crucial for bacteria and other microbes to survive in diverse environments, particularly those that undergo fluctuations in pH. Mechanisms of acid resistance remain poorly understood in mycobacteria. Although, studies investigating acid stress in M. tuberculosis are gaining traction, few center on Mycobacterium avium subsp. paratuberculosis (MAP), the etiological agent of chronic enteritis in ruminants. We identified a MAP acid stress response network involved in macrophage infection. The central node of this network was MAP0403, a predicted serine protease that shared an 86% amino acid identity with MarP in M. tuberculosis. Previous studies confirmed MarP as a serine protease integral to maintaining intra-bacterial pH and survival in acid in vitro and in vivo. We show that MAP0403 is upregulated in infected macrophages and MAC-T cells that coincided with phagosome acidification. Treatment of mammalian cells with bafilomcyin A1, a potent inhibitor of phagosomal vATPases, diminished MAP0403 transcription. MAP0403 expression was also noted in acidic medium. A surrogate host, M. smegmatis mc2 155, was designed to express MAP0403 and when exposed to either macrophages or in vitro acid stress had increased bacterial cell viability, which corresponds to maintenance of intra-bacterial pH in acidic (pH = 5) conditions, compared to the parent strain. These data suggest that MAP0403 may be the equivalent of MarP in MAP. Future studies confirming MAP0403 as a serine protease and exploring its structure and possible substrates are warranted. PMID:27597934

  20. Proposal to elevate Mycobacterium avium complex ITS sequevar MAC-Q to Mycobacterium vulneris sp. nov.

    PubMed

    van Ingen, J; Boeree, M J; Kösters, K; Wieland, A; Tortoli, E; Dekhuijzen, P N R; van Soolingen, D

    2009-09-01

    The Mycobacterium avium complex (MAC) consists of four recognized species, Mycobacterium avium, Mycobacterium colombiense, Mycobacterium intracellulare and Mycobacterium chimaera, and a variety of other strains that may be members of undescribed taxa. We report on two isolates of a scotochromogenic, slowly growing, non-tuberculous Mycobacterium species within the M. avium complex from a lymph node and an infected wound after a dogbite of separate patients in The Netherlands. The extrapulmonary infections in immunocompetent patients suggested a high level of virulence. These isolates were characterized by a unique nucleotide sequence in the 16S rRNA gene, 99% similar to Mycobacterium colombiense, and the MAC-Q 16S-23S internal transcribed spacer (ITS) sequence. Sequence analyses of the hsp65 gene revealed 97% similarity to M. avium. The rpoB gene sequence was 98% similar to M. colombiense. Phenotypically, the scotochromogenicity, positive semi-quantitative catalase and heat-stable catalase tests, negative tellurite reductase and urease tests and susceptibility to hydroxylamine and oleic acid set these isolates apart from related species. High-performance liquid chromatography analysis of cell-wall mycolic acid content revealed a unique pattern, related to that of M. avium and M. colombiense. Together, these findings supported a separate species status within the Mycobacterium avium complex. We propose elevation of scotochromogenic M. avium complex strains sharing this 16S gene and MAC-Q ITS sequence to separate species status, for which the name Mycobacterium vulneris sp. nov. is proposed. The type strain is NLA000700772T (=DSM 45247T=CIP 109859T). PMID:19620376

  1. Mycobacterium paraintracellulare sp. nov., for the genotype INT-1 of Mycobacterium intracellulare.

    PubMed

    Lee, So-Young; Kim, Byoung-Jun; Kim, Hong; Won, Yu-Seop; Jeon, Che Ok; Jeong, Joseph; Lee, Seon Ho; Lim, Ji-Hun; Lee, Seung-Heon; Kim, Chang Ki; Kook, Yoon-Hoh; Kim, Bum-Joon

    2016-08-01

    Three mycobacterial strains, isolated from independent Korean patients with pulmonary infections, belonging to the Mycobacterium intracellulare genotype 1 (INT-1) were characterized using a polyphasic approach. The sequences of the 16S rRNA gene and internal transcribed spacer 1 (ITS1) of the INT-1 strains were identical to those of Mycobacterium intracellulare ATCC 13950T. However, multilocus sequence typing (MLST) analysis targeting five housekeeping genes (hsp65, rpoB, argG, gnd and pgm) revealed the phylogenetic separation of these strains from M. intracellulare ATCC 13950T. DNA-DNA hybridization values of >70 % confirmed that the three isolates belong to the same species, while the values of <70 % between one of them and the type strains of M. intracellulare and Mycobacterium chimaera confirmed their belonging to a distinct species. In addition, phenotypic characteristics such as positive growth on MacConkey agar and in acidic broth culture, unique matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) MS profiles of lipids, and unique mycolic acids profiles further supported the taxonomic status of these strains as representatives of a novel species of the Mycobacterium avium complex named Mycobacterium paraintracellulare. The type strain is MOTT64T (=KCTC 29084T=JCM 30622T). PMID:27189351

  2. Whole genome analyses of marine fish pathogenic isolate, Mycobacterium sp. 012931.

    PubMed

    Kurokawa, Satoru; Kabayama, Jun; Hwang, Seong Don; Nho, Seong Won; Hikima, Jun-ichi; Jung, Tae Sung; Kondo, Hidehiro; Hirono, Ikuo; Takeyama, Haruko; Mori, Tetsushi; Aoki, Takashi

    2014-10-01

    Mycobacterium is a genus within the order Actinomycetales that comprises of a large number of well-characterized species, several of which includes pathogens known to cause serious disease in human and animal. Here, we report the whole genome sequence of Mycobacterium sp. strain 012931 isolated from the marine fish, yellowtail (Seriola quinqueradiata). Mycobacterium sp. 012931 is a fish pathogen causing serious damage to aquaculture farms in Japan. DNA dot plot analysis showed that Mycobacterium sp. 012931 was more closely related to Mycobacterium marinum when compared across several Mycobacterium species. However, little conservation of the gene order was observed between Mycobacterium sp. 012931 and M. marinum genome. The annotated 5,464 genes of Mycobacterium sp. 012931 was classified into 26 subsystems. The insertion/deletion gene analysis shows Mycobacterium sp. 012931 had 643 unique genes that were not found in the M. marinum strains. In the virulence, disease, and defense subsystem, both insertion and deletion genes of Mycobacterium sp. 012931 were associated with the PPE gene cluster of Mycobacteria. Of seven plcB genes in Mycobacterium sp. 012931, plcB_2 and plcB_3 showed low identities with those of M. marinum strains. Therefore, Mycobacterium sp. 012931 has differences on genetic and virulence from M. marinum and may induce different interaction mechanisms between host and pathogen. PMID:24879010

  3. The Chromosomal parDE2 Toxin–Antitoxin System of Mycobacterium tuberculosis H37Rv: Genetic and Functional Characterization

    PubMed Central

    Gupta, Manish; Nayyar, Nishtha; Chawla, Meenakshi; Sitaraman, Ramakrishnan; Bhatnagar, Rakesh; Banerjee, Nirupama

    2016-01-01

    Mycobacterium tuberculosis H37Rv escapes host-generated stresses by entering a dormant persistent state. Activation of toxin-antitoxin modules is one of the mechanisms known to trigger such a state with low metabolic activity. M. tuberculosis harbors a large number of TA systems mostly located within discernible genomic islands. We have investigated the parDE2 operon of M. tuberculosis H37Rv encoding MParE2 toxin and MParD2 antitoxin proteins. The parDE2 locus was transcriptionally active from growth phase till late stationary phase in M. tuberculosis. A functional promoter located upstream of parD2 GTG start-site was identified by 5′-RACE and lacZ reporter assay. The MParD2 protein transcriptionally regulated the PparDE2 promoter by interacting through Arg16 and Ser15 residues located in the N-terminus. In Escherichia coli, ectopic expression of MParE2 inhibited growth in early stages, with a drastic reduction in colony forming units. Live-dead analysis revealed that the reduction was not due to cell death alone but due to formation of viable but non-culturable cells (VBNCs) also. The toxic activity of the protein, identified in the C-terminal residues Glu98 and Arg102, was neutralized by the antitoxin MParD2, both in vivo and in vitro. MParE2 inhibited mycobacterial DNA gyrase and interacted with the GyrB subunit without affecting its ATPase activity. Introduction of parE2 gene in the heterologous M. smegmatis host prevented growth and colony formation by the transformed cells. An M. smegmatis strain containing the parDE2 operon also switched to a non-culturable phenotype in response to oxidative stress. Loss in colony-forming ability of a major part of the MParE2 expressing cells suggests its potential role in dormancy, a cellular strategy for adaptation to environmental stresses. Our study has laid the foundation for future investigations to explore the physiological significance of parDE2 operon in mycobacterial pathogenesis. PMID:27379032

  4. Native New Zealand plants with inhibitory activity towards Mycobacterium tuberculosis

    PubMed Central

    2010-01-01

    Background Plants have long been investigated as a source of antibiotics and other bioactives for the treatment of human disease. New Zealand contains a diverse and unique flora, however, few of its endemic plants have been used to treat tuberculosis. One plant, Laurelia novae-zelandiae, was reportedly used by indigenous Maori for the treatment of tubercular lesions. Methods Laurelia novae-zelandiae and 44 other native plants were tested for direct anti-bacterial activity. Plants were extracted with different solvents and extracts screened for inhibition of the surrogate species, Mycobacterium smegmatis. Active plant samples were then tested for bacteriostatic activity towards M. tuberculosis and other clinically-important species. Results Extracts of six native plants were active against M. smegmatis. Many of these were also inhibitory towards M. tuberculosis including Laurelia novae-zelandiae (Pukatea). M. excelsa (Pohutukawa) was the only plant extract tested that was active against Staphylococcus aureus. Conclusions Our data provide support for the traditional use of Pukatea in treating tuberculosis. In addition, our analyses indicate that other native plant species possess antibiotic activity. PMID:20537175

  5. New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters

    PubMed Central

    Kanno, Alex I.; Goulart, Cibelly; Rofatto, Henrique K.; Oliveira, Sergio C.; Leite, Luciana C. C.

    2016-01-01

    The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovis BCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. PMID:26850295

  6. New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters.

    PubMed

    Kanno, Alex I; Goulart, Cibelly; Rofatto, Henrique K; Oliveira, Sergio C; Leite, Luciana C C; McFadden, Johnjoe

    2016-04-01

    The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovisBCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. PMID:26850295

  7. Analysis of the Mycobacterium tuberculosis 85A antigen promoter region.

    PubMed Central

    Kremer, L; Baulard, A; Estaquier, J; Content, J; Capron, A; Locht, C

    1995-01-01

    A mycobacterial expression-secretion vector was constructed in which the Escherichia coli alkaline phosphatase (phoA) reporter gene was placed under the control of the Mycobacterium tuberculosis 85A promoter and secretion signal sequences. In recombinant Mycobacterium smegmatis and Mycobacterium bovis BCG, PhoA activity could readily be detected on the mycobacterial cell surface and in the culture supernatant, indicating that the 85A signals can drive heterologous expression and secretion in both species. In contrast to the mycobacteria, the 85A promoter did not function in E. coli. We mapped the promoter region by progressive deletions using BAL 31 exonuclease and by primer extension analysis. Insertion and deletion mutations within the promoter region indicated that, unlike most E. coli promoters but similar to Streptomyces promoters, the position of the putative -35 region was not critical for efficient promoter activity. In addition, we investigated the ability of the identified signals to drive the production and secretion in BCG of recombinant Schistosoma mansoni glutathione S-transferase (Sm28GST), a protective antigen against schistosomiasis. BALB/c mice immunized with the recombinant BCG by a single dose exhibited a weak but specific T-cell response to Sm28GST. PMID:7836298

  8. Draft Genome Sequences of Two Extensively Drug-Resistant Strains of Mycobacterium tuberculosis Belonging to the Euro-American S Lineage.

    PubMed

    Malinga, Lesibana A; Abeel, Thomas; Desjardins, Christopher A; Dlamini, Talent C; Cassell, Gail; Chapman, Sinéad B; Birren, Bruce W; Earl, Ashlee M; van der Walt, Martie

    2016-01-01

    We report the whole-genome sequencing of two extensively drug-resistant tuberculosis strains belonging to the Euro-American S lineage. The RSA 114 strain showed single-nucleotide polymorphisms predicted to have drug efflux activity. PMID:26941159

  9. Draft Genome Sequences of Two Extensively Drug-Resistant Strains of Mycobacterium tuberculosis Belonging to the Euro-American S Lineage

    PubMed Central

    Abeel, Thomas; Desjardins, Christopher A.; Dlamini, Talent C.; Cassell, Gail; Chapman, Sinéad B.; Birren, Bruce W.; Earl, Ashlee M.; van der Walt, Martie

    2016-01-01

    We report the whole-genome sequencing of two extensively drug-resistant tuberculosis strains belonging to the Euro-American S lineage. The RSA 114 strain showed single-nucleotide polymorphisms predicted to have drug efflux activity. PMID:26941159

  10. Strain classification of Mycobacterium tuberculosis isolates in Brazil based on genotypes obtained by spoligotyping, mycobacterial interspersed repetitive unit typing and the presence of large sequence and single nucleotide polymorphism.

    PubMed

    Vasconcellos, Sidra E G; Acosta, Chyntia Carolina; Gomes, Lia Lima; Conceição, Emilyn Costa; Lima, Karla Valéria; de Araujo, Marcelo Ivens; Leite, Maria de Lourdes; Tannure, Flávio; Caldas, Paulo Cesar de Souza; Gomes, Harrison M; Santos, Adalberto Rezende; Gomgnimbou, Michel K; Sola, Christophe; Couvin, David; Rastogi, Nalin; Boechat, Neio; Suffys, Philip Noel

    2014-01-01

    Rio de Janeiro is endemic for tuberculosis (TB) and presents the second largest prevalence of the disease in Brazil. Here, we present the bacterial population structure of 218 isolates of Mycobacterium tuberculosis, derived from 186 patients that were diagnosed between January 2008 and December 2009. Genotypes were generated by means of spoligotyping, 24 MIRU-VNTR typing and presence of fbpC103, RDRio and RD174. The results confirmed earlier data that predominant genotypes in Rio de Janeiro are those of the Euro American Lineages (99%). However, we observed differences between the classification by spoligotyping when comparing to that of 24 MIRU-VNTR typing, being respectively 43.6% vs. 62.4% of LAM, 34.9% vs. 9.6% of T and 18.3% vs. 21.5% of Haarlem. Among isolates classified as LAM by MIRU typing, 28.0% did not present the characteristic spoligotype profile with absence of spacers 21 to 24 and 32 to 36 and we designated these conveniently as "LAM-like", 79.3% of these presenting the LAM-specific SNP fbpC103. The frequency of RDRio and RD174 in the LAM strains, as defined both by spoligotyping and 24 MIRU-VNTR loci, were respectively 11% and 15.4%, demonstrating that RD174 is not always a marker for LAM/RDRio strains. We conclude that, although spoligotyping alone is a tool for classification of strains of the Euro-American lineage, when combined with MIRU-VNTRs, SNPs and RD typing, it leads to a much better understanding of the bacterial population structure and phylogenetic relationships among strains of M. tuberculosis in regions with high incidence of TB. PMID:25314118

  11. Strain Classification of Mycobacterium tuberculosis Isolates in Brazil Based on Genotypes Obtained by Spoligotyping, Mycobacterial Interspersed Repetitive Unit Typing and the Presence of Large Sequence and Single Nucleotide Polymorphism

    PubMed Central

    Vasconcellos, Sidra E. G.; Acosta, Chyntia Carolina; Gomes, Lia Lima; Conceição, Emilyn Costa; Lima, Karla Valéria; de Araujo, Marcelo Ivens; Leite, Maria de Lourdes; Tannure, Flávio; Caldas, Paulo Cesar de Souza; Gomes, Harrison M.; Santos, Adalberto Rezende; Gomgnimbou, Michel K.; Sola, Christophe; Couvin, David; Rastogi, Nalin; Boechat, Neio; Suffys, Philip Noel

    2014-01-01

    Rio de Janeiro is endemic for tuberculosis (TB) and presents the second largest prevalence of the disease in Brazil. Here, we present the bacterial population structure of 218 isolates of Mycobacterium tuberculosis, derived from 186 patients that were diagnosed between January 2008 and December 2009. Genotypes were generated by means of spoligotyping, 24 MIRU-VNTR typing and presence of fbpC103, RDRio and RD174. The results confirmed earlier data that predominant genotypes in Rio de Janeiro are those of the Euro American Lineages (99%). However, we observed differences between the classification by spoligotyping when comparing to that of 24 MIRU-VNTR typing, being respectively 43.6% vs. 62.4% of LAM, 34.9% vs. 9.6% of T and 18.3% vs. 21.5% of Haarlem. Among isolates classified as LAM by MIRU typing, 28.0% did not present the characteristic spoligotype profile with absence of spacers 21 to 24 and 32 to 36 and we designated these conveniently as “LAM-like”, 79.3% of these presenting the LAM-specific SNP fbpC103. The frequency of RDRio and RD174 in the LAM strains, as defined both by spoligotyping and 24 MIRU-VNTR loci, were respectively 11% and 15.4%, demonstrating that RD174 is not always a marker for LAM/RDRio strains. We conclude that, although spoligotyping alone is a tool for classification of strains of the Euro-American lineage, when combined with MIRU-VNTRs, SNPs and RD typing, it leads to a much better understanding of the bacterial population structure and phylogenetic relationships among strains of M. tuberculosis in regions with high incidence of TB. PMID:25314118

  12. Mycobacterium microti: More diverse than previously thought.

    PubMed

    Smith, N H; Crawshaw, T; Parry, J; Birtles, R J

    2009-08-01

    Mycobacterium microti is a member of the Mycobacterium tuberculosis complex of bacteria. This species was originally identified as a pathogen of small rodents and shrews and was associated with limited diversity and a much reduced spoligotype pattern. More recently, specific deletions of chromosomal DNA have been shown to define this group of organisms, which can be identified by the absence of chromosomal region RD1(mic). We describe here the molecular characteristics of 141 strains of the Mycobacterium tuberculosis complex isolated in Great Britain over a 14-year period. All strains have characteristic loss of some spoligotype spacers and characteristic alleles at the ETR-E and ETR-F variable-number tandem-repeat (VNTR) loci, and a sample of these strains was deleted for regions RD7, RD9, and RD1(mic) but intact for regions RD4 and RD12. We therefore identified these strains as M. microti and show that they have much more diverse spoligotype patterns and VNTR types than previously thought. The most common source of these strains was domestic cats, and we show that the molecular types of M. microti are geographically localized in the same way that molecular types of Mycobacterium bovis are geographically localized in cattle in the United Kingdom. We describe the pathology of M. microti infection in cats and suggest that the feline disease is a spillover from a disease maintained in an unknown wild mammal, probably field voles. The location of the cats with M. microti infection suggests that they do not overlap geographically with the strains of Mycobacterium bovis in Great Britain. PMID:19535520

  13. Mycobacterium microti: More Diverse than Previously Thought▿

    PubMed Central

    Smith, N. H.; Crawshaw, T.; Parry, J.; Birtles, R. J.

    2009-01-01

    Mycobacterium microti is a member of the Mycobacterium tuberculosis complex of bacteria. This species was originally identified as a pathogen of small rodents and shrews and was associated with limited diversity and a much reduced spoligotype pattern. More recently, specific deletions of chromosomal DNA have been shown to define this group of organisms, which can be identified by the absence of chromosomal region RD1mic. We describe here the molecular characteristics of 141 strains of the Mycobacterium tuberculosis complex isolated in Great Britain over a 14-year period. All strains have characteristic loss of some spoligotype spacers and characteristic alleles at the ETR-E and ETR-F variable-number tandem-repeat (VNTR) loci, and a sample of these strains was deleted for regions RD7, RD9, and RD1mic but intact for regions RD4 and RD12. We therefore identified these strains as M. microti and show that they have much more diverse spoligotype patterns and VNTR types than previously thought. The most common source of these strains was domestic cats, and we show that the molecular types of M. microti are geographically localized in the same way that molecular types of Mycobacterium bovis are geographically localized in cattle in the United Kingdom. We describe the pathology of M. microti infection in cats and suggest that the feline disease is a spillover from a disease maintained in an unknown wild mammal, probably field voles. The location of the cats with M. microti infection suggests that they do not overlap geographically with the strains of Mycobacterium bovis in Great Britain. PMID:19535520

  14. Non Mycobacterial Virulence Genes in the Genome of the Emerging Pathogen Mycobacterium abscessus

    PubMed Central

    Schenowitz, Chantal; Dossat, Carole; Barbe, Valérie; Rottman, Martin; Macheras, Edouard; Heym, Beate; Herrmann, Jean-Louis; Daffé, Mamadou; Brosch, Roland; Risler, Jean-Loup; Gaillard, Jean-Louis

    2009-01-01

    Mycobacterium abscessus is an emerging rapidly growing mycobacterium (RGM) causing a pseudotuberculous lung disease to which patients with cystic fibrosis (CF) are particularly susceptible. We report here its complete genome sequence. The genome of M. abscessus (CIP 104536T) consists of a 5,067,172-bp circular chromosome including 4920 predicted coding sequences (CDS), an 81-kb full-length prophage and 5 IS elements, and a 23-kb mercury resistance plasmid almost identical to pMM23 from Mycobacterium marinum. The chromosome encodes many virulence proteins and virulence protein families absent or present in only small numbers in the model RGM species Mycobacterium smegmatis. Many of these proteins are encoded by genes belonging to a “mycobacterial” gene pool (e.g. PE and PPE proteins, MCE and YrbE proteins, lipoprotein LpqH precursors). However, many others (e.g. phospholipase C, MgtC, MsrA, ABC Fe(3+) transporter) appear to have been horizontally acquired from distantly related environmental bacteria with a high G+C content, mostly actinobacteria (e.g. Rhodococcus sp., Streptomyces sp.) and pseudomonads. We also identified several metabolic regions acquired from actinobacteria and pseudomonads (relating to phenazine biosynthesis, homogentisate catabolism, phenylacetic acid degradation, DNA degradation) not present in the M. smegmatis genome. Many of the “non mycobacterial” factors detected in M. abscessus are also present in two of the pathogens most frequently isolated from CF patients, Pseudomonas aeruginosa and Burkholderia cepacia. This study elucidates the genetic basis of the unique pathogenicity of M. abscessus among RGM, and raises the question of similar mechanisms of pathogenicity shared by unrelated organisms in CF patients. PMID:19543527

  15. Assessing the Inactivation of Mycobacterium avium subsp. paratuberculosis during Composting of Livestock Carcasses

    PubMed Central

    Tkachuk, Victoria L.; Krause, Denis O.; McAllister, Tim A.; Buckley, Katherine E.; Reuter, Tim; Hendrick, Steve

    2013-01-01

    Mycobacterium avium subsp. paratuberculosis causes Johne's disease (JD) in ruminants, with substantial economic impacts on the cattle industry. Johne's disease is known for its long latency period, and difficulties in diagnosis are due to insensitivities of current detection methods. Eradication is challenging as M. avium subsp. paratuberculosis can survive for extended periods within the environment, resulting in new infections in naïve animals (W. Xu et al., J. Environ. Qual. 38:437-450, 2009). This study explored the use of a biosecure, static composting structure to inactivate M. avium subsp. paratuberculosis. Mycobacterium smegmatis was also assessed as a surrogate for M. avium subsp. paratuberculosis. Two structures were constructed to hold three cattle carcasses each. Naturally infected tissues and ground beef inoculated with laboratory-cultured M. avium subsp. paratuberculosis and M. smegmatis were placed in nylon and plastic bags to determine effects of temperature and compost environment on viability over 250 days. After removal, samples were cultured and growth of both organisms was assessed after 12 weeks. After 250 days, M. avium subsp. paratuberculosis was still detectable by PCR, while M. smegmatis was not detected after 67 days of composting. Furthermore, M. avium subsp. paratuberculosis remained viable in both implanted nylon and plastic bags over the composting period. As the compost never reached a homogenous thermophilic (55 to 65°C) state throughout each structure, an in vitro experiment was conducted to examine viability of M. avium subsp. paratuberculosis after exposure to 80°C for 90 days. Naturally infected lymph tissues were mixed with and without compost. After 90 days, M. avium subsp. paratuberculosis remained viable despite exposure to temperatures typically higher than that achieved in compost. In conclusion, it is unlikely composting can be used as a means of inactivating M. avium subsp. paratuberculosis associated with cattle

  16. Dxr is essential in Mycobacterium tuberculosis and fosmidomycin resistance is due to a lack of uptake

    PubMed Central

    Brown, Amanda C; Parish, Tanya

    2008-01-01

    Fosmidomycin is a phosphonic antibiotic which inhibits 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Dxr), the first committed step of the non-mevalonate pathway of isoprenoid biosynthesis. In Mycobacterium tuberculosis Dxr is encoded by Rv2870c, and although the antibiotic has been shown to inhibit the recombinant enzyme [1], mycobacteria are intrinsically resistant to fosmidomycin at the whole cell level. Fosmidomycin is a hydrophilic molecule and in many bacteria its uptake is an active process involving a cAMP dependent glycerol-3-phosphate transporter (GlpT). The fact that there is no glpT homologue in the M. tuberculosis genome and the highly impervious nature of the hydrophobic mycobacterial cell wall suggests that resistance may be due to a lack of cellular penetration. Results We demonstrated that dxr (Rv2780c) is an essential gene in M. tuberculosis, since we could not delete the chromosomal copy unless a second functional copy was provided on an integrating vector. This confirmed that the intracellular target of fosmidomycin was essential as well as sensitive. We looked at the uptake of fosmidomycin in two mycobacterial species, the slow-growing pathogenic M. tuberculosis and the fast-growing, saprophytic Mycobacterium smegmatis; both species were resistant to fosmidomycin to a high level. Fosmidomycin was not accumulated intra-cellularly in M. tuberculosis or M. smegmatis but remained in the extra-cellular medium. In contrast, fosmidomycin uptake was confirmed in the sensitive organism, Escherichia coli. We established that the lack of intra-cellular accumulation was not due to efflux, since efflux pump inhibitors had no effect on fosmidomycin resistance. Finally, we demonstrated that fosmidomycin was not modified by mycobacterial cells or by extracts but remained in a fully functional state. Conclusion Taken together, these data demonstrate that fosmidomycin resistance in M. tuberculosis and M. smegmatis results from a lack of penetration of the

  17. Lipoprotein LprI of Mycobacterium tuberculosis Acts as a Lysozyme Inhibitor.

    PubMed

    Sethi, Deepti; Mahajan, Sahil; Singh, Chaahat; Lama, Amrita; Hade, Mangesh Dattu; Gupta, Pawan; Dikshit, Kanak L

    2016-02-01

    Mycobacterium tuberculosis executes numerous defense strategies for the successful establishment of infection under a diverse array of challenges inside the host. One such strategy that has been delineated in this study is the abrogation of lytic activity of lysozyme by a novel glycosylated and surface-localized lipoprotein, LprI, which is exclusively present in M. tuberculosis complex. The lprI gene co-transcribes with the glbN gene (encoding hemoglobin (HbN)) and both are synchronously up-regulated in M. tuberculosis during macrophage infection. Recombinant LprI, expressed in Escherichia coli, exhibited strong binding (Kd ≤ 2 nm) with lysozyme and abrogated its lytic activity completely, thereby conferring protection to fluorescein-labeled Micrococcus lysodeikticus from lysozyme-mediated hydrolysis. Expression of the lprI gene in Mycobacterium smegmatis (8-10-fold) protected its growth from lysozyme inhibition in vitro and enhanced its phagocytosis and survival during intracellular infection of peritoneal and monocyte-derived macrophages, known to secrete lysozyme, and in the presence of exogenously added lysozyme in secondary cell lines where lysozyme levels are low. In contrast, the presence of HbN enhanced phagocytosis and intracellular survival of M. smegmatis only in the absence of lysozyme but not under lysozyme stress. Interestingly, co-expression of the glbN-lprI gene pair elevated the invasion and survival of M. smegmatis 2-3-fold in secondary cell lines in the presence of lysozyme in comparison with isogenic cells expressing these genes individually. Thus, specific advantage against macrophage-generated lysozyme, conferred by the combination of LprI-HbN during invasion of M. tuberculosis, may have vital implications on the pathogenesis of tuberculosis. PMID:26589796

  18. Assessing the inactivation of Mycobacterium avium subsp. paratuberculosis during composting of livestock carcasses.

    PubMed

    Tkachuk, Victoria L; Krause, Denis O; McAllister, Tim A; Buckley, Katherine E; Reuter, Tim; Hendrick, Steve; Ominski, Kim H

    2013-05-01

    Mycobacterium avium subsp. paratuberculosis causes Johne's disease (JD) in ruminants, with substantial economic impacts on the cattle industry. Johne's disease is known for its long latency period, and difficulties in diagnosis are due to insensitivities of current detection methods. Eradication is challenging as M. avium subsp. paratuberculosis can survive for extended periods within the environment, resulting in new infections in naïve animals (W. Xu et al., J. Environ. Qual. 38:437-450, 2009). This study explored the use of a biosecure, static composting structure to inactivate M. avium subsp. paratuberculosis. Mycobacterium smegmatis was also assessed as a surrogate for M. avium subsp. paratuberculosis. Two structures were constructed to hold three cattle carcasses each. Naturally infected tissues and ground beef inoculated with laboratory-cultured M. avium subsp. paratuberculosis and M. smegmatis were placed in nylon and plastic bags to determine effects of temperature and compost environment on viability over 250 days. After removal, samples were cultured and growth of both organisms was assessed after 12 weeks. After 250 days, M. avium subsp. paratuberculosis was still detectable by PCR, while M. smegmatis was not detected after 67 days of composting. Furthermore, M. avium subsp. paratuberculosis remained viable in both implanted nylon and plastic bags over the composting period. As the compost never reached a homogenous thermophilic (55 to 65°C) state throughout each structure, an in vitro experiment was conducted to examine viability of M. avium subsp. paratuberculosis after exposure to 80°C for 90 days. Naturally infected lymph tissues were mixed with and without compost. After 90 days, M. avium subsp. paratuberculosis remained viable despite exposure to temperatures typically higher than that achieved in compost. In conclusion, it is unlikely composting can be used as a means of inactivating M. avium subsp. paratuberculosis associated with cattle

  19. In Vitro Activity of Selected West African Medicinal Plants against Mycobacterium ulcerans Disease.

    PubMed

    Tsouh Fokou, Patrick Valere; Kissi-Twum, Abena Adomah; Yeboah-Manu, Dorothy; Appiah-Opong, Regina; Addo, Phyllis; Tchokouaha Yamthe, Lauve Rachel; Ngoutane Mfopa, Alvine; Fekam Boyom, Fabrice; Nyarko, Alexander Kwadwo

    2016-01-01

    Buruli ulcer (BU) is the third most prevalent mycobacteriosis, after tuberculosis and leprosy. The currently recommended combination of rifampicin-streptomycin suffers from side effects and poor compliance, which leads to reliance on local herbal remedies. The objective of this study was to investigate the antimycobacterial properties and toxicity of selected medicinal plants. Sixty-five extracts from 27 plant species were screened against Mycobacterium ulcerans and Mycobacterium smegmatis, using the Resazurin Microtiter Assay (REMA). The cytotoxicity of promising extracts was assayed on normal Chang liver cells by an MTT assay. Twenty five extracts showed activity with minimal inhibitory concentration (MIC) values ranging from 16 µg/mL to 250 µg/mL against M. smegmatis, while 17 showed activity against M. ulcerans with MIC values ranging from 125 µg/mL to 250 µg/mL. In most of the cases, plant extracts with antimycobacterial activity showed no cytotoxicity on normal human liver cells. Exception were Carica papaya, Cleistopholis patens, and Polyalthia suaveolens with 50% cell cytotoxic concentrations (CC50) ranging from 3.8 to 223 µg/mL. These preliminary results support the use of some West African plants in the treatment of Buruli ulcer. Meanwhile, further studies are required to isolate and characterize the active ingredients in the extracts. PMID:27089314

  20. Immune Responses in Cattle Inoculated with Mycobacterium bovis, Mycobacterium tuberculosis, or Mycobacterium kansasii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cattle were inoculated with Mycobacterium bovis, Mycobacterium tuberculosis, or Mycobacterium kansasii to compare antigen-specific immune responses to varied patterns of mycobacterial disease. Disease expression ranged from colonization with associated pathology (M. bovis), colonization without path...

  1. PCR identification of Mycobacterium bovis BCG.

    PubMed Central

    Talbot, E A; Williams, D L; Frothingham, R

    1997-01-01

    The attenuated bacillus Calmette-Guérin (BCG) vaccine strain is derived from a virulent strain of Mycobacterium bovis. BCG is difficult to differentiate from other strains of M. bovis and other members of the M. tuberculosis complex by conventional methods. Recently, a genomic region designated RD1 was found to be present in all virulent M. bovis and M. tuberculosis strains tested but deleted from all BCG strains tested. With this information, a multiplex PCR method was developed to detect the RD1 deletion. A large collection of BCG and other M. tuberculosis complex strains from diverse host and geographic origins was tested. RD1 was deleted in 23 of 23 BCG strains. RD1 was present in 129 of 129 other M. tuberculosis complex strains. This multiplex PCR method can be used as a tool for the rapid and specific identification of BCG. PMID:9041390

  2. Mycobacterium arupense, Mycobacterium heraklionense, and a Newly Proposed Species, "Mycobacterium virginiense" sp. nov., but Not Mycobacterium nonchromogenicum, as Species of the Mycobacterium terrae Complex Causing Tenosynovitis and Osteomyelitis.

    PubMed

    Vasireddy, Ravikiran; Vasireddy, Sruthi; Brown-Elliott, Barbara A; Wengenack, Nancy L; Eke, Uzoamaka A; Benwill, Jeana L; Turenne, Christine; Wallace, Richard J

    2016-05-01

    Mycobacterium terrae complex has been recognized as a cause of tenosynovitis, with M. terrae and Mycobacterium nonchromogenicum reported as the primary etiologic pathogens. The molecular taxonomy of the M. terrae complex causing tenosynovitis has not been established despite approximately 50 previously reported cases. We evaluated 26 isolates of the M. terrae complex associated with tenosynovitis or osteomyelitis recovered between 1984 and 2014 from 13 states, including 5 isolates reported in 1991 as M. nonchromogenicum by nonmolecular methods. The isolates belonged to three validated species, one new proposed species, and two novel related strains. The majority of isolates (20/26, or 77%) belonged to two recently described species: Mycobacterium arupense (10 isolates, or 38%) and Mycobacterium heraklionense (10 isolates, or 38%). Three isolates (12%) had 100% sequence identity to each other by 16S rRNA and 99.3 to 100% identity by rpoB gene region V sequencing and represent a previously undescribed species within the M. terrae complex. There were no isolates of M. terrae or M. nonchromogenicum, including among the five isolates reported in 1991. The 26 isolates were susceptible to clarithromycin (100%), rifabutin (100%), ethambutol (92%), and sulfamethoxazole or trimethoprim-sulfamethoxazole (70%). The current study suggests that M. arupense, M. heraklionense, and a newly proposed species ("M. virginiense" sp. nov.; proposed type strain MO-233 [DSM 100883, CIP 110918]) within the M. terrae complex are the major causes of tenosynovitis and osteomyelitis in the United States, with little change over 20 years. Species identification within this complex requires sequencing methods. PMID:26962085

  3. Asymmetric growth and division in Mycobacterium spp.: compensatory mechanisms for non-medial septa.

    PubMed

    Singh, Bhupender; Nitharwal, Ram Gopal; Ramesh, Malavika; Pettersson, B M Fredrik; Kirsebom, Leif A; Dasgupta, Santanu

    2013-04-01

    Mycobacterium spp., rod-shaped cells belonging to the phylum Actinomycetes, lack the Min- and Noc/Slm systems responsible for preventing the placement of division sites at the poles or over the nucleoids to ensure septal assembly at mid-cell. We show that the position for establishment of the FtsZ-ring in exponentially growing Mycobacterium marinum and Mycobacterium smegmatis cells is nearly random, and that the cells often divide non-medially, producing two unequal but viable daughters. Septal sites and cellular growth disclosed by staining with the membrane-specific dye FM4-64 and fluorescent antibiotic vancomycin (FL-Vanco), respectively, showed that many division sites were off-centre, often over the nucleoids, and that apical cell growth was frequently unequal at the two poles. DNA transfer through the division septum was detected, and translocation activity was supported by the presence of a putative mycobacterial DNA translocase (MSMEG2690) at the majority of the division sites. Time-lapse imaging of single live cells through several generations confirmed both acentric division site placement and unequal polar growth in mycobacteria. Our evidence suggests that post-septal DNA transport and unequal polar growth may compensate for the non-medial division site placement in Mycobacterium spp. PMID:23387305

  4. Uracil excision repair in Mycobacterium tuberculosis cell-free extracts.

    PubMed

    Kumar, Pradeep; Bharti, Sanjay Kumar; Varshney, Umesh

    2011-05-01

    Uracil excision repair is ubiquitous in all domains of life and initiated by uracil DNA glycosylases (UDGs) which excise the promutagenic base, uracil, from DNA to leave behind an abasic site (AP-site). Repair of the resulting AP-sites requires an AP-endonuclease, a DNA polymerase, and a DNA ligase whose combined activities result in either short-patch or long-patch repair. Mycobacterium tuberculosis, the causative agent of tuberculosis, has an increased risk of accumulating uracils because of its G + C-rich genome, and its niche inside host macrophages where it is exposed to reactive nitrogen and oxygen species, two major causes of cytosine deamination (to uracil) in DNA. In vitro assays to study DNA repair in this important human pathogen are limited. To study uracil excision repair in mycobacteria, we have established assay conditions using cell-free extracts of M. tuberculosis and M. smegmatis (a fast-growing mycobacterium) and oligomer or plasmid DNA substrates. We show that in mycobacteria, uracil excision repair is completed primarily via long-patch repair. In addition, we show that M. tuberculosis UdgB, a newly characterized family 5 UDG, substitutes for the highly conserved family 1 UDG, Ung, thereby suggesting that UdgB might function as backup enzyme for uracil excision repair in mycobacteria. PMID:21371942

  5. Mycobacterium Cytidylate Kinase Appears to Be an Undruggable Target.

    PubMed

    Craig, Justin K; Risler, Jenni K; Loesch, Kimberly A; Dong, Wen; Baker, Dwight; Barrett, Lynn K; Subramanian, Sandhya; Samudrala, Ram; Van Voorhis, Wesley C

    2016-08-01

    New and improved drugs against tuberculosis are urgently needed as multi-drug-resistant forms of the disease become more prevalent. Mycobacterium tuberculosis cytidylate kinase is an attractive target for screening due to its essentiality and different substrate specificity to the human orthologue. However, we selected the Mycobacterium smegmatis cytidylate kinase for screening because of the availability of high-resolution X-ray crystallographic data defining its structure and the high likelihood of active site structural similarity to the M. tuberculosis orthologue. We report the development and implementation of a high-throughput luciferase-based activity assay and screening of 19,920 compounds derived from small-molecule libraries and an in silico screen predicting likely inhibitors of the cytidylate kinase enzyme. Hit validation included a counterscreen for luciferase inhibitors that would result in false positives in the initial screen. Results of this counterscreen ruled out all of the putative cytidylate kinase inhibitors identified in the initial screening, leaving no compounds as candidates for drug development. Although a negative result, this study indicates that this important drug target may in fact be undruggable and serve as a warning for future investigations. PMID:27146385

  6. A High-Throughput Cidality Screen for Mycobacterium Tuberculosis

    PubMed Central

    Kaur, Parvinder; Ghosh, Anirban; Krishnamurthy, Ramya Vadageri; Bhattacharjee, Deepa Gagwani; Achar, Vijayashree; Datta, Santanu; Narayanan, Shridhar; Anbarasu, Anand; Ramaiah, Sudha

    2015-01-01

    Exposure to Mycobacterium tuberculosis (Mtb) aerosols is a major threat to tuberculosis (TB) researchers, even in bio-safety level-3 (BSL-3) facilities. Automation and high-throughput screens (HTS) in BSL3 facilities are essential for minimizing manual aerosol-generating interventions and facilitating TB research. In the present study, we report the development and validation of a high-throughput, 24-well ‘spot-assay’ for selecting bactericidal compounds against Mtb. The bactericidal screen concept was first validated in the fast-growing surrogate Mycobacterium smegmatis (Msm) and subsequently confirmed in Mtb using the following reference anti-tubercular drugs: rifampicin, isoniazid, ofloxacin and ethambutol (RIOE, acting on different targets). The potential use of the spot-assay to select bactericidal compounds from a large library was confirmed by screening on Mtb, with parallel plating by the conventional gold standard method (correlation, r2 = 0.808). An automated spot-assay further enabled an MBC90 determination on resistant and sensitive Mtb clinical isolates. The implementation of the spot-assay in kinetic screens to enumerate residual Mtb after either genetic silencing (anti-sense RNA, AS-RNA) or chemical inhibition corroborated its ability to detect cidality. This relatively simple, economical and quantitative HTS considerably minimized the bio-hazard risk and enabled the selection of novel vulnerable Mtb targets and mycobactericidal compounds. Thus, spot-assays have great potential to impact the TB drug discovery process. PMID:25693161

  7. Characterization of Mycobacterium tuberculosis EsxA Membrane Insertion

    PubMed Central

    Ma, Yue; Keil, Verena; Sun, Jianjun

    2015-01-01

    EsxA (ESAT-6), an important virulence factor of Mycobacterium tuberculosis, plays an essential role in phagosome rupture and bacterial cytosolic translocation within host macrophages. Our previous study showed that EsxA exhibits a unique membrane-interacting activity that is not found in its ortholog from nonpathogenic Mycobacterium smegmatis. However, the molecular mechanism of EsxA membrane insertion remains unknown. In this study, we generated truncated EsxA proteins with deletions of the N- and/or C-terminal flexible arm. Using a fluorescence-based liposome leakage assay, we found that both the N- and C-terminal arms were required for membrane disruption. Moreover, we found that, upon acidification, EsxA converted into a more organized structure with increased α-helical content, which was evidenced by CD analysis and intrinsic tryptophan fluorescence. Finally, using an environmentally sensitive fluorescent dye, we obtained direct evidence that the central helix-turn-helix motif of EsxA inserted into the membranes and formed a membrane-spanning pore. A model of EsxA membrane insertion is proposed and discussed. PMID:25645924

  8. Performance of the New Version (v2.0) of the GenoType MTBDRsl Test for Detection of Resistance to Second-Line Drugs in Multidrug-Resistant Mycobacterium tuberculosis Complex Strains.

    PubMed

    Brossier, Florence; Guindo, David; Pham, Anne; Reibel, Florence; Sougakoff, Wladimir; Veziris, Nicolas; Aubry, Alexandra

    2016-06-01

    Detecting resistance to fluoroquinolones (FQ) and second-line injectable drugs (amikacin [AMK], kanamycin [KAN], and capreomycin [CAP]) is crucial given the worldwide increase in the incidence of extensively drug-resistant tuberculosis (XDR-TB). A new version of the GenoType MTBDRsl test (v2.0) has been developed to improve the detection of resistance to FQ (involving gyrA and gyrB mutations) and to second-line injectable drugs (involving rrs and eis promoter mutations) in Mycobacterium tuberculosis A collection of 127 multidrug-resistant (MDR) M. tuberculosis complex strains was tested using the first (v1) and second (v2.0) versions of the MTBDRsl test, as well as DNA sequencing. The specificities in resistance detection of v1 and v2.0 were similar throughout, whereas the levels of sensitivity of v2.0 were superior for FQ (94.8% versus 89.6%) and KAN (90.5% versus 59.5%) but similar for AMK (91.3%) and CAP (83.0%). The sensitivity and specificity of v2.0 were superior to those of v1 for the detection of pre-XDR strains (83.3% versus 75.0% and 88.6% versus 67.1%, respectively), whereas the sensitivity of v2.0 was superior to that of v1 only for the detection of XDR strains (83.0% versus 49.1%). In conclusion, MTBDRsl v2.0 is superior to MTBDRsl v1 and efficiently detects the most common mutations involved in resistance to FQ and aminoglycosides/CAP. However, due to mutations not recognized by v2.0 or to the presence of resistance mechanisms not yet characterized (particularly mechanisms related to monoresistance to aminoglycosides or CAP), the results for wild-type strains obtained with MTBDRsl v2.0 should be confirmed by further DNA sequencing and phenotypic drug susceptibility testing. PMID:27053671

  9. Genomic analysis of a Mycobacterium bovis bacillus [corrected] Calmette-Guérin strain isolated from an adult patient with pulmonary tuberculosis..

    PubMed

    Li, Xuming; Chen, Liping; Zhu, Yongqiang; Yu, Xia; Cao, Jun; Wang, Rui; Lv, Xinyan; He, Jin; Guo, Aizhen; Huang, Hairong; Zheng, Huajun; Liu, Siguo

    2015-01-01

    For years, bacillus Calmette-Guérin (BCG) has served as the unique vaccine against tuberculosis and has generally been regarded as safe. However, a clinical strain labeled 3281 that was isolated from a TB patient was identified to be BCG. Via the combination of next-generation sequencing (NGS) and comparative genomic analysis, unique 3281 genetic characteristics were revealed. A region containing the dnaA and dnaN genes that is closely related to the initial chromosome replication was found to repeat three times on the BCG Pasteur-specific tandem duplication region DU1. Due to the minimum number of epitopes in BCG strains, 3281 was inferred to have a high possibility for immune evasion. Additionally, variations in the virulence genes and predictions for potential virulence factors were analyzed. Overall, we report a pathogen that has never previously been thought to be pathogenic and initial insights that are focused on the genetic characteristics of virulent BCG. PMID:25876043

  10. Genomic Analysis of a Mycobacterium Bovis Bacillus Calmette-Guérin Strain Isolated from an Adult Patient with Pulmonary Tuberculosis

    PubMed Central

    Zhu, Yongqiang; Yu, Xia; Cao, Jun; Wang, Rui; Lv, Xinyan; He, Jin; Guo, Aizhen; Huang, Hairong; Zheng, Huajun; Liu, Siguo

    2015-01-01

    For years, bacillus Calmette-Guérin (BCG) has served as the unique vaccine against tuberculosis and has generally been regarded as safe. However, a clinical strain labeled 3281 that was isolated from a TB patient was identified to be BCG. Via the combination of next-generation sequencing (NGS) and comparative genomic analysis, unique 3281 genetic characteristics were revealed. A region containing the dnaA and dnaN genes that is closely related to the initial chromosome replication was found to repeat three times on the BCG Pasteur-specific tandem duplication region DU1. Due to the minimum number of epitopes in BCG strains, 3281 was inferred to have a high possibility for immune evasion. Additionally, variations in the virulence genes and predictions for potential virulence factors were analyzed. Overall, we report a pathogen that has never previously been thought to be pathogenic and initial insights that are focused on the genetic characteristics of virulent BCG. PMID:25876043

  11. The adjuvant activity of a non-toxic, water-soluble glycopeptide present in large quantities in the culture filtrate of Mycobacterium tuberculosis strain DT.

    PubMed Central

    Stewart-Tull, D E; Shimono, T; Kotani, S; Kato, M; Ogawa, Y; Yamamura, Y; Koga, T; Pearson, C M

    1975-01-01

    A water-soluble mycobacterial glycopeptide was obtained in large quantities from the culture supernatant fluid of M. tuberculosis strain DT. This glycopeptide was strongly adjuvant-active when injected, in a water-in-oil emulsion contianing ovalbumin, into guinea-pigs. In addition, it was devoid of cord factor toxicity in mice, polyarthritogenic activity in rats and cavity stimulating activity in rabbit lungs. Images FIG. 2 FIG. 3 FIG. 4 FIG. 5 FIG. 6 FIG. 8 PMID:806515

  12. Assessing the effectiveness of low-pressure ultraviolet light for inactivating Mycobacterium avium complex (MAC) micro-organisms

    EPA Science Inventory

    Aims: To assess low-pressure ultraviolet light (LP-UV) inactivation kinetics of Mycobacterium avium complex (MAC) strains in a water matrix using collimated beam apparatus. Methods and Results: Strains of M. avium (n = 3) and Mycobacterium intracellulare (n = 2) were exposed t...

  13. Evaluation of MGIT 960-Based Antimicrobial Testing and Determination of Critical Concentrations of First- and Second-Line Antimicrobial Drugs with Drug-Resistant Clinical Strains of Mycobacterium tuberculosis

    PubMed Central

    Krüüner, Annika; Yates, Malcolm D.; Drobniewski, Francis A.

    2006-01-01

    The objectives of this study were to (i) compare agreement of the MGIT 960 system for first-line drugs with a methodology (the resistance ratio method [RRM]) that had been used in clinical trials, relating drug susceptibility to clinical outcome; (ii) compare the performance of the MGIT 960, RRM, and microtiter plate assay (MPA) methodologies for second-line drug testing; and (iii) define critical concentrations for ciprofloxacin and moxifloxacin for liquid-culture-based testing. The large collection of clinical isolates of Mycobacterium tuberculosis (n = 247) used included 176 (71%) multidrug-resistant isolates. The results for MGIT 960 and the RRM for rifampin and isoniazid (n = 200) were in excellent (99 to 100%) agreement for all strains. For streptomycin, 97% of the results at the critical concentration and 92% at high concentration, and for pyrazinamide 92% of results overall, were concordant, but for ethambutol, fewer than 85% (65% for the critical concentration and 84% for the high concentration) of the MGIT-based results were concordant with those for the RRM. The MGIT 960, RRM, and MPA assays (n = 133) correlated well for most second-line drugs tested. For susceptibility to ofloxacin, the MGIT 960 and MPA results were in full agreement. The amikacin and rifabutin results obtained by MGIT 960 agreed with the RRM results in 131 (99%) cases, and for capreomycin, they agreed for 129 of 133 isolates tested (97%). For prothionamide testing, only a limited number of drug-resistant isolates were available for testing and drawing definitive conclusions. We propose critical concentrations of 1.0 μg/ml and 0.125 μg/ml for ciprofloxacin and moxifloxacin, respectively, for liquid-culture-based testing. PMID:16517859

  14. Draft genome sequence of a Mycobacterium avium complex isolate from a broadbill bird

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the draft genome sequences of ten Mycobacterium avium complex isolates obtained from diverse hosts. This collection includes isolates obtained from deer, pig, elephant, ruddy duck and Red-tailed hawk species. The type strain of Mycobacterium avium subspecies silvaticum (ATCC 49884) is also...

  15. Mycobacterium angelicum sp. nov., a non-chromogenic, slow-growing species isolated from fish and related to Mycobacterium szulgai.

    PubMed

    Pourahmad, Fazel; Pate, Mateja; Ocepek, Matjaž; Borroni, Emanuele; Cabibbe, Andrea M; Capitolo, Eleonora; Cittaro, Davide; Frizzera, Eliana; Jenčič, Vlasta; Mariottini, Alessandro; Marumo, Kenji; Vaggelli, Guendalina; Cirillo, Daniela M; Tortoli, Enrico

    2015-12-01

    The name 'Mycobacterium angelicum' dates back to 2003 when it was suggested for a slowly growing mycobacterium isolated from freshwater angelfish. This name is revived here and the novel species is proposed on the basis of the polyphasic characterization of four strains including the original one. The four strains presented 100 % 16S rRNA gene sequence similarity with Mycobacterium szulgai but clearly differed from M. szulgai for the milky white aspect of the colonies. The sequence similarity with the type strain of M. szulgai ranged, in eight additionally investigated genetic targets, from 78.9 to 94.3 %, an evident contrast with the close relatedness that emerged at the level of 16S rRNA gene. The average nucleotide identity between the genomes of M. szulgai DSM 44166T and strain 126/5/03T (type strain of the novel species) was 92.92 %, and supported the status of independent species. The confirmation of the name Mycobacterium angelicum sp. nov. is proposed, with strain 126/5/03T ( = CIP 109313T = DSM 45057T) as the type strain. PMID:26420689

  16. Variable transcriptional adaptation between the laboratory (H37Rv) and clinical strains (S7 and S10) of Mycobacterium tuberculosis under hypoxia.

    PubMed

    Devasundaram, Santhi; Raja, Alamelu

    2016-06-01

    Tuberculosis continues to be a major public health problem in many parts of the world, despite intensified efforts taken to control the disease. The remarkable success of M. tuberculosis as a pathogen is largely due to its ability to persist within the host for long periods. To develop the effective intervention strategies, understanding the biology of persistence is highly required. Accumulating evidences showed oxygen deprivation (hypoxia) as a potential stimulus for triggering the transition of M. tuberculosis to a non-replicating persistent state analogous to latency in vivo. To date, in vitro hypoxia experimental models used the laboratory adapted isolate H37Rv and very little is known about the behavior of clinical isolates that are involved during disease outbreaks. Hence, we compared the transcription profiles of H37Rv and two south Indian clinical isolates (S7 and S10) under hypoxia to find differences in gene expression pattern. The main objective of this current work is to find "differentially regulated genes" (genes that are down regulated in H37Rv but upregulated in both the clinical isolates) under hypoxia. Microarray results showed, a total of 502 genes were down regulated in H37Rv under hypoxia and 10 out of 502 genes were upregulated in both the clinical isolates. Thus, giving less importance to down regulated genes based on H37Rv model strain might exclude the true representative gene candidates in clinical isolates. Our study suggests the use of most prevalent clinical isolates for in vitro experimental model to minimize the variation in understanding the adaptation mechanisms of the strains. PMID:26780642

  17. Isolation of Mycobacterium kumamotonense from a patient with pulmonary infection and latent tuberculosis.

    PubMed

    Kontos, Fanourios; Mavromanolakis, Dimitrios Nikitas; Zande, Marina Chari; Gitti, Zoe Georgios

    2016-01-01

    Mycobacterium kumamotonense is a novel, slow-growing non-chromogenic nontuberculous mycobacterium, which belongs to Mycobacterium terrae complex. We report, for the first time in Greece, the isolation of M. kumamotonense from an immunocompetent patient with pulmonary infection and latent tuberculosis. M. kumamotonense was identified by sequencing analysis of 16S rDNA and 65-kDa heat shock protein genes while by commercial molecular assays it was misidentified as Mycobacterium celatum. Antibiotic susceptibility testing was performed by the reference broth microdilution method. The strain was susceptible to amikacin, clarithromycin, rifampin, ciprofloxacin, moxifloxacin, rifabutin, ethambutol and linezolid. PMID:27080783

  18. Mycobacterium marinum infection.

    PubMed

    Cassetty, Christopher T; Sanchez, Miguel

    2004-01-01

    A 49-year-old man presented with nodules on his right hand after a history of Mycobacterium marinum infection recently treated with rifampin and clarithromycin. The patient has an aquarium with Betta fish (Siamese fighting fish). PMID:15748591

  19. Crystal structure and functional implications of LprF from Mycobacterium tuberculosis and M. bovis.

    PubMed

    Kim, Jin Sik; Jiao, Li; Oh, Jeong Il; Ha, Nam Chul; Kim, Yong Hak

    2014-10-01

    The Gram-positive bacteria Mycobacterium tuberculosis and M. bovis are causative agents of tuberculosis in humans and cattle. The lipoprotein LprF is found in M. tuberculosis and M. bovis but not in the nonpathogenic M. smegmatis. To date, the role of LprF remains to be elucidated. In this study, the crystal structure of LprF has been determined at 1.1 Å resolution. The overall structure is similar to that of a homologue, LprG, with a central hydrophobic cavity that binds a triacylated glycolipid. LprF exhibited a central cavity structure similar to that of LprG, but with a smaller cavity that binds two alkyl chains. Consistently, subsequent mass-spectrometric analysis revealed that the bound ligand was a diacylated glycolipid, as found in the structure. Furthermore, an increased ratio of lipoarabinomannan to lipomannan in the mycobacterial cell wall was observed when lprF was introduced into M. smegmatis. These observations suggested that LprF transfers the diacylated glycolipid from the plasma membrane to the cell wall, which might be related to the pathogenesis of the bacteria. PMID:25286846

  20. Composition and potency characterization of Mycobacterium avium subsp. paratuberculosis purified protein derivatives

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mycobacterium avium subsp. paratuberculosis (MAP) purified protein derivatives (PPDs) are immunologic reagents prepared from cultured filtrates of the type strain ATCC 19698. Traditional production consists of floating culture incubation at 37oC, organism inactivation by autoclaving, coarse filtrat...

  1. Differentiation of slowly growing Mycobacterium species, including Mycobacterium tuberculosis, by gene amplification and restriction fragment length polymorphism analysis.

    PubMed Central

    Plikaytis, B B; Plikaytis, B D; Yakrus, M A; Butler, W R; Woodley, C L; Silcox, V A; Shinnick, T M

    1992-01-01

    A two-step assay combining a gene amplification step and a restriction fragment length polymorphism analysis was developed to differentiate the Mycobacterium species that account for greater than 90% of potentially pathogenic isolates and greater than 86% of all isolates in clinical laboratories in the United States. These species are M. tuberculosis, M. bovis, M. avium, M. intracellulare, M. kansasii, and M. gordonae. With lysates of pure cultures as the template, two oligonucleotide primers that amplified an approximately 1,380-bp portion of the hsp65 gene from all 139 strains of 19 Mycobacterium species tested, but not from the 19 non-Mycobacterium species tested, were identified. Digestion of the amplicons from 126 strains of the six most commonly isolated Mycobacterium species with the restriction enzymes BstNI and XhoI in separate reactions generated restriction fragment patterns that were distinctive for each of these species, except for those of M. tuberculosis and M. bovis, which were not distinguishable. By including size standards in each sample, the restriction fragment profiles could be normalized to a fixed distance and the similarities of patterns could be calculated by using a computer-aided comparison program. The availability of this data base should enable the identification of an unknown Mycobacterium strain to the species level by a comparison of the restriction fragment pattern of the unknown with the data base of known patterns. Images PMID:1352786

  2. Identification of Functional Tat Signal Sequences in Mycobacterium tuberculosis Proteins▿ †

    PubMed Central

    McDonough, Justin A.; McCann, Jessica R.; Tekippe, Erin McElvania; Silverman, Jason S.; Rigel, Nathan W.; Braunstein, Miriam

    2008-01-01

    The twin-arginine translocation (Tat) pathway is a system used by some bacteria to export proteins out from the cytosol to the cell surface or extracellular environment. A functional Tat pathway exists in the important human pathogen Mycobacterium tuberculosis. Identification of the substrates exported by the Tat pathway can help define the role that this pathway plays in the physiology and pathogenesis of M. tuberculosis. Here we used a reporter of Tat export, a truncated β-lactamase, ′BlaC, to experimentally identify M. tuberculosis proteins with functional Tat signal sequences. Of the 13 proteins identified, one lacks the hallmark of a Tat-exported substrate, the twin-arginine dipeptide, and another is not predicted by in silico analysis of the annotated M. tuberculosis genome. Full-length versions of a subset of these proteins were tested to determine if the native proteins are Tat exported. For three proteins, expression in a Δtat mutant of Mycobacterium smegmatis revealed a defect in precursor processing compared to expression in the wild type, indicating Tat export of the full-length proteins. Conversely, two proteins showed no obvious Tat export in M. smegmatis. One of this latter group of proteins was the M. tuberculosis virulence factor phospholipase C (PlcB). Importantly, when tested in M. tuberculosis a different result was obtained and PlcB was exported in a twin-arginine-dependent manner. This suggests the existence of an M. tuberculosis-specific factor(s) for Tat export of a proven virulence protein. It also emphasizes the importance of domains beyond the Tat signal sequence and bacterium-specific factors in determining if a given protein is Tat exported. PMID:18658266

  3. Regulation of lipid biosynthesis, sliding motility, and biofilm formation by a membrane-anchored nucleoid-associated protein of Mycobacterium tuberculosis.

    PubMed

    Ghosh, Soumitra; Indi, Shantinath S; Nagaraja, Valakunja

    2013-04-01

    Bacteria use a number of small basic proteins for organization and compaction of their genomes. By their interaction with DNA, these nucleoid-associated proteins (NAPs) also influence gene expression. Rv3852, a NAP of Mycobacterium tuberculosis, is conserved among the pathogenic and slow-growing species of mycobacteria. Here, we show that the protein predominantly localizes in the cell membrane and that the carboxy-terminal region with the propensity to form a transmembrane helix is necessary for its membrane localization. The protein is involved in genome organization, and its ectopic expression in Mycobacterium smegmatis resulted in altered nucleoid morphology, defects in biofilm formation, sliding motility, and change in apolar lipid profile. We demonstrate its crucial role in regulating the expression of KasA, KasB, and GroEL1 proteins, which are in turn involved in controlling the surface phenotypes in mycobacteria. PMID:23396914