Science.gov

Sample records for nadph-dependent oxidoreductase genes

  1. Molecular cloning and characterization of two YGL039w genes encoding broad specificity NADPH-dependent aldehyde reductases from Kluyveromyces marxianus strain DMB1.

    PubMed

    Akita, Hironaga; Watanabe, Masahiro; Suzuki, Toshihiro; Nakashima, Nobutaka; Hoshino, Tamotsu

    2015-08-01

    Two genes from Kluyveromyces marxianus strain DMB1, YGL039w1 and YGL039w2, encode putative uncharacterized oxidoreductases that respectively share 42 and 44% identity with the Saccharomyces cerevisiae S288c NADPH-dependent methylglyoxal reductase (EC 1.1.1.283). To determine the enzymatic characteristics of their products, the two genes were expressed in recombinant Escherichia coli cells, after which the YGL039w1 and YGL039w2 proteins were purified to homogeneity. In the presence of NADPH, both enzymes showed reductive activities toward at least nine aldehyde substrates, but no NADP(+)-dependent oxidative activities. These two YGL039w proteins thus appear to be aldehyde reductases. In addition, although both enzymes retained more than 70% of their activities after incubation for 30 min at temperatures below 40°C or at pHs between 5.5 and 11.3, YGL039w2 was slightly more thermostable than YGL039w1. PMID:26223585

  2. Characterization of the Kluyveromyces marxianus strain DMB1 YGL157w gene product as a broad specificity NADPH-dependent aldehyde reductase.

    PubMed

    Akita, Hironaga; Watanabe, Masahiro; Suzuki, Toshihiro; Nakashima, Nobutaka; Hoshino, Tamotsu

    2015-01-01

    The open reading frame YGL157w in the genome of the yeast Kluyveromyces marxianus strain DMB1 encodes a putative uncharacterized oxidoreductase. However, this protein shows 46% identity with the Saccharomyces cerevisiae S288c NADPH-dependent methylglyoxal reductase, which exhibits broad substrate specificity for aldehydes. In the present study, the YGL157w gene product (KmGRE2) was purified to homogeneity from overexpressing Escherichia coli cells and found to be a monomer. The enzyme was strictly specific for NADPH and was active with a wide variety of substrates, including aliphatic (branched-chain and linear) and aromatic aldehydes. The optimal pH for methylglyoxal reduction was 5.5. With methylglyoxal as a substrate, the optimal temperature for enzyme activity at pH 5.5 was 45°C. The enzyme retained more than 70% of its activity after incubation for 30 min at temperatures below 35°C or at pHs between 5.5 and 9.0. In addition, the KmGRE2-overexpressing E. coli showed improved growth when cultivated in cedar hydrolysate, as compared to cells not expressing the enzyme. Taken together, these results indicate that KmGRE2 is potentially useful as an inhibit decomposer in E. coli cells. PMID:25852994

  3. The housekeeping gene xanthine oxidoreductase is necessary for milk fat

    E-print Network

    Capecchi, Mario R.

    The housekeeping gene xanthine oxidoreductase is necessary for milk fat droplet enveloping in purine catabolism occurring in most cell types. However, this housekeeping gene is expressed at very high, 2002. Xanthine oxidoreductase (XOR) is a housekeeping gene that encodes a molybdenum iron-sulfur flavin

  4. NADPH-dependent Reductases Involved in the Detoxification of Reactive Carbonyls in Plants*

    PubMed Central

    Yamauchi, Yasuo; Hasegawa, Ayaka; Taninaka, Ai; Mizutani, Masaharu; Sugimoto, Yukihiro

    2011-01-01

    Reactive carbonyls, especially ?,?-unsaturated carbonyls produced through lipid peroxidation, damage biomolecules such as proteins and nucleotides; elimination of these carbonyls is therefore essential for maintaining cellular homeostasis. In this study, we focused on an NADPH-dependent detoxification of reactive carbonyls in plants and explored the enzyme system involved in this detoxification process. Using acrolein (CH2 = CHCHO) as a model ?,?-unsaturated carbonyl, we purified a predominant NADPH-dependent acrolein-reducing enzyme from cucumber leaves, and we identified the enzyme as an alkenal/one oxidoreductase (AOR) catalyzing reduction of an ?,?-unsaturated bond. Cloning of cDNA encoding AORs revealed that cucumber contains two distinct AORs, chloroplastic AOR and cytosolic AOR. Homologs of cucumber AORs were found among various plant species, including Arabidopsis, and we confirmed that a homolog of Arabidopsis (At1g23740) also had AOR activity. Phylogenetic analysis showed that these AORs belong to a novel class of AORs. They preferentially reduced ?,?-unsaturated ketones rather than ?,?-unsaturated aldehydes. Furthermore, we selected candidates of other classes of enzymes involved in NADPH-dependent reduction of carbonyls based on the bioinformatic information, and we found that an aldo-keto reductase (At2g37770) and aldehyde reductases (At1g54870 and At3g04000) were implicated in the reduction of an aldehyde group of saturated aldehydes and methylglyoxal as well as ?,?-unsaturated aldehydes in chloroplasts. These results suggest that different classes of NADPH-dependent reductases cooperatively contribute to the detoxification of reactive carbonyls. PMID:21169366

  5. No associations between Parkinson's disease and polymorphisms of the quinone oxidoreductase (NQO1, NQO2) genes.

    PubMed

    Okada, Starlyn; Farin, Federico M; Stapleton, Patricia; Viernes, Hanna; Quigley, Sean D; Powers, Karen M; Smith-Weller, Terri; Franklin, Gary M; Longstreth, W T; Swanson, Phillip D; Checkoway, Harvey

    2005-03-01

    Reactive oxygen species derived from dopamine metabolism can induce oxidative stress and thus may contribute to Parkinson's disease (PD) pathogenesis. The quinone oxidoreductases, nicotinamide adenine dinucleotide (phosphate) (NAD[P]H): quinone oxidoreductase 1 (NQO1) and dihydronicotinamide riboside (NRH): quinone oxidoreductase 2 (NQO2) detoxify quinones and quinonoid compounds. We investigated associations of genetic polymorphisms of NQO1 (C609T) and NQO2 (I/D, 29 base pairs) with PD in a population-based case-control study of 190 idiopathic PD cases and 305 unrelated controls matched on age and sex. No associations were detected for either gene variant or for any allele combinations. PMID:15694256

  6. ISOLATION AND CHARACTERIZATION OF THE ALKANE-INDUCIBLE NADPH-CYTOCHROME P-450 OXIDOREDUCTASE GENE FROM CANDIDA TROPICALIS

    EPA Science Inventory

    The gene coding for the Candida tropicalis NADPH-cytochrome P-450 oxidoreductase (CPR, NADPH: ferricytochrome oxidoreductase, EC 1.6.2.4) was isolated by immunoscreening of a C. tropicalis gtll expression library and colony hybridization of a C. tropicalis genomic library. he C. ...

  7. Paraquat and NADPH-dependent lipid peroxidation in lung microsomes

    SciTech Connect

    Misra, H.P.; Gorsky, L.D.

    1981-10-10

    Since there exists some controversy in the literature as to whether paraquat augments microsomal lipid peroxidation via superoxide anion (O/sub 2//sup -/), the role of paraquat and active oxygen species in NADPH-dependent lung microsomal lipid peroxidation was investigated. Incubation of buffered aerobic mixture of bovine lung microsome and NADPH, in the presence or absence of exogenously added iron, resulted in a progressive formation of lipid peroxides whose accumulation could be followed at 535 nm as malondialdehyde. Paraquat strongly inhibited this lipid peroxidation, Thus, malondialydehyde formation was 50% inhibited by 4 X 10/sup -5/ M paraquat in the reaction mixture. The malondialdehyde color development by lipid peroxides was not affected by this concentration of paraquat. Lipid peroxidation was also strongly inhibited by singlet oxygen scavengers, e.g. dimethylfuran and diphenylfuran, and by catalase. Hydroxyl radical scavengers, e.g. mannitol, benzoate, and ethanol, had little effect in malondialydehyde production. Superoxide dismutase, which removes O/sub 2//sup -/ efficiently, did not inhibit malondialdehyde production by lung microsomes and rather enhanced its formation. A scheme in which paraquat and active O/sub 2/ species may be involved with microsomal lipid peroxidation is presented.

  8. Tissue- and cell-specific expression of mouse xanthine oxidoreductase gene in vivo: regulation by bacterial lipopolysaccharide.

    PubMed Central

    Kurosaki, M; Li Calzi, M; Scanziani, E; Garattini, E; Terao, M

    1995-01-01

    The expression of the xanthine oxidoreductase gene was studied in various mouse organs and tissues, under basal conditions and on treatment with bacterial lipopolysaccharide. Levels of xanthine oxidoreductase protein and mRNA were compared in order to understand the molecular mechanisms regulating the expression of this enzyme system. The highest amounts of xanthine oxidoreductase and the respective mRNA are observed in the duodenum and jejunum, where the protein is present in an unusual form because of a specific proteolytic cleavage of the primary translation product present in all locations. Under basal conditions, multiple tissue-specific mechanisms of xanthine oxidoreductase regulation are evident. Lipopolysaccharide increases enzyme activity in some, but not all tissues, mainly via modulation of the respective transcript, although translational and post-translational mechanisms are also active. In situ hybridization studies on tissue sections obtained from mice under control conditions or with lipopolysaccharide treatment demonstrate that xanthine oxidoreductase is present in hepatocytes, predominantly in the proximal tubules of the kidney, epithelial layer of the gastrointestinal mucosa, the alveolar compartment of the lung, the pulpar region of the spleen and the vascular component of the heart. Images Figure 1 Figure 2 Figure 4 Figure 5 Figure 6 PMID:7864814

  9. [Cloning and expressing of 1,3-propanediol oxidoreductase-encoding gene].

    PubMed

    Chi, Naiyu; Liu, Changjiang; Liu, Yinghao; Zhang, Qingfang; Zheng, Xuefang

    2003-12-01

    Based on what mentioned above, the gene encoding 1,3-propanediol Oxidoreductase (dhaT) in Clostridium pasteurianum CpN-86 was cloned by using PCR method. The sequence, expressing vector construction and its expression of dhaT in E. coli were accomplished respectively. The recombination protein expressed by dhaT was also isolated and purified. The experimental results showed that: (1) The homogeneity of dhaT cloned by PCR and that in klebsiella pneumoniae strain was 82.9%; (2)The enzymatic activity of the protein expressed by cloned dhaT was 108 microM/ mg; (3)The molecular weight of the protein was 43 kD; (4) The protein expressed by dhaT has the same antigenicity as the natural protein of CpN-86 through Western blotting. PMID:16276891

  10. Human NAD(P)H:quinone oxidoreductase (NQO sub 1 ) gene structure and induction by dioxin

    SciTech Connect

    Jaiswal, A.K. Fox Chase Cancer Center, Philadelphia, PA )

    1991-11-05

    The human NAD(P):quinone oxidoreductase (NQO{sub 1}) gene, 1850 base pairs (bp) of the 5{prime} flanking region, and 67 bp of the 3{prime} flanking region have been sequenced. The human NQO{sub 1} gene is approximately 20 kb in length and has six exons interrupted by five introns. The start site of transcription was determined by primer extension analysis. Nuclear run-on experiments performed using nuclei isolated from 2,3,7,8-tetrachlorodibenzo-p-doxin (TCDD) treated and untreated human hepatoblastoma (Hep-G2) cells demonstrated that TCDD treatment increases the rate of transcription of endogenous NQO{sub 1} gene by 3-fold. The sequence analysis of the 5{prime} flanking region of the NQO{sub 1} gene showed the presence of a TATA box in the {minus}37 to {minus}32 bp region, one CCAAT box at nucleotide {minus}649, an AP1 binding site at position {minus}462, an AP2 site at nucleotide position {minus}156, and one copy of the nucleotide sequence GCGTC. It is noteworthy that XRE in human NQO{sub 1} gene is located 5{prime} to the ARE compared to its 3{prime} location in the rat quinone reductase gene. Interestingly, the consensus sequence for binding to AP1 protein (TGACTCA) is contained within the ARE sequence (TCACAGTGACTCAGCAGAATC) of human NQO{sub 1} gene. By deletion mutagenesis and transfection studies, the author has identified a segment of DNA in the upstream region of the human NQO{sub 1} gene required for a high level of expression in hepatoma cells and its induction by TCDD.

  11. Coregulated Genes Link Sulfide:Quinone Oxidoreductase and Arsenic Metabolism in Synechocystis sp. Strain PCC6803

    PubMed Central

    Nagy, Csaba I.; Vass, Imre; Rákhely, Gábor; Vass, István Zoltán; Tóth, András; Duzs, Ágnes; Peca, Loredana; Kruk, Jerzy

    2014-01-01

    Although the biogeochemistry of the two environmentally hazardous compounds arsenic and sulfide has been extensively investigated, the biological interference of these two toxic but potentially energy-rich compounds has only been hypothesized and indirectly proven. Here we provide direct evidence for the first time that in the photosynthetic model organism Synechocystis sp. strain PCC6803 the two metabolic pathways are linked by coregulated genes that are involved in arsenic transport, sulfide oxidation, and probably in sulfide-based alternative photosynthesis. Although Synechocystis sp. strain PCC6803 is an obligate photoautotrophic cyanobacterium that grows via oxygenic photosynthesis, we discovered that specific genes are activated in the presence of sulfide or arsenite to exploit the energy potentials of these chemicals. These genes form an operon that we termed suoRSCT, located on a transposable element of type IS4 on the plasmid pSYSM of the cyanobacterium. suoS (sll5036) encodes a light-dependent, type I sulfide:quinone oxidoreductase. The suoR (sll5035) gene downstream of suoS encodes a regulatory protein that belongs to the ArsR-type repressors that are normally involved in arsenic resistance. We found that this repressor has dual specificity, resulting in 200-fold induction of the operon upon either arsenite or sulfide exposure. The suoT gene encodes a transmembrane protein similar to chromate transporters but in fact functioning as an arsenite importer at permissive concentrations. We propose that the proteins encoded by the suoRSCT operon might have played an important role under anaerobic, reducing conditions on primordial Earth and that the operon was acquired by the cyanobacterium via horizontal gene transfer. PMID:25022856

  12. Electron transport to nitrogenase. Purification and characterization of pyruvate:flavodoxin oxidoreductase. The nifJ gene product.

    PubMed

    Shah, V K; Stacey, G; Brill, W J

    1983-10-10

    Pyruvate:flavodoxin oxidoreductase, the nifJ gene product of Klebsiella pneumoniae, was purified to homogeneity. Pyruvate:flavodoxin oxidoreductase, flavodoxin, and nitrogenase components I and II are the only proteins required for pyruvate-coupled nitrogenase activity. The physiological source of electrons to nitrogenase in K. pneumoniae is pyruvate. Flavodoxin from Azotobacter vinelandii was only one-third as effective as K. pneumoniae flavodoxin in transferring electrons from pyruvate:flavodoxin oxidoreductase to Azotobacter and Klebsiella nitrogenases. Ferredoxins from aerobic, anaerobic and photosynthetic nitrogen-fixing organisms, as well as benzyl viologen and methyl viologen, were ineffective in coupling pyruvate oxidation to nitrogenase activity. One mol each of acetyl-CoA, CO2, and ethylene are formed by pyruvate-supported acetylene reduction. The enzyme contains 8.0 +/- 0.6 mol of iron and 6.6 +/- 0.2 mol of acid-labile sulfide per mol of protein (Mr = 240,000). Pyruvate:flavodoxin oxidoreductase is irreversibly inactivated by air. PMID:6352705

  13. Human carbonyl reductase 4 is a mitochondrial NADPH-dependent quinone reductase.

    PubMed

    Endo, Satoshi; Matsunaga, Toshiyuki; Kitade, Yukio; Ohno, Satoshi; Tajima, Kazuo; El-Kabbani, Ossama; Hara, Akira

    2008-12-26

    A protein encoded in the gene Cbr4 on human chromosome 4q32.3 belongs to the short-chain dehydrogenase/reductase family. Contrary to the functional annotation as carbonyl reductase 4 (CBR4), we show that the recombinant tetrameric protein, composed of 25-kDa subunits, exhibits NADPH-dependent reductase activity for o- and p-quinones, but not for other aldehydes and ketones. The enzyme was insensitive to dicumarol and quercetin, potent inhibitors of cytosolic quinone reductases. The 25-kDa CBR4 was detected in human liver, kidney and cell lines on Western blotting using anti-CBR4 antibodies. The overexpression of CBR4 in bovine endothelial cells reveals that the enzyme has a non-cleavable mitochondrial targeting signal. We further demonstrate that the in vitro quinone reduction by CBR4 generates superoxide through the redox cycling, and suggest that the enzyme may be involved in the induction of apoptosis by cytotoxic 9,10-phenanthrenequinone. PMID:19000905

  14. Fur activates expression of the 2-oxoglutarate oxidoreductase genes (oorDABC) in Helicobacter pylori.

    PubMed

    Gilbreath, Jeremy J; West, Abby L; Pich, Oscar Q; Carpenter, Beth M; Michel, Sarah; Merrell, D Scott

    2012-12-01

    Helicobacter pylori is a highly successful pathogen that colonizes the gastric mucosa of ?50% of the world's population. Within this colonization niche, the bacteria encounter large fluctuations in nutrient availability. As such, it is critical that this organism regulate expression of key metabolic enzymes so that they are present when environmental conditions are optimal for growth. One such enzyme is the 2-oxoglutarate (?-ketoglutarate) oxidoreductase (OOR), which catalyzes the conversion of ?-ketoglutarate to succinyl coenzyme A (succinyl-CoA) and CO(2). Previous studies from our group suggested that the genes that encode the OOR are activated by iron-bound Fur (Fe-Fur); microarray analysis showed that expression of oorD, oorA, and oorC was altered in a fur mutant strain of H. pylori. The goal of the present work was to more thoroughly characterize expression of the oorDABC genes in H. pylori as well as to define the role of Fe-Fur in this process. Here we show that these four genes are cotranscribed as an operon and that expression of the operon is decreased in a fur mutant strain. Transcriptional start site mapping and promoter analysis revealed the presence of a canonical extended -10 element but a poorly conserved -35 element upstream of the +1. Additionally, we identified a conserved Fur binding sequence ?130 bp upstream of the transcriptional start site. Transcriptional analysis using promoter fusions revealed that this binding sequence was required for Fe-Fur-mediated activation. Finally, fluorescence anisotropy assays indicate that Fe-Fur specifically bound this Fur box with a relatively high affinity (dissociation constant [K(d)] = 200 nM). These findings provide novel insight into the genetic regulation of a key metabolic enzyme and add to our understanding of the diverse roles Fur plays in gene regulation in H. pylori. PMID:23002221

  15. Biodesulfurization of dibenzothiophene in Escherichia coli is enhanced by expression of a Vibrio harveyi oxidoreductase gene

    SciTech Connect

    Reichmuth, D.S.; Hittle, J.L.; Blanch, H.W.; Keasling, J.D.

    2000-01-05

    One possible alternative to current fuel hydrodesulfurization methods is the use of microorganisms to remove sulfur compounds. Biodesulfurization requires much milder processing conditions, gives higher specificity, and does not require molecular hydrogen. In the present work the authors have produced two compatible plasmids: pDSR3, which allows Escherichia coli to convert dibenzothiophene (DBT) to hydroxybiphenyl (HBP), and pDSR2, which produces a Vibrio harveyi flavin oxidoreductase. The authors show that the flavin oxidoreductase enhances the rate of DBT removal when co-expressed in vivo with the desulfurization enzymes. The plasmids pDSR2 and pDSR3 were co-expressed in growing cultures. The expression of oxidoreductase caused an increase in the rate of DBT removal but a decrease in the rate of HBP production. The maximum rate of DBT removal was 8 mg/h {center{underscore}dot} g dry cell weight. Experiments were also conducted using resting cells with the addition of various carbon sources. It was found that the addition of glucose or glycerol to cultures with oxidoreductase expression produced the highest DBT removal rate. The culture with acetate and no oxidoreductase expression had the highest level of HBP production. For all carbon sources, the DBT removal rate was faster and the HBP generation rate slower with the expression of the oxidoreductase. Analysis of desulfurization intermediates indicates that the last enzyme in the pathway may be limiting.

  16. Comparative Molecular Modeling Study of Arabidopsis NADPH-Dependent Thioredoxin Reductase and Its

    E-print Network

    Lee, Keun Woo

    Center Program (2009-0081539) and Management of Climate Change Program (2010-0029084) through the NRFComparative Molecular Modeling Study of Arabidopsis NADPH-Dependent Thioredoxin Reductase and Its) simulations on AtNTRC and AtNTRA-(Trx-D) proteins with same cofactors such as NADPH and flavin adenine

  17. Transcriptional Regulation of the Human P450 Oxidoreductase Gene: Hormonal Regulation and Influence of Promoter Polymorphisms

    PubMed Central

    Tee, Meng Kian; Huang, Ningwu; Damm, Izabella

    2011-01-01

    P450 oxidoreductase (POR) is the flavoprotein that acts as the obligatory electron donor to all microsomal P450 enzymes, including those involved in hepatic drug metabolism as well as three steroidogenic P450 enzymes. The untranslated first exon of human POR was located recently, permitting analysis of human POR transcription. Expression of deletional mutants containing up to 3193 bp of the human POR promoter in human adrenal NCI-H295A and liver Hep-G2 cells located the proximal promoter at ?325/?1 bp from the untranslated exon. Common human POR polymorphisms at ?208 and ?173 had little influence on transcription, but the polymorphism at ?152 reduced transcription significantly in both cell lines. EMSA and supershift assays identified binding of Smad3/Smad4 between ?249 and ?261 and binding of thyroid hormone receptor-? (TR?) at ?240/?245. Chromatin immunoprecipitation showed that Smad3, Smad4, TR?, TR?, and estrogen receptor-? were bound between ?374 and ?149. Cotransfection of vectors for these transcription factors and POR promoter-reporter constructs into both cell types followed by hormonal treatment showed that T3 exerts major tropic effects via TR?, with TR?, estrogen receptor-?, Smad3, and Smad4 exerting lesser, modulatory effects. T3 also increased POR mRNA in both cell lines. Thyroid hormone also is essential for rat liver POR expression but acts via different transcription factor complexes. These are the first data on human POR gene transcription, establishing roles for TR? and Smad3/4 in its expression and indicating that the common polymorphism at ?152 may play a role in genetic variation in steroid biosynthesis and drug metabolism. PMID:21393444

  18. Ca2+ regulation of thyroid NADPH-dependent H2O2 generation.

    PubMed

    Dupuy, C; Dème, D; Kaniewski, J; Pommier, J; Virion, A

    1988-06-01

    A thyroid particulate fraction contains an NADPH-dependent H2O2-generating enzyme which requires Ca2+ for activity. A Chaps solubilized extract of the thyroid particulate fraction partially purified by DEAE chromatography did not show a dependence on Ca2+ for activity. Preincubation of the particulate fraction with Ca2+ yielded a preparation insensitive to Ca2+. The non-particulate fraction obtained after incubation of the particles in the presence of Ca2+ was able to inhibit, in the presence of EGTA, the Ca2+-desensitized particulate fraction and the enzyme isolated on DEAE. It is concluded that the reversible Ca2+ activation of the NADPH-dependent H2O2 generation was modulated in porcine thyroid tissue by (a) calcium-releasable inhibitor protein(s). PMID:3133245

  19. Molecular cloning and characterization of the human mitochondrial NADH:ubiquinone oxidoreductase 24-kDa gene

    SciTech Connect

    Coo, J. de; Buddiger, P.; Kessel, A.G. van

    1994-09-01

    The mitochondrial NADH:ubiquinone oxidoreductase (complex I) of the respiratory chain is composed of at least 41 individual proteins. Seven are encoded for by the mitochondrial genome and 34 are of nuclear origin. Mutations in the mitochondrial encoded subunits have been observed in a number of different mitochondrial encephalomyopathies. In order to investigate the contribution of mutations in the nuclearly encoded subunits, we started to characterize the human gene for the 24 kDa flavoprotein fragment, one of the three key subunits of complex I. Two gene loci were detected with a human cDNA as a probe using somatic cell hybrids, one on chromosome 18 and one on chromosome 19. Cosmid clones were isolated containing the two genes. Using FISH analysis the map position was further refined to 18p11.2-18p11.31 and 19qter, respectively. RNA studies showed that only the chromosome 18 gene was expressed. This gene spans approximately 20 kb and consists of 8 exons. Exon and flanking intron sequences were characterized. The pseudogene differs from the intact cDNA by the lack of the methionine initiator codon. Currently, we are testing patients with complex I deficiencies for mutations in their 24 kDa gene.

  20. Expression of the iorAB genes from Brevundimonas diminuta 7 encoding the molybdenum hydroxylase isoquinoline 1-oxidoreductase in Pseudomonas putida.

    PubMed

    Israel, Ilka; Sohni, Monika; Fetzner, Susanne

    2002-04-23

    Isoquinoline 1-oxidoreductase (Ior) from Brevundimonas diminuta 7, encoded by iorAB, is a molybdenum hydroxylase containing a molybdopterin cytosine dinucleotide molybdenum cofactor (Mo-MCD) and two distinct [2Fe2S] clusters. The iorAB genes were inserted into pJB653, generating pIL1. Pseudomonas putida KT2440, and P. putida 86 which produces a Mo-MCD-containing quinoline 2-oxidoreductase when grown on quinoline, were used as recipients for pIL1. Upon induction of gene expression, both clones produced Ior protein, but Ior activity was not detectable in P. putida KT2440 pIL1. In P. putida 86 pIL1, formation of catalytically active Ior required the presence of quinoline, suggesting that accessory gene(s) encoding product(s) essential for the assembly of catalytically competent Ior is (are) part of the quinoline regulon in P. putida 86. PMID:12023088

  1. Eicosanoids up-regulate production of reactive oxygen species by NADPH-dependent oxidase in Spodoptera exigua phagocytic hemocytes.

    PubMed

    Park, Youngjin; Stanley, David W; Kim, Yonggyun

    2015-08-01

    Eicosanoids mediate cellular immune responses in insects, including phagocytosis of invading microbes. Phagocytosis entails two major steps, the internalization of microbes and the subsequent killing of them via formation of reactive oxygen species (ROS). Here, we posed the hypothesis that eicosanoids mediate ROS production by activating NADPH-dependent oxidase (NOX) and tested the idea in the model insect, Spodoptera exigua. A NOX gene (we named SeNOX4) was identified and cloned, yielding a full open reading frame encoding 547 amino acid residues with a predicted molecular weight of 63,410Da and an isoelectric point at 9.28. A transmembrane domain and a large intracellular domain containing NADPH and FAD-binding sites were predicted. Phylogenetic analysis indicated SeNOX4 clusters with other NOX4 genes. SeNOX4 was expressed in all life stages except eggs, and exclusively in hemocytes. Bacterial challenge and, separately, arachidonic acid (AA, a precursor of eicosanoid biosynthesis) injection increased its expression. The internalization step was assessed by counting hemocytes engulfing fluorescence-labeled bacteria. The phagocytic behavior was inhibited by dsRNA suppression of SeNOX4 expression and, separately by dexamethasone (DEX, a specific inhibitor of eicosanoid biosynthesis) treatments. However, injecting AA to dsSeNOX4-treated larvae did not rescue the phagocytic activity. Hemocytic ROS production increased following bacterial challenge, which was sharply reduced in dsSeNOX4-treated, and separately, in DEX-treated larvae. AA partially reversed the suppressed ROS production in dsSeNOX4-treated larvae. Treating larvae with either the ROS-suppressing dsSeNOX4 construct or DEX rendered experimental larvae unable to inhibit bacterial proliferation in their hemocoels. We infer that eicosanoids mediate ROS production during phagocytosis by inducing expression of SeNOX4. PMID:26071791

  2. Posttranslational Influence of NADPH-Dependent Thioredoxin Reductase C on Enzymes in Tetrapyrrole Synthesis[W][OA

    PubMed Central

    Richter, Andreas S.; Peter, Enrico; Rothbart, Maxi; Schlicke, Hagen; Toivola, Jouni; Rintamäki, Eevi; Grimm, Bernhard

    2013-01-01

    The NADPH-dependent thioredoxin reductase C (NTRC) is involved in redox-related regulatory processes in chloroplasts and nonphotosynthetic active plastids. Together with 2-cysteine peroxiredoxin, it forms a two-component peroxide-detoxifying system that acts as a reductant under stress conditions. NTRC stimulates in vitro activity of magnesium protoporphyrin IX monomethylester (MgPMME) cyclase, most likely by scavenging peroxides. Reexamination of tetrapyrrole intermediate levels of the Arabidopsis (Arabidopsis thaliana) knockout ntrc reveals lower magnesium protoporphyrin IX (MgP) and MgPMME steady-state levels, the substrate and the product of MgP methyltransferase (CHLM) preceding MgPMME cyclase, while MgP strongly accumulates in mutant leaves after 5-aminolevulinic acid feeding. The ntrc mutant has a reduced capacity to synthesize 5-aminolevulinic acid and reduced CHLM activity compared with the wild type. Although transcript levels of genes involved in chlorophyll biosynthesis are not significantly altered in 2-week-old ntrc seedlings, the contents of glutamyl-transfer RNA reductase1 (GluTR1) and CHLM are reduced. Bimolecular fluorescence complementation assay confirms a physical interaction of NTRC with GluTR1 and CHLM. While ntrc contains partly oxidized CHLM, the wild type has only reduced CHLM. As NTRC also stimulates CHLM activity in vitro, it is proposed that NTRC has a regulatory impact on the redox status of conserved cysteine residues of CHLM. It is hypothesized that a deficiency of NTRC leads to a lower capacity to reduce cysteine residues of GluTR1 and CHLM, affecting the stability and, thereby, altering the activity in the entire tetrapyrrole synthesis pathway. PMID:23569108

  3. Reconstruction of an Acetogenic 2,3-Butanediol Pathway Involving a Novel NADPH-Dependent Primary-Secondary Alcohol Dehydrogenase

    PubMed Central

    Köpke, Michael; Gerth, Monica L.; Maddock, Danielle J.; Mueller, Alexander P.; Liew, FungMin

    2014-01-01

    Acetogenic bacteria use CO and/or CO2 plus H2 as their sole carbon and energy sources. Fermentation processes with these organisms hold promise for producing chemicals and biofuels from abundant waste gas feedstocks while simultaneously reducing industrial greenhouse gas emissions. The acetogen Clostridium autoethanogenum is known to synthesize the pyruvate-derived metabolites lactate and 2,3-butanediol during gas fermentation. Industrially, 2,3-butanediol is valuable for chemical production. Here we identify and characterize the C. autoethanogenum enzymes for lactate and 2,3-butanediol biosynthesis. The putative C. autoethanogenum lactate dehydrogenase was active when expressed in Escherichia coli. The 2,3-butanediol pathway was reconstituted in E. coli by cloning and expressing the candidate genes for acetolactate synthase, acetolactate decarboxylase, and 2,3-butanediol dehydrogenase. Under anaerobic conditions, the resulting E. coli strain produced 1.1 ± 0.2 mM 2R,3R-butanediol (23 ?M h?1 optical density unit?1), which is comparable to the level produced by C. autoethanogenum during growth on CO-containing waste gases. In addition to the 2,3-butanediol dehydrogenase, we identified a strictly NADPH-dependent primary-secondary alcohol dehydrogenase (CaADH) that could reduce acetoin to 2,3-butanediol. Detailed kinetic analysis revealed that CaADH accepts a range of 2-, 3-, and 4-carbon substrates, including the nonphysiological ketones acetone and butanone. The high activity of CaADH toward acetone led us to predict, and confirm experimentally, that C. autoethanogenum can act as a whole-cell biocatalyst for converting exogenous acetone to isopropanol. Together, our results functionally validate the 2,3-butanediol pathway from C. autoethanogenum, identify CaADH as a target for further engineering, and demonstrate the potential of C. autoethanogenum as a platform for sustainable chemical production. PMID:24657865

  4. Randomly selected suppressor mutations in genes for NADH?:?quinone oxidoreductase-1, which rescue motility of a Salmonella ubiquinone-biosynthesis mutant strain.

    PubMed

    Barker, Clive S; Meshcheryakova, Irina V; Sasaki, Toshio; Roy, Michael C; Sinha, Prem Kumar; Yagi, Takao; Samatey, Fadel A

    2014-06-01

    The primary mobile electron-carrier in the aerobic respiratory chain of Salmonella is ubiquinone. Demethylmenaquinone and menaquinone are alternative electron-carriers involved in anaerobic respiration. Ubiquinone biosynthesis was disrupted in strains bearing deletions of the ubiA or ubiE genes. In soft tryptone agar both mutant strains swam poorly. However, the ubiA deletion mutant strain produced suppressor mutant strains with somewhat rescued motility and growth. Six independent suppressor mutants were purified and comparative genome sequence analysis revealed that they each bore a single new missense mutation, which localized to genes for subunits of NADH?:?quinone oxidoreductase-1. Four mutants bore an identical nuoG(Q297K) mutation, one mutant bore a nuoM(A254S) mutation and one mutant bore a nuoN(A444E) mutation. The NuoG subunit is part of the hydrophilic domain of NADH?:?quinone oxidoreductase-1 and the NuoM and NuoN subunits are part of the hydrophobic membrane-embedded domain. Respiration was rescued and the suppressed mutant strains grew better in Luria-Bertani broth medium and could use l-malate as a sole carbon source. The quinone pool of the cytoplasmic membrane was characterized by reversed-phase HPLC. Wild-type cells made ubiquinone and menaquinone. Strains with a ubiA deletion mutation made demethylmenaquinone and menaquinone and the ubiE deletion mutant strain made demethylmenaquinone and 2-octaprenyl-6-methoxy-1,4-benzoquinone; the total quinone pool was reduced. Immunoblotting found increased NADH?:?quinone oxidoreductase-1 levels for ubiquinone-biosynthesis mutant strains and enzyme assays measured electron transfer from NADH to demethylmenaquinone or menaquinone. Under certain growth conditions the suppressor mutations improved electron flow activity of NADH?:?quinone oxidoreductase-1 for cells bearing a ubiA deletion mutation. PMID:24692644

  5. Randomly selected suppressor mutations in genes for NADH?:?quinone oxidoreductase-1, which rescue motility of a Salmonella ubiquinone-biosynthesis mutant strain

    PubMed Central

    Meshcheryakova, Irina V.; Sasaki, Toshio; Roy, Michael C.; Sinha, Prem Kumar; Yagi, Takao

    2014-01-01

    The primary mobile electron-carrier in the aerobic respiratory chain of Salmonella is ubiquinone. Demethylmenaquinone and menaquinone are alternative electron-carriers involved in anaerobic respiration. Ubiquinone biosynthesis was disrupted in strains bearing deletions of the ubiA or ubiE genes. In soft tryptone agar both mutant strains swam poorly. However, the ubiA deletion mutant strain produced suppressor mutant strains with somewhat rescued motility and growth. Six independent suppressor mutants were purified and comparative genome sequence analysis revealed that they each bore a single new missense mutation, which localized to genes for subunits of NADH?:?quinone oxidoreductase-1. Four mutants bore an identical nuoG(Q297K) mutation, one mutant bore a nuoM(A254S) mutation and one mutant bore a nuoN(A444E) mutation. The NuoG subunit is part of the hydrophilic domain of NADH?:?quinone oxidoreductase-1 and the NuoM and NuoN subunits are part of the hydrophobic membrane-embedded domain. Respiration was rescued and the suppressed mutant strains grew better in Luria–Bertani broth medium and could use l-malate as a sole carbon source. The quinone pool of the cytoplasmic membrane was characterized by reversed-phase HPLC. Wild-type cells made ubiquinone and menaquinone. Strains with a ubiA deletion mutation made demethylmenaquinone and menaquinone and the ubiE deletion mutant strain made demethylmenaquinone and 2-octaprenyl-6-methoxy-1,4-benzoquinone; the total quinone pool was reduced. Immunoblotting found increased NADH?:?quinone oxidoreductase-1 levels for ubiquinone-biosynthesis mutant strains and enzyme assays measured electron transfer from NADH to demethylmenaquinone or menaquinone. Under certain growth conditions the suppressor mutations improved electron flow activity of NADH?:?quinone oxidoreductase-1 for cells bearing a ubiA deletion mutation. PMID:24692644

  6. Light Driven CO2 Fixation by Using Cyanobacterial Photosystem I and NADPH-Dependent Formate Dehydrogenase

    PubMed Central

    Ihara, Masaki; Kawano, Yusuke; Urano, Miho; Okabe, Ayako

    2013-01-01

    The ultimate goal of this research is to construct a new direct CO2 fixation system using photosystems in living algae. Here, we report light-driven formate production from CO2 by using cyanobacterial photosystem I (PS I). Formate, a chemical hydrogen carrier and important industrial material, can be produced from CO2 by using the reducing power and the catalytic function of formate dehydrogenase (FDH). We created a bacterial FDH mutant that experimentally switched the cofactor specificity from NADH to NADPH, and combined it with an in vitro-reconstituted cyanobacterial light-driven NADPH production system consisting of PS I, ferredoxin (Fd), and ferredoxin-NADP+-reductase (FNR). Consequently, light-dependent formate production under a CO2 atmosphere was successfully achieved. In addition, we introduced the NADPH-dependent FDH mutant into heterocysts of the cyanobacterium Anabaena sp. PCC 7120 and demonstrated an increased formate concentration in the cells. These results provide a new possibility for photo-biological CO2 fixation. PMID:23936519

  7. Electron Transfer Pathways and Dynamics of Chloroplast NADPH-dependent Thioredoxin Reductase C (NTRC)*

    PubMed Central

    Bernal-Bayard, Pilar; Hervás, Manuel; Cejudo, Francisco J.; Navarro, José A.

    2012-01-01

    NADPH-dependent thioredoxin reductases (NTRs) contain a flavin cofactor and a disulfide as redox-active groups. The catalytic mechanism of standard NTR involves a large conformational change between two configurations. Oxygenic photosynthetic organisms possess a plastid-localized NTR, called NTRC, with a thioredoxin module fused at the C terminus. NTRC is an efficient reductant of 2-Cys peroxiredoxins (2-Cys Prxs) and thus is involved in the protection against oxidative stress, among other functions. Although the mechanism of electron transfer of canonical NTRs is well established, it is not yet known in NTRC. By employing stopped-flow spectroscopy, we have carried out a comparative kinetic study of the electron transfer reactions involving NTRC, the truncated NTR module of NTRC, and NTRB, a canonical plant NTR. Whereas the three NTRs maintain the conformational change associated with the reductive cycle of catalysis, NTRC intramolecular electron transfer to the thioredoxin module presents two kinetic components (kET of ?2 and 0.1 s?1), indicating the occurrence of additional dynamic motions. Moreover, the dynamic features associated with the electron transfer to the thioredoxin module are altered in the presence of 2-Cys Prx. NTRC shows structural constraints that may locate the thioredoxin module in positions with different efficiencies for electron transfer, the presence of 2-Cys Prx shifting the conformational equilibrium of the thioredoxin module to a specific position, which is not the most efficient. PMID:22833674

  8. Structure of Hordeum vulgare NADPH-dependent thioredoxin reductase 2. Unwinding the reaction mechanism

    SciTech Connect

    Kirkensgaard, Kristine G.; Hägglund, Per; Finnie, Christine; Svensson, Birte; Henriksen, Anette

    2009-09-01

    The first crystal structure of a cereal NTR, a protein involved in seed development and germination, has been determined. The structure is in a conformation that excludes NADPH binding and indicates that a domain reorientation facilitated by Trx binding precedes NADPH binding in the reaction mechanism. Thioredoxins (Trxs) are protein disulfide reductases that regulate the intracellular redox environment and are important for seed germination in plants. Trxs are in turn regulated by NADPH-dependent thioredoxin reductases (NTRs), which provide reducing equivalents to Trx using NADPH to recycle Trxs to the active form. Here, the first crystal structure of a cereal NTR, HvNTR2 from Hordeum vulgare (barley), is presented, which is also the first structure of a monocot plant NTR. The structure was determined at 2.6 Å resolution and refined to an R{sub cryst} of 19.0% and an R{sub free} of 23.8%. The dimeric protein is structurally similar to the structures of AtNTR-B from Arabidopsis thaliana and other known low-molecular-weight NTRs. However, the relative position of the two NTR cofactor-binding domains, the FAD and the NADPH domains, is not the same. The NADPH domain is rotated by 25° and bent by a 38% closure relative to the FAD domain in comparison with AtNTR-B. The structure may represent an intermediate between the two conformations described previously: the flavin-oxidizing (FO) and the flavin-reducing (FR) conformations. Here, analysis of interdomain contacts as well as phylogenetic studies lead to the proposal of a new reaction scheme in which NTR–Trx interactions mediate the FO to FR transformation.

  9. 1,4-Naphthoquinones and Others NADPH-Dependent Glutathione Reductase-Catalyzed Redox Cyclers as Antimalarial Agents

    PubMed Central

    Belorgey, Didier; Lanfranchi, Don Antoine; Davioud-Charvet, Elisabeth

    2013-01-01

    The homodimeric flavoenzyme glutathione reductase catalyzes NADPH-dependent glutathione disulfide reduction. This reaction is important for keeping the redox homeostasis in human cells and in the human pathogen Plasmodium falciparum. Different types of NADPH-dependent disulfide reductase inhibitors were designed in various chemical series to evaluate the impact of each inhibition mode on the propagation of the parasites. Against malaria parasites in cultures the most potent and specific effects were observed for redox-active agents acting as subversive substrates for both glutathione reductases of the Plasmodium-infected red blood cells. In their oxidized form, these redox-active compounds are reduced by NADPH-dependent flavoenzyme-catalyzed reactions in the cytosol of infected erythrocytes. In their reduced forms, these compounds can reduce molecular oxygen to reactive oxygen species, or reduce oxidants like methemoglobin, the major nutrient of the parasite, to indigestible hemoglobin. Furthermore, studies on a fluorinated suicide-substrate of the human glutathione reductase indicate that the glutathione reductase-catalyzed bioactivation of 3-benzylnaphthoquinones to the corresponding reduced 3-benzoyl metabolites is essential for the observed antimalarial activity. In conclusion, the antimalarial lead naphthoquinones are suggested to perturb the major redox equilibria of the targeted cells. These effects result in development arrest of the parasite and contribute to the removal of the parasitized erythrocytes by macrophages. PMID:23116403

  10. NADPH-dependent H2O2 generation catalyzed by thyroid plasma membranes. Studies with electron scavengers.

    PubMed

    Dupuy, C; Kaniewski, J; Dème, D; Pommier, J; Virion, A

    1989-11-20

    Hog thyroid plasma membrane preparations containing a Ca2+-regulated NADPH-dependent H2O2-generating system were studied. The Ca2+-dependent reductase activities of ferricytochrome c, 2,6-dichloroindophenol, nitroblue tetrazolium, and potassium ferricyanide were tested and the effect of these scavengers on H2O2 formation, NADPH oxidation and O2 consumption were measured, with the following results. 1. Thyroid plasma membrane Ca2+-independent cytochrome c reduction was not catalyzed by the NADPH-dependent H2O2-generating system. This activity was superoxide-dismutase-insensitive. 2. Of the three other electron scavengers tested, only K3Fe(CN)6 was clearly, but partially reduced in a Ca2+-dependent manner. 3. Though the NADPH-dependent reduction of nitroblue tetrazolium was very low and superoxide-dismutase-insensitive, nitroblue tetrazolium inhibited O2 consumption, H2O2 formation and NADPH oxidation, indicating that nitroblue tetrazolium inhibits the H2O2-generating system. We conclude that the thyroid plasma membrane H2O2-generating system does not or liberate O2- and that Ca2+ controls the first step (NADPH oxidation) of the H2O2-generating system. PMID:2556271

  11. Toxic-Selenium and Low-Selenium Transcriptomes in Caenorhabditis elegans: Toxic Selenium Up-Regulates Oxidoreductase and Down-Regulates Cuticle-Associated Genes

    PubMed Central

    Boehler, Christopher J.; Raines, Anna M.; Sunde, Roger A.

    2014-01-01

    Selenium (Se) is an element that in trace quantities is both essential in mammals but also toxic to bacteria, yeast, plants and animals, including C. elegans. Our previous studies showed that selenite was four times as toxic as selenate to C. elegans, but that deletion of thioredoxin reductase did not modulate Se toxicity. To characterize Se regulation of the full transcriptome, we conducted a microarray study in C. elegans cultured in axenic media supplemented with 0, 0.05, 0.1, 0.2, and 0.4 mM Se as selenite. C. elegans cultured in 0.2 and 0.4 mM Se displayed a significant delay in growth as compared to 0, 0.05, or 0.1 mM Se, indicating Se-induced toxicity, so worms were staged to mid-L4 larval stage for these studies. Relative to 0.1 mM Se treatment, culturing C. elegans at these Se concentrations resulted in 1.9, 9.7, 5.5, and 2.3%, respectively, of the transcriptome being altered by at least 2-fold. This toxicity altered the expression of 295 overlapping transcripts, which when filtered against gene sets for sulfur and cadmium toxicity, identified a dataset of 182 toxic-Se specific genes that were significantly enriched in functions related to oxidoreductase activity, and significantly depleted in genes related to structural components of collagen and the cuticle. Worms cultured in low Se (0 mM Se) exhibited no signs of deficiency, but low Se was accompanied by a transcriptional response of 59 genes changed ?2-fold when compared to all other Se concentrations, perhaps due to decreases in Se-dependent TRXR-1 activity. Overall, these results suggest that Se toxicity in C. elegans causes an increase in ROS and stress responses, marked by increased expression of oxidoreductases and reduced expression of cuticle-associated genes, which together underlie the impaired growth observed in these studies. PMID:24971995

  12. Identification of the gene encoding the major NAD(P)H-flavin oxidoreductase of the bioluminescent bacterium Vibrio fischeri ATCC 7744.

    PubMed

    Zenno, S; Saigo, K; Kanoh, H; Inouye, S

    1994-06-01

    The gene encoding the major NAD(P)H-flavin oxidoreductase (flavin reductase) of the luminous bacterium Vibrio fischeri ATCC 7744 was isolated by using synthetic oligonucleotide probes corresponding to the N-terminal amino acid sequence of the enzyme. Nucleotide sequence analysis suggested that the major flavin reductase of V. fischeri consisted of 218 amino acids and had a calculated molecular weight of 24,562. Cloned flavin reductase expressed in Escherichia coli was purified virtually to homogeneity, and its basic biochemical properties were examined. As in the major flavin reductase in crude extracts of V. fischeri, cloned flavin reductase showed broad substrate specificity and served well as a catalyst to supply reduced flavin mononucleotide (FMNH2) to the bioluminescence reaction. The major flavin reductase of V. fischeri not only showed significant similarity in amino acid sequence to oxygen-insensitive NAD(P)H nitroreductases of Salmonella typhimurium, Enterobacter cloacae, and E. coli but also was associated with a low level of nitroreductase activity. The major flavin reductase of V. fischeri and the nitroreductases of members of the family Enterobacteriaceae would thus appear closely related in evolution and form a novel protein family. PMID:8206830

  13. Dehydroepiandrosterone supplement increases malate dehydrogenase activity and decreases NADPH-dependent antioxidant enzyme activity in rat hepatocellular carcinogenesis

    PubMed Central

    Kim, Sook-Hee; Choi, Haymie

    2008-01-01

    Beneficial effects of dehydroepiandrosterone (DHEA) supplement on age-associated chronic diseases such as cancer, cardiovascular disease, insulin resistance and diabetes, have been reported. However, its mechanism of action in hepatocellular carcinoma in vivo has not been investigated in detail. We have previously shown that during hepatocellular carcinogenesis, DHEA treatment decreases formation of preneoplastic glutathione S-transferase placental form-positive foci in the liver and has antioxidant effects. Here we aimed to determine the mechanism of actions of DHEA, in comparison to vitamin E, in a chemically-induced hepatocellular carcinoma model in rats. Sprague-Dawley rats were administered with control diet without a carcinogen, diets with 1.5% vitamin E, 0.5% DHEA and both of the compounds with a carcinogen for 6 weeks. The doses were previously reported to have anti-cancer effects in animals without known toxicities. With DHEA treatment, cytosolic malate dehydrogenase activities were significantly increased by ~5 fold and glucose 6-phosphate dehydrogenase activities were decreased by ~25% compared to carcinogen treated group. Activities of Se-glutathione peroxidase in the cytotol was decreased significantly with DHEA treatment, confirming its antioxidative effect. However, liver microsomal cytochrome P-450 content and NADPH-dependent cytochrome P-450 reductase activities were not altered with DHEA treatment. Vitamin E treatment decreased cytosolic Se-glutathione peroxidase activities in accordance with our previous reports. However, vitamin E did not alter glucose 6-phosphate dehydrogenase or malate dehydrogenase activities. Our results suggest that DHEA may have decreased tumor nodule formation and reduced lipid peroxidation as previously reported, possibly by increasing the production of NADPH, a reducing equivalent for NADPH-dependent antioxidant enzymes. DHEA treatment tended to reduce glucose 6-phosphate dehydrogenase activities, which may have resulted in limited supply for de novo synthesis of DNA via inhibiting the hexose monophophaste pathway. Although both DHEA and vitamin E effectively reduced preneoplastic foci in this model, they seemed to function in different mechanisms. In conclusion, DHEA may be used to reduce hepatocellular carcinoma growth by targeting NADPH synthesis, cell proliferation and anti-oxidant enzyme activities during tumor growth. PMID:20126370

  14. Characterization of NADPH-dependent methemoglobin reductase as a heme-binding protein present in erythrocytes and liver.

    PubMed Central

    Xu, F; Quandt, K S; Hultquist, D E

    1992-01-01

    An NADPH-dependent reductase, first shown in the 1930s to catalyze the methylene blue-dependent reduction of methemoglobin in erythrocytes, has now been characterized as a high-affinity heme-binding protein and has been detected in liver. Highly purified bovine erythrocyte reductase binds protohemin to form a 1:1 complex with a Kd of 7 nM. Binding of protohemin completely inhibits reductase activity. Other tetrapyrroles and fatty acids also bind to the reductase and inhibit its activity. Protoporphyrin, hematoporphyrin, and coproporphyrin form 1:1 complexes with Kd values ranging from 1 to 5 microM. The inhibition constants for a number of saturated and unsaturated fatty acids range from 6 to 52 microM. A protein that is immunologically cross-reactive to the reductase has been detected in the cytosolic fractions of bovine and rat liver and of bovine, rat, rabbit, and human erythrocytes. By immunoblot analysis, the bovine liver and erythrocyte proteins appear identical in size, as do the rat liver and erythrocyte proteins. The concentration of the protein in bovine erythrocytes has been estimated by quantitative immunoblotting to be 10 microM. The detection of this protein in liver cells, the demonstration of its binding properties, and its weak reductase activity bring into question the long-held belief that this is uniquely an erythrocyte protein and that it functions as a reductase. Images PMID:1549573

  15. Characterization of NADPH-dependent methemoglobin reductase as a heme-binding protein present in erythrocytes and liver.

    PubMed

    Xu, F; Quandt, K S; Hultquist, D E

    1992-03-15

    An NADPH-dependent reductase, first shown in the 1930s to catalyze the methylene blue-dependent reduction of methemoglobin in erythrocytes, has now been characterized as a high-affinity heme-binding protein and has been detected in liver. Highly purified bovine erythrocyte reductase binds protohemin to form a 1:1 complex with a Kd of 7 nM. Binding of protohemin completely inhibits reductase activity. Other tetrapyrroles and fatty acids also bind to the reductase and inhibit its activity. Protoporphyrin, hematoporphyrin, and coproporphyrin form 1:1 complexes with Kd values ranging from 1 to 5 microM. The inhibition constants for a number of saturated and unsaturated fatty acids range from 6 to 52 microM. A protein that is immunologically cross-reactive to the reductase has been detected in the cytosolic fractions of bovine and rat liver and of bovine, rat, rabbit, and human erythrocytes. By immunoblot analysis, the bovine liver and erythrocyte proteins appear identical in size, as do the rat liver and erythrocyte proteins. The concentration of the protein in bovine erythrocytes has been estimated by quantitative immunoblotting to be 10 microM. The detection of this protein in liver cells, the demonstration of its binding properties, and its weak reductase activity bring into question the long-held belief that this is uniquely an erythrocyte protein and that it functions as a reductase. PMID:1549573

  16. Molecular cloning of the isoquinoline 1-oxidoreductase genes from Pseudomonas diminuta 7, structural analysis of iorA and iorB, and sequence comparisons with other molybdenum-containing hydroxylases.

    PubMed

    Lehmann, M; Tshisuaka, B; Fetzner, S; Lingens, F

    1995-06-16

    The iorA and iorB genes from the isoquinoline-degrading bacterium Pseudomonas diminuta 7, encoding the heterodimeric molybdo-iron-sulfur-protein isoquinoline 1-oxidoreductase, were cloned and sequenced. The deduced amino acid sequences IorA and IorB showed homologies (i) to the small (gamma) and large (alpha) subunits of complex molybdenum-containing hydroxylases (alpha beta gamma/alpha 2 beta 2 gamma 2) possessing a pterin molybdenum cofactor with a monooxo-monosulfido-type molybdenum center, (ii) to the N- and C-terminal regions of aldehyde oxidoreductase from Desulfovibrio gigas, and (iii) to the N- and C-terminal domains of eucaryotic xanthine dehydrogenases, respectively. The closest similarity to IorB was shown by aldehyde dehydrogenase (Adh) from the acetic acid bacterium Acetobacter polyoxogenes. Five conserved domains of IorB were identified by multiple sequence alignments. Whereas IorB and Adh showed an identical sequential arrangement of these conserved domains, in all other molybdenum-containing hydroxylases the relative position of "domain A" differed. IorA contained eight conserved cysteine residues. The amino acid pattern harboring the four cysteine residues proposed to ligate the Fe/S I cluster was homologous to the consensus binding site of bacterial and chloroplast-type [2Fe-2S] ferredoxins, whereas the pattern including the four cysteines assumed to ligate the Fe/S II center showed no similarities to any described [2Fe-2S] binding motif. The N-terminal region of IorB comprised a putative signal peptide similar to typical leader peptides, indicating that isoquinoline 1-oxidoreductase is associated with the cell membrane. PMID:7782304

  17. Crystallization and preliminary X-ray diffraction analysis of NADPH-dependent thioredoxin reductase I from Saccharomyces cerevisiae

    SciTech Connect

    Oliveira, Marcos Antonio de; Discola, Karen Fulan; Alves, Simone Vidigal; Barbosa, João Alexandre Ribeiro Gonçalves; Medrano, Francisco Javier; Netto, Luis Eduardo Soares; Guimarães, Beatriz Gomes

    2005-04-01

    Thioredoxin reductase 1 (Trr1) from S. cerevisiae is a component of the thioredoxin system, which is involved in several biological processes, including the reduction of disulfide bonds and response to oxidative stress. The expression, purification, crystallization and preliminary X-ray crystallographic studies of yeast Trr1 are reported. Thioredoxin reductase 1 (Trr1) from Saccharomyces cerevisiae is a member of the family of pyridine nucleotide-disulfide oxidoreductases capable of reducing the redox-active disulfide bond of the cytosolic thioredoxin 1 (Trx1) and thioredoxin 2 (Trx2). NADPH, Trr1 and Trx1 (or Trx2) comprise the thioredoxin system, which is involved in several biological processes, including the reduction of disulfide bonds and response to oxidative stress. Recombinant Trr1 was expressed in Escherichia coli as a His{sub 6}-tagged fusion protein and purified by nickel-affinity chromatography. The protein was crystallized using the hanging-drop vapour-diffusion method in the presence of PEG 3000 as precipitant after treatment with hydrogen peroxide. X-ray diffraction data were collected to a maximum resolution of 2.4 Å using a synchrotron-radiation source. The crystal belongs to the centred monoclinic space group C2, with unit-cell parameters a = 127.97, b = 135.41, c = 75.81 Å, ? = 89.95°. The crystal structure was solved by molecular-replacement methods and structure refinement is in progress.

  18. Thioredoxin f1 and NADPH-Dependent Thioredoxin Reductase C Have Overlapping Functions in Regulating Photosynthetic Metabolism and Plant Growth in Response to Varying Light Conditions.

    PubMed

    Thormählen, Ina; Meitzel, Tobias; Groysman, Julia; Öchsner, Alexandra Bianca; von Roepenack-Lahaye, Edda; Naranjo, Belén; Cejudo, Francisco J; Geigenberger, Peter

    2015-11-01

    Two different thiol redox systems exist in plant chloroplasts, the ferredoxin-thioredoxin (Trx) system, which depends on ferredoxin reduced by the photosynthetic electron transport chain and, thus, on light, and the NADPH-dependent Trx reductase C (NTRC) system, which relies on NADPH and thus may be linked to sugar metabolism in the dark. Previous studies suggested, therefore, that the two different systems may have different functions in plants. We now report that there is a previously unrecognized functional redundancy of Trx f1 and NTRC in regulating photosynthetic metabolism and growth. In Arabidopsis (Arabidopsis thaliana) mutants, combined, but not single, deficiencies of Trx f1 and NTRC led to severe growth inhibition and perturbed light acclimation, accompanied by strong impairments of Calvin-Benson cycle activity and starch accumulation. Light activation of key enzymes of these pathways, fructose-1,6-bisphosphatase and ADP-glucose pyrophosphorylase, was almost completely abolished. The subsequent increase in NADPH-NADP(+) and ATP-ADP ratios led to increased nitrogen assimilation, NADP-malate dehydrogenase activation, and light vulnerability of photosystem I core proteins. In an additional approach, reporter studies show that Trx f1 and NTRC proteins are both colocalized in the same chloroplast substructure. Results provide genetic evidence that light- and NADPH-dependent thiol redox systems interact at the level of Trx f1 and NTRC to coordinately participate in the regulation of the Calvin-Benson cycle, starch metabolism, and growth in response to varying light conditions. PMID:26338951

  19. Thioredoxin f1 and NADPH-Dependent Thioredoxin Reductase C Have Overlapping Functions in Regulating Photosynthetic Metabolism and Plant Growth in Response to Varying Light Conditions1[OPEN

    PubMed Central

    Thormählen, Ina; Meitzel, Tobias; Groysman, Julia; Öchsner, Alexandra Bianca; von Roepenack-Lahaye, Edda; Naranjo, Belén; Cejudo, Francisco J.; Geigenberger, Peter

    2015-01-01

    Two different thiol redox systems exist in plant chloroplasts, the ferredoxin-thioredoxin (Trx) system, which depends on ferredoxin reduced by the photosynthetic electron transport chain and, thus, on light, and the NADPH-dependent Trx reductase C (NTRC) system, which relies on NADPH and thus may be linked to sugar metabolism in the dark. Previous studies suggested, therefore, that the two different systems may have different functions in plants. We now report that there is a previously unrecognized functional redundancy of Trx f1 and NTRC in regulating photosynthetic metabolism and growth. In Arabidopsis (Arabidopsis thaliana) mutants, combined, but not single, deficiencies of Trx f1 and NTRC led to severe growth inhibition and perturbed light acclimation, accompanied by strong impairments of Calvin-Benson cycle activity and starch accumulation. Light activation of key enzymes of these pathways, fructose-1,6-bisphosphatase and ADP-glucose pyrophosphorylase, was almost completely abolished. The subsequent increase in NADPH-NADP+ and ATP-ADP ratios led to increased nitrogen assimilation, NADP-malate dehydrogenase activation, and light vulnerability of photosystem I core proteins. In an additional approach, reporter studies show that Trx f1 and NTRC proteins are both colocalized in the same chloroplast substructure. Results provide genetic evidence that light- and NADPH-dependent thiol redox systems interact at the level of Trx f1 and NTRC to coordinately participate in the regulation of the Calvin-Benson cycle, starch metabolism, and growth in response to varying light conditions. PMID:26338951

  20. Photosynthetic electron partitioning between [FeFe]-hydrogenase and ferredoxin:NADP+-oxidoreductase (FNR) enzymes in vitro.

    PubMed

    Yacoby, Iftach; Pochekailov, Sergii; Toporik, Hila; Ghirardi, Maria L; King, Paul W; Zhang, Shuguang

    2011-06-01

    Photosynthetic water splitting, coupled to hydrogenase-catalyzed hydrogen production, is considered a promising clean, renewable source of energy. It is widely accepted that the oxygen sensitivity of hydrogen production, combined with competition between hydrogenases and NADPH-dependent carbon dioxide fixation are the main limitations for its commercialization. Here we provide evidence that, under the anaerobic conditions that support hydrogen production, there is a significant loss of photosynthetic electrons toward NADPH production in vitro. To elucidate the basis for competition, we bioengineered a ferredoxin-hydrogenase fusion and characterized hydrogen production kinetics in the presence of Fd, ferredoxin:NADP(+)-oxidoreductase (FNR), and NADP(+). Replacing the hydrogenase with a ferredoxin-hydrogenase fusion switched the bias of electron transfer from FNR to hydrogenase and resulted in an increased rate of hydrogen photoproduction. These results suggest a new direction for improvement of biohydrogen production and a means to further resolve the mechanisms that control partitioning of photosynthetic electron transport. PMID:21606330

  1. Peroxiredoxins and NADPH-Dependent Thioredoxin Systems in the Model Legume Lotus japonicus1[W][OA

    PubMed Central

    Tovar-Méndez, Alejandro; Matamoros, Manuel A.; Bustos-Sanmamed, Pilar; Dietz, Karl-Josef; Cejudo, Francisco Javier; Rouhier, Nicolas; Sato, Shusei; Tabata, Satoshi; Becana, Manuel

    2011-01-01

    Peroxiredoxins (Prxs), thioredoxins (Trxs), and NADPH-thioredoxin reductases (NTRs) constitute central elements of the thiol-disulfide redox regulatory network of plant cells. This study provides a comprehensive survey of this network in the model legume Lotus japonicus. The aims were to identify and characterize these gene families and to assess whether the NTR-Trx systems are operative in nodules. Quantitative reverse transcription-polymerase chain reaction and immunological and proteomic approaches were used for expression profiling. We identified seven Prx, 14 Trx, and three NTR functional genes. The PrxQ1 gene was found to be transcribed in two alternative spliced variants and to be expressed at high levels in leaves, stems, petals, pods, and seeds and at low levels in roots and nodules. The 1CPrx gene showed very high expression in the seed embryos and low expression in vegetative tissues and was induced by nitric oxide and cytokinins. In sharp contrast, cytokinins down-regulated all other Prx genes, except PrxQ1, in roots and nodules, but only 2CPrxA and PrxQ1 in leaves. Gene-specific changes in Prx expression were also observed in response to ethylene, abscisic acid, and auxins. Nodules contain significant mRNA and protein amounts of cytosolic PrxIIB, Trxh1, and NTRA and of plastidic NTRC. Likewise, they express cytosolic Trxh3, Trxh4, Trxh8, and Trxh9, mitochondrial PrxIIF and Trxo, and plastidic Trxm2, Trxm4, and ferredoxin-Trx reductase. These findings reveal a complex regulation of Prxs that is dependent on the isoform, tissue, and signaling molecule and support that redox NTR-Trx systems are functional in the cytosol, mitochondria, and plastids of nodules. PMID:21562331

  2. Escherichia coli 6-phosphogluconate dehydrogenase aids in tellurite resistance by reducing the toxicant in a NADPH-dependent manner.

    PubMed

    Sandoval, J M; Arenas, F A; García, J A; Díaz-Vásquez, W A; Valdivia-González, M; Sabotier, M; Vásquez, C C

    2015-08-01

    Exposure to the tellurium oxyanion tellurite (TeO3(2-)) results in the establishment of an oxidative stress status in most microorganisms. Usually, bacteria growing in the presence of the toxicant turn black because of the reduction of tellurite (Te(4+)) to the less-toxic elemental tellurium (Te(0)). In vitro, at least part of tellurite reduction occurs enzymatically in a nicotinamide dinucleotide-dependent reaction. In this work, we show that TeO3(2-) reduction by crude extracts of Escherichia coli overexpressing the zwf gene (encoding glucose-6-phosphate dehydrogenase) takes place preferentially in the presence of NADPH instead of NADH. The enzyme responsible for toxicant reduction was identified as 6-phosphogluconate dehydrogenase (Gnd). The gnd gene showed a subtle induction at short times after toxicant exposure while strains lacking gnd were more susceptible to the toxicant. These results suggest that both NADPH-generating enzymes from the pentose phosphate shunt may be involved in tellurite detoxification and resistance in E. coli. PMID:26211962

  3. Meta-Analyses of Dehalococcoides mccartyi Strain 195 Transcriptomic Profiles Identify a Respiration Rate-Related Gene Expression Transition Point and Interoperon Recruitment of a Key Oxidoreductase Subunit

    PubMed Central

    Mansfeldt, Cresten B.; Rowe, Annette R.; Heavner, Gretchen L. W.; Zinder, Stephen H.

    2014-01-01

    A cDNA-microarray was designed and used to monitor the transcriptomic profile of Dehalococcoides mccartyi strain 195 (in a mixed community) respiring various chlorinated organics, including chloroethenes and 2,3-dichlorophenol. The cultures were continuously fed in order to establish steady-state respiration rates and substrate levels. The organization of array data into a clustered heat map revealed two major experimental partitions. This partitioning in the data set was further explored through principal component analysis. The first two principal components separated the experiments into those with slow (1.6 ± 0.6 ?M Cl?/h)- and fast (22.9 ± 9.6 ?M Cl?/h)-respiring cultures. Additionally, the transcripts with the highest loadings in these principal components were identified, suggesting that those transcripts were responsible for the partitioning of the experiments. By analyzing the transcriptomes (n = 53) across experiments, relationships among transcripts were identified, and hypotheses about the relationships between electron transport chain members were proposed. One hypothesis, that the hydrogenases Hup and Hym and the formate dehydrogenase-like oxidoreductase (DET0186-DET0187) form a complex (as displayed by their tight clustering in the heat map analysis), was explored using a nondenaturing protein separation technique combined with proteomic sequencing. Although these proteins did not migrate as a single complex, DET0112 (an FdhB-like protein encoded in the Hup operon) was found to comigrate with DET0187 rather than with the catalytic Hup subunit DET0110. On closer inspection of the genome annotations of all Dehalococcoides strains, the DET0185-to-DET0187 operon was found to lack a key subunit, an FdhB-like protein. Therefore, on the basis of the transcriptomic, genomic, and proteomic evidence, the place of the missing subunit in the DET0185-to-DET0187 operon is likely filled by recruiting a subunit expressed from the Hup operon (DET0112). PMID:25063656

  4. Meta-analyses of Dehalococcoides mccartyi strain 195 transcriptomic profiles identify a respiration rate-related gene expression transition point and interoperon recruitment of a key oxidoreductase subunit.

    PubMed

    Mansfeldt, Cresten B; Rowe, Annette R; Heavner, Gretchen L W; Zinder, Stephen H; Richardson, Ruth E

    2014-10-01

    A cDNA-microarray was designed and used to monitor the transcriptomic profile of Dehalococcoides mccartyi strain 195 (in a mixed community) respiring various chlorinated organics, including chloroethenes and 2,3-dichlorophenol. The cultures were continuously fed in order to establish steady-state respiration rates and substrate levels. The organization of array data into a clustered heat map revealed two major experimental partitions. This partitioning in the data set was further explored through principal component analysis. The first two principal components separated the experiments into those with slow (1.6±0.6 ?M Cl-/h)- and fast (22.9±9.6 ?M Cl-/h)-respiring cultures. Additionally, the transcripts with the highest loadings in these principal components were identified, suggesting that those transcripts were responsible for the partitioning of the experiments. By analyzing the transcriptomes (n=53) across experiments, relationships among transcripts were identified, and hypotheses about the relationships between electron transport chain members were proposed. One hypothesis, that the hydrogenases Hup and Hym and the formate dehydrogenase-like oxidoreductase (DET0186-DET0187) form a complex (as displayed by their tight clustering in the heat map analysis), was explored using a nondenaturing protein separation technique combined with proteomic sequencing. Although these proteins did not migrate as a single complex, DET0112 (an FdhB-like protein encoded in the Hup operon) was found to comigrate with DET0187 rather than with the catalytic Hup subunit DET0110. On closer inspection of the genome annotations of all Dehalococcoides strains, the DET0185-to-DET0187 operon was found to lack a key subunit, an FdhB-like protein. Therefore, on the basis of the transcriptomic, genomic, and proteomic evidence, the place of the missing subunit in the DET0185-to-DET0187 operon is likely filled by recruiting a subunit expressed from the Hup operon (DET0112). PMID:25063656

  5. Alkaloid Cluster Gene ccsA of the Ergot Fungus Claviceps purpurea Encodes Chanoclavine I Synthase, a Flavin Adenine Dinucleotide-Containing Oxidoreductase Mediating the Transformation of N-Methyl-Dimethylallyltryptophan to Chanoclavine I ?

    PubMed Central

    Lorenz, Nicole; Olšovská, Jana; Šulc, Miroslav; Tudzynski, Paul

    2010-01-01

    Ergot alkaloids are indole-derived secondary metabolites synthesized by the phytopathogenic ascomycete Claviceps purpurea. In wild-type strains, they are exclusively produced in the sclerotium, a hibernation structure; for biotechnological applications, submerse production strains have been generated by mutagenesis. It was shown previously that the enzymes specific for alkaloid biosynthesis are encoded by a gene cluster of 68.5 kb. This ergot alkaloid cluster consists of 14 genes coregulated and expressed under alkaloid-producing conditions. Although the role of some of the cluster genes in alkaloid biosynthesis could be confirmed by a targeted knockout approach, further functional analyses are needed, especially concerning the early pathway-specific steps up to the production of clavine alkaloids. Therefore, the gene ccsA, originally named easE and preliminarily annotated as coding for a flavin adenine dinucleotide-containing oxidoreductase, was deleted in the C. purpurea strain P1, which is able to synthesize ergot alkaloids in axenic culture. Five independent knockout mutants were analyzed with regard to alkaloid-producing capability. Thin-layer chromatography (TLC), ultrapressure liquid chromatography (UPLC), and mass spectrometry (MS) analyses revealed accumulation of N-methyl-dimethylallyltryptophan (Me-DMAT) and traces of dimethylallyltryptophan (DMAT), the first pathway-specific intermediate. Since other alkaloid intermediates could not be detected, we conclude that deletion of ccsA led to a block in alkaloid biosynthesis beyond Me-DMAT formation. Complementation with a ccsA/gfp fusion construct restored alkaloid biosynthesis. These data indicate that ccsA encodes the chanoclavine I synthase or a component thereof catalyzing the conversion of N-methyl-dimethylallyltryptophan to chanoclavine I. PMID:20118373

  6. Alkaloid cluster gene ccsA of the ergot fungus Claviceps purpurea encodes chanoclavine I synthase, a flavin adenine dinucleotide-containing oxidoreductase mediating the transformation of N-methyl-dimethylallyltryptophan to chanoclavine I.

    PubMed

    Lorenz, Nicole; Olsovská, Jana; Sulc, Miroslav; Tudzynski, Paul

    2010-03-01

    Ergot alkaloids are indole-derived secondary metabolites synthesized by the phytopathogenic ascomycete Claviceps purpurea. In wild-type strains, they are exclusively produced in the sclerotium, a hibernation structure; for biotechnological applications, submerse production strains have been generated by mutagenesis. It was shown previously that the enzymes specific for alkaloid biosynthesis are encoded by a gene cluster of 68.5 kb. This ergot alkaloid cluster consists of 14 genes coregulated and expressed under alkaloid-producing conditions. Although the role of some of the cluster genes in alkaloid biosynthesis could be confirmed by a targeted knockout approach, further functional analyses are needed, especially concerning the early pathway-specific steps up to the production of clavine alkaloids. Therefore, the gene ccsA, originally named easE and preliminarily annotated as coding for a flavin adenine dinucleotide-containing oxidoreductase, was deleted in the C. purpurea strain P1, which is able to synthesize ergot alkaloids in axenic culture. Five independent knockout mutants were analyzed with regard to alkaloid-producing capability. Thin-layer chromatography (TLC), ultrapressure liquid chromatography (UPLC), and mass spectrometry (MS) analyses revealed accumulation of N-methyl-dimethylallyltryptophan (Me-DMAT) and traces of dimethylallyltryptophan (DMAT), the first pathway-specific intermediate. Since other alkaloid intermediates could not be detected, we conclude that deletion of ccsA led to a block in alkaloid biosynthesis beyond Me-DMAT formation. Complementation with a ccsA/gfp fusion construct restored alkaloid biosynthesis. These data indicate that ccsA encodes the chanoclavine I synthase or a component thereof catalyzing the conversion of N-methyl-dimethylallyltryptophan to chanoclavine I. PMID:20118373

  7. The formate:oxygen oxidoreductase supercomplex of Escherichia coli aerobic respiratory chain.

    PubMed

    Sousa, Pedro M F; Videira, Marco A M; Melo, Ana M P

    2013-08-19

    The Escherichia coli formate:oxygen oxidoreductase supercomplex (FdOx) was investigated with respect to function and composition. Formate oxidoreductase activity was detected in blue native polyacrylamide gel electrophoresis (BN-PAGE) resolved membranes of E. coli, which were also capable of cyanide sensitive formate:oxygen oxidoreductase activity. The latter was compromised in strains devoid of specific oxygen reductases, particularly, in those devoid of cytochrome bo3 or bdI. A principal component analysis (PCA) integrating E. coli aerobic respiratory chain gene transcription, enzyme activity and growth dynamics was performed, correlating formate:oxygen oxidoreductase activity and the transcription of the genes encoding cytochromes bo3 and bdI, and corroborating previous evidence that associated these complexes in FdOx. PMID:23827816

  8. Improvement of NADPH-dependent P450-mediated biotransformation of 7?,15?-diOH-DHEA from DHEA by a dual cosubstrate-coupled system.

    PubMed

    Wu, Yan; Li, Hui; Zhang, Xiao-Mei; Gong, Jin-Song; Li, Heng; Rao, Zhi-Ming; Shi, Jin-Song; Xu, Zheng-Hong

    2015-09-01

    Hydroxylation of DHEA to 7?,15?-diOH-DHEA was catalyzed by NADPH-dependent cytochrome P450 monooxygenase from Colletotrichum lini. By adding coenzyme precursor nicotinic acid, the NADPH/NADP ratio was significantly increased, and the 7?,15?-diOH-DHEA molar conversion was enhanced from 37.37% to 50.85%. To improve the availability of intracellular NADPH, a dual cosubstrate-coupled system consisting of nicotinic acid and glucose was investigated in C. lini. Using 20mM nicotinic acid and 15g/L glucose as cosubstrate for NADPH regeneration, the 7?,15?-diOH-DHEA molar conversion was dramatically increased by 74.58%. The conversion course was simultaneously shortened by 30h. Moreover, a fed-batch transformation model was established to diminish DHEA toxicity to C. lini and further increase DHEA concentration. The maximum concentration of DHEA was elevated to 15g/L using a three-batch transformation in a coenzyme regeneration system, and 7?,15?-diOH-DHEA production of 11.21g/L could be achieved after 60h of biotransformation. These results demonstrated that this strategy was promising for steroids hydroxylation. PMID:26032779

  9. In the Nicotiana sylvestris CMSII mutant, a recombination-mediated change 5' to the first exon of the mitochondrial nad1 gene is associated with lack of the NADH:ubiquinone oxidoreductase (complex I) NAD1 subunit.

    PubMed

    Gutierres, S; Combettes, B; De Paepe, R; Mirande, M; Lelandais, C; Vedel, F; Chétrit, P

    1999-04-01

    We previously reported that the Nicotiana sylvestris CMSII mutant mitochondrial DNA carried a large deletion. Several expressed sequences, most of which are duplicated, and the unique copy of the nad7 gene encoding the NAD7 subunit of the NADH:ubiquinone oxidoreductase complex (complex I) are found in the deletion. Here, we show that the orf87-nad3-nad1/A cotranscription unit transcribed from a unique promoter element in the wild-type, is disrupted in CMSII. Nad3, orf87 and the promoter element are part of the deleted sequence, whilst the nad1/A sequence is present and transcribed from a new promoter brought by the recombination event, as indicated by Northern and primer extension experiments. However, Western analyses of mitochondrial protein fractions and of complex I purified using anti-NAD9 affinity columns, revealed that NAD1 is lacking in CMSII mitochondria. Our results suggest that translation of nad1 transcripts rather than transcription itself could be altered in the mutant. Consequences of lack of this submit belonging the membrane arm of complex I and thought to contain the ubiquinone-binding site, are discussed. PMID:10215845

  10. A novel cytosolic NADH:quinone oxidoreductase from Methanothermobacter marburgensis

    PubMed Central

    Ullmann, Eva; Tan, Tien Chye; Gundinger, Thomas; Herwig, Christoph; Divne, Christina; Spadiut, Oliver

    2014-01-01

    Methanothermobacter marburgensis is a strictly anaerobic, thermophilic methanogenic archaeon that uses methanogenesis to convert H2 and CO2 to energy. M. marburgensis is one of the best-studied methanogens, and all genes required for methanogenic metabolism have been identified. Nonetheless, the present study describes a gene (Gene ID 9704440) coding for a putative NAD(P)H:quinone oxidoreductase that has not yet been identified as part of the metabolic machinery. The gene product, MmNQO, was successfully expressed, purified and characterized biochemically, as well as structurally. MmNQO was identified as a flavin-dependent NADH:quinone oxidoreductase with the capacity to oxidize NADH in the presence of a wide range of electron acceptors, whereas NADPH was oxidized with only three acceptors. The 1.50 Å crystal structure of MmNQO features a homodimeric enzyme where each monomer comprises 196 residues folding into flavodoxin-like ?/? domains with non-covalently bound FMN (flavin mononucleotide). The closest structural homologue is the modulator of drug activity B from Streptococcus mutans with 1.6 Å root-mean-square deviation on 161 C? atoms and 28% amino-acid sequence identity. The low similarity at sequence and structural level suggests that MmNQO is unique among NADH:quinone oxidoreductases characterized to date. Based on preliminary bioreactor experiments, MmNQO could provide a useful tool to prevent overflow metabolism in applications that require cells with high energy demand. PMID:25372605

  11. The Saccharomyces cerevisiae YMR315W Gene Encodes an NADP(H)-Specific Oxidoreductase Regulated by the Transcription Factor Stb5p in Response to NADPH Limitation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Engineered xylose-metabolizing cells grown on xylose show increased expression of YMR315W at both the mRNA and protein levels. Additionally, the YMR315W promoter contains a putative binding site for the transcription factor Stb5p, which has been shown to regulate genes involved in nicotinamide aden...

  12. A Novel NADPH-Dependent Aldehyde Reductase Gene from Saccharomyces cerevisiae NRRL Y-12632 Involved in the Detoxification of Aldehyde Inhibitors Derived from Lignocellulosic Biomass Conversion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aldehyde inhibitors such as furfural, 5-hydroxymethylfurfural (HMF), anisaldehyde, benzaldehyde, cinnamaldehyde, and phenylaldehyde are commonly generated during lignocellulosic biomass conversion process for low-cost cellulosic ethanol production that interferes with subsequent microbial growth and...

  13. Lactic acid-producing yeast cells having nonfunctional L- or D-lactate:ferricytochrome C oxidoreductase cells

    DOEpatents

    Miller, Matthew (Boston, MA); Suominen, Pirkko (Maple Grove, MN); Aristidou, Aristos (Highland Ranch, CO); Hause, Benjamin Matthew (Currie, MN); Van Hoek, Pim (Camarillo, CA); Dundon, Catherine Asleson (Minneapolis, MN)

    2012-03-20

    Yeast cells having an exogenous lactate dehydrogenase gene ae modified by reducing L- or D-lactate:ferricytochrome c oxidoreductase activity in the cell. This leads to reduced consumption of lactate by the cell and can increase overall lactate yields in a fermentation process. Cells having the reduced L- or D-lactate:ferricytochrome c oxidoreductase activity can be screened for by resistance to organic acids such as lactic or glycolic acid.

  14. Cytochrome P450 oxidoreductase participates in nitric oxide consumption by rat brain.

    PubMed

    Hall, Catherine N; Keynes, Robert G; Garthwaite, John

    2009-04-15

    In low nanomolar concentrations, NO (nitric oxide) functions as a transmitter in brain and other tissues, whereas near-micromolar NO concentrations are associated with toxicity and cell death. Control of the NO concentration, therefore, is critical for proper brain function, but, although its synthesis pathway is well-characterized, the major route of breakdown of NO in brain is unclear. Previous observations indicate that brain cells actively consume NO at a high rate. The mechanism of this consumption was pursued in the present study. NO consumption by a preparation of central glial cells was abolished by cell lysis and recovered by addition of NADPH. NADPH-dependent consumption of NO localized to cell membranes and was inhibited by proteinase K, indicating the involvement of a membrane-bound protein. Purification of this activity yielded CYPOR (cytochrome P450 oxidoreductase). Antibodies against CYPOR inhibited NO consumption by brain membranes and the amount of CYPOR in several cell types correlated with their rate of NO consumption. NO was also consumed by purified CYPOR but this activity was found to depend on the presence of the vitamin E analogue Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid), included in the buffer as a precaution against inadvertent NO consumption by lipid peroxidation. In contrast, NO consumption by brain membranes was independent of Trolox. Hence, it appears that, during the purification process, CYPOR becomes separated from a partner needed for NO consumption. Cytochrome P450 inhibitors inhibited NO consumption by brain membranes, making these proteins likely candidates. PMID:19152507

  15. Cytochrome P450 oxidoreductase participates in nitric oxide consumption by rat brain

    PubMed Central

    Hall, Catherine N.; Keynes, Robert G.; Garthwaite, John

    2009-01-01

    In low nanomolar concentrations, NO (nitric oxide) functions as a transmitter in brain and other tissues, whereas near-micromolar NO concentrations are associated with toxicity and cell death. Control of the NO concentration, therefore, is critical for proper brain function, but, although its synthesis pathway is well-characterized, the major route of breakdown of NO in brain is unclear. Previous observations indicate that brain cells actively consume NO at a high rate. The mechanism of this consumption was pursued in the present study. NO consumption by a preparation of central glial cells was abolished by cell lysis and recovered by addition of NADPH. NADPH-dependent consumption of NO localized to cell membranes and was inhibited by proteinase K, indicating the involvement of a membrane-bound protein. Purification of this activity yielded CYPOR (cytochrome P450 oxidoreductase). Antibodies against CYPOR inhibited NO consumption by brain membranes and the amount of CYPOR in several cell types correlated with their rate of NO consumption. NO was also consumed by purified CYPOR but this activity was found to depend on the presence of the vitamin E analogue Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid), included in the buffer as a precaution against inadvertent NO consumption by lipid peroxidation. In contrast, NO consumption by brain membranes was independent of Trolox. Hence, it appears that, during the purification process, CYPOR becomes separated from a partner needed for NO consumption. Cytochrome P450 inhibitors inhibited NO consumption by brain membranes, making these proteins likely candidates. PMID:19152507

  16. Discovering the electronic circuit diagram of life: structural relationships among transition metal binding sites in oxidoreductases

    PubMed Central

    Kim, J. Dongun; Senn, Stefan; Harel, Arye; Jelen, Benjamin I.; Falkowski, Paul G.

    2013-01-01

    Oxidoreductases play a central role in catalysing enzymatic electron-transfer reactions across the tree of life. To first order, the equilibrium thermodynamic properties of these proteins are governed by protein folds associated with specific transition metals and ligands at the active site. A global analysis of holoenzyme structures and functions suggests that there are fewer than approximately 500 fundamental oxidoreductases, which can be further clustered into 35 unique groups. These catalysts evolved in prokaryotes early in the Earth's history and are largely responsible for the emergence of non-equilibrium biogeochemical cycles on the planet's surface. Although the evolutionary history of the amino acid sequences in the oxidoreductases is very difficult to reconstruct due to gene duplication and horizontal gene transfer, the evolution of the folds in the catalytic sites can potentially be used to infer the history of these enzymes. Using a novel, yet simple analysis of the secondary structures associated with the ligands in oxidoreductases, we developed a structural phylogeny of these enzymes. The results of this ‘composome’ analysis suggest an early split from a basal set of a small group of proteins dominated by loop structures into two families of oxidoreductases, one dominated by ?-helices and the second by ?-sheets. The structural evolutionary patterns in both clades trace redox gradients and increased hydrogen bond energy in the active sites. The overall pattern suggests that the evolution of the oxidoreductases led to decreased entropy in the transition metal folds over approximately 2.5 billion years, allowing the enzymes to use increasingly oxidized substrates with high specificity. PMID:23754810

  17. Discovering the electronic circuit diagram of life: structural relationships among transition metal binding sites in oxidoreductases.

    PubMed

    Kim, J Dongun; Senn, Stefan; Harel, Arye; Jelen, Benjamin I; Falkowski, Paul G

    2013-07-19

    Oxidoreductases play a central role in catalysing enzymatic electron-transfer reactions across the tree of life. To first order, the equilibrium thermodynamic properties of these proteins are governed by protein folds associated with specific transition metals and ligands at the active site. A global analysis of holoenzyme structures and functions suggests that there are fewer than approximately 500 fundamental oxidoreductases, which can be further clustered into 35 unique groups. These catalysts evolved in prokaryotes early in the Earth's history and are largely responsible for the emergence of non-equilibrium biogeochemical cycles on the planet's surface. Although the evolutionary history of the amino acid sequences in the oxidoreductases is very difficult to reconstruct due to gene duplication and horizontal gene transfer, the evolution of the folds in the catalytic sites can potentially be used to infer the history of these enzymes. Using a novel, yet simple analysis of the secondary structures associated with the ligands in oxidoreductases, we developed a structural phylogeny of these enzymes. The results of this 'composome' analysis suggest an early split from a basal set of a small group of proteins dominated by loop structures into two families of oxidoreductases, one dominated by ?-helices and the second by ?-sheets. The structural evolutionary patterns in both clades trace redox gradients and increased hydrogen bond energy in the active sites. The overall pattern suggests that the evolution of the oxidoreductases led to decreased entropy in the transition metal folds over approximately 2.5 billion years, allowing the enzymes to use increasingly oxidized substrates with high specificity. PMID:23754810

  18. Thioredoxin-thioredoxin reductase system of Streptomyces clavuligerus: sequences, expression, and organization of the genes.

    PubMed Central

    Cohen, G; Yanko, M; Mislovati, M; Argaman, A; Schreiber, R; Av-Gay, Y; Aharonowitz, Y

    1993-01-01

    The genes that encode thioredoxin and thioredoxin reductase of Streptomyces clavuligerus were cloned, and their DNA sequences were determined. Previously, we showed that S. clavuligerus possesses a disulfide reductase with broad substrate specificity that biochemically resembles the thioredoxin oxidoreductase system and may play a role in the biosynthesis of beta-lactam antibiotics. It consists consists of two components, a 70-kDa NADPH-dependent flavoprotein disulfide reductase with two identical subunits and a 12-kDa heat-stable protein general disulfide reductant. In this study, we found, by comparative analysis of their predicted amino acid sequences, that the 35-kDa protein is in fact thioredoxin reductase; it shares 48.7% amino acid sequence identity with Escherichia coli thioredoxin reductase, the 12-kDa protein is thioredoxin, and it shares 28 to 56% amino acid sequence identity with other thioredoxins. The streptomycete thioredoxin reductase has the identical cysteine redox-active region--Cys-Ala-Thr-Cys--and essentially the same flavin adenine dinucleotide- and NADPH dinucleotide-binding sites as E. coli thioredoxin reductase and is partially able to accept E. coli thioredoxin as a substrate. The streptomycete thioredoxin has the same cysteine redox-active segment--Trp-Cys-Gly-Pro-Cys--that is present in virtually all eucaryotic and procaryotic thioredoxins. However, in vivo it is unable to donate electrons to E. coli methionine sulfoxide reductase and does not serve as a substrate in vitro for E. coli thioredoxin reductase. The S. clavuligerus thioredoxin (trxA) and thioredoxin reductase (trxB) genes are organized in a cluster. They are transcribed in the same direction and separated by 33 nucleotides. In contrast, the trxA and trxB genes of E. coli, the only other organism in which both genes have been characterized, are physically widely separated. Images PMID:8349555

  19. Replacing Escherichia coli NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) with a NADP-dependent enzyme from Clostridium acetobutylicum facilitates NADPH dependent pathways.

    PubMed

    Martínez, Irene; Zhu, Jiangfeng; Lin, Henry; Bennett, George N; San, Ka-Yiu

    2008-11-01

    Reactions requiring reducing equivalents, NAD(P)H, are of enormous importance for the synthesis of industrially valuable compounds such as carotenoids, polymers, antibiotics and chiral alcohols among others. The use of whole-cell biocatalysis can reduce process cost by acting as catalyst and cofactor regenerator at the same time; however, product yields might be limited by cofactor availability within the cell. Thus, our study focussed on the genetic manipulation of a whole-cell system by modifying metabolic pathways and enzymes to improve the overall production process. In the present work, we genetically engineered an Escherichia coli strain to increase NADPH availability to improve the productivity of products that require NADPH in its biosynthesis. The approach involved an alteration of the glycolysis step where glyceraldehyde-3-phosphate (GAP) is oxidized to 1,3 bisphophoglycerate (1,3-BPG). This reaction is catalyzed by NAD-dependent endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) encoded by the gapA gene. We constructed a recombinant E. coli strain by replacing the native NAD-dependent gapA gene with a NADP-dependent GAPDH from Clostridium acetobutylicum, encoded by the gene gapC. The beauty of this approach is that the recombinant E. coli strain produces 2 mol of NADPH, instead of NADH, per mole of glucose consumed. Metabolic flux analysis showed that the flux through the pentose phosphate (PP) pathway, one of the main pathways that produce NADPH, was reduced significantly in the recombinant strain when compared to that of the parent strain. The effectiveness of the NADPH enhancing system was tested using the production of lycopene and epsilon-caprolactone as model systems using two different background strains. The recombinant strains, with increased NADPH availability, consistently showed significant higher productivity than the parent strains. PMID:18852061

  20. FabG, an NADPH-Dependent 3-Ketoacyl Reductase of Pseudomonas aeruginosa, Provides Precursors for Medium-Chain-Length Poly-3-Hydroxyalkanoate Biosynthesis in Escherichia coli

    PubMed Central

    Ren, Qun; Sierro, Nicolas; Witholt, Bernard; Kessler, Birgit

    2000-01-01

    Escherichia coli hosts expressing fabG of Pseudomonas aeruginosa showed 3-ketoacyl coenzyme A (CoA) reductase activity toward R-3-hydroxyoctanoyl-CoA. Furthermore, E. coli recombinants carrying the poly-3-hydroxyalkanoate (PHA) polymerase-encoding gene phaC in addition to fabG accumulated medium-chain-length PHAs (mcl-PHAs) from alkanoates. When E. coli fadB or fadA mutants, which are deficient in steps downstream or upstream of the 3-ketoacyl-CoA formation step during ?-oxidation, respectively, were transformed with fabG, higher levels of PHA were synthesized in E. coli fadA, whereas similar levels of PHA were found in E. coli fadB, compared with those of the corresponding mutants carrying phaC alone. These results strongly suggest that FabG of P. aeruginosa is able to reduce mcl-3-ketoacyl-CoAs generated by the ?-oxidation to 3-hydroxyacyl-CoAs to provide precursors for the PHA polymerase. PMID:10781572

  1. Epimerization at C-3'' in butirosin biosynthesis by an NAD(+) -dependent dehydrogenase BtrE and an NADPH-dependent reductase BtrF.

    PubMed

    Takeishi, Ryohei; Kudo, Fumitaka; Numakura, Mario; Eguchi, Tadashi

    2015-02-01

    Butirosin is an aminoglycoside antibiotic consisting two epimers at C-3'' of ribostamycin/xylostasin with a unique 4-amino-2-hydroxybutyrate moiety at C-1 of the aminocyclitol 2-deoxystreptamine (2DOS). To date, most of the enzymes encoded in the biosynthetic gene cluster for butirosin, from the producing strain Bacillus circulans, have been characterized. A few unknown functional proteins, including nicotinamide adenine dinucleotide cofactor-dependent dehydrogenase/reductase (BtrE and BtrF), are supposed to be involved in the epimerization at C-3'' of butirosin B/ribostamycin but remain to be characterized. Herein, the conversion of ribostamycin to xylsostasin by BtrE and BtrF in the presence of NAD(+) and NADPH was demonstrated. BtrE oxidized the C-3'' of ribostamycin with NAD(+) to yield 3''-oxoribostamycin. BtrF then reduced the generated 3''-oxoribostamycin with NADPH to produce xylostasin. This reaction step was the last piece of butirosin biosynthesis to be described. PMID:25600434

  2. Esculetin-induced protection of human hepatoma HepG2 cells against hydrogen peroxide is associated with the Nrf2-dependent induction of the NAD(P)H: Quinone oxidoreductase 1 gene

    SciTech Connect

    Subramaniam, Sudhakar R.; Ellis, Elizabeth M.

    2011-01-15

    Esculetin (6,7-dihydroxy coumarin), is a potent antioxidant that is present in several plant species. The aim of this study was to investigate the mechanism of protection of esculetin in human hepatoma HepG2 cells against reactive oxygen species (ROS) induced by hydrogen peroxide. Cell viability, cell integrity, intracellular glutathione levels, generation of reactive oxygen species and expression of antioxidant enzymes were used as markers to measure cellular oxidative stress and response to ROS. The protective effect of esculetin was compared to a well-characterized chemoprotective compound quercetin. Pre-treatment of HepG2 cells with sub-lethal (10-25 {mu}M) esculetin for 8 h prevented cell death and maintained cell integrity following exposure to 0.9 mM hydrogen peroxide. An increase in the generation of ROS following hydrogen peroxide treatment was significantly attenuated by 8 h pre-treatment with esculetin. In addition, esculetin ameliorated the decrease in intracellular glutathione caused by hydrogen peroxide exposure. Moreover, treatment with 25 {mu}M esculetin for 8 h increased the expression of NAD(P)H: quinone oxidoreductase (NQO1) at both protein and mRNA levels significantly, by 12-fold and 15-fold, respectively. Esculetin treatment also increased nuclear accumulation of Nrf2 by 8-fold indicating that increased NQO1 expression is Nrf2-mediated. These results indicate that esculetin protects human hepatoma HepG2 cells from hydrogen peroxide induced oxidative injury and that this protection is provided through the induction of protective enzymes as part of an adaptive response mediated by Nrf2 nuclear accumulation.

  3. Thiol-disulfide oxidoreductases are essential for the production of the lantibiotic sublancin 168.

    PubMed

    Dorenbos, Ronald; Stein, Torsten; Kabel, Jorrit; Bruand, Claude; Bolhuis, Albert; Bron, Sierd; Quax, Wim J; Van Dijl, Jan Maarten

    2002-05-10

    Thiol-disulfide oxidoreductases are required for disulfide bond formation in proteins that are exported from the cytoplasm. Four enzymes of this type, termed BdbA, BdbB, BdbC, and BdbD, have been identified in the Gram-positive eubacterium Bacillus subtilis. BdbC and BdbD have been shown to be critical for the folding of a protein required for DNA uptake during natural competence. In contrast, no function has been assigned so far to the BdbA and BdbB proteins. The bdbA and bdbB genes are located in one operon that also contains the genes specifying the lantibiotic sublancin 168 and the ATP-binding cassette transporter SunT. Interestingly sublancin 168 contains two disulfide bonds. The present studies demonstrate that SunT and BdbB, but not BdbA, are required for the production of active sublancin 168. In addition, the BdbB paralogue BdbC is at least partly able to replace BdbB in sublancin 168 production. These observations show the unprecedented involvement of thiol-disulfide oxidoreductases in the synthesis of a peptide antibiotic. Notably BdbB cannot complement BdbC in competence development, showing that these two closely related thiol-disulfide oxidoreductases have different, but partly overlapping, substrate specificities. PMID:11872755

  4. A plant porphyria related to defects in plastid import of protochlorophyllide oxidoreductase A

    PubMed Central

    Pollmann, Stephan; Springer, Armin; Buhr, Frank; Lahroussi, Abder; Samol, Iga; Bonneville, Jean-Marc; Tichtinsky, Gabrielle; von Wettstein, Diter; Reinbothe, Christiane; Reinbothe, Steffen

    2007-01-01

    The plastid envelope of higher plant chloroplasts is a focal point of plant metabolism. It is involved in numerous pathways, including tetrapyrrole biosynthesis and protein translocation. Chloroplasts need to import a large number of proteins from the cytosol because most are encoded in the nucleus. Here we report that a loss-of-function mutation in the outer plastid envelope 16-kDa protein (oep16) gene causes a conditional seedling lethal phenotype related to defects in import and assembly of NADPH:protochlorophyllide (Pchlide) oxidoreductase A. In the isolated knockout mutant of Arabidopsis thaliana, excess Pchlide accumulated in the dark operated as photosensitizer and provoked cell death during greening. Our results highlight the essential role of the substrate-dependent plastid import pathway of precursor Pchlide oxidoreductase A for seedling survival and the avoidance of developmentally programmed porphyria in higher plants. PMID:17261815

  5. Endoplasmic Reticulum Chaperones and Oxidoreductases: Critical Regulators of Tumor Cell Survival and Immunorecognition

    PubMed Central

    Gutiérrez, Tomás; Simmen, Thomas

    2014-01-01

    Endoplasmic reticulum (ER) chaperones and oxidoreductases are abundant enzymes that mediate the production of fully folded secretory and transmembrane proteins. Resisting the Golgi and plasma membrane-directed “bulk flow,” ER chaperones and oxidoreductases enter retrograde trafficking whenever they are pulled outside of the ER by their substrates. Solid tumors are characterized by the increased production of reactive oxygen species (ROS), combined with reduced blood flow that leads to low oxygen supply and ER stress. Under these conditions, hypoxia and the unfolded protein response upregulate their target genes. When this occurs, ER oxidoreductases and chaperones become important regulators of tumor growth. However, under these conditions, these proteins not only promote the folding of proteins, but also alter the properties of the plasma membrane and hence modulate tumor immune recognition. For instance, high levels of calreticulin serve as an “eat-me” signal on the surface of tumor cells. Conversely, both intracellular and surface BiP/GRP78 promotes tumor growth. Other ER folding assistants able to modulate the properties of tumor tissue include protein disulfide isomerase (PDI), Ero1? and GRP94. Understanding the roles and mechanisms of ER chaperones in regulating tumor cell functions and immunorecognition will lead to important insight for the development of novel cancer therapies. PMID:25386408

  6. Light-Dependent Protochlorophyllide Oxidoreductase: Phylogeny, Regulation, and Catalytic Properties.

    PubMed

    Gabruk, Michal; Mysliwa-Kurdziel, Beata

    2015-09-01

    This Current Topic focuses on light-dependent protochlorophyllide oxidoreductase (POR, EC 1.3.1.33). POR catalyzes the penultimate reaction of chlorophyll biosynthesis, i.e., the light-triggered reduction of protochlorophyllide to chlorophyllide. In this reaction, the chlorin ring of the chlorophyll molecule is formed, which is crucial for photosynthesis. POR is one of very few enzymes that are driven by light; however, it is unique in the need for its substrate to absorb photons to induce the conformational changes in the enzyme, which are required for its catalytic activation. Moreover, the enzyme is also involved in the negative feedback of the chlorophyll biosynthesis pathway and controls chlorophyll content via its light-dependent activity. Even though it has been almost 70 years since the first isolation of active POR complexes, our knowledge of them has markedly advanced in recent years. In this review, we summarize the current state of knowledge of POR, including the phylogenetic roots of POR, the mechanisms of the regulation of POR genes expression, the regulation of POR activity, the import of POR into plastids, the role of POR in PLB formation, and the molecular mechanism of protochlorophyllide reduction by POR. To the best of our knowledge, no previous review has compiled such a broad set of recent findings about POR. PMID:26230427

  7. Origin and Evolution of the Sodium -Pumping NADH: Ubiquinone Oxidoreductase

    PubMed Central

    Reyes-Prieto, Adrian; Barquera, Blanca; Juárez, Oscar

    2014-01-01

    The sodium -pumping NADH: ubiquinone oxidoreductase (Na+-NQR) is the main ion pump and the primary entry site for electrons into the respiratory chain of many different types of pathogenic bacteria. This enzymatic complex creates a transmembrane gradient of sodium that is used by the cell to sustain ionic homeostasis, nutrient transport, ATP synthesis, flagellum rotation and other essential processes. Comparative genomics data demonstrate that the nqr operon, which encodes all Na+-NQR subunits, is found in a large variety of bacterial lineages with different habitats and metabolic strategies. Here we studied the distribution, origin and evolution of this enzymatic complex. The molecular phylogenetic analyses and the organizations of the nqr operon indicate that Na+-NQR evolved within the Chlorobi/Bacteroidetes group, after the duplication and subsequent neofunctionalization of the operon that encodes the homolog RNF complex. Subsequently, the nqr operon dispersed through multiple horizontal transfer events to other bacterial lineages such as Chlamydiae, Planctomyces and ?, ?, ? and ? -proteobacteria. Considering the biochemical properties of the Na+-NQR complex and its physiological role in different bacteria, we propose a detailed scenario to explain the molecular mechanisms that gave rise to its novel redox- dependent sodium -pumping activity. Our model postulates that the evolution of the Na+-NQR complex involved a functional divergence from its RNF homolog, following the duplication of the rnf operon, the loss of the rnfB gene and the recruitment of the reductase subunit of an aromatic monooxygenase. PMID:24809444

  8. The roles of thiol oxidoreductases in yeast replicative aging.

    PubMed

    Hacioglu, Elise; Esmer, Isil; Fomenko, Dmitri E; Gladyshev, Vadim N; Koc, Ahmet

    2010-01-01

    Thiol-based redox reactions are involved in the regulation of a variety of biological functions, such as protection against oxidative stress, signal transduction and protein folding. Some proteins involved in redox regulation have been shown to modulate life span in organisms from yeast to mammals. To assess the role of thiol oxidoreductases in aging on a genome-wide scale, we analyzed the replicative life span of yeast cells lacking known and candidate thiol oxidoreductases. The data suggest the role of several pathways in controlling yeast replicative life span, including thioredoxin reduction, protein folding and degradation, peroxide reduction, PIP3 signaling, and ATP synthesis. PMID:20934449

  9. Regulation of yeast replicative life span by thiol oxidoreductases

    PubMed Central

    Hacioglu, Elise; Esmer, Isil; Fomenko, Dmitri E.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Thiol-based redox reactions are involved in the regulation of a variety of biological functions, such as protection against oxidative stress, signal transduction and protein folding. Some proteins involved in redox regulation have been shown to modulate life span in organisms from yeast to mammals. To assess the role of thiol oxidoreductases in aging on a genome-wide scale, we analyzed the replicative life span of yeast cells lacking known and candidate thiol oxidoreductases. The data suggest the role of several pathways in regulation of yeast aging, including thioredoxin reduction, protein folding and degradation, peroxide reduction, PIP3 signaling, and ATP synthesis. PMID:20934449

  10. The Bifunctional Pyruvate Decarboxylase/Pyruvate Ferredoxin Oxidoreductase from Thermococcus guaymasensis

    PubMed Central

    2014-01-01

    The hyperthermophilic archaeon Thermococcus guaymasensis produces ethanol as a metabolic end product, and an alcohol dehydrogenase (ADH) catalyzing the reduction of acetaldehyde to ethanol has been purified and characterized. However, the enzyme catalyzing the formation of acetaldehyde has not been identified. In this study an enzyme catalyzing the production of acetaldehyde from pyruvate was purified and characterized from T. guaymasensis under strictly anaerobic conditions. The enzyme had both pyruvate decarboxylase (PDC) and pyruvate ferredoxin oxidoreductase (POR) activities. It was oxygen sensitive, and the optimal temperatures were 85°C and >95°C for the PDC and POR activities, respectively. The purified enzyme had activities of 3.8 ± 0.22?U?mg?1 and 20.2 ± 1.8?U?mg?1, with optimal pH-values of 9.5 and 8.4 for each activity, respectively. Coenzyme A was essential for both activities, although it did not serve as a substrate for the former. Enzyme kinetic parameters were determined separately for each activity. The purified enzyme was a heterotetramer. The sequences of the genes encoding the subunits of the bifunctional PDC/POR were determined. It is predicted that all hyperthermophilic ?-keto acids ferredoxin oxidoreductases are bifunctional, catalyzing the activities of nonoxidative and oxidative decarboxylation of the corresponding ?-keto acids. PMID:24982594

  11. A male twin infant with skull deformity and elevated neonatal 17-hydroxyprogesterone: a prismatic case of P450 oxidoreductase deficiency.

    PubMed

    Wudy, Stefan A; Hartmann, Michaela F; Draper, Nicole; Stewart, Paul M; Arlt, Wiebke

    2004-11-01

    We report on a male twin infant who presented with brachy-turri-cephaly, frontal bossing, large anterior fontanelle, low set and malformed ears, and mild arachnodactyly. He had normal male genitalia. There was no evidence for maternal virilization during pregnancy. The pattern of malformations resembled Antley-Bixler-Syndrome (ABS). However, sequencing analysis of the fibroblast growth factor receptor 2 gene (FGFR2) did not reveal mutations. The boy's twin sister did not show any somatic or endocrine abnormalities. In the boy, neonatal screening for congenital adrenal hyperplasia was positive with moderately elevated 17-hydroxyprogesterone. Sequence analysis of his CYP21 gene did not reveal any mutations. The short synacthen test revealed an exaggerated 17-hydroxyprogesterone and a blunted cortisol response. Urinary steroid profiling by gas chromatography-mass spectrometry (GC-MS) revealed a unique steroid metabolome suggestive of impaired activity of both 17-hydroxylase and 21-hydroxylase. Clinical and metabolic findings therefore were compatible with the recently described variant of congenital adrenal hyperplasia, P450 oxidoreductase deficiency (ORD). Subsequently, sequencing analysis of CPR, the gene encoding P450 oxidoreductase (OR), revealed a homozygous mutation in the patient, resulting in an amino acid exchange in position 284 of the OR protein (A284P). Both the female twin sister and the parents were heterozygous for the A284P mutation. P450 oxidoreductase deficiency represents a novel autosomal recessively inherited form of congenital adrenal hyperplasia. Its characteristic steroid metabolome can readily be detected by GC-MS analysis of spot urine. Clinical features may include an ABS phenotype, ambiguous genitalia (virilization in girls, feminization in boys), and glucocorticoid deficiency. If required, hydrocortisone replacement should be provided. PMID:15666853

  12. Molybdenum incorporation in tungsten aldehyde oxidoreductase enzymes from Pyrococcus furiosus.

    PubMed

    Sevcenco, Ana-Maria; Bevers, Loes E; Pinkse, Martijn W H; Krijger, Gerard C; Wolterbeek, Hubert T; Verhaert, Peter D E M; Hagen, Wilfred R; Hagedoorn, Peter-Leon

    2010-08-01

    The hyperthermophilic archaeon Pyrococcus furiosus expresses five aldehyde oxidoreductase (AOR) enzymes, all containing a tungsto-bispterin cofactor. The growth of this organism is fully dependent on the presence of tungsten in the growth medium. Previous studies have suggested that molybdenum is not incorporated in the active site of these enzymes. Application of the radioisotope (99)Mo in metal isotope native radioautography in gel electrophoresis (MIRAGE) technology to P. furiosus shows that molybdenum can in fact be incorporated in all five AOR enzymes. Mo(V) signals characteristic for molybdopterin were observed in formaldehyde oxidoreductase (FOR) in electron paramagnetic resonance (EPR)-monitored redox titrations. Our finding that the aldehyde oxidation activity of FOR and WOR5 (W-containing oxidoreductase 5) correlates only with the residual tungsten content suggests that the Mo-containing AORs are most likely inactive. An observed W/Mo antagonism is indicative of tungstate-dependent negative feedback of the expression of the tungstate/molybdate ABC transporter. An intracellular selection mechanism for tungstate and molybdate processing has to be present, since tungsten was found to be preferentially incorporated into the AORs even under conditions with comparable intracellular concentrations of tungstate and molybdate. Under the employed growth conditions of starch as the main carbon source in a rich medium, no tungsten- and/or molybdenum-associated proteins are detected in P. furiosus other than the high-affinity transporter, the proteins of the metallopterin insertion machinery, and the five W-AORs. PMID:20562313

  13. Acta Cryst. (1999). D55, 14651467 Frazao et al. Rubredoxin oxygen oxidoreductase 1465 crystallization papers

    E-print Network

    1999-01-01

    of Crystallography Printed in Denmark ± all rights reserved Crystals of rubredoxin oxygen oxidoreductase have beenActa Cryst. (1999). D55, 1465±1467 FrazaÄo et al. Rubredoxin oxygen oxidoreductase 1465 crystallization papers Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Crystallization

  14. CRYSTAL STRUCTURE ANALYSIS OF A PUTATIVE OXIDOREDUCTASE FROM KLEBSIELLA PNEUMONIAE

    SciTech Connect

    Baig, M.; Brown, A.; Eswaramoorthy, S.; Swaminathan, S.

    2009-01-01

    Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) at Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.

  15. Neuronal expression of a single-subunit yeast NADH-ubiquinone oxidoreductase (Ndi1) extends Drosophila lifespan.

    PubMed

    Bahadorani, Sepehr; Cho, Jaehyoung; Lo, Thomas; Contreras, Heidy; Lawal, Hakeem O; Krantz, David E; Bradley, Timothy J; Walker, David W

    2010-04-01

    The 'rate of living' theory predicts that longevity should be inversely correlated with the rate of mitochondrial respiration. However, recent studies in a number of model organisms, including mice, have reported that interventions that retard the aging process are, in fact, associated with an increase in mitochondrial activity. To better understand the relationship between energy metabolism and longevity, we supplemented the endogenous respiratory chain machinery of the fruit fly Drosophila melanogaster with the alternative single-subunit NADH-ubiquinone oxidoreductase (Ndi1) of the baker's yeast Saccharomyces cerevisiae. Here, we report that expression of Ndi1 in fly mitochondria leads to an increase in NADH-ubiquinone oxidoreductase activity, oxygen consumption, and ATP levels. In addition, exogenous Ndi1 expression results in increased CO2 production in living flies. Using an inducible gene-expression system, we expressed Ndi1 in different cells and tissues and examined the impact on longevity. In doing so, we discovered that targeted expression of Ndi1 in fly neurons significantly increases lifespan without compromising fertility or physical activity. These findings are consistent with the idea that enhanced respiratory chain activity in neuronal tissue can prolong fly lifespan. PMID:20089120

  16. A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria[C][W

    PubMed Central

    Bandaranayake, Pradeepa C.G.; Filappova, Tatiana; Tomilov, Alexey; Tomilova, Natalya B.; Jamison-McClung, Denneal; Ngo, Quy; Inoue, Kentaro; Yoder, John I.

    2010-01-01

    Parasitic plants in the Orobanchaceae develop haustoria in response to contact with host roots or chemical haustoria-inducing factors. Experiments in this manuscript test the hypothesis that quinolic-inducing factors activate haustorium development via a signal mechanism initiated by redox cycling between quinone and hydroquinone states. Two cDNAs were previously isolated from roots of the parasitic plant Triphysaria versicolor that encode distinct quinone oxidoreductases. QR1 encodes a single-electron reducing NADPH quinone oxidoreductase similar to ?-crystallin. The QR2 enzyme catalyzes two electron reductions typical of xenobiotic detoxification. QR1 and QR2 transcripts are upregulated in a primary response to chemical-inducing factors, but only QR1 was upregulated in response to host roots. RNA interference technology was used to reduce QR1 and QR2 transcripts in Triphysaria roots that were evaluated for their ability to form haustoria. There was a significant decrease in haustorium development in roots silenced for QR1 but not in roots silenced for QR2. The infrequent QR1 transgenic roots that did develop haustoria had levels of QR1 similar to those of nontransgenic roots. These experiments implicate QR1 as one of the earliest genes on the haustorium signal transduction pathway, encoding a quinone oxidoreductase necessary for the redox bioactivation of haustorial inducing factors. PMID:20424175

  17. Radical reactions of thiamin pyrophosphate in 2-oxoacid oxidoreductases.

    PubMed

    Reed, George H; Ragsdale, Stephen W; Mansoorabadi, Steven O

    2012-11-01

    Thiamin pyrophosphate (TPP) is essential in carbohydrate metabolism in all forms of life. TPP-dependent decarboxylation reactions of 2-oxo-acid substrates result in enamine adducts between the thiazolium moiety of the coenzyme and decarboxylated substrate. These central enamine intermediates experience different fates from protonation in pyruvate decarboxylase to oxidation by the 2-oxoacid dehydrogenase complexes, the pyruvate oxidases, and 2-oxoacid oxidoreductases. Virtually all of the TPP-dependent enzymes, including pyruvate decarboxylase, can be assayed by 1-electron redox reactions linked to ferricyanide. Oxidation of the enamines is thought to occur via a 2-electron process in the 2-oxoacid dehydrogenase complexes, wherein acyl group transfer is associated with reduction of the disulfide of the lipoamide moiety. However, discrete 1-electron steps occur in the oxidoreductases, where one or more [4Fe-4S] clusters mediate the electron transfer reactions to external electron acceptors. These radical intermediates can be detected in the absence of the acyl-group acceptor, coenzyme A (CoASH). The ?-electron system of the thiazolium ring stabilizes the radical. The extensively delocalized character of the radical is evidenced by quantitative analysis of nuclear hyperfine splitting tensors as detected by electron paramagnetic resonance (EPR) spectroscopy and by electronic structure calculations. The second electron transfer step is markedly accelerated by the presence of CoASH. While details of the second electron transfer step and its facilitation by CoASH remain elusive, expected redox properties of potential intermediates limit possible scenarios. This article is part of a Special Issue entitled: Radical SAM enzymes and Radical Enzymology. PMID:22178227

  18. Structure and function of Caulobacter crescentus aldose-aldose oxidoreductase.

    PubMed

    Taberman, Helena; Andberg, Martina; Koivula, Anu; Hakulinen, Nina; Penttilä, Merja; Rouvinen, Juha; Parkkinen, Tarja

    2015-12-15

    Aldose-aldose oxidoreductase (Cc AAOR) is a recently characterized enzyme from the bacterial strain Caulobacter crescentus CB15 belonging to the glucose-fructose oxidoreductase/inositol dehydrogenase/rhizopine catabolism protein (Gfo/Idh/MocA) family. Cc AAOR catalyses the oxidation and reduction of a panel of aldose monosaccharides using a tightly bound NADP(H) cofactor that is regenerated in the catalytic cycle. Furthermore, Cc AAOR can also oxidize 1,4-linked oligosaccharides. In the present study, we present novel crystal structures of the dimeric Cc AAOR in complex with the cofactor and glycerol, D-xylose, D-glucose, maltotriose and D-sorbitol determined to resolutions of 2.0, 1.8, 1.7, 1.9 and 1.8 Å (1 Å=0.1 nm), respectively. These complex structures allowed for a detailed analysis of the ligand-binding interactions. The structures showed that the C1 carbon of a substrate, which is either reduced or oxidized, is close to the reactive C4 carbon of the nicotinamide ring of NADP(H). In addition, the O1 hydroxy group of the substrate, which is either protonated or deprotonated, is unexpectedly close to both Lys(104) and Tyr(189), which may both act as a proton donor or acceptor. This led us to hypothesize that this intriguing feature could be beneficial for Cc AAOR to catalyse the reduction of a linear form of a monosaccharide substrate and the oxidation of a pyranose form of the same substrate in a reaction cycle, during which the bound cofactor is regenerated. PMID:26438878

  19. Purification and characterization of malate:quinone oxidoreductase from thermophilic Bacillus sp. PS3.

    PubMed

    Kabashima, Yoshiki; Sone, Nobuhito; Kusumoto, Tomoichirou; Sakamoto, Junshi

    2013-02-01

    Several bacteria possess membrane-bound dehydrogenases other than cytosolic dehydrogenases in their respiratory chains. In many cases, the membrane-bound malate:quinone oxidoreductases (MQOs) are essential for growth. However, these MQOs are absent in mammalian mitochondria, and therefore may be a potential drug target for pathogenic bacteria. To characterize the kinetic properties of MQOs, we purified MQO from Bacillus sp. PS3, which is a gram-positive and thermophilic bacterium, and cloned the gene encoding MQO based on the obtained partial N-terminus sequence. Purified MQOs showed a molecular mass of ~90 kDa, which was estimated using gel filtration, and it consists of two subunits with a molecular mass of ~50 kDa. Phylogenetic analysis showed a high similarity to the MQO of the Geobacillus group rather than the Bacillus group. Additionally, the purified enzyme was thermostable and it retained menaquinol reduction activity at high temperatures. Although it is difficult to conduct experiments using menaquinol because of its instability, we were able to measure the oxidase activity of cytochrome bd-type quinol oxidase by using menaquinol-1 by coupling this molecule with the menaquinol reduction reaction using purified MQOs. PMID:23143325

  20. REVEILLE1 promotes NADPH: protochlorophyllide oxidoreductase A expression and seedling greening in Arabidopsis.

    PubMed

    Xu, Gang; Guo, Haiyan; Zhang, Dong; Chen, Dongqin; Jiang, Zhimin; Lin, Rongcheng

    2015-12-01

    Chlorophyll biosynthesis plays a crucial role in the greening process and survival of etiolated seedlings and yet the mechanism underlying the regulation of this process is poorly understood. Upon light stimulation, NADPH: protochlorophyllide oxidoreductase (POR) catalyzes the reduction of protochlorophyllide (Pchlide) to chlorophyllide. Whereas this represents a key step in the chlorophyll biosynthetic pathway, the regulation of POR remains largely unknown. Three POR isoforms exist in Arabidopsis thaliana, i.e., PORA, PORB, and PORC. In this study, we identified a transcription factor, REVEILLE1 (RVE1), that binds directly to the PORA promoter through the EE-box cis-regulatory element. Analysis of PORA expression in RVE1 loss-of-function (rve1) and overexpression (RVE1-OX) Arabidopsis plants showed that RVE1 positively regulates the transcription of PORA. We found that Pchlide levels were reduced in RVE1-OX seedlings. Furthermore, rve1 etiolated seedlings had lower greening rates than the wild type when exposed to light, whereas RVE1-OX seedlings had higher greening rates. In addition, when etiolated seedlings were exposed to light, RVE1-OX plants had less reactive oxygen species (ROS) accumulation and cell death than the wild type, and had reduced levels of ROS-responsive gene expression. Taken together, our study reveals an important role for RVE1 in regulating chlorophyll biosynthesis and promoting seedling greening during early plant growth and development. PMID:25910753

  1. Ã?Â?NADPH: Protochlorophyllide Oxidoreductase-Structure, Catalytic Function, and Role in Prolamellar Body Formation and Morphogenesis

    SciTech Connect

    Michael P. Timko

    2013-02-01

    The biosynthesis of chlorophyll is a critical biochemical step in the development of photosynthetic vascular plants and green algae. From photosynthetic bacteria (cyanobacteria) to algae, non-vascular plants, gymnosperms and vascular plants, mechanisms have evolved for protochlorophyllide reduction a key step in chlorophyll synthesis. Protochlorophyllide reduction is carried out by both a light-dependent (POR) and light-independent (LIPOR) mechanisms. NADPH: protochlorophyllide oxidoreductase (EC 1.3.1.33, abbreviated POR) catalyzes the light-dependent reduction of protochlorophyllide (PChlide) to chlorophyllide (Chlide). In contrast, a light-independent protochlorophyllide reductase (LIPOR) involves three plastid gene products (chlL, chlN, and chlB) and several nuclear factors. Our work focused on characterization of both the POR and LIPOR catalyzed processes.

  2. Disarming Burkholderia pseudomallei: Structural and Functional Characterization of a Disulfide Oxidoreductase (DsbA) Required for Virulence In Vivo

    PubMed Central

    McMahon, Róisín M.; Marshall, Laura E.; Halili, Maria; Furlong, Emily; Tay, Stephanie; Sarkar-Tyson, Mitali

    2014-01-01

    Abstract Aims: The intracellular pathogen Burkholderia pseudomallei causes the disease melioidosis, a major source of morbidity and mortality in southeast Asia and northern Australia. The need to develop novel antimicrobials is compounded by the absence of a licensed vaccine and the bacterium's resistance to multiple antibiotics. In a number of clinically relevant Gram-negative pathogens, DsbA is the primary disulfide oxidoreductase responsible for catalyzing the formation of disulfide bonds in secreted and membrane-associated proteins. In this study, a putative B. pseudomallei dsbA gene was evaluated functionally and structurally and its contribution to infection assessed. Results: Biochemical studies confirmed the dsbA gene encodes a protein disulfide oxidoreductase. A dsbA deletion strain of B. pseudomallei was attenuated in both macrophages and a BALB/c mouse model of infection and displayed pleiotropic phenotypes that included defects in both secretion and motility. The 1.9 Å resolution crystal structure of BpsDsbA revealed differences from the classic member of this family Escherichia coli DsbA, in particular within the region surrounding the active site disulfide where EcDsbA engages with its partner protein E. coli DsbB, indicating that the interaction of BpsDsbA with its proposed partner BpsDsbB may be distinct from that of EcDsbA-EcDsbB. Innovation: This study has characterized BpsDsbA biochemically and structurally and determined that it is required for virulence of B. pseudomallei. Conclusion: These data establish a critical role for BpsDsbA in B. pseudomallei infection, which in combination with our structural characterization of BpsDsbA will facilitate the future development of rationally designed inhibitors against this drug-resistant organism. Antioxid. Redox Signal. 20, 606–617. PMID:23901809

  3. Chlorophyllide a Oxidoreductase Works as One of the Divinyl Reductases Specifically Involved in Bacteriochlorophyll a Biosynthesis*

    PubMed Central

    Harada, Jiro; Mizoguchi, Tadashi; Tsukatani, Yusuke; Yokono, Makio; Tanaka, Ayumi; Tamiaki, Hitoshi

    2014-01-01

    Bacteriochlorophyll a is widely distributed among anoxygenic photosynthetic bacteria. In bacteriochlorophyll a biosynthesis, the reduction of the C8 vinyl group in 8-vinyl-chlorophyllide a is catalyzed to produce chlorophyllide a by an 8-vinyl reductase called divinyl reductase (DVR), which has been classified into two types, BciA and BciB. However, previous studies demonstrated that mutants lacking the DVR still synthesize normal bacteriochlorophyll a with the C8 ethyl group and suggested the existence of an unknown “third” DVR. Meanwhile, we recently observed that chlorophyllide a oxidoreductase (COR) of a purple bacterium happened to show the 8-vinyl reduction of 8-vinyl-chlorophyllide a in vitro. In this study, we made a double mutant lacking BciA and COR of the purple bacterium Rhodobacter sphaeroides in order to investigate whether the mutant still produces pigments with the C8 ethyl group or if COR actually works as the third DVR. The single mutant deleting BciA or COR showed production of the C8 ethyl group pigments, whereas the double mutant accumulated 8-vinyl-chlorophyllide, indicating that there was no enzyme other than BciA and COR functioning as the unknown third DVR in Rhodobacter sphaeroides (note that this bacterium has no bciB gene). Moreover, some COR genes derived from other groups of anoxygenic photosynthetic bacteria were introduced into the double mutant, and all of the complementary strains produced normal bacteriochlorophyll a. This observation indicated that COR of these bacteria performs two functions, reductions of the C8 vinyl group and the C7=C8 double bond, and that such an activity is probably conserved in the widely ranging groups. PMID:24637023

  4. Chlorophyllide a oxidoreductase works as one of the divinyl reductases specifically involved in bacteriochlorophyll a biosynthesis.

    PubMed

    Harada, Jiro; Mizoguchi, Tadashi; Tsukatani, Yusuke; Yokono, Makio; Tanaka, Ayumi; Tamiaki, Hitoshi

    2014-05-01

    Bacteriochlorophyll a is widely distributed among anoxygenic photosynthetic bacteria. In bacteriochlorophyll a biosynthesis, the reduction of the C8 vinyl group in 8-vinyl-chlorophyllide a is catalyzed to produce chlorophyllide a by an 8-vinyl reductase called divinyl reductase (DVR), which has been classified into two types, BciA and BciB. However, previous studies demonstrated that mutants lacking the DVR still synthesize normal bacteriochlorophyll a with the C8 ethyl group and suggested the existence of an unknown "third" DVR. Meanwhile, we recently observed that chlorophyllide a oxidoreductase (COR) of a purple bacterium happened to show the 8-vinyl reduction of 8-vinyl-chlorophyllide a in vitro. In this study, we made a double mutant lacking BciA and COR of the purple bacterium Rhodobacter sphaeroides in order to investigate whether the mutant still produces pigments with the C8 ethyl group or if COR actually works as the third DVR. The single mutant deleting BciA or COR showed production of the C8 ethyl group pigments, whereas the double mutant accumulated 8-vinyl-chlorophyllide, indicating that there was no enzyme other than BciA and COR functioning as the unknown third DVR in Rhodobacter sphaeroides (note that this bacterium has no bciB gene). Moreover, some COR genes derived from other groups of anoxygenic photosynthetic bacteria were introduced into the double mutant, and all of the complementary strains produced normal bacteriochlorophyll a. This observation indicated that COR of these bacteria performs two functions, reductions of the C8 vinyl group and the C7=C8 double bond, and that such an activity is probably conserved in the widely ranging groups. PMID:24637023

  5. Bacterial Na+-translocating ferredoxin:NAD+ oxidoreductase

    PubMed Central

    Biegel, Eva; Müller, Volker

    2010-01-01

    The anaerobic acetogenic bacterium Acetobacterium woodii carries out a unique type of Na+-motive, anaerobic respiration with caffeate as electron acceptor, termed “caffeate respiration.” Central, and so far the only identified membrane-bound reaction in this respiration pathway, is a ferredoxin:NAD+ oxidoreductase (Fno) activity. Here we show that inverted membrane vesicles of A. woodii couple electron transfer from reduced ferredoxin to NAD+ with the transport of Na+ from the outside into the lumen of the vesicles. Na+ transport was electrogenic, and accumulation was inhibited by sodium ionophores but not protonophores, demonstrating a direct coupling of Fno activity to Na+ transport. Results from inhibitor studies are consistent with the hypothesis that Fno activity coupled to Na+ translocation is catalyzed by the Rnf complex, a membrane-bound, iron–sulfur and flavin-containing electron transport complex encoded by many bacterial and some archaeal genomes. Fno is a unique type of primary Na+ pump and represents an early evolutionary mechanism of energy conservation that expands the redox range known to support life. In addition, it explains the lifestyle of many anaerobic bacteria and gives a mechanistic explanation for the enigma of the energetic driving force for the endergonic reduction of ferredoxin with NADH plus H+ as reductant in a number of aerobic bacteria. PMID:20921383

  6. Elementary tetrahelical protein design for diverse oxidoreductase functions

    PubMed Central

    Lichtenstein, Bruce R; Sheehan, Molly M; Fry, Bryan A; Bialas, Chris; Ennist, Nathan M; Siedlecki, Jessica A; Zhao, Zhenyu; Stetz, Matthew A; Valentine, Kathleen G; Anderson, J L Ross; Wand, A Joshua; Discher, Bohdana M; Moser, Christopher C; Dutton, P Leslie

    2014-01-01

    Emulating functions of natural enzymes in man-made constructs has proven challenging. Here we describe a man-made protein platform that reproduces many of the diverse functions of natural oxidoreductases without importing the complex and obscure interactions common to natural proteins. Our design is founded on an elementary, structurally stable 4-?-helix protein monomer with a minimalist interior malleable enough to accommodate various light- and redox-active cofactors and with an exterior tolerating extensive charge patterning for modulation of redox cofactor potentials and environmental interactions. Despite its modest size, the construct offers several independent domains for functional engineering that targets diverse natural activities, including dioxygen binding and superoxide and peroxide generation, interprotein electron transfer to natural cytochrome c and light-activated intraprotein energy transfer and charge separation approximating the core reactions of photosynthesis, cryptochrome and photolyase. The highly stable, readily expressible and biocompatible characteristics of these open-ended designs promise development of practical in vitro and in vivo applications. PMID:24121554

  7. Goats' milk xanthine oxidoreductase is grossly deficient in molybdenum.

    PubMed

    Atmani, Djebbar; Benboubetra, Mustapha; Harrison, Roger

    2004-02-01

    Xanthine oxidoreductase (XOR) was purified from goats' milk. The u.v.-visible absorption spectrum was essentially identical to those of the corresponding bovine and human milk enzymes and showed an A280/A450 ratio of 5.20+/-0.12, indicating a high degree of purity. Like bovine and human milk XORs, enzyme purified from goats' milk showed a single band on SDS-PAGE corresponding to a subunit with approximate Mr 150,000. On Western blotting, mouse monoclonal anti-human XOR antibody cross-reacted with purified caprine and bovine XORs. The specific xanthine oxidase activity of goats' milk XOR, however, was very much lower than that of bovine XOR, although NADH oxidase activities of XOR from the two sources were similar. In these respects, the caprine milk XOR mirrors the human milk enzyme, in which case the kinetic effects have previously been attributed to relatively low molybdenum content. The molybdenum content of goats' milk XOR also was shown to be relatively low, with 0.09 atoms Mo per subunit, compared with 055 atoms Mo per subunit for the bovine enzyme. A parallel purification of human milk XOR showed 0.03 atoms Mo per subunit. The possible physiological significance of the low molybdenum content of the caprine milk enzyme and of its correspondingly low enzymic activity is discussed. PMID:15068060

  8. Xanthine Oxidoreductase Function Contributes to Normal Wound Healing

    PubMed Central

    Madigan, Michael C; McEnaney, Ryan M; Shukla, Ankur J; Hong, Guiying; Kelley, Eric E; Tarpey, Margaret M; Gladwin, Mark; Zuckerbraun, Brian S; Tzeng, Edith

    2015-01-01

    Chronic, nonhealing wounds result in patient morbidity and disability. Reactive oxygen species (ROS) and nitric oxide (NO) are both required for normal wound repair, and derangements of these result in impaired healing. Xanthine oxidoreductase (XOR) has the unique capacity to produce both ROS and NO. We hypothesize that XOR contributes to normal wound healing. Cutaneous wounds were created in C57Bl6 mice. XOR was inhibited with dietary tungsten or allopurinol. Topical hydrogen peroxide (H2O2, 0.15%) or allopurinol (30 ?g) was applied to wounds every other day. Wounds were monitored until closure or collected at d 5 to assess XOR expression and activity, cell proliferation and histology. The effects of XOR, nitrite, H2O2 and allopurinol on keratinocyte cell (KC) and endothelial cell (EC) behavior were assessed. We identified XOR expression and activity in the skin and wound edges as well as granulation tissue. Cultured human KCs also expressed XOR. Tungsten significantly inhibited XOR activity and impaired healing with reduced ROS production with reduced angiogenesis and KC proliferation. The expression and activity of other tungsten-sensitive enzymes were minimal in the wound tissues. Oral allopurinol did not reduce XOR activity or alter wound healing but topical allopurinol significantly reduced XOR activity and delayed healing. Topical H2O2 restored wound healing in tungsten-fed mice. In vitro, nitrite and H2O2 both stimulated KC and EC proliferation and EC migration. These studies demonstrate for the first time that XOR is abundant in wounds and participates in normal wound healing through effects on ROS production. PMID:25879627

  9. Protein Conformational Gating of Enzymatic Activity in Xanthine Oxidoreductase

    SciTech Connect

    Ishikita, Hiroshi; Eger, Bryan T.; Okamoto, Ken; Nishino, Takeshi; Pai, Emil F.

    2012-05-24

    In mammals, xanthine oxidoreductase can exist as xanthine dehydrogenase (XDH) and xanthine oxidase (XO). The two enzymes possess common redox active cofactors, which form an electron transfer (ET) pathway terminated by a flavin cofactor. In spite of identical protein primary structures, the redox potential difference between XDH and XO for the flavin semiquinone/hydroquinone pair (E{sub sq/hq}) is {approx}170 mV, a striking difference. The former greatly prefers NAD{sup +} as ultimate substrate for ET from the iron-sulfur cluster FeS-II via flavin while the latter only accepts dioxygen. In XDH (without NAD{sup +}), however, the redox potential of the electron donor FeS-II is 180 mV higher than that for the acceptor flavin, yielding an energetically uphill ET. On the basis of new 1.65, 2.3, 1.9, and 2.2 {angstrom} resolution crystal structures for XDH, XO, the NAD{sup +}- and NADH-complexed XDH, E{sub sq/hq} were calculated to better understand how the enzyme activates an ET from FeS-II to flavin. The majority of the E{sub sq/hq} difference between XDH and XO originates from a conformational change in the loop at positions 423-433 near the flavin binding site, causing the differences in stability of the semiquinone state. There was no large conformational change observed in response to NAD{sup +} binding at XDH. Instead, the positive charge of the NAD{sup +} ring, deprotonation of Asp429, and capping of the bulk surface of the flavin by the NAD{sup +} molecule all contribute to altering E{sub sq/hq} upon NAD{sup +} binding to XDH.

  10. Roles of the sodium-translocating NADH:quinone oxidoreductase (Na+-NQR) on vibrio cholerae metabolism, motility and osmotic stress resistance.

    PubMed

    Minato, Yusuke; Fassio, Sara R; Kirkwood, Jay S; Halang, Petra; Quinn, Matthew J; Faulkner, Wyatt J; Aagesen, Alisha M; Steuber, Julia; Stevens, Jan F; Häse, Claudia C

    2014-01-01

    The Na+ translocating NADH:quinone oxidoreductase (Na+-NQR) is a unique respiratory enzyme catalyzing the electron transfer from NADH to quinone coupled with the translocation of sodium ions across the membrane. Typically, Vibrio spp., including Vibrio cholerae, have this enzyme but lack the proton-pumping NADH:ubiquinone oxidoreductase (Complex I). Thus, Na+-NQR should significantly contribute to multiple aspects of V. cholerae physiology; however, no detailed characterization of this aspect has been reported so far. In this study, we broadly investigated the effects of loss of Na+-NQR on V. cholerae physiology by using Phenotype Microarray (Biolog), transcriptome and metabolomics analyses. We found that the V. cholerae ?nqrA-F mutant showed multiple defects in metabolism detected by Phenotype Microarray. Transcriptome analysis revealed that the V. cholerae ?nqrA-F mutant up-regulates 31 genes and down-regulates 55 genes in both early and mid-growth phases. The most up-regulated genes included the cadA and cadB genes, encoding a lysine decarboxylase and a lysine/cadaverine antiporter, respectively. Increased CadAB activity was further suggested by the metabolomics analysis. The down-regulated genes include sialic acid catabolism genes. Metabolomic analysis also suggested increased reductive pathway of TCA cycle and decreased purine metabolism in the V. cholerae ?nqrA-F mutant. Lack of Na+-NQR did not affect any of the Na+ pumping-related phenotypes of V. cholerae suggesting that other secondary Na+ pump(s) can compensate for Na+ pumping activity of Na+-NQR. Overall, our study provides important insights into the contribution of Na+-NQR to V. cholerae physiology. PMID:24811312

  11. Structural basis for human NADPH-cytochrome P450 oxidoreductase deficiency

    SciTech Connect

    Xia, Chuanwu; Panda, Satya P.; Marohnic, Christopher C.; Martásek, Pavel; Masters, Bettie Sue; Kim, Jung-Ja P.

    2012-03-15

    NADPH-cytochrome P450 oxidoreductase (CYPOR) is essential for electron donation to microsomal cytochrome P450-mediated monooxygenation in such diverse physiological processes as drug metabolism (approximately 85-90% of therapeutic drugs), steroid biosynthesis, and bioactive metabolite production (vitamin D and retinoic acid metabolites). Expressed by a single gene, CYPOR's role with these multiple redox partners renders it a model for understanding protein-protein interactions at the structural level. Polymorphisms in human CYPOR have been shown to lead to defects in bone development and steroidogenesis, resulting in sexual dimorphisms, the severity of which differs significantly depending on the degree of CYPOR impairment. The atomic structure of human CYPOR is presented, with structures of two naturally occurring missense mutations, V492E and R457H. The overall structures of these CYPOR variants are similar to wild type. However, in both variants, local disruption of H bonding and salt bridging, involving the FAD pyrophosphate moiety, leads to weaker FAD binding, unstable protein, and loss of catalytic activity, which can be rescued by cofactor addition. The modes of polypeptide unfolding in these two variants differ significantly, as revealed by limited trypsin digestion: V492E is less stable but unfolds locally and gradually, whereas R457H is more stable but unfolds globally. FAD addition to either variant prevents trypsin digestion, supporting the role of the cofactor in conferring stability to CYPOR structure. Thus, CYPOR dysfunction in patients harboring these particular mutations may possibly be prevented by riboflavin therapy in utero, if predicted prenatally, or rescued postnatally in less severe cases.

  12. Synechococcus sp. strain PCC 7002 nifJ mutant lacking pyruvate:ferredoxin oxidoreductase.

    PubMed

    McNeely, Kelsey; Xu, Yu; Ananyev, Gennady; Bennette, Nicholas; Bryant, Donald A; Dismukes, G Charles

    2011-04-01

    The nifJ gene codes for pyruvate:ferredoxin oxidoreductase (PFOR), which reduces ferredoxin during fermentative catabolism of pyruvate to acetyl-coenzyme A (acetyl-CoA). A nifJ knockout mutant was constructed that lacks one of two pathways for the oxidation of pyruvate in the cyanobacterium Synechococcus sp. strain PCC 7002. Remarkably, the photoautotrophic growth rate of this mutant increased by 20% relative to the wild-type (WT) rate under conditions of light-dark cycling. This result is attributed to an increase in the quantum yield of photosystem II (PSII) charge separation as measured by photosynthetic electron turnover efficiency determined using fast-repetition-rate fluorometry (F(v)/F(m)). During autofermentation, the excretion of acetate and lactate products by nifJ mutant cells decreased 2-fold and 1.2-fold, respectively. Although nifJ cells displayed higher in vitro hydrogenase activity than WT cells, H(2) production in vivo was 1.3-fold lower than the WT level. Inhibition of acetate-CoA ligase and pyruvate dehydrogenase complex by glycerol eliminated acetate production, with a resulting loss of reductant and a 3-fold decrease in H(2) production by nifJ cells compared to WT cells. Continuous electrochemical detection of dissolved H(2) revealed two temporally resolved phases of H(2) production during autofermentation, a minor first phase and a major second phase. The first phase was attributed to reduction of ferredoxin, because its level decreased 2-fold in nifJ cells. The second phase was attributed to glycolytic NADH production and decreased 20% in nifJ cells. Measurement of the intracellular NADH/NAD(+) ratio revealed that the reductant generated by PFOR contributing to the first phase of H(2) production was not in equilibrium with bulk NADH/NAD(+) and that the second phase corresponded to the equilibrium NADH-mediated process. PMID:21317262

  13. Preliminary crystallographic data of the three homologues of the thiol–disulfide oxidoreductase DsbA in Neisseria meningitidis

    SciTech Connect

    Lafaye, Céline; Griat, Mickael; Serre, Laurence

    2008-02-01

    The Neisseria meningitidis genome possesses three genes encoding active DsbAs. To throw light on the reason for this genetic multiplicity, the three enzymes have been purified and crystallized. Bacterial virulence depends on the correct folding of surface-exposed proteins, a process that is catalyzed by the thiol-disulfide oxidoreductase DsbA, which facilitates the synthesis of disulfide bonds in Gram-negative bacteria. Uniquely among bacteria, the Neisseria meningitidis genome possesses three genes encoding active DsbAs: DsbA1, DsbA2 and DsbA3. DsbA1 and DsbA2 have been characterized as lipoproteins involved in natural competence and in host-interactive biology, while the function of DsbA3 remains unknown. In an attempt to shed light on the reason for this multiplicity of dsbA genes, the three enzymes from N. meningitidis have been purified and crystallized in the presence of high concentrations of ammonium sulfate. The best crystals were obtained using DsbA1 and DsbA3; they belong to the orthorhombic and tetragonal systems and diffract to 1.5 and 2.7 Å resolution, respectively.

  14. Similarity of Escherichia coli propanediol oxidoreductase (fucO product) and an unusual alcohol dehydrogenase from Zymomonas mobilis and Saccharomyces cerevisiae

    SciTech Connect

    Conway, T. ); Ingram, L.O. )

    1989-07-01

    The gene that encodes 1,2-propanediol oxidoreductase (fucO) from Escherichia coli was sequenced. The reading frame specified a protein of 383 amino acids (including the N-terminal methionine), with an aggregate molecular weight of 40,642. The induction of fucO transcription, which occurred in the presence of fucose, was confirmed by Northern blot analysis. In E. coli, the primary fucO transcript was approximately 2.1 kilobases in length. The 5{prime} end of the transcript began more than 0.7 kilobase upstream of the fucO start codon within or beyond the fucA gene. Propanediol oxidoreductase exhibited 41.7% identity with the iron-containing alcohol dehydrogenase II from Zymomonas mobilis and 39.5% identity with ADH4 from Saccharomyces cerevisiae. These three proteins did not share homology with either short-chain or long-chain zinc-containing alcohol dehydrogenase enzymes. We propose that these three unusual alcohol dehydrogenases define a new family of enzymes.

  15. The Effects of Xanthine Oxidoreductase Inhibitors on Oxidative Stress Markers following Global Brain Ischemia Reperfusion Injury in C57BL/6 Mice

    PubMed Central

    Yamaguchi, Masahiro; Okamoto, Ken; Kusano, Teruo; Matsuda, Yoko; Suzuki, Go; Fuse, Akira; Yokota, Hiroyuki

    2015-01-01

    We demonstrated that 3-nitrotyrosine and 4-hydroxy-2-nonenal levels in mouse brain were elevated from 1 h until 8 h after global brain ischemia for 14 min induced with the 3-vessel occlusion model; this result indicates that ischemia reperfusion injury generated oxidative stress. Reactive oxygen species production was observed not only in the hippocampal region, but also in the cortical region. We further evaluated the neuroprotective effect of xanthine oxidoreductase inhibitors in the mouse 3-vessel occlusion model by analyzing changes in the expression of genes regulated by the transcription factor nuclear factor-kappa B (including pro-inflammatory cytokines interleukin-1? (IL-1?) and tumor necrosis factor-? (TNF-?), matrix metalloproteinase-9 and intercellular adhesion molecules-1). Administration of allopurinol resulted in a statistically significant decrease in IL-1? and TNF-? mRNA expression, whereas febuxostat had no significant effect on expression of these genes; nevertheless, both inhibitors effectively reduced serum uric acid concentration. It is suggested that the neuroprotective effect of allopurinol is derived not from inhibition of reactive oxygen species production by xanthine oxidoreductase, but rather from a direct free-radical-scavenging effect. PMID:26230326

  16. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

    PubMed Central

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-01-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  17. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Glyphosate Oxidoreductase GOX or... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.524 Glyphosate... Glyphosate Oxidoreductase GOX or GOXv247 enzyme in all plants are exempt from the requirement of a...

  18. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances...Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of...

  19. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances...Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of...

  20. Thiol-disulfide Oxidoreductases TRX1 and TMX3 Decrease Neuronal Atrophy in a Lentiviral Mouse Model of Huntington’s Disease

    PubMed Central

    Fox, Jonathan; Lu, Zhen; Barrows, Lorraine

    2015-01-01

    Huntington’s disease (HD) is caused by a trinucleotide CAG repeat in the huntingtin gene (HTT) that results in expression of a polyglutamine-expanded mutant huntingtin protein (mHTT). N-terminal fragments of mHTT accumulate in brain neurons and glia as soluble monomeric and oligomeric species as well as insoluble protein aggregates and drive the disease process. Decreasing mHTT levels in brain provides protection and reversal of disease signs in HD mice making mHTT a prime target for disease modification. There is evidence for aberrant thiol oxidation within mHTT and other proteins in HD models. Based on this, we hypothesized that a specific thiol-disulfide oxidoreductase exists that decreases mHTT levels in cells and provides protection in HD mice. We undertook an in-vitro genetic screen of key thiol-disulfide oxidoreductases then completed secondary screens to identify those with mHTT decreasing properties. Our in-vitro experiments identified thioredoxin 1 and thioredoxin-related transmembrane protein 3 as proteins that decrease soluble mHTT levels in cultured cells. Using a lentiviral mouse model of HD we tested the effect of these proteins in striatum. Both proteins decreased mHTT-induced striatal neuronal atrophy. Findings provide evidence for a role of dysregulated protein-thiol homeostasis in the pathogenesis of HD. PMID:26664998

  1. Toward high-throughput screening of NAD(P)-dependent oxidoreductases using boron-doped diamond microelectrodes and microfluidic devices.

    PubMed

    Oyobiki, Ryo; Kato, Taisuke; Katayama, Michinobu; Sugitani, Ai; Watanabe, Takeshi; Einaga, Yasuaki; Matsumoto, Yoshinori; Horisawa, Kenichi; Doi, Nobuhide

    2014-10-01

    Although oxidoreductases are widely used in many applications, such as biosensors and biofuel cells, improvements in the function of existing oxidoreductases or the discovery of novel oxidoreductases with greater activities is desired. To increase the activity of oxidoreductases by directed evolution, a powerful screening technique for oxidoreductases is required. In this study, we demonstrate the utility of boron-doped diamond (BDD) microelectrodes for quantitative and potentially high-throughput measurement of the activity of NAD(P)-dependent oxidoreductases. We first confirmed that BDD microelectrodes can quantify the activity of low concentrations (10-100 pM) of glucose-6-phosphate dehydrogenase and alcohol dehydrogenase with a measuring time of 1 ms per sample. In addition, we found that poisoning of BDD microelectrodes can be repressed by optimizing the pH and by adding l-arginine to the enzyme solution as an antiaggregation agent. Finally, we fabricated a microfluidic device containing a BDD electrode for the first time and observed the elevation of the oxidation current of NADH with increasing flow rate. These results imply that the combination of a BDD microelectrode and microfluidics can be used for high-throughput screening of an oxidoreductase library containing a large number (>10(6)) of samples, each with a small (nanoliter) sample volume. PMID:25211652

  2. IgG abzymes with peroxidase and oxidoreductase activities from the sera of healthy humans.

    PubMed

    Tolmacheva, Anna S; Blinova, Elena A; Ermakov, Evgeny A; Buneva, Valentina N; Vasilenko, Nataliya L; Nevinsky, Georgy A

    2015-09-01

    We present the evidence showing that small fractions of electrophoretically homogeneous immunoglobulin G (IgGs) from the sera of healthy humans and their Fab and F(ab)2 fragments oxidize 3,3'-diaminobenzidine through a peroxidase activity in the presence of H2 O2 and through an oxidoreductase activity in the absence of H2 O2 . During purification on protein G-Sepharose and gel filtration, the polyclonal IgGs partially lose the Me(2+) ions. After extensive dialysis of purified Abs against agents chelating metal ions, the relative peroxidase activity decreased dependently of IgG analyzed from 100 to ~10-85%, while oxidoreductase activity from 100 to 14-83%. Addition of external metal ions to dialyzed and non-dialyzed IgGs leads to a significant increase in their activity. Chromatography of the IgGs on Chelex non-charged with Cu(2+) ions results in the adsorption of a small IgG fraction bound with metal ions (~5%), while Chelex charged with Cu(2+) ions bind additionally ~38% of the total IgGs. Separation of Abs on both sorbents results in IgG separation to many different subfractions demonstrating various affinities to the chelating resin and different levels of the specific oxidoreductase and peroxidase activities. In the presence of external Cu(2+) ions, the specific peroxidase activity of several IgG subfractions achieves 20-27 % as compared with horseradish peroxidase (HRP, taken for 100%). The oxidoreductase activity of these fractions is ~4-6-fold higher than that for HRP. Antioxidant enzymes such as superoxide dismutases, catalases, and glutathione peroxidases are known to represent critical defence mechanisms for preventing oxidative modifications of DNA, proteins, and lipids. Peroxidase and oxidoreductase activities of human IgGs could also play an important role in the protection of organisms from oxidative stress and toxic compounds. PMID:25946706

  3. Role for Ferredoxin:NAD(P)H Oxidoreductase (FprA) in Sulfate Assimilation and Siderophore Biosynthesis in Pseudomonads

    PubMed Central

    Glassing, Angela; Harper, Justin; Franklin, Michael J.

    2013-01-01

    Pyridine-2,6-bis(thiocarboxylate) (PDTC), produced by certain pseudomonads, is a sulfur-containing siderophore that binds iron, as well as a wide range of transition metals, and it affects the net hydrolysis of the environmental contaminant carbon tetrachloride. The pathway of PDTC biosynthesis has not been defined. Here, we performed a transposon screen of Pseudomonas putida DSM 3601 to identify genes necessary for PDTC production (Pdt phenotype). Transposon insertions within genes for sulfate assimilation (cysD, cysNC, and cysG [cobA2]) dominated the collection of Pdt mutations. In addition, two insertions were within the gene for the LysR-type transcriptional activator FinR (PP1637). Phenotypic characterization indicated that finR mutants were cysteine bradytrophs. The Pdt phenotype of finR mutants could be complemented by the known target of FinR regulation, fprA (encoding ferredoxin:NADP+ oxidoreductase), or by Escherichia coli cysJI (encoding sulfite reductase). These data indicate that fprA is necessary for effective sulfate assimilation by P. putida and that the effect of finR mutation on PDTC production was due to deficient expression of fprA and sulfite reduction. fprA expression in both P. putida and P. aeruginosa was found to be regulated by FinR, but in a manner dependent upon reduced sulfur sources, implicating FinR in sulfur regulatory physiology. The genes and phenotypes identified in this study indicated a strong dependence upon intracellular reduced sulfur/cysteine for PDTC biosynthesis and that pseudomonads utilize sulfite reduction enzymology distinct from that of E. coli and possibly similar to that of chloroplasts and other proteobacteria. PMID:23794620

  4. NAD(P)H Cytochrome b5 Oxidoreductase Deficiency in Leishmania major Results in Impaired Linoleate Synthesis Followed by Increased Oxidative Stress and Cell Death*

    PubMed Central

    Mukherjee, Supratim; Sen Santara, Sumit; Das, Shantanabha; Bose, Moumita; Roy, Jayasree; Adak, Subrata

    2012-01-01

    NAD(P)H cytochrome b5 oxidoreductase (Ncb5or), comprising cytochrome b5 and cytochrome b5 reductase domains, is widely distributed in eukaryotic organisms. Although Ncb5or plays a crucial role in lipid metabolism of mice, so far no Ncb5or gene has been reported in the unicellular parasitic protozoa Leishmania species. We have cloned, expressed, and characterized Ncb5or gene from Leishmania major. Steady state catalysis and spectral studies show that NADH can quickly reduce the ferric state of the enzyme to the ferrous state and is able to donate an electron(s) to external acceptors. To elucidate its exact physiological role in Leishmania, we attempted to create NAD(P)H cytochrome b5 oxidoreductase from L. major (LmNcb5or) knock-out mutants by targeted gene replacement technique. A free fatty acid profile in knock-out (KO) cells reveals marked deficiency in linoleate and linolenate when compared with wild type (WT) or overexpressing cells. KO culture has a higher percentage of dead cells compared with both WT and overexpressing cells. Increased O2 uptake, uncoupling and ATP synthesis, and loss of mitochondrial membrane potential are evident in KO cells. Flow cytometric analysis reveals the presence of a higher concentration of intracellular H2O2, indicative of increased oxidative stress in parasites lacking LmNcb5or. Cell death is significantly reduced when the KO cells are pretreated with BSA bound linoleate. Real time PCR studies demonstrate a higher ?12 desaturase, superoxide dismutase, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA with a concomitant fall in ?9 desaturase mRNA expression in LmNcb5or null cell line. Together these findings suggest that decreased linoleate synthesis, and increased oxidative stress and apoptosis are the major consequences of LmNcb5or deficiency in Leishmania. PMID:22923617

  5. ArxA, a new clade of arsenite oxidase within the DMSO reductase family of molybdenum oxidoreductases

    USGS Publications Warehouse

    Zargar, Kamrun; Conrad, Alison; Bernick, David L.; Lowe, Todd M.; Stolc, Viktor; Hoeft, Shelley; Oremland, Ronald S.; Stolz, John; Saltikov, Chad W.

    2012-01-01

    Arsenotrophy, growth coupled to autotrophic arsenite oxidation or arsenate respiratory reduction, occurs only in the prokaryotic domain of life. The enzymes responsible for arsenotrophy belong to distinct clades within the DMSO reductase family of molybdenum-containing oxidoreductases: specifically arsenate respiratory reductase, ArrA, and arsenite oxidase, AioA (formerly referred to as AroA and AoxB). A new arsenite oxidase clade, ArxA, represented by the haloalkaliphilic bacterium Alkalilimnicola ehrlichii strain MLHE-1 was also identified in the photosynthetic purple sulfur bacterium Ectothiorhodospira sp. strain PHS-1. A draft genome sequence of PHS-1 was completed and an arx operon similar to MLHE-1 was identified. Gene expression studies showed that arxA was strongly induced with arsenite. Microbial ecology investigation led to the identification of additional arxA-like sequences in Mono Lake and Hot Creek sediments, both arsenic-rich environments in California. Phylogenetic analyses placed these sequences as distinct members of the ArxA clade of arsenite oxidases. ArxA-like sequences were also identified in metagenome sequences of several alkaline microbial mat environments of Yellowstone National Park hot springs. These results suggest that ArxA-type arsenite oxidases appear to be widely distributed in the environment presenting an opportunity for further investigations of the contribution of Arx-dependent arsenotrophy to the arsenic biogeochemical cycle.

  6. Rhodobacter sphaeroides mutants overexpressing chlorophyllide a oxidoreductase of Blastochloris viridis elucidate functions of enzymes in late bacteriochlorophyll biosynthetic pathways

    PubMed Central

    Tsukatani, Yusuke; Harada, Jiro; Nomata, Jiro; Yamamoto, Haruki; Fujita, Yuichi; Mizoguchi, Tadashi; Tamiaki, Hitoshi

    2015-01-01

    In previous studies we have demonstrated that chlorophyllide a oxidoreductases (CORs) from bacteriochlorophyll (BChl) a-producing Rhodobacter species and BChl b-producing Blastochloris viridis show distinct substrate recognition and different catalytic hydrogenation reactions, and that these two types of CORs therefore cause committed steps for BChls a and b biosynthesis. In this study, COR genes from B.?viridis were incorporated and overexpressed in a series of Rhodobacter sphaeroides mutants. We found that the following two factors are essential in making R. sphaeroides produce BChl b: the loss of functions of both intrinsic COR and 8-vinyl reductase (BciA) in the host R. sphaeroides strain; and expression of the BchYZ catalytic components of COR from B. viridis, not the complete set of COR (BchXYZ), in the host strain. In addition, we incorporated bchYZ of B. viridis into the R. sphaeroides mutant lacking BchJ and BciA, resulting in the strain accumulating both BChl a and BChl b. This is the first example of an anoxygenic photosynthetic bacterium producing BChls a and b together. The results suggest that BchJ enhances activity of the intrinsic COR. The physiological significance of BchJ in pigment biosynthetic pathways will be discussed. PMID:25978726

  7. Deficiency of electron transfer flavoprotein or electron transfer flavoprotein:ubiquinone oxidoreductase in glutaric acidemia type II fibroblasts.

    PubMed Central

    Frerman, F E; Goodman, S I

    1985-01-01

    Glutaric acidemia type II (GA II) is a human genetic disorder. It has been suggested that the primary defect in this disorder is a deficiency of a protein involved in electron transport between the acyl-CoA dehydrogenases and the bc1 complex of the mitochondrial respiratory chain. Antisera were raised to purified porcine electron transfer flavoprotein (ETF) and electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO). The antisera were used to detect the two electron transferases in control and GA II fibroblasts by immunoblotting. Fibroblasts from three unrelated GA II patients were deficient in immunologically detectable ETF:QO and extracts from these three fibroblast lines contained no detectable ETF:QO catalytic activity. Fibroblasts from parents of two of these patients had ETF:QO activity intermediate between activities in control fibroblasts and fibroblasts from the patients. These data indicate that the primary defect in these patients is a deficiency of ETF:QO and that the mode of transmission of the gene is autosomal recessive. Fibroblasts from two other patients with severe GA II had normal levels of ETF-QO activity and antigen but were deficient in immunoreactive ETF. These findings show that GA II results from a deficiency of ETF in some patients and ETF:QO in others. In addition, these investigations provide strong evidence for the specificity and physiological function of the iron-sulfur flavoprotein ETF:QO. Images PMID:2989828

  8. Quinone reduction by Rhodothermus marinus succinate:menaquinone oxidoreductase is not stimulated by the membrane potential

    SciTech Connect

    Fernandes, Andreia S.; Konstantinov, Alexander A.; Teixeira, Miguel; Pereira, Manuela M. . E-mail: mpereira@itqb.unl.pt

    2005-05-06

    Succinate:quinone oxidoreductase (SQR), a di-haem enzyme purified from Rhodothermus marinus, reveals an HQNO-sensitive succinate:quinone oxidoreductase activity with several menaquinone analogues as electron acceptors that decreases with lowering the redox midpoint potential of the quinones. A turnover with the low-potential 2,3-dimethyl-1,4-naphthoquinone that is the closest analogue of menaquinone, although low, can be detected in liposome-reconstituted SQR. Reduction of the quinone is not stimulated by an imposed K{sup +}-diffusion membrane potential of a physiological sign (positive inside the vesicles). Nor does the imposed membrane potential increase the reduction level of the haems in R. marinus SQR poised with the succinate/fumarate redox couple. The data do not support a widely discussed hypothesis on the electrogenic transmembrane electron transfer from succinate to menaquinone catalysed by di-haem SQRs. The role of the membrane potential in regulation of the SQR activity is discussed.

  9. Plant science. Morphinan biosynthesis in opium poppy requires a P450-oxidoreductase fusion protein.

    PubMed

    Winzer, Thilo; Kern, Marcelo; King, Andrew J; Larson, Tony R; Teodor, Roxana I; Donninger, Samantha L; Li, Yi; Dowle, Adam A; Cartwright, Jared; Bates, Rachel; Ashford, David; Thomas, Jerry; Walker, Carol; Bowser, Tim A; Graham, Ian A

    2015-07-17

    Morphinan alkaloids from the opium poppy are used for pain relief. The direction of metabolites to morphinan biosynthesis requires isomerization of (S)- to (R)-reticuline. Characterization of high-reticuline poppy mutants revealed a genetic locus, designated STORR [(S)- to (R)-reticuline] that encodes both cytochrome P450 and oxidoreductase modules, the latter belonging to the aldo-keto reductase family. Metabolite analysis of mutant alleles and heterologous expression demonstrate that the P450 module is responsible for the conversion of (S)-reticuline to 1,2-dehydroreticuline, whereas the oxidoreductase module converts 1,2-dehydroreticuline to (R)-reticuline rather than functioning as a P450 redox partner. Proteomic analysis confirmed that these two modules are contained on a single polypeptide in vivo. This modular assembly implies a selection pressure favoring substrate channeling. The fusion protein STORR may enable microbial-based morphinan production. PMID:26113639

  10. Towards a systematic analysis of human short-chain dehydrogenases/reductases (SDR): Ligand identification and structure-activity relationships.

    PubMed

    Bhatia, Chitra; Oerum, Stephanie; Bray, James; Kavanagh, Kathryn L; Shafqat, Naeem; Yue, Wyatt; Oppermann, Udo

    2015-06-01

    Short-chain dehydrogenases/reductases (SDRs) constitute a large, functionally diverse branch of enzymes within the class of NAD(P)(H) dependent oxidoreductases. In humans, over 80 genes have been identified with distinct metabolic roles in carbohydrate, amino acid, lipid, retinoid and steroid hormone metabolism, frequently associated with inherited genetic defects. Besides metabolic functions, a subset of atypical SDR proteins appears to play critical roles in adapting to redox status or RNA processing, and thereby controlling metabolic pathways. Here we present an update on the human SDR superfamily and a ligand identification strategy using differential scanning fluorimetry (DSF) with a focused library of oxidoreductase and metabolic ligands to identify substrate classes and inhibitor chemotypes. This method is applicable to investigate structure-activity relationships of oxidoreductases and ultimately to better understand their physiological roles. PMID:25526675

  11. Comparative Genomics of Thiol Oxidoreductases Reveals Widespread and Essential Functions of Thiol-based Redox Control of Cellular Processes

    PubMed Central

    2012-01-01

    Abstract Aims: Redox regulation of cellular processes is an important mechanism that operates in organisms from bacteria to mammals. Much of the redox control is provided by thiol oxidoreductases: proteins that employ cysteine residues for redox catalysis. We wanted to identify thiol oxidoreductases on a genome-wide scale and use this information to obtain insights into the general principles of thiol-based redox control. Results: Thiol oxidoreductases were identified by three independent methods that took advantage of the occurrence of selenocysteine homologs of these proteins and functional linkages among thiol oxidoreductases revealed by comparative genomics. Based on these searches, we describe thioredoxomes, which are sets of thiol oxidoreductases in organisms. Their analyses revealed that these proteins are present in all living organisms, generally account for 0.5%–1% of the proteome and that their use correlates with proteome size, distinguishing these proteins from those involved in core metabolic functions. We further describe thioredoxomes of Saccharomyces cerevisiae and humans, including proteins which have not been characterized previously. Thiol oxidoreductases occur in various cellular compartments and are enriched in the endoplasmic reticulum and cytosol. Innovation: We developed bioinformatics methods and used them to characterize thioredoxomes on a genome-wide scale, which in turn revealed properties of thioredoxomes. Conclusion: These data provide information about organization and properties of thiol-based redox control, whose use is increased with the increase in complexity of organisms. Our data also show an essential combined function of a set of thiol oxidoreductases, and of thiol-based redox regulation in general, in all living organisms. Antioxid. Redox Signal. 16, 193–201. PMID:21902454

  12. A Structure-Based Approach for Detection of Thiol Oxidoreductases and Their Catalytic Redox-Active Cysteine Residues

    PubMed Central

    Marino, Stefano M.; Gladyshev, Vadim N.

    2009-01-01

    Cysteine (Cys) residues often play critical roles in proteins, for example, in the formation of structural disulfide bonds, metal binding, targeting proteins to the membranes, and various catalytic functions. However, the structural determinants for various Cys functions are not clear. Thiol oxidoreductases, which are enzymes containing catalytic redox-active Cys residues, have been extensively studied, but even for these proteins there is little understanding of what distinguishes their catalytic redox Cys from other Cys functions. Herein, we characterized thiol oxidoreductases at a structural level and developed an algorithm that can recognize these enzymes by (i) analyzing amino acid and secondary structure composition of the active site and its similarity to known active sites containing redox Cys and (ii) calculating accessibility, active site location, and reactivity of Cys. For proteins with known or modeled structures, this method can identify proteins with catalytic Cys residues and distinguish thiol oxidoreductases from the enzymes containing other catalytic Cys types. Furthermore, by applying this procedure to Saccharomyces cerevisiae proteins containing conserved Cys, we could identify the majority of known yeast thiol oxidoreductases. This study provides insights into the structural properties of catalytic redox-active Cys and should further help to recognize thiol oxidoreductases in protein sequence and structure databases. PMID:19424433

  13. Cell growth defect factor 1 is crucial for the plastid import of NADPH:protochlorophyllide oxidoreductase A in Arabidopsis thaliana.

    PubMed

    Reinbothe, Steffen; Gray, John; Rustgi, Sachin; von Wettstein, Diter; Reinbothe, Christiane

    2015-05-01

    Tetrapyrroles such as chlorophyll, heme, and bacteriochlorophyll play fundamental roles in the energy absorption and transduction of all photosynthetic organisms. They are synthesized via a complex pathway taking place in chloroplasts. Chlorophyll biosynthesis in angiosperms involves 16 steps of which only one is light-requiring and driven by the NADPH:protochlorophyllide oxidoreductase (POR). Three POR isoforms have been identified in Arabidopsis thaliana--designated PORA, PORB, and PORC--that are differentially expressed in etiolated, light-exposed, and light-adapted plants. All three isoforms are encoded by nuclear genes, are synthesized as larger precursors in the cytosol (pPORs), and are imported posttranslationally into the plastid compartment. Import of the precursor to the dark-specific isoform PORA (pPORA) is protochlorophyllide (Pchlide)-dependent and due to the operation of a unique translocon complex dubbed PTC (Pchlide-dependent translocon complex) in the plastid envelope. Here, we identified a ?30-kDa protein that participates in pPORA import. The ?30-kDa protein is identical to the previously identified CELL GROWTH DEFECT FACTOR 1 (CDF1) in Arabidopsis that is conserved in higher plants and Synechocystis. CDF1 operates in pPORA import and stabilization and hereby acts as a chaperone for PORA protein translocation. CDF1 permits tight interactions between Pchlide synthesized in the plastid envelope and the importing PORA polypeptide chain such that no photoexcitative damage occurs through the generation of singlet oxygen operating as a cell death inducer. Together, our results identify an ancient mechanism dating back to the endosymbiotic origin of chloroplasts as a key element of Pchlide-dependent pPORA import. PMID:25901327

  14. Simultaneous Involvement of a Tungsten-Containing Aldehyde:Ferredoxin Oxidoreductase and a Phenylacetaldehyde Dehydrogenase in Anaerobic Phenylalanine Metabolism

    PubMed Central

    Debnar-Daumler, Carlotta; Seubert, Andreas; Schmitt, Georg

    2014-01-01

    Anaerobic phenylalanine metabolism in the denitrifying betaproteobacterium Aromatoleum aromaticum is initiated by conversion of phenylalanine to phenylacetate, which is further metabolized via benzoyl-coenzyme A (CoA). The formation of phenylacetate is catalyzed by phenylalanine transaminase, phenylpyruvate decarboxylase, and a phenylacetaldehyde-oxidizing enzyme. The presence of these enzymes was detected in extracts of cells grown with phenylalanine and nitrate. We found that two distinct enzymes are involved in the oxidation of phenylacetaldehyde to phenylacetate, an aldehyde:ferredoxin oxidoreductase (AOR) and a phenylacetaldehyde dehydrogenase (PDH). Based on sequence comparison, growth studies with various tungstate concentrations, and metal analysis of the enriched enzyme, AOR was shown to be a tungsten-containing enzyme, necessitating specific cofactor biosynthetic pathways for molybdenum- and tungsten-dependent enzymes simultaneously. We predict from the genome sequence that most enzymes of molybdopterin biosynthesis are shared, while the molybdate/tungstate uptake systems are duplicated and specialized paralogs of the sulfur-inserting MoaD and the metal-inserting MoeA proteins seem to be involved in dedicating biosynthesis toward molybdenum or tungsten cofactors. We also characterized PDH biochemically and identified both NAD+ and NADP+ as electron acceptors. We identified the gene coding for the enzyme and purified a recombinant Strep-tagged PDH variant. The homotetrameric enzyme is highly specific for phenylacetaldehyde, has cooperative kinetics toward the substrate, and shows considerable substrate inhibition. Our data suggest that A. aromaticum utilizes PDH as the primary enzyme during anaerobic phenylalanine degradation, whereas AOR is not essential for the metabolic pathway. We hypothesize a function as a detoxifying enzyme if high aldehyde concentrations accumulate in the cytoplasm, which would lead to substrate inhibition of PDH. PMID:24214948

  15. Simultaneous involvement of a tungsten-containing aldehyde:ferredoxin oxidoreductase and a phenylacetaldehyde dehydrogenase in anaerobic phenylalanine metabolism.

    PubMed

    Debnar-Daumler, Carlotta; Seubert, Andreas; Schmitt, Georg; Heider, Johann

    2014-01-01

    Anaerobic phenylalanine metabolism in the denitrifying betaproteobacterium Aromatoleum aromaticum is initiated by conversion of phenylalanine to phenylacetate, which is further metabolized via benzoyl-coenzyme A (CoA). The formation of phenylacetate is catalyzed by phenylalanine transaminase, phenylpyruvate decarboxylase, and a phenylacetaldehyde-oxidizing enzyme. The presence of these enzymes was detected in extracts of cells grown with phenylalanine and nitrate. We found that two distinct enzymes are involved in the oxidation of phenylacetaldehyde to phenylacetate, an aldehyde:ferredoxin oxidoreductase (AOR) and a phenylacetaldehyde dehydrogenase (PDH). Based on sequence comparison, growth studies with various tungstate concentrations, and metal analysis of the enriched enzyme, AOR was shown to be a tungsten-containing enzyme, necessitating specific cofactor biosynthetic pathways for molybdenum- and tungsten-dependent enzymes simultaneously. We predict from the genome sequence that most enzymes of molybdopterin biosynthesis are shared, while the molybdate/tungstate uptake systems are duplicated and specialized paralogs of the sulfur-inserting MoaD and the metal-inserting MoeA proteins seem to be involved in dedicating biosynthesis toward molybdenum or tungsten cofactors. We also characterized PDH biochemically and identified both NAD(+) and NADP(+) as electron acceptors. We identified the gene coding for the enzyme and purified a recombinant Strep-tagged PDH variant. The homotetrameric enzyme is highly specific for phenylacetaldehyde, has cooperative kinetics toward the substrate, and shows considerable substrate inhibition. Our data suggest that A. aromaticum utilizes PDH as the primary enzyme during anaerobic phenylalanine degradation, whereas AOR is not essential for the metabolic pathway. We hypothesize a function as a detoxifying enzyme if high aldehyde concentrations accumulate in the cytoplasm, which would lead to substrate inhibition of PDH. PMID:24214948

  16. Human sulfide:quinone oxidoreductase catalyzes the first step in hydrogen sulfide metabolism and produces a sulfane sulfur metabolite.

    PubMed

    Jackson, Michael R; Melideo, Scott L; Jorns, Marilyn Schuman

    2012-08-28

    Sulfide:quinone oxidoreductase (SQOR) is a membrane-bound enzyme that catalyzes the first step in the mitochondrial metabolism of H(2)S. Human SQOR is successfully expressed at low temperature in Escherichia coli by using an optimized synthetic gene and cold-adapted chaperonins. Recombinant SQOR contains noncovalently bound FAD and catalyzes the two-electron oxidation of H(2)S to S(0) (sulfane sulfur) using CoQ(1) as an electron acceptor. The prosthetic group is reduced upon anaerobic addition of H(2)S in a reaction that proceeds via a long-wavelength-absorbing intermediate (?(max) = 673 nm). Cyanide, sulfite, or sulfide can act as the sulfane sulfur acceptor in reactions that (i) exhibit pH optima at 8.5, 7.5, or 7.0, respectively, and (ii) produce thiocyanate, thiosulfate, or a putative sulfur analogue of hydrogen peroxide (H(2)S(2)), respectively. Importantly, thiosulfate is a known intermediate in the oxidation of H(2)S by intact animals and the major product formed in glutathione-depleted cells or mitochondria. Oxidation of H(2)S by SQOR with sulfite as the sulfane sulfur acceptor is rapid and highly efficient at physiological pH (k(cat)/K(m,H(2)S) = 2.9 × 10(7) M(-1) s(-1)). A similar efficiency is observed with cyanide, a clearly artificial acceptor, at pH 8.5, whereas a 100-fold lower value is seen with sulfide as the acceptor at pH 7.0. The latter reaction is unlikely to occur in healthy individuals but may become significant under certain pathological conditions. We propose that sulfite is the physiological acceptor of the sulfane sulfur and that the SQOR reaction is the predominant source of the thiosulfate produced during H(2)S oxidation by mammalian tissues. PMID:22852582

  17. The End of the Line: Can Ferredoxin and Ferredoxin NADP(H) Oxidoreductase Determine the Fate of Photosynthetic Electrons?

    PubMed Central

    Goss, Tatjana; Hanke, Guy

    2014-01-01

    At the end of the linear photosynthetic electron transfer (PET) chain, the small soluble protein ferredoxin (Fd) transfers electrons to Fd:NADP(H) oxidoreductase (FNR), which can then reduce NADP+ to support C assimilation. In addition to this linear electron flow (LEF), Fd is also thought to mediate electron flow back to the membrane complexes by different cyclic electron flow (CEF) pathways: either antimycin A sensitive, NAD(P)H complex dependent, or through FNR located at the cytochrome b6f complex. Both Fd and FNR are present in higher plant genomes as multiple gene copies, and it is now known that specific Fd iso-proteins can promote CEF. In addition, FNR iso-proteins vary in their ability to dynamically interact with thylakoid membrane complexes, and it has been suggested that this may also play a role in CEF. We will highlight work on the different Fd-isoproteins and FNR-membrane association found in the bundle sheath (BSC) and mesophyll (MC) cell chloroplasts of the C4 plant maize. These two cell types perform predominantly CEF and LEF, and the properties and activities of Fd and FNR in the BSC and MC are therefore specialized for CEF and LEF respectively. A diversity of Fd isoproteins and dynamic FNR location has also been recorded in C3 plants, algae and cyanobacteria. This indicates that the principles learned from the extreme electron transport situations in the BSC and MC of maize might be usefully applied to understanding the dynamic transition between these states in other systems. PMID:24678667

  18. Tenebrionid secretions and a fungal benzoquinone oxidoreductase form competing components of an arms race between a host and pathogen.

    PubMed

    Pedrini, Nicolás; Ortiz-Urquiza, Almudena; Huarte-Bonnet, Carla; Fan, Yanhua; Juárez, M Patricia; Keyhani, Nemat O

    2015-07-14

    Entomopathogenic fungi and their insect hosts represent a model system for examining invertebrate-pathogen coevolutionary selection processes. Here we report the characterization of competing components of an arms race consisting of insect protective antimicrobial compounds and evolving fungal mechanisms of detoxification. The insect pathogenic fungus Beauveria bassiana has a remarkably wide host range; however, some insects are resistant to fungal infection. Among resistant insects is the tenebrionid beetle Tribolium castaneum that produces benzoquinone-containing defensive secretions. Reduced fungal germination and growth was seen in media containing T. castaneum dichloromethane extracts or synthetic benzoquinone. In response to benzoquinone exposure, the fungus expresses a 1,4-benzoquinone oxidoreductase, BbbqrA, induced >40-fold. Gene knockout mutants (?BbbqrA) showed increased growth inhibition, whereas B. bassiana overexpressing BbbqrA (Bb::BbbqrA(O)) displayed increased resistance to benzoquinone compared with wild type. Increased benzoquinone reductase activity was detected in wild-type cells exposed to benzoquinone and in the overexpression strain. Heterologous expression and purification of BbBqrA in Escherichia coli confirmed NAD(P)H-dependent benzoquinone reductase activity. The ?BbbqrA strain showed decreased virulence toward T. castaneum, whereas overexpression of BbbqrA increased mortality versus T. castaneum. No change in virulence was seen for the ?BbbqrA or Bb::BbbqrA(O) strains when tested against the greater wax moth Galleria mellonella or the beetle Sitophilus oryzae, neither of which produce significant amounts of cuticular quinones. The observation that artificial overexpression of BbbqrA results in increased virulence only toward quinone-secreting insects implies the lack of strong selection or current failure of B. bassiana to counteradapt to this particular host defense throughout evolution. PMID:26056261

  19. Crystal structures of Pseudomonas syringae pv. tomato DC3000 quinone oxidoreductase and its complex with NADPH

    SciTech Connect

    Pan, Xiaowei; Graduate University of the Chinese Academy of Sciences, Beijing 100049 ; Zhang, Hongmei; Gao, Yu; Li, Mei; Chang, Wenrui

    2009-12-18

    Zeta-crystallin-like quinone oxidoreductase is NAD(P)H-dependent and catalyzes one-electron reduction of certain quinones to generate semiquinone. Here we present the crystal structures of zeta-crystallin-like quinone oxidoreductase from Pseudomonas syringae pv. tomato DC3000 (PtoQOR) and its complexes with NADPH determined at 2.4 and 2.01 A resolutions, respectively. PtoQOR forms as a homologous dimer, each monomer containing two domains. In the structure of the PtoQOR-NADPH complex, NADPH locates in the groove between the two domains. NADPH binding causes obvious conformational changes in the structure of PtoQOR. The putative substrate-binding site of PtoQOR is wider than that of Escherichia coli and Thermus thermophilus HB8. Activity assays show that PtoQOR has weak 1,4-benzoquinone catalytic activity, and very strong reduction activity towards large substrates such as 9,10-phenanthrenequinone. We propose a model to explain the conformational changes which take place during reduction reactions catalyzed by PtoQOR.

  20. The Saccharomyces cerevisiae quinone oxidoreductase Lot6p: stability, inhibition and cooperativity.

    PubMed

    Megarity, Clare F; Looi, Hong Keat; Timson, David J

    2014-08-01

    Lot6p (EC 1.5.1.39; Ylr011wp) is the sole quinone oxidoreductase in the budding yeast, Saccharomyces cerevisiae. Using hexahistidine tagged, recombinant Lot6p, we determined the steady-state enzyme kinetic parameters with both NADH and NADPH as electron donors; no cooperativity was observed with these substrates. The NQO1 inhibitor curcumin, the NQO2 inhibitor resveratrol, the bacterial nitroreductase inhibitor nicotinamide and the phosphate mimic vanadate all stabilise the enzyme towards thermal denaturation as judged by differential scanning fluorimetry. All except vanadate have no observable effect on the chemical cross-linking of the two subunits of the Lot6p dimer. These compounds all inhibit Lot6p's oxidoreductase activity, and all except nicotinamide exhibit negative cooperativity. Molecular modelling suggests that curcumin, resveratrol and nicotinamide all bind over the isoalloxazine ring of the FMN cofactor in Lot6p. Resveratrol was predicted to contact an ?-helix that links the two active sites. Mutation of Gly-142 (which forms part of this helix) to serine does not greatly affect the thermal stability of the enzyme. However, this variant shows less cooperativity towards resveratrol than the wild type. This suggests a plausible hypothesis for the transmission of information between the subunits and, thus, the molecular mechanism of negative cooperativity in Lot6p. PMID:24866129

  1. A novel aldose-aldose oxidoreductase for co-production of D-xylonate and xylitol from D-xylose with Saccharomyces cerevisiae.

    PubMed

    Wiebe, Marilyn G; Nygård, Yvonne; Oja, Merja; Andberg, Martina; Ruohonen, Laura; Koivula, Anu; Penttilä, Merja; Toivari, Mervi

    2015-11-01

    An open reading frame CC1225 from the Caulobacter crescentus CB15 genome sequence belongs to the Gfo/Idh/MocA protein family and has 47 % amino acid sequence identity with the glucose-fructose oxidoreductase from Zymomonas mobilis (Zm GFOR). We expressed the ORF CC1225 in the yeast Saccharomyces cerevisiae and used a yeast strain expressing the gene coding for Zm GFOR as a reference. Cell extracts of strains overexpressing CC1225 (renamed as Cc aaor) showed some Zm GFOR type of activity, producing D-gluconate and D-sorbitol when a mixture of D-glucose and D-fructose was used as substrate. However, the activity in Cc aaor expressing strain was >100-fold lower compared to strains expressing Zm gfor. Interestingly, C. crescentus AAOR was clearly more efficient than the Zm GFOR in converting in vitro a single sugar substrate D-xylose (10 mM) to xylitol without an added cofactor, whereas this type of activity was very low with Zm GFOR. Furthermore, when cultured in the presence of D-xylose, the S. cerevisiae strain expressing Cc aaor produced nearly equal concentrations of D-xylonate and xylitol (12.5 g D-xylonate l(-1) and 11.5 g D-xylitol l(-1) from 26 g D-xylose l(-1)), whereas the control strain and strain expressing Zm gfor produced only D-xylitol (5 g l(-1)). Deletion of the gene encoding the major aldose reductase, Gre3p, did not affect xylitol production in the strain expressing Cc aaor, but decreased xylitol production in the strain expressing Zm gfor. In addition, expression of Cc aaor together with the D-xylonolactone lactonase encoding the gene xylC from C. crescentus slightly increased the final concentration and initial volumetric production rate of both D-xylonate and D-xylitol. These results suggest that C. crescentus AAOR is a novel type of oxidoreductase able to convert the single aldose substrate D-xylose to both its oxidized and reduced product. PMID:26264136

  2. Adaptive Hepatic and Intestinal Alterations in Mice after Deletion of NADPH-Cytochrome P450 Oxidoreductase (Cpr) in Hepatocytes

    PubMed Central

    Cheng, Xingguo; Gu, Jun

    2014-01-01

    Cytochrome P450 enzymes (P450) play an important role in first-pass metabolism in both the intestine and liver. NADPH-cytochrome P450 oxidoreductase (Cpr) is an essential electron transfer protein required for microsomal P450 activity. Mice with conditional knockout of Cpr in hepatocytes develop normally and survive even with complete loss of liver microsomal P450 activity. Our current studies were performed to determine whether alternative drug-metabolizing pathways increase in an attempt to maintain whole-body homeostasis. In addition to the liver, Cpr is mainly expressed in tissues such as lung, kidney, and gastrointestinal tract. In livers of H-Cpr-null mice, there is a marked increase in mRNA expression of phase I enzymes (Aldh1a1, 1a7, 3a2; Ces1b2, 2a6, and 2a12), antioxidant enzymes (Ho-1, Nqo1, and epoxide hydrolase), phase II enzymes (Ugt1a9; Gsta1/2, m3, m4, m6, t1, and t3; and Sult1a1 and 1d1), and drug transporters (Oatp1a4, Oct3, Mate1, Mdr1a, and Mrp3 and 4). In addition, glucuronide-conjugated bilirubin concentrations are doubled in serum of H-Cpr-null mice. Both constitutive androstane receptor (CAR) and nuclear factor erythroid 2-related factor 2 (Nrf2) protein in nuclei are higher in the livers of H-Cpr-null mice, indicating that CAR and Nrf2 are activated. In the small intestine of H-Cpr-null mice, mRNA expression of Cyp3a11 and Mdr1a, two genes critical for intestinal first-pass metabolism, are markedly up-regulated. In addition, nutrient (Pept1) and cholesterol (Npc1l1) transporters are induced in the small intestine of H-Cpr-null mice. In conclusion, in H-Cpr-null mice, adaptive regulation of alternative detoxification genes in liver and small intestine appear to partially compensate for the loss of microsomal P450 function in liver. PMID:25147274

  3. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement...GOX or GOXv247 enzyme in all plants are exempt from the requirement of a tolerance when used as plant-incorporated protectant inert ingredients in all food commodities. [72 FR...

  4. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement...GOX or GOXv247 enzyme in all plants are exempt from the requirement of a tolerance when used as plant-incorporated protectant inert ingredients in all food commodities. [72 FR...

  5. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement...GOX or GOXv247 enzyme in all plants are exempt from the requirement of a tolerance when used as plant-incorporated protectant inert ingredients in all food commodities. [72 FR...

  6. Functional diversity of cysteine residues in proteins and unique features of catalytic redox-active cysteines in thiol oxidoreductases.

    PubMed

    Fomenko, Dmitri E; Marino, Stefano M; Gladyshev, Vadim N

    2008-09-30

    Thiol-dependent redox systems are involved in regulation of diverse biological processes, such as response to stress, signal transduction, and protein folding. The thiol-based redox control is provided by mechanistically similar, but structurally distinct families of enzymes known as thiol oxidoreductases. Many such enzymes have been characterized, but identities and functions of the entire sets of thiol oxidoreductases in organisms are not known. Extreme sequence and structural divergence makes identification of these proteins difficult. Thiol oxidoreductases contain a redox-active cysteine residue, or its functional analog selenocysteine, in their active sites. Here, we describe computational methods for in silico prediction of thiol oxidoreductases in nucleotide and protein sequence databases and identification of their redox-active cysteines. We discuss different functional categories of cysteine residues, describe methods for discrimination between catalytic and noncatalytic and between redox and non-redox cysteine residues and highlight unique properties of the redox-active cysteines based on evolutionary conservation, secondary and three-dimensional structures, and sporadic replacement of cysteines with catalytically superior selenocysteine residues. PMID:18648218

  7. Functional Diversity of Cysteine Residues in Proteins and Unique Features of Catalytic Redox-active Cysteines in Thiol Oxidoreductases

    PubMed Central

    Fomenko, Dmitri E.; Marino, Stefano M.; Gladyshev, Vadim N.

    2009-01-01

    Thiol-dependent redox systems are involved in regulation of diverse biological processes, such as response to stress, signal transduction, and protein folding. The thiol-based redox control is provided by mechanistically similar, but structurally distinct families of enzymes known as thiol oxidoreductases. Many such enzymes have been characterized, but identities and functions of the entire sets of thiol oxidoreductases in organisms are not known. Extreme sequence and structural divergence makes identification of these proteins difficult. Thiol oxidoreductases contain a redox-active cysteine residue, or its functional analog selenocysteine, in their active sites. Here, we describe computational methods for in silico prediction of thiol oxidoreductases in nucleotide and protein sequence databases and identification of their redox-active cysteines. We discuss different functional categories of cysteine residues, describe methods for discrimination between catalytic and noncatalytic and between redox and non-redox cysteine residues and highlight unique properties of the redox-active cysteines based on evolutionary conservation, secondary and three-dimensional structures, and sporadic replacement of cysteines with catalytically superior selenocysteine residues. PMID:18648218

  8. Identification and cloning of two immunogenic Clostridium perfringens proteins, elongation factor Tu and pyruvate:ferredoxin oxidoreductase of C. perfringens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clostridium-related poultry diseases such as necrotic enteritis (NE) and gangrenous dermatitis (GD) cause substantial economic losses on a global scale. Two antigenic Clostridium perfringens proteins, elongation factor Tu (EF-Tu) and pyruvate:ferredoxin oxidoreductase (PFO), were identified by react...

  9. Evaluation of Neuronal Protective Effects of Xanthine Oxidoreductase Inhibitors on Severe Whole-brain Ischemia in Mouse Model and Analysis of Xanthine Oxidoreductase Activity in the Mouse Brain

    PubMed Central

    SUZUKI, Go; OKAMOTO, Ken; KUSANO, Teruo; MATSUDA, Yoko; FUSE, Akira; YOKOTA, Hiroyuki

    2015-01-01

    Global cerebral ischemia and reperfusion (I/R) often result in high mortality. Free radicals play an important role in global cerebral I/R. Xanthine oxidoreductase (XOR) inhibitors, such as allopurinol, have been reported to protect tissues from damage caused by reactive oxygen species (ROS) by inhibiting its production through XOR inhibition. The recently introduced XOR inhibitor febuxostat, which is a more potent inhibitor than allopurinol, is expected to decrease free radical production more effectively. Here, we analyzed the effects of allopurinol and febuxostat in decreasing global severe cerebral I/R damage in mice. Mice were divided into three groups: a placebo group, an allopurinol group, and a febuxostat group. Pathological examinations, which were performed in each group in the CA1 and CA2 regions of the hippocampus 4 days after I/R surgery, revealed that there was a decrease in the number of neuronal cells in the 14-min occlusion model in both regions and that drugs that were administered to prevent this damage were not effective. The enzymatic activity was extremely low in the mouse brain, and XOR could not be detected in the nonischemic and ischemic mice brains with western blot analyses. Thus, one of the reasons for the decreased effectiveness of XOR inhibitors in controlling severe whole-brain ischemia in a mouse model was the low levels of expression of XOR in the mouse brain. PMID:25744353

  10. Enantiocomplementary Yarrowia lipolytica Oxidoreductases: Alcohol Dehydrogenase 2 and Short Chain Dehydrogenase/Reductase

    PubMed Central

    Napora-Wijata, Kamila; Strohmeier, Gernot A.; Sonavane, Manoj N.; Avi, Manuela; Robins, Karen; Winkler, Margit

    2013-01-01

    Enzymes of the non-conventional yeast Yarrowia lipolytica seem to be tailor-made for the conversion of lipophilic substrates. Herein, we cloned and overexpressed the Zn-dependent alcohol dehydrogenase ADH2 from Yarrowia lipolytica in Escherichia coli. The purified enzyme was characterized in vitro. The substrate scope for YlADH2 mediated oxidation and reduction was investigated spectrophotometrically and the enzyme showed a broader substrate range than its homolog from Saccharomyces cerevisiae. A preference for secondary compared to primary alcohols in oxidation direction was observed for YlADH2. 2-Octanone was investigated in reduction mode in detail. Remarkably, YlADH2 displays perfect (S)-selectivity and together with a highly (R)-selective short chain dehydrogenase/ reductase from Yarrowia lipolytica it is possible to access both enantiomers of 2-octanol in >99% ee with Yarrowia lipolytica oxidoreductases. PMID:24970175

  11. Xanthine oxidoreductase-catalyzed reactive species generation: A process in critical need of reevaluation?

    PubMed Central

    Cantu-Medellin, Nadiezhda; Kelley, Eric E.

    2013-01-01

    Nearly 30 years have passed since the discovery of xanthine oxidoreductase (XOR) as a critical source of reactive species in ischemia/reperfusion injury. Since then, numerous inflammatory disease processes have been associated with elevated XOR activity and allied reactive species formation solidifying the ideology that enhancement of XOR activity equates to negative clinical outcomes. However, recent evidence may shatter this paradigm by describing a nitrate/nitrite reductase capacity for XOR whereby XOR may be considered a crucial source of beneficial •NO under ischemic/hypoxic/acidic conditions; settings similar to those that limit the functional capacity of nitric oxide synthase. Herein, we review XOR-catalyzed reactive species generation and identify key microenvironmental factors whose interplay impacts the identity of the reactive species (oxidants vs. •NO) produced. In doing so, we redefine existing dogma and shed new light on an enzyme that has weathered the evolutionary process not as gadfly but a crucial component in the maintenance of homeostasis. PMID:24024171

  12. Genotype-Phenotype Analysis in Congenital Adrenal Hyperplasia due to P450 Oxidoreductase Deficiency

    PubMed Central

    Krone, Nils; Reisch, Nicole; Idkowiak, Jan; Dhir, Vivek; Ivison, Hannah E.; Hughes, Beverly A.; Rose, Ian T.; O'Neil, Donna M.; Vijzelaar, Raymon; Smith, Matthew J.; MacDonald, Fiona; Cole, Trevor R.; Adolphs, Nicolai; Barton, John S.; Blair, Edward M.; Braddock, Stephen R.; Collins, Felicity; Cragun, Deborah L.; Dattani, Mehul T.; Day, Ruth; Dougan, Shelley; Feist, Miriam; Gottschalk, Michael E.; Gregory, John W.; Haim, Michaela; Harrison, Rachel; Haskins Olney, Ann; Hauffa, Berthold P.; Hindmarsh, Peter C.; Hopkin, Robert J.; Jira, Petr E.; Kempers, Marlies; Kerstens, Michiel N.; Khalifa, Mohamed M.; Köhler, Birgit; Maiter, Dominique; Nielsen, Shelly; O'Riordan, Stephen M.; Roth, Christian L.; Shane, Kate P.; Silink, Martin; Stikkelbroeck, Nike M. M. L.; Sweeney, Elizabeth; Szarras-Czapnik, Maria; Waterson, John R.; Williamson, Lori; Hartmann, Michaela F.; Taylor, Norman F.; Wudy, Stefan A.; Malunowicz, Ewa M.; Shackleton, Cedric H. L.

    2012-01-01

    Context: P450 oxidoreductase deficiency (PORD) is a unique congenital adrenal hyperplasia variant that manifests with glucocorticoid deficiency, disordered sex development (DSD), and skeletal malformations. No comprehensive data on genotype-phenotype correlations in Caucasian patients are available. Objective: The objective of the study was to establish genotype-phenotype correlations in a large PORD cohort. Design: The design of the study was the clinical, biochemical, and genetic assessment including multiplex ligation-dependent probe amplification (MLPA) in 30 PORD patients from 11 countries. Results: We identified 23 P450 oxidoreductase (POR) mutations (14 novel) including an exonic deletion and a partial duplication detected by MLPA. Only 22% of unrelated patients carried homozygous POR mutations. p.A287P was the most common mutation (43% of unrelated alleles); no other hot spot was identified. Urinary steroid profiling showed characteristic PORD metabolomes with variable impairment of 17?-hydroxylase and 21-hydroxylase. Short cosyntropin testing revealed adrenal insufficiency in 89%. DSD was present in 15 of 18 46,XX and seven of 12 46,XY individuals. Homozygosity for p.A287P was invariably associated with 46,XX DSD but normal genitalia in 46,XY individuals. The majority of patients with mild to moderate skeletal malformations, assessed by a novel scoring system, were compound heterozygous for missense mutations, whereas nearly all patients with severe malformations carried a major loss-of-function defect on one of the affected alleles. Conclusions: We report clinical, biochemical, and genetic findings in a large PORD cohort and show that MLPA is a useful addition to POR mutation analysis. Homozygosity for the most frequent mutation in Caucasians, p.A287P, allows for prediction of genital phenotype and moderate malformations. Adrenal insufficiency is frequent, easily overlooked, but readily detected by cosyntropin testing. PMID:22162478

  13. Regulation of gap junction function and Connexin 43 expression by cytochrome P450 oxidoreductase (CYPOR)

    SciTech Connect

    Polusani, Srikanth R.; Kar, Rekha; Riquelme, Manuel A.; Masters, Bettie Sue; Panda, Satya P.

    2011-08-05

    Highlights: {yields} Humans with severe forms of cytochrome P450 oxidoreductase (CYPOR) mutations show bone defects as observed in Antley-Bixler Syndrome. {yields} First report showing knockdown of CYPOR in osteoblasts decreased Connexin 43 (Cx43) protein levels. Cx43 is known to play an important role in bone modeling. {yields} Knockdown of CYPOR decreased Gap Junctional Intercellular Communication and hemichannel activity. {yields} Knockdown of CYPOR decreased Cx43 in mouse primary calvarial osteoblasts. {yields} Decreased Cx43 expression was observed at the transcriptional level. -- Abstract: Cytochrome P450 oxidoreductase (CYPOR) is a microsomal electron-transferring enzyme containing both FAD and FMN as co-factors, which provides the reducing equivalents to various redox partners, such as cytochromes P450 (CYPs), heme oxygenase (HO), cytochrome b{sub 5} and squalene monooxygenase. Human patients with severe forms of CYPOR mutation show bone defects such as cranio- and humeroradial synostoses and long bone fractures, known as Antley-Bixler-like Syndrome (ABS). To elucidate the role of CYPOR in bone, we knocked-down CYPOR in multiple osteoblast cell lines using RNAi technology. In this study, knock-down of CYPOR decreased the expression of Connexin 43 (Cx43), known to play a critical role in bone formation, modeling, and remodeling. Knock-down of CYPOR also decreased Gap Junction Intercellular Communication (GJIC) and hemichannel activity. Promoter luciferase assays revealed that the decrease in expression of Cx43 in CYPOR knock-down cells was due to transcriptional repression. Primary osteoblasts isolated from bone specific Por knock-down mice calvariae confirmed the findings in the cell lines. Taken together, our study provides novel insights into the regulation of gap junction function by CYPOR and suggests that Cx43 may play an important role(s) in CYPOR-mediated bone defects seen in patients.

  14. (The interaction of ferredoxin:NADP sup + oxidoreductase and ferredoxin:thioredoxin reductase with substrates)

    SciTech Connect

    Not Available

    1992-01-01

    We seek to map the ferredoxin-binding sites on three soluble enzymes located in spinach chloroplasts which utilize ferredoxin as an electron donor:Ferredoxin:NADP{sup +}oxidoreductase (FNR); ferredoxin:thioredoxin reductase (FTR) and glutamate synthase. As the availability of amino acid sequences for the enzymes are important in such studies, that the amino acid sequence of glutamate synthase needs be determined, the amino acid sequences of FNR, FTR and ferredoxin are already known. Related to an aim elucidate the binding sites for ferredoxin to determine whether there is a common binding site on all of these ferredoxin-dependent chloroplast enzymes and, if so, to map it. Additionally thioredoxin binding by FTR needs be determine to resolve whether the same site on FTR is involved in binding both ferredoxin and thioredoxin. Considerable progress is reported on the prosthetic groups of glutamate synthase, in establishing the role of arginine and lysine residues in ferredoxin binding by, ferredoxin:nitrite oxidoreductase nitrite reductase, labelling carboxyl groups on ferredoxin with taurine and labelling lysine residues biotinylation, and low potential heme proteins have been isolated and characterized from a non-photosynthetic plant tissue. Although the monoclonal antibodies raised against FNR turned out not to be useful for mapping the FNR/ferredoxin or FNR/NADPinteraction domains, good progress has been made on mapping the FNR/ferredoxin interaction domains by an alternative technique. The techniques developed for differential chemical modification of these two proteins - taurine modification of aspartate and glutamate residues and biotin modification of lysine residues - should be useful for mapping the interaction domains of many proteins that associate through electrostatic interactions.

  15. Spin labeling of the Escherichia coli NADH ubiquinone oxidoreductase (complex I).

    PubMed

    Pohl, Thomas; Spatzal, Thomas; Aksoyoglu, Müge; Schleicher, Erik; Rostas, Arpad Mihai; Lay, Helga; Glessner, Udo; Boudon, Corinne; Hellwig, Petra; Weber, Stefan; Friedrich, Thorsten

    2010-12-01

    The proton-pumping NADH:ubiquinone oxidoreductase, the respiratory complex I, couples the transfer of electrons from NADH to ubiquinone with the translocation of protons across the membrane. Electron microscopy revealed the two-part structure of the complex with a peripheral arm involved in electron transfer and a membrane arm most likely involved in proton translocation. It was proposed that the quinone binding site is located at the joint of the two arms. Most likely, proton translocation in the membrane arm is enabled by the energy of the electron transfer reaction in the peripheral arm transmitted by conformational changes. For the detection of the conformational changes and the localization of the quinone binding site, we set up a combination of site-directed spin labeling and EPR spectroscopy. Cysteine residues were introduced to the surface of the Escherichia coli complex I. The spin label (1-oxyl-2,2,5,5-tetramethyl-?3-pyrroline-3-methyl)-methanethiosulfonate (MTSL) was exclusively bound to the engineered positions. Neither the mutation nor the labeling had an effect on the NADH:decyl-ubiquinone oxidoreductase activity. The characteristic signals of the spin label were detected by EPR spectroscopy, which did not change by reducing the preparation with NADH. A decyl-ubiquinone derivative with the spin label covalently attached to the alkyl chain was synthesized in order to localize the quinone binding site. The distance between a MTSL labeled complex I variant and the bound quinone was determined by continuous-wave (cw) EPR allowing an inference on the location of the quinone binding site. The distances between the labeled quinone and other complex I variants will be determined in future experiments to receive further geometry information by triangulation. PMID:20959113

  16. Extensive horizontal gene transfer, duplication, and loss of chlorophyll synthesis genes in the algae

    DOE PAGESBeta

    Hunsperger, Heather M.; Randhawa, Tejinder; Cattolico, Rose Ann

    2015-02-10

    Two non-homologous, isofunctional enzymes catalyze the penultimate step of chlorophyll a synthesis in oxygenic photosynthetic organisms such as cyanobacteria, eukaryotic algae and land plants: the light independent (LIPOR) and light-dependent (POR) protochlorophyllide oxidoreductases. Whereas the distribution of these enzymes in cyanobacteria and land plants is well understood, the presence, loss, duplication, and replacement of these genes have not been surveyed in the polyphyletic and remarkably diverse eukaryotic algal lineages.

  17. Genes encoding mercuric reductases from selected gram-negative aquatic bacteria have a low degree of homology with merA of transposon Tn501.

    PubMed Central

    Barkay, T; Gillman, M; Liebert, C

    1990-01-01

    An investigation of the Hg2+ resistance mechanism of four freshwater and four coastal marine bacteria that did not hybridize with a mer operonic probe was conducted (T. Barkay, C. Liebert, and M. Gillman, Appl. Environ. Microbiol. 55:1196-1202, 1989). Hybridization with a merA probe, the gene encoding the mercuric reductase polypeptide, at a stringency of hybridization permitting hybrid formation between evolutionarily distant merA genes (as exists between gram-positive and -negative bacteria), detected merA sequences in the genomes of all tested strains. Inducible Hg2+ volatilization was demonstrated for all eight organisms, and NADPH-dependent mercuric reductase activities were detected in crude cell extracts of six of the strains. Because these strains represented random selections of bacteria from three aquatic environments, it is concluded that merA encodes a common molecular mechanism for Hg2+ resistance and volatilization in aerobic heterotrophic aquatic communities. Images PMID:2166470

  18. Metabolic activities of metronidazole-sensitive and -resistant strains of Helicobacter pylori: repression of pyruvate oxidoreductase and expression of isocitrate lyase activity correlate with resistance.

    PubMed Central

    Hoffman, P S; Goodwin, A; Johnsen, J; Magee, K; Veldhuyzen van Zanten, S J

    1996-01-01

    In this study, we compared metronidazole (Mtz)-sensitive and -resistant strains of Helicobacter pylori for metabolic differences that might correlate with drug resistance. Included in this study was an isogenic Mtz(r) strain, HP1107, that was constructed by transforming genomic DNA from Mtz(r) strain HP439 into Mtz(s) strain HP500. Enzyme activities were also measured for Mtz(r) strains grown in the presence or absence of 18 micrograms of metronidazole per ml (ca. one-half of the MIC). These studies confirmed the presence of the Embden-Meyerhof-Parnas, Entner-Doudoroff, and pentose pathways. H. pylori strains expressed enzymatic activities indicative of a complete and active Krebs cycle. All strains expressed pyruvate oxidoreductase (POR) and alpha-ketoglutarate oxidoreductase (KOR) as measured with the redox-active dye benzyl viologen (30 to 96 nmol/min/mg of protein for POR and 30 nmol/min/mg of protein for KOR). When grown in the presence of Mtz at > or = 3.5 micrograms/ml, Mtz(r) strains expressed no detectable POR or KOR activity. The apparent repression of POR and KOR activities by Mtz affected bacterial growth as manifest by extended lag periods and growth yield reductions of > 30%. A dose-dependent relationship was demonstrated between the metronidazole concentration in the growth medium and the specific activity of POR measured in bacterial cell extracts. The observed repression was not due to inactivation of POR by Mtz. In addition to repression of POR and KOR activities, growth in the presence of Mtz also led to decreases in the activities of various Krebs cycle enzymes, including aconitase, isocitrate dehydrogenase and succinate dehydrogenase. All of the Mtz(r) strains examined expressed isocitrate lyase and malate synthase activities indicative of the glyoxylate bypass. No isocitrate lyase activity was detected in Mtz(s) strain HP500. Isocitrate lyase activity was expressed by HP500 following transformation to Mtz resistance (Mtz(r) strain HP1107) with DNA from an Mtz(r) strain. The results of this study suggest that Mtz resistance may be a recessive trait, possibly involving inactivation of a regulatory gene, that results in constitutive expression of isocitrate lyase. Repression of POR and KOR activities in response to low levels of Mtz may be a general response of H. pylori strains to Mtz, but only resistant strains manage to survive via activation of compensatory metabolic pathways. PMID:8759844

  19. Role of cysteine-58 and cysteine-95 residues in the thiol di-sulfide oxidoreductase activity of Macrophage Migration Inhibitory Factor-2 of Wuchereria bancrofti.

    PubMed

    Chauhan, Nikhil; Hoti, S L

    2016-01-01

    Macrophage Migration Inhibitory Factor (MIF) is the first human cytokine reported and was thought to have a central role in the regulation of inflammatory responses. Homologs of this molecule have been reported in bacteria, invertebrates and plants. Apart from cytokine activity, it also has two catalytic activities viz., tautomerase and di-sulfide oxidoreductase, which appear to be involved in immunological functions. The CXXC catalytic site is responsible for di-sulfide oxidoreductase activity of MIF. We have recently reported thiol-disulfide oxidoreductase activity of Macrophage Migration Inhibitory Factor-2 of Wuchereria bancrofti (Wba-MIF-2), although it lacks the CXXC motif. We hypothesized that three conserved cysteine residues might be involved in the formation of di-sulfide oxidoreductase catalytic site. Homology modeling of Wba-MIF-2 showed that among the three cysteine residues, Cys58 and Cys95 residues came in close proximity (3.23Å) in the tertiary structure with pKa value 9, indicating that these residues might play a role in the di-sulfide oxidoreductase catalytic activity. We carried out site directed mutagenesis of these residues (Cys58Ser & Cys95Ser) and expressed mutant proteins in Escherichia coli. The mutant proteins did not show any oxidoreductase activity in the insulin reduction assay, thus indicating that these two cysteine residues are vital for the catalytic activity of Wba-MIF-2. PMID:26432350

  20. Purification and characterization of isoquinoline 1-oxidoreductase from Pseudomonas diminuta 7, a novel molybdenum-containing hydroxylase.

    PubMed

    Lehmann, M; Tshisuaka, B; Fetzner, S; Röger, P; Lingens, F

    1994-04-15

    Isoquinoline 1-oxidoreductase, which catalyzes the hydroxylation of isoquinoline to 1-oxo-1,2-dihydroisoquinoline with concomitant reduction of a suitable electron acceptor, was purified from the isoquinoline degrading bacterium Pseudomonas diminuta 7 to apparent homogeneity. The native enzyme was a heterodimer with a molecular mass of 95 kDa consisting of a 16- and a 80-kDa subunit. It contained 0.85 g atom molybdenum, 3.95 g atom iron, 3.9 g atom acid-labile sulfur, 2.1 mol of phosphate, and 1 mol of CMP/mol of enzyme. CMP and phosphate are suggested to originate from molybdopterin cytosine dinucleotide of the pterin molybdenum cofactor. It is assumed that the iron and the acid-labile sulfur are arranged in two (2Fe-2S) clusters. The isoelectric point of the isoquinoline 1-oxidoreductase was within the range of pH 6.2 to 6.8. Cytochrome c, ferricyanide, and several non-physiological electron acceptors served as oxidizing substrates, whereas O2 and NAD were not used. Isoquinoline 1-oxidoreductase revealed a high specificity toward the reducing substrates isoquinoline, 5-hydroxyisoquinoline, quinazoline, and phthalazine. Isoquinoline 1-oxidoreductase was inactivated by methanol, arsenite, p-hydroxymercuribenzoate, 1,10-phenanthroline, and cyanide. Additionally, the enzyme was inactivated upon incubation with its substrates isoquinoline, which slowly inhibited the enzyme in the absence of an electron acceptor, and 5-hydroxy-isoquinoline, which rapidly and very effectively inactivated the enzyme in the presence as well as in the absence of the electron acceptors iodonitrotetrazolium chloride, phenazine methosulfate, or ferricyanide. PMID:8157655

  1. Over-expression of NADH-dependent oxidoreductase (fucO) for increasing furfural or 5-hydroxymethylfurfural tolerance

    DOEpatents

    Miller, Elliot N.; Zhang, Xueli; Yomano, Lorraine P.; Wang, Xuan; Shanmugam, Keelnatham T.; Ingram, Lonnie O'Neal

    2015-10-13

    The subject invention pertains to the discovery that the NADH-dependent propanediol oxidoreductase (FucO) can reduce furfural. This allows for a new approach to improve furfural tolerance in bacterial and/or yeast cells used to produce desired products. Thus, novel biocatalysts (bacterial, fungal or yeast cells) exhibiting increased tolerance to furfural and 5-hydroxymethylfurfural (5-HMF) are provided as are methods of making and using such biocatalysts for the production of a desired product.

  2. Failure to detect delta 5-3 beta-hydroxysteroid oxidoreductase activity in the preimplantation rabbit embryo

    SciTech Connect

    Bleau, G.

    1981-02-01

    Preimplantation rabbit embryos were incubated with pregnenolone and dehydroisoandrosterone under conditions which gave formazan precipitation by the histochemical technique. The metabolic fate of the labeled steroids were assessed simultaneously. There was no concomitant transformation of pregnenolone to progesterone and dehydroisoandrosterone was not transformed to androstenedione. It is concluded that the formazan precipitation is coupled with an activity other than delta 5-3 beta-hydroxysteroid oxidoreductase.

  3. Structural and Biochemical Characterization of the Oxidoreductase NmDsbA3 from Neisseria meningitidis

    SciTech Connect

    Vivian, Julian P.; Scoullar, Jessica; Robertson, Amy L.; Bottomley, Stephen P.; Horne, James; Chin, Yanni; Wielens, Jerome; Thompson, Philip E.; Velkov, Tony; Piek, Susannah; Byres, Emma; Beddoe, Travis; Wilce, Matthew C.J.; Kahler, Charlene M.; Rossjohn, Jamie; Scanlon, Martin J.

    2009-09-02

    DsbA is an enzyme found in the periplasm of Gram-negative bacteria that catalyzes the formation of disulfide bonds in a diverse array of protein substrates, many of which are involved in bacterial pathogenesis. Although most bacteria possess only a single essential DsbA, Neisseria meningitidis is unusual in that it possesses three DsbAs, although the reason for this additional redundancy is unclear. Two of these N. meningitidis enzymes (NmDsbA1 and NmDsbA2) play an important role in meningococcal attachment to human epithelial cells, whereas NmDsbA3 is considered to have a narrow substrate repertoire. To begin to address the role of DsbAs in the pathogenesis of N. meningitidis, we have determined the structure of NmDsbA3 to 2.3-{angstrom} resolution. Although the sequence identity between NmDsbA3 and other DsbAs is low, the NmDsbA3 structure adopted a DsbA-like fold. Consistent with this finding, we demonstrated that NmDsbA3 acts as a thiol-disulfide oxidoreductase in vitro and is reoxidized by Escherichia coli DsbB (EcDsbB). However, pronounced differences in the structures between DsbA3 and EcDsbA, which are clustered around the active site of the enzyme, suggested a structural basis for the unusual substrate specificity that is observed for NmDsbA3.

  4. Reduction of nitric oxide catalyzed by hydroxylamine oxidoreductase from an anammox bacterium.

    PubMed

    Irisa, Tatsuya; Hira, Daisuke; Furukawa, Kenji; Fujii, Takao

    2014-12-01

    The hydroxylamine oxidoreductase (HAO) from the anammox bacterium, Candidatus Kuenenia stuttgartiensis has been reported to catalyze the oxidation of hydroxylamine (NH2OH) to nitric oxide (NO) by using bovine cytochrome c as an oxidant. In contrast, we investigated whether the HAO from anammox bacterium strain KSU-1 could catalyze the reduction of NO with reduced benzyl viologen (BVred) and the NO-releasing reagent, NOC 7. The reduction proceeded, resulting in the formation of NH2OH as a product. The oxidation rate of BVred was proportional to the concentration of BVred itself for a short period in each experiment, a situation that was termed quasi-steady state. The analyses of the states at various concentrations of HAO allowed us to determine the rate constant for the catalytic reaction, (2.85 ± 0.19) × 10(5) M(-1) s(-1), governing NO reduction by BVred and HAO, which was comparable to that reported for the HAO from the ammonium oxidizer, Nitrosomonas with reduced methyl viologen. These results suggest that the anammox HAO functions to adjust anammox by inter-conversion of NO and NH2OH depending on the redox potential of the physiological electron transfer protein in anammox bacteria. PMID:24996970

  5. Characterization of two-step deglycosylation via oxidation by glycoside oxidoreductase and defining their subfamily

    PubMed Central

    Kim, Eun-Mi; Seo, Joo-Hyun; Baek, Kiheon; Kim, Byung-Gee

    2015-01-01

    Herein, we report a two-step deglycosylation mediated by the oxidation of glycoside which is different from traditional glycoside hydrolase (GH) mechanism. Previously, we reported a novel flavin adenine dinucleotide (FAD)-dependent glycoside oxidoreductase (FAD-GO) having deglycosylation activity. Various features of the reaction of FAD-GO such as including mechanism and catalytic residue and substrate specificity were studied. In addition, classification of novel FAD-GO subfamily was attempted. Deglycosylation of glycoside was performed spontaneously via oxidation of 3-OH of glycone moiety by FAD-GO mediated oxidation reaction. His493 residue was identified as a catalytic residue for the oxidation step. Interestingly, this enzyme has broad glycone and aglycon specificities. For the classification of FAD-GO enzyme subfamily, putative FAD-GOs were screened based on the FAD-GO from Rhizobium sp. GIN611 (gi 365822256) using BLAST search. The homologs of R. sp. GIN611 included the putative FAD-GOs from Stenotrophomonas strains, Sphingobacterium strains, Agrobacterium tumefaciens str. C58, and etc. All the cloned FAD-GOs from the three strains catalyzed the deglycosylation via enzymatic oxidation. Based on their substrate specificities, deglycosylation and oxidation activities to various ginsenosides, the FAD-GO subfamily members can be utilized as novel biocatalysts for the production of various aglycones. PMID:26057169

  6. Plant Protochlorophyllide Oxidoreductases A and B: CATALYTIC EFFICIENCY AND INITIAL REACTION STEPS.

    PubMed

    Garrone, Alessio; Archipowa, Nataliya; Zipfel, Peter F; Hermann, Gudrun; Dietzek, Benjamin

    2015-11-20

    The enzyme protochlorophyllide oxidoreductase (POR, EC 1.3.1.33) has a key role in plant development. It catalyzes one of the later steps in chlorophyll synthesis, the light-induced reduction of protochlorophyllide (PChlide) into chlorophyllide (Chlide) in the presence of NADPH. Two isozymes of plant POR, POR A and POR B from barley, which differ in their function during plant life, are compared with respect to their substrate binding affinity, catalytic efficiency, and catalytic mechanism. POR B as compared with POR A shows an 5-fold higher binding affinity for PChlide and an about 6-fold higher catalytic efficiency measured as kcat/Km. Based on the reaction intermediates, which can be trapped at low temperatures the same reaction mechanism operates in both POR A and POR B. In contrast to results reported for POR enzymes from cyanobacteria, the initial light-driven step, which occurs at temperatures below 180 K already involves the full chemistry of the photoreduction and yields the reaction product, Chlide, in an enzyme-bound form. The subsequent dark reactions, which include cofactor (NADP(+)) release and cofactor (NADPH) rebinding, show different temperature dependences for POR A and POR B and suggest a higher conformational flexibility of POR B in the surrounding active center. Both the higher substrate binding affinity and well adapted enzyme dynamics are held responsible for the increased catalytic activity of POR B as compared with POR A. PMID:26408201

  7. Localization, Purification, and Characterization of Shikimate Oxidoreductase-Dehydroquinate Hydrolyase from Stroma of Spinach Chloroplasts 1

    PubMed Central

    Fiedler, Erich; Schultz, Gernot

    1985-01-01

    The stroma of chloroplasts is probably the sole site of the shikimate pathway enzymes shikimate oxidoreductase/dehydroquinate hydrolyase (SORase/DHQase) in spinach leaves. (a) The chromatographic behavior of the bifunctional protein SORase/DHQase on several separation materials with extracts from stroma compared with leaf extracts showed only one peak of enzymic activity originating from the stroma. (b) Polyacrylamide gel electrophoresis (PAGE) of these extracts followed by specific staining resulted in the same pattern without a band of extraplastidic enzyme. (c) In protoplast fractionation experiments it was shown that SORase/DHQase was present only in the soluble chloroplast protein fraction. An improved purification procedure for SORase/DHQase from stroma of chloroplasts, yield 40%, 1600 times as pure, gave essentially one protein band on sodium dodecyl sulfate-PAGE. Our results demonstrate that both enzyme functions are carried out by a single polypeptide. Nondenaturing PAGE exhibited a pattern of four bands with SORase/DHQase showing that they differ in charge but not in their molecular weight. Molecular weight was determined to be 67 kilodaltons (gel filtration) and 59 kilodaltons (PAGE) for all four forms. It was proven they were not due to artifacts. The four forms show similar kinetic properties, their Km and pH optima differing only very slightly. Response to some metabolites is reported. Images Fig. 3 Fig. 7 PMID:16664373

  8. Xanthine Oxidoreductase-Catalyzed Reduction of Nitrite to Nitric Oxide: Insights Regarding Where, When and How

    PubMed Central

    Cantu-Medellin, Nadiezhda; Kelley, Eric E.

    2013-01-01

    Numerous inflammatory disorders are associated with elevated levels of xanthine oxidoreductase (XOR) and allied enhancement of reactive species formation contributory to systemic pathology. Despite a long standing association between increased XOR activity and negative clinical outcomes, recent reports describe a paradigm shift where XOR mediates beneficial actions by catalyzing the reduction of NO2? to •NO. While provocative, these observations contradict reports of improved outcomes in similar models upon XOR inhibition as well as reports revealing strict anoxia as a requisite for XOR-mediated •NO formation. To garner a more clear understanding of conditions necessary for in vivo XOR-catalyzed •NO production, this review critically analyzes the impact of O2 tension, pH, substrate concentrations, glycoaminoglycan docking and inhibition strategies on the nitrite reductase activity of XOR and reveals a hypoxic milieu where this process may be operative. As such, information herein serves to link recent reports in which XOR activity has been identified as mediating the beneficial outcomes resulting from nitrite supplementation to a microenviromental setting where XOR can serve as substantial source of •NO. PMID:23454592

  9. Functional characterization of the FoxE iron oxidoreductase from the photoferrotroph Rhodobacter ferrooxidans SW2.

    PubMed

    Saraiva, Ivo H; Newman, Dianne K; Louro, Ricardo O

    2012-07-20

    Photoferrotrophy is presumed to be an ancient type of photosynthetic metabolism in which bacteria use the reducing power of ferrous iron to drive carbon fixation. In this work the putative iron oxidoreductase of the photoferrotroph Rhodobacter ferrooxidans SW2 was cloned, purified, and characterized for the first time. This protein, FoxE, was characterized using spectroscopic, thermodynamic, and kinetic techniques. It is a c-type cytochrome that forms a trimer or tetramer in solution; the two hemes of each monomer are hexacoordinated by histidine and methionine. The hemes have positive reduction potentials that allow downhill electron transfer from many geochemically relevant ferrous iron forms to the photosynthetic reaction center. The reduction potentials of the hemes are different and are cross-assigned to fast and slow kinetic phases of ferrous iron oxidation in vitro. Lower reactivity was observed at high pH and may contribute to prevent ferric iron precipitation inside or at the surface of the cell. These results help fill in the molecular details of a metabolic process that likely contributed to the deposition of precambrian banded iron formations, globally important sedimentary rocks that are found on every continent today. PMID:22661703

  10. NADH and NADPH-dependent reduction of coenzyme Q at the plasma membrane.

    PubMed

    Arroyo, A; Kagan, V E; Tyurin, V A; Burgess, J R; de Cabo, R; Navas, P; Villalba, J M

    2000-01-01

    High affinity for NADH, and low affinity for NADPH, for reduction of endogenous coenzyme Q10 (CoQ10) by pig liver plasma membrane is reported in the present work. CoQ reduction in plasma membrane is carried out, in addition to other mechanisms, by plasma membrane coenzyme Q reductase (PMQR). We show that PMQR-catalyzed reduction of CoQ0 by both NADH and NADPH is accompanied by generation of CoQ0 semiquinone radicals in a superoxide-dependent reaction. In the presence of a water-soluble vitamin E homologue, Trolox, this reduction leads to quenching of the Trolox phenoxyl radicals. The involvement of PMQR versus DT-diaphorase under the conditions of vitamin E and selenium sufficiency and deficiency was evaluated for CoQ reduction by plasma membranes. The data presented here suggest that both nucleotides (NADH and NADPH) can be accountable for CoQ reduction by PMQR on the basis of their physiological concentrations within the cell. The enzyme is primarily responsible for CoQ reduction in plasma membrane under normal (nonoxidative stress-associated) conditions. PMID:11229530

  11. Nonenzymatic NADPH-dependent reduction of 2,6-dichlorophenol-indophenol.

    PubMed

    Dupuy, C; Kaniewski, J; Ohayon, R; Dème, D; Virion, A; Pommier, J

    1990-11-15

    The reduction of 2,6-dichloroindophenol (DCIP) by direct interaction with NADPH was studied. The results indicate that reduction proceeds via a direct electron transfer from NADPH to DCIP, with no oxygen consumption, and a rate constant of k = 4.69 M-1.s-1. The reduced DCIP can rapidly transfer its electrons to potassium ferricyanide (K3Fe(CN)6) or ferricytochrome c, but not to nitro blue tetrazolium. Superoxide dismutase inhibits DCIP reduction in an oxygen-dependent manner by favoring the reoxidation of the reduced DCIP. We therefore conclude DCIP is not suitable for detecting O2- when the nucleotides NADH or NADPH are present. PMID:1964024

  12. Kinetic mechanism of quinone oxidoreductase 2 and its inhibition by the antimalarial quinolines.

    PubMed

    Kwiek, Jesse J; Haystead, Timothy A J; Rudolph, Johannes

    2004-04-20

    Quinone oxidoreductase 2 (QR2) purified from human red blood cells was recently shown to be a potential target of the quinoline antimalarial compounds [Graves et al., (2002) Mol. Pharmacol. 62, 1364]. QR2 catalyzes the two-electron reduction of menadione via the oxidation of N-alkylated or N-ribosylated nicotinamides. To investigate the mechanism and consequences of inhibition of QR2 by the quinolines further, we have used steady-state and transient-state kinetics to define the mechanism of QR2. Importantly, we have shown that QR2 when isolated from an overproducing strain of E. coli is kinetically equivalent to the enzyme from the native human red blood cell source. We observe ping-pong kinetics consistent with one substrate/inhibitor binding site that shows selectivity for the oxidation state of the FAD cofactor, suggesting that selective inhibition of the liver versus red blood cell forms of malaria may be possible. The reductant N-methyldihydronicotinamide and the inhibitor primaquine bind exclusively to the oxidized enzyme. In contrast, the inhibitors quinacrine and chloroquine bind exclusively to the reduced enzyme. The quinone substrate menadione, on the other hand, binds nonspecifically to both forms of the enzyme. Single-turnover kinetics of the reductive half-reaction are chemically and kinetically competent and confirm the inhibitor selectivity seen in the steady-state experiments. Our studies shed light on the possible in vivo potency of the quinolines and provide a foundation for future studies aimed at creating more potent QR2 inhibitors and at understanding the physiological significance of QR2. PMID:15078100

  13. Structure determination by multiwavelength anomalous diffraction of aclacinomycin oxidoreductase: indications of multidomain pseudomerohedral twinning.

    PubMed

    Sultana, Azmiri; Alexeev, Igor; Kursula, Inari; Mäntsälä, Pekka; Niemi, Jarmo; Schneider, Gunter

    2007-02-01

    The crystal structure of aclacinomycin oxidoreductase (AknOx), a tailoring enzyme involved in the biosynthesis of the polyketide antibiotic aclacinomycin, was determined to 1.65 A resolution by multiwavelength anomalous diffraction using data from selenomethionine-substituted crystals. The crystals belong to space group P2(1), with unit-cell parameters a = 68.2, b = 264.5, c = 68.2 A, beta = 119 degrees . Analysis of the intensity statistics clearly showed the presence of pseudomerohedral twinning. The data set could also be indexed and scaled with an R(sym) of 0.072 in the orthorhombic space group C222(1) (unit-cell parameters a = 69.7, b = 117.5, c = 264.4 A), indicating the possibility of pseudomerohedral twinning along the diagonal between the monoclinic a and c directions. Refinement using this twin operator resulted in an R(free) of 24.2%. A monoclinic lattice with a = c and beta close to 120 degrees can emulate a hexagonal metric, with the possibility of a threefold twin operator along the b axis and three twin domains. Refinement assuming three-domain twinning gave a final R(free) of 26.5%. The structure of AknOx can be thus refined with comparable R(free) values using either of the twin operators separately, suggesting the possibility that crystals of AknOx contain six twin domains generated by the twofold and threefold twin operators perpendicular to each other. Both twin operators coincide with noncrystallographic symmetry axes that may promote twinning. PMID:17242508

  14. Unique amino acids cluster for switching from the dehydrogenase to oxidase form of xanthine oxidoreductase.

    PubMed

    Kuwabara, Yoshimitsu; Nishino, Tomoko; Okamoto, Ken; Matsumura, Tomohiro; Eger, Bryan T; Pai, Emil F; Nishino, Takeshi

    2003-07-01

    In mammals, xanthine oxidoreductase is synthesized as a dehydrogenase (XDH) but can be readily converted to its oxidase form (XO) either by proteolysis or modification of cysteine residues. The crystal structures of bovine milk XDH and XO demonstrated that atoms in the highly charged active-site loop (Gln-423-Lys-433) around the FAD cofactor underwent large dislocations during the conversion, blocking the approach of the NAD+ substrate to FAD in the XO form as well as changing the electrostatic environment around FAD. Here we identify a unique cluster of amino acids that plays a dual role by forming the core of a relay system for the XDH/XO transition and by gating a solvent channel leading toward the FAD ring. A more detailed structural comparison and site-directed mutagenesis analysis experiments showed that Phe-549, Arg-335, Trp-336, and Arg-427 sit at the center of a relay system that transmits modifications of the linker peptide by cysteine oxidation or proteolytic cleavage to the active-site loop (Gln-423-Lys-433). The tight interactions of these residues are crucial in the stabilization of the XDH conformation and for keeping the solvent channel closed. Both oxidative and proteolytic generation of XO effectively leads to the removal of Phe-549 from the cluster causing a reorientation of the bulky side chain of Trp-336, which then in turn forces a dislocation of Arg-427, an amino acid located in the active-site loop. The conformational change also opens the gate for the solvent channel, making it easier for oxygen to reach the reduced FAD in XO. PMID:12817083

  15. Cyclin-Dependent Kinase Five Mediates Activation of Lung Xanthine Oxidoreductase in Response to Hypoxia

    PubMed Central

    Kim, Bo S.; Serebreni, Leonid; Fallica, Jonathan; Hamdan, Omar; Wang, Lan; Johnston, Laura; Kolb, Todd; Damarla, Mahendra; Damico, Rachel; Hassoun, Paul M.

    2015-01-01

    Background Xanthine oxidoreductase (XOR) is involved in oxidative metabolism of purines and is a source of reactive oxygen species (ROS). As such, XOR has been implicated in oxidant-mediated injury in multiple cardiopulmonary diseases. XOR enzyme activity is regulated, in part, via a phosphorylation-dependent, post-translational mechanism, although the kinase(s) responsible for such hyperactivation are unknown. Methods and Results Using an in silico approach, we identified a cyclin-dependent kinase 5 (CDK5) consensus motif adjacent to the XOR flavin adenine dinucleotide (FAD) binding domain. CDK5 is a proline-directed serine/threonine kinase historically linked to neural development and injury. We tested the hypothesis that CDK5 and its activators are mediators of hypoxia-induced hyperactivation of XOR in pulmonary microvascular endothelial cells (EC) and the intact murine lung. Using complementary molecular and pharmacologic approaches, we demonstrated that hypoxia significantly increased CDK5 activity in EC. This was coincident with increased expression of the CDK5 activators, cyclin-dependent kinase 5 activator 1 (CDK5r1 or p35/p25), and decreased expression of the CDK5 inhibitory peptide, p10. Expression of p35/p25 was necessary for XOR hyperactivation. Further, CDK5 physically associated with XOR and was necessary and sufficient for XOR phosphorylation and hyperactivation both in vitro and in vivo. XOR hyperactivation required the target threonine (T222) within the CDK5-consensus motif. Conclusions and Significance These results indicate that p35/CDK5-mediated phosphorylation of T222 is required for hypoxia-induced XOR hyperactivation in the lung. Recognizing the contribution of XOR to oxidative injury in cardiopulmonary disease, these observations identify p35/CDK5 as novel regulators of XOR and potential modifiers of ROS-mediated injury. PMID:25831123

  16. Membrane-Associated Glucose-Methanol-Choline Oxidoreductase Family Enzymes PhcC and PhcD Are Essential for Enantioselective Catabolism of Dehydrodiconiferyl Alcohol.

    PubMed

    Takahashi, Kenji; Hirose, Yusaku; Kamimura, Naofumi; Hishiyama, Shojiro; Hara, Hirofumi; Araki, Takuma; Kasai, Daisuke; Kajita, Shinya; Katayama, Yoshihiro; Fukuda, Masao; Masai, Eiji

    2015-12-01

    Sphingobium sp. strain SYK-6 is able to degrade various lignin-derived biaryls, including a phenylcoumaran-type compound, dehydrodiconiferyl alcohol (DCA). In SYK-6 cells, the alcohol group of the B-ring side chain of DCA is initially oxidized to the carboxyl group to generate 3-(2-(4-hydroxy-3-methoxyphenyl)-3-(hydroxymethyl)-7-methoxy-2,3-dihydrobenzofuran-5-yl) acrylic acid (DCA-C). Next, the alcohol group of the A-ring side chain of DCA-C is oxidized to the carboxyl group, and then the resulting metabolite is catabolized through vanillin and 5-formylferulate. In this study, the genes involved in the conversion of DCA-C were identified and characterized. The DCA-C oxidation activities in SYK-6 were enhanced in the presence of flavin adenine dinucleotide and an artificial electron acceptor and were induced ca. 1.6-fold when the cells were grown with DCA. Based on these observations, SLG_09480 (phcC) and SLG_09500 (phcD), encoding glucose-methanol-choline oxidoreductase family proteins, were presumed to encode DCA-C oxidases. Analyses of phcC and phcD mutants indicated that PhcC and PhcD are essential for the conversion of (+)-DCA-C and (-)-DCA-C, respectively. When phcC and phcD were expressed in SYK-6 and Escherichia coli, the gene products were mainly observed in their membrane fractions. The membrane fractions of E. coli that expressed phcC and phcD catalyzed the specific conversion of DCA-C into the corresponding carboxyl derivatives. In the oxidation of DCA-C, PhcC and PhcD effectively utilized ubiquinone derivatives as electron acceptors. Furthermore, the transcription of a putative cytochrome c gene was significantly induced in SYK-6 grown with DCA. The DCA-C oxidation catalyzed by membrane-associated PhcC and PhcD appears to be coupled to the respiratory chain. PMID:26362985

  17. Comparison of the inhibitory action of synthetic capsaicin analogues with various NADH-ubiquinone oxidoreductases.

    PubMed

    Satoh, T; Miyoshi, H; Sakamoto, K; Iwamura, H

    1996-01-11

    Capsaicin is a new naturally occurring inhibitor of proton-pumping NADH-ubiquinone oxidoreductase (NDH-1), that competitively acts against ubiquinone. A series of capsaicin analogues was synthesized to examine the structural factors required for the inhibitory action and to probe the structural property of the ubiquinone catalytic site of various NADH-ubiquinone reductases, including non-proton-pumping enzyme (NDH-2), from bovine heart mitochondria, potato tuber (Solanum tuberosum, L) mitochondria and Escherichia coli (GR 19N) plasma membranes. Some synthetic capsaicins were fairly potent inhibitors of each of the three NDH-1 compared with the potent rotenone and piericidin A. Synthetic capsaicin analogues inhibited all three NDH-1 activities in a competitive manner against an exogenous quinone. The modification both of the substitution pattern and of the number of methoxy groups on the benzene ring, which may be superimposable on the quinone ring of ubiquinone, did not drastically affect the inhibitory potency. In addition, alteration of the position of dipolar amide bond unit in the molecule and chemical modifications of this unit did not change the inhibitory potency, particularly with bovine heart and potato tuber NDH-1. These results might be explained assuming that the ubiquinone catalytic site of NDH-1 is spacious enough to accommodate a variety of structurally different capsaicin analogues in a dissimilar manner. Regarding the moiety corresponding to the alkyl side chain, a rigid diphenyl ether structure was more inhibitory than a flexible alkyl chain. Structure-activity studies and molecular orbital calculations suggested that a bent form is the active conformation of capsaicin analogues. On the other hand, poor correlations between the inhibitory potencies determined with the three NDH-1 suggested that the structural similarity of the ubiquinone catalytic sites of these enzymes is rather poor. The sensitivity to the inhibition by synthetic capsaicins remarkably differed between NDH-1 and NDH-2, supporting the notion that the sensitivity against capsaicin inhibition correlates well with the presence of an energy coupling site in the enzyme (Yagi, T. (1990) Arch. Biochem. Biophys. 281, 305-311). It is noteworthy that several synthetic capsaicins discriminated between NDH-1 and NDH-2 much better than natural capsaicin. PMID:8573592

  18. High-Yield Expression of a Catalytically Active Membrane-Bound Protein: Human P450 Oxidoreductase

    PubMed Central

    Sandee, Duanpen

    2011-01-01

    P450 oxidoreductase (POR) is a two-flavin protein that reduces microsomal P450 enzymes and some other proteins. Preparation of active bacterially expressed human POR for biochemical studies has been difficult because membrane-bound proteins tend to interact with column matrices. To reduce column-protein interactions and permit more vigorous washing, human POR lacking 27 N-terminal residues (N-27 POR) was modified to carry a C-terminal Gly3His6-tag (N-27 POR-G3H6). When expressed in Escherichia coli, N-27 POR-G3H6 could be purified to apparent homogeneity by a modified, single-step nickel-nitrilotriacetic acid affinity chromatography, yielding 31 mg POR per liter of culture, whereas standard purification of native N-27 POR required multiple steps, yielding 5 mg POR per liter. Both POR proteins had absorption maxima at 375 and 453 nm and both reduced cytochrome c with indistinguishable specific activities. Using progesterone as substrate for bacterially expressed purified human P450c17, the Michaelis constant for 17?-hydroxylase activity supported by N-27 POR or N-27 POR-G3H6 were 1.73 or 1.49 ?m, and the maximal velocity was 0.029 or 0.026 pmol steroids per picomole P450 per minute, respectively. Using 17-hydroxypregnenolone as the P450c17 substrate, the Michaelis constant for 17,20 lyase activity using N-27 POR or N-27 POR-G3H6 was 1.92 or 1.89 ?m and the maximal velocity was 0.041 or 0.042 pmol steroid per picomole P450 per minute, respectively. Thus, N-27 POR-G3H6 is equally active as native N-27 POR. This expression and purification system permits the rapid preparation of large amounts of highly pure, biologically active POR and may be generally applicable for the preparation of membrane-bound proteins. PMID:21586563

  19. The aerobic respiratory chain of Escherichia coli: from genes to supercomplexes.

    PubMed

    Sousa, Pedro M F; Videira, Marco A M; Bohn, Andreas; Hood, Brian L; Conrads, Thomas P; Goulao, Luis F; Melo, Ana M P

    2012-09-01

    In spite of the large number of reports on the aerobic respiratory chain of Escherichia coli, from gene transcription regulation to enzyme kinetics and structural studies, an integrative perspective of this pathway is yet to be produced. Here, a multi-level analysis of the aerobic respiratory chain of E. coli was performed to find correlations between gene transcription, enzyme activity, growth dynamics, and supercomplex formation and composition. The transcription level of all genes encoding the aerobic respiratory chain of E. coli varied significantly in response to bacterial growth. Coordinated expression patterns were observed between the genes encoding NADH?:?quinone oxidoreductase and complex I (NDH-1), alternative NADH?:?quinone oxidoreductase (NDH-2) and cytochrome bdI, and also between sdhA and appC, encoding succinate dehydrogenase and cytochrome bdII, respectively. In general, the rates of the respiratory chain activities increased from mid-exponential to late-stationary phase, with no significant further variation occurring until the mid-stationary phase. Multi-level correlations between gene transcription, enzyme activity and growth dynamics were also found in this study. The previously reported NADH dehydrogenase and formate?:?oxygen oxidoreductase supercomplexes of E. coli were already assembled at mid-exponential phase and remained throughout growth. A new succinate oxidase supercomplex composed of succinate dehydrogenase and cytochrome bdII was identified, in agreement with the suggestion provided by the coordinated transcription of sdhA and appC. PMID:22700653

  20. Ferredoxin:NADP+ oxidoreductase in junction with CdSe/ZnS quantum dots: characteristics of an enzymatically active nanohybrid

    NASA Astrophysics Data System (ADS)

    Szczepaniak, Krzysztof; Worch, Remigiusz; Grzyb, Joanna

    2013-05-01

    Ferredoxin:NADP+ oxidoreductase (FNR) is a plant and cyanobacterial photosynthetic enzyme, also found in non-photosynthetic tissues, where it is involved in redox reactions of biosynthetic pathways. In vivo it transfers electrons to nicotinamide adenine dinucleotide phosphate (NADP+), forming its reduced version, NADPH, while in vitro it can also use NADPH to reduce several substrates, such as ferricyanide, various quinones and nitriles. As an oxidoreductase catalyzing reaction of a broad range of substrates, FNR may be used in biotechnological processes. Quantum dots are semiconductor nanocrystals of a few to several nanometers diameter, having very useful luminescent properties. We present the spectroscopic and functional characteristics of a covalent conjugation of FNR and CdSe/ZnS quantum dots. Two types of quantum dots, of different diameter and emission maximum (550 and 650 nm), were used for comparison. Steady-state fluorescence and gel electrophoresis confirmed efficient conjugation, while fluorescence correlation spectroscopy (FCS) allowed for determination of the conjugates’ radii. The nanohybrids sustained enzymatic activity; however, changes in maximal reaction rates and Michaelis constant were found. Detailed analysis of the kinetic parameters showed that the changes in the enzyme activity depend on the substrate used for activity measurement but also on the size of the quantum dots. The presented nanohybrids, as the first example using plant and photosynthetic enzyme as a protein partner, may became a tool to study photosynthesis as well as other biosynthetic and biotechnological processes, involving enzymatically catalyzed electron transfer.

  1. Chemical constituents from the rice fermented with the edible mushroom Pleurotus eryngii and their quinone oxidoreductase 1 inducing effect.

    PubMed

    Liu, Shun; Dong, Yanan; Li, Yongxia; Bao, Li; Liu, Hongwei; Li, Heran

    2013-12-01

    The fruiting bodies or mycelia of mushrooms have been used as food and food-flavoring material for centuries due to their nutritional and medicinal values and the diversity of their bioactive components. The present research was the first to study the chemical components in rice fermented with the edible mushroom Pleurotus eryngii and the quinone oxidoreductase 1 inducing effect of these compounds. Through chemical investigation, one new compound, ((6S,7S)-6,7-dihydroxy-6-methyl-2-(3-methylbutanoyl)-4,5,6,7-tetrahydrobenzofuran-3-yl)methyl acetate (1) and eight known compounds (2-9) were isolated from the P. eryngii-fermented rice. All of these compounds were isolated from rice fermented with the edible mushroom P. eryngii for the first time. Their structures were elucidated by MS and NMR data analyses. Alternariol-5-O-methyl ether (2) showed strong quinone oxidoreductase 1 inducing effect with an IR value of 2.58 at the concentration of 20 ?g/ml. The content of adenosine (8) in the fermented rice (175.64 ?g/g) is much higher than that of non-fermented rice (14.38 ?g/g). PMID:23933238

  2. Convenient microtiter plate-based, oxygen-independent activity assays for flavin-dependent oxidoreductases based on different redox dyes

    PubMed Central

    Brugger, Dagmar; Krondorfer, Iris; Zahma, Kawah; Stoisser, Thomas; Bolivar, Juan M; Nidetzky, Bernd; Peterbauer, Clemens K; Haltrich, Dietmar

    2014-01-01

    Flavin-dependent oxidoreductases are increasingly recognized as important biocatalysts for various industrial applications. In order to identify novel activities and to improve these enzymes in engineering approaches, suitable screening methods are necessary. We developed novel microtiter-plate-based assays for flavin-dependent oxidases and dehydrogenases using redox dyes as electron acceptors for these enzymes. 2,6-dichlorophenol-indophenol, methylene green, and thionine show absorption changes between their oxidized and reduced forms in the visible range, making it easy to judge visually changes in activity. A sample set of enzymes containing both flavoprotein oxidases and dehydrogenases – pyranose 2-oxidase, pyranose dehydrogenase, cellobiose dehydrogenase, d-amino acid oxidase, and l-lactate oxidase – was selected. Assays for these enzymes are based on a direct enzymatic reduction of the redox dyes and not on the coupled detection of a reaction product as in the frequently used assays based on hydrogen peroxide formation. The different flavoproteins show low Michaelis constants with these electron acceptor substrates, and therefore these dyes need to be added in only low concentrations to assure substrate saturation. In conclusion, these electron acceptors are useful in selective, reliable and cheap MTP-based screening assays for a range of flavin-dependent oxidoreductases, and offer a robust method for library screening, which could find applications in enzyme engineering programs. PMID:24376171

  3. Diversity and Spatial Distribution of Hydrazine Oxidoreductase (hzo) Gene in the Oxygen Minimum Zone Off Costa Rica

    E-print Network

    Kong, Liangliang

    Anaerobic ammonia oxidation (anammox) as an important nitrogen loss pathway has been reported in marine oxygen minimum zones (OMZs), but the community composition and spatial distribution of anammox bacteria in the eastern ...

  4. Specificity and locale of the l-3-glycerophosphate–flavoprotein oxidoreductase of mitochondria isolated from the flight muscle of Sarcophaga barbata Thoms

    PubMed Central

    Donnellan, J. F.; Barker, M. D.; Wood, J.; Beechey, R. B.

    1970-01-01

    1. The oxidation of l-3-glycerophosphate by flight-muscle mitochondria isolated from the flesh fly Sarcophaga barbata has been studied. Use of substrate analogues indicates that the catalytic and effector l-3-glycerophosphate binding sites on the allosteric l-3-glycerophosphate–flavoprotein oxidoreductase differ markedly in specificity. 2. The l-3-glycerophosphate–cyanoferrate oxidoreductase system in these mitochondria is antimycin-insensitive whereas the corresponding NADH–cyanoferrate oxidoreductase is extremely sensitive to this respiratory-chain inhibitor. Also no swelling is observed when these mitochondria are suspended in iso-osmotic solutions of ammonium glycerophosphate in contrast with the extensive swelling seen in similar solutions of ammonium pyruvate. These observations indicate that l-3-glycerophosphate does not penetrate the mitochondrial matrix whereas pyruvate does. 3. Submitochondrial particles catalyse the ATP-driven reduction of NAD+ by l-3-glycerophosphate but at a far lower rate than that seen when succinate is the electron donor. These particles do not have an energy-linked pyridine nucleotide transhydrogenase activity. 4. We conclude that the l-3-glycerophosphate–flavoprotein oxidoreductase is located on the outer surface of the inner membrane of the flight-muscle mitochondria. PMID:5499959

  5. Identification and cloning of two immunogenic C. perfringens proteins, elongation factor Tu (EF-Tu) and pyruvate:ferredoxin oxidoreductase (PFO) of Clostridium perfringens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Clostridium related poultry diseases such as necrotic enteritis (NE) and gangrenous dermatitis (GD) cause substantial economic losses on a global scale. Two antigenic C. perfringens proteins, elongation factor Tu (EF-Tu) and pyruvate:ferredoxin oxidoreductase (PFO), were identified by reaction with...

  6. O2 and Reactive Oxygen Species Detoxification Complex, Composed of O2-Responsive NADH:Rubredoxin Oxidoreductase-Flavoprotein A2-Desulfoferrodoxin Operon Enzymes, Rubperoxin, and Rubredoxin, in Clostridium acetobutylicum? †

    PubMed Central

    Kawasaki, Shinji; Sakai, Yu; Takahashi, Tohru; Suzuki, Ippei; Niimura, Youichi

    2009-01-01

    Clostridium acetobutylicum, an obligate anaerobe, grows normally under continuous-O2-flow culture conditions, where the cells consume O2 proficiently. An O2-responsive NADH:rubredoxin oxidoreductase operon composed of three genes (nror, fprA2, and dsr), encoding NROR, functionally uncharacterized flavoprotein A2 (FprA2), and the predicted superoxide reductase desulfoferrodoxin (Dsr), has been proposed to participate in defense against O2 stress. To functionally characterize these proteins, native NROR from C. acetobutylicum, recombinant NROR (rNROR), FprA2, Dsr, and rubredoxin (Rd) expressed in Escherichia coli were purified. Purified native NROR and rNROR both exhibited weak H2O2-forming NADH oxidase activity that was slightly activated by Rd. A mixture of NROR, Rd, and FprA2 functions as an efficient H2O-forming NADH oxidase with a high affinity for O2 (the Km for O2 is 2.9 ± 0.4 ?M). A mixture of NROR, Rd, and Dsr functions as an NADH-dependent O2? reductase. A mixture of NROR, Rd, and rubperoxin (Rpr, a rubrerythrin homologue) functions as an inefficient H2O-forming NADH oxidase but an efficient NADH peroxidase with a low affinity for O2 and a high affinity for H2O2 (the Kms for O2 and H2O2 are 303 ± 39 ?M and ?1 ?M, respectively). A gene encoding Rd is dicistronically transcribed with a gene encoding a glutaredoxin (Gd) homologue, and the expression levels of the genes encoding Gd and Rd were highly upregulated upon exposure to O2. Therefore, nror operon enzymes, together with Rpr, efficiently function to scavenge O2, O2?, and H2O2 by using an O2-responsive rubredoxin as a common electron carrier protein. PMID:19124587

  7. The two common polymorphic forms of human NRH-quinone oxidoreductase 2 (NQO2) have different biochemical properties

    PubMed Central

    Megarity, Clare F.; Gill, James R.E.; Clare Caraher, M.; Stratford, Ian J.; Nolan, Karen A.; Timson, David J.

    2014-01-01

    There are two common forms of NRH-quinone oxidoreductase 2 (NQO2) in the human population resulting from SNP rs1143684. One has phenylalanine at position 47 (NQO2-F47) and the other leucine (NQO2-L47). Using recombinant proteins, we show that these variants have similar steady state kinetic parameters, although NQO2-L47 has a slightly lower specificity constant. NQO2-L47 is less stable towards proteolytic digestion and thermal denaturation than NQO2-F47. Both forms are inhibited by resveratrol, but NQO2-F47 shows negative cooperativity with this inhibitor. Thus these data demonstrate, for the first time, clear biochemical differences between the variants which help explain previous biomedical and epidemiological findings. PMID:24631540

  8. Specific disintegration of complex II succinate:ubiquinone oxidoreductase links pH changes to oxidative stress for apoptosis induction.

    PubMed

    Lemarie, A; Huc, L; Pazarentzos, E; Mahul-Mellier, A-L; Grimm, S

    2011-02-01

    The formation of reactive oxygen species (ROS) and the change of the intracellular pH (pH(i)) are common phenomena during apoptosis. How they are interconnected, however, is poorly understood. Here we show that numerous anticancer drugs and cytokines such as Fas ligand and tumour necrosis factor ? provoke intracellular acidification and cause the formation of mitochondrial ROS. In parallel, we found that the succinate:ubiquinone oxidoreductase (SQR) activity of the mitochondrial respiratory complex II is specifically impaired without affecting the second enzymatic activity of this complex as a succinate dehydrogenase (SDH). Only in this configuration is complex II an apoptosis mediator and generates superoxides for cell death. This is achieved by the pH(i) decline that leads to the specific dissociation of the SDHA/SDHB subunits, which encompass the SDH activity, from the membrane-bound components of complex II that are required for the SQR activity. PMID:20706275

  9. The two common polymorphic forms of human NRH-quinone oxidoreductase 2 (NQO2) have different biochemical properties.

    PubMed

    Megarity, Clare F; Gill, James R E; Caraher, M Clare; Stratford, Ian J; Nolan, Karen A; Timson, David J

    2014-05-01

    There are two common forms of NRH-quinone oxidoreductase 2 (NQO2) in the human population resulting from SNP rs1143684. One has phenylalanine at position 47 (NQO2-F47) and the other leucine (NQO2-L47). Using recombinant proteins, we show that these variants have similar steady state kinetic parameters, although NQO2-L47 has a slightly lower specificity constant. NQO2-L47 is less stable towards proteolytic digestion and thermal denaturation than NQO2-F47. Both forms are inhibited by resveratrol, but NQO2-F47 shows negative cooperativity with this inhibitor. Thus these data demonstrate, for the first time, clear biochemical differences between the variants which help explain previous biomedical and epidemiological findings. PMID:24631540

  10. Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus.

    PubMed

    Ikeda, Takeshi; Yamamoto, Masahiro; Arai, Hiroyuki; Ohmori, Daijiro; Ishii, Masaharu; Igarashi, Yasuo

    2010-01-01

    Pyruvate: ferredoxin oxidoreductase (POR; EC 1.2.7.1) catalyzes the thiamine pyrophosphate-dependent oxidative decarboxylation of pyruvate to form acetyl-CoA and CO(2). The thermophilic, obligate chemolithoautotrophic hydrogen-oxidizing bacterium, Hydrogenobacter thermophilus TK-6, assimilates CO(2) via the reductive tricarboxylic acid cycle. In this cycle, POR acts as pyruvate synthase catalyzing the reverse reaction (i.e. reductive carboxylation of acetyl-CoA) to form pyruvate. The pyruvate synthesis reaction catalyzed by POR is an energetically unfavorable reaction and requires a strong reductant. Moreover, the reducing equivalents must be supplied via its physiological electron mediator, a small iron-sulfur protein ferredoxin. Therefore, the reaction is difficult to demonstrate in vitro and the reaction mechanism has been poorly understood. In the present study, we coupled the decarboxylation of 2-oxoglutarate catalyzed by 2-oxoglutarate: ferredoxin oxidoreductase (EC 1.2.7.3), which generates sufficiently low-potential electrons to reduce ferredoxin, to drive the energy-demanding pyruvate synthesis by POR. We demonstrate that H. thermophilus POR catalyzes pyruvate synthesis from acetyl-CoA and CO(2), confirming the operation of the reductive tricarboxylic acid cycle in this bacterium. We also measured the electron paramagnetic resonance spectra of the POR intermediates in both the forward and reverse reactions, and demonstrate the intermediacy of a 2-(1-hydroxyethyl)- or 2-(1-hydroxyethylidene)-thiamine pyrophosphate radical in both reactions. The reaction mechanism of the reductive carboxylation of acetyl-CoA is also discussed. PMID:20015072

  11. Inhibitory Effects of Tart Cherry (Prunus cerasus) Juice on Xanthine Oxidoreductase Activity and its Hypouricemic and Antioxidant Effects on Rats.

    PubMed

    Haidari, F; Mohammad Shahi, M; Keshavarz, S A; Rashidi, M R

    2009-03-01

    The aim of this study was to investigate the effect of tart cherry juice on serum uric acid levels, hepatic xanthine oxidoreductase activity and two non-invasive biomarkers of oxidative stress (total antioxidant capacity and malondialdehyde concentration), in normal and hyperuricemic rats. Tart cherry juice (5 ml/kg) was given by oral gavage to rats for 2 weeks. Allopurinol (5 mg/kg) was used as a positive control and was also given by oral gavage. Data showed that tart cherry juice treatment did not cause any significant reduction in the serum uric acid levels in normal rats, but significantly reduced (P<0.05) the serum uric acid levels of hyperuricemic rats in a time-dependent manner. Tart cherry juice treatment also inhibited hepatic xanthine oxidase/dehydrogenase activity. Moreover, a significant increase (P<0.05) in serum total antioxidant capacity was observed in tart cherry juice treated-rats in both normal and hyperuricemic groups. The oral administration of tart cherry juice also led to a significant reduction (P<0.05) in MDA concentration in the hyperuricemic rats. Although the hypouricemic effect of allopurinol, as a putative inhibitor of xanthine oxidoreductase, was much higher than that of tart cherry, it could not significantly change anti-oxidative parameters. These features of tart cherry make it an attractive candidate for the prophylactic treatment of hyperuricaemia, particularly if it is to be taken on a long-term basis. Further investigations to define its clinical efficacy would be highly desirable. PMID:22691805

  12. [The interaction of ferredoxin:NADP{sup +} oxidoreductase and ferredoxin:thioredoxin reductase with substrates]. Progress report

    SciTech Connect

    Not Available

    1992-09-01

    We seek to map the ferredoxin-binding sites on three soluble enzymes located in spinach chloroplasts which utilize ferredoxin as an electron donor:Ferredoxin:NADP{sup +}oxidoreductase (FNR); ferredoxin:thioredoxin reductase (FTR) and glutamate synthase. As the availability of amino acid sequences for the enzymes are important in such studies, that the amino acid sequence of glutamate synthase needs be determined, the amino acid sequences of FNR, FTR and ferredoxin are already known. Related to an aim elucidate the binding sites for ferredoxin to determine whether there is a common binding site on all of these ferredoxin-dependent chloroplast enzymes and, if so, to map it. Additionally thioredoxin binding by FTR needs be determine to resolve whether the same site on FTR is involved in binding both ferredoxin and thioredoxin. Considerable progress is reported on the prosthetic groups of glutamate synthase, in establishing the role of arginine and lysine residues in ferredoxin binding by, ferredoxin:nitrite oxidoreductase nitrite reductase, labelling carboxyl groups on ferredoxin with taurine and labelling lysine residues biotinylation, and low potential heme proteins have been isolated and characterized from a non-photosynthetic plant tissue. Although the monoclonal antibodies raised against FNR turned out not to be useful for mapping the FNR/ferredoxin or FNR/NADPinteraction domains, good progress has been made on mapping the FNR/ferredoxin interaction domains by an alternative technique. The techniques developed for differential chemical modification of these two proteins - taurine modification of aspartate and glutamate residues and biotin modification of lysine residues - should be useful for mapping the interaction domains of many proteins that associate through electrostatic interactions.

  13. The Rnf Complex of Clostridium ljungdahlii Is a Proton-Translocating Ferredoxin:NAD(+) Oxidoreductase Essential for Autotrophic Growth

    SciTech Connect

    Tremblay, PL; Zhang, T; Dar, SA; Leang, C; Lovley, DR

    2012-12-26

    It has been predicted that the Rnf complex of Clostridium ljungdahlii is a proton-translocating ferredoxin: NAD(+) oxidoreductase which contributes to ATP synthesis by an H+-translocating ATPase under both autotrophic and heterotrophic growth conditions. The recent development of methods for genetic manipulation of C. ljungdahlii made it possible to evaluate the possible role of the Rnf complex in energy conservation. Disruption of the C. ljungdahlii rnf operon inhibited autotrophic growth. ATP synthesis, proton gradient, membrane potential, and proton motive force collapsed in the Rnf-deficient mutant with H-2 as the electron source and CO2 as the electron acceptor. Heterotrophic growth was hindered in the absence of a functional Rnf complex, as ATP synthesis, proton gradient, and proton motive force were significantly reduced with fructose as the electron donor. Growth of the Rnf-deficient mutant was also inhibited when no source of fixed nitrogen was provided. These results demonstrate that the Rnf complex of C. ljungdahlii is responsible for translocation of protons across the membrane to elicit energy conservation during acetogenesis and is a multifunctional device also implicated in nitrogen fixation. IMPORTANCE Mechanisms for energy conservation in the acetogen Clostridium ljungdahlii are of interest because of its potential value as a chassis for the production of biocommodities with novel electron donors such as carbon monoxide, syngas, and electrons derived from electrodes. Characterizing the components implicated in the chemiosmotic ATP synthesis during acetogenesis by C. ljungdahlii is a prerequisite for the development of highly productive strains. The Rnf complex has been considered the prime candidate to be the pump responsible for the formation of an ion gradient coupled with ATP synthesis in multiple acetogens. However, experimental evidence for a proton-pumping Rnf complex has been lacking. This study establishes the C. ljungdahlii Rnf complex as a proton-translocating ferredoxin: NAD(+) oxidoreductase and demonstrates that C. ljungdahlii has the potential of becoming a model organism to study proton translocation, electron transport, and other functions of the Rnf complex in energy conservation or other processes.

  14. The Ocean as a Global Reservoir of Antibiotic Resistance Genes.

    PubMed

    Hatosy, Stephen M; Martiny, Adam C

    2015-11-01

    Recent studies of natural environments have revealed vast genetic reservoirs of antibiotic resistance (AR) genes. Soil bacteria and human pathogens share AR genes, and AR genes have been discovered in a variety of habitats. However, there is little knowledge about the presence and diversity of AR genes in marine environments and which organisms host AR genes. To address this, we identified the diversity of genes conferring resistance to ampicillin, tetracycline, nitrofurantoin, and sulfadimethoxine in diverse marine environments using functional metagenomics (the cloning and screening of random DNA fragments). Marine environments were host to a diversity of AR-conferring genes. Antibiotic-resistant clones were found at all sites, with 28% of the genes identified as known AR genes (encoding beta-lactamases, bicyclomycin resistance pumps, etc.). However, the majority of AR genes were not previously classified as such but had products similar to proteins such as transport pumps, oxidoreductases, and hydrolases. Furthermore, 44% of the genes conferring antibiotic resistance were found in abundant marine taxa (e.g., Pelagibacter, Prochlorococcus, and Vibrio). Therefore, we uncovered a previously unknown diversity of genes that conferred an AR phenotype among marine environments, which makes the ocean a global reservoir of both clinically relevant and potentially novel AR genes. PMID:26296734

  15. Expression of WW Domain-Containing Oxidoreductase WOX1 in Human Nervous System Tumors

    PubMed Central

    Chiang, Ming-Fu; Chen, Shur-Tzu; Lo, Chen-Peng; Sze, Chun-I; Chang, Nan-Shan; Chen, Yu-Jen

    2013-01-01

    Background and ObjectiveS: We aimed to evaluate the expression levels of the tumor suppressor WOX1 in nervous system tumors and its co-expression with p53 and neurofibromatosis type 2/merlin (NF2) tumor suppressor gene products. Methods: Immunohistochemistry, western blotting and in situ hybridization were used for WOX1 protein and WWOX mRNA expression. Immunofluorescence and electron microscopical immunohistochemistry were performed for colocalization of gene products. Results: WOX1 expression is low in normal cortical neurons, mainly on the axon fibers, whereas there is moderate to high immunoreactivity in the cytosol and nuclei of certain tumor cells. In the microcystic (WHO grade I) and malignant (WHO grade III) meningiomas, WOX1 expression is intense, but various in transitional (WHO grade I) and atypical (WHO grade II) subtypes. WOX1 levels are moderate to high in the menigiotheliomatous area, but relatively low in the fibroblastic area. WOX1 and NF2/merlin, but not p53, colocalized in certain tumor cells, primarily at the borders of nuclei. Schwannoma and astrocytoma specimens stained moderately to strongly positive for the WOX1 protein. Interestingly, the expression of WOX1, NF2/merlin and mutant p53 is intense in high grade glioblastoma, but WOX1 expression is low in metastatic carcinoma or adenocarcinoma. Conclusions: The expression of WOX1 on different types of nervous system tumors, including primary and metastatic tumors, is differential. PMID:24503545

  16. Evidence for an ergot alkaloid gene cluster in Claviceps purpurea.

    PubMed

    Tudzynski, P; Hölter, K; Correia, T; Arntz, C; Grammel, N; Keller, U

    1999-02-01

    A gene (cpd1) coding for the dimethylallyltryptophan synthase (DMATS) that catalyzes the first specific step in the biosynthesis of ergot alkaloids, was cloned from a strain of Claviceps purpurea that produces alkaloids in axenic culture. The derived gene product (CPD1) shows only 70% similarity to the corresponding gene previously isolated from Claviceps strain ATCC 26245, which is likely to be an isolate of C. fusiformis. Therefore, the related cpd1 most probably represents the first C. purpurea gene coding for an enzymatic step of the alkaloid biosynthetic pathway to be cloned. Analysis of the 3'-flanking region of cpd1 revealed a second, closely linked ergot alkaloid biosynthetic gene named cpps1, which codes for a 356-kDa polypeptide showing significant similarity to fungal modular peptide synthetases. The protein contains three amino acid-activating modules, and in the second module a sequence is found which matches that of an internal peptide (17 amino acids in length) obtained from a tryptic digest of lysergyl peptide synthetase 1 (LPS1) of C. purpurea, thus confirming that cpps1 encodes LPS1. LPS1 activates the three amino acids of the peptide portion of ergot peptide alkaloids during D-lysergyl peptide assembly. Chromosome walking revealed the presence of additional genes upstream of cpd1 which are probably also involved in ergot alkaloid biosynthesis: cpox1 probably codes for an FAD-dependent oxidoreductase (which could represent the chanoclavine cyclase), and a second putative oxidoreductase gene, cpox2, is closely linked to it in inverse orientation. RT-PCR experiments confirm that all four genes are expressed under conditions of peptide alkaloid biosynthesis. These results strongly suggest that at least some genes of ergot alkaloid biosynthesis in C. purpurea are clustered, opening the way for a detailed molecular genetic analysis of the pathway. PMID:10071219

  17. Automated resonance assignment of the 21 kDa stereo-array isotope labeled thioldisulfide oxidoreductase DsbA

    NASA Astrophysics Data System (ADS)

    Schmidt, Elena; Ikeya, Teppei; Takeda, Mitsuhiro; Löhr, Frank; Buchner, Lena; Ito, Yutaka; Kainosho, Masatsune; Güntert, Peter

    2014-12-01

    The automated chemical shift assignment algorithm FLYA has been extended for use with stereo-array isotope labeled (SAIL) proteins to determine the sequence-specific resonance assignments of large proteins. Here we present the assignment of the backbone and sidechain chemical shifts of the 21 kDa thioldisulfide oxidoreductase DsbA from Escherichia coli that were determined with the SAIL-FLYA algorithm in conjunction with automated peak picking. No manual corrections of peak lists or assignments were applied. The assignments agreed with manually determined reference assignments in 95.4% of the cases if 16 input spectra were used, 94.1% if only 3D 13C/15N-resolved NOESY, CBCA(CO)NH, and 2D [13C/15N,1H]-HSQC were used, and 86.8% if exclusively 3D 13C/15N-resolved NOESY spectra were used. Considering only the assignments that are classified as reliable by the SAIL-FLYA algorithm, the degrees of agreement increased to 97.5%, 96.5%, and 94.2%, respectively. With our approach it is thus possible to automatically obtain almost complete and correct assignments of proteins larger than 20 kDa.

  18. Insights into Flavin-based Electron Bifurcation via the NADH-dependent Reduced Ferredoxin:NADP Oxidoreductase Structure.

    PubMed

    Demmer, Julius K; Huang, Haiyan; Wang, Shuning; Demmer, Ulrike; Thauer, Rudolf K; Ermler, Ulrich

    2015-09-01

    NADH-dependent reduced ferredoxin:NADP oxidoreductase (NfnAB) is found in the cytoplasm of various anaerobic bacteria and archaea. The enzyme reversibly catalyzes the endergonic reduction of ferredoxin with NADPH driven by the exergonic transhydrogenation from NADPH onto NAD(+). Coupling is most probably accomplished via the mechanism of flavin-based electron bifurcation. To understand this process on a structural basis, we heterologously produced the NfnAB complex of Thermotoga maritima in Escherichia coli, provided kinetic evidence for its bifurcating behavior, and determined its x-ray structure in the absence and presence of NADH. The structure of NfnAB reveals an electron transfer route including the FAD (a-FAD), the [2Fe-2S] cluster of NfnA and the FAD (b-FAD), and the two [4Fe-4S] clusters of NfnB. Ferredoxin is presumably docked onto NfnB close to the [4Fe-4S] cluster distal to b-FAD. NAD(H) binds to a-FAD and NADP(H) consequently to b-FAD, which is positioned in the center of the NfnAB complex and the site of electron bifurcation. Arg(187) is hydrogen-bonded to N5 and O4 of the bifurcating b-FAD and might play a key role in adjusting a low redox potential of the FADH(•)/FAD pair required for ferredoxin reduction. A mechanism of FAD-coupled electron bifurcation by NfnAB is proposed. PMID:26139605

  19. Spectroscopic and kinetic characterization of the light-dependent enzyme protochlorophyllide oxidoreductase (POR) using monovinyl and divinyl substrates.

    PubMed

    Heyes, Derren J; Kruk, Jerzy; Hunter, C Neil

    2006-02-15

    The enzyme POR [Pchlide (protochlorophyllide) oxidoreductase] catalyses the reduction of Pchlide to chlorophyllide, which is a key step in the chlorophyll biosynthesis pathway. This light-dependent reaction has previously been studied in great detail but recent reports suggest that a mixture of MV (monovinyl) and DV (divinyl) Pchlides may have influenced some of these properties of the reaction. Low-temperature absorbance and fluorescence spectroscopy have revealed several spectral differences between MV and DV Pchlides, which were purified from a Rhodobacter capsulatus strain that was shown to contain a mixture of the two pigments. A thorough steady-state kinetic characterization using both Pchlide forms demonstrates that neither pigment appears to affect the kinetic properties of the enzyme. The reaction has also been monitored following illumination at low temperatures and was shown to consist of an initial photochemical step followed by four 'dark' steps for both pigments. However, minor differences were observed in the spectral properties of some of the intermediates, although the temperature dependency of each step was nearly identical for the two pigments. This work provides the first detailed kinetic and spectroscopic study of this unique enzyme using biologically important MV and DV substrate analogues. It also has significant implications for the DV reductase enzyme, which is responsible for converting DV pigments into their MV counterparts, and its position in the sequence of reactions that comprise the chlorophyll biosynthesis pathway. PMID:16274361

  20. Cryogenic and Laser Photoexcitation Studies Identify Multiple Roles for Active Site Residues in the Light-driven Enzyme Protochlorophyllide Oxidoreductase*

    PubMed Central

    Menon, Binuraj R. K.; Waltho, Jonathan P.; Scrutton, Nigel S.; Heyes, Derren J.

    2009-01-01

    The light-activated enzyme NADPH-protochlorophyllide oxidoreductase (POR) catalyzes the trans addition of hydrogen across the C-17–C-18 double bond of protochlorophyllide (Pchlide), a key step in chlorophyll biosynthesis. Similar to other members of the short chain alcohol dehydrogenase/reductase family of enzymes, POR contains a conserved Tyr and Lys residue in the enzyme active site, which are implicated in a proposed reaction mechanism involving proton transfer from the Tyr hydoxyl group to Pchlide. We have analyzed a number of POR variant enzymes altered in these conserved residues using a combination of steady-state turnover, laser photoexcitation studies, and low temperature fluorescence spectroscopy. None of the mutations completely abolished catalytic activity. We demonstrate their importance to catalysis by defining multiple roles in the overall reaction pathway. Mutation of either residue impairs formation of the ground state ternary enzyme-substrate complex, pointing to a key role in substrate binding. By analyzing the most active variant (Y193F), we show that Tyr-193 participates in proton transfer to Pchlide and stabilizes the Pchlide excited state, enabling hydride transfer from NADPH to Pchilde. Thus, in addition to confirming the probable identity of the proton donor in Pchlide reduction, our work defines additional roles for these residues in facilitating hydride transfer through stabilization of the ground and excited states of the ternary enzyme complex. PMID:19439417

  1. Computational investigation of the initial two-electron, two-proton steps in the reaction mechanism of hydroxylamine oxidoreductase.

    PubMed

    Attia, Amr A A; Silaghi-Dumitrescu, Radu

    2014-10-23

    Reported here is a computational study based on density functional theory that presents the first attempt to investigate the 2-electron 2-proton reaction of Fe(III)-H2NOH to Fe(III)-HNO in the catalytic cycle of hydroxylamine oxidoreductase-a multiheme-containing enzyme that catalyzes the conversion of hydroxylamine (HA) to nitrite in nitrifying bacteria. Two subsequent protonation events are proposed to initiate the process, of which the second is suggested to be concerted with a one-electron oxidation. The final one-electron oxidation is further proposed to be accompanied by a third deprotonation process, suggesting that Fe(III)-HNO may not be an isolable intermediate in the HAO catalytic cycle. Further explorations are suggested to be focused on the following steps in the catalytic cycle, the influence of the lateral substituents of the heme (and especially of the Cys and Tyr cross-links), the comparative study of hydrazine oxidation, the proton delivery network in the distal site and, possibly, on linkage isomerism. PMID:25277374

  2. A New Class of Tungsten-Containing Oxidoreductase in Caldicellulosiruptor, a Genus of Plant Biomass-Degrading Thermophilic Bacteria.

    PubMed

    Scott, Israel M; Rubinstein, Gabe M; Lipscomb, Gina L; Basen, Mirko; Schut, Gerrit J; Rhaesa, Amanda M; Lancaster, W Andrew; Poole, Farris L; Kelly, Robert M; Adams, Michael W W

    2015-10-15

    Caldicellulosiruptor bescii grows optimally at 78°C and is able to decompose high concentrations of lignocellulosic plant biomass without the need for thermochemical pretreatment. C. bescii ferments both C5 and C6 sugars primarily to hydrogen gas, lactate, acetate, and CO2 and is of particular interest for metabolic engineering applications given the recent availability of a genetic system. Developing optimal strains for technological use requires a detailed understanding of primary metabolism, particularly when the goal is to divert all available reductant (electrons) toward highly reduced products such as biofuels. During an analysis of the C. bescii genome sequence for oxidoreductase-type enzymes, evidence was uncovered to suggest that the primary redox metabolism of C. bescii has a completely uncharacterized aspect involving tungsten, a rarely used element in biology. An active tungsten utilization pathway in C. bescii was demonstrated by the heterologous production of a tungsten-requiring, aldehyde-oxidizing enzyme (AOR) from the hyperthermophilic archaeon Pyrococcus furiosus. Furthermore, C. bescii also contains a tungsten-based AOR-type enzyme, here termed XOR, which is phylogenetically unique, representing a completely new member of the AOR tungstoenzyme family. Moreover, in C. bescii, XOR represents ca. 2% of the cytoplasmic protein. XOR is proposed to play a key, but as yet undetermined, role in the primary redox metabolism of this cellulolytic microorganism. PMID:26276113

  3. Insights into MHC class I peptide loading from the structure of the Tapasin-ERp57 thiol oxidoreductase heterodimer

    SciTech Connect

    Dong, G.; Wearsch, P.A.; Peaper, D.R.; Cresswell, P.; Reinisch, K.M.

    2009-03-02

    Tapasin is a glycoprotein critical for loading major histocompatibility complex (MHC) class I molecules with high-affinity peptides. It functions within the multimeric peptide-loading complex (PLC) as a disulfide-linked, stable heterodimer with the thiol oxidoreductase ERp57, and this covalent interaction is required to support optimal PLC activity. Here, we present the 2.6 {angstrom} resolution structure of the tapasin-ERp57 core of the PLC. The structure revealed that tapasin interacts with both ERp57 catalytic domains, accounting for the stability of the heterodimer, and provided an example of a protein disulfide isomerase family member interacting with substrate. Mutational analysis identified a conserved surface on tapasin that interacted with MHC class I molecules and was critical for peptide loading and editing functions of the tapasin-ERp57 heterodimer. By combining the tapasin-ERp57 structure with those of other defined PLC components, we present a molecular model that illuminates the processes involved in MHC class I peptide loading.

  4. Collapse of the native structure caused by a single amino acid exchange in human NAD(P)H:quinone oxidoreductase

    PubMed Central

    Uhl, Michael K.; Binter, Alexandra; Pulido, Sergio A.; Saf, Robert; Zangger, Klaus; Gruber, Karl; Macheroux, Peter

    2015-01-01

    Human NAD(P)H:quinone oxidoreductase 1 (NQO1) is essential for the antioxidant defense system, stabilization of tumor suppressors (e.g. p53, p33, and p73), and activation of quinone-based chemotherapeutics. Overexpression of NQO1 in many solid tumors, coupled with its ability to convert quinone-based chemotherapeutics into potent cytotoxic compounds, have made it a very attractive target for anticancer drugs. A naturally occurring single-nucleotide polymorphism (C609T) leading to an amino acid exchange (P187S) has been implicated in the development of various cancers and poor survival rates following anthracyclin-based adjuvant chemotherapy. Despite its importance for cancer prediction and therapy, the exact molecular basis for the loss of function in NQO1 P187S is currently unknown. Therefore, we solved the crystal structure of NQO1 P187S. Surprisingly, this structure is almost identical to NQO1. Employing a combination of NMR spectroscopy and limited proteolysis experiments, we demonstrated that the single amino acid exchange destabilized interactions between the core and C-terminus, leading to depopulation of the native structure in solution. This collapse of the native structure diminished cofactor affinity and led to a less competent FAD-binding pocket, thus severely compromising the catalytic capacity of the variant protein. Hence, our findings provide a rationale for the loss of function in NQO1 P187S with a frequently occurring single-nucleotide polymorphism. PMID:25143260

  5. MHC Class II-Restricted Epitopes Containing an Oxidoreductase Activity Prompt CD4+ T Cells with Apoptosis-Inducing Properties

    PubMed Central

    Malek Abrahimians, Elin; Carlier, Vincent A.; Vander Elst, Luc; Saint-Remy, Jean-Marie R.

    2015-01-01

    Abrogating an unwanted immune response toward a specific antigen without compromising the entire immune system is a hoped-for goal in immunotherapy. Instead of manipulating dendritic cells and suppressive regulatory T cells, depleting effector T cells or blocking their co-stimulatory pathways, we describe a method to specifically inhibit the presentation of an antigen eliciting an unwanted immune reaction. Inclusion of an oxidoreductase motif within the flanking residues of MHC class II epitopes polarizes CD4+ T cells to cytolytic cells capable of inducing apoptosis in antigen presenting cells (APCs) displaying cognate peptides through MHC class II molecules. This novel function results from an increased synapse formation between both cells. Moreover, these cells eliminate by apoptosis bystander CD4+ T cells activated at the surface of the APC. We hypothesize that they would thereby block the recruitment of cells of alternative specificity for the same autoantigen or cells specific for another antigen associated with the pathology, providing a system by which response against multiple antigens linked with the same disease can be suppressed. These findings open the way toward a novel form of antigen-specific immunosuppression. PMID:26388872

  6. Crystallization of the NADH-oxidizing domain of the Na{sup +}-translocating NADH:ubiquinone oxidoreductase from Vibrio cholerae

    SciTech Connect

    Tao, Minli; Türk, Karin; Diez, Joachim; Grütter, Markus G.; Fritz, Günter; Steuber, Julia

    2006-02-01

    The FAD domain of the NqrF subunit from the Na{sup +}-translocating NADH dehydrogenase from V. cholerae has been purified and crystallized. A complete data set was recorded at 3.1 Å. The Na{sup +}-translocating NADH:quinone oxidoreductase (Na{sup +}-NQR) from pathogenic and marine bacteria is a respiratory complex that couples the exergonic oxidation of NADH by quinone to the transport of Na{sup +} across the membrane. The NqrF subunit oxidizes NADH and transfers the electrons to other redox cofactors in the enzyme. The FAD-containing domain of NqrF has been expressed, purified and crystallized. The purified NqrF FAD domain exhibited high rates of NADH oxidation and contained stoichiometric amounts of the FAD cofactor. Initial crystallization of the flavin domain was achieved by the sitting-drop technique using a Cartesian MicroSys4000 robot. Optimization of the crystallization conditions yielded yellow hexagonal crystals with dimensions of 30 × 30 × 70 µm. The protein mainly crystallizes in long hexagonal needles with a diameter of up to 30 µm. Crystals diffract to 2.8 Å and belong to space group P622, with unit-cell parameters a = b = 145.3, c = 90.2 Å, ? = ? = 90, ? = 120°.

  7. Dark-operative protochlorophyllide oxidoreductase generates substrate radicals by an iron-sulphur cluster in bacteriochlorophyll biosynthesis

    PubMed Central

    Nomata, Jiro; Kondo, Toru; Mizoguchi, Tadashi; Tamiaki, Hitoshi; Itoh, Shigeru; Fujita, Yuichi

    2014-01-01

    Photosynthesis converts solar energy to chemical energy using chlorophylls (Chls). In a late stage of biosynthesis of Chls, dark-operative protochlorophyllide (Pchlide) oxidoreductase (DPOR), a nitrogenase-like enzyme, reduces the C17 = C18 double bond of Pchlide and drastically changes the spectral properties suitable for photosynthesis forming the parental chlorin ring for Chl a. We previously proposed that the spatial arrangement of the proton donors determines the stereospecificity of the Pchlide reduction based on the recently resolved structure of the DPOR catalytic component, NB-protein. However, it was not clear how the two-electron and two-proton transfer events are coordinated in the reaction. In this study, we demonstrate that DPOR initiates a single electron transfer reaction from a [4Fe-4S]-cluster (NB-cluster) to Pchlide, generating Pchlide anion radicals followed by a single proton transfer, and then, further electron/proton transfer steps transform the anion radicals into chlorophyllide (Chlide). Thus, DPOR is a unique iron-sulphur enzyme to form substrate radicals followed by sequential proton- and electron-transfer steps with the protein folding very similar to that of nitrogenase. This novel radical-mediated reaction supports the biosynthesis of Chl in a wide variety of photosynthetic organisms. PMID:24965831

  8. The Crystal Structure and Mechanism of an Unusual Oxidoreductase, GilR, Involved in Gilvocarcin V Biosynthesis

    SciTech Connect

    Noinaj, Nicholas; Bosserman, Mary A.; Schickli, M. Alexandra; Piszczek, Grzegorz; Kharel, Madan K.; Pahari, Pallab; Buchanan, Susan K.; Rohr, Jürgen

    2012-11-26

    GilR is a recently identified oxidoreductase that catalyzes the terminal step of gilvocarcin V biosynthesis and is a unique enzyme that establishes the lactone core of the polyketide-derived gilvocarcin chromophore. Gilvocarcin-type compounds form a small distinct family of anticancer agents that are involved in both photo-activated DNA-alkylation and histone H3 cross-linking. High resolution crystal structures of apoGilR and GilR in complex with its substrate pregilvocarcin V reveals that GilR belongs to the small group of a relatively new type of the vanillyl-alcohol oxidase flavoprotein family characterized by bicovalently tethered cofactors. GilR was found as a dimer, with the bicovalently attached FAD cofactor mediated through His-65 and Cys-125. Subsequent mutagenesis and functional assays indicate that Tyr-445 may be involved in reaction catalysis and in mediating the covalent attachment of FAD, whereas Tyr-448 serves as an essential residue initiating the catalysis by swinging away from the active site to accommodate binding of the 6R-configured substrate and consequently abstracting the proton of the hydroxyl residue of the substrate hemiacetal 6-OH group. These studies lay the groundwork for future enzyme engineering to broaden the substrate specificity of this bottleneck enzyme of the gilvocarcin biosynthetic pathway for the development of novel anti-cancer therapeutics.

  9. Reference genes for gene expression studies in wheat flag leaves grown under different farming conditions

    PubMed Central

    2011-01-01

    Background Internal control genes with highly uniform expression throughout the experimental conditions are required for accurate gene expression analysis as no universal reference genes exists. In this study, the expression stability of 24 candidate genes from Triticum aestivum cv. Cubus flag leaves grown under organic and conventional farming systems was evaluated in two locations in order to select suitable genes that can be used for normalization of real-time quantitative reverse-transcription PCR (RT-qPCR) reactions. The genes were selected among the most common used reference genes as well as genes encoding proteins involved in several metabolic pathways. Findings Individual genes displayed different expression rates across all samples assayed. Applying geNorm, a set of three potential reference genes were suitable for normalization of RT-qPCR reactions in winter wheat flag leaves cv. Cubus: TaFNRII (ferredoxin-NADP(H) oxidoreductase; AJ457980.1), ACT2 (actin 2; TC234027), and rrn26 (a putative homologue to RNA 26S gene; AL827977.1). In addition of these three genes that were also top-ranked by NormFinder, two extra genes: CYP18-2 (Cyclophilin A, AY456122.1) and TaWIN1 (14-3-3 like protein, AB042193) were most consistently stably expressed. Furthermore, we showed that TaFNRII, ACT2, and CYP18-2 are suitable for gene expression normalization in other two winter wheat varieties (Tommi and Centenaire) grown under three treatments (organic, conventional and no nitrogen) and a different environment than the one tested with cv. Cubus. Conclusions This study provides a new set of reference genes which should improve the accuracy of gene expression analyses when using wheat flag leaves as those related to the improvement of nitrogen use efficiency for cereal production. PMID:21951810

  10. Tropine Forming Tropinone Reductase Gene from Withania somnifera (Ashwagandha): Biochemical Characteristics of the Recombinant Enzyme and Novel Physiological Overtones of Tissue-Wide Gene Expression Patterns

    PubMed Central

    Kushwaha, Amit Kumar; Sangwan, Neelam Singh; Trivedi, Prabodh Kumar; Negi, Arvind Singh; Misra, Laxminarain; Sangwan, Rajender Singh

    2013-01-01

    Withania somnifera is one of the most reputed medicinal plants of Indian systems of medicine synthesizing diverse types of secondary metabolites such as withanolides, alkaloids, withanamides etc. Present study comprises cloning and E. coli over-expression of a tropinone reductase gene (WsTR-I) from W. somnifera, and elucidation of biochemical characteristics and physiological role of tropinone reductase enzyme in tropane alkaloid biosynthesis in aerial tissues of the plant. The recombinant enzyme was demonstrated to catalyze NADPH-dependent tropinone to tropine conversion step in tropane metabolism, through TLC, GC and GC-MS-MS analyses of the reaction product. The functionally active homodimeric ?60 kDa enzyme catalyzed the reaction in reversible manner at optimum pH 6.7. Catalytic kinetics of the enzyme favoured its forward reaction (tropine formation). Comparative 3-D models of landscape of the enzyme active site contours and tropinone binding site were also developed. Tissue-wide and ontogenic stage-wise assessment of WsTR-I transcript levels revealed constitutive expression of the gene with relatively lower abundance in berries and young leaves. The tissue profiles of WsTR-I expression matched those of tropine levels. The data suggest that, in W. somnifera, aerial tissues as well possess tropane alkaloid biosynthetic competence. In vivo feeding of U-[14C]-sucrose to orphan shoot (twigs) and [14C]-chasing revealed substantial radiolabel incorporation in tropinone and tropine, confirming the de novo synthesizing ability of the aerial tissues. This inherent independent ability heralds a conceptual novelty in the backdrop of classical view that these tissues acquire the alkaloids through transportation from roots rather than synthesis. The TR-I gene expression was found to be up-regulated on exposure to signal molecules (methyl jasmonate and salicylic acid) and on mechanical injury. The enzyme's catalytic and structural properties as well as gene expression profiles are discussed with respect to their physiological overtones. PMID:24086372

  11. Genes and Gene Therapy

    MedlinePLUS

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  12. Cytochrome P450 Oxidoreductase Influences CYP2B6 Activity in Cyclophosphamide Bioactivation

    PubMed Central

    El-Serafi, Ibrahim; Afsharian, Parvaneh; Moshfegh, Ali; Hassan, Moustapha; Terelius, Ylva

    2015-01-01

    Introduction Cyclophosphamide is commonly used as an important component in conditioning prior to hematopoietic stem cell transplantation, a curative treatment for several hematological diseases. Cyclophosphamide is a prodrug activated mainly by cytochrome P450 2B6 (CYP2B6) in the liver. A high degree of inter- and intra-individual variation in cyclophosphamide kinetics has been reported in several studies. Materials and Methods Hydroxylation of cyclophosphamide was investigated in vitro using three microsomal batches of CYP2B6*1 with different ratios of POR/CYP expression levels. Twenty patients undergoing hematopoietic stem cell transplantation were also included in the study. All patients received an i.v. infusion of cyclophosphamide (60 mg/kg/day, for two days) as a part of their conditioning. Blood samples were collected from each patient before cyclophosphamide infusion, 6 h after the first dose and before and 6 h after the second dose. POR gene expression was measured by mRNA analysis and the pharmacokinetics of cyclophosphamide and its active metabolite were determined. Results A strong correlation between the in vitro intrinsic clearance of cyclophosphamide and the POR/CYP ratio was found. The apparent Km for CYP2B6.1 was almost constant (3-4 mM), while the CLint values were proportional to the POR/CYP ratio (3-34 ?L/min/nmol CYP). In patients, the average expression of the POR gene in blood was significantly (P <0.001) up-regulated after cyclophosphamide infusion, with high inter-individual variations and significant correlation with the concentration ratio of the active metabolite 4-hydroxy-cyclophosphamide/cyclophosphamide. Nine patients were carriers for POR*28; four patients had relatively high POR expression. Conclusions This investigation shows for the first time that POR besides CYP2B6 can influence cyclophosphamide metabolism. Our results indicate that not only CYPs are important, but also POR expression and/or activity may influence cyclophosphamide bioactivation, affecting therapeutic efficacy and treatment related toxicity and hence on clinical outcome. Thus, both POR and CYP genotype and expression levels may have to be taken into account when personalizing treatment schedules to achieve optimal therapeutic drug plasma concentrations of cyclophosphamide. PMID:26544874

  13. Genetic evidence for NAD(P)H:quinone oxidoreductase 1-catalyzed quinone reduction on passage through the mouse pulmonary circulation

    PubMed Central

    Lindemer, Brian J.; Bongard, Robert D.; Hoffmann, Raymond; Baumgardt, Shelley; Gonzalez, Frank J.

    2011-01-01

    The quinones duroquinone (DQ) and coenzyme Q1 (CoQ1) and quinone reductase inhibitors have been used to identify reductases involved in quinone reduction on passage through the pulmonary circulation. In perfused rat lung, NAD(P)H:quinone oxidoreductase 1 (NQO1) was identified as the predominant DQ reductase and NQO1 and mitochondrial complex I as the CoQ1 reductases. Since inhibitors have nonspecific effects, the goal was to use Nqo1-null (NQO1?/?) mice to evaluate DQ as an NQO1 probe in the lung. Lung homogenate cytosol NQO1 activities were 97 ± 11, 54 ± 6, and 5 ± 1 (SE) nmol dichlorophenolindophenol reduced·min?1·mg protein?1 for NQO1+/+, NQO1+/?, and NQO1?/? lungs, respectively. Intact lung quinone reduction was evaluated by infusion of DQ (50 ?M) or CoQ1 (60 ?M) into the pulmonary arterial inflow of the isolated perfused lung and measurement of pulmonary venous effluent hydroquinone (DQH2 or CoQ1H2). DQH2 efflux rates for NQO1+/+, NQO1+/?, and NQO1?/? lungs were 0.65 ± 0.08, 0.45 ± 0.04, and 0.13 ± 0.05 (SE) ?mol·min?1·g dry lung?1, respectively. DQ reduction in NQO1+/+ lungs was inhibited by 90 ± 4% with dicumarol; there was no inhibition in NQO1?/? lungs. There was no significant difference in CoQ1H2 efflux rates for NQO1+/+ and NQO1?/? lungs. Differences in DQ reduction were not due to differences in lung dry weights, wet-to-dry weight ratios, perfusion pressures, perfused surface areas, or total DQ recoveries. The data provide genetic evidence implicating DQ as a specific NQO1 probe in the perfused rodent lung. PMID:21296895

  14. Antiparasitic drug nitazoxanide inhibits the pyruvate oxidoreductases of Helicobacter pylori, selected anaerobic bacteria and parasites, and Campylobacter jejuni.

    PubMed

    Hoffman, Paul S; Sisson, Gary; Croxen, Matthew A; Welch, Kevin; Harman, W Dean; Cremades, Nunilo; Morash, Michael G

    2007-03-01

    Nitazoxanide (NTZ) exhibits broad-spectrum activity against anaerobic bacteria and parasites and the ulcer-causing pathogen Helicobacter pylori. Here we show that NTZ is a noncompetitive inhibitor (K(i), 2 to 10 microM) of the pyruvate:ferredoxin/flavodoxin oxidoreductases (PFORs) of Trichomonas vaginalis, Entamoeba histolytica, Giardia intestinalis, Clostridium difficile, Clostridium perfringens, H. pylori, and Campylobacter jejuni and is weakly active against the pyruvate dehydrogenase of Escherichia coli. To further mechanistic studies, the PFOR operon of H. pylori was cloned and overexpressed in E. coli, and the multisubunit complex was purified by ion-exchange chromatography. Pyruvate-dependent PFOR activity with NTZ, as measured by a decrease in absorbance at 418 nm (spectral shift from 418 to 351 nm), unlike the reduction of viologen dyes, did not result in the accumulation of products (acetyl coenzyme A and CO(2)) and pyruvate was not consumed in the reaction. NTZ did not displace the thiamine pyrophosphate (TPP) cofactor of PFOR, and the 351-nm absorbing form of NTZ was inactive. Optical scans and (1)H nuclear magnetic resonance analyses determined that the spectral shift (A(418) to A(351)) of NTZ was due to protonation of the anion (NTZ(-)) of the 2-amino group of the thiazole ring which could be generated with the pure compound under acidic solutions (pK(a) = 6.18). We propose that NTZ(-) intercepts PFOR at an early step in the formation of the lactyl-TPP transition intermediate, resulting in the reversal of pyruvate binding prior to decarboxylation and in coordination with proton transfer to NTZ. Thus, NTZ might be the first example of an antimicrobial that targets the "activated cofactor" of an enzymatic reaction rather than its substrate or catalytic sites, a novel mechanism that may escape mutation-based drug resistance. PMID:17158936

  15. Antiparasitic Drug Nitazoxanide Inhibits the Pyruvate Oxidoreductases of Helicobacter pylori, Selected Anaerobic Bacteria and Parasites, and Campylobacter jejuni?

    PubMed Central

    Hoffman, Paul S.; Sisson, Gary; Croxen, Matthew A.; Welch, Kevin; Harman, W. Dean; Cremades, Nunilo; Morash, Michael G.

    2007-01-01

    Nitazoxanide (NTZ) exhibits broad-spectrum activity against anaerobic bacteria and parasites and the ulcer-causing pathogen Helicobacter pylori. Here we show that NTZ is a noncompetitive inhibitor (Ki, 2 to 10 ?M) of the pyruvate:ferredoxin/flavodoxin oxidoreductases (PFORs) of Trichomonas vaginalis, Entamoeba histolytica, Giardia intestinalis, Clostridium difficile, Clostridium perfringens, H. pylori, and Campylobacter jejuni and is weakly active against the pyruvate dehydrogenase of Escherichia coli. To further mechanistic studies, the PFOR operon of H. pylori was cloned and overexpressed in E. coli, and the multisubunit complex was purified by ion-exchange chromatography. Pyruvate-dependent PFOR activity with NTZ, as measured by a decrease in absorbance at 418 nm (spectral shift from 418 to 351 nm), unlike the reduction of viologen dyes, did not result in the accumulation of products (acetyl coenzyme A and CO2) and pyruvate was not consumed in the reaction. NTZ did not displace the thiamine pyrophosphate (TPP) cofactor of PFOR, and the 351-nm absorbing form of NTZ was inactive. Optical scans and 1H nuclear magnetic resonance analyses determined that the spectral shift (A418 to A351) of NTZ was due to protonation of the anion (NTZ?) of the 2-amino group of the thiazole ring which could be generated with the pure compound under acidic solutions (pKa = 6.18). We propose that NTZ? intercepts PFOR at an early step in the formation of the lactyl-TPP transition intermediate, resulting in the reversal of pyruvate binding prior to decarboxylation and in coordination with proton transfer to NTZ. Thus, NTZ might be the first example of an antimicrobial that targets the “activated cofactor” of an enzymatic reaction rather than its substrate or catalytic sites, a novel mechanism that may escape mutation-based drug resistance. PMID:17158936

  16. Phylogenomic Analysis and Predicted Physiological Role of the Proton-Translocating NADH:Quinone Oxidoreductase (Complex I) Across Bacteria

    PubMed Central

    Spero, Melanie A.; Aylward, Frank O.; Currie, Cameron R.

    2015-01-01

    ABSTRACT The proton-translocating NADH:quinone oxidoreductase (complex I) is a multisubunit integral membrane enzyme found in the respiratory chains of both bacteria and eukaryotic organelles. Although much research has focused on the enzyme’s central role in the mitochondrial respiratory chain, comparatively little is known about its role in the diverse energetic lifestyles of different bacteria. Here, we used a phylogenomic approach to better understand the distribution of complex I across bacteria, the evolution of this enzyme, and its potential roles in shaping the physiology of different bacterial groups. By surveying 970 representative bacterial genomes, we predict complex I to be present in ~50% of bacteria. While this includes bacteria with a wide range of energetic schemes, the presence of complex I is associated with specific lifestyles, including aerobic respiration and specific types of phototrophy (bacteria with only a type II reaction center). A phylogeny of bacterial complex I revealed five main clades of enzymes whose evolution is largely congruent with the evolution of the bacterial groups that encode complex I. A notable exception includes the gammaproteobacteria, whose members encode one of two distantly related complex I enzymes predicted to participate in different types of respiratory chains (aerobic versus anaerobic). Comparative genomic analyses suggest a broad role for complex I in reoxidizing NADH produced from various catabolic reactions, including the tricarboxylic acid (TCA) cycle and fatty acid beta-oxidation. Together, these findings suggest diverse roles for complex I across bacteria and highlight the importance of this enzyme in shaping diverse physiologies across the bacterial domain. PMID:25873378

  17. The Iron-Sulfur Cluster of Electron Transfer Flavoprotein-Ubiquinone Oxidoreductase Is the Electron Acceptor for Electron Transfer Flavoprotein†

    PubMed Central

    Swanson, Michael A.; Usselman, Robert J.; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

    2009-01-01

    Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) accepts electrons from electron transfer flavoprotein (ETF) and reduces ubiquinone from the ubiquinone pool. It contains one [4Fe-4S]2+,1+ and one FAD, which are diamagnetic in the isolated oxidized enzyme and can be reduced to paramagnetic forms by enzymatic donors or dithionite. In the porcine protein, threonine 367 is hydrogen bonded to N1 and O2 of the flavin ring of the FAD. The analogous site in Rhodobacter sphaeroides ETF-QO is asparagine 338. Mutations N338T and N338A were introduced into the R. sphaeroides protein by site-directed mutagenesis to determine the impact of hydrogen bonding at this site on redox potentials and activity. The mutations did not alter the optical spectra, EPR g-values, spin-lattice relaxation rates, or the [4Fe-4S]2+,1+ to FAD point-dipole interspin distances. The mutations had no impact on the reduction potential for the iron-sulfur cluster, which was monitored by changes in the continuous wave EPR signals of the [4Fe-4S]+ at 15 K. For the FAD semiquinone, significantly different potentials were obtained by monitoring the titration at 100 or 293 K. Based on spectra at 293 K the N338T mutation shifted the first and second midpoint potentials for the FAD from +47 and -30 mV for wild type to -11 and -19 mV, respectively. The N338A mutation decreased the potentials to -37 and -49 mV. Lowering the midpoint potentials resulted in a decrease in the quinone reductase activity and negligible impact on disproportionation of ETF1e- catalyzed by ETF-QO. These observations indicate that the FAD is involved in electron transfer to ubiquinone but not in electron transfer from ETF to ETF-QO. Therefore, the iron-sulfur cluster is the immediate acceptor from ETF. PMID:9585549

  18. Dispelling dogma and misconceptions regarding the most pharmacologically targetable source of reactive species in inflammatory disease, xanthine oxidoreductase.

    PubMed

    Kelley, Eric E

    2015-08-01

    Xanthine oxidoreductase (XOR), the molybdoflavin enzyme responsible for the terminal steps of purine degradation in humans, is also recognized as a significant source of reactive species contributory to inflammatory disease. In animal models and clinical studies, inhibition of XOR has resulted in diminution of symptoms and enhancement of function in a number of pathologies including heart failure, diabetes, sickle cell anemia, hypertension and ischemia-reperfusion injury. For decades, XOR involvement in pathologic processes has been established by salutary outcomes attained from treatment with the XOR inhibitor allopurinol. This has served to frame a working dogma that elevation of XOR-specific activity is associated with enhanced rates of reactive species generation that mediate negative outcomes. While adherence to this narrowly focused practice of designating elevated XOR activity to be "bad" has produced some benefit, it has also led to significant underdevelopment of the processes mediating XOR regulation, identification of alternative reactants and products as well as micro-environmental factors that alter enzymatic activity. This is exemplified by recent reports: (1) identifying XOR as a nitrite reductase and thus a source of beneficial nitric oxide ((•)NO) under in vivo conditions similar to those where XOR inhibition has been assumed an optimal treatment choice, (2) describing XOR-derived uric acid (UA) as a critical pro-inflammatory mediator in vascular and metabolic disease and (3) ascribing an antioxidant/protective role for XOR-derived UA. When taken together, these proposed and countervailing functions of XOR affirm the need for a more comprehensive evaluation of product formation as well as the factors that govern product identity. As such, this review will critically evaluate XOR-catalyzed oxidant, (•)NO and UA formation as well as identify factors that mediate their production, inhibition and the resultant impact on inflammatory disease. PMID:25995007

  19. Deletion of P399{sub E}401 in NADPH cytochrome P450 oxidoreductase results in partial mixed oxidase deficiency

    SciTech Connect

    Flueck, Christa E.; Mallet, Delphine; Hofer, Gaby; Samara-Boustani, Dinane; Leger, Juliane; Polak, Michel; Morel, Yves; Pandey, Amit V.

    2011-09-09

    Highlights: {yields} Mutations in human POR cause congenital adrenal hyperplasia. {yields} We are reporting a novel 3 amino acid deletion mutation in POR P399{sub E}401del. {yields} POR mutation P399{sub E}401del decreased P450 activities by 60-85%. {yields} Impairment of steroid metabolism may be caused by multiple hits. {yields} Severity of aromatase inhibition is related to degree of in utero virilization. -- Abstract: P450 oxidoreductase (POR) is the electron donor for all microsomal P450s including steroidogenic enzymes CYP17A1, CYP19A1 and CYP21A2. We found a novel POR mutation P399{sub E}401del in two unrelated Turkish patients with 46,XX disorder of sexual development. Recombinant POR proteins were produced in yeast and tested for their ability to support steroid metabolizing P450 activities. In comparison to wild-type POR, the P399{sub E}401del protein was found to decrease catalytic efficiency of 21-hydroxylation of progesterone by 68%, 17{alpha}-hydroxylation of progesterone by 76%, 17,20-lyase action on 17OH-pregnenolone by 69%, aromatization of androstenedione by 85% and cytochrome c reduction activity by 80%. Protein structure analysis of the three amino acid deletion P399{sub E}401 revealed reduced stability and flexibility of the mutant. In conclusion, P399{sub E}401del is a novel mutation in POR that provides valuable genotype-phenotype and structure-function correlation for mutations in a different region of POR compared to previous studies. Characterization of P399{sub E}401del provides further insight into specificity of different P450s for interaction with POR as well as nature of metabolic disruptions caused by more pronounced effect on specific P450s like CYP17A1 and aromatase.

  20. Substrate-specific modulation of CYP3A4 activity by genetic variants of cytochrome P450 oxidoreductase (POR)

    PubMed Central

    Agrawal, Vishal; Choi, Ji Ha; Giacomini, Kathleen M.; Miller, Walter L.

    2010-01-01

    Objectives CYP3A4 receives electrons from P450 oxidoreductase (POR) to metabolize about 50% of clinically used drugs. There is substantial inter-individual variation in CYP3A4 catalytic activity that is not explained by CYP3A4 genetic variants. CYP3A4 is flexible and distensible, permitting it to accommodate substrates varying in shape and size. To elucidate mechanisms of variability in CYP3A4 catalysis, we examined the effects of genetic variants of POR, and explored the possibility that substrate-induced conformational changes in CYP3A4 differentially affect the ability of POR variants to support catalysis. Methods We expressed human CYP3A4 and four POR variants (Q153R, A287P, R457H, A503V) in bacteria, reconstituted them in vitro and measured the Michaelis constant and maximum velocity with testosterone, midazolam, quinidine and erythromycin as substrates. Results POR A287P and R457H had low activity with all substrates; Q153R had 76–94% of wild type (WT) activity with midazolam and erythromycin, but 129–150% activity with testosterone and quinidine. The A503V polymorphism reduced CYP3A4 activity to 61–77% of wild type with testosterone and midazolam, but had nearly wild type activity with quinidine and erythromycin. Conclusion POR variants affect CYP3A4 activities. The impact of a POR variant on catalysis by CYP3A4 is substrate-specific, probably due to substrate-induced conformational changes in CYP3A4. PMID:20697309

  1. Modulation of biofilm-formation in Salmonella enterica serovar Typhimurium by the periplasmic DsbA/DsbB oxidoreductase system requires the GGDEF-EAL domain protein STM3615.

    PubMed

    Anwar, Naeem; Rouf, Syed Fazle; Römling, Ute; Rhen, Mikael

    2014-01-01

    In Salmonella enterica serovar Typhimurium (S. Typhimurium), biofilm-formation is controlled by the cytoplasmic intracellular small-molecular second messenger cyclic 3', 5'-di- guanosine monophosphate (c-di-GMP) through the activities of GGDEF and EAL domain proteins. Here we describe that deleting either dsbA or dsbB, respectively encoding a periplasmic protein disulfide oxidase and a cytoplasmic membrane disulfide oxidoreductase, resulted in increased biofilm-formation on solid medium. This increased biofilm-formation, defined as a red, dry and rough (rdar) colony morphotype, paralleled with enhanced expression of the biofilm master regulator CsgD and the biofilm-associated fimbrial subunit CsgA. Deleting csgD in either dsb mutant abrogated the enhanced biofilm-formation. Likewise, overexpression of the c-di-GMP phosphodiesterase YhjH, or mutationally inactivating the CsgD activator EAL-domain protein YdiV, reduced biofilm-formation in either of the dsb mutants. Intriguingly, deleting the GGDEF-EAL domain protein gene STM3615 (yhjK), previously not connected to rdar morphotype development, also abrogated the escalated rdar morphotype formation in dsb mutant backgrounds. Enhanced biofilm-formation in dsb mutants was furthermore annulled by exposure to the protein disulfide catalyst copper chloride. When analyzed for the effect of exogenous reducing stress on biofilm-formation, both dsb mutants initially showed an escalated rdar morphotype development that later dissolved to reveal a smooth mucoid colony morphotype. From these results we conclude that biofilm-development in S. Typhimurium is affected by periplasmic protein disulphide bond status through CsgD, and discuss the involvement of selected GGDEF/EAL domain protein(s) as signaling mediators. PMID:25153529

  2. Q-band ENDOR spectra of the Rieske protein from Rhodobacter capsulatus ubiquinol-cyctochrome c oxidoreductase show two histidines coordinated to the (2Fe-2S) cluster

    SciTech Connect

    Gurbiel, R.J. Jagiellonian Univ., Krakow ); Ohnishi, Tomoko; Robertson, D.E.; Daldal, F. ); Hoffman, B.M. )

    1991-12-10

    Electron nuclear double resonance (ENDOR) experiments were performed on {sup 14}N (natural abundance) and {sup 15}N-enriched iron-sulfur Rieske protein in the ubiquinol-cytochrome c{sub 2} oxidoreductase from Rhodobactor capsulatus. The experiments proved that two distinct nitrogenous ligands, histidines, are undoubtedly ligated to the Rieske (2Fe-2S) center. The calculations of hyperfine tensors give values similar but not identical to those of the Rieske-type cluster in phthalate dioxygenase of Pseudomonas cepacia and suggest a slightly different geometry of the iron-sulfur cluster in the two proteins.

  3. The yeast Saccharomyces cerevisiae contains two glutaredoxin genes that are required for protection against reactive oxygen species.

    PubMed

    Luikenhuis, S; Perrone, G; Dawes, I W; Grant, C M

    1998-05-01

    Glutaredoxins are small heat-stable proteins that act as glutathione-dependent disulfide oxidoreductases. Two genes, designated GRX1 and GRX2, which share 40-52% identity and 61-76% similarity with glutaredoxins from bacterial and mammalian species, were identified in the yeast Saccharomyces cerevisiae. Strains deleted for both GRX1 and GRX2 were viable but lacked heat-stable oxidoreductase activity using beta-hydroxyethylene disulfide as a substrate. Surprisingly, despite the high degree of homology between Grx1 and Grx2 (64% identity), the grx1 mutant was unaffected in oxidoreductase activity, whereas the grx2 mutant displayed only 20% of the wild-type activity, indicating that Grx2 accounted for the majority of this activity in vivo. Expression analysis indicated that this difference in activity did not arise as a result of differential expression of GRX1 and GRX2. In addition, a grx1 mutant was sensitive to oxidative stress induced by the superoxide anion, whereas a strain that lacked GRX2 was sensitive to hydrogen peroxide. Sensitivity to oxidative stress was not attributable to altered glutathione metabolism or cellular redox state, which did not vary between these strains. The expression of both genes was similarly elevated under various stress conditions, including oxidative, osmotic, heat, and stationary phase growth. Thus, Grx1 and Grx2 function differently in the cell, and we suggest that glutaredoxins may act as one of the primary defenses against mixed disulfides formed following oxidative damage to proteins. PMID:9571241

  4. Molecular Characterization of an NADPH-Dependent Acetoin Reductase/2,3-Butanediol Dehydrogenase from Clostridium beijerinckii NCIMB 8052

    PubMed Central

    Raedts, John; Siemerink, Marco A. J.; Levisson, Mark; van der Oost, John

    2014-01-01

    Acetoin reductase is an important enzyme for the fermentative production of 2,3-butanediol, a chemical compound with a very broad industrial use. Here, we report on the discovery and characterization of an acetoin reductase from Clostridium beijerinckii NCIMB 8052. An in silico screen of the C. beijerinckii genome revealed eight potential acetoin reductases. One of them (CBEI_1464) showed substantial acetoin reductase activity after expression in Escherichia coli. The purified enzyme (C. beijerinckii acetoin reductase [Cb-ACR]) was found to exist predominantly as a homodimer. In addition to acetoin (or 2,3-butanediol), other secondary alcohols and corresponding ketones were converted as well, provided that another electronegative group was attached to the adjacent C-3 carbon. Optimal activity was at pH 6.5 (reduction) and 9.5 (oxidation) and around 68°C. Cb-ACR accepts both NADH and NADPH as electron donors; however, unlike closely related enzymes, NADPH is preferred (Km, 32 ?M). Cb-ACR was compared to characterized close homologs, all belonging to the “threonine dehydrogenase and related Zn-dependent dehydrogenases” (COG1063). Metal analysis confirmed the presence of 2 Zn2+ atoms. To gain insight into the substrate and cofactor specificity, a structural model was constructed. The catalytic zinc atom is likely coordinated by Cys37, His70, and Glu71, while the structural zinc site is probably composed of Cys100, Cys103, Cys106, and Cys114. Residues determining NADP specificity were predicted as well. The physiological role of Cb-ACR in C. beijerinckii is discussed. PMID:24441158

  5. Eicosanoids up-regulate production of reactive oxygen species by NADPH-dependent oxidase in Spodoptera exigua phagocytic hemocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Eicosanoids mediate cellular immune responses in insects, including phagocytosis of invading microbes. Phagocytosis entails two major steps, the internalization of microbes and the subsequent killing of them via formation of reactive oxygen species (ROS). Here, we posed the hypothesis that eicosanoi...

  6. Overexpression of Arabidopsis NADPH-dependent thioredoxin reductase C (AtNTRC) confers freezing and cold shock tolerance to plants.

    PubMed

    Moon, Jeong Chan; Lee, Sangmin; Shin, Su Young; Chae, Ho Byoung; Jung, Young Jun; Jung, Hyun Suk; Lee, Kyun Oh; Lee, Jung Ro; Lee, Sang Yeol

    2015-08-01

    Overexpression of AtNTRC (AtNTRC(OE)) in Arabidopsis thaliana led to a freezing and cold stress tolerance, whereas a knockout mutant (atntrc) showed a stress-sensitive phenotype. Biochemical analyses showed that the recombinant AtNTRC proteins exhibited a cryoprotective activity for malate dehydrogenase and lactic dehydrogenase. Furthermore, conclusive evidence of its interaction with nucleic acids in vitro is provided here on the basis of gel shift and electron microscopy analysis. Recombinant AtNTRC efficiently protected RNA and DNA from RNase A and metal catalyzed oxidation damage, respectively. The C-terminal thioredoxin domain is required for the nucleic acid-protein complex formation. From these results, it can be hypothesized that AtNTRC, which is known to be an electron donor of peroxiredoxin, contributes the stability of macromolecules under cold stress. PMID:26086110

  7. Human carbonyl reductase (CBR) localized to band 21q22. 1 by high-resolution fluorescence in situ hybridization displays gene dosage effects in trisomy 21 cells

    SciTech Connect

    Lemieux, N. ); Malfoy, B. ); Forrest, G.L. )

    1993-01-01

    Human carbonyl reductase (CBR) belongs to a group of NADPH-dependent enzymes called aldo-keto reductases. The enzyme can function as an aldo-keto reductase or as a quinone reductase with potential for modulating quinone-mediated oxygen free radicals. The CBR gene was mapped by high-resolution fluorescence in situ hybridization to band 21q22.12, very close to the SOD1 locus at position 2lq22.11. CBR displayed gene dosage effects in trisomy 21 human lymphoblasts at the DNA and mRNA levels. Lymphoblasts with increasing chromosome 21 ploidy also showed increased aldo-keto reductase activity and increased quinone reductase activity. Both aldo-keto reductase activity and quinone reductase activity have been shown to be associated with carbonyl reductase. The location of CBR near SOD1 and the increased enzyme activity and potential for free radical modulation in trisomy 21 cells implicate CBR as a candidate for contributing to the pathology of certain diseases such as Down syndrome and Alzheimer disease. 28 refs., 1 fig., 1 tab.

  8. Functional and Bioinformatics Analysis of Two Campylobacter jejuni Homologs of the Thiol-Disulfide Oxidoreductase, DsbA

    PubMed Central

    Grabowska, Anna D.; Wywia?, Ewa; Dunin-Horkawicz, Stanislaw; ?asica, Anna M.; Wösten, Marc M. S. M.; Nagy-Staro?, Anna; Godlewska, Renata; Bocian-Ostrzycka, Katarzyna; Pie?kowska, Katarzyna; ?aniewski, Pawe?; Bujnicki, Janusz M.; van Putten, Jos P. M.; Jagusztyn-Krynicka, E. Katarzyna

    2014-01-01

    Background Bacterial Dsb enzymes are involved in the oxidative folding of many proteins, through the formation of disulfide bonds between their cysteine residues. The Dsb protein network has been well characterized in cells of the model microorganism Escherichia coli. To gain insight into the functioning of the Dsb system in epsilon-Proteobacteria, where it plays an important role in the colonization process, we studied two homologs of the main Escherichia coli Dsb oxidase (EcDsbA) that are present in the cells of the enteric pathogen Campylobacter jejuni, the most frequently reported bacterial cause of human enteritis in the world. Methods and Results Phylogenetic analysis suggests the horizontal transfer of the epsilon-Proteobacterial DsbAs from a common ancestor to gamma-Proteobacteria, which then gave rise to the DsbL lineage. Phenotype and enzymatic assays suggest that the two C. jejuni DsbAs play different roles in bacterial cells and have divergent substrate spectra. CjDsbA1 is essential for the motility and autoagglutination phenotypes, while CjDsbA2 has no impact on those processes. CjDsbA1 plays a critical role in the oxidative folding that ensures the activity of alkaline phosphatase CjPhoX, whereas CjDsbA2 is crucial for the activity of arylsulfotransferase CjAstA, encoded within the dsbA2-dsbB-astA operon. Conclusions Our results show that CjDsbA1 is the primary thiol-oxidoreductase affecting life processes associated with bacterial spread and host colonization, as well as ensuring the oxidative folding of particular protein substrates. In contrast, CjDsbA2 activity does not affect the same processes and so far its oxidative folding activity has been demonstrated for one substrate, arylsulfotransferase CjAstA. The results suggest the cooperation between CjDsbA2 and CjDsbB. In the case of the CjDsbA1, this cooperation is not exclusive and there is probably another protein to be identified in C. jejuni cells that acts to re-oxidize CjDsbA1. Altogether the data presented here constitute the considerable insight to the Epsilonproteobacterial Dsb systems, which have been poorly understood so far. PMID:25181355

  9. Characterization of Escherichia coli thioredoxin variants mimicking the active-sites of other thiol/disulfide oxidoreductases.

    PubMed Central

    Mössner, E.; Huber-Wunderlich, M.; Glockshuber, R.

    1998-01-01

    Thiol/disulfide oxidoreductases like thioredoxin, glutaredoxin, DsbA, or protein disulfide isomerase (PDI) share the thioredoxin fold and a catalytic disulfide bond with the sequence Cys-Xaa-Xaa-Cys (Xaa corresponds to any amino acid). Despite their structural similarities, the enzymes have very different redox properties, which is reflected by a 100,000-fold difference in the equilibrium constant (K(eq)) with glutathione between the most oxidizing member, DsbA, and the most reducing member, thioredoxin. Here we present a systematic study on a series of variants of thioredoxin from Escherichia coli, in which the Xaa-Xaa dipeptide was exchanged by that of glutaredoxin, PDI, and DsbA. Like the corresponding natural enzymes, all thioredoxin variants proved to be stronger oxidants than the wild-type, with the order wild-type < PDI-type < DsbA-type < glutaredoxin-type. The most oxidizing, glutaredoxin-like variant has a 420-fold decreased value of K(eq), corresponding to an increase in redox potential by 75 mV. While oxidized wild-type thioredoxin is more stable than the reduced form (delta deltaG(ox/red) = 16.9 kJ/mol), both redox forms have almost the same stability in the variants. The pH-dependence of the reactivity with the alkylating agent iodoacetamide proved to be the best method to determine the pKa value of thioredoxin's nucleophilic active-site thiol (Cys32). A pKa of 7.1 was measured for Cys32 in the reduced wild-type. All variants showed a lowered pKa of Cys32, with the lowest value of 5.9 for the glutaredoxin-like variant. A correlation of redox potential and the Cys32 pKa value could be established on a quantitative level. However, the predicted correlation between the measured delta deltaG(ox/red) values and Cys32 pKa values was only qualitative. PMID:9605329

  10. Directed Evolution and Resolution Mechanism of 1, 3-Propanediol Oxidoreductase from Klebsiella pneumoniae toward Higher Activity by Error-Prone PCR and Bioinformatics

    PubMed Central

    Jiang, Wei; Zhuang, Yuan; Wang, Shizhen; Fang, Baishan

    2015-01-01

    1, 3-propanediol oxidoreductase (PDOR) is a key enzyme in glycerol bioconversion to 1,3-propanediol (1, 3-PD) which is a valuable chemical and one of the six new petrochemical products. We used error-prone PCR and activity screening to identify mutants of Klebsiella pneumoniae (K. pneumoniae) PDOR with improved activity. The activity of one of the identified mutants, PDOR’-24, which includes a single mutation, A199S, was 48 U/mg, 4.9 times that of the wild-type enzyme. Molecular docking was performed to analyze the identified mutants; and amino acids S103, H271, N366, D106, N262 and D364 were predicted to bond with NADH. The origins of the improved activity of PDOR’-24, as well as three other mutants were analyzed by simulating the interaction mechanism of the mutants with the substrate and coenzyme, respectively. This research provides useful information about the use of safranine O plate screening for the directed evolution of oxidoreductases, identifies interesting sites for improving PDOR activity, and demonstrates the utility of using molecular docking to analyze the interaction mechanism of the mutants with the substrate and coenzyme, respectively. PMID:26528716

  11. Investigation of protein FTT1103 electroactivity using carbon and mercury electrodes. Surface-inhibition approach for disulfide oxidoreductases using silver amalgam powder.

    PubMed

    Ve?erková, Renata; Hernychová, Lenka; Dobeš, Petr; Vrba, Ji?í; Josyp?uk, Bohdan; Bartošík, Martin; Vacek, Jan

    2014-06-01

    Recently, it was shown that electrochemical methods can be used for analysis of poorly water-soluble proteins and for study of their structural changes and intermolecular (protein-ligand) interactions. In this study, we focused on complex electrochemical investigation of recombinant protein FTT1103, a disulfide oxidoreductase with structural similarity to well described DsbA proteins. This thioredoxin-like periplasmic lipoprotein plays an important role in virulence of bacteria Francisella tularensis. For electrochemical analyses, adsorptive transfer (ex situ) square-wave voltammetry with pyrolytic graphite electrode, and alternating-current voltammetry and constant-current chronopotentiometric stripping analysis with mercury electrodes, including silver solid amalgam electrode (AgSAE) were used. AgSAE was used in poorly water-soluble protein analysis for the first time. In addition to basic redox, electrocatalytic and adsorption/desorption characterization of FTT1103, electrochemical methods were also used for sensitive determination of the protein at nanomolar level and study of its interaction with surface of AgSA microparticles. Proposed electrochemical protocol and AgSA surface-inhibition approach presented here could be used in future for biochemical studies focused on proteins associated with membranes as well as on those with disulfide oxidoreductase activity. PMID:24856508

  12. Redox-activated expression of the cytosolic copper/zinc superoxide dismutase gene in Nicotiana.

    PubMed Central

    Hérouart, D; Van Montagu, M; Inzé, D

    1993-01-01

    Superoxide dismutases (SODs; superoxide: superoxide oxidoreductase, EC 1.15.1.1) play a key role in protection against oxygen radicals, and SOD gene expression is highly induced during environmental stress. To determine the conditions of SOD induction, the promoter of the cytosolic copper/zinc SOD (Cu/ZnSODcyt) gene was isolated in Nicotiana plumbaginifolia and fused to the beta-glucuronidase reporter gene. Oxidative stress is likely to alter the cellular redox in favor of the oxidized status. Surprisingly, the expression of the Cu/ZnSODcyt gene is induced by sulfhydryl antioxidants such as reduced glutathione, cysteine, and dithiothreitol, whereas the oxidized forms of glutathione and cysteine have no effect. It is therefore possible that reduced glutathione directly acts as an antioxidant and simultaneously activates the Cu/ZnSODcyt gene during oxidative stress. Images Fig. 2 PMID:8464930

  13. Influence of Populus Genotype on Gene Expression by the Wood Decay Fungus Phanerochaete chrysosporium

    PubMed Central

    Gaskell, Jill; Marty, Amber; Mozuch, Michael; Kersten, Philip J.; Splinter BonDurant, Sandra; Sabat, Grzegorz; Azarpira, Ali; Ralph, John; Skyba, Oleksandr; Mansfield, Shawn D.; Blanchette, Robert A.

    2014-01-01

    We examined gene expression patterns in the lignin-degrading fungus Phanerochaete chrysosporium when it colonizes hybrid poplar (Populus alba × tremula) and syringyl (S)-rich transgenic derivatives. A combination of microarrays and liquid chromatography-tandem mass spectrometry (LC-MS/MS) allowed detection of a total of 9,959 transcripts and 793 proteins. Comparisons of P. chrysosporium transcript abundance in medium containing poplar or glucose as a sole carbon source showed 113 regulated genes, 11 of which were significantly higher (>2-fold, P < 0.05) in transgenic line 64 relative to the parental line. Possibly related to the very large amounts of syringyl (S) units in this transgenic tree (94 mol% S), several oxidoreductases were among the upregulated genes. Peptides corresponding to a total of 18 oxidoreductases were identified in medium consisting of biomass from line 64 or 82 (85 mol% S) but not in the parental clone (65 mol% S). These results demonstrate that P. chrysosporium gene expression patterns are substantially influenced by lignin composition. PMID:25015893

  14. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

    PubMed Central

    DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

    2015-01-01

    The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

  15. Identification of pathways, gene networks and paralogous gene families in Daphnia pulex responding to exposure to the toxic cyanobacterium Microcystis aeruginosa

    PubMed Central

    Asselman, Jana; De Coninck, Dieter IM; Glaholt, Stephen; Colbourne, John K; Janssen, Colin R; Shaw, Joseph R; De Schamphelaere, Karel AC

    2013-01-01

    Although cyanobacteria produce a wide range of natural toxins that impact aquatic organisms, food webs and water quality, the mechanisms of toxicity are still insufficiently understood. Here, we implemented a whole-genome expression microarray to identify pathways, gene networks and paralogous gene families responsive to Microcystis stress in Daphnia pulex. Therefore, neonates of a sensitive isolate were given a diet contaminated with Microcystis to contrast with those given a control diet for sixteen days. The microarray revealed 2247 differentially expressed (DE) genes (7.6% of the array) in response to Microcystis, of which 17% are lineage specific( i.e., these genes have no detectable homology to any other gene in currently available databases) and 49% are gene duplicates (paralogs). We identified four pathways/gene networks and eight paralogous gene families affected by Microcystis. Differential regulation of the ribosome, including 3 paralogous gene families encoding 40S, 60S and mitochondrial ribosomal proteins, suggests an impact of Microcystis on protein synthesis of D. pulex. In addition, differential regulation of the oxidative phosphorylation pathway (including the NADH ubquinone oxidoreductase gene family) and the trypsin paralogous gene family (a major component of the digestive system in D. pulex) could explain why fitness is reduced based on energy budget considerations. PMID:22799445

  16. Chloroplast lipid droplet type II NAD(P)H quinone oxidoreductase is essential for prenylquinone metabolism and vitamin K1 accumulation.

    PubMed

    Eugeni Piller, Lucia; Besagni, Céline; Ksas, Brigitte; Rumeau, Dominique; Bréhélin, Claire; Glauser, Gaétan; Kessler, Felix; Havaux, Michel

    2011-08-23

    Lipid droplets are ubiquitous cellular structures in eukaryotes and are required for lipid metabolism. Little is currently known about plant lipid droplets other than oil bodies. Here, we define dual roles for chloroplast lipid droplets (plastoglobules) in energy and prenylquinone metabolism. The prenylquinones--plastoquinone, plastochromanol-8, phylloquinone (vitamin K(1)), and tocopherol (vitamin E)--are partly stored in plastoglobules. This work shows that NAD(P)H dehydrogenase C1 (NDC1) (At5g08740), a type II NAD(P)H quinone oxidoreductase, associates with plastoglobules. NDC1 reduces a plastoquinone analog in vitro and affects the overall redox state of the total plastoquinone pool in vivo by reducing the plastoquinone reservoir of plastoglobules. Finally, NDC1 is required for normal plastochromanol-8 accumulation and is essential for vitamin K(1) production. PMID:21844348

  17. Chloroplast lipid droplet type II NAD(P)H quinone oxidoreductase is essential for prenylquinone metabolism and vitamin K1 accumulation

    PubMed Central

    Eugeni Piller, Lucia; Besagni, Céline; Ksas, Brigitte; Rumeau, Dominique; Bréhélin, Claire; Glauser, Gaétan; Kessler, Felix; Havaux, Michel

    2011-01-01

    Lipid droplets are ubiquitous cellular structures in eukaryotes and are required for lipid metabolism. Little is currently known about plant lipid droplets other than oil bodies. Here, we define dual roles for chloroplast lipid droplets (plastoglobules) in energy and prenylquinone metabolism. The prenylquinones—plastoquinone, plastochromanol-8, phylloquinone (vitamin K1), and tocopherol (vitamin E)—are partly stored in plastoglobules. This work shows that NAD(P)H dehydrogenase C1 (NDC1) (At5g08740), a type II NAD(P)H quinone oxidoreductase, associates with plastoglobules. NDC1 reduces a plastoquinone analog in vitro and affects the overall redox state of the total plastoquinone pool in vivo by reducing the plastoquinone reservoir of plastoglobules. Finally, NDC1 is required for normal plastochromanol-8 accumulation and is essential for vitamin K1 production. PMID:21844348

  18. A secondary mode of action of polymyxins against Gram-negative bacteria involves the inhibition of NADH-quinone oxidoreductase activity

    PubMed Central

    Deris, Zakuan Z.; Akter, Jesmin; Sivanesan, Sivashangarie; Roberts, Kade D.; Thompson, Philip E.; Nation, Roger L.; Li, Jian; Velkov, Tony

    2013-01-01

    Polymyxin B and colistin were examined for their ability to inhibit the type II NADH-quinone oxidoreductases (NDH-2) of three species of Gram-negative bacteria. Polymyxin B and colistin inhibited the NDH-2 activity in preparations from all of the isolates in a concentration-dependent manner. The mechanism of NDH-2 inhibition by polymyxin B was investigated in detail with E. coli inner membrane preparations and conformed to a mixed inhibition model with respect to ubiquinone-1 and a non-competitive inhibition model with respect to NADH. These suggest inhibition of vital respiratory enzymes in the bacterial inner membrane represents one of the secondary modes of action for polymyxins. PMID:24169795

  19. A light-dependent complementation system for analysis of NADPH:protochlorophyllide oxidoreductase: Identification and mutagenesis of two conserved residues that are essential for enzyme activity

    SciTech Connect

    Wilks, H.M.; Timko, M.P.

    1995-01-31

    Protochlorophyllide reductase (NADPH:protochlorophyllide oxidoreductase; EC 1.6.99.1) catalyzes the light-dependent reduction of protochlorophyllide to chlorophyllide, a key regulatory step in the chlorophyll biosynthetic pathway. We have developed an expression system in which the protochlorophyllide reductase from pea (Pisum sativum L.) is used to complement protochlorophyllide reduction mutants in the photosynthetic bacterium Rhodobacter capsulatus, allowing analysis of wild-type and mutant forms of the enzyme. By protein sequence comparisons, we have identified the plant protochlorophyllide reductases as belonging to the family of short-chain alcohol dehydrogenases. Based on our protein sequence alignments, we have identified and mutated two conserved residues (Tyr-275 and Lys-279) within the proposed active site of the enzyme and shown that they are critical for activity. A model of the enzyme reaction mechanism for light-dependent protochlorophyllide reduction is proposed. 33 refs., 5 figs.

  20. Time-lapse anomalous X-ray diffraction shows how Fe(2+) substrate ions move through ferritin protein nanocages to oxidoreductase sites.

    PubMed

    Pozzi, Cecilia; Di Pisa, Flavio; Lalli, Daniela; Rosa, Camilla; Theil, Elizabeth; Turano, Paola; Mangani, Stefano

    2015-04-01

    Ferritin superfamily protein cages reversibly synthesize internal biominerals, Fe2O3·H2O. Fe(2+) and O2 (or H2O2) substrates bind at oxidoreductase sites in the cage, initiating biomineral synthesis to concentrate iron and prevent potentially toxic reactions products from Fe(2+)and O2 or H2O2 chemistry. By freezing ferritin crystals of Rana catesbeiana ferritin M (RcMf) at different time intervals after exposure to a ferrous salt, a series of high-resolution anomalous X-ray diffraction data sets were obtained that led to crystal structures that allowed the direct observation of ferrous ions entering, moving along and binding at enzyme sites in the protein cages. The ensemble of crystal structures from both aerobic and anaerobic conditions provides snapshots of the iron substrate bound at different cage locations that vary with time. The observed differential occupation of the two iron sites in the enzyme oxidoreductase centre (with Glu23 and Glu58, and with Glu58, His61 and Glu103 as ligands, respectively) and other iron-binding sites (with Glu53, His54, Glu57, Glu136 and Asp140 as ligands) reflects the approach of the Fe(2+) substrate and its progression before the enzymatic cycle 2Fe(2+) + O2 ? Fe(3+)-O-O-Fe(3+) ? Fe(3+)-O(H)-Fe(3+) and turnover. The crystal structures also revealed different Fe(2+) coordination compounds bound to the ion channels located at the threefold and fourfold symmetry axes of the cage. PMID:25849404

  1. Omeprazole induces NAD(P)H quinone oxidoreductase 1 via aryl hydrocarbon receptor-independent mechanisms: Role of the transcription factor nuclear factor erythroid 2-related factor 2.

    PubMed

    Zhang, Shaojie; Patel, Ananddeep; Moorthy, Bhagavatula; Shivanna, Binoy

    2015-11-13

    Activation of the aryl hydrocarbon receptor (AhR) transcriptionally induces phase I (cytochrome P450 (CYP) 1A1) and phase II (NAD(P)H quinone oxidoreductase 1 (NQO1) detoxifying enzymes. The effects of the classical and nonclassical AhR ligands on phase I and II enzymes are well studied in human hepatocytes. Additionally, we observed that the proton pump inhibitor, omeprazole (OM), transcriptionally induces CYP1A1 in the human adenocarcinoma cell line, H441 cells via AhR. Whether OM activates AhR and induces the phase II enzyme, NAD(P)H quinone oxidoreductase 1 (NQO1), in fetal primary human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce NQO1 in HPMEC via the AhR. The concentrations of OM used in our experiments did not result in cytotoxicity. OM activated AhR as evident by increased CYP1A1 mRNA expression. However, contrary to our hypothesis, OM increased NQO1 mRNA and protein via an AhR-independent mechanism as AhR knockdown failed to abrogate OM-mediated increase in NQO1 expression. Interestingly, OM activated Nrf2 as evident by increased phosphoNrf2 (S40) expression in OM-treated compared to vehicle-treated cells. Furthermore, Nrf2 knockdown abrogated OM-mediated increase in NQO1 expression. In conclusion, we provide evidence that OM induces NQO1 via AhR-independent, but Nrf2-dependent mechanisms. PMID:26441083

  2. Studying Genes

    MedlinePLUS

    ... Area What are genes? Genes are sections of DNA that contain instructions for making the molecules—many ... material in an organism. This includes genes and DNA elements that control the activity of genes. Does ...

  3. Recombinant expression of four oxidoreductases in Phanerochaete chrysosporium improves degradation of phenolic and non-phenolic substrates.

    PubMed

    Coconi-Linares, Nancy; Ortiz-Vázquez, Elizabeth; Fernández, Francisco; Loske, Achim M; Gómez-Lim, Miguel A

    2015-09-10

    Phanerochaete chrysosporium belongs to a group of lignin-degrading fungi that secretes various oxidoreductive enzymes, including lignin peroxidase (LiP) and manganese peroxidase (MnP). Previously, we demonstrated that the heterologous expression of a versatile peroxidase (VP) in P. chrysosporium recombinant strains is possible. However, the production of laccases (Lac) in this fungus has not been completely demonstrated and remains controversial. In order to investigate if the co-expression of Lac and VP in P. chrysosporium would improve the degradation of phenolic and non-phenolic substrates, we tested the constitutive co-expression of the lacIIIb gene from Trametes versicolor and the vpl2 gene from Pleurotus eryngii, and also the endogenous genes mnp1 and lipH8 by shock wave mediated transformation. The co-overexpression of peroxidases and laccases was improved up to five-fold as compared with wild type species. Transformant strains showed a broad spectrum in phenolic/non-phenolic biotransformation and a high percentage in synthetic dye decolorization in comparison with the parental strain. Our results show that the four enzymes can be constitutively expressed in a single transformant of P. chrysosporium in minimal medium. These data offer new possibilities for an easy and efficient co-expression of laccases and peroxidases in suitable basidiomycete species. PMID:26113215

  4. The thioredoxin system of Penicillium chrysogenum and its possible role in penicillin biosynthesis.

    PubMed Central

    Cohen, G; Argaman, A; Schreiber, R; Mislovati, M; Aharonowitz, Y

    1994-01-01

    Penicillium chrysogenum is an important producer of penicillin antibiotics. A key step in their biosynthesis is the oxidative cyclization of delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine (ACV) to isopenicillin N by the enzyme isopenicillin N synthase (IPNS). bis-ACV, the oxidized disulfide form of ACV is, however, not a substrate for IPNS. We report here the characterization of a broad-range disulfide reductase from P. chrysogenum that efficiently reduces bis-ACV to the thiol monomer. When coupled in vitro with IPNS, it converts bis-ACV to isopenicillin N and may therefore play a role in penicillin biosynthesis. The disulfide reductase consists of two protein components, a 72-kDa NADPH-dependent reductase, containing two identical subunits, and a 12-kDa general disulfide reductant. The latter reduces disulfide bonds in low-molecular-weight compounds and in proteins. The genes coding for the reductase system were cloned and sequenced. Both possess introns. A comparative analysis of their predicted amino acid sequences showed that the 12-kDa protein shares 26 to 60% sequence identity with thioredoxins and that the 36-kDa protein subunit shares 44 to 49% sequence identity with the two known bacterial thioredoxin reductases. In addition, the P. chrysogenum NADPH-dependent reductase is able to accept thioredoxin as a substrate. These results establish that the P. chrysogenum broad-range disulfide reductase is a member of the thioredoxin family of oxidoreductases. This is the first example of the cloning of a eucaryotic thioredoxin reductase gene. Images PMID:8106340

  5. High-Level Chromate Resistance in Arthrobacter sp. strain FB24 Requires Previously Uncharacterized Accessory Genes

    SciTech Connect

    Henne, Kristene L.; Nakatsu, Cindy N.; Thompson, Dorothea K.; Konopka, Allan

    2009-09-24

    The annotated genome sequence of Arthrobacter sp. strain FB24 revealed a chromate resistance determinant (CRD): a cluster of 8 genes located on a 10.6 kb fragment of a 96 kb plasmid. The CRD includes chrA, which encodes a putative chromate efflux protein, and three genes with amino acid similarities to the amino and carboxy termini of ChrB, a putative regulatory protein. There are also three novel genes that have not been previously associated with chromate resistance in other bacteria; they encode an oxidoreductase (most similar to malate:quinone oxidoreductase), a functionally unknown protein with a WD40 repeat domain and a lipoprotein. A chromate-sensitive mutant (strain D11) was generated by curing FB24 of its 96-kb plasmid. Elemental analysis indicated that chromate-exposed cells of strain D11 accumulated three times more chromium than strain FB24. Introduction of the CRD into strain D11 conferred chromate resistance comparable to wild-type levels, whereas deletion of specific regions of the CRD led to decreased resistance. Using real-time reverse transcriptase PCR, we show that expression of each gene within the CRD is specifically induced in response to chromate but not by lead, hydrogen peroxide or arsenate. Higher levels of chrA expression were achieved when the chrB orthologs and the WD40 repeat domain genes were present, suggesting their regulatory roles. Collectively, our findings indicate that chromate resistance in strain FB24 is primarily achieved by plasmid-mediated chromate efflux with the contribution of previously unrecognized accessory genes.

  6. Electron microscopic analysis and structural characterization of novel NADP(H)-containing methanol: N,N'-dimethyl-4-nitrosoaniline oxidoreductases from the gram-positive methylotrophic bacteria Amycolatopsis methanolica and Mycobacterium gastri MB19.

    PubMed Central

    Bystrykh, L V; Vonck, J; van Bruggen, E F; van Beeumen, J; Samyn, B; Govorukhina, N I; Arfman, N; Duine, J A; Dijkhuizen, L

    1993-01-01

    The quaternary protein structure of two methanol:N,N'-dimethyl-4-nitrosoaniline (NDMA) oxidoreductases purified from Amycolatopsis methanolica and Mycobacterium gastri MB19 was analyzed by electron microscopy and image processing. The enzymes are decameric proteins (displaying fivefold symmetry) with estimated molecular masses of 490 to 500 kDa based on their subunit molecular masses of 49 to 50 kDa. Both methanol:NDMA oxidoreductases possess a tightly but noncovalently bound NADP(H) cofactor at an NADPH-to-subunit molar ratio of 0.7. These cofactors are redox active toward alcohol and aldehyde substrates. Both enzymes contain significant amounts of Zn2+ and Mg2+ ions. The primary amino acid sequences of the A. methanolica and M. gastri MB19 methanol:NDMA oxidoreductases share a high degree of identity, as indicated by N-terminal sequence analysis (63% identity among the first 27 N-terminal amino acids), internal peptide sequence analysis, and overall amino acid composition. The amino acid sequence analysis also revealed significant similarity to a decameric methanol dehydrogenase of Bacillus methanolicus C1. Images PMID:8449887

  7. Novel insights into structure-function mechanism and tissue-specific expression profiling of full-length dxr gene from Cymbopogon winterianus.

    PubMed

    Devi, Kamalakshi; Dehury, Budheswar; Phukon, Munmi; Modi, Mahendra Kumar; Sen, Priyabrata

    2015-01-01

    The 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR; EC1.1.1.267), an NADPH-dependent reductase, plays a pivotal role in the methylerythritol 4-phosphate pathway (MEP), in the conversion of 1-deoxy-d-xylulose-5-phosphate (DXP) into MEP. The sheath and leaf of citronella (Cymbopogon winterianus) accumulates large amount of terpenes and sesquiterpenes with proven medicinal value and economic uses. Thus, sequencing of full length dxr gene and its characterization seems to be a valuable resource in metabolic engineering to alter the flux of isoprenoid active ingredients in plants. In this study, full length DXR from citronella was characterized through in silico and tissue-specific expression studies to explain its structure-function mechanism, mode of cofactor recognition and differential expression. The modelled DXR has a three-domain architecture and its active site comprised of a cofactor (NADPH) binding pocket and the substrate-binding pocket. Molecular dynamics simulation studies indicated that DXR model retained most of its secondary structure during 10 ns simulation in aqueous solution. The modelled DXR superimposes well with its closest structural homolog but subtle variations in the charge distribution over the cofactor recognition site were noticed. Molecular docking study revealed critical residues aiding tight anchoring NADPH within the active pocket of DXR. Tissue-specific differential expression analysis using semi-quantitative RT-PCR and qRT-PCR in various tissues of citronella plant revealed distinct differential expression of DXR. To our knowledge, this is the first ever report on DXR from the important medicinal plant citronella and further characterization of this gene will open up better avenues for metabolic engineering of secondary metabolite pathway genes from medicinal plants in the near future. PMID:25941629

  8. Structure-Based Computational Study of Two Disease Resistance Gene Homologues (Hm1 and Hm2) in Maize (Zea mays L.) with Implications in Plant-Pathogen Interactions

    PubMed Central

    Maharana, Jitendra; Sahu, Jagajjit; Sen, Priyabrata; Modi, Mahendra Kumar; Choudhury, Manabendra Dutta; Barooah, Madhumita

    2014-01-01

    The NADPH-dependent HC-toxin reductases (HCTR1 and 2) encoded by enzymatic class of disease resistance homologous genes (Hm1 and Hm2) protect maize by detoxifying a cyclic tetrapeptide, HC-toxin, secreted by the fungus Cochliobolus carbonum race 1(CCR1). Unlike the other classes' resistance (R) genes, HCTR-mediated disease resistance is an inimitable mechanism where the avirulence (Avr) component from CCR1 is not involved in toxin degradation. In this study, we attempted to decipher cofactor (NADPH) recognition and mode of HC-toxin binding to HCTRs through molecular docking, molecular dynamics (MD) simulations and binding free energy calculation methods. The rationality and the stability of docked complexes were validated by 30-ns MD simulation. The binding free energy decomposition of enzyme-cofactor complex was calculated to find the driving force behind cofactor recognition. The overall binding free energies of HCTR1-NADPH and HCTR2-NADPH were found to be ?616.989 and ?16.9749 kJ mol?1 respectively. The binding free energy decomposition revealed that the binding of NADPH to the HCTR1 is mainly governed by van der Waals and nonpolar interactions, whereas electrostatic terms play dominant role in stabilizing the binding mode between HCTR2 and NADPH. Further, docking analysis of HC-toxin with HCTR-NADPH complexes showed a distinct mode of binding and the complexes were stabilized by a strong network of hydrogen bond and hydrophobic interactions. This study is the first in silico attempt to unravel the biophysical and biochemical basis of cofactor recognition in enzymatic class of R genes in cereal crop maize. PMID:24847713

  9. Novel insights into structure–function mechanism and tissue-specific expression profiling of full-length dxr gene from Cymbopogon winterianus

    PubMed Central

    Devi, Kamalakshi; Dehury, Budheswar; Phukon, Munmi; Modi, Mahendra Kumar; Sen, Priyabrata

    2015-01-01

    The 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR; EC1.1.1.267), an NADPH-dependent reductase, plays a pivotal role in the methylerythritol 4-phosphate pathway (MEP), in the conversion of 1-deoxy-d-xylulose-5-phosphate (DXP) into MEP. The sheath and leaf of citronella (Cymbopogon winterianus) accumulates large amount of terpenes and sesquiterpenes with proven medicinal value and economic uses. Thus, sequencing of full length dxr gene and its characterization seems to be a valuable resource in metabolic engineering to alter the flux of isoprenoid active ingredients in plants. In this study, full length DXR from citronella was characterized through in silico and tissue-specific expression studies to explain its structure–function mechanism, mode of cofactor recognition and differential expression. The modelled DXR has a three-domain architecture and its active site comprised of a cofactor (NADPH) binding pocket and the substrate-binding pocket. Molecular dynamics simulation studies indicated that DXR model retained most of its secondary structure during 10 ns simulation in aqueous solution. The modelled DXR superimposes well with its closest structural homolog but subtle variations in the charge distribution over the cofactor recognition site were noticed. Molecular docking study revealed critical residues aiding tight anchoring NADPH within the active pocket of DXR. Tissue-specific differential expression analysis using semi-quantitative RT-PCR and qRT-PCR in various tissues of citronella plant revealed distinct differential expression of DXR. To our knowledge, this is the first ever report on DXR from the important medicinal plant citronella and further characterization of this gene will open up better avenues for metabolic engineering of secondary metabolite pathway genes from medicinal plants in the near future. PMID:25941629

  10. The MoxR ATPase RavA and Its Cofactor ViaA Interact with the NADH:Ubiquinone Oxidoreductase I in Escherichia coli

    PubMed Central

    Wong, Keith S.; Snider, Jamie D.; Graham, Chris; Greenblatt, Jack F.; Emili, Andrew; Babu, Mohan; Houry, Walid A.

    2014-01-01

    MoxR ATPases are widespread throughout bacteria and archaea. The experimental evidence to date suggests that these proteins have chaperone-like roles in facilitating the maturation of dedicated protein complexes that are functionally diverse. In Escherichia coli, the MoxR ATPase RavA and its putative cofactor ViaA are found to exist in early stationary-phase cells at 37°C at low levels of about 350 and 90 molecules per cell, respectively. Both proteins are predominantly localized to the cytoplasm, but ViaA was also unexpectedly found to localize to the cell membrane. Whole genome microarrays and synthetic lethality studies both indicated that RavA-ViaA are genetically linked to Fe-S cluster assembly and specific respiratory pathways. Systematic analysis of mutant strains of ravA and viaA indicated that RavA-ViaA sensitizes cells to sublethal concentrations of aminoglycosides. Furthermore, this effect was dependent on RavA's ATPase activity, and on the presence of specific subunits of NADH:ubiquinone oxidoreductase I (Nuo Complex, or Complex I). Importantly, both RavA and ViaA were found to physically interact with specific Nuo subunits. We propose that RavA-ViaA facilitate the maturation of the Nuo complex. PMID:24454883

  11. Steady-state kinetic mechanism of the proline:ubiquinone oxidoreductase activity of proline utilization A (PutA) from Escherichia coli.

    PubMed

    Moxley, Michael A; Tanner, John J; Becker, Donald F

    2011-12-15

    The multifunctional proline utilization A (PutA) flavoenzyme from Escherichia coli performs the oxidation of proline to glutamate in two catalytic steps using separate proline dehydrogenase (PRODH) and ?(1)-pyrroline-5-carboxylate (P5C) dehydrogenase domains. In the first reaction, the oxidation of proline is coupled to the reduction of ubiquinone (CoQ) by the PRODH domain, which has a ?(8)?(8)-barrel structure that is conserved in bacterial and eukaryotic PRODH enzymes. The structural requirements of the benzoquinone moiety were examined by steady-state kinetics using CoQ analogs. PutA displayed activity with all the analogs tested; the highest k(cat)/K(m) was obtained with CoQ(2). The kinetic mechanism of the PRODH reaction was investigated use a variety of steady-state approaches. Initial velocity patterns measured using proline and CoQ(1), combined with dead-end and product inhibition studies, suggested a two-site ping-pong mechanism for PutA. The kinetic parameters for PutA were not strongly influenced by solvent viscosity suggesting that diffusive steps do not significantly limit the overall reaction rate. In summary, the kinetic data reported here, along with analysis of the crystal structure data for the PRODH domain, suggest that the proline:ubiquinone oxidoreductase reaction of PutA occurs via a rapid equilibrium ping-pong mechanism with proline and ubiquinone binding at two distinct sites. PMID:22040654

  12. Steady-State Kinetic Mechanism of the Proline:Ubiquinone Oxidoreductase Activity of Proline Utilization A (PutA) from Escherichia coli

    PubMed Central

    Moxley, Michael A.; Tanner, John J.; Becker, Donald F.

    2011-01-01

    The multifunctional proline utilization A (PutA) flavoenzyme from Escherichia coli performs the oxidation of proline to glutamate in two catalytic steps using separate proline dehydrogenase (PRODH) and ?1-pyrroline-5-carboxylate (P5C) dehydrogenase domains. In the first reaction, the oxidation of proline is coupled to the reduction of ubiquinone (CoQ) by the PRODH domain, which has a ?8?8-barrel structure that is conserved in bacterial and eukaryotic PRODH enzymes. The structural requirements of the benzoquinone moiety were examined by steady-state kinetics using CoQ analogs. PutA displayed activity with all the analogs tested; the highest kcat/Km was obtained with CoQ2. The kinetic mechanism of the PRODH reaction was investigated use a variety of steady-state approaches. Initial velocity patterns measured using proline and CoQ1, combined with dead-end and product inhibition studies, suggested a two-site ping-pong mechanism for PutA. The kinetic parameters for PutA were not strongly influenced by solvent viscosity suggesting that diffusive steps do not significantly limit the overall reaction rate. In summary, the kinetic data reported here, along with analysis of the crystal structure data for the PRODH domain, suggest that the proline:ubiquinone oxidoreductase reaction of PutA occurs via a rapid equilibrium ping-pong mechanism with proline and ubiquinone binding at two distinct sites. PMID:22040654

  13. Mycobacterium tuberculosis Type II NADH-Menaquinone Oxidoreductase Catalyzes Electron Transfer through a Two-Site Ping-Pong Mechanism and Has Two Quinone-Binding Sites

    PubMed Central

    2015-01-01

    Type II NADH-quinone oxidoreductase (NDH-2) catalyzes the transfer electrons from NADH to the quinone pool and plays an essential role in the oxidative phosphorylation system of Mycobacterium tuberculosis (Mtb). The absence of NDH-2 in the mammalian mitochondrial electron transport chain makes this enzyme an attractive target for antibiotic development. To fully establish the kinetic properties of this enzyme, we studied the interaction of Mtb NDH-2 with substrates, NADH, and various quinone analogues and their products in both membrane and soluble environments. These studies, and comparative analyses of the kinetics with thio-NAD+ and quinone electron acceptors, provided evidence that Mtb NDH-2 catalyzes the transfer electrons from NADH to quinone substrates by a nonclassical, two-site ping-pong kinetic mechanism whereby substrate quinones bind to a site that is distinct from the NADH-binding site. Furthermore, the effects of quinols on Mtb NDH-2 catalytic activity demonstrate the presence of two binding sites for quinone ligands, one favoring the reduced form and the other favoring the oxidized form. PMID:24447297

  14. Structural data on the periplasmic aldehyde oxidoreductase PaoABC from Escherichia coli: SAXS and preliminary X-ray crystallography analysis.

    PubMed

    Otrelo-Cardoso, Ana Rita; da Silva Correia, Márcia Alexandra; Schwuchow, Viola; Svergun, Dmitri I; Romão, Maria João; Leimkühler, Silke; Santos-Silva, Teresa

    2014-01-01

    The periplasmic aldehyde oxidoreductase PaoABC from Escherichia coli is a molybdenum enzyme involved in detoxification of aldehydes in the cell. It is an example of an ??? heterotrimeric enzyme of the xanthine oxidase family of enzymes which does not dimerize via its molybdenum cofactor binding domain. In order to structurally characterize PaoABC, X-ray crystallography and small angle X-ray scattering (SAXS) have been carried out. The protein crystallizes in the presence of 20% (w/v) polyethylene glycol 3350 using the hanging-drop vapour diffusion method. Although crystals were initially twinned, several experiments were done to overcome twinning and lowering the crystallization temperature (293 K to 277 K) was the solution to the problem. The non-twinned crystals used to solve the structure diffract X-rays to beyond 1.80 Å and belong to the C2 space group, with cell parameters a = 109.42 Å, b = 78.08 Å, c = 151.77 Å, ? = 99.77°, and one molecule in the asymmetric unit. A molecular replacement solution was found for each subunit separately, using several proteins as search models. SAXS data of PaoABC were also collected showing that, in solution, the protein is also an ??? heterotrimer. PMID:24492481

  15. The role and specificity of the catalytic and regulatory cation-binding sites of the Na+-pumping NADH:quinone oxidoreductase from Vibrio cholerae.

    PubMed

    Juárez, Oscar; Shea, Michael E; Makhatadze, George I; Barquera, Blanca

    2011-07-29

    The Na(+)-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na(+)-NQR enables pumping of Li(+), as well as Na(+) across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na(+)-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with (22)Na(+) show that, in both its oxidized and reduced states, Na(+)-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  16. GmcA Is a Putative Glucose-Methanol-Choline Oxidoreductase Required for the Induction of Asexual Development in Aspergillus nidulans

    PubMed Central

    Etxebeste, Oier; Herrero-García, Erika; Cortese, Marc S.; Garzia, Aitor; Oiartzabal-Arano, Elixabet; de los Ríos, Vivian; Ugalde, Unai; Espeso, Eduardo A.

    2012-01-01

    Aspergillus nidulans asexual differentiation is induced by Upstream Developmental Activators (UDAs) that include the bZIP-type Transcription Factor (TF) FlbB. A 2D-PAGE/MS-MS-coupled screen for proteins differentially expressed in the presence and absence of FlbB identified 18 candidates. Most candidates belong to GO term classes involved in osmotic and/or oxidative stress response. Among these, we focused on GmcA, a putative glucose-methanol-choline oxidoreductase which is upregulated in a ?flbB background. GmcA is not required for growth since no differences were detected in the radial extension upon deletion of gmcA. However, its activity is required to induce conidiation under specific culture conditions. A ?gmcA strain conidiates profusely under acid conditions but displays a characteristic fluffy aconidial phenotype in alkaline medium. The absence of asexual development in a ?gmcA strain can be suppressed, on one hand, using high concentrations of non-fermentable carbon sources like glycerol, and on the other hand, when the cMyb-type UDA TF flbD is overexpressed. Overall, the results obtained in this work support a role for GmcA at early stages of conidiophore initiation. PMID:22792266

  17. Expression of rat liver NAD(P)H:quinone-acceptor oxidoreductase in Escherichia coli and mutagenesis in vitro at Arg-177.

    PubMed

    Chen, H H; Ma, J X; Forrest, G L; Deng, P S; Martino, P A; Lee, T D; Chen, S

    1992-06-15

    A prokaryotic expression plasmid, pKK-DT2, containing the cDNA of rat liver NAD(P)H:quinone-acceptor oxidoreductase (EC 1.6.99.2; DT-diaphorase) was constructed and used to transform Escherichia coli strain JM109. The rat liver quinone reductase was expressed in strain in JM109 and was inducible with isopropyl beta-D-thiogalactopyranoside (IPTG). The expressed rat protein was purified by affinity chromatography and had kinetic and physical properties identical with the protein purified from rat liver in that it could utilize either NADH or NADPH as the electron donor and its activity was inhibited by dicoumarol. In addition, we have generated four mutants, Arg-177----His (R177H), Arg-177----Ala (R177A), Arg-177----Cys (R177C) and Arg-177----Leu (R177L), using this expression system. Several of the mutants behaved anomalously on SDS/PAGE, but all of the mutant proteins had the expected M(r) as determined by electrospray m.s. These results and those obtained from enzyme kinetic analysis, u.v./visible absorption spectral analysis, and flavin and tryptophan fluorescence analysis of the wild-type enzyme and four mutants indicated that mutations at Arg-177 changed the conformation of the enzyme, resulting in a decrease in enzyme activity. Replacing Arg-177 with leucine altered the protein conformation and decreased FAD incorporation. PMID:1622401

  18. Characterization of the Type 2 NADH:menaquinone oxidoreductases from Staphylococcus aureus and the bactericidal action of phenothiazines

    PubMed Central

    Schurig-Briccio, Lici A.; Yano, Takahiro; Rubin, Harvey; Gennis, Robert B.

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is currently one of the principal multiply resistant bacterial pathogens causing serious infections, many of which are life-threatening. Consequently, new therapeutic targets are required to combat such infections. In the current work, we explore the type 2 NADH dehydrogenases (NDH-2s) as possible drug targets and look at the effects of phenothiazines, known to inhibit NDH-2 from Mycobacterium tuberculosis. NDH-2s are monotopic membrane proteins that catalyze the transfer of electrons from NADH via FAD to the quinone pool. They are required for maintaining the NADH/NAD+ redox balance and contribute indirectly to the generation of proton motive force. NDH-2s are not present in mammals, but are the only form of respiratory NADH dehydrogenase in several pathogens, including S. aureus. In this work, the two putative ndh genes present in the S. aureus genome were identified, cloned and expressed, and the proteins purified and characterized. Phenothiazines were shown to inhibit both of the S. aureus NDH-2s with IC50 values as low as 8 ?M. However, evaluating the effects of phenothiazines on whole cells of S. aureus was complicated by the fact that they are also acting as uncouplers of oxidative phosphorylation. PMID:24709059

  19. Adaptive response due to changes in gene regulation: a study with Drosophila.

    PubMed Central

    McDonald, J F; Chambers, G K; David, J; Ayala, F J

    1977-01-01

    In spite of the critical role of the process of adaptation in evolution, there are few detailed studies of the genotypic and molecular basis of the process. Drosophila melanogaster flies selected for increased tolerance to ethanol exhibited higher levels of alcohol dehydrogenase (alcohol:NAD+ oxidoreductase; EC 1.1.1.1) activity than unselected controls. A series of tests (electrophoresis, product inhibition, temperature stability, pH optima, substrate specificity, and Michaelis constants) gave no evidence of structural differences in the enzyme of the selected and the control flies. However, quantitative immunological assays showed that the selected flies contained significantly higher amounts of alcohol dehydrogenase. Adaptation of the selected flies to higher alcohol tolerance has most likely taken place by changes not in the structural gene locus coding for the enzyme, but by regulatory changes affecting the amount of gene product. Images PMID:412190

  20. Defining redox centers in human electron transfer flavoprotein: ubiquinone oxidoreductase (ETF:QO) by expression in Saccharomyces cerevisiae

    SciTech Connect

    Frerman, F.E.; Beard, S.; Goodman, S.I.

    1994-09-01

    Mutations in ETF or ETC:QO cause glutaric acidemia type II (GA2). ETF:QO is an iron-sulfur flavoprotein in the inner mitochondrial membrane which transfers electrons from ETF in the mitochondrial matrix to ubiquinone (Q). The human ETF:QO gene is on chromosome 4q32{r_arrow}qter, and encodes a 617 amino acid precursor which is processed to the 64 kDa mature form in the mitochondrion. One ETF:QO mutation in GA2 is a G{r_arrow}T transversion in a donor splice site, deleting the 222 bp upstream exon from the transcript. The deleted 74 amino acids are near the carboxyl terminus just beyond a predicted membrane helix, and include C561, one of four cysteine residues predicted to ligate the 4Fe4S cluster. The mutant protein is not stable in patient fibroblasts. We have expressed cDNAs encoding wild type (wt) ETF:QO, ETF:QO with the 74 amino acid deletion, and ETFF:QO with only a C561A mutation, in S cerevisiae. In all instances, precursor and mature ETF:QOs were stably inserted into the mitochondrial membrane. ETF:QO (C561A) is extracted from the membrane under the same conditions as wt ETF:QO, but ETF:QO with the deletion is much more difficult to extract. Wt ETF:QO accepts electrons from ETF and reduces Q but, while both mutant proteins accept electrons from ETF, neither of them reduces Q. This work demonstrates that C561 in human ETF:QO is essential for Q reduction (probably because it ligands the 4Fe4S cluster), that mutant proteins that are unstable in man may be stable in other systems, that cleavage of signal peptide from precursor proteins can occur within the inner mitochondrial membrane, and the general usefulness of expressing human mitochondrial proteins in yeast.

  1. Characterization of a unique chromosomal copper resistance gene cluster from Xanthomonas campestris pv. vesicatoria.

    PubMed

    Basim, Huseyin; Minsavage, Gerald V; Stall, Robert E; Wang, Jaw-Fen; Shanker, Savita; Jones, Jeffrey B

    2005-12-01

    We characterized the copper resistance genes in strain XvP26 of Xanthomonas campestris pv. vesicatoria, which was originally isolated from a pepper plant in Taiwan. The copper resistance genes were localized to a 7,652-bp region which, based on pulsed-field gel electrophoresis and Southern hybridization, was determined to be located on the chromosome. These genes hybridized only weakly, as determined by Southern analysis, to other copper resistance genes in Xanthomonas and Pseudomonas strains. We identified five open reading frames (ORFs) whose products exhibited high levels of amino acid sequence identity to the products of previously reported copper genes. Mutations in ORF1, ORF3, and ORF4 removed copper resistance, whereas mutations in ORF5 resulted in an intermediate copper resistance phenotype and insertions in ORF2 had no effect on resistance conferred to a copper-sensitive recipient in transconjugant tests. Based on sequence analysis, ORF1 was determined to have high levels of identity with the CopR (66%) and PcoR (63%) genes in Pseudomonas syringae pv. tomato and Escherichia coli, respectively. ORF2 and ORF5 had high levels of identity with the PcoS gene in E. coli and the gene encoding a putative copper-containing oxidoreductase signal peptide protein in Sinorhizobium meliloti, respectively. ORF3 and ORF4 exhibited 23% identity to the gene encoding a cation efflux system membrane protein, CzcC, and 62% identity to the gene encoding a putative copper-containing oxidoreductase protein, respectively. The latter two ORFs were determined to be induced following exposure to low concentrations of copper, while addition of Co, Cd, or Zn resulted in no significant induction. PCR analysis of 51 pepper and 34 tomato copper-resistant X. campestris pv. vesicatoria strains collected from several regions in Taiwan between 1987 and 2000 and nine copper-resistant strains from the United States and South America showed that successful amplification of DNA was obtained only for strain XvP26. The organization of this set of copper resistance genes appears to be uncommon, and the set appears to occur rarely in X. campestris pv. vesicatoria. PMID:16332814

  2. FeS/S/FeS2 Redox System and Its Oxidoreductase-like Chemistry in the Iron-Sulfur World

    NASA Astrophysics Data System (ADS)

    Wang, Wei; Yang, Bin; Qu, Youpeng; Liu, Xiaoyang; Su, Wenhui

    2011-06-01

    The iron-sulfur world (ISW) theory is an intriguing prediction regarding the origin of life on early Earth. It hypothesizes that life arose as a geochemical process from inorganic starting materials on the surface of sulfide minerals in the vicinity of deep-sea hot springs. During the last two decades, many experimental studies have been carried out on this topic, and some interesting results have been achieved. Among them, however, the processes of carbon/nitrogen fixation and biomolecular assembly on the mineral surface have received an inordinate amount of attention. To the present, an abiotic model for the oxidation-reduction of intermediates participating in metabolic pathways has been ignored. We examined the oxidation-reduction effect of a prebiotic FeS/S/FeS2 redox system on the interconversion between several pairs of ±-hydroxy acids and ±-keto acids (i.e., lactate/pyruvate, malate/oxaloacetate, and glycolate/glyoxylate). We found that, in the absence of FeS, elemental sulfur (S) oxidized ±-hydroxy acids to form corresponding keto acids only at a temperature higher than its melting point (113°C); in the presence of FeS, such reactions occurred more efficiently through a coupled reaction mechanism, even at a temperature below the phase transition point of S. On the other hand, FeS was shown to have the capacity to reversibly reduce the keto acids. Such an oxidoreductase-like chemistry of the FeS/S/FeS2 redox system suggests that it can determine the redox homeostasis of metabolic intermediates in the early evolutionary phase of life. The results provide a possible pathway for the development of primordial redox biochemistry in the iron-sulfur world.

  3. Mitochondrial Impairment May Increase Cellular NAD(P)H: Resazurin Oxidoreductase Activity, Perturbing the NAD(P)H-Based Viability Assays

    PubMed Central

    Aleshin, Vasily A.; Artiukhov, Artem V.; Oppermann, Henry; Kazantsev, Alexey V.; Lukashev, Nikolay V.; Bunik, Victoria I.

    2015-01-01

    Cellular NAD(P)H-dependent oxidoreductase activity with artificial dyes (NAD(P)H-OR) is an indicator of viability, as the cellular redox state is important for biosynthesis and antioxidant defense. However, high NAD(P)H due to impaired mitochondrial oxidation, known as reductive stress, should increase NAD(P)H-OR yet perturb viability. To better understand this complex behavior, we assayed NAD(P)H-OR with resazurin (Alamar Blue) in glioblastoma cell lines U87 and T98G, treated with inhibitors of central metabolism, oxythiamin, and phosphonate analogs of 2-oxo acids. Targeting the thiamin diphosphate (ThDP)-dependent enzymes, the inhibitors are known to decrease the NAD(P)H production in the pentose phosphate shuttle and/or upon mitochondrial oxidation of 2-oxo acids. Nevertheless, the inhibitors elevated NAD(P)H-OR with resazurin in a time- and concentration-dependent manner, suggesting impaired NAD(P)H oxidation rather than increased viability. In particular, inhibition of the ThDP-dependent enzymes affects metabolism of malate, which mediates mitochondrial oxidation of cytosolic NAD(P)H. We showed that oxythiamin not only inhibited mitochondrial 2-oxo acid dehydrogenases, but also induced cell-specific changes in glutamate and malate dehydrogenases and/or malic enzyme. As a result, inhibition of the 2-oxo acid dehydrogenases compromises mitochondrial metabolism, with the dysregulated electron fluxes leading to increases in cellular NAD(P)H-OR. Perturbed mitochondrial oxidation of NAD(P)H may thus complicate the NAD(P)H-based viability assay. PMID:26308058

  4. Pyruvate:ferredoxin oxidoreductase and thioredoxin reductase are involved in 5-nitroimidazole activation while flavin metabolism is linked to 5-nitroimidazole resistance in Giardia lamblia

    PubMed Central

    Leitsch, David; Burgess, Anita G.; Dunn, Linda A.; Krauer, Kenia G.; Tan, Kevin; Duchêne, Michael; Upcroft, Peter; Eckmann, Lars; Upcroft, Jacqueline A.

    2011-01-01

    Objectives The mechanism of action of, and resistance to, metronidazole in the anaerobic (or micro-aerotolerant) protozoan parasite Giardia lamblia has long been associated with the reduction of ferredoxin (Fd) by the enzyme pyruvate:ferredoxin oxidoreductase (PFOR) and the subsequent activation of metronidazole by Fd to toxic radical species. Resistance to metronidazole has been associated with down-regulation of PFOR and Fd. The aim of this study was to determine whether the PFOR/Fd couple is the only pathway involved in metronidazole activation in Giardia. Methods PFOR and Fd activities were measured in extracts of highly metronidazole-resistant (MTRr) lines and activities of recombinant G. lamblia thioredoxin reductase (GlTrxR) and NADPH oxidase were assessed for their involvement in metronidazole activation and resistance. Results We demonstrated that several lines of highly MTRr G. lamblia have fully functional PFOR and Fd indicating that PFOR/Fd-independent mechanisms are involved in metronidazole activation and resistance in these cells. Flavin-dependent GlTrxR, like TrxR of other anaerobic protozoa, reduces 5-nitroimidazole compounds including metronidazole, although expression of TrxR is not decreased in MTRr Giardia. However, reduction of flavins is suppressed in highly MTRr cells, as evidenced by as much as an 80% decrease in NADPH oxidase flavin mononucleotide reduction activity. This suppression is consistent with generalized impaired flavin metabolism in highly MTRr Trichomonas vaginalis. Conclusions These data add to the mounting evidence against the dogma that PFOR/Fd is the only couple with a low enough redox potential to reduce metronidazole in anaerobes and point to the multi-factorial nature of metronidazole resistance. PMID:21602576

  5. Removal of naphthols and analogues by the combined use of an oxidoreductase polyphenol oxidase and a biopolymer chitosan from aqueous solutions.

    PubMed

    Kimura, Yuji; Gotoh, Asahi; Shinozaki, Fumiyoshi; Kashiwada, Ayumi; Yamada, Kazunori

    2014-01-01

    In this study, the combined use of an amino group-containing polymer chitosan and an oxidoreductase polyphenol oxidase (PPO) was applied to the removal of naphthols and dihydroxynaphthalenes (DHNs) from aqueous solutions. The process parameters, such as the pH value, temperature and enzyme dose, were discussed for PPO-catalysed oxidation of 1-naphthol. The optimum conditions of enzymatic oxidation of 1-naphthol were determined to be pH 8.0 and 40 °C. Under the optimum conditions, PPO-catalysed oxidation of 1-naphthol increased with an increase in the enzyme dose. Quinone derivatives enzymatically generated were chemisorbed on chitosan beads and the initial velocity of PPO-catalysed oxidation increased with an increase in the amount of added chitosan beads. A specific initial velocity of 0.0675 ?mol/U·min was obtained in the PPO concentration range below 200 U/cm³ and 1-naphthol was completely removed within 24 h by quinone adsorption on chitosan beads (0.20 cm³/cm³) at a PPO concentration of 100 U/cm³. The removal time was shortened by increasing the enzyme dose or the amount of added chitosan beads. 2-Naphthol was also completely removed at an initial concentration of 0.05 mM or less by prolonging the reaction time, since PPO-catalysed oxidation of 2-naphthol was much slower than that of 1-naphthol. In addition, this procedure was also applied to the removal of DHNs. These results revealed that the procedure constructed in this study was an effective technique to remove naphthols and DHNs from the aqueous medium. PMID:25189838

  6. Regulation of etioplast pigment-protein complexes, inner membrane architecture, and protochlorophyllide a chemical heterogeneity by light-dependent NADPH:protochlorophyllide oxidoreductases A and B.

    PubMed

    Franck, F; Sperling, U; Frick, G; Pochert, B; van Cleve, B; Apel, K; Armstrong, G A

    2000-12-01

    The etioplast of dark-grown angiosperms is characterized by the prolamellar body (PLB) inner membrane, the absence of chlorophyll, and the accumulation of divinyl and monovinyl derivatives of protochlorophyll(ide) a [Pchl(ide) a]. Either of two structurally related, but differentially expressed light-dependent NADPH:Pchlide oxidoreductases (PORs), PORA and PORB, can assemble the PLB and form dark-stable ternary complexes containing enzymatically photoactive Pchlide-F655. Here we have examined in detail whether these polypeptides play redundant roles in etioplast differentiation by manipulating the total POR content and the PORA-to-PORB ratio of etiolated Arabidopsis seedlings using antisense and overexpression approaches. POR content correlates closely with PLB formation, the amounts, spectroscopic properties, and photoreduction kinetics of photoactive Pchlide, the ratio of photoactive Pchlide-F655 to non-photoactive Pchl(ide)-F632, and the ratio of divinyl- to monovinyl-Pchl(ide). This last result defines POR as the first endogenous protein factor demonstrated to influence the chemical heterogeneity of Pchl(ide) in angiosperms. It is intriguing that excitation energy transfer between different spectroscopic forms of Pchl(ide) in etiolated cotyledons remains largely independent of POR content. We therefore propose that the PLB contains a minimal structural unit with defined pigment stoichiometries, within which a small amount of non-photoactive Pchl(ide) transfers excitation energy to a large excess of photoactive Pchlide-F655. In addition, our data suggests that POR may bind not only stoichiometric amounts of photoactive Pchlide, but also substoichiometric amounts of non-photoactive Pchl(ide). We conclude that the typical characteristics of etioplasts are closely related to total POR content, but not obviously to the specific presence of PORA or PORB. PMID:11115885

  7. Electrical Wiring of the Aldehyde Oxidoreductase PaoABC with a Polymer Containing Osmium Redox Centers: Biosensors for Benzaldehyde and GABA.

    PubMed

    Badalyan, Artavazd; Dierich, Marlen; Stiba, Konstanze; Schwuchow, Viola; Leimkühler, Silke; Wollenberger, Ulla

    2014-12-01

    Biosensors for the detection of benzaldehyde and ?-aminobutyric acid (GABA) are reported using aldehyde oxidoreductase PaoABC from Escherichia coli immobilized in a polymer containing bound low potential osmium redox complexes. The electrically connected enzyme already electrooxidizes benzaldehyde at potentials below -0.15 V (vs. Ag|AgCl, 1 M KCl). The pH-dependence of benzaldehyde oxidation can be strongly influenced by the ionic strength. The effect is similar with the soluble osmium redox complex and therefore indicates a clear electrostatic effect on the bioelectrocatalytic efficiency of PaoABC in the osmium containing redox polymer. At lower ionic strength, the pH-optimum is high and can be switched to low pH-values at high ionic strength. This offers biosensing at high and low pH-values. A "reagentless" biosensor has been formed with enzyme wired onto a screen-printed electrode in a flow cell device. The response time to addition of benzaldehyde is 30 s, and the measuring range is between 10-150 µM and the detection limit of 5 µM (signal to noise ratio 3:1) of benzaldehyde. The relative standard deviation in a series (n = 13) for 200 µM benzaldehyde is 1.9%. For the biosensor, a response to succinic semialdehyde was also identified. Based on this response and the ability to work at high pH a biosensor for GABA is proposed by coimmobilizing GABA-aminotransferase (GABA-T) and PaoABC in the osmium containing redox polymer. PMID:25587431

  8. Structural and Functional Investigation of Flavin Binding Center of the NqrC Subunit of Sodium-Translocating NADH:Quinone Oxidoreductase from Vibrio harveyi

    PubMed Central

    Bertsova, Yulia; Polovinkin, Vitaly; Gushchin, Ivan; Ishchenko, Andrii; Kovalev, Kirill; Mishin, Alexey; Kachalova, Galina; Popov, Alexander; Bogachev, Alexander; Gordeliy, Valentin

    2015-01-01

    Na+-translocating NADH:quinone oxidoreductase (NQR) is a redox-driven sodium pump operating in the respiratory chain of various bacteria, including pathogenic species. The enzyme has a unique set of redox active prosthetic groups, which includes two covalently bound flavin mononucleotide (FMN) residues attached to threonine residues in subunits NqrB and NqrC. The reason of FMN covalent bonding in the subunits has not been established yet. In the current work, binding of free FMN to the apo-form of NqrC from Vibrio harveyi was studied showing very low affinity of NqrC to FMN in the absence of its covalent bonding. To study structural aspects of flavin binding in NqrC, its holo-form was crystallized and its 3D structure was solved at 1.56 Å resolution. It was found that the isoalloxazine moiety of the FMN residue is buried in a hydrophobic cavity and that its pyrimidine ring is squeezed between hydrophobic amino acid residues while its benzene ring is extended from the protein surroundings. This structure of the flavin-binding pocket appears to provide flexibility of the benzene ring, which can help the FMN residue to take the bended conformation and thus to stabilize the one-electron reduced form of the prosthetic group. These properties may also lead to relatively weak noncovalent binding of the flavin. This fact along with periplasmic location of the FMN-binding domains in the vast majority of NqrC-like proteins may explain the necessity of the covalent bonding of this prosthetic group to prevent its loss to the external medium. PMID:25734798

  9. Down-regulation of the detoxifying enzyme NAD(P)H:quinone oxidoreductase 1 by vanadium in Hepa 1c1c7 cells

    SciTech Connect

    Anwar-Mohamed, Anwar; El-Kadi, Ayman O.S.

    2009-05-01

    Recent data suggest that vanadium (V{sup 5+}) compounds exert protective effects against chemical-induced carcinogenesis, mainly through modifying various xenobiotic metabolizing enzymes. In fact, we have shown that V{sup 5+} down-regulates the expression of Cyp1a1 at the transcriptional level through an ATP-dependent mechanism. However, incongruously, there is increasing evidence that V{sup 5+} is found in higher amounts in cancer cells and tissues than in normal cells or tissues. Therefore, the current study aims to address the possible effect of this metal on the regulation of expression of an enzyme that helps maintain endogenous antioxidants used to protect tissues/cells from mutagens, carcinogens, and oxidative stress damage, NAD(P)H:quinone oxidoreductase 1 (Nqo1). In an attempt to examine these effects, Hepa 1c1c7 cells and its AhR-deficient version, c12, were treated with increasing concentrations of V{sup 5+} in the presence of two distinct Nqo1 inducers, the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and isothiocyanate sulforaphane (SUL). Our results showed that V{sup 5+} inhibits the TCDD- and SUL-mediated induction of Nqo1 at mRNA, protein, and catalytic activity levels. At transcriptional level, V{sup 5+} was able to decrease the TCDD- and SUL-induced nuclear accumulation of Nrf2 and the subsequent binding to antioxidant responsive element (ARE) without affecting Nrf2 protein levels. Looking at post-transcriptional level; we found that V{sup 5+} did not affect Nqo1 mRNA transcripts turn-over rates. However, at the post-translational level V{sup 5+} increased Nqo1 protein half-life. In conclusion, the present study demonstrates that V{sup 5+} down-regulates Nqo1 at the transcriptional level, possibly through inhibiting the ATP-dependent activation of Nrf2.

  10. Arsenite pretreatment enhances the cytotoxicity of mitomycin C in human cancer cell lines via increased NAD(P)H quinone oxidoreductase 1 expression

    SciTech Connect

    Lin Yiling; Ho, I-C.; Su, P.-F.; Lee, T.-C. . E-mail: bmtcl@ibms.sinica.edu.tw

    2006-08-01

    Arsenic is an effective therapeutic agent for the treatment of patients with refractory or relapsed acute promyelocytic leukemia. The use of arsenic for treating solid tumors, particularly in combination with other chemotherapeutic agents, has been extensively studied. Here, we report that arsenite-resistant human lung cancer CL3R15 cells constitutively overexpress NAD(P)H quinone oxidoreductase 1 (NQO1), an enzyme responsible for activation of mitomycin C (MMC), and are more susceptible to MMC cytotoxicity than parental CL3 cells. The effects of arsenite pretreatment on NQO1 induction were examined in CL3, H1299, H460, and MC-T2 cells. Arsenite pretreatment significantly enhanced the expression of NQO1 and susceptibility to MMC in CL3, H1299, and MC-T2 cells, but not in H460 cells that express high endogenous levels of NQO1. Alternatively, arsenic pretreatment reduced adriamycin sensitivity of CL3 cells. Arsenite-mediated MMC susceptibility was abrogated by dicumarol (DIC), an NQO1 inhibitor, indicating that NQO1 is one of the key regulators of arsenite-mediated MMC susceptibility. Various cancer cell lines showed different basal levels of NQO1 activity and a different capacity for NQO1 induction in response to arsenite treatment. However, overall, there was a positive correlation between induced NQO1 activity and MMC susceptibility in cells pretreated with various doses of arsenite. These results suggest that arsenite may increase NQO1 activity and thus enhance the antineoplastic activity of MMC. In addition, our results also showed that inhibition of NQO1 activity by DIC reversed the arsenite resistance of CL3R15 cells.

  11. Apoptosis-inducing Factor (AIF) and Its Family Member Protein, AMID, Are Rotenone-sensitive NADH:Ubiquinone Oxidoreductases (NDH-2).

    PubMed

    Elguindy, Mahmoud M; Nakamaru-Ogiso, Eiko

    2015-08-21

    Apoptosis-inducing factor (AIF) and AMID (AIF-homologous mitochondrion-associated inducer of death) are flavoproteins. Although AIF was originally discovered as a caspase-independent cell death effector, bioenergetic roles of AIF, particularly relating to complex I functions, have since emerged. However, the role of AIF in mitochondrial respiration and redox metabolism has remained unknown. Here, we investigated the redox properties of human AIF and AMID by comparing them with yeast Ndi1, a type 2 NADH:ubiquinone oxidoreductase (NDH-2) regarded as alternative complex I. Isolated AIF and AMID containing naturally incorporated FAD displayed no NADH oxidase activities. However, after reconstituting isolated AIF or AMID into bacterial or mitochondrial membranes, N-terminally tagged AIF and AMID displayed substantial NADH:O? activities and supported NADH-linked proton pumping activities in the host membranes almost as efficiently as Ndi1. NADH:ubiquinone-1 activities in the reconstituted membranes were highly sensitive to 2-n-heptyl-4-hydroxyquinoline-N-oxide (IC?? = ?1 ?m), a quinone-binding inhibitor. Overexpressing N-terminally tagged AIF and AMID enhanced the growth of a double knock-out Escherichia coli strain lacking complex I and NDH-2. In contrast, C-terminally tagged AIF and NADH-binding site mutants of N-terminally tagged AIF and AMID failed to show both NADH:O? activity and the growth-enhancing effect. The disease mutant AIF?R201 showed decreased NADH:O? activity and growth-enhancing effect. Furthermore, we surprisingly found that the redox activities of N-terminally tagged AIF and AMID were sensitive to rotenone, a well known complex I inhibitor. We propose that AIF and AMID are previously unidentified mammalian NDH-2 enzymes, whose bioenergetic function could be supplemental NADH oxidation in cells. PMID:26063804

  12. Isolation and characterization of the human tyrosine hydroxylase gene: identification of 5' alternative splice sites responsible for multiple mRNAs

    SciTech Connect

    O'Malley, K.L.; Anhalt, M.J.; Martin, B.M.; Kelsoe, J.R.; Winfield, S.L.; Ginns, E.I.

    1987-11-03

    A full-length genomic clone for human tyrosine hydroxylase (L-tyrosine, tetrahydropteridine:oxygen oxidoreductase, EC 1.14.16.2) has been isolated. A human brain genomic library constructed in EMBL3 was screened by using a rat cDNA for tyrosine hydroxylase as a probe. Out of one million recombinant phage, one clone was identified that hybridized to both 5' and 3' rat cDNA probes. Restriction endonuclease mapping, Southern blotting, and sequence analysis revealed that, like its rodent counterpart, the human gene is single copy, contains 13 primary exons, and spans approximately 8 kilobases (kb). In contrast to the rat gene, human tyrosine hydroxylase undergoes alternative RNA processing within intron 1, generating at least three distinct mRNAs. A comparison of the human tyrosine hydroxylase and phenylalanine hydroxylase genes indicates that although both probably evolved from a common ancestral gene, major changes in the size of introns have occurred since their divergence.

  13. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity.

    PubMed Central

    Halaban, R; Moellmann, G

    1990-01-01

    Melanogenesis is regulated in large part by tyrosinase (monophenol monooxygenase; monophenol, L-dopa:oxygen oxidoreductase, EC 1.14.18.1), and defective tyrosinase leads to albinism. The mechanisms for other pigmentation determinants (e.g., those operative in tyrosinase-positive albinism and in murine coat-color mutants) are not yet known. One murine pigmentation gene, the brown (b) locus, when mutated leads to a brown (b/b) or hypopigmented (Blt/Blt) coat versus the wild-type black (B/B). We show that the b locus codes for a glycoprotein with the activity of a catalase (hydrogen-peroxide:hydrogen-peroxide oxidoreductase, EC 1.11.1.6) (catalase B). Only the c locus protein is a tyrosinase. Because peroxides may be by-products of melanogenic activity and hydrogen peroxide in particular is known to destroy melanin precursors and melanin, we conclude that pigmentation is controlled not only by tyrosinase but also by a hydroperoxidase. Our studies indicate that catalase B is identical with gp75, a known human melanosomal glycoprotein; that the b mutation is in a heme-associated domain; and that the Blt mutation renders the protein susceptible to rapid proteolytic degradation. Images PMID:1693779

  14. NAD(P)H:quinone oxidoreductase expression in Cyp1a-knockout and CYP1A-humanized mouse lines and its effect on bioactivation of the carcinogen aristolochic acid I

    SciTech Connect

    Levova, Katerina; Moserova, Michaela; Nebert, Daniel W.; Phillips, David H.; Frei, Eva; Schmeiser, Heinz H.; Arlt, Volker M.; Stiborova, Marie

    2012-12-15

    Aristolochic acid causes a specific nephropathy (AAN), Balkan endemic nephropathy, and urothelial malignancies. Using Western blotting suitable to determine protein expression, we investigated in several transgenic mouse lines expression of NAD(P)H:quinone oxidoreductase (NQO1)—the most efficient cytosolic enzyme that reductively activates aristolochic acid I (AAI). The mouse tissues used were from previous studies [Arlt et al., Chem. Res. Toxicol. 24 (2011) 1710; Stiborova et al., Toxicol. Sci. 125 (2012) 345], in which the role of microsomal cytochrome P450 (CYP) enzymes in AAI metabolism in vivo had been determined. We found that NQO1 levels in liver, kidney and lung of Cyp1a1(?/?), Cyp1a2(?/?) and Cyp1a1/1a2(?/?) knockout mouse lines, as well as in two CYP1A-humanized mouse lines harboring functional human CYP1A1 and CYP1A2 and lacking the mouse Cyp1a1/1a2 orthologs, differed from NQO1 levels in wild-type mice. NQO1 protein and enzymic activity were induced in hepatic and renal cytosolic fractions isolated from AAI-pretreated mice, compared with those in untreated mice. Furthermore, this increase in hepatic NQO1 enzyme activity was associated with bioactivation of AAI and elevated AAI-DNA adduct levels in ex vivo incubations of cytosolic fractions with DNA and AAI. In conclusion, AAI appears to increase its own metabolic activation by inducing NQO1, thereby enhancing its own genotoxic potential. Highlights: ? NAD(P)H:quinone oxidoreductase expression in Cyp1a knockout and humanized CYP1A mice ? Reductive activation of the nephrotoxic and carcinogenic aristolochic acid I (AAI) ? NAD(P)H:quinone oxidoreductase is induced in mice treated with AAI. ? Induced hepatic enzyme activity resulted in elevated AAI-DNA adduct levels.

  15. The Iron-Sulfur Cluster of Electron Transfer Flavoprotein-ubiquinone Oxidoreductase (ETF-QO) is the Electron Acceptor for Electron Transfer Flavoprotein†

    PubMed Central

    Swanson, Michael A.; Usselman, Robert J.; Frerman, Frank E.; Eaton, Gareth R.; Eaton, Sandra S.

    2011-01-01

    Electron-transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) accepts electrons from electron-transfer flavoprotein (ETF) and reduces ubiquinone from the ubiquinone-pool. It contains one [4Fe-4S]2+,1+ and one FAD, which are diamagnetic in the isolated oxidized enzyme and can be reduced to paramagnetic forms by enzymatic donors or dithionite. In the porcine protein, threonine 367 is hydrogen bonded to N1 and O2 of the flavin ring of the FAD. The analogous site in Rhodobacter sphaeroides ETF-QO is asparagine 338. Mutations N338T and N338A were introduced into the R. sphaeroides protein by site-directed mutagenesis to determine the impact of hydrogen bonding at this site on redox potentials and activity. The mutations did not alter the optical spectra, EPR g-values, spin-lattice relaxation rates, or the [4Fe-4S]2+,1+ to FAD point-dipole interspin distances. The mutations had no impact on the reduction potential for the iron-sulfur cluster, which was monitored by changes in the continuous wave EPR signals of the [4Fe-4S]+ at 15 K. For the FAD semiquinone, significantly different potentials were obtained by monitoring the titration at 100 or 293 K. Based on spectra at 293 K the N338T mutation shifted the first and second midpoint potentials for the FAD from +47 mV and ?30 mV for wild type to ?11 mV and ?19 mV, respectively. The N338A mutation decreased the potentials to ?37 mV and ?49 mV. Lowering the midpoint potentials resulted in a decrease in the quinone reductase activity and negligible impact on disproportionation of ETF1e? catalyzed by ETF-QO. These observations indicate that the FAD is involved in electron transfer to ubiquinone, but not in electron transfer from ETF to ETF-QO. Therefore the iron-sulfur cluster is the immediate acceptor from ETF. PMID:18672901

  16. The bioreduction of a series of benzoquinone ansamycins by NAD(P)H:quinone oxidoreductase 1 to more potent heat shock protein 90 inhibitors, the hydroquinone ansamycins.

    PubMed

    Guo, Wenchang; Reigan, Philip; Siegel, David; Zirrolli, Joseph; Gustafson, Daniel; Ross, David

    2006-10-01

    We have previously evaluated the role of NAD(P)H:quinone oxidoreductase 1 (NQO1) in the bioreductive metabolism of 17-(allylamino)-demethoxygeldanamycin (17AAG) to the corresponding hydroquinone, a more potent 90-kDa heat shock protein (Hsp90) inhibitor. Here, we report an extensive study with a series of benzoquinone ansamycins, which includes gel-danamycin, 17-(amino)-17-demethoxygeldanamycin, and 17-demethoxy-17-[[2-(dimethylamino)ethyl]amino]-geldanamycin. The reduction of these benzoquinone ansamycins by recombinant human NQO1 to the corresponding hydroquinone ansamycins was monitored by high-performance liquid chromatography (HPLC) and confirmed by liquid chromatography/mass spectrometry. Inhibition of purified yeast Hsp90 ATPase activity was augmented in the presence of NQO1 and abrogated by 5-methoxy-1,2-dimethyl-3-[(4-nitrophenoxy)methyl-]indole-4,7-dione (ES936), a mechanism-based inhibitor of NQO1, showing that the hydroquinone ansamycins were more potent Hsp90 inhibitors than their parent quinones. An isogenic pair of human breast cancer cell lines, MDA468 and MDA468/NQ16, differing in expression of NQO1, was used, and HPLC analysis showed that hydroquinone ansamycins were formed by the MDA468/NQ16 cells, which could be prevented by ES936 pretreatment. The MDA468/NQ16 cells were more sensitive to growth inhibition after treatment with the benzoquinone ansamycins compared with the MDA468 cells; this increased sensitivity could be reduced by ES936 pretreatment. The increased duration of benzoquinone ansamycin exposure showed increased potency and -fold inhibition in MDA468/NQ16 cells relative to the parental MDA468 cells. Computational-based molecular modeling studies displayed additional contacts between yeast Hsp90 and the hydroquinone ansamycins, which translated to greater interaction energies compared with the corresponding benzoquinone ansamycins. In conclusion, these studies show that the reduction of this series of benzoquinone ansamycins by NQO1 generates the corresponding hydroquinone ansamycins, which exhibit enhanced Hsp90 inhibition. PMID:16825487

  17. Organization of the human [zeta]-crystallin/quinone reductase gene (CRYZ)

    SciTech Connect

    Gonzalez, P.; Rao, P.V.; Zigler, J.S. Jr. )

    1994-05-15

    [zeta]-Crystallin is a protein highly expressed in the lens of guinea pigs and camels, where it comprises about 10% of the total soluble protein. It has recently been characterized as a novel quinone oxidoreductase present in a variety of mammalian tissues. The authors report here the isolation and characterization of the human [zeta]-crystallin gene (CRYZ) and its processed pseudogene. The functional gene is composed of nine exons and spans about 20 kb. The 5[prime]-flanking region of the gene is rich in G and C (58%) and lacks TATA and CAAT boxes. Previous analysis of the guinea pig gene revealed the presence of two different promoters, one responsible for the high lens-specific expression and the other for expression at the enzymatic level in numerous tissues. Comparative analysis with the guinea pig gene shows that a region of [approximately]2.5 kb that includes the promoter responsible for the high expression in the lens in guinea pig is not present in the human gene. 34 refs., 6 figs., 1 tab.

  18. The Pseudomonas aeruginosa rhlG and rhlAB genes are inversely regulated and RhlG is not required for rhamnolipid synthesis

    PubMed Central

    2014-01-01

    Background Pseudomonas aeruginosa produces rhamnolipid biosurfactants involved in numerous phenomena including virulence. The transcriptional study of the rhlAB operon encoding two key enzymes for rhamnolipid synthesis led to the discovery of the quorum sensing system RhlRI. The latter positively controls the transcription of rhlAB, as well as of rhlC, which is required for di-rhamnolipid synthesis. The rhlG gene encodes an NADPH-dependent ?-ketoacyl reductase. Although it was reported to be required for the biosynthesis of the fatty acid part of rhamnolipids, its function in rhamnolipid synthesis was later questioned. The rhlG transcription and its role in rhamnolipid production were investigated here. Results Using 5?-RACE PCR, a luxCDABE-based transcriptional fusion, and quantitative reverse transcription-PCR, we confirmed two previously identified ?70- and ?54-dependent promoters and we identified a third promoter recognized by the extra-cytoplasmic function sigma factor AlgU. rhlG was inversely regulated compared to rhlAB and rhlC: the rhlG transcription was down-regulated in response to N-butyryl-l-homoserine lactone, the communication molecule of the RhlRI system, and was induced by hyperosmotic stress in an AlgU-dependent manner. Consistently with this transcriptional pattern, the single or double deletions of rhlG and PA3388, which forms an operon with rhlG, did not dramatically impair rhamnolipid synthesis. Conclusion This first detailed study of rhlG transcription reveals a complex regulation involving three sigma factors and N-butyryl-l-homoserine lactone. We furthermore present evidences that RhlG does not play a key role in rhamnolipid synthesis. PMID:24943492

  19. Identification and Characterization of the Streptazone?E Biosynthetic Gene Cluster in Streptomyces sp. MSC090213JE08.

    PubMed

    Ohno, Shoto; Katsuyama, Yohei; Tajima, Yuka; Izumikawa, Miho; Takagi, Motoki; Fujie, Manabu; Satoh, Noriyuki; Shin-Ya, Kazuo; Ohnishi, Yasuo

    2015-11-01

    Streptazone derivatives isolated from Streptomyces species are piperidine alkaloids with a cyclopenta[b]pyridine scaffold. Previous studies indicated that these compounds are polyketides, but the biosynthetic enzymes responsible for their synthesis are unknown. Here, we have identified the streptazone?E biosynthetic gene cluster in Streptomyces?sp. MSC090213JE08, which encodes a modular type?I PKS and tailoring enzymes that include an aminotransferase, three oxidoreductases, and two putative cyclases. The functions of the six tailoring enzymes were analyzed by gene disruption, and two putative biosynthetic intermediates that accumulated in particular mutants were structurally elucidated. On the basis of these results, we propose a pathway for the biosynthesis of streptazone?E in which the two putative cyclases of the nuclear transport factor?2-like superfamily are responsible for C-C bond formation coupled with epoxide ring opening to give the five-membered ring of streptazone?E. PMID:26403163

  20. Identification of the Genes Involved in the Fruiting Body Production and Cordycepin Formation of Cordyceps militaris Fungus

    PubMed Central

    Zheng, Zhuang-li; Qiu, Xue-hong

    2015-01-01

    A mutant library of Cordyceps militaris was constructed by improved Agrobacterium tumefaciens-mediated transformation and screened for degradation features. Six mutants with altered characters in in vitro and in vivo fruiting body production, and cordycepin formation were found to contain a single copy T-DNA. T-DNA flanking sequences of these mutants were identified by thermal asymmetric interlaced-PCR approach. ATP-dependent helicase, cytochrome oxidase subunit I and ubiquitin-like activating enzyme were involved in in vitro fruiting body production, serine/threonine phosphatase involved in in vivo fruiting body production, while glucose-methanol-choline oxidoreductase and telomerase reverse transcriptase involved in cordycepin formation. These genes were analyzed by bioinformatics methods, and their molecular function and biology process were speculated by Gene Ontology (GO) analysis. The results provided useful information for the control of culture degeneration in commercial production of C. militaris. PMID:25892913

  1. Gene Concepts, Gene Talk, and Gene Patents

    E-print Network

    Torrance, Andrew W.

    2010-01-01

    concepts have exerted strong effects on institutions such as medicine, the biotechnology industry, politics, and the law. A particularly rich example of this is the interplay between gene concepts and patent law. Over the last century, biology has...

  2. Identification of methylmercury tolerance gene candidates in Drosophila.

    PubMed

    Mahapatra, Cecon T; Bond, Jeffrey; Rand, David M; Rand, Matthew D

    2010-07-01

    Methylmercury (MeHg) is a ubiquitous environmental contaminant that preferentially targets the developing nervous system. Variable outcomes of prenatal MeHg exposure within a population point to a genetic component that regulates MeHg toxicity. We therefore sought to identify fundamental MeHg tolerance genes using the Drosophila model for genetic and molecular dissection of a MeHg tolerance trait. We observe autosomal dominance in a MeHg tolerance trait (development on MeHg food) in both wild-derived and laboratory-selected MeHg-tolerant strains of flies. We performed whole-genome transcript profiling of larval brains of tolerant (laboratory selected) and nontolerant (control) strains in the presence and absence of MeHg stress. Pairwise transcriptome comparisons of four conditions (+/-selection and +/-MeHg) identified a "down-down-up" expression signature, whereby MeHg alone and selection alone resulted in a greater number of downregulated transcripts, and the combination of selection + MeHg resulted in a greater number of upregulated transcripts. Functional annotation cluster analyses showed enrichment for monooxygenases/oxidoreductases, which include cytochrome P450 (CYP) family members. Among the 10 CYPs upregulated with selection + MeHg in tolerant strains, CYP6g1, previously identified as the dichlorodiphenyl trichloroethane resistance allele in flies, was the most highly expressed and responsive to MeHg. Among all the genes, Turandot A (TotA), an immune pathway-regulated humoral response gene, showed the greatest upregulation with selection + MeHg. Neural-specific transgenic overexpression of TotA enhanced MeHg tolerance during pupal development. Identification of TotA and CYP genes as MeHg tolerance genes is an inroad to investigating the conserved function of immune signaling and phase I metabolism pathways in MeHg toxicity and tolerance in higher organisms. PMID:20375079

  3. Negative Regulation of DsbA-L Gene Expression by the Transcription Factor Sp1

    PubMed Central

    Fang, Qichen; Yang, Wenjing; Li, Huating; Hu, Wenxiu; Chen, Lihui; Jiang, Shan; Dong, Kun; Song, Qianqian; Wang, Chen; Chen, Shuo; Liu, Feng

    2014-01-01

    Disulfide-bond A oxidoreductase-like protein (DsbA-L) possesses beneficial effects such as promoting adiponectin multimerization and stability, increasing insulin sensitivity, and enhancing energy metabolism. The expression level of DsbA-L is negatively correlated with obesity in mice and humans, but the underlying mechanisms remain unknown. To address this question, we generated reporter gene constructs containing the promoter sequence of the mouse DsbA-L gene. Deletion analysis showed that the proximal promoter of mouse DsbA-L is located between ?186 and ?34 bp relative to the transcription start site. In silico analysis identified a putative Sp1 transcription factor binding site in the first intron of the DsbA-L gene. Electrophoretic mobility shift assay and chromatin immunoprecipitation analysis indicated that Sp1 bound to this intron region in vitro and in intact cells. Overexpression of Sp1 or suppressing Sp1 expression by siRNA reduced or increased DsbA-L promoter activity, respectively. The binding activity of Sp1 was gradually decreased during 3T3-L1 cell differentiation and was significantly increased in adipose tissues of obese mice. Our results identify Sp1 as an inhibitor of DsbA-L gene transcription, and the Sp1-mediated inhibition of DsbA-L gene expression may provide a mechanism underlying obesity-induced adiponectin downregulation and insulin resistance. PMID:25024375

  4. Alpha-Tocopherol Modulates Genes Involved in Hepatic Xenobiotic Pathways in Mice

    PubMed Central

    Mustacich, Debbie J.; Gohil, Kishorchandra; Bruno, Richard S.; Yan, Michelle; Leonard, Scott W.; Ho, Emily; Cross, Carroll E.; Traber, Maret G.

    2009-01-01

    Hepatic proteins involved in xenobiotic pathways (Phases I, II, and III) are responsible for the metabolism and disposition of endogenous and exogenous compounds including dietary phytochemicals. To test the hypothesis that elevated ?-tocopherol intakes alter gene expression of hepatic xenobiotic pathways, mice were fed diets supplemented with either 1000 IU (++E) or 35 IU (E) all-rac-?-tocopheryl acetate for 4 month, liver RNA was isolated and gene expression determined using both whole genome microarray and real-time quantitative PCR (RT-qPCR) analyses. Hepatic ?-tocopherol (173 ± 18 vs. 21 ± 1 nmol/g, mean ± SE) and its metabolite (?-CEHC, 0.232 ± 0.046 vs. 0.031 ± .019 nmol/g) concentrations were ?8-fold higher following the ++E dietary treatment. In ++E relative to E mice, gene expression of Phase I enzymes, P450 oxidoreductase and cytochrome P450 (Cyp) 3a11, increased 1.6- and 4.0-fold, respectively; two Phase II genes, sulfotransferase 2a and glutathione S-transferase mu 3, increased 10.8- and 1.9-fold respectively; and a Phase III biliary transporter, Abcb1a, doubled. Thus, consumption of high-level dietary ?-tocopherol simultaneously coordinated Phase I, II and III gene expression. These data demonstrate that increased hepatic ?-tocopherol modulates its own concentrations through increasing xenobiotic metabolism, a process that may alter metabolism of other foreign compounds, such as therapeutic drugs and phytochemicals, in humans. PMID:18789671

  5. Role of acidic residues in the interaction of NADPH-cytochrome P450 oxidoreductase with cytochrome P450 and cytochrome c.

    PubMed

    Shen, A L; Kasper, C B

    1995-11-17

    Site-directed mutagenesis of the acidic clusters 207Asp-Asp-Asp209 and 213Glu-Glu-Asp215 of NADPH-cytochrome P450 oxidoreductase demonstrates that both cytochrome c and cytochrome P450 interact with this region; however, the sites and mechanisms of interaction of the two substrates are clearly distinct. Substitutions in the first acidic cluster did not affect cytochrome c or ferricyanide reductase activity, but substitution of asparagine for aspartate at position 208 reduced cytochrome P450-dependent benzphetamine N-demethylase activity by 63% with no effect on KP450m or KNADPHm. Substitutions in the second acidic cluster affected cytochrome c reduction but not benzphetamine N-demethylase or ferricyanide reductase activity. The E213Q enzyme exhibited a 59% reduction in cytochrome c reductase activity and a 47% reduction in KCyt cm under standard conditions (x0.27 M potassium phosphate, pH 7.7), as well as a decreased KCyt cm at every ionic strength and a shift of the salt dependence of cytochrome c reductase activity toward lower ionic strengths. The E214Q substitution did not affect cytochrome c reductase activity under standard conditions, but shifted the salt dependence of cytochrome c reductase activity toward higher ionic strengths. Measurements of the effect of ionic strength on steady-state kinetic properties indicated that increasing ionic strength destabilized the reductase-cytochrome c3+ ground state and reductase-cytochrome c transition state complexes for the wild-type, E213Q, and E214Q enzymes, suggesting the presence of electrostatic interactions involving Glu213 and Glu214 as well as additional residues outside this region. The ionic strength dependence of kcat/KCyt cm for the wild-type and E214Q enzymes is consistent with the presence of charge-pairing interactions in the transition state and removal of a weak ionic interaction in the reductase-cytochrome c transition-state complex by the E214Q substitution. The ionic strength dependence of the E213Q enzyme, however, is not consistent with a simple electrostatic model. Effects of ionic strength on kinetic properties of E213Q suggest that substitution of glutamine stabilizes the reductase-cytochrome c3+ ground-state complex, leading to a net increase in activation energy and decrease in kcat. Glu213 is also involved in a repulsive interaction with cytochrome c3+. Cytochrome c2+ Ki for the wild-type enzyme was 82.4 microM at 118 mM ionic strength and 10.8 microM at 749 mM ionic strength; similar values were observed for the E214Q enzyme. Cytochrome c Ki for the E213Q enzyme was 17.6 microM at 118 mM and 15.7 microM at 749 mM ionic strength, consistent with removal of an electrostatic repulsion between the reductase and cytochrome c2+. PMID:7499204

  6. Formation of 17-allylamino-demethoxygeldanamycin (17-AAG) hydroquinone by NAD(P)H:quinone oxidoreductase 1: role of 17-AAG hydroquinone in heat shock protein 90 inhibition.

    PubMed

    Guo, Wenchang; Reigan, Philip; Siegel, David; Zirrolli, Joseph; Gustafson, Daniel; Ross, David

    2005-11-01

    We have examined the role of NAD(P)H:quinone oxidoreductase 1 (NQO1) in the bioreductive metabolism of 17-allylamino-demethoxygeldanamycin (17-AAG). High-performance liquid chromatography (HPLC) analysis of the metabolism of 17-AAG by recombinant human NQO1 revealed the formation of a more polar metabolite 17-AAGH2. The formation of 17-AAGH2 was NQO1 dependent, and its formation could be inhibited by the addition of 5-methoxy-1,2-dimethyl-3-[(4-nitrophenoxy)methyl]indole-4,7-dione (ES936), a mechanism-based (suicide) inhibitor of NQO1. The reduction of 17-AAG to the corresponding hydroquinone 17-AAGH2 was confirmed by tandem liquid chromatography-mass spectrometry. 17-AAGH2 was relatively stable and only slowly underwent autooxidation back to 17-AAG over a period of hours. To examine the role of NQO1 in 17-AAG metabolism in cells, we used an isogenic pair of human breast cancer cell lines differing only in NQO1 levels. MDA468 cells lack NQO1 due to a genetic polymorphism, and MDA468/NQ16 cells are a stably transfected clone that express high levels of NQO1 protein. HPLC analysis of 17-AAG metabolism using cell sonicates and intact cells showed that 17-AAGH2 was formed by MDA468/NQ16 cells, and formation of 17-AAGH2 could be inhibited by ES936. No 17-AAGH2 was detected in sonicates or intact MDA468 cells. Following a 4-hour treatment with 17-AAG, the MDA468/NQ16 cells were 12-fold more sensitive to growth inhibition compared with MDA468 cells. More importantly, the increased sensitivity of MDA468/NQ16 cells to 17-AAG could be abolished if the cells were pretreated with ES936. Cellular markers of heat shock protein (Hsp) 90 inhibition, Hsp70 induction, and Raf-1 degradation were measured by immunoblot analysis. Marked Hsp70 induction and Raf-1 degradation was observed in MDA468/NQ16 cells but not in MDA468 cells. Similarly, downstream Raf-1 signaling molecules mitogen-activated protein kinase/extracellular signal-regulated kinase (ERK) kinase and ERK also showed decreased levels of phosphorylation in MDA468/NQ16 cells but not in MDA468 cells. The ability of 17-AAG and 17-AAGH2 to inhibit purified yeast and human Hsp90 ATPase activity was examined. Maximal 17-AAG-induced ATPase inhibition was observed in the presence of NQO1 and could be abrogated by ES936, showing that 17-AAGH2 was a more potent Hsp90 inhibitor compared with 17-AAG. Molecular modeling studies also showed that due to increased hydrogen bonding between the hydroquinone and the Hsp90 protein, 17-AAGH2 was bound more tightly to the ATP-binding site in both yeast and human Hsp90 models. In conclusion, these studies have shown that reduction of 17-AAG by NQO1 generates 17-AAGH2, a relatively stable hydroquinone that exhibits superior Hsp90 inhibition. PMID:16267026

  7. Single gene insertion drives bioalcohol production by a thermophilic archaeon

    SciTech Connect

    Basen, M; Schut, GJ; Nguyen, DM; Lipscomb, GL; Benn, RA; Prybol, CJ; Vaccaro, BJ; Poole, FL; Kelly, RM; Adams, MWW

    2014-12-09

    Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.

  8. Single gene insertion drives bioalcohol production by a thermophilic archaeon

    PubMed Central

    Basen, Mirko; Schut, Gerrit J.; Nguyen, Diep M.; Lipscomb, Gina L.; Benn, Robert A.; Prybol, Cameron J.; Vaccaro, Brian J.; Poole, Farris L.; Kelly, Robert M.; Adams, Michael W. W.

    2014-01-01

    Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 °C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways. PMID:25368184

  9. Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae

    PubMed Central

    Gonzalez-Perez, David; Alcalde, Miguel

    2014-01-01

    The ligninolytic enzymatic consortium produced by white-rot fungi is one of the most efficient oxidative systems found in nature, with many potential applications that range from the production of 2nd generation biofuels to chemicals synthesis. In the current study, two high redox potential oxidoreductase fusion genes (laccase -Lac- and versatile peroxidase -Vp-) that had been evolved in the laboratory were re-assembled in Saccharomyces cerevisiae. First, cell viability and secretion were assessed after co-transforming the Lac and Vp genes into yeast. Several expression cassettes were inserted in vivo into episomal bi-directional vectors in order to evaluate inducible promoter and/or terminator pairs of different strengths in an individual and combined manner. The synthetic white-rot yeast model harboring Vp(GAL1/CYC1)-Lac(GAL10/ADH1) displayed up to 1000 and 100 Units per L of peroxidase and laccase activity, respectively, representing a suitable point of departure for future synthetic biology studies. PMID:24830983

  10. Single gene insertion drives bioalcohol production by a thermophilic archaeon.

    PubMed

    Basen, Mirko; Schut, Gerrit J; Nguyen, Diep M; Lipscomb, Gina L; Benn, Robert A; Prybol, Cameron J; Vaccaro, Brian J; Poole, Farris L; Kelly, Robert M; Adams, Michael W W

    2014-12-01

    Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 °C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways. PMID:25368184

  11. Trichoderma genes

    DOEpatents

    Foreman, Pamela (Los Altos, CA); Goedegebuur, Frits (Vlaardingen, NL); Van Solingen, Pieter (Naaldwijk, NL); Ward, Michael (San Francisco, CA)

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  12. The Role of Glycine Residues 140 and 141 of Subunit B in the Functional Ubiquinone Binding Site of the Na+-pumping NADH:quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Neehaul, Yashvin; Turk, Erin; Chahboun, Najat; DeMicco, Jessica M.; Hellwig, Petra; Barquera, Blanca

    2012-01-01

    The Na+-pumping NADH:quinone oxidoreductase (Na+-NQR) is the main entrance for electrons into the respiratory chain of many marine and pathogenic bacteria. The enzyme accepts electrons from NADH and donates them to ubiquinone, and the free energy released by this redox reaction is used to create an electrochemical gradient of sodium across the cell membrane. Here we report the role of glycine 140 and glycine 141 of the NqrB subunit in the functional binding of ubiquinone. Mutations at these residues altered the affinity of the enzyme for ubiquinol. Moreover, mutations in residue NqrB-G140 almost completely abolished the electron transfer to ubiquinone. Thus, NqrB-G140 and -G141 are critical for the binding and reaction of Na+-NQR with its electron acceptor, ubiquinone. PMID:22645140

  13. Isolation and characterization of styrene metabolism genes from styrene-assimilating soil bacteria Rhodococcus sp. ST-5 and ST-10.

    PubMed

    Toda, Hiroshi; Itoh, Nobuya

    2012-01-01

    Styrene metabolism genes were isolated from styrene-assimilating bacteria Rhodococcus sp. ST-5 and ST-10. Strain ST-5 had a gene cluster containing four open reading frames which encoded styrene degradation enzymes. The genes showed high similarity to styABCD of Pseudomonas sp. Y2. On the other hand, strain ST-10 had only two genes which encoded styrene monooxygenase and flavin oxidoreductase (styAB). Escherichia coli transformants possessing the sty genes of strains ST-5 and ST-10 produced (S)-styrene oxide from styrene, indicating that these genes function as styrene degradation enzymes. Metabolite analysis by resting-cell reaction with gas chromatography-mass spectrometry revealed that strain ST-5 converts styrene to phenylacetaldehyde via styrene oxide by styrene oxide isomerase (styC) reaction. On the other hand, strain ST-10 lacked this enzyme, and thus accumulated styrene oxide as an intermediate. HPLC analysis showed that styrene oxide was spontaneously isomerized to phenylacetaldehyde by chemical reaction. The produced phenylacetaldehyde was converted to phenylacetic acid (PAA) in strain ST-10 as well as in strain ST-5. Furthermore, phenylacetic acid was converted to phenylacetyl-CoA by the catalysis of phenylacetate-CoA ligase in strains ST-5 and ST-10. This study proposes possible styrene metabolism pathways in Rhodococcus sp. strains ST-5 and ST-10. PMID:21996027

  14. Metabolic gene variants associated with chromosomal aberrations in healthy humans.

    PubMed

    Hemminki, Kari; Frank, Christoph; Försti, Asta; Musak, Ludovit; Kazimirova, Alena; Barancokova, Magdalena; Horska, Alexandra; Vymetalkova, Veronika; Smerhovsky, Zdenek; Naccarati, Alessio; Soucek, Pavel; Vodickova, Ludmila; Buchancova, Janka; Smolkova, Bozena; Dusinska, Maria; Vodicka, Pavel

    2015-04-01

    Nonspecific chromosomal aberrations (CAs) are found in about 1% of lymphocytes drawn from healthy individuals. They include chromosome-type aberrations (CSAs), which are increased in exposure to ionizing radiation, and chromatid-type aberrations (CTAs) which in experimental systems are formed by DNA binding carcinogens and mutagens. The frequency of CAs is associated with the risk of cancer, but the causes of CAs in general population are unknown. Here, we want to test whether variants in metabolic genes associate with CAs in healthy volunteers. Cases were considered those whose total CA (CAtot) frequency was >2% and for CSA and CTA the limit was >1%. Controls had lower frequencies of CAs. Functional polymorphisms in seven genes were selected for analysis: cytochrome P450 1B1 (CYP1B1), epoxide hydrolase 1 (EPHX1), NAD(P)H:quinone oxidoreductase 1 (NQO1), each coding for phase 1 enzymes, and glutathione S-transferase P1 (GSTP1), glutathione S-transferases M1 (GSTM1) and T1 (GSTT1), coding for enzymes which conjugate reactive metabolites, that is, phase 2 enzymes. The number of volunteers genotyped for each gene varied from 550 to 1,500. Only EPHX1 was individually associated with CAtot; high activity genotypes decreased CAtot. A total of six significant (P < 0.01) pair-wise interactions were observed, most including a GST variant as one of the pair. In all genotype combinations with significant odds ratios for CAs a GST variant was involved. The present data provide evidence that variants in genes coding for metabolic enzymes, which individually have small effects, interact and are associated with CA frequencies in peripheral lymphocytes of healthy volunteers. PMID:25622915

  15. Pseudomonas aeruginosa LysR PA4203 Regulator NmoR Acts as a Repressor of the PA4202 nmoA Gene, Encoding a Nitronate Monooxygenase

    PubMed Central

    Vercammen, Ken; Wei, Qing; Charlier, Daniel; Dötsch, Andreas; Haüssler, Susanne; Schulz, Sebastian; Salvi, Francesca; Gadda, Giovanni; Spain, Jim; Rybtke, Morten Levin; Tolker-Nielsen, Tim; Dingemans, Jozef; Ye, Lumeng

    2014-01-01

    The PA4203 gene encodes a LysR regulator and lies between the ppgL gene (PA4204), which encodes a periplasmic gluconolactonase, and, in the opposite orientation, the PA4202 (nmoA) gene, coding for a nitronate monooxygenase, and ddlA (PA4201), encoding a d-alanine alanine ligase. The intergenic regions between PA4203 and ppgL and between PA4203 and nmoA are very short (79 and 107 nucleotides, respectively). Here we show that PA4203 (nmoR) represses its own transcription and the expression of nmoA. A chromatin immunoprecipitation analysis showed the presence of a single NmoR binding site between nmoA and nmoR, which was confirmed by electrophoretic mobility shift assays (EMSAs) with the purified NmoR protein. Despite this observation, a transcriptome analysis revealed more genes to be affected in an nmoR mutant, including genes known to be part of the MexT LysR activator regulon. The PA1225 gene, encoding a quinone oxidoreductase, was the most highly upregulated gene in the nmoR deletion mutant, independently of MexT. Finally, deletion of the nmoA gene resulted in an increased sensitivity of the cells to 3-nitropropionic acid (3-NPA), confirming the role of the nitronate monooxygenase protein in the detoxification of nitronate. PMID:25384477

  16. Pseudomonas aeruginosa LysR PA4203 regulator NmoR acts as a repressor of the PA4202 nmoA gene, encoding a nitronate monooxygenase.

    PubMed

    Vercammen, Ken; Wei, Qing; Charlier, Daniel; Dötsch, Andreas; Haüssler, Susanne; Schulz, Sebastian; Salvi, Francesca; Gadda, Giovanni; Spain, Jim; Rybtke, Morten Levin; Tolker-Nielsen, Tim; Dingemans, Jozef; Ye, Lumeng; Cornelis, Pierre

    2015-03-01

    The PA4203 gene encodes a LysR regulator and lies between the ppgL gene (PA4204), which encodes a periplasmic gluconolactonase, and, in the opposite orientation, the PA4202 (nmoA) gene, coding for a nitronate monooxygenase, and ddlA (PA4201), encoding a d-alanine alanine ligase. The intergenic regions between PA4203 and ppgL and between PA4203 and nmoA are very short (79 and 107 nucleotides, respectively). Here we show that PA4203 (nmoR) represses its own transcription and the expression of nmoA. A chromatin immunoprecipitation analysis showed the presence of a single NmoR binding site between nmoA and nmoR, which was confirmed by electrophoretic mobility shift assays (EMSAs) with the purified NmoR protein. Despite this observation, a transcriptome analysis revealed more genes to be affected in an nmoR mutant, including genes known to be part of the MexT LysR activator regulon. The PA1225 gene, encoding a quinone oxidoreductase, was the most highly upregulated gene in the nmoR deletion mutant, independently of MexT. Finally, deletion of the nmoA gene resulted in an increased sensitivity of the cells to 3-nitropropionic acid (3-NPA), confirming the role of the nitronate monooxygenase protein in the detoxification of nitronate. PMID:25384477

  17. Transcriptome Analysis of Integument Differentially Expressed Genes in the Pigment Mutant (quail) during Molting of Silkworm, Bombyx mori

    PubMed Central

    Cheng, Tingcai; Li, Qiongyan; Wu, Yuqian; Zhou, Mengting; Zhang, Yinxia; Xia, Qingyou

    2014-01-01

    In the silkworm Bombyx mori, pigment mutants with diverse body colors have been maintained throughout domestication for about 5000 years. The silkworm larval body color is formed through the mutual interaction of melanin, ommochromes, pteridines and uric acid. These pigments/compounds are synthesized by the cooperative action of various genes and enzymes. Previous reports showed that melanin, ommochrome and pteridine are increased in silkworm quail (q) mutants. To understand the pigment increase and alterations in pigment synthesis in q mutant, transcriptome profiles of the silkworm integument were investigated at 16 h after head capsule slippage in the fourth molt in q mutants and wild-type (Dazao). Compared to the wild-type, 1161 genes were differentially expressed in the q mutant. Of these modulated genes, 62.4% (725 genes) were upregulated and 37.6% (436 genes) were downregulated in the q mutant. The molecular function of differently expressed genes was analyzed by Blast2GO. The results showed that upregulated genes were mainly involved in protein binding, small molecule binding, transferase activity, nucleic acid binding, specific DNA-binding transcription factor activity and chromatin binding, while exclusively down-expressed genes functioned in oxidoreductase activity, cofactor binding, tetrapyrrole binding, peroxidase activity and pigment binding. We focused on genes related to melanin, pteridine and ommochrome biosynthesis; transport of uric acid; and juvenile hormone metabolism because of their importance in integument coloration during molting. This study identified differently expressed genes implicated in silkworm integument formation and pigmentation using silkworm q mutant. The results estimated the number and types of genes that drive new integument formation. PMID:24718369

  18. Studying Genes

    MedlinePLUS

    ... one generation to the next. What is a genome? A genome is all of the genetic material in an ... activity of genes. Does everybody have the same genome? While the human genome is mostly the same ...

  19. Identification of Plasmopara viticola genes potentially involved in pathogenesis on grapevine suggests new similarities between oomycetes and true fungi.

    PubMed

    Luis, P; Gauthier, A; Trouvelot, S; Poinssot, B; Frettinger, P

    2013-10-01

    Plant diseases caused by fungi and oomycetes result in significant economic losses every year. Although phylogenetically distant, these organisms share many common features during infection. We identified genes in the oomycete Plasmopara viticola that are potentially involved in pathogenesis in grapevine by using fungal databases and degenerate primers. Fragments of P. viticola genes encoding NADH-ubiquinone oxidoreductase (PvNuo), laccase (PvLac), and invertase (PvInv) were obtained. PvNuo was overexpressed at 2 days postinoculation (dpi), during the development of the first hyphal structures and haustoria. PvLac was overexpressed at 5 dpi when genes related to pterostilbene biosynthesis were induced in grapevine. Transcript level for PvInv increased between 1 and 4 dpi before reaching a plateau. These results might suggest a finely tuned strategy of infection depending on nutrition and plant response. Phylogenetic analyses of PvNuo showed that P. viticola clustered with other oomycetes and was associated with brown algae and diatoms, forming a typical Straminipila clade. Based on the comparison of available sequences for laccases and invertases, the group formed by P. viticola and other oomycetes tended to be more closely related to Opisthokonta than to Straminipila. Convergent evolution or horizontal gene transfer could explain the presence of fungus-like genes in P. viticola. PMID:23634808

  20. The WWOX Gene Modulates HDL and Lipid Metabolism

    PubMed Central

    Iatan, Iulia; Choi, Hong Y.; Ruel, Isabelle; Linga Reddy, M.V. Prasad; Kil, Hyunsuk; Lee, Jaeho; Abu Odeh, Mohammad; Salah, Zaidoun; Abu-Remaileh, Muhannad; Weissglas-Volkov, Daphna; Nikkola, Elina; Civelek, Mete; Awan, Zuhier; Croce, Carlo M.; Aqeilan, Rami I.; Pajukanta, Päivi; Aldaz, C. Marcelo; Genest, Jacques

    2014-01-01

    Background Low high-density lipoprotein-cholesterol (HDL-C) constitutes a major risk factor for atherosclerosis. Recent studies from our group reported a genetic association between the WW domain-containing oxidoreductase (WWOX) gene and HDL-C levels. Here, through next-generation resequencing, in vivo functional studies and gene microarray analyses, we investigated the role of WWOX in HDL and lipid metabolism. Methods and Results Using next-generation resequencing of the WWOX region, we first identified 8 variants significantly associated and perfectly segregating with the low-HDL trait in two multi-generational French Canadian dyslipidemic families. To understand in vivo functions of WWOX, we used liver-specific Wwoxhep?/? and total Wwox?/? mice models, where we found decreased ApoA-I and ABCA1 levels in hepatic tissues. Analyses of lipoprotein profiles in Wwox?/?, but not Wwox hep?/? littermates, also showed marked reductions in serum HDL-C concentrations, concordant with the low-HDL findings observed in families. We next obtained evidence of a gender-specific effect in female Wwoxhep?/? mice, where an increase in plasma triglycerides and altered lipid metabolic pathways by microarray analyses were observed. We further identified a significant reduction in ApoA-I and LPL, and upregulation in Fas, Angptl4 and Lipg, suggesting that the effects of Wwox involve multiple pathways, including cholesterol homeostasis, ApoA-I/ABCA1 pathway, and fatty acid biosynthesis/triglyceride metabolism. Conclusions Our data indicate that WWOX disruption alters HDL and lipoprotein metabolism through several mechanisms and may account for the low-HDL phenotype observed in families expressing the WWOX variants. These findings thus describe a novel gene involved in cellular lipid homeostasis, which effects may impact atherosclerotic disease development. PMID:24871327

  1. Transcriptomic analysis of Arabidopsis developing stems: a close-up on cell wall genes

    PubMed Central

    Minic, Zoran; Jamet, Elisabeth; San-Clemente, Hélène; Pelletier, Sandra; Renou, Jean-Pierre; Rihouey, Christophe; Okinyo, Denis PO; Proux, Caroline; Lerouge, Patrice; Jouanin, Lise

    2009-01-01

    Background Different strategies (genetics, biochemistry, and proteomics) can be used to study proteins involved in cell biogenesis. The availability of the complete sequences of several plant genomes allowed the development of transcriptomic studies. Although the expression patterns of some Arabidopsis thaliana genes involved in cell wall biogenesis were identified at different physiological stages, detailed microarray analysis of plant cell wall genes has not been performed on any plant tissues. Using transcriptomic and bioinformatic tools, we studied the regulation of cell wall genes in Arabidopsis stems, i.e. genes encoding proteins involved in cell wall biogenesis and genes encoding secreted proteins. Results Transcriptomic analyses of stems were performed at three different developmental stages, i.e., young stems, intermediate stage, and mature stems. Many genes involved in the synthesis of cell wall components such as polysaccharides and monolignols were identified. A total of 345 genes encoding predicted secreted proteins with moderate or high level of transcripts were analyzed in details. The encoded proteins were distributed into 8 classes, based on the presence of predicted functional domains. Proteins acting on carbohydrates and proteins of unknown function constituted the two most abundant classes. Other proteins were proteases, oxido-reductases, proteins with interacting domains, proteins involved in signalling, and structural proteins. Particularly high levels of expression were established for genes encoding pectin methylesterases, germin-like proteins, arabinogalactan proteins, fasciclin-like arabinogalactan proteins, and structural proteins. Finally, the results of this transcriptomic analyses were compared with those obtained through a cell wall proteomic analysis from the same material. Only a small proportion of genes identified by previous proteomic analyses were identified by transcriptomics. Conversely, only a few proteins encoded by genes having moderate or high level of transcripts were identified by proteomics. Conclusion Analysis of the genes predicted to encode cell wall proteins revealed that about 345 genes had moderate or high levels of transcripts. Among them, we identified many new genes possibly involved in cell wall biogenesis. The discrepancies observed between results of this transcriptomic study and a previous proteomic study on the same material revealed post-transcriptional mechanisms of regulation of expression of genes encoding cell wall proteins. PMID:19149885

  2. Tyrosine phosphorylation controls nuclear export of Fyn, allowing Nrf2 activation of cytoprotective gene expression.

    PubMed

    Kaspar, James W; Jaiswal, Anil K

    2011-03-01

    Fyn, an Src kinase family member, acts as a negative regulator of NF-E2-related factor 2 (Nrf2). Under stressful conditions, Nrf2 translocates into the nucleus and binds to the antioxidant response element (ARE), activating defensive gene expression. Once Nrf2 completes activation, Fyn phosphorylates tyrosine 568 of Nrf2, resulting in the nuclear export and degradation of Nrf2. The present studies demonstrate that within 0.5 h of antioxidant treatment in human hepatoblastoma (HepG2) cells, Fyn exports out of the nucleus, allowing Nrf2 unimpeded movement to the ARE. Mutation of tyrosine 213 of Fyn stymied nuclear export, suggesting that tyrosine phosphorylation controls nuclear export. Mass spectrometry confirmed tyrosine 213 as the site of phosphorylation. ChIP and real-time PCR assays revealed that FynY213A mutant caused decreased binding of Nrf2 to the promoter of defensive gene NAD(P)H:quinone oxidoreductase 1 (NQO1) and decreased NQO1 expression by 5-fold (P<0.0001) compared to wild-type Fyn. In addition, a putative nuclear export signal (NES) was identified, and mutation of it also inhibited nuclear export of Fyn. Furthermore, FynY213A caused an increased susceptibility to cell death following treatment with etoposide in mouse hepatoma (Hepa-1) cells. The preinduction regulation of Nrf2 is controlled by the nuclear export of Fyn, allowing for activation of defensive gene expression. PMID:21097520

  3. Cloning and sequencing of Coxiella burnetii outer membrane protein gene com1.

    PubMed Central

    Hendrix, L R; Mallavia, L P; Samuel, J E

    1993-01-01

    The gene for an approximately 27-kDa outer membrane-associated, immunoreactive protein was cloned from the rickettsial pathogen Coxiella burnetii. The gene, designated com1 for Coxiella outer membrane protein 1, was expressed in Escherichia coli, presumably by its own promoter. The complete nucleotide sequence of the gene was determined. The deduced amino acid sequence of 252 residues includes a putative leader sequence. The leader sequence is recognized in and removed by E. coli on the basis of the difference in the molecular mass of the protein produced in an in vitro transcription-translation system (27.6 kDa) and that of the protein immunoprecipitated from an iodinated E. coli clone (25.7 kDa). The Com1 protein expressed in E. coli was proteinase K sensitive in nondisrupted cells and soluble in 1% Sarkosyl, suggesting a loose association with the outer membrane. While the complete predicted sequence of the Com1 protein does not show any overall similarity to those of previously described proteins, a region which includes the only two cysteines in Com1 is homologous to the catalytic site of protein disulfide oxidoreductases. Images PMID:8423075

  4. Temperature and Development Impacts on Housekeeping Gene Expression in Cowpea Aphid, Aphis craccivora (Hemiptera: Aphidiae).

    PubMed

    Yang, Chunxiao; Pan, Huipeng; Liu, Yong; Zhou, Xuguo

    2015-01-01

    Quantitative real-time PCR (qRT-PCR) is a powerful technique to quantify gene expression. To standardize gene expression studies and obtain more accurate qRT-PCR analysis, normalization relative to consistently expressed housekeeping genes (HKGs) is required. In this study, ten candidate HKGs including elongation factor 1 ? (EF1A), ribosomal protein L11 (RPL11), ribosomal protein L14 (RPL14), ribosomal protein S8 (RPS8), ribosomal protein S23 (RPS23), NADH-ubiquinone oxidoreductase (NADH), vacuolar-type H+-ATPase (ATPase), heat shock protein 70 (HSP70), 18S ribosomal RNA (18S), and 12S ribosomal RNA (12S) from the cowpea aphid, Aphis craccivora Koch were selected. Four algorithms, geNorm, Normfinder, BestKeeper, and the ?Ct method were employed to evaluate the expression profiles of these HKGs as endogenous controls across different developmental stages and temperature regimes. Based on RefFinder, which integrates all four analytical algorithms to compare and rank the candidate HKGs, RPS8, RPL14, and RPL11 were the three most stable HKGs across different developmental stages and temperature conditions. This study is the first step to establish a standardized qRT-PCR analysis in A. craccivora following the MIQE guideline. Results from this study lay a foundation for the genomics and functional genomics research in this sap-sucking insect pest with substantial economic impact. PMID:26090683

  5. Temperature and Development Impacts on Housekeeping Gene Expression in Cowpea Aphid, Aphis craccivora (Hemiptera: Aphidiae)

    PubMed Central

    Liu, Yong; Zhou, Xuguo

    2015-01-01

    Quantitative real-time PCR (qRT-PCR) is a powerful technique to quantify gene expression. To standardize gene expression studies and obtain more accurate qRT-PCR analysis, normalization relative to consistently expressed housekeeping genes (HKGs) is required. In this study, ten candidate HKGs including elongation factor 1 ? (EF1A), ribosomal protein L11 (RPL11), ribosomal protein L14 (RPL14), ribosomal protein S8 (RPS8), ribosomal protein S23 (RPS23), NADH-ubiquinone oxidoreductase (NADH), vacuolar-type H+-ATPase (ATPase), heat shock protein 70 (HSP70), 18S ribosomal RNA (18S), and 12S ribosomal RNA (12S) from the cowpea aphid, Aphis craccivora Koch were selected. Four algorithms, geNorm, Normfinder, BestKeeper, and the ?Ct method were employed to evaluate the expression profiles of these HKGs as endogenous controls across different developmental stages and temperature regimes. Based on RefFinder, which integrates all four analytical algorithms to compare and rank the candidate HKGs, RPS8, RPL14, and RPL11 were the three most stable HKGs across different developmental stages and temperature conditions. This study is the first step to establish a standardized qRT-PCR analysis in A. craccivora following the MIQE guideline. Results from this study lay a foundation for the genomics and functional genomics research in this sap-sucking insect pest with substantial economic impact. PMID:26090683

  6. Attention Genes

    ERIC Educational Resources Information Center

    Posner, Michael I.; Rothbart, Mary K.; Sheese, Brad E.

    2007-01-01

    A major problem for developmental science is understanding how the cognitive and emotional networks important in carrying out mental processes can be related to individual differences. The last five years have seen major advances in establishing links between alleles of specific genes and the neural networks underlying aspects of attention. These…

  7. Designer Genes.

    ERIC Educational Resources Information Center

    Miller, Judith; Miller, Mark

    1983-01-01

    Genetic technologies may soon help fill some of the most important needs of humanity from food to energy to health care. The research of major designer genes companies and reasons why the initial mad rush for biotechnology has slowed are reviewed. (SR)

  8. Inhibition of protein translation by the DISC1-Boymaw fusion gene from a Scottish family with major psychiatric disorders

    PubMed Central

    Ji, Baohu; Higa, Kerin K.; Kim, Minjung; Zhou, Lynn; Young, Jared W.; Geyer, Mark A.; Zhou, Xianjin

    2014-01-01

    The t(1; 11) translocation appears to be the causal genetic lesion with 70% penetrance for schizophrenia, major depression and other psychiatric disorders in a Scottish family. Molecular studies identified the disruption of the disrupted-in-schizophrenia 1 (DISC1) gene by chromosome translocation at chromosome 1q42. Our previous studies, however, revealed that the translocation also disrupted another gene, Boymaw (also termed DISC1FP1), on chromosome 11. After translocation, two fusion genes [the DISC1-Boymaw (DB7) and the Boymaw-DISC1 (BD13)] are generated between the DISC1 and Boymaw genes. In the present study, we report that expression of the DB7 fusion gene inhibits both intracellular NADH oxidoreductase activities and protein translation. We generated humanized DISC1-Boymaw mice with gene targeting to examine the in vivo functions of the fusion genes. Consistent with the in vitro studies on the DB7 fusion gene, protein translation activity is decreased in the hippocampus and in cultured primary neurons from the brains of the humanized mice. Expression of Gad67, Nmdar1 and Psd95 proteins are also reduced. The humanized mice display prolonged and increased responses to the NMDA receptor antagonist, ketamine, on various mouse genetic backgrounds. Abnormal information processing of acoustic startle and depressive-like behaviors are also observed. In addition, the humanized mice display abnormal erythropoiesis, which was reported to associate with depression in humans. Expression of the DB7 fusion gene may reduce protein translation to impair brain functions and thereby contribute to the pathogenesis of major psychiatric disorders. PMID:24908665

  9. Inhibition of protein translation by the DISC1-Boymaw fusion gene from a Scottish family with major psychiatric disorders.

    PubMed

    Ji, Baohu; Higa, Kerin K; Kim, Minjung; Zhou, Lynn; Young, Jared W; Geyer, Mark A; Zhou, Xianjin

    2014-11-01

    The t(1; 11) translocation appears to be the causal genetic lesion with 70% penetrance for schizophrenia, major depression and other psychiatric disorders in a Scottish family. Molecular studies identified the disruption of the disrupted-in-schizophrenia 1 (DISC1) gene by chromosome translocation at chromosome 1q42. Our previous studies, however, revealed that the translocation also disrupted another gene, Boymaw (also termed DISC1FP1), on chromosome 11. After translocation, two fusion genes [the DISC1-Boymaw (DB7) and the Boymaw-DISC1 (BD13)] are generated between the DISC1 and Boymaw genes. In the present study, we report that expression of the DB7 fusion gene inhibits both intracellular NADH oxidoreductase activities and protein translation. We generated humanized DISC1-Boymaw mice with gene targeting to examine the in vivo functions of the fusion genes. Consistent with the in vitro studies on the DB7 fusion gene, protein translation activity is decreased in the hippocampus and in cultured primary neurons from the brains of the humanized mice. Expression of Gad67, Nmdar1 and Psd95 proteins are also reduced. The humanized mice display prolonged and increased responses to the NMDA receptor antagonist, ketamine, on various mouse genetic backgrounds. Abnormal information processing of acoustic startle and depressive-like behaviors are also observed. In addition, the humanized mice display abnormal erythropoiesis, which was reported to associate with depression in humans. Expression of the DB7 fusion gene may reduce protein translation to impair brain functions and thereby contribute to the pathogenesis of major psychiatric disorders. PMID:24908665

  10. The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

    PubMed

    Chen, Y M; Zhu, Y; Lin, E C

    1987-12-01

    In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans. PMID:3325779

  11. Differential gene expression in Giardia lamblia under oxidative stress: significance in eukaryotic evolution.

    PubMed

    Raj, Dibyendu; Ghosh, Esha; Mukherjee, Avik K; Nozaki, Tomoyoshi; Ganguly, Sandipan

    2014-02-10

    Giardia lamblia is a unicellular, early branching eukaryote causing giardiasis, one of the most common human enteric diseases. Giardia, a microaerophilic protozoan parasite has to build up mechanisms to protect themselves against oxidative stress within the human gut (oxygen concentration 60 ?M) to establish its pathogenesis. G. lamblia is devoid of the conventional mechanisms of the oxidative stress management system, including superoxide dismutase, catalase, peroxidase, and glutathione cycling, which are present in most eukaryotes. NADH oxidase is a major component of the electron transport chain of G. lamblia, which in concurrence with disulfide reductase, protects oxygen-labile proteins such as pyruvate: ferredoxin oxidoreductase against oxidative stress by sustaining a reduced intracellular environment. It also contains the arginine dihydrolase pathway, which occurs in a number of anaerobic prokaryotes, includes substrate level phosphorylation and adequately active to make a major contribution to ATP production. To study differential gene expression under three types of oxidative stress, a Giardia genomic DNA array was constructed and hybridized with labeled cDNA of cells with or without stress. The transcriptomic data has been analyzed and further validated using real time PCR. We identified that out of 9216 genes represented on the array, more than 200 genes encoded proteins with functions in metabolism, oxidative stress management, signaling, reproduction and cell division, programmed cell death and cytoskeleton. We recognized genes modulated by at least ? 2 fold at a significant time point in response to oxidative stress. The study has highlighted the genes that are differentially expressed during the three experimental conditions which regulate the stress management pathway differently to achieve redox homeostasis. Identification of some unique genes in oxidative stress regulation may help in new drug designing for this common enteric parasite prone to drug resistance. Additionally, these data suggest the major role of this early divergent ancient eukaryote in anaerobic to aerobic organism evolution. PMID:24321693

  12. Gene and protein expression profiles of Shewanella oneidensis during anaerobic growth with different electron acceptors.

    SciTech Connect

    Beliaev, A. S.; Thompson, D. K.; Khare, T.; Lim, H.; Brandt, C. C.; Li, G.; Murray, A. E.; Heidelberg, J. F.; Giometti, C. S.; Yates, J., III; Nealson, K. H.; Tiedje, J. M.; Zhou, J.; Biosciences Division; ORNL; Scripps Research Inst.; Michigan State Univ.; The Inst. for Genomic Research; Jet Propulsion Laboratory; California Inst. of Tech.

    2002-01-01

    Changes in mRNA and protein expression profiles of Shewanella oneidenesis MR-1 during switch from aerobic to fumarate-, Fe(III)-, or nitrate-reducing conditions were examined using DNA microarrays and two-dimensional polyacrylamide gel electrophoresis (2-D PAGE). In response to changes in growth conditions, 121 of the 691 arrayed genes displayed at least a two-fold difference in transcript abundance as determined by microarray analysis. Genes involved in aerobic respiration encoding cytochrome c and d oxidases and TCA cycle enzymes were repressed under anaerobic conditions. Genes induced during anaerobic respiration included those involved in cofactor biosynthesis and assembly (moaACE, ccmHF, nosD, cysG), substrate transport (cysUP, cysTWA, dcuB), and anaerobic energy metabolism (dmsAB, psrC, pshA, hyaABC, hydA). Transcription of genes encoding a periplasmic nitrate reductase (napBHGA), cytochrome c{sub 552}, and prismane was elevated 8- to 56-fold in response to the presence of nitrate, while cymA, ifcA, and frdA were specifically induced three- to eightfold under fumarate-reducing conditions. The mRNA levels for two oxidoreductase-like genes of unknown function and several cell envelope genes involved in multidrug resistance increased two- to fivefold specifically under Fe(III)-reducing conditions. Analysis of protein expression profiles under aerobic and anaerobic conditions revealed 14 protein spots that showed significant differences in abundance on 2-D gels. Protein identification by mass spectrometry indicated that the expression of prismane, dihydrolipoamide succinyltransferase, and alcaligin siderophore biosynthesis protein correlated with the microarray data.

  13. What Is a Gene?

    MedlinePLUS

    ... their lungs as healthy as possible. What Is Gene Therapy? Gene therapy is a new kind of medicine — so new ... tested is replacing sick genes with healthy ones. Gene therapy trials — where the research is tested on people — ...

  14. Genes and Psoriasis

    MedlinePLUS

    ... Diet Tips" to find out more! Email * Zipcode Genes and Psoriasis Genes hold the key to understanding ... is responsible for causing psoriatic disease. How do genes work? Genes control everything from height to eye ...

  15. Genes and Hearing Loss

    MedlinePLUS

    ... Meeting Calendar Find an ENT Doctor Near You Genes and Hearing Loss Genes and Hearing Loss Patient ... mutation may only have dystopia canthorum. How Do Genes Work? Genes are a road map for the ...

  16. Role of the C-terminal extension stacked on the re-face of the isoalloxazine ring moiety of the flavin adenine dinucleotide prosthetic group in ferredoxin-NADP(+) oxidoreductase from Bacillus subtilis.

    PubMed

    Seo, Daisuke; Asano, Tomoya; Komori, Hirofumi; Sakurai, Takeshi

    2014-08-01

    Ferredoxin-NADP(+) oxidoreductase [EC 1.18.1.2] from Bacillus subtilis (BsFNR) is homologous to the bacterial NADPH-thioredoxin reductase, but possesses a unique C-terminal extension that covers the re-face of the isoalloxazine ring moiety of the flavin adenine dinucleotide (FAD) prosthetic group. In this report, we utilize BsFNR mutants depleted of their C-terminal residues to examine the importance of the C-terminal extension in reactions with NADPH and ferredoxin (Fd) from B. subtilis by spectroscopic and steady-state reaction analyses. The depletions of residues Y313 to K332 (whole C-terminal extension region) and S325 to K332 (His324 intact) resulted in significant increases in the catalytic efficiency with NADPH in diaphorase assay with ferricyanide, whereas Km values for ferricyanide were increased. In the cytochrome c reduction assay in the presence of B. subtilis ferredoxin, the S325-K332 depleted mutant displayed a significant decrease in the turnover rate with an Fd concentration range of 1-10 ?M. The Y313-K332 depleted mutant demonstrated an increase in the rate of the direct reduction of horse heart cytochrome c in the absence of Fd. These data indicated that depletion of the C-terminal extension plays an important role in the reaction of BsFNR with ferredoxin. PMID:24529496

  17. The Conformational Changes Induced by Ubiquinone Binding in the Na+-pumping NADH:Ubiquinone Oxidoreductase (Na+-NQR) Are Kinetically Controlled by Conserved Glycines 140 and 141 of the NqrB Subunit*

    PubMed Central

    Strickland, Madeleine; Juárez, Oscar; Neehaul, Yashvin; Cook, Darcie A.; Barquera, Blanca; Hellwig, Petra

    2014-01-01

    Na+-pumping NADH:ubiquinone oxidoreductase (Na+-NQR) is responsible for maintaining a sodium gradient across the inner bacterial membrane. This respiratory enzyme, which couples sodium pumping to the electron transfer between NADH and ubiquinone, is not present in eukaryotes and as such could be a target for antibiotics. In this paper it is shown that the site of ubiquinone reduction is conformationally coupled to the NqrB subunit, which also hosts the final cofactor in the electron transport chain, riboflavin. Previous work showed that mutations in conserved NqrB glycine residues 140 and 141 affect ubiquinone reduction and the proper functioning of the sodium pump. Surprisingly, these mutants did not affect the dissociation constant of ubiquinone or its analog HQNO (2-n-heptyl-4-hydroxyquinoline N-oxide) from Na+-NQR, which indicates that these residues do not participate directly in the ubiquinone binding site but probably control its accessibility. Indeed, redox-induced difference spectroscopy showed that these mutations prevented the conformational change involved in ubiquinone binding but did not modify the signals corresponding to bound ubiquinone. Moreover, data are presented that demonstrate the NqrA subunit is able to bind ubiquinone but with a low non-catalytically relevant affinity. It is also suggested that Na+-NQR contains a single catalytic ubiquinone binding site and a second site that can bind ubiquinone but is not active. PMID:25006248

  18. Variation in P450 oxidoreductase (POR) A503V and flavin containing monooxygenase (FMO)-3 E158K is associated with minor alterations in nicotine metabolism but does not alter cigarette consumption

    PubMed Central

    Chenoweth, Meghan J.; Zhu, Andy Z. X.; Cox, Lisa Sanderson; Ahluwalia, Jasjit S.; Benowitz, Neal L.; Tyndale, Rachel F.

    2014-01-01

    Nicotine metabolism rates differ widely, even after controlling for genetic variation in the major nicotine metabolizing enzyme, CYP2A6. Genetic variants in an additional nicotine metabolizing enzyme, flavin containing monooxygenase (FMO)-3, and an obligate microsomal CYP-supportive enzyme, cytochrome P450 oxidoreductase (POR), were investigated. We examined the impact of FMO3 E158K and POR A503V, before and after stratifying by CYP2A6 metabolism group. In 130 non-smokers of African descent who received 4 mg oral nicotine, FMO3 158K trended towards slower nicotine metabolism in reduced CYP2A6 metabolizers (P=0.07) only, whereas POR 503V was associated with faster CYP2A6 activity (nicotine metabolite ratio) in normal (P=0.03), but not reduced, CYP2A6 metabolizers. Neither FMO3 158K nor POR 503V significantly altered the nicotine metabolic ratio (N=659), cigarette consumption (N=667), or urine total nicotine equivalents (N=418) in smokers of African descent. Thus, FMO3 E158K and POR A503V are minor sources of nicotine metabolism variation, insufficient to appreciably alter smoking. PMID:24448396

  19. Metformin Inhibits the Production of Reactive Oxygen Species from NADH:Ubiquinone Oxidoreductase to Limit Induction of Interleukin-1? (IL-1?) and Boosts Interleukin-10 (IL-10) in Lipopolysaccharide (LPS)-activated Macrophages.

    PubMed

    Kelly, Beth; Tannahill, Gillian M; Murphy, Michael P; O'Neill, Luke A J

    2015-08-14

    Metformin, a frontline treatment for type II diabetes mellitus, decreases production of the pro-form of the inflammatory cytokine IL-1? in response to LPS in macrophages. We found that it specifically inhibited pro-IL-1? production, having no effect on TNF-?. Furthermore, metformin boosted induction of the anti-inflammatory cytokine IL-10 in response to LPS. We ruled out a role for AMP-activated protein kinase (AMPK) in the effect of metformin because activation of AMPK with A769662 did not mimic metformin here. Furthermore, metformin was still inhibitory in AMKP?1- or AMPK?1-deficient cells. The activity of NADH:ubiquinone oxidoreductase (complex I) was inhibited by metformin. Another complex I inhibitor, rotenone, mimicked the effect of metformin on pro-IL-1? and IL-10. LPS induced reactive oxygen species production, an effect inhibited by metformin or rotenone pretreatment. MitoQ, a mitochondrially targeted antioxidant, decreased LPS-induced IL-1? without affecting TNF-?. These results, therefore, implicate complex I in LPS action in macrophages. PMID:26152715

  20. RAP-PCR fingerprinting reveals time-dependent expression of development-related genes following differentiation process of Bacillus thuringiensis.

    PubMed

    Huang, Tianpei; Yu, Xiaomin; Gelbi?, Ivan; Guan, Xiong

    2015-09-01

    Gene expression profiles are important data to reveal the functions of genes putatively involved in crucial biological processes. RNA arbitrarily primed polymerase chain reaction (RAP-PCR) and specifically primed reverse transcription polymerase chain reaction (RT-PCR) were combined to screen differentially expressed genes following development of a commercial Bacillus thuringiensis subsp. kurstaki strain 8010 (serotype 3a3b). Six differentially expressed transcripts (RAP1 to RAP6) were obtained. RAP1 encoded a putative triple helix repeat-containing collagen or an exosporium protein H related to spore pathogenicity. RAP2 was homologous to a ClpX protease and an ATP-dependent protease La (LonB), which likely acted as virulence factors. RAP3 was homologous to a beta subunit of propionyl-CoA carboxylase required for the development of Myxococcus xanthus. RAP4 had homology to a quinone oxidoreductase involved in electron transport and ATP formation. RAP5 showed significant homology to a uridine kinase that mediates phosphorylation of uridine and azauridine. RAP6 shared high sequence identity with 3-methyl-2-oxobutanoate-hydroxymethyltransferase (also known as ketopantoate hydroxymethyltransferase or PanB) involved in the operation of the tricarboxylic acid cycle. The findings described here would help to elucidate the molecular mechanisms underlying the differentiation process of B. thuringiensis and unravel novel pathogenic genes. PMID:26191639

  1. H2O2 production rate in Lactobacillus johnsonii is modulated via the interplay of a heterodimeric flavin oxidoreductase with a soluble 28 Kd PAS domain containing protein

    PubMed Central

    Valladares, Ricardo B.; Graves, Christina; Wright, Kaitlyn; Gardner, Christopher L.; Lorca, Graciela L.; Gonzalez, Claudio F.

    2015-01-01

    Host and commensals crosstalk, mediated by reactive oxygen species (ROS), has triggered a growing scientific interest to understand the mechanisms governing such interaction. However, the majority of the scientific studies published do not evaluate the ROS production by commensals bacteria. In this context we recently showed that Lactobacillus johnsonii N6.2, a strain of probiotic value, modulates the activity of the critical enzymes 2,3-indoleamine dioxygenase via H2O2 production. L. johnsonii N6.2 by decreasing IDO activity, is able to modify the tryptophan/kynurenine ratio in the host blood with further systemic consequences. Understanding the mechanisms of H2O2 production is critical to predict the probiotic value of these strains and to optimize bacterial biomass production in industrial processes. We performed a transcriptome analysis to identify genes differentially expressed in L. johnsonii N6.2 cells collected from cultures grown under different aeration conditions. Herein we described the biochemical characteristics of a heterodimeric FMN reductase (FRedA/B) whose in vitro activity is controlled by LjPAS protein with a typical Per-Arnst-Sim (PAS) sensor domain. Interestingly, LjPAS is fused to the FMN reductase domains in other lactobacillaceae. In L. johnsonii, LjPAS is encoded by an independent gene which expression is repressed under anaerobic conditions (>3 fold). Purified LjPAS was able to slow down the FRedA/B initial activity rate when the holoenzyme precursors (FredA, FredB, and FMN) were mixed in vitro. Altogether the results obtained suggest that LjPAS module regulates the H2O2 production helping the cells to minimize oxidative stress in response to environmental conditions. PMID:26236298

  2. Evolutionary diversification and characterization of the eubacterial gene family encoding DXR type II, an alternative isoprenoid biosynthetic enzyme

    PubMed Central

    2013-01-01

    Background Isoprenoids constitute a vast family of natural compounds performing diverse and essential functions in all domains of life. In most eubacteria, isoprenoids are synthesized through the methylerythritol 4-phosphate (MEP) pathway. The production of MEP is usually catalyzed by deoxyxylulose 5-phosphate reductoisomerase (DXR-I) but a few organisms use an alternative DXR-like enzyme (DXR-II). Results Searches through 1498 bacterial complete proteomes detected 130 sequences with similarity to DXR-II. Phylogenetic analysis identified three well-resolved clades: the DXR-II family (clustering 53 sequences including eleven experimentally verified as functional enzymes able to produce MEP), and two previously uncharacterized NAD(P)-dependent oxidoreductase families (designated DLO1 and DLO2 for DXR-II-like oxidoreductases 1 and 2). Our analyses identified amino acid changes critical for the acquisition of DXR-II biochemical function through type-I functional divergence, two of them mapping onto key residues for DXR-II activity. DXR-II showed a markedly discontinuous distribution, which was verified at several levels: taxonomic (being predominantly found in Alphaproteobacteria and Firmicutes), metabolic (being mostly found in bacteria with complete functional MEP pathways with or without DXR-I), and phenotypic (as no biological/phenotypic property was found to be preferentially distributed among DXR-II-containing strains, apart from pathogenicity in animals). By performing a thorough comparative sequence analysis of GC content, 3:1 dinucleotide frequencies, codon usage and codon adaptation indexes (CAI) between DXR-II sequences and their corresponding genomes, we examined the role of horizontal gene transfer (HGT), as opposed to an scenario of massive gene loss, in the evolutionary origin and diversification of the DXR-II subfamily in bacteria. Conclusions Our analyses support a single origin of the DXR-II family through functional divergence, in which constitutes an exceptional model of acquisition and maintenance of redundant gene functions between non-homologous genes as a result of convergent evolution. Subsequently, although old episodic events of HGT could not be excluded, the results supported a prevalent role of gene loss in explaining the distribution of DXR-II in specific pathogenic eubacteria. Our results highlight the importance of the functional characterization of evolutionary shortcuts in isoprenoid biosynthesis for screening specific antibacterial drugs and for regulating the production of isoprenoids of human interest. PMID:24004839

  3. Multivariate detection of gene-gene interactions

    E-print Network

    Washington at Seattle, University of

    interactions is crucial to obtaining a more complete picture of complex diseases. It is thought that gene-gene-mediated disease. Interactions among genes are de...ned as pheno- typic e¤ects that di¤er from those observed and ongoing e¤orts have centered on disease associations with single genes (a single nucleotide polymorphism

  4. Quantification of yeast and bacterial gene transcripts in retail cheeses by reverse transcription-quantitative PCR.

    PubMed

    Monnet, Christophe; Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

    2013-01-01

    The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

  5. CDDO-Im protects from acetaminophen hepatotoxicity through induction of Nrf2-dependent genes

    SciTech Connect

    Reisman, Scott A.; Buckley, David B.; Tanaka, Yuji; Klaassen, Curtis D.

    2009-04-01

    CDDO-Im is a synthetic triterpenoid recently shown to induce cytoprotective genes through the Nrf2-Keap1 pathway, an important mechanism for the induction of cytoprotective genes in response to oxidative stress. Upon oxidative or electrophilic insult, the transcription factor Nrf2 translocates to the nucleus, heterodimerizes with small Maf proteins, and binds to antioxidant response elements (AREs) in the upstream promoter regions of various cytoprotective genes. To further elucidate the hepatoprotective effects of CDDO-Im, wild-type and Nrf2-null mice were pretreated with CDDO-Im (1 mg/kg, i.p.) or vehicle (DMSO), and then administered acetaminophen (500 mg/kg, i.p.). Pretreatment of wild-type mice with CDDO-Im reduced liver injury caused by acetaminophen. In contrast, hepatoprotection by CDDO-Im was not observed in Nrf2-null mice. CDDO-Im increased Nrf2 protein expression and Nrf2-ARE binding in wild-type, but not Nrf2-null mice. Furthermore, CDDO-Im increased the mRNA expression of the Nrf2 target genes NAD(P)H: quinone oxidoreductase-1 (Nqo1); glutamate-cysteine ligase, catalytic subunit (Gclc); and heme-oxygenase-1 (Ho-1), in both a dose- and time-dependent manner. Conversely, CDDO-Im did not induce Nqo1, Gclc, and Ho-1 mRNA expression in Nrf2-null mice. Collectively, the present study shows that CDDO-Im pretreatment induces Nrf2-dependent cytoprotective genes and protects the liver from acetaminophen-induced hepatic injury.

  6. Compare Gene Profiles

    SciTech Connect

    2014-05-31

    Compare Gene Profiles (CGP) performs pairwise gene content comparisons among a relatively large set of related bacterial genomes. CGP performs pairwise BLAST among gene calls from a set of input genome and associated annotation files, and combines the results to generate lists of common genes, unique genes, homologs, and genes from each genome that differ substantially in length from corresponding genes in the other genomes. CGP is implemented in Python and runs in a Linux environment in serial or parallel mode.

  7. Novel genes of the dsr gene cluster and evidence for close interaction of Dsr proteins during sulfur oxidation in the phototrophic sulfur bacterium Allochromatium vinosum.

    PubMed

    Dahl, Christiane; Engels, Sabine; Pott-Sperling, Andrea S; Schulte, Andrea; Sander, Johannes; Lübbe, Yvonne; Deuster, Oliver; Brune, Daniel C

    2005-02-01

    Seven new genes designated dsrLJOPNSR were identified immediately downstream of dsrABEFHCMK, completing the dsr gene cluster of the phototrophic sulfur bacterium Allochromatium vinosum D (DSM 180(T)). Interposon mutagenesis proved an essential role of the encoded proteins for the oxidation of intracellular sulfur, an obligate intermediate during the oxidation of sulfide and thiosulfate. While dsrR and dsrS encode cytoplasmic proteins of unknown function, the other genes encode a predicted NADPH:acceptor oxidoreductase (DsrL), a triheme c-type cytochrome (DsrJ), a periplasmic iron-sulfur protein (DsrO), and an integral membrane protein (DsrP). DsrN resembles cobyrinic acid a,c-diamide synthases and is probably involved in the biosynthesis of siro(heme)amide, the prosthetic group of the dsrAB-encoded sulfite reductase. The presence of most predicted Dsr proteins in A. vinosum was verified by Western blot analysis. With the exception of the constitutively present DsrC, the formation of Dsr gene products was greatly enhanced by sulfide. DsrEFH were purified from the soluble fraction and constitute a soluble alpha(2)beta(2)gamma(2)-structured 75-kDa holoprotein. DsrKJO were purified from membranes pointing at the presence of a transmembrane electron-transporting complex consisting of DsrKMJOP. In accordance with the suggestion that related complexes from dissimilatory sulfate reducers transfer electrons to sulfite reductase, the A. vinosum Dsr complex is copurified with sulfite reductase, DsrEFH, and DsrC. We therefore now have an ideal and unique possibility to study the interaction of sulfite reductase with other proteins and to clarify the long-standing problem of electron transport from and to sulfite reductase, not only in phototrophic bacteria but also in sulfate-reducing prokaryotes. PMID:15687204

  8. Novel Genes of the dsr Gene Cluster and Evidence for Close Interaction of Dsr Proteins during Sulfur Oxidation in the Phototrophic Sulfur Bacterium Allochromatium vinosum

    PubMed Central

    Dahl, Christiane; Engels, Sabine; Pott-Sperling, Andrea S.; Schulte, Andrea; Sander, Johannes; Lübbe, Yvonne; Deuster, Oliver; Brune, Daniel C.

    2005-01-01

    Seven new genes designated dsrLJOPNSR were identified immediately downstream of dsrABEFHCMK, completing the dsr gene cluster of the phototrophic sulfur bacterium Allochromatium vinosum D (DSM 180T). Interposon mutagenesis proved an essential role of the encoded proteins for the oxidation of intracellular sulfur, an obligate intermediate during the oxidation of sulfide and thiosulfate. While dsrR and dsrS encode cytoplasmic proteins of unknown function, the other genes encode a predicted NADPH:acceptor oxidoreductase (DsrL), a triheme c-type cytochrome (DsrJ), a periplasmic iron-sulfur protein (DsrO), and an integral membrane protein (DsrP). DsrN resembles cobyrinic acid a,c-diamide synthases and is probably involved in the biosynthesis of siro(heme)amide, the prosthetic group of the dsrAB-encoded sulfite reductase. The presence of most predicted Dsr proteins in A. vinosum was verified by Western blot analysis. With the exception of the constitutively present DsrC, the formation of Dsr gene products was greatly enhanced by sulfide. DsrEFH were purified from the soluble fraction and constitute a soluble ?2?2?2-structured 75-kDa holoprotein. DsrKJO were purified from membranes pointing at the presence of a transmembrane electron-transporting complex consisting of DsrKMJOP. In accordance with the suggestion that related complexes from dissimilatory sulfate reducers transfer electrons to sulfite reductase, the A. vinosum Dsr complex is copurified with sulfite reductase, DsrEFH, and DsrC. We therefore now have an ideal and unique possibility to study the interaction of sulfite reductase with other proteins and to clarify the long-standing problem of electron transport from and to sulfite reductase, not only in phototrophic bacteria but also in sulfate-reducing prokaryotes. PMID:15687204

  9. Xenobiotic Metabolizing Gene Variants and Renal Cell Cancer: A Multicenter Study

    PubMed Central

    Heck, Julia E.; Moore, Lee E.; Lee, Yuan-Chin A.; McKay, James D.; Hung, Rayjean J.; Karami, Sara; Gaborieau, Valérie; Szeszenia-Dabrowska, Neonila; Zaridze, David G.; Mukeriya, Anush; Mates, Dana; Foretova, Lenka; Janout, Vladimir; Kollárová, Helena; Bencko, Vladimir; Rothman, Nathaniel; Brennan, Paul; Chow, Wong-Ho; Boffetta, Paolo

    2011-01-01

    Background: The countries of Central and Eastern Europe have among the highest worldwide rates of renal cell cancer (RCC). Few studies have examined whether genetic variation in xenobiotic metabolic pathway genes may modify risk for this cancer. Methods: The Central and Eastern Europe Renal Cell Cancer study was a hospital-based case–control study conducted between 1998 and 2003 across seven centers in Central and Eastern Europe. Detailed data were collected from 874 cases and 2053 controls on demographics, work history, and occupational exposure to chemical agents. Genes [cytochrome P-450 family, N-acetyltransferases, NAD(P)H:quinone oxidoreductase I (NQO1), microsomal epoxide hydrolase (mEH), catechol-O-methyltransferase (COMT), uridine diphosphate-glucuronosyltransferase (UGT)] were selected for the present analysis based on their putative role in xenobiotic metabolism. Haplotypes were calculated using fastPhase. Odds ratios and 95% confidence intervals were estimated by unconditional logistic regression adjusted for country of residence, age, sex, smoking, alcohol intake, obesity, and hypertension. Results: We observed an increased risk of RCC with one SNP. After adjustment for multiple comparisons it did not remain significant. Neither NAT1 nor NAT2 slow acetylation was associated with disease. Conclusion: We observed no association between this pathway and renal cell cancer. PMID:22645715

  10. Phytoremediation and phytosensing of chemical contaminants, RDX and TNT: identification of the required target genes.

    PubMed

    Rao, Murali R; Halfhill, Matthew D; Abercrombie, Laura G; Ranjan, Priya; Abercrombie, Jason M; Gouffon, Julia S; Saxton, Arnold M; Stewart, C Neal

    2009-11-01

    High explosives such as hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), and 2,4,6-trinitrotoluene (TNT) are important contaminants in the environment and phytoremediation has been viewed as a cost-effective abatement. There remains, however, an insufficient knowledge-base about how plants respond to explosives, especially in the steady state. Microarray analysis was conducted on Arabidopsis thaliana that were grown in Murashige and Skoog media containing steady-state levels of 0.5 mM RDX or 2.0 microM TNT to study the effect of these compounds on its transcriptional profile. Our results for both RDX and TNT were consistent with the existing theory for xenobiotic metabolism in plants. Among the genes that were differentially expressed included oxidoreductases, cytochrome P450s, transferases, transporters, and several unknown expressed proteins. We discuss the potential role of upregulated genes in plant metabolism, phytoremediation, and phytosensing. Phytosensing, the detection of field contamination using plants, is an end goal of this project. PMID:19543758

  11. IruO Is a Reductase for Heme Degradation by IsdI and IsdG Proteins in Staphylococcus aureus*

    PubMed Central

    Loutet, Slade A.; Kobylarz, Marek J.; Chau, Crystal H. T.; Murphy, Michael E. P.

    2013-01-01

    Staphylococcus aureus is a common hospital- and community-acquired bacterium that can cause devastating infections and is often multidrug-resistant. Iron acquisition is required by S. aureus during an infection, and iron acquisition pathways are potential targets for therapies. The gene NWMN2274 in S. aureus strain Newman is annotated as an oxidoreductase of the diverse pyridine nucleotide-disulfide oxidoreductase (PNDO) family. We show that NWMN2274 is an electron donor to IsdG and IsdI catalyzing the degradation of heme, and we have renamed this protein IruO. Recombinant IruO is a FAD-containing NADPH-dependent reductase. In the presence of NADPH and IruO, either IsdI or IsdG degraded bound heme 10-fold more rapidly than with the chemical reductant ascorbic acid. Varying IsdI-heme substrate and monitoring loss of the heme Soret band gave a Km of 15 ± 4 ?m, a kcat of 5.2 ± 0.7 min?1, and a kcat/Km of 5.8 × 103 m?1 s?1. From HPLC and electronic spectra, the major heme degradation products are 5-oxo-?-bilirubin and 15-oxo-?-bilirubin (staphylobilins), as observed with ascorbic acid. Although heme degradation by IsdI or IsdG can occur in the presence of H2O2, the addition of catalase and superoxide dismutase did not disrupt NADPH/IruO heme degradation reactions. The degree of electron coupling between IruO and IsdI or IsdG remains to be determined. Homologs of IruO were identified by sequence similarity in the genomes of Gram-positive bacteria that possess IsdG-family heme oxygenases. A phylogeny of these homologs identifies a distinct clade of pyridine nucleotide-disulfide oxidoreductases likely involved in iron uptake systems. IruO is the likely in vivo reductant required for heme degradation by S. aureus. PMID:23893407

  12. Molecular Cloning, Heterologous Expression, and Functional Characterization of an NADPH-Cytochrome P450 Reductase Gene from Camptotheca acuminata, a Camptothecin-Producing Plant.

    PubMed

    Qu, Xixing; Pu, Xiang; Chen, Fei; Yang, Yun; Yang, Lixia; Zhang, Guolin; Luo, Yinggang

    2015-01-01

    Camptothecin (CAM), a complex pentacyclic pyrroloqinoline alkaloid, is the starting material for CAM-type drugs that are well-known antitumor plant drugs. Although many chemical and biological research efforts have been performed to produce CAM, a few attempts have been made to uncover the enzymatic mechanism involved in the biosynthesis of CAM. Enzyme-catalyzed oxidoreduction reactions are ubiquitously presented in living organisms, especially in the biosynthetic pathway of most secondary metabolites such as CAM. Due to a lack of its reduction partner, most catalytic oxidation steps involved in the biosynthesis of CAM have not been established. In the present study, an NADPH-cytochrome P450 reductase (CPR) encoding gene CamCPR was cloned from Camptotheca acuminata, a CAM-producing plant. The full length of CamCPR cDNA contained an open reading frame of 2127-bp nucleotides, corresponding to 708-amino acid residues. CamCPR showed 70 ~ 85% identities to other characterized plant CPRs and it was categorized to the group II of CPRs on the basis of the results of multiple sequence alignment of the N-terminal hydrophobic regions. The intact and truncate CamCPRs with N- or C-terminal His6-tag were heterologously overexpressed in Escherichia coli. The recombinant enzymes showed NADPH-dependent reductase activity toward a chemical substrate ferricyanide and a protein substrate cytochrome c. The N-terminal His6-tagged CamCPR showed 18- ~ 30-fold reduction activity higher than the C-terminal His6-tagged CamCPR, which supported a reported conclusion, i.e., the last C-terminal tryptophan of CPRs plays an important role in the discrimination between NADPH and NADH. Co-expression of CamCPR and a P450 monooxygenase, CYP73A25, a cinnamate 4-hydroxylase from cotton, and the following catalytic formation of p-coumaric acid suggested that CamCPR transforms electrons from NADPH to the heme center of P450 to support its oxidation reaction. Quantitative real-time PCR analysis showed that CamCPR was expressed in the roots, stems, and leaves of C. acuminata seedlings. The relative transcript level of CamCPR in leaves was 2.2-fold higher than that of roots and the stems showed 1.5-fold transcript level higher than the roots. The functional characterization of CamCPR will be helpful to disclose the mysterious mechanisms of the biosynthesis of CAM. The present study established a platform to characterize the P450 enzymes involved in the growth, development, and metabolism of eukaryotic organisms. PMID:26252645

  13. Molecular Cloning, Heterologous Expression, and Functional Characterization of an NADPH-Cytochrome P450 Reductase Gene from Camptotheca acuminata, a Camptothecin-Producing Plant

    PubMed Central

    Chen, Fei; Yang, Yun; Yang, Lixia; Zhang, Guolin; Luo, Yinggang

    2015-01-01

    Camptothecin (CAM), a complex pentacyclic pyrroloqinoline alkaloid, is the starting material for CAM-type drugs that are well-known antitumor plant drugs. Although many chemical and biological research efforts have been performed to produce CAM, a few attempts have been made to uncover the enzymatic mechanism involved in the biosynthesis of CAM. Enzyme-catalyzed oxidoreduction reactions are ubiquitously presented in living organisms, especially in the biosynthetic pathway of most secondary metabolites such as CAM. Due to a lack of its reduction partner, most catalytic oxidation steps involved in the biosynthesis of CAM have not been established. In the present study, an NADPH-cytochrome P450 reductase (CPR) encoding gene CamCPR was cloned from Camptotheca acuminata, a CAM-producing plant. The full length of CamCPR cDNA contained an open reading frame of 2127-bp nucleotides, corresponding to 708-amino acid residues. CamCPR showed 70 ~ 85% identities to other characterized plant CPRs and it was categorized to the group II of CPRs on the basis of the results of multiple sequence alignment of the N-terminal hydrophobic regions. The intact and truncate CamCPRs with N- or C-terminal His6-tag were heterologously overexpressed in Escherichia coli. The recombinant enzymes showed NADPH-dependent reductase activity toward a chemical substrate ferricyanide and a protein substrate cytochrome c. The N-terminal His6-tagged CamCPR showed 18- ~ 30-fold reduction activity higher than the C-terminal His6-tagged CamCPR, which supported a reported conclusion, i.e., the last C-terminal tryptophan of CPRs plays an important role in the discrimination between NADPH and NADH. Co-expression of CamCPR and a P450 monooxygenase, CYP73A25, a cinnamate 4-hydroxylase from cotton, and the following catalytic formation of p-coumaric acid suggested that CamCPR transforms electrons from NADPH to the heme center of P450 to support its oxidation reaction. Quantitative real-time PCR analysis showed that CamCPR was expressed in the roots, stems, and leaves of C. acuminata seedlings. The relative transcript level of CamCPR in leaves was 2.2-fold higher than that of roots and the stems showed 1.5-fold transcript level higher than the roots. The functional characterization of CamCPR will be helpful to disclose the mysterious mechanisms of the biosynthesis of CAM. The present study established a platform to characterize the P450 enzymes involved in the growth, development, and metabolism of eukaryotic organisms. PMID:26252645

  14. Hemophilia and Gene Therapy

    E-print Network

    Brutlag, Doug

    Hemophilia and Gene Therapy Jackie Chu June 4, 2008 #12;Overview Hemophilia, the disease Gene therapy Hemophilia as a target for gene therapy Gene delivery systems Clinical trials New methods Future of gene therapy for hemophilia #12;Hemophilia, the disease X-linked, recessive bleeding disorder

  15. The Structure of the Bacterial Oxidoreductase Enzyme DsbA in Complex with a Peptide Reveals a Basis for Substrate Specificity in the Catalytic Cycle of DsbA Enzymes

    SciTech Connect

    Paxman, Jason J.; Borg, Natalie A.; Horne, James; Thompson, Philip E.; Chin, Yanni; Sharma, Pooja; Simpson, Jamie S.; Wielens, Jerome; Piek, Susannah; Kahler, Charlene M.; Sakellaris, Harry; Pearce, Mary; Bottomley, Stephen P.; Rossjohn, Jamie; Scanlon, Martin J.

    2010-09-07

    Oxidative protein folding in Gram-negative bacteria results in the formation of disulfide bonds between pairs of cysteine residues. This is a multistep process in which the dithiol-disulfide oxidoreductase enzyme, DsbA, plays a central role. The structure of DsbA comprises an all helical domain of unknown function and a thioredoxin domain, where active site cysteines shuttle between an oxidized, substrate-bound, reduced form and a DsbB-bound form, where DsbB is a membrane protein that reoxidizes DsbA. Most DsbA enzymes interact with a wide variety of reduced substrates and show little specificity. However, a number of DsbA enzymes have now been identified that have narrow substrate repertoires and appear to interact specifically with a smaller number of substrates. The transient nature of the DsbA-substrate complex has hampered our understanding of the factors that govern the interaction of DsbA enzymes with their substrates. Here we report the crystal structure of a complex between Escherichia coli DsbA and a peptide with a sequence derived from a substrate. The binding site identified in the DsbA-peptide complex was distinct from that observed for DsbB in the DsbA-DsbB complex. The structure revealed details of the DsbA-peptide interaction and suggested a mechanism by which DsbA can simultaneously show broad specificity for substrates yet exhibit specificity for DsbB. This mode of binding was supported by solution nuclear magnetic resonance data as well as functional data, which demonstrated that the substrate specificity of DsbA could be modified via changes at the binding interface identified in the structure of the complex.

  16. Isotropic exchange interaction between Mo and the proximal FeS center in the xanthine oxidase family member aldehyde oxidoreductase from Desulfovibrio gigas on native and polyalcohol inhibited samples: an EPR and QM/MM study.

    PubMed

    Gómez, María C; Neuman, Nicolás I; Dalosto, Sergio D; González, Pablo J; Moura, José J G; Rizzi, Alberto C; Brondino, Carlos D

    2015-03-01

    Aldehyde oxidoreductase from Desulfovibrio gigas (DgAOR) is a homodimeric molybdenum-containing protein that catalyzes the hydroxylation of aldehydes to carboxylic acids and contains a Mo-pyranopterin active site and two FeS centers called FeS 1 and FeS 2. The electron transfer reaction inside DgAOR is proposed to be performed through a chemical pathway linking Mo and the two FeS clusters involving the pyranopterin ligand. EPR studies performed on reduced as-prepared DgAOR showed that this pathway is able to transmit very weak exchange interactions between Mo(V) and reduced FeS 1. Similar EPR studies but performed on DgAOR samples inhibited with glycerol and ethylene glycol showed that the value of the exchange coupling constant J increases ~2 times upon alcohol inhibition. Structural studies in these DgAOR samples have demonstrated that the Mo-FeS 1 bridging pathway does not show significant differences, confirming that the changes in J observed upon inhibition cannot be ascribed to structural changes associated neither with pyranopterin and FeS 1 nor with changes in the electronic structure of FeS 1, as its EPR properties remain unchanged. Theoretical calculations indicate that the changes in J detected by EPR are related to changes in the electronic structure of Mo(V) determined by the replacement of the OHx labile ligand for an alcohol molecule. Since the relationship between electron transfer rate and isotropic exchange interaction, the present results suggest that the intraenzyme electron transfer process mediated by the pyranopterin moiety is governed by a Mo ligand-based regulatory mechanism. PMID:25344343

  17. The single NqrB and NqrC subunits in the Na(+)-translocating NADH: quinone oxidoreductase (Na(+)-NQR) from Vibrio cholerae each carry one covalently attached FMN.

    PubMed

    Casutt, Marco S; Schlosser, Andreas; Buckel, Wolfgang; Steuber, Julia

    2012-10-01

    The Na(+)-translocating NADH:quinone oxidoreductase (Na(+)-NQR) is the prototype of a novel class of flavoproteins carrying a riboflavin phosphate bound to serine or threonine by a phosphodiester bond to the ribityl side chain. This membrane-bound, respiratory complex also contains one non-covalently bound FAD, one non-covalently bound riboflavin, ubiquinone-8 and a [2Fe-2S] cluster. Here, we report the quantitative analysis of the full set of flavin cofactors in the Na(+)-NQR and characterize the mode of linkage of the riboflavin phosphate to the membrane-bound NqrB and NqrC subunits. Release of the flavin by ?-elimination and analysis of the cofactor demonstrates that the phosphate group is attached at the 5'-position of the ribityl as in authentic FMN and that the Na(+)-NQR contains approximately 1.7mol covalently bound FMN per mol non-covalently bound FAD. Therefore, each of the single NqrB and NqrC subunits in the Na(+)-NQR carries a single FMN. Elimination of the phosphodiester bond yields a dehydro-2-aminobutyrate residue, which is modified with ?-mercaptoethanol by Michael addition. Proteolytic digestion followed by mass determination of peptide fragments reveals exclusive modification of threonine residues, which carry FMN in the native enzyme. The described reactions allow quantification and localization of the covalently attached FMNs in the Na(+)-NQR and in related proteins belonging to the Rhodobacter nitrogen fixation (RNF) family of enzymes. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). PMID:22366169

  18. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    SciTech Connect

    Lo, Raymond; Matthews, Jason

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ER?). In this study we investigated the crosstalk among NRF2, AHR and ER? in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ER? activator, 3,3?-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17?-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ER? but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ER? to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ER?-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ER? signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ER?, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ER? repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ER?-dependent repression of HMOX1 and NQO1.

  19. Evidence for repeated gene duplications in Tritrichomonas foetus supported by EST analysis and comparison with the Trichomonas vaginalis genome.

    PubMed

    Oyhenart, Jorge; Breccia, Javier D

    2014-12-15

    Tritrichomonas foetus causes a venereal infection in cattle; the disease has mild or no clinical manifestation in bulls, while cows may present vaginitis, placentitis, pyometra and abortion in the more severe cases. T. foetus has one of the largest known genomes among trichomonads. However molecular data are fragmentary and have minimally contributed to the understanding of the biology and pathogenesis of this protozoan. In a search of new T. foetus genes, a detailed exploration was performed using recently available expressed sequences. Genes involved in the central carbon metabolism (phosphoenol pyruvate carboxykinase, glyceraldehyde-3-phosphate dehydrogenase, fructose-1,6-bisphosphate aldolase, thioredoxin peroxidase, alpha and beta chains of succinyl CoA synthetase, malate dehydrogenase, malate oxidoreductase and enolase) as well as in cell structure and motility (actin, ?-tubulin and ?-tubulin) were found duplicated and, in many cases, repeatedly duplicated. Homology analysis suggested that massive expansions might have occurred in the T. foetus genome in a similar way it was also predicted for Trichomonas vaginalis, while conservation assessment showed that duplications have been acquired after differentiation of the two species. Therefore, gene duplications might be common among these parasitic protozoans. PMID:25458117

  20. Effects of Leuzea carthamoides on human breast adenocarcinoma MCF-7 cells determined by gene expression profiling and functional assays.

    PubMed

    Gaube, Friedemann; Wölfl, Stefan; Pusch, Larissa; Werner, Ulrike; Kroll, Torsten C; Schrenk, Dieter; Hartmann, Rolf W; Hamburger, Matthias

    2008-11-01

    Products derived from roots of Leuzea carthamoides (Maral root) are being promoted as dietary supplements with anti-aging, adaptogenic and anabolic activity, without much scientific evidence. We investigated the effects of a lipophilic Leuzea root extract and the major phytoecdysteroid, 20-hydroxyecdysone, in human breast adenocarcinoma MCF-7 cells. Cell proliferation was inhibited by the extract (IC50 = 30 microg/mL) but not by 20-hydroxyecdysone. Genome-wide expression profiling using Affymetrix HG U133 Plus 2.0 microarrays was carried out to analyse effects at the transcriptional level. 241 genes appeared to be differentially expressed after Leuzea treatment, more than after treatment with either 17beta-estradiol or tamoxifen. Transcripts linked to cell cycle regulation and DNA replication were highly over-represented and regulated in an anti-proliferative manner. Genes involved in apoptosis were regulated in a pro-apoptotic manner. Expression levels of several oxidoreductase transcripts were strongly induced, most prominent CYP1A1, known to be regulated via the aryl hydrocarbon receptor pathway. An XRE-dependent reporter gene assay confirmed the AhR-agonistic activity of the Leuzea root extract, whereas 20-hydroxyecdysone was not active. Leuzea extract also inhibited 5alpha-reductase, type II. While the extract significantly modulates cellular activities, the phytoecdysteroids, are most likely not the active principles of L. carthamoides. PMID:18975255

  1. The Evaluation of WBP2NL-Related Genes Expression in Breast Cancer.

    PubMed

    Nourashrafeddin, Seyedmehdi; Aarabi, Mahmoud; Modarressi, Mohammad Hosein; Rahmati, Marveh; Nouri, Mohammad

    2015-04-01

    Breast cancer is the most frequent cause of mortality in women all around the world; therefore, study on molecular aspects of breast cancer is necessary for finding new biomarkers. Recent studies have shown that WW Binding Protein 2 (WBP2) is an important protein for the oncogenic property of cancer. We have previously evaluated the WW Binding Protein 2 N-Terminal Like (WBP2NL) gene expression in cancerous cell line and breast tumor tissues, and reported changes in expression, which could increase tumorigenic cell growth. However, the molecular mechanisms of WBP2NL and its clinical relevance have not been investigated. In this study, the expression of WBP2NL-related genes in the invasive breast carcinoma and normal breast tissues was evaluated for the first time. Analysis of WBP2NL-related genes expression was performed with reverse transcription-PCR and real time-PCR detection method. The target genes studied were as follow: WW domain containing E3 ubiquitin protein ligase 1(WWP1), membrane associated guanylatekinase containing WW and PDZ domain-1 (MAGI1), neural precursor cell expressed developmentally down-regulated 4 (NEDD4), formin binding protein-4 (FNBP4), BCL2-associated athanogene-3 (BAG3), WW domain-containing oxidoreductase (WWOX), yes-associated protein-1 (YAP1), WW domain containing transcription regulator (WWTR1), member RAS oncogene family (RAB2A), and small G protein signaling modulator 3 (SGSM3). The expression of WWP1, BAG3, and WWTR1 was significantly increased in breast cancer. In contrast, the expression of WWOX, YAP1, RAB2A, and SGSM3 was significantly decreased. The MAGI1 and NEDD4 expression was increased, while the expression of FNBP4 was unchanged. These findings lead us to suggest that WBP2NL might play roles as an anti-apoptotic factor or co-activator to promote breast cancer cell survival and proliferation. PMID:25417742

  2. An Integrative Analysis of Meningioma Tumors Reveals the Determinant Genes and Pathways of Malignant Transformation

    PubMed Central

    Iglesias Gómez, José Carlos; Mosquera Orgueira, Adrián

    2014-01-01

    Meningiomas are frequent central nervous system neoplasms, which despite their predominant benignity, show sporadically malignant behavior. Type 2 neurofibromatosis and polymorphisms in several genes have been associated with meningioma risk and are probably involved in its pathogenesis. Although GWAS studies have found loci related to meningioma risk, little is known about the factors determining malignant transformation. Thus, this study is aimed to identify the genomic and transcriptomic factors influencing evolution from benignity toward aggressive phenotypes. By applying an integrative bioinformatics pipeline combining public information on a wealth of biological layers of complexity (from genetic polymorphisms to protein interactions), this study identified a module of co-expressed genes highly correlated with tumor stage and statistically linked to several genomic regions (module Quantitative Trait Loci, mQTLs). Ontology analysis of the transcription hub genes identified microtubule-associated cell-cycle processes as key drivers of such network. mQTLs and single nucleotide polymorphisms associated with meningioma stage were replicated in an alternative meningioma cohort, and integration of these results with up-to-date scientific literature and several databases retrieved a list of genes and pathways with a potentially important role in meningioma malignancy. As a result, cytoskeleton and cell–cell adhesion pathways, calcium-channels and glutamate receptors, as well as oxidoreductase and endoplasmic reticulum-associated degradation pathways were found to be the most important and redundant findings associated to meningioma progression. This study presents an integrated view of the pathways involved in meningioma malignant conversion and paves the way for the development of new research lines that will improve our understanding of meningioma biology. PMID:25003081

  3. In vitro resistance to 5-nitroimidazoles and benzimidazoles in Giardia duodenalis: variability and variation in gene expression.

    PubMed

    Argüello-García, Raúl; Cruz-Soto, Maricela; Romero-Montoya, Lydia; Ortega-Pierres, Guadalupe

    2009-12-01

    The susceptibility of Giardia duodenalis trophozoites exposed in vitro to sublethal concentrations of metronidazole (MTZ) and albendazole (ABZ) may exhibit inter-culture (variability) and intra-culture (variation) differences in drug susceptibility. It was previously reported that MTZ-resistant trophozoites may display changes in pyruvate:ferredoxin oxidoreductase (PFOR) expression while changes at the beta-tubulin molecule are apparently absent in ABZ-resistant cultures. To assess the levels of gene expression of these molecules, we obtained cloned cultures growing at concentrations up to 23 microM MTZ (WBRM23) and up to 8muM ABZ (WBRA8) and gene sequence and expression of pfor and beta-tubulin loci were compared with these of drug-susceptible clone WB1. Neither the pfor nor the beta-tubulin genes showed changes at sequence level but the MTZ-resistant clones WBRM21 and WBRM23 showed up-regulation of the pfor RNA using the gdh gene as reference. By using WB1 and WBRA8 clones in representational difference analyses of gene expression (RDA) an insert referred to as ARR-VSP was selected and sequenced. It showed the highest homology to one VSP molecule in the Giardia Genome Database (orf GL50803_101765). This isogene was up-regulated in five ABZ-resistant clones and the clone WBRA8 exhibited the highest RNA expression level. When successive progenies of clones WB1, WBRM23 and WBRA8 were analyzed in Northern blot assays to detect pfor and ARR-VSP RNAs respectively, the expression patterns showed variation for both genes but it was much lower in the clone WBRA8. These results suggest that G. duodenalis cultures either susceptible or resistant to MTZ and ABZ may display variability and variation at RNA expression levels albeit these were more marked in the MTZ-resistant parasites. These data might have further implications defining major mechanisms involved in drug resistance of Giardia. PMID:19481175

  4. Gene doping: gene delivery for olympic victory.

    PubMed

    Gould, David

    2013-08-01

    With one recently recommended gene therapy in Europe and a number of other gene therapy treatments now proving effective in clinical trials it is feasible that the same technologies will soon be adopted in the world of sport by unscrupulous athletes and their trainers in so called 'gene doping'. In this article an overview of the successful gene therapy clinical trials is provided and the potential targets for gene doping are highlighted. Depending on whether a doping gene product is secreted from the engineered cells or is retained locally to, or inside engineered cells will, to some extent, determine the likelihood of detection. It is clear that effective gene delivery technologies now exist and it is important that detection and prevention plans are in place. PMID:23082866

  5. Autism and Genes

    ERIC Educational Resources Information Center

    National Institutes of Health, 2005

    2005-01-01

    This document defines and discusses autism and how genes play a role in the condition. Answers to the following questions are covered: (1) What are genes? (2) What is autism? (3) What causes autism? (4) Why study genes to learn about autism? (5) How do researchers look for the genes involved in autism? (screen the whole genome; conduct cytogenetic…

  6. Compare Gene Profiles

    Energy Science and Technology Software Center (ESTSC)

    2014-05-31

    Compare Gene Profiles (CGP) performs pairwise gene content comparisons among a relatively large set of related bacterial genomes. CGP performs pairwise BLAST among gene calls from a set of input genome and associated annotation files, and combines the results to generate lists of common genes, unique genes, homologs, and genes from each genome that differ substantially in length from corresponding genes in the other genomes. CGP is implemented in Python and runs in a Linuxmore »environment in serial or parallel mode.« less

  7. Methylated pentavalent arsenic metabolites are bifunctional inducers, as they induce cytochrome P450 1A1 and NAD(P)H:quinone oxidoreductase through AhR- and Nrf2-dependent mechanisms.

    PubMed

    Anwar-Mohamed, Anwar; Elshenawy, Osama H; Soshilov, Anatoly A; Denison, Michael S; Chris Le, X; Klotz, Lars-Oliver; El-Kadi, Ayman O S

    2014-02-01

    Activation of the aryl hydrocarbon receptor (AhR) ultimately leads to the induction of the carcinogen-activating enzyme cytochrome P450 1A1 (CYP1A1), and activation of the nuclear factor-erythroid 2 p45-related factor 2 (Nrf2) in addition to the AhR pathway induces the expression of the NADP(H):quinone oxidoreductase (NQO1). Therefore, the aim of this study was to examine the effect of As(III) pentavalent metabolites, MMA(V), DMA(V), and TMA(V), on AhR and Nrf2 activation and on the expression of their prototypical downstream targets CYP1A1 and NQO1, respectively. Our results showed that treatment of HepG2 cells with MMA(V), DMA(V), or TMA(V) in the absence and presence of 2,3,7,8-tetrachlorodibenzo-p-dioxin or sulforaphane significantly induced both CYP1A1 and NQO1 at the mRNA, protein, and catalytic activity levels. Furthermore, these metabolites increased the AhR-dependent XRE-driven and the Nrf2-dependent ARE-driven luciferase reporter activities, which coincided with increased nuclear accumulation of both transcription factors. However, none of these metabolites were shown to be AhR ligands. The induction of CYP1A1 by these metabolites seems to be ligand-independent, possibly through a decrease in HSP90 protein expression levels. The metabolites also increased ROS production, which was significantly higher than that produced by As(III). Upon knockdown of AhR and Nrf2 the MMA(V)-, DMA(V)-, and TMA(V)-mediated induction of both CYP1A1 and NQO1 proteins was significantly decreased. In conclusion, this study demonstrates for the first time that methylated pentavalent arsenic metabolites are bifunctional inducers, as they increase CYP1A1 by activating the AhR/XRE signaling pathway and they increase NQO1 by activating the Nrf2/ARE signaling pathway in addition to the AhR/XRE pathway. PMID:24161444

  8. A novel approach to simultaneously scan genes at fragile sites

    PubMed Central

    Willem, Pascale; Brown, Jacqueline; Schouten, Jan

    2006-01-01

    Background Fragile sites are regions of the genome sensitive to replication stress and to exposure to environmental carcinogens. The two most commonly expressed fragile sites FRA3B and FRA16D host the histidine triad (FHIT) and WW domain containing oxidoreductase (WWOX) genes respectively. There is growing evidence that both genes contribute to cancer development and they are frequently altered by allelic and homozygous deletions in a variety of tumors. Their status is linked to prognosis in several malignancies and they are thought to be involved in early tumorigenesis. The loci for FHIT and WWOX both span over a megabase but the genes encode for small transcripts. Thus the screening of intragenic deletion can be difficult and has relied on loss of heterozygosity LOH assays, or genomic arrays. Methods Multiplex ligation dependent probe amplification MLPA, allows for the detection of deletions/duplications and relative quantification of up to 40 specific probes in a single assay. A FHIT/WWOX MLPA assay was designed, applied and validated in five esophageal squamous cell carcinoma ESCC, cell lines established in South Africa where this cancer is of high prevalence. Sixteen probes covered all FHIT exons and 7 probes covered WWOX. Results Both homozygous and hemizygous deletions were detected in FHIT, in four of the cell lines with a preferential deletion of exons 5 and 4. Chromosome 3 short arm was present in normal copy number indicating that deletions were site specific. In contrast WWOX was not altered in any cell lines. RT-PCR expression pattern paralleled the pattern of deletions. Ten primary ESCC tumor specimens were subsequently screened with this assay. FHIT exon deletions were found in four of them. Conclusion This method offers an alternative to loss of heterozygosity studies. Simultaneous scanning of FHIT and WWOX exons in the context of early tumorigenesis and tumor progression, may help clarify the mechanistic events related to cancer development which are not revealed by imuno histochemistry assays. The presence of site specific deletions of FHIT in these cell lines and primary tumors support its possible role in South African ESCC and justifies a wider screening. PMID:16895604

  9. Genes of the N-Methylglutamate Pathway Are Essential for Growth of Methylobacterium extorquens DM4 with Monomethylamine

    PubMed Central

    Gruffaz, Christelle; Muller, Emilie E. L.; Louhichi-Jelail, Yousra; Nelli, Yella R.; Guichard, Gilles

    2014-01-01

    Monomethylamine (MMA, CH3NH2) can be used as a carbon and nitrogen source by many methylotrophic bacteria. Methylobacterium extorquens DM4 lacks the MMA dehydrogenase encoded by mau genes, which in M. extorquens AM1 is essential for growth on MMA. Identification and characterization of minitransposon mutants with an MMA-dependent phenotype showed that strain DM4 grows with MMA as the sole source of carbon, energy, and nitrogen by the N-methylglutamate (NMG) pathway. Independent mutations were found in a chromosomal region containing the genes gmaS, mgsABC, and mgdABCD for the three enzymes of the pathway, ?-glutamylmethylamide (GMA) synthetase, NMG synthase, and NMG dehydrogenase, respectively. Reverse transcription-PCR confirmed the operonic structure of the two divergent gene clusters mgsABC-gmaS and mgdABCD and their induction during growth with MMA. The genes mgdABCD and mgsABC were found to be essential for utilization of MMA as a carbon and nitrogen source. The gene gmaS was essential for MMA utilization as a carbon source, but residual growth of mutant DM4gmaS growing with succinate and MMA as a nitrogen source was observed. Plasmid copies of gmaS and the gmaS homolog METDI4690, which encodes a protein 39% identical to GMA synthetase, fully restored the ability of mutants DM4gmaS and DM4gmaS?metdi4690 to use MMA as a carbon and nitrogen source. Similarly, chemically synthesized GMA, the product of GMA synthetase, could be used as a nitrogen source for growth in the wild-type strain, as well as in DM4gmaS and DM4gmaS?metdi4690 mutants. The NADH:ubiquinone oxidoreductase respiratory complex component NuoG was also found to be essential for growth with MMA as a carbon source. PMID:24682302

  10. Aspirin may promote mitochondrial biogenesis via the production of hydrogen peroxide and the induction of Sirtuin1/PGC-1? genes.

    PubMed

    Kamble, Pratibha; Selvarajan, Krithika; Aluganti Narasimhulu, Chandrakala; Nandave, Mukesh; Parthasarathy, Sampath

    2013-01-15

    Based on the rapid hydrolysis of acetyl salicylic acid (ASA, Aspirin) to salicylic acid (SA), the ability of SA to form dihydroxy benzoic acid (DBA), and the latter's redox reactions to yield hydrogen peroxide (H(2)O(2)), we predicted that ASA may have the potential to induce Sirtuin1 (Sirt1) and its downstream effects. We observed that treatment of cultured liver cells with ASA resulted in the induction of Sirt1, peroxisome proliferator-activated receptor-gamma co-activator-1? (PGC-1?), and NAD(P)H quinone oxidoreductase 1 (Nqo1) genes. Paraoxonase 1 (PON1) and Aryl hydrocarbon receptor (AhR) siRNA transfections inhibited the induction of gene expressions by ASA suggesting the need for the acetyl ester hydrolysis and hydroxylation to DHBA. The latter also induced Sirt1, confirming the proposed pathway. As predicted, ASA and SA treatment resulted in the production of H(2)O(2), a known inducer of Sirt1 and confirmed in the current studies. More importantly, ASA treatment resulted in an increase in mitochondria as seen by tracking dyes. We suggest that DHBA, generated from ASA, via its oxidation/reduction reactions mediated by Nqo1 might be involved in the production of O(2)(-.) and H(2)O(2). As Sirt1 and PGC-1? profoundly affect mitochondrial metabolism and energy utilization, ASA may have therapeutic potential beyond its ability to inhibit cyclooxygenases. PMID:23228932

  11. Tert-butylhydroquinone ameliorates doxorubicin-induced cardiotoxicity by activating Nrf2 and inducing the expression of its target genes

    PubMed Central

    Wang, Lin-Feng; Su, Su-Wen; Wang, Lei; Zhang, Guo-Qiang; Zhang, Rong; Niu, Yu-Jie; Guo, Yan-Su; Li, Chun-Yan; Jiang, Wen-Bo; Liu, Yi; Guo, Hui-Cai

    2015-01-01

    Oxidative stress plays an important role in doxorubicin (DOX)-induced cardiotoxicity. Nuclear factor E2-related factor-2 (Nrf2) is a transcription factor that orchestrates the antioxidant and cytoprotective responses to oxidative stress. In the present study, we tested whether tert-butylhydroquinone (tBHQ) could protect against DOX-induced cardiotoxicity in vivo and, if so, whether the protection was associated with the up-regulation of the Nrf2 pathway. The results showed that treatment with tBHQ significantly decreased the DOX-induced cardiac injury in wild-type mice. Moreover, tBHQ ameliorated the DOX-induced oxidative stress and apoptosis. Further studies suggested that tBHQ increased the nuclear accumulation of Nrf2 and the Nrf2-regulated gene expression, including heme oxygenase-1 (HO-1) and NAD(P)H:quinone oxido-reductase-1 (NQO-1) expression. Knocking out Nrf2 in mice abolished the protective effect of tBHQ on the DOX-induced cardiotoxicity. These results indicate that tBHQ has a beneficial effect on DOX-induced cardiotoxicity, and this effect was associated with the enhanced expression of Nrf2 and its downstream antioxidant genes, HO-1 and NQO-1. PMID:26692920

  12. Gene symbol precision.

    PubMed

    Bennani-Baiti, Barbara; Bennani-Baiti, Idriss M

    2012-01-10

    Several gene databases, including heavily used ones such as the National Center for Biotechnology Information (NCBI) database, erroneously assign, on occasion, literature references to genes or proteins. These mistakes are mostly due to an overlap in gene aliases, whereby two distinct genes share a pseudonym. This is particularly confusing when the gene products have also biological properties in common, are part of signaling pathways that cross-talk to one another, or are regulated by the same effectors. We present examples spanning several research fields including apoptosis, ubiquitin-dependent degradation, signaling by Notch, Wnt, and small G proteins, transporters of glutathione conjugates of electrophiles, and mitochondrial and ribosomal RNA genes. To solve the problem, we argue in favor of including Entrez gene numbers in papers submitted for publication as unique gene identifiers to allow precise identification of genes and species studied. PMID:22019431

  13. Leber's Hereditary Optic Neuropathy-Gene Therapy: From Benchtop to Bedside

    PubMed Central

    Koilkonda, Rajeshwari D.; Guy, John

    2011-01-01

    Leber's hereditary optic neuropathy (LHON) is a maternally transmitted disorder caused by point mutations in mitochondrial DNA (mtDNA). Most cases are due to mutations in genes encoding subunits of the NADH-ubiquinone oxidoreductase that is Complex I of the electron transport chain (ETC). These mutations are located at nucleotide positions 3460, 11778, or 14484 in the mitochondrial genome. The disease is characterized by apoplectic, bilateral, and severe visual loss. While the mutated mtDNA impairs generation of ATP by all mitochondria, there is only a selective loss of retinal ganglion cells and degeneration of optic nerve axons. Thus, blindness is typically permanent. Half of the men and 10% of females who harbor the pathogenic mtDNA mutation actually develop the phenotype. This incomplete penetrance and gender bias is not fully understood. Additional mitochondrial and/or nuclear genetic factors may modulate the phenotypic expression of LHON. In a population-based study, the mtDNA background of haplogroup J was associated with an inverse relationship of low-ATP generation and increased production of reactive oxygen species (ROS). Effective therapy for LHON has been elusive. In this paper, we describe the findings of pertinent published studies and discuss the controversies of potential strategies to ameliorate the disease. PMID:21253496

  14. Speciation genes in plants

    PubMed Central

    Rieseberg, Loren H.; Blackman, Benjamin K.

    2010-01-01

    Background Analyses of speciation genesgenes that contribute to the cessation of gene flow between populations – can offer clues regarding the ecological settings, evolutionary forces and molecular mechanisms that drive the divergence of populations and species. This review discusses the identities and attributes of genes that contribute to reproductive isolation (RI) in plants, compares them with animal speciation genes and investigates what these genes can tell us about speciation. Scope Forty-one candidate speciation genes were identified in the plant literature. Of these, seven contributed to pre-pollination RI, one to post-pollination, prezygotic RI, eight to hybrid inviability, and 25 to hybrid sterility. Genes, gene families and genetic pathways that were frequently found to underlie the evolution of RI in different plant groups include the anthocyanin pathway and its regulators (pollinator isolation), S RNase-SI genes (unilateral incompatibility), disease resistance genes (hybrid necrosis), chimeric mitochondrial genes (cytoplasmic male sterility), and pentatricopeptide repeat family genes (cytoplasmic male sterility). Conclusions The most surprising conclusion from this review is that identities of genes underlying both prezygotic and postzygotic RI are often predictable in a broad sense from the phenotype of the reproductive barrier. Regulatory changes (both cis and trans) dominate the evolution of pre-pollination RI in plants, whereas a mix of regulatory mutations and changes in protein-coding genes underlie intrinsic postzygotic barriers. Also, loss-of-function mutations and copy number variation frequently contribute to RI. Although direct evidence of positive selection on speciation genes is surprisingly scarce in plants, analyses of gene family evolution, along with theoretical considerations, imply an important role for diversifying selection and genetic conflict in the evolution of RI. Unlike in animals, however, most candidate speciation genes in plants exhibit intraspecific polymorphism, consistent with an important role for stochastic forces and/or balancing selection in development of RI in plants. PMID:20576737

  15. Oxidoreductase mimic activity of natural pyrrhotite

    NASA Astrophysics Data System (ADS)

    Ibáñez de Aldecoa, A. L.; Velasco, F.; Menor-Salván, C.

    2012-09-01

    The theory of the chemo-autotrophic origin of life, also called the "iron-sulfur world hypothesis", proposes that the system FeS/FeS2 present in the primitive Earth crust gave the reductive power necessary to conduct the first protometabolic redox reactions. Some experimental studies demonstrated the redox activity of the FeS/SH2 system, but none of them used natural FeS. Here, we show that the iron sulfide mineral pyrrhotite is able to mimic the redox activity of the enzyme lactate dehydrogenase, which reversibly reduces the pyruvate in lactate, under prebiotic conditions with pyrite formation.

  16. Gene Ontology Driven Classification of Gene

    E-print Network

    Spang, Rainer

    evaluation on leukemia · Limitations and future work · Conclusions #12;Introduction 23-Jul-02 3 / 17Claudio · Identifier, name, description · Children (other GO nodes) · Probe-set annotations · One logistic regression genes and direct children) #12;GO driven gene expression classification 23-Jul-02 7 / 17Claudio Lottaz

  17. From Gene Networks to Gene Function

    PubMed Central

    Schlitt, Thomas; Palin, Kimmo; Rung, Johan; Dietmann, Sabine; Lappe, Michael; Ukkonen, Esko; Brazma, Alvis

    2003-01-01

    We propose a novel method to identify functionally related genes based on comparisons of neighborhoods in gene networks. This method does not rely on gene sequence or protein structure homologies, and it can be applied to any organism and a wide variety of experimental data sets. The character of the predicted gene relationships depends on the underlying networks;they concern biological processes rather than the molecular function. We used the method to analyze gene networks derived from genome-wide chromatin immunoprecipitation experiments, a large-scale gene deletion study, and from the genomic positions of consensus binding sites for transcription factors of the yeast Saccharomyces cerevisiae. We identified 816 functional relationships between 159 genes and show that these relationships correspond to protein–protein interactions, co-occurrence in the same protein complexes, and/or co-occurrence in abstracts of scientific articles. Our results suggest functions for seven previously uncharacterized yeast genes: KIN3 and YMR269W may be involved in biological processes related to cell growth and/or maintenance, whereas IES6, YEL008W, YEL033W, YHL029C, YMR010W, and YMR031W-A are likely to have metabolic functions. PMID:14656964

  18. Human Gene Therapy: Genes without Frontiers?

    ERIC Educational Resources Information Center

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  19. Isolation and partial nucleotide sequence of the laccase gene from Neurospora crassa: amino acid sequence homology of the protein to human ceruloplasmin.

    PubMed Central

    Germann, U A; Lerch, K

    1986-01-01

    The laccase (benzenediol:oxygen oxidoreductase, EC 1.10.3.2) gene from Neurospora crassa was cloned and part of its nucleotide sequence corresponding to the carboxyl-terminal region of the protein has been determined. The gene was cloned by cDNA synthesis with a laccase-specific synthetic deoxyundecanucleotide as primer and poly(A) RNA isolated from cycloheximide-treated N. crassa cultures as template. Based on the nucleotide sequence of the cDNA obtained, a unique 21-mer was synthesized and used to screen a genomic DNA library from N. crassa. Five different positive clones were isolated and shown to share an overlapping DNA region with the same pattern of restriction sites. Sequence analysis of the common 1.36-kilobase Sal I fragment revealed an open reading frame of 726 nucleotides. The amino acid sequence deduced is in complete agreement with the primary structures of several tryptic peptides isolated previously from N. crassa laccase. The analyzed carboxyl-terminal region of laccase exhibits a striking sequence homology to the carboxyl-terminal part of the third homology unit of the multicopper oxidase ceruloplasmin and to a smaller extent, to the low molecular weight blue copper proteins plastocyanin and azurin. Based on amino acid sequence comparison between these proteins, putative copper ligands of N. crassa laccase are proposed. Moreover, these data further support the hypothesis that the small blue copper proteins and the multicopper oxidases have evolved from the same ancestral gene. Images PMID:2947240

  20. LuSens: a keratinocyte based ARE reporter gene assay for use in integrated testing strategies for skin sensitization hazard identification.

    PubMed

    Ramirez, Tzutzuy; Mehling, Annette; Kolle, Susanne N; Wruck, Christoph J; Teubner, Wera; Eltze, Tobias; Aumann, Alexandra; Urbisch, Daniel; van Ravenzwaay, Ben; Landsiedel, Robert

    2014-12-01

    Allergic contact dermatitis can develop following repeated exposure to allergenic substances. To date, hazard identification is still based on animal studies as non-animal alternatives have not yet gained global regulatory acceptance. Several non-animal methods addressing key-steps of the adverse outcome pathway (OECD, 2012) will most likely be needed to fully address this effect. Among the initial cellular events is the activation of keratinocytes and currently only one method, the KeratinoSens™, has been formally validated to address this event. In this study, a further method, the LuSens assay, that uses a human keratinocyte cell line harbouring a reporter gene construct composed of the antioxidant response element (ARE) of the rat NADPH:quinone oxidoreductase 1 gene and the luciferase gene. The assay was validated in house using a selection of 74 substances which included the LLNA performance standards. The predictivity of the LuSens assay for skin sensitization hazard identification was comparable to other non-animal methods, in particular to the KeratinoSens™. When used as part of a testing battery based on the OECD adverse outcome pathway for skin sensitization, a combination of the LuSens assay, the DPRA and a dendritic cell line activation test attained predictivities similar to that of the LLNA. PMID:25172300

  1. The Activation of Nrf2 and Its Downstream Regulated Genes Mediates the Antioxidative Activities of Xueshuan Xinmaining Tablet in Human Umbilical Vein Endothelial Cells

    PubMed Central

    Xiong, Lingxin; Xie, Jingshu; Song, Chenxue; Liu, Jinping; Zheng, Jingtong; Liu, Chuangui; Zhang, Xiaotian; Li, Pingya; Wang, Fang

    2015-01-01

    Epidemiological studies have verified the critical role that antioxidative stress plays in protecting vascular endothelial cells. The aims of the present study were to investigate the antioxidative activities and differential regulation of nuclear erythroid-related factor 2- (Nrf2-) mediated gene expression by Xueshuan Xinmaining Tablet (XXT), a traditional Chinese medicine with the effect of treating cardiovascular diseases. The antioxidative activities of XXT were investigated using quantitative real-time PCR (qPCR), a PCR array, and western blotting. Our results indicated that XXT exhibited potent antioxidative activities by suppressing the levels of hydrogen peroxide- (H2O2-) induced reactive oxygen species (ROS) in human umbilical vein endothelial cells (HUVECs). We were also conscious of strong Nrf2-mediated antioxidant induction. XXT enhanced the expressions of Keap1, Nrf2, and Nrf2-mediated genes, such as glutamate-cysteine ligase modifier subunit (GCLM), NAD(P)H: quinine oxidoreductase 1 (NQO1), heme oxygenase 1 (HMOX1), and glutathione peroxidase (GPX) in HUVECs. In summary, XXT strongly activated Nrf2 and its downstream regulated genes, which may contribute to the antioxidative and vascular endothelial cell protective activities of XXT. PMID:26681964

  2. Analysis of the nucleotide sequence of the Streptomyces glaucescens tcmI genes provides key information about the enzymology of polyketide antibiotic biosynthesis.

    PubMed Central

    Bibb, M J; Biró, S; Motamedi, H; Collins, J F; Hutchinson, C R

    1989-01-01

    Key information about the biosynthesis of polyketide metabolites has been uncovered by sequence analysis of the tetracenomycin C polyketide synthase genes (tcml) from Streptomyces glaucescens GLA.0. The sequence data revealed the presence of three complete open reading frames (ORFs). ORF1 and ORF2 appear to be translationally coupled and would encode proteins containing 426 and 405 amino acids, respectively. The two deduced proteins are homologous to known beta-ketoacyl synthases. ORF3 begins 70 nucleotides after the stop codon of ORF2 and would code for an 83 amino acid protein with a strong resemblance to known bacterial, animal and plant acyl-carrier proteins (ACP). The presence of an ACP gene within the tcm gene cluster suggests that different ACPs are used in fatty acid and polyketide biosynthesis in Streptomyces. We conclude from these data and earlier information that polyketide biosynthesis in S. glaucescens, and most likely in other bacteria, involves a multienzyme complex consisting of at least five types of enzymes: acylCoA transferases that load the acyl and 2-carboxyacyl precursors onto the ACP; a beta-ketoacyl synthase that, along with the acylated ACP, forms the poly-beta-ketoacyl intermediates; a poly-beta-ketone cyclase that forms carbocyclic structures from the latter intermediates; a beta-ketoacyl oxidoreductase that forms beta-hydroxyacyl intermediates or reduces ketone groups in fully formed polyketides; and a thioesterase that releases the assembled polyketide from the enzyme. Images PMID:2684656

  3. Insertion of Mini-IS605 and Deletion of Adjacent Sequences in the Nitroreductase (rdxA) Gene Cause Metronidazole Resistance in Helicobacter pylori NCTC11637

    PubMed Central

    Debets-Ossenkopp, Yvette J.; Pot, Raymond G. J.; van Westerloo, David J.; Goodwin, Avery; Vandenbroucke-Grauls, Christina M. J. E.; Berg, Douglas E.; Hoffman, Paul S.; Kusters, Johannes G.

    1999-01-01

    We found that NCTC11637, the type strain of Helicobacter pylori, the causative agent of peptic ulcer disease and an early risk factor for gastric cancer, is metronidazole resistant. DNA transformation, PCR-based restriction analysis, and DNA sequencing collectively showed that the metronidazole resistance of this strain was due to mutation in rdxA (gene HP0954 in the full genome sequence of H. pylori 26695) and that resistance did not depend on mutation in any of the other genes that had previously been suggested: catalase (katA), ferredoxin (fdx), flavodoxin (fldA), pyruvate:flavodoxin oxidoreductase (por????), RecA (recA), or superoxide dismutase (sodB). This is in accord with another recent study that attributed metronidazole resistance to point mutations in rdxA. However, the mechanism of rdxA inactivation that we found in NCTC11637 is itself also novel: insertion of mini-IS605, one of the endogenous transposable elements of H. pylori, and deletion of adjacent DNA sequences including 462 bp of the 851-bp-long rdxA gene. PMID:10543743

  4. Crystallization and preliminary X-ray characterization of the nitrile reductase QueF: a queuosine-biosynthesis enzyme

    SciTech Connect

    Swairjo, Manal A. Reddy, Robert R.; Lee, Bobby; Van Lanen, Steven G.; Brown, Shannon; Crécy-Lagard, Valérie de; Iwata-Reuyl, Dirk; Schimmel, Paul

    2005-10-01

    Structural informatics and modelling correctly predicted that substrate was required to obtain diffracting crystals of the first characterized nitrile oxidoreductase: the homododecameric QueF. QueF (MW = 19.4 kDa) is a recently characterized nitrile oxidoreductase which catalyzes the NADPH-dependent reduction of 7-cyano-7-deazaguanine (preQ{sub 0}) to 7-aminomethyl-7-deazaguanine, a late step in the biosynthesis of the modified tRNA nucleoside queuosine. Initial crystals of homododecameric Bacillus subtilis QueF diffracted poorly to 8.0 Å. A three-dimensional model based on homology with the tunnel-fold enzyme GTP cyclohydrolase I suggested catalysis at intersubunit interfaces and a potential role for substrate binding in quaternary structure stabilization. Guided by this insight, a second crystal form was grown that was strictly dependent on the presence of preQ{sub 0}. This crystal form diffracted to 2.25 Å resolution.

  5. Gene Carlson Oral History

    E-print Network

    Carlson, Gene; Shriner, Clint

    2009-12-10

    Oral history interview with Gene Carlson conducted by Clint Shriner on December 10, 2009. In this interview, Gene Carlson, lead pastor at Westlink Christian Church, discusses the formative experiences that resulted in his decision to join...

  6. Proto-genes and de novo gene birth

    E-print Network

    Carvunis, Anne-Ruxandra

    Novel protein-coding genes can arise either through re-organization of pre-existing genes or de novo. Processes involving re-organization of pre-existing genes, notably after gene duplication, have been extensively described. ...

  7. Downregulation of Mouse Hepatic CYP3A Protein by 3-Methylcholanthrene Does Not Require Cytochrome P450-Dependent Metabolism

    PubMed Central

    Lee, Chunja; Ding, Xinxin

    2013-01-01

    The aryl hydrocarbon receptor (AHR)–dependent induction of cytochromes P450 (P450) such as CYP1A1 by 3-methylcholanthrene (MC) and related polycyclic aromatic hydrocarbons is well characterized. We reported previously that MC treatment triggers a pronounced downregulation, particularly at the protein level, of mouse hepatic Cyp3a11, a counterpart of the key human drug-metabolizing enzyme CYP3A4. To determine whether this effect of MC requires hepatic microsomal P450 activity, we studied liver Cpr-null (LCN) mice with hepatocyte-specific conditional deletion of the NADPH-cytochrome P450 oxidoreductase gene. In vehicle-treated animals, basal levels of CYP3A11 mRNA and CYP3A protein immunoreactivity were elevated by approximately 9-fold in LCN mice compared with wild-type (WT) mice, whereas CYP3A catalytic activity was profoundly compromised in LCN mice. MC treatment caused suppression of CYP3A11 mRNA, CYP3A protein immunoreactivity, and CYP3A catalytic activity in WT mice, and the MC effects at the mRNA and protein levels were maintained in LCN mice. Flavin-containing monooxygenase-3 (Fmo3) induction by MC was suggested previously to occur via an AHR-dependent mechanism requiring conversion of the parent compound to DNA-damaging reactive metabolites; however, hepatic FMO3 mRNA levels were dramatically increased by MC in both WT and LCN mice. MC did not function as a mechanism-based inactivator of CYP3A enzymes in hepatic microsomes prepared from untreated WT mice, under conditions in which 1-aminobenzotriazole caused marked NADPH-dependent loss of total P450 content and CYP3A catalytic activity. These results indicate that MC downregulates mouse hepatic CYP3A protein via a pretranslational mechanism that does not require hepatic microsomal P450-dependent activity. PMID:23846873

  8. Sandro Rusconi Gene transfer

    E-print Network

    Málaga, Universidad de

    Sandro Rusconi aaaaaa UNIFR Rusconi 2003 Gene transfer: limits and potential as doping vehicle Geneva 30.09.03 AISTS 'genes & sport' workshop 1972-75 Primary school teacher (Locarno, Switzerland) 1975 on 'molecular medicine' & molecular doping: applications and problems, Gene-based doping applications

  9. Sandro Rusconi Gene transfer

    E-print Network

    Málaga, Universidad de

    Sandro Rusconi UNIFR Rusconi 2003 Gene transfer: limits and potential as doping vehicle Geneva 30.09.03 AISTS 'genes & sport' workshop 1972-75 Primary school teacher (Locarno, Switzerland) 1975-79 Graduation medicine' & molecular doping: applications and problems, Gene-based doping applications, comparison

  10. Reading and Generalist Genes

    ERIC Educational Resources Information Center

    Haworth, Claire M. A.; Meaburn, Emma L.; Harlaar, Nicole; Plomin, Robert

    2007-01-01

    Twin-study research suggests that many (but not all) of the same genes contribute to genetic influence on diverse learning abilities and disabilities, a hypothesis called "generalist genes". This generalist genes hypothesis was tested using a set of 10 DNA markers (single nucleotide polymorphisms [SNPs]) found to be associated with early reading…

  11. Evolution of Gene Expression after Gene Amplification

    PubMed Central

    Garcia, Nelson; Zhang, Wei; Wu, Yongrui; Messing, Joachim

    2015-01-01

    We took a rather unique approach to investigate the conservation of gene expression of prolamin storage protein genes across two different subfamilies of the Poaceae. We took advantage of oat plants carrying single maize chromosomes in different cultivars, called oat–maize addition (OMA) lines, which permitted us to determine whether regulation of gene expression was conserved between the two species. We found that ?-zeins are expressed in OMA7.06, which carries maize chromosome 7 even in the absence of the trans-acting maize prolamin-box-binding factor (PBF), which regulates their expression. This is likely because oat PBF can substitute for the function of maize PBF as shown in our transient expression data, using a ?-zein promoter fused to green fluorescent protein (GFP). Despite this conservation, the younger, recently amplified prolamin genes in maize, absent in oat, are not expressed in the corresponding OMAs. However, maize can express the oldest prolamin gene, the wheat high-molecular weight glutenin Dx5 gene, even when maize Pbf is knocked down (through PbfRNAi), and/or another maize transcription factor, Opaque-2 (O2) is knocked out (in maize o2 mutant). Therefore, older genes are conserved in their regulation, whereas younger ones diverged during evolution and eventually acquired a new repertoire of suitable transcriptional activators. PMID:25912045

  12. Immunoglobulin ? Gene Rearrangement Can Precede ? Gene Rearrangement

    DOE PAGESBeta

    Berg, Jörg; Mcdowell, Mindy; Jäck, Hans-Martin; Wabl, Matthias

    1990-01-01

    Immunoglobulin genes are generated during differentiation of B lymphocytes by joining gene segments. A mouse pre-B cell contains a functional immunoglobulin heavy-chain gene, but no light-chain gene. Although there is only one heavy-chain locus, there are two lightchain loci: ? and ? .It has been reported that ? loci in the germ-line configuration are never (in man) or very rarely (in the mouse) present in cells with functionally rearranged ? -chain genes. Two explanations have been proposed to explain this: (a) the ordered rearrangement theory, which postulatesmore »that light-chain gene rearrangement in the pre-B cell is first attempted at the ? locus, and that only upon failure to produce a functional ? chain is there an attempt to rearrange the ? locus; and (b) the stochastic theory, which postulates that rearrangement at the ? locus proceeds at a rate that is intrinsically much slower than that at the ? locus. We show here that ? -chain genes are generated whether or not the ? locus has lost its germ-line arrangement, a result that is compatible only with the stochastic theory. « less

  13. Biosynthetic Gene Cluster of Cetoniacytone A, an Unusual Aminocyclitol from the Endosymbiotic Bacterium Actinomyces sp. Lu 9419

    PubMed Central

    Wu, Xiumei; Flatt, Patricia M.; Xu, Hui

    2011-01-01

    A gene cluster responsible for the biosynthesis of the antitumor agent cetoniacytone A was identified in Actinomyces sp. strain Lu 9419, an endosymbiotic bacteria isolated from the intestines of the rose chafer beetle (Cetonia aurata). The nucleotide sequence analysis of the 46 kb DNA region revealed the presence of 31 complete ORFs, including genes predicted to encode a 2-epi-5-epi-valiolone synthase (CetA), a glyoxalase/bleomycin resistance protein (CetB), an acyltransferase (CetD), an FAD-dependent dehydrogenase (CetF2), two oxidoreductases (CetF1 and CetG), two aminotransferases (CetH and CetM), and a pyranose oxidase (CetL). CetA has previously been demonstrated to catalyze the cyclization of sedoheptulose 7-phosphate to the cyclic intermediate, 2-epi-5-epi-valiolone. In this report, the glyoxalase/bleomycin resistance protein homolog CetB was identified as a 2-epi-5-epi-valiolone epimerase (EVE), a new member of the Vicinal Oxygen Chelate (VOC) superfamily. The 24 kDa recombinant histidine-tagged CetB was found to form a homodimer; each monomer contains two ????? scaffolds that form a metal binding site with two histidine and two glutamic acid residues. BLAST search using the newly isolated cet biosynthetic genes revealed an analogous suite of genes in the genome of Frankia alni ACN14a, suggesting that this plant symbiotic nitrogen-fixing bacterium is capable of producing a secondary metabolite related to the cetoniacytones. PMID:19101977

  14. Biosynthetic gene cluster of cetoniacytone A, an unusual aminocyclitol from the endosymbiotic Bacterium Actinomyces sp. Lu 9419.

    PubMed

    Wu, Xiumei; Flatt, Patricia M; Xu, Hui; Mahmud, Taifo

    2009-01-26

    A gene cluster responsible for the biosynthesis of the antitumor agent cetoniacytone A was identified in Actinomyces sp. strain Lu 9419, an endosymbiotic bacterium isolated from the intestines of the rose chafer beetle (Cetonia aurata). The nucleotide sequence analysis of the 46 kb DNA region revealed the presence of 31 complete ORFs, including genes predicted to encode a 2-epi-5-epi-valiolone synthase (CetA), a glyoxalase/bleomycin resistance protein (CetB), an acyltransferase (CetD), an FAD-dependent dehydrogenase (CetF2), two oxidoreductases (CetF1 and CetG), two aminotransferases (CetH and CetM), and a pyranose oxidase (CetL). CetA has previously been demonstrated to catalyze the cyclization of sedoheptulose 7-phosphate to the cyclic intermediate, 2-epi-5-epi-valiolone. In this report, the glyoxalase/bleomycin resistance protein homolog CetB was identified as a 2-epi-5-epi-valiolone epimerase (EVE), a new member of the vicinal oxygen chelate (VOC) superfamily. The 24 kDa recombinant histidine-tagged CetB was found to form a homodimer; each monomer contains two betaalphabetabetabeta scaffolds that form a metal binding site with two histidine and two glutamic acid residues. A BLAST search using the newly isolated cet biosynthetic genes revealed an analogous suite of genes in the genome of Frankia alni ACN14a, suggesting that this plant symbiotic nitrogen-fixing bacterium is capable of producing a secondary metabolite related to the cetoniacytones. PMID:19101977

  15. Connectionist Approaches for Predicting Mouse Gene Function from Gene Expression

    E-print Network

    Bonner, Anthony

    Therapy. Identifying gene function based on gene expression data is much easier in prokaryotes than ways, especially in Gene Therapy [5]. Identifying gene function in prokaryotes is much easier thanConnectionist Approaches for Predicting Mouse Gene Function from Gene Expression Emad Andrews

  16. Identification of the Gene Cluster for the Anaerobic Degradation of 3,5-Dihydroxybenzoate (?-Resorcylate) in Thauera aromatica Strain AR-1.

    PubMed

    Molina-Fuentes, Águeda; Pacheco, Daniel; Marín, Patricia; Philipp, Bodo; Schink, Bernhard; Marqués, Silvia

    2015-10-01

    Thauera aromatica strain AR-1 degrades 3,5-dihydroxybenzoate (3,5-DHB) with nitrate as an electron acceptor. Previous biochemical studies have shown that this strain converts 3,5-DHB to hydroxyhydroquinone (1,2,4-trihydroxybenzene) through water-dependent hydroxylation of the aromatic ring and subsequent decarboxylation, and they suggest a pathway homologous to that described for the anaerobic degradation of 1,3-dihydroxybenzene (resorcinol) by Azoarcus anaerobius. Southern hybridization of a T. aromatica strain AR-1 gene library identified a 25-kb chromosome region based on its homology with A. anaerobius main pathway genes. Sequence analysis defined 20 open reading frames. Knockout mutations of the most relevant genes in the pathway were generated by reverse genetics. Physiological and biochemical analyses identified the genes for the three main steps in the pathway which were homologous to those described in A. anaerobius and suggested the function of several auxiliary genes possibly involved in enzyme maturation and intermediate stabilization. However, T. aromatica strain AR-1 had an additional enzyme to metabolize hydroxyhydroquinone, a putative cytoplasmic quinone oxidoreductase. In addition, a specific tripartite ATP-independent periplasmic (TRAP) transport system was required for efficient growth on 3,5-DHB. Reverse transcription-PCR (RT-PCR) analysis showed that the pathway genes were organized in five 3,5-DHB-inducible operons, three of which have been shown to be under the control of a single LysR-type transcriptional regulator, DbdR. Despite sequence homology, the genetic organizations of the clusters in T. aromatica strain AR-1 and A. anaerobius differed substantially. PMID:26253674

  17. Genes Help Set Menopause Timing

    MedlinePLUS

    ... rights reserved. More Health News on: Genes and Gene Therapy Menopause Recent Health News Related MedlinePlus Health Topics Genes and Gene Therapy Menopause About MedlinePlus Site Map FAQs Contact Us ...

  18. Studies on the enzymatic reduction of N-Boc-4S-amino-3-oxo-5-phenylpentanoic acid methylester.

    PubMed

    Nassenstein, A; Hemberger, J; Schwartz, H; Kula, M R

    1992-11-01

    The enzymatic reduction of N-Boc-4S-amino-3-oxo-5-phenylpentanoic acid methylester, the key intermediate in the stereoselective synthesis of a statinanalogue, was studied with Hansenula anomala and Hansenula silvicola. Using whole cells of H. anomala gives complete conversion and a diastereomeric excess of 88% of the desired 3S, 4S statinanalogue. The strain contains two NADPH-dependent oxidoreductases, that can be separated by ion exchange chromatography or gelfiltration, yielding the 3S, 4S or 3R, 4S stereoisomers, respectively, with > 99% diastereomeric excess (DE). In the crude extract the 3S, 4S oxidoreductase is very unstable and could be purified with < 1% yield only. In contrast, H. silvicola, which gave poor conversions using whole cells, exhibited about 80-fold higher specific activity in the crude extract than H. anomala. The NADPH-dependent oxidoreductase was purified 317-fold in 12% yield. A single enzyme of 54 kDa reduces the substrate with 97.4% DE. Besides the statinanalogue a wide range of other compounds could be reduced, most notably diones and chinones such as isatin or campherchinone. It was demonstrated that the enzymes often discussed for the reduction of beta-ketoesters with yeast e.g. L-3-hydroxyacyl CoA dehydrogenase (EC 1.1.1.35), the beta-ketoreductase of the fatty acid synthase complex and also the 3-hydroxy-3-methyl glutaryl-CoA dehydrogenase (EC 1.1.1.34) are separated during the purification steps from the oxidoreductase acting on N-Boc-4S-amino-3-oxo-5-phenylpentanoic acid methylester. The physiological role of the new enzyme is still unknown. PMID:1369149

  19. 1,3-Propanediol production by new recombinant Escherichia coli containing genes from pathogenic bacteria.

    PubMed

    Przysta?owska, Hanna; Zeyland, Joanna; Szymanowska-Powa?owska, Daria; Szalata, Marlena; S?omski, Ryszard; Lipi?ski, Daniel

    2015-02-01

    1,3-Propanediol (1,3-PDO) is an organic compound, which is a valuable intermediate product, widely used as a monomer for synthesizing biodegradable polymers, increasing their strength; as well as an ingredient of textile, cosmetic and medical products. 1,3-PDO is mostly synthesized chemically. Global companies have developed technologies for 1,3-PDO synthesis from petroleum products such as acrolein and ethylene oxide. A potentially viable alternative is offered by biotechnological processes using microorganisms capable of synthesizing 1,3-PDO from renewable substrates (waste glycerol, a by-product of biofuel production, or glucose). In the present study, genes from Citrobacter freundii and Klebsiella pneumoniae were introduced into Escherichia coli bacteria to enable the synthesis of 1,3-PDO from waste glycerol. These strains belong to the best 1,3-PDO producers, but they are pathogenic, which restricts their application in industrial processes. The present study involved the construction of two gene expression constructs, containing a total of six heterologous glycerol catabolism pathway genes from C. freundii ATCC 8090 and K. pneumoniae ATCC 700721. Heterologous genes encoding glycerol dehydratase (dhaBCE) and the glycerol dehydratase reactivation factor (dhaF, dhaG) from C. freundii and gene encoding 1,3-PDO oxidoreductase (dhaT) from K. pneumoniae were expressed in E. coli under the control of the T7lac promoter. An RT-PCR analysis and overexpression confirmed that 1,3-PDO synthesis pathway genes were expressed on the RNA and protein levels. In batch fermentation, recombinant E. coli bacteria used 32.6gl(-1) of glycerol to produce 10.6 gl(-1) of 1,3-PDO, attaining the efficiency of 0.4 (mol?,?-PDO molglycerol(-1)). The recombinant E. coli created is capable of metabolizing glycerol to produce 1,3-PDO, and the efficiency achieved provides a significant research potential of the bacterium. In the face of shortage of fossil fuel supplies and climate warming there is an increasing industrial need to exchange the chemical way of chemicals synthesis for biotechnological - more ecological manner. The 1,3-PDO production from glycerol is an desirable alternative to the traditional production from non-renewable resources. This work is a part of project, which opens a way to development of innovative "green chemistry" and new perspectives to chemical industry. PMID:25644946

  20. Gene hunting in autoinflammation

    PubMed Central

    2013-01-01

    Steady progress in our understanding of the genetic basis of autoinflammatory diseases has been made over the past 16 years. Since the discovery of the familial Mediterranean fever gene MEFV (also known as marenostrin) in 1997, 18 other genes responsible for monogenic autoinflammatory diseases have been identified to date. The discovery of these genes was made through the utilisation of many genetic mapping techniques, including next generation sequencing platforms. This review article clearly describes the gene hunting approaches, methods of data analysis and the technological platforms used, which has relevance to all those working within the field of gene discovery for Mendelian disorders. PMID:24070009

  1. Regulated Gene Therapy.

    PubMed

    Breger, Ludivine; Wettergren, Erika Elgstrand; Quintino, Luis; Lundberg, Cecilia

    2016-01-01

    Gene therapy represents a promising approach for the treatment of monogenic and multifactorial neurological disorders. It can be used to replace a missing gene and mutated gene or downregulate a causal gene. Despite the versatility of gene therapy, one of the main limitations lies in the irreversibility of the process: once delivered to target cells, the gene of interest is constitutively expressed and cannot be removed. Therefore, efficient, safe and long-term gene modification requires a system allowing fine control of transgene expression.Different systems have been developed over the past decades to regulate transgene expression after in vivo delivery, either at transcriptional or post-translational levels. The purpose of this chapter is to give an overview on current regulatory system used in the context of gene therapy for neurological disorders. Systems using external regulation of transgenes using antibiotics are commonly used to control either gene expression using tetracycline-controlled transcription or protein levels using destabilizing domain technology. Alternatively, specific promoters of genes that are regulated by disease mechanisms, increasing expression as the disease progresses or decreasing expression as disease regresses, are also examined. Overall, this chapter discusses advantages and drawbacks of current molecular methods for regulated gene therapy in the central nervous system. PMID:26611578

  2. The 380 kb pCMU01 Plasmid Encodes Chloromethane Utilization Genes and Redundant Genes for Vitamin B12- and Tetrahydrofolate-Dependent Chloromethane Metabolism in Methylobacterium extorquens CM4: A Proteomic and Bioinformatics Study

    PubMed Central

    Roselli, Sandro; Nadalig, Thierry; Vuilleumier, Stéphane; Bringel, Françoise

    2013-01-01

    Chloromethane (CH3Cl) is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu) was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD), as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2). In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase) are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex), conversion of tetrahydrofolate-bound one-carbon units, and central metabolism. The mosaic organization of plasmid pCMU01 and the clustering of genes coding for dehalogenase enzymes and for biosynthesis of associated cofactors suggests a history of gene acquisition related to chloromethane utilization. PMID:23593113

  3. Do Housekeeping Genes Exist?

    PubMed Central

    Sun, Bingyun

    2015-01-01

    The searching of human housekeeping (HK) genes has been a long quest since the emergence of transcriptomics, and is instrumental for us to understand the structure of genome and the fundamentals of biological processes. The resolved genes are frequently used in evolution studies and as normalization standards in quantitative gene-expression analysis. Within the past 20 years, more than a dozen HK-gene studies have been conducted, yet none of them sampled human tissues completely. We believe an integration of these results will help remove false positive genes owing to the inadequate sampling. Surprisingly, we only find one common gene across 15 examined HK-gene datasets comprising 187 different tissue and cell types. Our subsequent analyses suggest that it might not be appropriate to rigidly define HK genes as expressed in all tissue types that have diverse developmental, physiological, and pathological states. It might be beneficial to use more robustly identified HK functions for filtering criteria, in which the representing genes can be a subset of genome. These genes are not necessarily the same, and perhaps need not to be the same, everywhere in our body. PMID:25970694

  4. The gap gene network

    PubMed Central

    2010-01-01

    Gap genes are involved in segment determination during the early development of the fruit fly Drosophila melanogaster as well as in other insects. This review attempts to synthesize the current knowledge of the gap gene network through a comprehensive survey of the experimental literature. I focus on genetic and molecular evidence, which provides us with an almost-complete picture of the regulatory interactions responsible for trunk gap gene expression. I discuss the regulatory mechanisms involved, and highlight the remaining ambiguities and gaps in the evidence. This is followed by a brief discussion of molecular regulatory mechanisms for transcriptional regulation, as well as precision and size-regulation provided by the system. Finally, I discuss evidence on the evolution of gap gene expression from species other than Drosophila. My survey concludes that studies of the gap gene system continue to reveal interesting and important new insights into the role of gene regulatory networks in development and evolution. PMID:20927566

  5. Gene expression data analysis.

    PubMed

    Brazma, A; Vilo, J

    2001-08-01

    Microarrays are one of the latest breakthroughs in experimental molecular biology, which allow monitoring of gene expression for tens of thousands of genes in parallel and are already producing huge amounts of valuable data. Analysis and handling of such data is becoming one of the major bottlenecks in the utilization of the technology. The raw microarray data are images, which have to be transformed into gene expression matrices, tables where rows represent genes, columns represent various samples such as tissues or experimental conditions, and numbers in each cell characterize the expression level of the particular gene in the particular sample. These matrices have to be analyzed further if any knowledge about the underlying biological processes is to be extracted. In this paper we concentrate on discussing bioinformatics methods used for such analysis. We briefly discuss supervised and unsupervised data analysis and its applications, such as predicting gene function classes and cancer classification as well as some possible future directions. PMID:11580977

  6. Mammalian suppressor genes

    SciTech Connect

    Sharp, P.A.; Capecchi, M.R.; Raj Bhandary, U.L.; Laski, F.A.

    1987-08-18

    A method is described of suppressing a nonsense codon in a gene for production of a protein of interest in mammalian cells, the method comprising: (a) preparing an oligonucleotide primer comprising a region complementary to the nonsense codon; (b) preparing a DNA template for production of a tRNA molecule; (c) forming a suppressor gene from the template and primer by site specific mutagenesis; and (d) transforming the suppressor gene into a mammalian cell, whereby the nonsense codon will be suppressed.

  7. Green genes gleaned.

    PubMed

    Beale, Samuel I

    2005-07-01

    A recent paper by Ayumi Tanaka and colleagues identifying an Arabidopsis thaliana gene for 3,8-divinyl(proto)chlorophyllide 8-vinyl reductase brings a satisfying conclusion to the hunt for genes encoding enzymes for the steps in the chlorophyll biosynthetic pathway. Now, at least in angiosperm plants represented by Arabidopsis, genes for all 15 steps in the pathway from glutamyl-tRNA to chlorophylls a and b have been identified. PMID:15951223

  8. History of gene therapy.

    PubMed

    Wirth, Thomas; Parker, Nigel; Ylä-Herttuala, Seppo

    2013-08-10

    Two decades after the initial gene therapy trials and more than 1700 approved clinical trials worldwide we not only have gained much new information and knowledge regarding gene therapy in general, but also learned to understand the concern that has persisted in society. Despite the setbacks gene therapy has faced, success stories have increasingly emerged. Examples for these are the positive recommendation for a gene therapy product (Glybera) by the EMA for approval in the European Union and the positive trials for the treatment of ADA deficiency, SCID-X1 and adrenoleukodystrophy. Nevertheless, our knowledge continues to grow and during the course of time more safety data has become available that helps us to develop better gene therapy approaches. Also, with the increased understanding of molecular medicine, we have been able to develop more specific and efficient gene transfer vectors which are now producing clinical results. In this review, we will take a historical view and highlight some of the milestones that had an important impact on the development of gene therapy. We will also discuss briefly the safety and ethical aspects of gene therapy and address some concerns that have been connected with gene therapy as an important therapeutic modality. PMID:23618815

  9. Selecting Informative Genes from Microarray Dataset by Incorporating Gene Ontology

    E-print Network

    Buffalo, State University of New York

    Selecting Informative Genes from Microarray Dataset by Incorporating Gene Ontology Xian Xu Aidong 14224, USA xianxu,azhang@cse.buffalo.edu Abstract Selecting informative genes from microarray experi, namely large num- ber of genes and limited number of samples, the statistical soundness of gene selection

  10. Essential Genes Are More Evolutionarily Conserved Than Are Nonessential Genes

    E-print Network

    Jordan, King

    Essential Genes Are More Evolutionarily Conserved Than Are Nonessential Genes in Bacteria I. King The "knockout-rate" prediction holds that essential genes should be more evolutionarily conserved than are nonessential genes. This is because negative (purifying) selection acting on essential genes is expected

  11. Analysis of Gene Order Evolution beyond Single-Copy Genes

    E-print Network

    El-Mabrouk, Nadia

    -chromosomal rearrangement events, which do not change gene content, but may radically alter gene order. InferringAnalysis of Gene Order Evolution beyond Single-Copy Genes Nadia El-Mabrouk D´epartement d genomics based on representation of genomes as ordered sequences of signed genes. We specifically focus

  12. Cloning, characterization, and expression in Escherichia coli of a gene encoding Listeria seeligeri catalase, a bacterial enzyme highly homologous to mammalian catalases.

    PubMed Central

    Haas, A; Brehm, K; Kreft, J; Goebel, W

    1991-01-01

    A gene coding for catalase (hydrogen-peroxide:hydrogen-peroxide oxidoreductase; EC 1.11.1.6) of the gram-positive bacterium Listeria seeligeri was cloned from a plasmid library of EcoRI-digested chromosomal DNA, with Escherichia coli DH5 alpha as a host. The recombinant catalase was expressed in E. coli to an enzymatic activity approximately 50 times that of the combined E. coli catalases. The nucleotide sequence was determined, and the deduced amino acid sequence revealed 43.2% amino acid sequence identity between bovine liver catalase and L. seeligeri catalase. Most of the amino acid residues which are involved in catalytic activity, the formation of the active center accession channel, and heme binding in bovine liver catalase were also present in L. seeligeri catalase at the corresponding positions. The recombinant protein contained 488 amino acid residues and had a calculated molecular weight of 55,869. The predicted isoelectric point was 5.0. Enzymatic and genetic analyses showed that there is most probably a single catalase of this type in L. seeligeri. A perfect 21-bp inverted repeat, which was highly homologous to previously reported binding sequences of the Fur (ferric uptake regulon) protein of E. coli, was detected next to the putative promoter region of the L. seeligeri catalase gene. Images PMID:1860824

  13. Library Generation by Gene Shuffling

    PubMed Central

    Meyer, Adam J.; Ellefson, JaredW.; Ellington, Andrew D.

    2014-01-01

    This unit describes the process of gene shuffling (also known as sexual PCR). Gene shuffling is a facile method for the generation of sequence libraries containing the information from a family of related genes. Essentially, related genes are fragmented by DNase I digestion and reassembled by primerless PCR. The resulting chimeric genes can then be screened or selected for a desired function. PMID:24510437

  14. 4. AERIAL VIEW OF GENE WASH RESERVOIR AND GENE CAMP ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. AERIAL VIEW OF GENE WASH RESERVOIR AND GENE CAMP LOOKING SOUTHWEST. DAM AND SPILLWAY VISIBLE IN BOTTOM OF PHOTO. - Gene Wash Reservoir & Dam, 2 miles west of Parker Dam, Parker Dam, San Bernardino County, CA

  15. GENE EXPRESSION NETWORKS

    EPA Science Inventory

    "Gene expression network" is the term used to describe the interplay, simple or complex, between two or more gene products in performing a specific cellular function. Although the delineation of such networks is complicated by the existence of multiple and subtle types of intera...

  16. Ocular Gene Therapy.

    PubMed

    Campbell, J Peter; McFarland, Trevor J; Stout, J Timothy

    2016-01-01

    Ocular gene therapy involves the introduction of an exogenous gene product to a host's cellular and genetic machinery for endogenous production of a desired gene product. The eye represents an ideal target organ due to its easy visibility and accessibility, and several trials have demonstrated proof-of-principle safety and efficacy in a subtype of Leber's congenital amaurosis. There are numerous ongoing clinical trials exploring gene therapy in other retinal diseases. In autosomal recessively inherited retinal degenerations, the introduced gene product replaces a known genetically deficient gene product and provides restoration of function. In other disease states, such as neovascular age-related macular degeneration, the delivered gene product modulates existing proteins within a cell, such as vascular endothelial growth factor, for a desired therapeutic effect. This latter approach may have broader applications in other diseases such as diabetes and other retinal vascular diseases that are as yet unrealized. This review summarizes the current state of clinical research in ocular gene therapy focusing on those diseases in which the technology has reached clinical trials. PMID:26502313

  17. Gene promoters dictate histone occupancy within genes.

    PubMed

    Perales, Roberto; Erickson, Benjamin; Zhang, Lian; Kim, Hyunmin; Valiquett, Elan; Bentley, David

    2013-10-01

    Spt6 is a transcriptional elongation factor and histone chaperone that reassembles transcribed chromatin. Genome-wide H3 mapping showed that Spt6 preferentially maintains nucleosomes within the first 500 bases of genes and helps define nucleosome-depleted regions in 5' and 3' flanking sequences. In Spt6-depleted cells, H3 loss at 5' ends correlates with reduced pol II density suggesting enhanced transcription elongation. Consistent with its 'Suppressor of Ty' (Spt) phenotype, Spt6 inactivation caused localized H3 eviction over 1-2 nucleosomes at 5' ends of Ty elements. H3 displacement differed between genes driven by promoters with 'open'/DPN and 'closed'/OPN chromatin conformations with similar pol II densities. More eviction occurred on genes with 'closed' promoters, associated with 'noisy' transcription. Moreover, swapping of 'open' and 'closed' promoters showed that they can specify distinct downstream patterns of histone eviction/deposition. These observations suggest a novel function for promoters in dictating histone dynamics within genes possibly through effects on transcriptional bursting or elongation rate. PMID:24013117

  18. Virtual Gene: Using Correlations Between Genes to Select Informative Genes on Microarray Datasets

    E-print Network

    Buffalo, State University of New York

    Virtual Gene: Using Correlations Between Genes to Select Informative Genes on Microarray Datasets State University of New York at Buffalo, Buffalo, NY 14260, USA Abstract. Gene Selection is one class of most used data analysis algorithms on microarray datasets. The goal of gene selection algorithms

  19. Genes from scratch – the evolutionary fate of de novo genes

    PubMed Central

    Schlötterer, Christian

    2015-01-01

    Although considered an extremely unlikely event, many genes emerge from previously noncoding genomic regions. This review covers the entire life cycle of such de novo genes. Two competing hypotheses about the process of de novo gene birth are discussed as well as the high death rate of de novo genes. Despite the high death rate, some de novo genes are retained and remain functional, even in distantly related species, through their integration into gene networks. Further studies combining gene expression with ribosome profiling in multiple populations across different species will be instrumental for an improved understanding of the evolutionary processes operating on de novo genes. PMID:25773713

  20. Structures of oxalate oxidoreductase : C? activation by a microbial TPP-dependent ferredoxin oxidoreductase

    E-print Network

    Gibson, Marcus Ian

    2015-01-01

    Oxalic acid is a two-carbon diprotic acid that is toxic to humans. In large doses, it can cause death by poisoning, and in smaller doses over time it can lead to chronic renal disease, such as the formation of kidney stones, ...

  1. Gene expression data analysis.

    PubMed

    Brazma, A; Vilo, J

    2000-08-25

    Microarrays are one of the latest breakthroughs in experimental molecular biology, which allow monitoring of gene expression for tens of thousands of genes in parallel and are already producing huge amounts of valuable data. Analysis and handling of such data is becoming one of the major bottlenecks in the utilization of the technology. The raw microarray data are images, which have to be transformed into gene expression matrices--tables where rows represent genes, columns represent various samples such as tissues or experimental conditions, and numbers in each cell characterize the expression level of the particular gene in the particular sample. These matrices have to be analyzed further, if any knowledge about the underlying biological processes is to be extracted. In this paper we concentrate on discussing bioinformatics methods used for such analysis. We briefly discuss supervised and unsupervised data analysis and its applications, such as predicting gene function classes and cancer classification. Then we discuss how the gene expression matrix can be used to predict putative regulatory signals in the genome sequences. In conclusion we discuss some possible future directions. PMID:10967323

  2. Effect of the deletion of qmoABC and the promoter distal gene encoding a hypothetical protein on sulfate-reduction in Desulfovibrio vulgaris Hildenborough

    SciTech Connect

    Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.

    2010-03-18

    The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.

  3. Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage

    PubMed Central

    Guo, Peiguo; Baum, Michael; Grando, Stefania; Ceccarelli, Salvatore; Bai, Guihua; Li, Ronghua; von Korff, Maria; Varshney, Rajeev K.; Graner, Andreas; Valkoun, Jan

    2009-01-01

    Drought tolerance is a key trait for increasing and stabilizing barley productivity in dry areas worldwide. Identification of the genes responsible for drought tolerance in barley (Hordeum vulgare L.) will facilitate understanding of the molecular mechanisms of drought tolerance, and also facilitate the genetic improvement of barley through marker-assisted selection or gene transformation. To monitor the changes in gene expression at the transcriptional level in barley leaves during the reproductive stage under drought conditions, the 22K Affymetrix Barley 1 microarray was used to screen two drought-tolerant barley genotypes, Martin and Hordeum spontaneum 41-1 (HS41-1), and one drought-sensitive genotype Moroc9-75. Seventeen genes were expressed exclusively in the two drought-tolerant genotypes under drought stress, and their encoded proteins may play significant roles in enhancing drought tolerance through controlling stomatal closure via carbon metabolism (NADP malic enzyme, NADP-ME, and pyruvate dehydrogenase, PDH), synthesizing the osmoprotectant glycine-betaine (C-4 sterol methyl oxidase, CSMO), generating protectants against reactive-oxygen-species scavenging (aldehyde dehydrogenase,ALDH, ascorbate-dependent oxidoreductase, ADOR), and stabilizing membranes and proteins (heat-shock protein 17.8, HSP17.8, and dehydrin 3, DHN3). Moreover, 17 genes were abundantly expressed in Martin and HS41-1 compared with Moroc9-75 under both drought and control conditions. These genes were possibly constitutively expressed in drought-tolerant genotypes. Among them, seven known annotated genes might enhance drought tolerance through signalling [such as calcium-dependent protein kinase (CDPK) and membrane steroid binding protein (MSBP)], anti-senescence (G2 pea dark accumulated protein, GDA2), and detoxification (glutathione S-transferase, GST) pathways. In addition, 18 genes, including those encoding ?l-pyrroline-5-carboxylate synthetase (P5CS), protein phosphatase 2C-like protein (PP2C), and several chaperones, were differentially expressed in all genotypes under drought; thus they were more likely to be general drought-responsive genes in barley. These results could provide new insights into further understanding of drought-tolerance mechanisms in barley. PMID:19561048

  4. The gene tree delusion.

    PubMed

    Springer, Mark S; Gatesy, John

    2016-01-01

    Higher-level relationships among placental mammals are mostly resolved, but several polytomies remain contentious. Song et al. (2012) claimed to have resolved three of these using shortcut coalescence methods (MP-EST, STAR) and further concluded that these methods, which assume no within-locus recombination, are required to unravel deep-level phylogenetic problems that have stymied concatenation. Here, we reanalyze Song et al.'s (2012) data and leverage these re-analyses to explore key issues in systematics including the recombination ratchet, gene tree stoichiometry, the proportion of gene tree incongruence that results from deep coalescence versus other factors, and simulations that compare the performance of coalescence and concatenation methods in species tree estimation. Song et al. (2012) reported an average locus length of 3.1kb for the 447 protein-coding genes in their phylogenomic dataset, but the true mean length of these loci (start codon to stop codon) is 139.6kb. Empirical estimates of recombination breakpoints in primates, coupled with consideration of the recombination ratchet, suggest that individual coalescence genes (c-genes) approach ?12bp or less for Song et al.'s (2012) dataset, three to four orders of magnitude shorter than the c-genes reported by these authors. This result has general implications for the application of coalescence methods in species tree estimation. We contend that it is illogical to apply coalescence methods to complete protein-coding sequences. Such analyses amalgamate c-genes with different evolutionary histories (i.e., exons separated by >100,000bp), distort true gene tree stoichiometry that is required for accurate species tree inference, and contradict the central rationale for applying coalescence methods to difficult phylogenetic problems. In addition, Song et al.'s (2012) dataset of 447 genes includes 21 loci with switched taxonomic names, eight duplicated loci, 26 loci with non-homologous sequences that are grossly misaligned, and numerous loci with >50% missing data for taxa that are misplaced in their gene trees. These problems were compounded by inadequate tree searches with nearest neighbor interchange branch swapping and inadvertent application of substitution models that did not account for among-site rate heterogeneity. Sixty-six gene trees imply unrealistic deep coalescences that exceed 100 million years (MY). Gene trees that were obtained with better justified models and search parameters show large increases in both likelihood scores and congruence. Coalescence analyses based on a curated set of 413 improved gene trees and a superior coalescence method (ASTRAL) support a Scandentia (treeshrews)+Glires (rabbits, rodents) clade, contradicting one of the three primary systematic conclusions of Song et al. (2012). Robust support for a Perissodactyla+Carnivora clade within Laurasiatheria is also lost, contradicting a second major conclusion of this study. Song et al.'s (2012) MP-EST species tree provided the basis for circular simulations that led these authors to conclude that the multispecies coalescent accounts for 77% of the gene tree conflicts in their dataset, but many internal branches of their MP-EST tree are stunted by an order of magnitude or more due to wholesale gene tree reconstruction errors. An independent assessment of branch lengths suggests the multispecies coalescent accounts for ?15% of the conflicts among Song et al.'s (2012) 447 gene trees. Unfortunately, Song et al.'s (2012) flawed phylogenomic dataset has been used as a model for additional simulation work that suggests the superiority of shortcut coalescence methods relative to concatenation. Investigator error was passed on to the subsequent simulation studies, which also incorporated further logical errors that should be avoided in future simulation studies. Illegitimate branch length switches in the simulation routines unfairly protected coalescence methods from their Achilles' heel, high gene tree reconstruction error at short internodes. These simulations therefore provide no

  5. GeneCards Version 3: the human gene integrator

    PubMed Central

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-01-01

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73 000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards’ unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene’s functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database URL: www.genecards.org PMID:20689021

  6. Identification of four soybean reference genes for gene expression normalization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene expression analysis requires the use of reference genes stably expressed independently of specific tissues or environmental conditions. Housekeeping genes (e.g., actin, tubulin, ribosomal, polyubiquitin and elongation factor 1-alpha) are commonly used as reference genes with the assumption tha...

  7. Gene Mutations Gene a finite segment of DNA specified

    E-print Network

    Massey, Thomas N.

    Mutation only appear in both parents contribute the same gene. · It may take generations for a recessive a large amount of DNA. · This allows expression of recessive genes on the X chromosome. · There are moreModule 5 Gene Mutations · Gene ­ a finite segment of DNA specified by an exact sequence of bases

  8. Functional Grouping of Genes Using Spectral Clustering and Gene Ontology

    E-print Network

    Zell, Andreas

    Functional Grouping of Genes Using Spectral Clustering and Gene Ontology Nora Speer, Holger amounts of biological data. During the analysis of such data the need for a functional grouping of genes arises. In this paper, we propose a new method based on spectral clustering for the partitioning of genes

  9. A Gene Scrapbook A Tribute to Gene Loh

    E-print Network

    A Gene Scrapbook A Tribute to Gene Loh on the Occasion of His Retirement Feb 22, 2003 #12;The Early of Technology, 1961 #12;The Missing Years Not much is known about Gene's whereabouts between 1961 until his (probably kelp) for transport by sea. #12;Why did Gene leave Cornell? He got tired of shoveling all

  10. 5. OVERHEAD VIEW OF GENE CAMP LOOKING SOUTH. GENE PUMP ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. OVERHEAD VIEW OF GENE CAMP LOOKING SOUTH. GENE PUMP PLANT IS AT CENTER WITH ADMINISTRATIVE COMPLEX IN FOREGROUND AND RESIDENTIAL AREA BEYOND PLANT. - Gene Pump Plant, South of Gene Wash Reservoir, 2 miles west of Whitsett Pump Plant, Parker Dam, San Bernardino County, CA

  11. "Bad genes" & criminal responsibility.

    PubMed

    González-Tapia, María Isabel; Obsuth, Ingrid

    2015-01-01

    The genetics of the accused is trying to break into the courts. To date several candidate genes have been put forward and their links to antisocial behavior have been examined and documented with some consistency. In this paper, we focus on the so called "warrior gene", or the low-activity allele of the MAOA gene, which has been most consistently related to human behavior and specifically to violence and antisocial behavior. In preparing this paper we had two objectives. First, to summarize and analyze the current scientific evidence, in order to gain an in depth understanding of the state of the issue and determine whether a dominant line of generally accepted scientific knowledge in this field can be asserted. Second, to derive conclusions and put forward recommendations related to the use of genetic information, specifically the presence of the low-activity genotype of the MAOA gene, in modulation of criminal responsibility in European and US courts. PMID:25708001

  12. Reading and Generalist Genes.

    PubMed

    Haworth, Claire M A; Meaburn, Emma L; Harlaar, Nicole; Plomin, Robert

    2007-12-01

    Twin-study research suggests that many (but not all) of the same genes contribute to genetic influence on diverse learning abilities and disabilities, a hypothesis called generalist genes. This generalist genes hypothesis was tested using a set of 10 DNA markers (single nucleotide polymorphisms [SNPs]) found to be associated with early reading ability in a study of 4,258 7-year-old children that screened 100,000 SNPs. Using the same sample, we show that this early reading SNP set also correlates with other aspects of literacy, components of mathematics, and more general cognitive abilities. These results provide support for the generalist genes hypothesis. Although the effect size of the current SNP set is small, such SNP sets could eventually be used to predict genetic risk for learning disabilities as well as to prescribe genetically tailored intervention and prevention programs. PMID:20383260

  13. Microfluidic gene synthesis

    E-print Network

    Kong, David Sun, 1979-

    2008-01-01

    The ability to synthesize custom de novo DNA constructs rapidly, accurately, and inexpensively is highly desired by researchers, as synthetic genes and longer DNA constructs are enabling to numerous powerful applications ...

  14. 1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon

    SciTech Connect

    I-Teh Tong; Hans H. Liao; Cameron, D.C. )

    1991-12-01

    The dha regulon in Klebsiella pneumoniae enables the organism to grown anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydoxyacetone and was screened for the production of 1, 3-PD. The cosmid pTC1 (42.5 kn total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycersol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1, 3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering.

  15. Classification of genes based on gene expression analysis

    NASA Astrophysics Data System (ADS)

    Angelova, M.; Myers, C.; Faith, J.

    2008-05-01

    Systems biology and bioinformatics are now major fields for productive research. DNA microarrays and other array technologies and genome sequencing have advanced to the point that it is now possible to monitor gene expression on a genomic scale. Gene expression analysis is discussed and some important clustering techniques are considered. The patterns identified in the data suggest similarities in the gene behavior, which provides useful information for the gene functionalities. We discuss measures for investigating the homogeneity of gene expression data in order to optimize the clustering process. We contribute to the knowledge of functional roles and regulation of E. coli genes by proposing a classification of these genes based on consistently correlated genes in expression data and similarities of gene expression patterns. A new visualization tool for targeted projection pursuit and dimensionality reduction of gene expression data is demonstrated.

  16. Classification of genes based on gene expression analysis

    SciTech Connect

    Angelova, M. Myers, C. Faith, J.

    2008-05-15

    Systems biology and bioinformatics are now major fields for productive research. DNA microarrays and other array technologies and genome sequencing have advanced to the point that it is now possible to monitor gene expression on a genomic scale. Gene expression analysis is discussed and some important clustering techniques are considered. The patterns identified in the data suggest similarities in the gene behavior, which provides useful information for the gene functionalities. We discuss measures for investigating the homogeneity of gene expression data in order to optimize the clustering process. We contribute to the knowledge of functional roles and regulation of E. coli genes by proposing a classification of these genes based on consistently correlated genes in expression data and similarities of gene expression patterns. A new visualization tool for targeted projection pursuit and dimensionality reduction of gene expression data is demonstrated.

  17. Evidence for homosexuality gene

    SciTech Connect

    Pool, R.

    1993-07-16

    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  18. GeneCards Version 3: the human gene integrator.

    PubMed

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-01-01

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73,000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards' unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene's functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database URL: www.genecards.org. PMID:20689021

  19. Tomato expressing Arabidopsis glutaredoxin gene AtGRXS17 confers tolerance to chilling stress via modulating cold responsive components.

    PubMed

    Hu, Ying; Wu, Qingyu; Sprague, Stuart A; Park, Jungeun; Oh, Myungmin; Rajashekar, C B; Koiwa, Hisashi; Nakata, Paul A; Cheng, Ninghui; Hirschi, Kendal D; White, Frank F; Park, Sunghun

    2015-01-01

    Chilling stress is a production constraint of tomato, a tropical origin, chilling-sensitive horticultural crop. The development of chilling tolerant tomato thus has significant potential to impact tomato production. Glutaredoxins (GRXs) are ubiquitous oxidoreductases, which utilize the reducing power of glutathione to reduce disulfide bonds of substrate proteins and maintain cellular redox homeostasis. Here, we report that tomato expressing Arabidopsis GRX gene AtGRXS17 conferred tolerance to chilling stress without adverse effects on growth and development. AtGRXS17-expressing tomato plants displayed lower ion leakage, higher maximal photochemical efficiency of photosystem II (Fv/Fm) and increased accumulation of soluble sugar compared with wild-type plants after the chilling stress challenge. Furthermore, chilling tolerance was correlated with increased antioxidant enzyme activities and reduced H2O2 accumulation. At the same time, temporal expression patterns of the endogenous C-repeat/DRE-binding factor 1 (SlCBF1) and CBF mediated-cold regulated genes were not altered in AtGRXS17-expressing plants when compared with wild-type plants, and proline concentrations remained unchanged relative to wild-type plants under chilling stress. Green fluorescent protein -AtGRXS17 fusion proteins, which were initially localized in the cytoplasm, migrated into the nucleus during chilling stress, reflecting a possible role of AtGRXS17 in nuclear signaling of chilling stress responses. Together, our findings demonstrate that genetically engineered tomato plants expressing AtGRXS17 can enhance chilling tolerance and suggest a genetic engineering strategy to improve chilling tolerance without yield penalty across different crop species. PMID:26623076

  20. Tomato expressing Arabidopsis glutaredoxin gene AtGRXS17 confers tolerance to chilling stress via modulating cold responsive components

    PubMed Central

    Hu, Ying; Wu, Qingyu; Sprague, Stuart A; Park, Jungeun; Oh, Myungmin; Rajashekar, C B; Koiwa, Hisashi; Nakata, Paul A; Cheng, Ninghui; Hirschi, Kendal D; White, Frank F; Park, Sunghun

    2015-01-01

    Chilling stress is a production constraint of tomato, a tropical origin, chilling-sensitive horticultural crop. The development of chilling tolerant tomato thus has significant potential to impact tomato production. Glutaredoxins (GRXs) are ubiquitous oxidoreductases, which utilize the reducing power of glutathione to reduce disulfide bonds of substrate proteins and maintain cellular redox homeostasis. Here, we report that tomato expressing Arabidopsis GRX gene AtGRXS17 conferred tolerance to chilling stress without adverse effects on growth and development. AtGRXS17-expressing tomato plants displayed lower ion leakage, higher maximal photochemical efficiency of photosystem II (Fv/Fm) and increased accumulation of soluble sugar compared with wild-type plants after the chilling stress challenge. Furthermore, chilling tolerance was correlated with increased antioxidant enzyme activities and reduced H2O2 accumulation. At the same time, temporal expression patterns of the endogenous C-repeat/DRE-binding factor 1 (SlCBF1) and CBF mediated-cold regulated genes were not altered in AtGRXS17-expressing plants when compared with wild-type plants, and proline concentrations remained unchanged relative to wild-type plants under chilling stress. Green fluorescent protein -AtGRXS17 fusion proteins, which were initially localized in the cytoplasm, migrated into the nucleus during chilling stress, reflecting a possible role of AtGRXS17 in nuclear signaling of chilling stress responses. Together, our findings demonstrate that genetically engineered tomato plants expressing AtGRXS17 can enhance chilling tolerance and suggest a genetic engineering strategy to improve chilling tolerance without yield penalty across different crop species. PMID:26623076

  1. Gene Therapy Current Methods and

    E-print Network

    Brutlag, Doug

    Gene Therapy Current Methods and Research for Cystic Fibrosis Alexis Wallen June 4, 2001 #12;What membrane · "Subtle defects in pulmonary function" #12;Gene Therapy for CF · General Principles of gene therapy is to cure disease by altering the genome to include or exclude a desired set of genes

  2. Gene Center Munich Genzentrum Mnchen

    E-print Network

    Frey, Erwin

    Gene Center Munich Genzentrum München Symposium December 1, 2010 'From Genes to Networks ­ Systems:50 ­ 12:50 Prof. Dr. Ulrike Gaul (Alexander von Humboldt Professor, LMU Munich) "Decoding regulatory gene. Patrick Cramer (LMU Munich) "Global mechanisms of gene transcription" 14:30 ­ 15:10 Prof. Dr. Gertrud

  3. How old is my gene?

    PubMed

    Capra, John A; Stolzer, Maureen; Durand, Dannie; Pollard, Katherine S

    2013-11-01

    Gene functions, interactions, disease associations, and ecological distributions are all correlated with gene age. However, it is challenging to estimate the intricate series of evolutionary events leading to a modern-day gene and then to reduce this history to a single age estimate. Focusing on eukaryotic gene families, we introduce a framework that can be used to compare current strategies for quantifying gene age, discuss key differences between these methods, and highlight several common problems. We argue that genes with complex evolutionary histories do not have a single well-defined age. As a result, care must be taken to articulate the goals and assumptions of any analysis that uses gene age estimates. Recent algorithmic advances offer the promise of gene age estimates that are fast, accurate, and consistent across gene families. This will enable a shift to integrated genome-wide analyses of all events in gene evolutionary histories in the near future. PMID:23915718

  4. How old is my gene?

    PubMed Central

    Capra, John A.; Stolzer, Maureen; Durand, Dannie; Pollard, Katherine S.

    2013-01-01

    Gene functions, interactions, disease associations, and ecological distributions are all correlated with gene age. However, it is challenging to estimate the intricate series of evolutionary events leading to a modern day gene and then reduce this history to a single age estimate. Focusing on eukaryotic gene families, we introduce a framework in which to compare current strategies for quantifying gene age, discuss key differences between these methods, and highlight several common problems. We argue that genes with complex evolutionary histories do not have a single well-defined age. As a result, care must be taken to articulate the goals and assumptions of any analysis that uses gene age estimates. Recent algorithmic advances offer the promise of gene age estimates that are fast, accurate, and consistent across gene families. This will enable a shift to integrated genome-wide analyses of all events in gene evolutionary histories in the near future. PMID:23915718

  5. Gene expression changes linked to antimicrobial resistance, oxidative stress, iron depletion and retained motility are observed when Burkholderia cenocepacia grows in cystic fibrosis sputum

    PubMed Central

    Drevinek, Pavel; Holden, Matthew TG; Ge, Zhaoping; Jones, Andrew M; Ketchell, Ian; Gill, Ryan T; Mahenthiralingam, Eshwar

    2008-01-01

    Background Bacteria from the Burkholderia cepacia complex (Bcc) are the only group of cystic fibrosis (CF) respiratory pathogens that may cause death by an invasive infection known as cepacia syndrome. Their large genome (> 7000 genes) and multiple pathways encoding the same putative functions make virulence factor identification difficult in these bacteria. Methods A novel microarray was designed to the genome of Burkholderia cenocepacia J2315 and transcriptomics used to identify genes that were differentially regulated when the pathogen was grown in a CF sputum-based infection model. Sputum samples from CF individuals infected with the same B. cenocepacia strain as genome isolate were used, hence, other than a dilution into a minimal growth medium (used as the control condition), no further treatment of the sputum was carried out. Results A total of 723 coding sequences were significantly altered, with 287 upregulated and 436 downregulated; the microarray-observed expression was validated by quantitative PCR on five selected genes. B. cenocepacia genes with putative functions in antimicrobial resistance, iron uptake, protection against reactive oxygen and nitrogen species, secretion and motility were among the most altered in sputum. Novel upregulated genes included: a transmembrane ferric reductase (BCAL0270) implicated in iron metabolism, a novel protease (BCAL0849) that may play a role in host tissue destruction, an organic hydroperoxide resistance gene (BCAM2753), an oxidoreductase (BCAL1107) and a nitrite/sulfite reductase (BCAM1676) that may play roles in resistance to the host defenses. The assumptions of growth under iron-depletion and oxidative stress formulated from the microarray data were tested and confirmed by independent growth of B. cenocepacia under each respective environmental condition. Conclusion Overall, our first full transcriptomic analysis of B. cenocepacia demonstrated the pathogen alters expression of over 10% of the 7176 genes within its genome when it grows in CF sputum. Novel genetic pathways involved in responses to antimicrobial resistance, oxidative stress, and iron metabolism were revealed by the microarray analysis. Virulence factors such as the cable pilus and Cenocepacia Pathogenicity Island were unaltered in expression. However, B. cenocepacia sustained or increased expression of motility-associated genes in sputum, maintaining a potentially invasive phenotype associated with cepacia syndrome. PMID:18801206

  6. FunGene: the functional gene pipeline and repository

    PubMed Central

    Fish, Jordan A.; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C. Titus; Tiedje, James M.; Cole, James R.

    2013-01-01

    Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes. PMID:24101916

  7. Virus induced gene silencing of Arabidopsis gene homologues in wheat identify genes conferring improved drought tolerance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a non-model staple crop like wheat, functional validation of potential drought stress responsive genes identified in Arabidopsis could provide gene targets for wheat breeding. Virus induced gene silencing (VIGS) of genes of interest can overcome the inherent problems of polyploidy and limited tra...

  8. GeneTIER: prioritization of candidate disease genes using tissue-specific gene expression profiles

    PubMed Central

    Antanaviciute, Agne; Daly, Catherine; Crinnion, Laura A.; Markham, Alexander F.; Watson, Christopher M.; Bonthron, David T.; Carr, Ian M.

    2015-01-01

    Motivation: In attempts to determine the genetic causes of human disease, researchers are often faced with a large number of candidate genes. Linkage studies can point to a genomic region containing hundreds of genes, while the high-throughput sequencing approach will often identify a great number of non-synonymous genetic variants. Since systematic experimental verification of each such candidate gene is not feasible, a method is needed to decide which genes are worth investigating further. Computational gene prioritization presents itself as a solution to this problem, systematically analyzing and sorting each gene from the most to least likely to be the disease-causing gene, in a fraction of the time it would take a researcher to perform such queries manually. Results: Here, we present Gene TIssue Expression Ranker (GeneTIER), a new web-based application for candidate gene prioritization. GeneTIER replaces knowledge-based inference traditionally used in candidate disease gene prioritization applications with experimental data from tissue-specific gene expression datasets and thus largely overcomes the bias toward the better characterized genes/diseases that commonly afflict other methods. We show that our approach is capable of accurate candidate gene prioritization and illustrate its strengths and weaknesses using case study examples. Availability and Implementation: Freely available on the web at http://dna.leeds.ac.uk/GeneTIER/. Contact: umaan@leeds.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25861967

  9. LQTS gene LOVD database.

    PubMed

    Zhang, Tao; Moss, Arthur; Cong, Peikuan; Pan, Min; Chang, Bingxi; Zheng, Liangrong; Fang, Quan; Zareba, Wojciech; Robinson, Jennifer; Lin, Changsong; Li, Zhongxiang; Wei, Junfang; Zeng, Qiang; Qi, Ming

    2010-11-01

    The Long QT Syndrome (LQTS) is a group of genetically heterogeneous disorders that predisposes young individuals to ventricular arrhythmias and sudden death. LQTS is mainly caused by mutations in genes encoding subunits of cardiac ion channels (KCNQ1, KCNH2,SCN5A, KCNE1, and KCNE2). Many other genes involved in LQTS have been described recently(KCNJ2, AKAP9, ANK2, CACNA1C, SCNA4B, SNTA1, and CAV3). We created an online database(http://www.genomed.org/LOVD/introduction.html) that provides information on variants in LQTS-associated genes. As of February 2010, the database contains 1738 unique variants in 12 genes. A total of 950 variants are considered pathogenic, 265 are possible pathogenic, 131 are unknown/unclassified, and 292 have no known pathogenicity. In addition to these mutations collected from published literature, we also submitted information on gene variants, including one possible novel pathogenic mutation in the KCNH2 splice site found in ten Chinese families with documented arrhythmias. The remote user is able to search the data and is encouraged to submit new mutations into the database. The LQTS database will become a powerful tool for both researchers and clinicians. PMID:20809527

  10. Engineered Gene Circuits

    NASA Astrophysics Data System (ADS)

    Hasty, Jeff

    2003-03-01

    Uncovering the structure and function of gene regulatory networks has become one of the central challenges of the post-genomic era. Theoretical models of protein-DNA feedback loops and gene regulatory networks have long been proposed, and recently, certain qualitative features of such models have been experimentally corroborated. This talk will focus on model and experimental results that demonstrate how a naturally occurring gene network can be used as a ``parts list'' for synthetic network design. The model formulation leads to computational and analytical approaches relevant to nonlinear dynamics and statistical physics, and the utility of such a formulation will be demonstrated through the consideration of specific design criteria for several novel genetic devices. Fluctuations originating from small molecule-number effects will be discussed in the context of model predictions, and the experimental validation of these stochastic effects underscores the importance of internal noise in gene expression. Potential biotech applications will be highlighted within the framework of cellular control schemes. Specifically, the coupling of an oscillating cellular process to a synthetic oscillator will be considered, and the resulting model behavior will be analyzed in the context of synchronization. The underlying methodology highlights the utility of engineering-based methods in the design of synthetic gene regulatory networks.

  11. Effect of long-term selenium yeast intervention on activity and gene expression of antioxidant and xenobiotic metabolising enzymes in healthy elderly volunteers from the Danish Prevention of Cancer by Intervention by Selenium (PRECISE) pilot study.

    PubMed

    Ravn-Haren, Gitte; Krath, Britta N; Overvad, Kim; Cold, Søren; Moesgaard, Sven; Larsen, Erik H; Dragsted, Lars O

    2008-06-01

    Numerous mechanisms have been proposed to explain the anti-carcinogenic effects of Se, among them altered carcinogen metabolism. We investigated the effect of Se supplementation on activities of glutathione peroxidase (GPX), glutathione reductase (GR) and glutathione S-transferase (GST) in different blood compartments, and expression of selected phase 1 and phase 2 genes in leucocytes (GPX1, gamma-glutamylcysteine ligase catalytic subunit (GCLC), AP-1 transcription factor Fos-related antigen 1 (Fra1), NAD(P)H:quinone oxidoreductase (NQO1), and aryl hydrocarbon receptor repressor (AhRR)). Healthy elderly Danes (n 105; age 71.3 (SD 4.26) years; 36% reporting use of multivitamin/mineral supplements) participated and were supplemented daily for 5 years with placebo, 100 microg, 200 microg or 300 microg Se as Se-enriched yeast (SelenoPrecise). Blood samples were collected after 5 years of intervention. When all four groups were compared we found no effect of Se supplementation on plasma GPX or GR, on erythrocyte GPX, GR or GST, or on thrombocyte GR or GST. We found increased thrombocyte GPX activity at the two highest dosage levels in women only, but not in men. No effects on GPX1, NQO1 or AhRR gene expression were found. When all Se-supplemented groups were pooled we found significant down regulation of the expression of some phase 2 genes (GCLC, Fra1). A significant increase in AhRR gene expression with smoking was found but was independent of Se supplementation. Down regulation of phase 2 genes could increase the risk of cancer. However, further studies are needed to establish whether the observed effect in leucocytes reflects a similar expression pattern in target tissues. PMID:18062829

  12. Characterizing gene family evolution

    PubMed Central

    Liberles, David A.

    2008-01-01

    Gene families are widely used in comparative genomics, molecular evolution, and in systematics. However, they are constructed in different manners, their data analyzed and interpreted differently, with different underlying assumptions, leading to sometimes divergent conclusions. In systematics, concepts like monophyly and the dichotomy between homoplasy and homology have been central to the analysis of phylogenies. We critique the traditional use of such concepts as applied to gene families and give examples of incorrect inferences they may lead to. Operational definitions that have emerged within functional genomics are contrasted with the common formal definitions derived from systematics. Lastly, we question the utility of layers of homology and the meaning of homology at the character state level in the context of sequence evolution. From this, we move forward to present an idealized strategy for characterizing gene family evolution for both systematic and functional purposes, including recent methodological improvements. PMID:19461954

  13. Beyond the Gene

    PubMed Central

    Fox Keller, Evelyn; Harel, David

    2007-01-01

    This paper is a response to the increasing difficulty biologists find in agreeing upon a definition of the gene, and indeed, the increasing disarray in which that concept finds itself. After briefly reviewing these problems, we propose an alternative to both the concept and the word gene—an alternative that, like the gene, is intended to capture the essence of inheritance, but which is both richer and more expressive. It is also clearer in its separation of what the organism statically is (what it tangibly inherits) and what it dynamically does (its functionality and behavior). Our proposal of a genetic functor, or genitor, is a sweeping extension of the classical genotype/phenotype paradigm, yet it appears to be faithful to the findings of contemporary biology, encompassing many of the recently emerging—and surprisingly complex—links between structure and functionality. PMID:18043738

  14. Alphaviruses in Gene Therapy

    PubMed Central

    Lundstrom, Kenneth

    2015-01-01

    Alphavirus vectors present an attractive approach for gene therapy applications due to the rapid and simple recombinant virus particle production and their broad range of mammalian host cell transduction. Mainly three types of alphavirus vectors, namely naked RNA, recombinant particles and DNA/RNA layered vectors, have been subjected to preclinical studies with the goal of achieving prophylactic or therapeutic efficacy, particularly in oncology. In this context, immunization with alphavirus vectors has provided protection against challenges with tumor cells. Moreover, alphavirus intratumoral and systemic delivery has demonstrated substantial tumor regression and significant prolonged survival rates in various animal tumor models. Recent discoveries of the strong association of RNA interference and disease have accelerated gene therapy based approaches, where alphavirus-based gene delivery can play an important role. PMID:25961488

  15. Growth of Rhodococcus sp. strain BCP1 on gaseous n-alkanes: new metabolic insights and transcriptional analysis of two soluble di-iron monooxygenase genes

    PubMed Central

    Cappelletti, Martina; Presentato, Alessandro; Milazzo, Giorgio; Turner, Raymond J.; Fedi, Stefano; Frascari, Dario; Zannoni, Davide

    2015-01-01

    Rhodococcus sp. strain BCP1 was initially isolated for its ability to grow on gaseous n-alkanes, which act as inducers for the co-metabolic degradation of low-chlorinated compounds. Here, both molecular and metabolic features of BCP1 cells grown on gaseous and short-chain n-alkanes (up to n-heptane) were examined in detail. We show that propane metabolism generated terminal and sub-terminal oxidation products such as 1- and 2-propanol, whereas 1-butanol was the only terminal oxidation product detected from n-butane metabolism. Two gene clusters, prmABCD and smoABCD—coding for Soluble Di-Iron Monooxgenases (SDIMOs) involved in gaseous n-alkanes oxidation—were detected in the BCP1 genome. By means of Reverse Transcriptase-quantitative PCR (RT-qPCR) analysis, a set of substrates inducing the expression of the sdimo genes in BCP1 were assessed as well as their transcriptional repression in the presence of sugars, organic acids, or during the cell growth on rich medium (Luria–Bertani broth). The transcriptional start sites of both the sdimo gene clusters were identified by means of primer extension experiments. Finally, proteomic studies revealed changes in the protein pattern induced by growth on gaseous- (n-butane) and/or liquid (n-hexane) short-chain n-alkanes as compared to growth on succinate. Among the differently expressed protein spots, two chaperonins and an isocytrate lyase were identified along with oxidoreductases involved in oxidation reactions downstream of the initial monooxygenase reaction step. PMID:26029173

  16. Oxygen at Nanomolar Levels Reversibly Suppresses Process Rates and Gene Expression in Anammox and Denitrification in the Oxygen Minimum Zone off Northern Chile

    PubMed Central

    Stewart, Frank J.; Thamdrup, Bo; De Brabandere, Loreto; Revsbech, Niels Peter; Ulloa, Osvaldo; Canfield, Don E.; DeLong, Edward F.

    2014-01-01

    ABSTRACT A major percentage (20 to 40%) of global marine fixed-nitrogen loss occurs in oxygen minimum zones (OMZs). Concentrations of O2 and the sensitivity of the anaerobic N2-producing processes of anammox and denitrification determine where this loss occurs. We studied experimentally how O2 at nanomolar levels affects anammox and denitrification rates and the transcription of nitrogen cycle genes in the anoxic OMZ off Chile. Rates of anammox and denitrification were reversibly suppressed, most likely at the enzyme level. Fifty percent inhibition of N2 and N2O production by denitrification was achieved at 205 and 297 nM O2, respectively, whereas anammox was 50% inhibited at 886 nM O2. Coupled metatranscriptomic analysis revealed that transcripts encoding nitrous oxide reductase (nosZ), nitrite reductase (nirS), and nitric oxide reductase (norB) decreased in relative abundance above 200 nM O2. This O2 concentration did not suppress the transcription of other dissimilatory nitrogen cycle genes, including nitrate reductase (narG), hydrazine oxidoreductase (hzo), and nitrite reductase (nirK). However, taxonomic characterization of transcripts suggested inhibition of narG transcription in gammaproteobacteria, whereas the transcription of anammox narG, whose gene product is likely used to oxidatively replenish electrons for carbon fixation, was not inhibited. The taxonomic composition of transcripts differed among denitrification enzymes, suggesting that distinct groups of microorganisms mediate different steps of denitrification. Sulfide addition (1 µM) did not affect anammox or O2 inhibition kinetics but strongly stimulated N2O production by denitrification. These results identify new O2 thresholds for delimiting marine nitrogen loss and highlight the utility of integrating biogeochemical and metatranscriptomic analyses. PMID:25352619

  17. Sodium fluoride affects zebrafish behaviour and alters mRNA expressions of biomarker genes in the brain: Role of Nrf2/Keap1.

    PubMed

    Mukhopadhyay, Debdip; Priya, Pooja; Chattopadhyay, Ansuman

    2015-09-01

    Sodium fluoride (NaF), used as pesticides and for industrial purposes are deposited in the water bodies and therefore affects its biota. Zebrafish exposed to NaF in laboratory condition showed hyperactivity and frequent surfacing activity, somersaulting and vertical swimming pattern as compared to the control group. Reactive oxygen species level was elevated and glutathione level was depleted along with increased malondialdehyde content in the brain. Levels of glutathione-s-transferase (GST), catalase (CAT) and superoxide dismutase were also elevated in the treatment groups. Expression of mRNA of nuclear factor erythroid 2 related factor 2 (Nrf2) and its inhibitor Kelch-like ECH-associated protein 1 (Keap1) during stress condition were observed along with Gst, Cat, NADPH: quinone oxidoreductase 1(Nqo1) and p38. Except Keap1, all other genes exhibited elevated expression. Nrf2/Keap1 proteins had similar expression pattern as their corresponding mRNA. The findings in this study might help to understand the molecular mechanism of fluoride induced neurotoxicity in fish. PMID:26245810

  18. Amino acids in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum involved in cycloguanil resistance differ from those involved in pyrimethamine resistance.

    PubMed Central

    Foote, S J; Galatis, D; Cowman, A F

    1990-01-01

    Cycloguanil, the active metabolite of the antimalarial drug proguanil, is an inhibitor of dihydrofolate reductase as is another antimalarial, pyrimethamine. Its use has been limited by the rapid development of resistance by parasites around the world. We have determined the cycloguanil- and pyrimethamine-sensitivity status of 10 isolates of Plasmodium falciparum and have sequenced in all these isolates the dihydrofolate reductase (DHFR; 5,6,7,8-tetrahydrofolate: NADP+ oxidoreductase, EC 1.5.1.3) portion of the DHFR-thymidylate synthase (TS; 5,10-methylenetetrahydrofolate: dUMP C-methyltransferase, EC 2.1.1.45) gene. Instead of the known serine-to-asparagine change at position 108 that is important in pyrimethamine resistance, a serine-to-threonine change at the same position is found in cycloguanil-resistant isolates along with an alanine-to-valine change at position 16. We conclude that pyrimethamine and cycloguanil resistance most commonly involve alternative mutations at the same site. However, we also have identified a parasite with a unique set of changes that results in resistance to both drugs. Images PMID:2183221

  19. Gene therapy in pancreatic cancer

    PubMed Central

    Liu, Si-Xue; Xia, Zhong-Sheng; Zhong, Ying-Qiang

    2014-01-01

    Pancreatic cancer (PC) is a highly lethal disease and notoriously difficult to treat. Only a small proportion of PC patients are eligible for surgical resection, whilst conventional chemoradiotherapy only has a modest effect with substantial toxicity. Gene therapy has become a new widely investigated therapeutic approach for PC. This article reviews the basic rationale, gene delivery methods, therapeutic targets and developments of laboratory research and clinical trials in gene therapy of PC by searching the literature published in English using the PubMed database and analyzing clinical trials registered on the Gene Therapy Clinical Trials Worldwide website (http://www. wiley.co.uk/genmed/ clinical). Viral vectors are main gene delivery tools in gene therapy of cancer, and especially, oncolytic virus shows brighter prospect due to its tumor-targeting property. Efficient therapeutic targets for gene therapy include tumor suppressor gene p53, mutant oncogene K-ras, anti-angiogenesis gene VEGFR, suicide gene HSK-TK, cytosine deaminase and cytochrome p450, multiple cytokine genes and so on. Combining different targets or combination strategies with traditional chemoradiotherapy may be a more effective approach to improve the efficacy of cancer gene therapy. Cancer gene therapy is not yet applied in clinical practice, but basic and clinical studies have demonstrated its safety and clinical benefits. Gene therapy will be a new and promising field for the treatment of PC. PMID:25309069

  20. Multidimensional gene search with Genehopper

    PubMed Central

    Munz, Matthias; Tönnies, Sascha; Balke, Wolf-Tilo; Simon, Eric

    2015-01-01

    The high abundance of genetic information enables researchers to gain new insights from the comparison of human genes according to their similarities. However, existing tools that allow the exploration of such gene-to-gene relationships, apply each similarity independently. To make use of multidimensional scoring, we developed a new search engine named Genehopper. It can handle two query types: (i) the typical use case starts with a term-to-gene search, i.e. an optimized full-text search for an anchor gene of interest. The web-interface can handle one or more terms including gene symbols and identifiers of Ensembl, UniProt, EntrezGene and RefSeq. (ii) When the anchor gene is defined, the user can explore its neighborhood by a gene-to-gene search as the weighted sum of nine normalized gene similarities based on sequence homology, protein domains, mRNA expression profiles, Gene Ontology Annotation, gene symbols and other features. Each weight can be adjusted by the user, allowing flexible customization of the gene search. All implemented similarities have a low pairwise correlation (max r2 = 0.4) implying a low linear dependency, i.e. any change in a single weight has an effect on the ranking. Thus, we treated them as separate dimensions in the search space. Genehopper is freely available at http://genehopper.ifis.cs.tu-bs.de. PMID:25990726

  1. Multidimensional gene search with Genehopper.

    PubMed

    Munz, Matthias; Tönnies, Sascha; Balke, Wolf-Tilo; Simon, Eric

    2015-07-01

    The high abundance of genetic information enables researchers to gain new insights from the comparison of human genes according to their similarities. However, existing tools that allow the exploration of such gene-to-gene relationships, apply each similarity independently. To make use of multidimensional scoring, we developed a new search engine named Genehopper. It can handle two query types: (i) the typical use case starts with a term-to-gene search, i.e. an optimized full-text search for an anchor gene of interest. The web-interface can handle one or more terms including gene symbols and identifiers of Ensembl, UniProt, EntrezGene and RefSeq. (ii) When the anchor gene is defined, the user can explore its neighborhood by a gene-to-gene search as the weighted sum of nine normalized gene similarities based on sequence homology, protein domains, mRNA expression profiles, Gene Ontology Annotation, gene symbols and other features. Each weight can be adjusted by the user, allowing flexible customization of the gene search. All implemented similarities have a low pairwise correlation (max r(2) = 0.4) implying a low linear dependency, i.e. any change in a single weight has an effect on the ranking. Thus, we treated them as separate dimensions in the search space. Genehopper is freely available at http://genehopper.ifis.cs.tu-bs.de. PMID:25990726

  2. Origin of?Genes

    PubMed Central

    Gilbert, Walter; de Souza, Sandro J.; Long, Manyuan

    1997-01-01

    We discuss two tests of the hypothesis that the first genes were assembled from exons. The hypothesis of exon shuffling in the progenote predicts that intron phases will be correlated so that exons will be an integer number of codons and predicts that the exons will be correlated with compact regions of polypeptide chain. These predictions have been tested on ancient conserved proteins (proteins without introns in prokaryotes but with introns in eukaryotes) and hold with high statistical significance. We conclude that introns are correlated with compact features of proteins 15-, 22-, or 30-amino acid residues long, as was predicted by “The Exon Theory of Genes.” PMID:9223251

  3. Phospholipid – Driven gene regulation

    PubMed Central

    Musille, Paul M.; Kohn, Jeffrey A.; Ortlund, Eric A.

    2013-01-01

    Phospholipids (PLs), well known for their fundamental role in cellular structure, play critical signaling roles via their derivatives and cleavage products acting as second messengers in signaling cascades. Recent work has shown that intact PLs act as signaling molecules in their own right by modulating the activity of nuclear hormone transcription factors responsible for tuning genes involved in metabolism, lipid flux, steroid synthesis and inflammation. As such, PLs have been classified as novel hormones. This review highlights recent work in PL-driven gene regulation with a focus on the unique structural features of phospholipid-sensing transcription factors and what sets them apart from well known soluble phospholipid transporters. PMID:23333623

  4. Genes and Vocal Learning

    PubMed Central

    White, Stephanie A.

    2009-01-01

    Could a mutation in a single gene be the evolutionary lynchpin supporting the development of human language? A rare mutation in the molecule known as FOXP2 discovered in a human family seemed to suggest so, and its sequence phylogeny reinforced a Chomskian view that language emerged wholesale in humans. Spurred by this discovery, research in primates, rodents and birds suggests that FoxP2 and other language-related genes are interactors in the neuromolecular networks that underlie subsystems of language, such symbolic understanding, vocal learning and theory of mind. The whole picture will only come together through comparative and integrative study into how the human language singularity evolved. PMID:19913899

  5. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    PubMed Central

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were ?-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and ?-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, ?-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  6. Differentially Coexpressed Genes

    E-print Network

    Spang, Rainer

    Fine-tuning #12;Do these pattern exist in real data ? Acute Lymphoblastic Leukemia · About 1/3 of all compared cytogenetically normal children to those with the phil+ translocation Yeoh EJ, RossMEet al. (2002) Classication, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene

  7. Gene electrotransfer clinical trials.

    PubMed

    Heller, Richard; Heller, Loree C

    2015-01-01

    Plasmid or non-viral gene therapy offers an alternative to classic viral gene delivery that negates the need for a biological vector. In this case, delivery is enhanced by a variety of approaches including lipid or polymer conjugation, particle-mediated delivery, hydrodynamic delivery, ultrasound or electroporation. Electroporation was originally used as a laboratory tool to deliver DNA to bacterial and mammalian cells in culture. Electrode development allowed this technique to be modified for in vivo use. After preclinical therapeutic studies, clinical delivery of cell impermeant chemotherapeutic agents progressed to clinical delivery of plasmid DNA. One huge benefit of this delivery technique is its malleability. The pulse protocol used for plasmid delivery can be fine-tuned to control the levels and duration of subsequent transgene expression. This fine-tuning allows transgene expression to be tailored to each therapeutic application. Effective and appropriate expression induces the desired clinical response that is a critical component for any gene therapy. This chapter focuses on clinical trials using in vivo electroporation or electrotransfer as a plasmid delivery method. The first clinical trial was initiated in 2004, and now more than fifty trials use electric fields for gene delivery. Safety and tolerability has been demonstrated by several groups, and early clinical efficacy results are promising in both cancer therapeutic and infectious disease vaccine applications. PMID:25620013

  8. GENE EXPRESSION PROFILING

    Technology Transfer Automated Retrieval System (TEKTRAN)

    DNA microarray technology is fast becoming a standard tool for gene expression analysis. The laboratory methods and protocols for array construction, processing, and hybridization are well established. Many of the initial plant genome sequencing projects are providing large sets of expressed seque...

  9. Inferring Horizontal Gene Transfer

    PubMed Central

    Lassalle, Florent; Dessimoz, Christophe

    2015-01-01

    Horizontal or Lateral Gene Transfer (HGT or LGT) is the transmission of portions of genomic DNA between organisms through a process decoupled from vertical inheritance. In the presence of HGT events, different fragments of the genome are the result of different evolutionary histories. This can therefore complicate the investigations of evolutionary relatedness of lineages and species. Also, as HGT can bring into genomes radically different genotypes from distant lineages, or even new genes bearing new functions, it is a major source of phenotypic innovation and a mechanism of niche adaptation. For example, of particular relevance to human health is the lateral transfer of antibiotic resistance and pathogenicity determinants, leading to the emergence of pathogenic lineages [1]. Computational identification of HGT events relies upon the investigation of sequence composition or evolutionary history of genes. Sequence composition-based ("parametric") methods search for deviations from the genomic average, whereas evolutionary history-based ("phylogenetic") approaches identify genes whose evolutionary history significantly differs from that of the host species. The evaluation and benchmarking of HGT inference methods typically rely upon simulated genomes, for which the true history is known. On real data, different methods tend to infer different HGT events, and as a result it can be difficult to ascertain all but simple and clear-cut HGT events. PMID:26020646

  10. Naming genes beyond Caenorhabditis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The nomenclature of genes in Caenorhabditis elegans is based on long-standing, successful guidelines established in the late 1970s. Over time these guidelines have matured into a comprehensive, systematic nomenclature that is easy to apply, descriptive and therefore highly informative. Recently, a f...

  11. IBMFS - gene mutations

    Cancer.gov

    A "mutation" is a change in a gene that prevents it from working properly. A "germline" mutation is a change that occurs in the egg or the sperm, or both, and is passed from one parent or both parents to the child.

  12. Genes and Vocal Learning

    ERIC Educational Resources Information Center

    White, Stephanie A.

    2010-01-01

    Could a mutation in a single gene be the evolutionary lynchpin supporting the development of human language? A rare mutation in the molecule known as FOXP2 discovered in a human family seemed to suggest so, and its sequence phylogeny reinforced a Chomskian view that language emerged wholesale in humans. Spurred by this discovery, research in…

  13. GENES REGULATING CHOLESTEROL METABOLISM

    E-print Network

    Brutlag, Doug

    GENES REGULATING CHOLESTEROL METABOLISM Chau Vu Bio 118 #12;FUNCTIONS OF CHOLESTEROL Maintain atherosclerosis #12;SYNTHESIS OF CHOLESTEROL Occurs in cytoplasm and microsomes acetyl-CoA ­ starting material OF CHOLESTEROL #12;REGULATION OF CHOLESTEROL Synthesis and dietary intake: Normal Adult: produce1g/day; consume

  14. Ultrasound mediated gene transfection

    NASA Astrophysics Data System (ADS)

    Williamson, Rene G.; Apfel, Robert E.; Brandsma, Janet L.

    2002-05-01

    Gene therapy is a promising modality for the treatment of a variety of human diseases both inherited and acquired, such as cystic fibrosis and cancer. The lack of an effective, safe method for the delivery of foreign genes into the cells, a process known as transfection, limits this effort. Ultrasound mediated gene transfection is an attractive method for gene delivery since it is a noninvasive technique, does not introduce any viral particles into the host and can offer very good temporal and spatial control. Previous investigators have shown that sonication increases transfection efficiency with and without ultrasound contrast agents. The mechanism is believed to be via a cavitation process where collapsing bubble nuclei permeabilize the cell membrane leading to increased DNA transfer. The research is focused on the use of pulsed wave high frequency focused ultrasound to transfect DNA into mammalian cells in vitro and in vivo. A better understanding of the mechanism behind the transfection process is also sought. A summary of some in vitro results to date will be presented, which includes the design of a sonication chamber that allows us to model the in vivo case more accurately.

  15. Your Genes, Your Choices

    MedlinePLUS

    ... to science literacy and the public understanding of science. Through its Directorate for Education and Human Resources Programs, AAAS has been a ... Your Genes, Your Choices is a publication of Science + Literacy for Health, a project of ... for Education and Human Resources . The publication was funded by ...

  16. Gene Manipulation In Cereals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aluminum, the most abundant metal on earth, is detrimental to plant growth and agricultural production. There are about 2.5 billion hectares of acid soils high in aluminum around the world. Molecular markers linked to aluminum tolerance gene complexes in rye would be of value in marker-mediated ge...

  17. Gene-Environment Interdependence

    ERIC Educational Resources Information Center

    Rutter, Michael

    2007-01-01

    Behavioural genetics was initially concerned with partitioning population variance into that due to genetics and that due to environmental influences. The implication was that the two were separate and it was assumed that gene-environment interactions were usually of so little importance that they could safely be ignored. Theoretical…

  18. GENE METHYLATION CHANGES IN TUMOR SUPPRESSOR GENES INDUCED BY ARSENIC

    EPA Science Inventory

    The choice of a dose-response model used for extrapolation can be influenced by knowledge of mechanism of action. We have already showed that arsenic affects methylation of the human p53 gene promoter. Evidence that genes other than the p53 tumor suppressor gene are affected woul...

  19. The Gene Ontology (GO) database and informatics Gene Ontology Consortium*

    E-print Network

    The Gene Ontology (GO) database and informatics resource Gene Ontology Consortium* GO-EBI, EMBL and Accepted September 12, 2003 ABSTRACT The Gene Ontology (GO) project (http://www. geneontology and sequences. Many model organism databases and genome annotation groups use the GO and contribute

  20. [Gene pool and gene geography of the USSR population].

    PubMed

    Rychkov, Iu G; Balanovskaia, E V

    1992-01-01

    Gene pool and gene geography are discussed from the point of view of their conceptual history beginning from the original concept of A.S. Serebrovski? (1928). Difference between the present-day gene geography and gene geography of gene pool is accentuated: the former only represents a portion of the latter. Historical and territorial integrity of the USSR population gene pool, in conjunction with its huge diversity, is the main problem being analysed by various means of computerized genetic cartography. Coupled with the gene frequency mapping, following methods were also used: mapping of average heterozygosity, of interpopulation differentiation, of principal component scores and mapping of geographical trend for each mapped genetic parameter. The work is based on 100 allelic genes and haplotypes from 30 independent loci studied on the average in 225 local populations. Statistical analysis of gene geographical maps is based on 3975 nodes of regular cartographic net for the USSR territory. The wind rose of systematic changes in the USSR gene pool has three main geographic orientations: W-E, SW-NE and S-N. At the same time, there are only two main systematic forces of gene pool evolution: the force of social history with predominant W-E orientation and the force of natural history with predominant S-N orientation of their actions. The heterozygosity level of gene pool declines strictly in accordance with the resultant in the SW-NE direction. PMID:1582574

  1. Spectral Clustering Gene Ontology Terms to Group Genes by Function

    E-print Network

    Zell, Andreas

    Spectral Clustering Gene Ontology Terms to Group Genes by Function Nora Speer, Christian Spieth throughput me- thods like DNA microarrays, biologists are capable of producing huge amounts of data. During the analysis of such data the need for a group- ing of the genes according to their biological function arises

  2. Proto-genes and de novo gene birth

    PubMed Central

    Carvunis, Anne-Ruxandra; Rolland, Thomas; Wapinski, Ilan; Calderwood, Michael A.; Yildirim, Muhammed A.; Simonis, Nicolas; Charloteaux, Benoit; Hidalgo, César A.; Barbette, Justin; Santhanam, Balaji; Brar, Gloria A.; Weissman, Jonathan S.; Regev, Aviv; Thierry-Mieg, Nicolas; Cusick, Michael E.; Vidal, Marc

    2012-01-01

    Novel protein-coding genes can arise either through re-organization of pre-existing genes or de novo1,2. Processes involving re-organization of pre-existing genes, notably following gene duplication, have been extensively described1,2. In contrast, de novo gene birth remains poorly understood, mainly because translation of sequences devoid of genes, or “non-genic” sequences, is expected to produce insignificant polypeptides rather than proteins with specific biological functions1,3-6. Here, we formalize an evolutionary model according to which functional genes evolve de novo through transitory proto-genes4 generated by widespread translational activity in non-genic sequences. Testing this model at genome-scale in Saccharomyces cerevisiae, we detect translation of hundreds of short species-specific open reading frames (ORFs) located in non-genic sequences. These translation events appear to provide adaptive potential7, as suggested by their differential regulation upon stress and by signatures of retention by natural selection. In line with our model, we establish that S. cerevisiae ORFs can be placed within an evolutionary continuum ranging from non-genic sequences to genes. We identify ~1,900 candidate proto-genes among S. cerevisiae ORFs and find that de novo gene birth from such a reservoir may be more prevalent than sporadic gene duplication. Our work illustrates that evolution exploits seemingly dispensable sequences to generate adaptive functional innovation. PMID:22722833

  3. Intervention in gene regulatory networks 

    E-print Network

    Choudhary, Ashish

    2006-10-30

    In recent years Boolean Networks (BN) and Probabilistic Boolean Networks (PBN) have become popular paradigms for modeling gene regulation. A PBN is a collection of BNs in which the gene state vector transitions according to the rules of one...

  4. Chapter 15: Disease Gene Prioritization

    PubMed Central

    Bromberg, Yana

    2013-01-01

    Disease-causing aberrations in the normal function of a gene define that gene as a disease gene. Proving a causal link between a gene and a disease experimentally is expensive and time-consuming. Comprehensive prioritization of candidate genes prior to experimental testing drastically reduces the associated costs. Computational gene prioritization is based on various pieces of correlative evidence that associate each gene with the given disease and suggest possible causal links. A fair amount of this evidence comes from high-throughput experimentation. Thus, well-developed methods are necessary to reliably deal with the quantity of information at hand. Existing gene prioritization techniques already significantly improve the outcomes of targeted experimental studies. Faster and more reliable techniques that account for novel data types are necessary for the development of new diagnostics, treatments, and cure for many diseases. PMID:23633938

  5. Cloning and nucleotide sequences of the genes for the subunits of NAD-reducing hydrogenase of Alcaligenes eutrophus H16.

    PubMed Central

    Tran-Betcke, A; Warnecke, U; Böcker, C; Zaborosch, C; Friedrich, B

    1990-01-01

    The genes hoxF, -U, -Y, and -H which encode the four subunit polypeptides alpha, gamma, delta, and beta of the NAD-reducing hydrogenase (HoxS) of Alcaligenes eutrophus H16, were cloned, expressed in Pseudomonas facilis, and sequenced. On the basis of the nucleotide sequence, the predicted amino acid sequences, and the N-terminal amino acid sequences, it was concluded that the structural genes are tightly linked and presumably organized as an operon, denoted hoxS. Two pairs of -24 and -12 consensus sequences resembling RpoN-activatable promoters lie upstream of hoxF, the first of the four genes. Primer extension experiments indicate that the second promoter is responsible for hoxS transcription. hoxF and hoxU code for the flavin-containing dimer (alpha and gamma subunits) of HoxS which exhibits NADH:oxidoreductase activity. A putative flavin-binding region is discussed. The 26.0-kilodalton (kDa) gamma subunit contains two cysteine clusters which may participate in the coordination of two [4F3-4S]centers. The genes hoxY and hoxH code for the small 22.9-kDa delta subunit and the nickel-containing 54.8-kDa beta subunit, respectively, of the hydrogenase dimer of HoxS. The latter dimer exhibits several conserved regions found in all nickel-containing hydrogenases. The roles of these regions in coordinating iron and nickel are discussed. Although the deduced amino acid sequences of the delta and beta subunits share some conserved regions with the corresponding polypeptides of other [NiFe] hydrogenases, the overall amino acid homology is marginal. Nevertheless, significant sequence homology (35%) to the corresponding polypeptides of the soluble methylviologen-reducing hydrogenase of Methanobacterium thermoautotrophicum was found. Unlike the small subunits of the membrane-bound and soluble periplasmic hydrogenases, the HoxS protein does not appear to be synthesized with an N-terminal leader peptide. Images PMID:2188945

  6. Regulation of eucaryotic gene expression

    SciTech Connect

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  7. Deconstructing cell determination: proneural genes

    E-print Network

    Montpellier II, Université

    involved in the development of sense organs in Drosophila, which itself has been the starting point genes in vertebrates. The first event leading to the formation of a sense organ in flies: for example, the genes achaete and scute confer the competence to form external sense organs, while the gene

  8. Independent Gene Discovery and Testing

    ERIC Educational Resources Information Center

    Palsule, Vrushalee; Coric, Dijana; Delancy, Russell; Dunham, Heather; Melancon, Caleb; Thompson, Dennis; Toms, Jamie; White, Ashley; Shultz, Jeffry

    2010-01-01

    A clear understanding of basic gene structure is critical when teaching molecular genetics, the central dogma and the biological sciences. We sought to create a gene-based teaching project to improve students' understanding of gene structure and to integrate this into a research project that can be implemented by instructors at the secondary level…

  9. Evolutionary Origin of Orphan Genes

    E-print Network

    Evolutionary Origin of Orphan Genes Diethard Tautz, Max-Planck Institute for Evolutionary Biology Orphangenesaregenesthatoccurinspecificevolutionary lineages without similarity to genes outside of these lin- eages and have, therefore, alternatively been named taxonomically restricted genes. They were so far con- sidered to emerge through

  10. Clinical Perspective Genes Associated with

    E-print Network

    Oliver, Douglas L.

    Clinical Perspective Genes Associated with Alcohol Dependence There is good evidence from studies, hundreds of genes likely are involved in this complex disorder, with each variant contributing only a very small effect. Therefore, identifying individual risk genes is difficult. Using a new approach

  11. PLANT MORPHOGENESIS AND KNOX GENES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    KNOX genes function in plant meristems, which produce leaves and stems. Three recent studies show that the dwarf phenotype, brevipedicellus, is caused by a recessive mutation in a KNOX gene. A fourth study shows that misexpression of KNOX genes leads to novel features that may have selective value....

  12. Eukaryotic Gene Prediction Kelli Davies

    E-print Network

    Eukaryotic Gene Prediction Kelli Davies 2009 December 12 Introduction: The advent of large in 1977, that of a small bacteriophage consisting of 11 genes over 5.4kb of DNA. In the bacteriophage, coding genes comprise 95% of the genome.1 Since then, numerous prokaryotic and eukaryotic genomes have

  13. From SNPs to Genes: Disease Association at the Gene Level

    PubMed Central

    Lehne, Benjamin; Lewis, Cathryn M.; Schlitt, Thomas

    2011-01-01

    Interpreting Genome-Wide Association Studies (GWAS) at a gene level is an important step towards understanding the molecular processes that lead to disease. In order to incorporate prior biological knowledge such as pathways and protein interactions in the analysis of GWAS data it is necessary to derive one measure of association for each gene. We compare three different methods to obtain gene-wide test statistics from Single Nucleotide Polymorphism (SNP) based association data: choosing the test statistic from the most significant SNP; the mean test statistics of all SNPs; and the mean of the top quartile of all test statistics. We demonstrate that the gene-wide test statistics can be controlled for the number of SNPs within each gene and show that all three methods perform considerably better than expected by chance at identifying genes with confirmed associations. By applying each method to GWAS data for Crohn's Disease and Type 1 Diabetes we identified new potential disease genes. PMID:21738570

  14. Gene Therapy and Children (For Parents)

    MedlinePLUS

    ... Kids Deal With Bullies Pregnant? What to Expect Gene Therapy and Children KidsHealth > Parents > Doctors & Hospitals > Medical Tests & ... by a "bad" gene. Continue Two Types of Gene Therapy The two forms of gene therapy are: Somatic ...

  15. Genetics Home Reference: What is gene therapy?

    MedlinePLUS

    ... Precision Medicine Next Handbook > Gene Therapy > What is gene therapy? Gene therapy is an experimental technique that uses ... have no other cures. For general information about gene therapy: MedlinePlus from the National Library of Medicine offers ...

  16. Biometrics 000, 000000 DOI: 000 Powerful tests for detecting a gene effect in the presence of possible gene-gene

    E-print Network

    Maity, Arnab

    Biometrics 000, 000­000 DOI: 000 000 0000 Powerful tests for detecting a gene effect in the presence of possible gene-gene interactions using garrote kernel machines Arnab Maity Department a gene effect on a continuous outcome in the presence of possible gene-gene interactions (epistasis

  17. Graphene based gene transfection

    NASA Astrophysics Data System (ADS)

    Feng, Liangzhu; Zhang, Shuai; Liu, Zhuang

    2011-03-01

    Graphene as a star in materials research has been attracting tremendous attentions in the past few years in various fields including biomedicine. In this work, for the first time we successfully use graphene as a non-toxic nano-vehicle for efficient gene transfection. Graphene oxide (GO) is bound with cationic polymers, polyethyleneimine (PEI) with two different molecular weights at 1.2 kDa and 10 kDa, forming GO-PEI-1.2k and GO-PEG-10k complexes, respectively, both of which are stable in physiological solutions. Cellular toxicity tests reveal that our GO-PEI-10k complex exhibits significantly reduced toxicity to the treated cells compared to the bare PEI-10k polymer. The positively charged GO-PEI complexes are able to further bind with plasmid DNA (pDNA) for intracellular transfection of the enhanced green fluorescence protein (EGFP) gene in HeLa cells. While EGFP transfection with PEI-1.2k appears to be ineffective, high EGFP expression is observed using the corresponding GO-PEI-1.2k as the transfection agent. On the other hand, GO-PEI-10k shows similar EGFP transfection efficiency but lower toxicity compared with PEI-10k. Our results suggest graphene to be a novel gene delivery nano-vector with low cytotoxicity and high transfection efficiency, promising for future applications in non-viral based gene therapy.Graphene as a star in materials research has been attracting tremendous attentions in the past few years in various fields including biomedicine. In this work, for the first time we successfully use graphene as a non-toxic nano-vehicle for efficient gene transfection. Graphene oxide (GO) is bound with cationic polymers, polyethyleneimine (PEI) with two different molecular weights at 1.2 kDa and 10 kDa, forming GO-PEI-1.2k and GO-PEG-10k complexes, respectively, both of which are stable in physiological solutions. Cellular toxicity tests reveal that our GO-PEI-10k complex exhibits significantly reduced toxicity to the treated cells compared to the bare PEI-10k polymer. The positively charged GO-PEI complexes are able to further bind with plasmid DNA (pDNA) for intracellular transfection of the enhanced green fluorescence protein (EGFP) gene in HeLa cells. While EGFP transfection with PEI-1.2k appears to be ineffective, high EGFP expression is observed using the corresponding GO-PEI-1.2k as the transfection agent. On the other hand, GO-PEI-10k shows similar EGFP transfection efficiency but lower toxicity compared with PEI-10k. Our results suggest graphene to be a novel gene delivery nano-vector with low cytotoxicity and high transfection efficiency, promising for future applications in non-viral based gene therapy. Electronic supplementary information (ESI) available: Thickness distribution of GO and GO-PEI; IR and TGA data; and confocal images of HeLa cells treated with bare EGFP pDNA and GO + pDNA. See DOI: 10.1039/c0nr00680g

  18. Brains, genes, and primates.

    PubMed

    Izpisua Belmonte, Juan Carlos; Callaway, Edward M; Caddick, Sarah J; Churchland, Patricia; Feng, Guoping; Homanics, Gregg E; Lee, Kuo-Fen; Leopold, David A; Miller, Cory T; Mitchell, Jude F; Mitalipov, Shoukhrat; Moutri, Alysson R; Movshon, J Anthony; Okano, Hideyuki; Reynolds, John H; Ringach, Dario; Sejnowski, Terrence J; Silva, Afonso C; Strick, Peter L; Wu, Jun; Zhang, Feng

    2015-05-01

    One of the great strengths of the mouse model is the wide array of genetic tools that have been developed. Striking examples include methods for directed modification of the genome, and for regulated expression or inactivation of genes. Within neuroscience, it is now routine to express reporter genes, neuronal activity indicators, and opsins in specific neuronal types in the mouse. However, there are considerable anatomical, physiological, cognitive, and behavioral differences between the mouse and the human that, in some areas of inquiry, limit the degree to which insights derived from the mouse can be applied to understanding human neurobiology. Several recent advances have now brought into reach the goal of applying these tools to understanding the primate brain. Here we describe these advances, consider their potential to advance our understanding of the human brain and brain disorders, discuss bioethical considerations, and describe what will be needed to move forward. PMID:25950631

  19. Genes and addiction.

    PubMed

    Nestler, E J

    2000-11-01

    Drug addiction, like all psychiatric disorders, is defined solely in behavioural terms. For example, addiction can be considered a loss of control over drug-taking, or compulsive drug-seeking and -taking despite horrendous consequences. Abnormal behaviours are a consequence of aberrant brain function, which means that it is a tangible goal to identify the biological underpinnings of addiction. The genetic basis of addiction encompasses two broad areas of enquiry. One of these is the identification of genetic variation in humans that partly determines susceptibility to addiction. The other is the use of animal models to investigate the role of specific genes in mediating the development of addiction. Whereas recent advances in this latter effort are heartening, a major challenge remains: to understand how the many genes implicated in rodent models interact to yield as complex a phenotype as addiction. PMID:11062465

  20. Alphaviruses in gene therapy.

    PubMed

    Lundstrom, Kenneth

    2009-06-01

    Alphaviruses are enveloped single stranded RNA viruses, which as gene therapy vectors provide high-level transient gene expression. Semliki Forest virus (SFV), Sindbis virus (SIN) and Venezuelan Equine Encephalitis (VEE) virus have been engineered as efficient replication-deficient and -competent expression vectors. Alphavirus vectors have frequently been used as vehicles for tumor vaccine generation. Moreover, SFV and SIN vectors have been applied for intratumoral injections in animals implanted with tumor xenografts. SIN vectors have demonstrated natural tumor targeting, which might permit systemic vector administration. Another approach for systemic delivery of SFV has been to encapsulate replication-deficient viral particles in liposomes, which can provide passive targeting to tumors and allow repeated administration without host immune responses. This approach has demonstrated safe delivery of encapsulated SFV particles to melanoma and kidney carcinoma patients in a phase I trial. Finally, the prominent neurotropism of alphaviruses make them attractive for the treatment of CNS-related diseases. PMID:21994535

  1. Pure genes, pure genius.

    PubMed

    McKnight, Steven L

    2012-09-14

    The 2012 Albert Lasker Special Achievement Award in Medical Science will be shared by Donald Brown and Tom Maniatis for their scientific work leading to the purification and study of single genes by physical and molecular biological methodologies. Brown and Maniatis are also recognized for their extraordinary commitment and generosity in promoting the careers of young scientists. The impact of these accomplishments has transformed biological and medical science over the past four decades. PMID:22980972

  2. Gene Expression in Bone

    NASA Astrophysics Data System (ADS)

    D'Ambrogio, A.

    Skeletal system has two main functions, to provide mechanical integrity for both locomotion and protection and to play an important role in mineral homeostasis. There is extensive evidence showing loss of bone mass during long-term Space-Flights. The loss is due to a break in the equilibrium between the activity of osteoblasts (the cells that forms bone) and the activity of osteoclasts (the cells that resorbs bone). Surprisingly, there is scanty information about the possible altered gene expression occurring in cells that form bone in microgravity.(Just 69 articles result from a "gene expression in microgravity" MedLine query.) Gene-chip or microarray technology allows to screen thousands of genes at the same time: the use of this technology on samples coming from cells exposed to microgravity could provide us with many important informations. For example, the identification of the molecules or structures which are the first sensors of the mechanical stress derived from lack of gravity, could help in understanding which is the first event leading to bone loss due to long-term exposure to microgravity. Consequently, this structure could become a target for a custom-designed drug. It is evident that bone mass loss, observed during long-time stay in Space, represents an accelerated model of what happens in aging osteoporosis. Therefore, the discovery and design of drugs able to interfere with the bone-loss process, could help also in preventing negative physiological processes normally observed on Earth. Considering the aims stated above, my research is designed to:

  3. DETECTING CANCER-RELATED GENES AND GENE-GENE INTERACTIONS BY MACHINE LEARNING METHODS

    E-print Network

    Han, Bing

    2011-12-31

    an integrative method based on the bootstrapping K-S test to evaluate a large number of microarray datasets. The experimental results demonstrate that my method can find meaningful alterations in gene relations. For gene-gene interaction detection, I propose...

  4. nanosheets for gene therapy

    NASA Astrophysics Data System (ADS)

    Kou, Zhongyang; Wang, Xin; Yuan, Renshun; Chen, Huabin; Zhi, Qiaoming; Gao, Ling; Wang, Bin; Guo, Zhaoji; Xue, Xiaofeng; Cao, Wei; Guo, Liang

    2014-10-01

    A new class of two-dimensional (2D) nanomaterial, transition metal dichalcogenides (TMDCs) such as MoS2, MoSe2, WS2, and WSe2 which have fantastic physical and chemical properties, has drawn tremendous attention in different fields recently. Herein, we for the first time take advantage of the great potential of MoS2 with well-engineered surface as a novel type of 2D nanocarriers for gene delivery and therapy of cancer. In our system, positively charged MoS2-PEG-PEI is synthesized with lipoic acid-modified polyethylene glycol (LA-PEG) and branched polyethylenimine (PEI). The amino end of positively charged nanomaterials can bind to the negatively charged small interfering RNA (siRNA). After detection of physical and chemical characteristics of the nanomaterial, cell toxicity was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Polo-like kinase 1 (PLK1) was investigated as a well-known oncogene, which was a critical regulator of cell cycle transmission at multiple levels. Through knockdown of PLK1 with siRNA carried by novel nanovector, qPCR and Western blot were used to measure the interfering efficiency; apoptosis assay was used to detect the transfection effect of PLK1. All results showed that the novel nanocarrier revealed good biocompatibility, reduced cytotoxicity, as well as high gene-carrying ability without serum interference, thus would have great potential for gene delivery and therapy.

  5. GENE DELIVERY TO BONE

    PubMed Central

    Evans, C. H.

    2012-01-01

    Gene delivery to bone is useful both as an experimental tool and as a potential therapeutic strategy. Among its advantages over protein delivery are the potential for directed, sustained and regulated expression of authentically processed, nascent proteins. Although no clinical trials have been initiated, there is a substantial pre-clinical literature documenting the successful transfer of genes to bone, and their intraosseous expression. Recombinant vectors derived from adenovirus, retrovirus and lentivirus, as well as non-viral vectors, have been used for this purpose. Both ex vivo and in vivo strategies, including gene-activated matrices, have been explored. Ex vivo delivery has often employed mesenchymal stem cells (MSCs), partly because of their ability to differentiate into osteoblasts. MSCs also have the potential to home to bone after systemic administration, which could serve as a useful way to deliver transgenes in a disseminated fashion for the treatment of diseases affecting the whole skeleton, such as osteoporosis or osteogenesis imperfecta. Local delivery of osteogenic transgenes, particularly those encoding bone morphogenetic proteins, has shown great promise in a number of applications where it is necessary to regenerate bone. These include healing large segmental defects in long bones and the cranium, as well as spinal fusion and treating avascular necrosis. PMID:22480730

  6. Venom evolution through gene duplications.

    PubMed

    Wong, Emily S W; Belov, Katherine

    2012-03-15

    Venoms contain highly complex mixtures that typically include hundreds of different components and have evolved independently in a diverse range of animals including platypuses, shrews, snakes, lizards, fishes, echinoderms, spiders, wasps, centipedes, sea snails, cephalopods, jellyfish and sea anemones. Many venom genes evolved through gene duplication. Gene duplication occurs in all domains of life and provides the raw substrate from which novel function arise. In this review, we focus on the role that gene duplication has played in the origin and diversification of venom genes. We outline the selective advantages of venom gene duplicates and the role that selection has played in the retention of these duplicates. We use toxin gene intermediates to help trace the evolution of toxin innovation. We also focus on other genomic processes, such as exon and domain duplications, in venom evolution. Finally, we conclude by focusing on the use of high throughput sequencing technology in understanding venom evolution. PMID:22285376

  7. Progress in gene targeting and gene therapy for retinitis pigmentosa

    SciTech Connect

    Farrar, G.J.; Humphries, M.M.; Erven, A.

    1994-09-01

    Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectors for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.

  8. An old yellow enzyme gene controls the branch point between Aspergillus fumigatus and Claviceps purpurea ergot alkaloid pathways.

    PubMed

    Coyle, Christine M; Cheng, Johnathan Z; O'Connor, Sarah E; Panaccione, Daniel G

    2010-06-01

    Ergot fungi in the genus Claviceps and several related fungal groups in the family Clavicipitaceae produce toxic ergot alkaloids. These fungi produce a variety of ergot alkaloids, including clavines as well as lysergic acid derivatives. Ergot alkaloids are also produced by the distantly related, opportunistic human pathogen Aspergillus fumigatus. However, this fungus produces festuclavine and fumigaclavines A, B, and C, which collectively differ from clavines of clavicipitaceous fungi in saturation of the last assembled of four rings in the ergoline ring structure. The two lineages are hypothesized to share early steps of the ergot alkaloid pathway before diverging at some point after the synthesis of the tricyclic intermediate chanoclavine-I. Disruption of easA, a gene predicted to encode a flavin-dependent oxidoreductase of the old yellow enzyme class, in A. fumigatus led to accumulation of chanoclavine-I and chanoclavine-I-aldehyde. Complementation of the A. fumigatus easA mutant with a wild-type allele from the same fungus restored the wild-type profile of ergot alkaloids. These data demonstrate that the product of A. fumigatus easA is required for incorporation of chanoclavine-I-aldehyde into more-complex ergot alkaloids, presumably by reducing the double bond conjugated to the aldehyde group, thus facilitating ring closure. Augmentation of the A. fumigatus easA mutant with a homologue of easA from Claviceps purpurea resulted in accumulation of ergot alkaloids typical of clavicipitaceous fungi (agroclavine, setoclavine, and its diastereoisomer isosetoclavine). These data indicate that functional differences in the easA-encoded old yellow enzymes of A. fumigatus and C. purpurea result in divergence of their respective ergot alkaloid pathways. PMID:20435769

  9. An Old Yellow Enzyme Gene Controls the Branch Point between Aspergillus fumigatus and Claviceps purpurea Ergot Alkaloid Pathways?

    PubMed Central

    Coyle, Christine M.; Cheng, Johnathan Z.; O'Connor, Sarah E.; Panaccione, Daniel G.

    2010-01-01

    Ergot fungi in the genus Claviceps and several related fungal groups in the family Clavicipitaceae produce toxic ergot alkaloids. These fungi produce a variety of ergot alkaloids, including clavines as well as lysergic acid derivatives. Ergot alkaloids are also produced by the distantly related, opportunistic human pathogen Aspergillus fumigatus. However, this fungus produces festuclavine and fumigaclavines A, B, and C, which collectively differ from clavines of clavicipitaceous fungi in saturation of the last assembled of four rings in the ergoline ring structure. The two lineages are hypothesized to share early steps of the ergot alkaloid pathway before diverging at some point after the synthesis of the tricyclic intermediate chanoclavine-I. Disruption of easA, a gene predicted to encode a flavin-dependent oxidoreductase of the old yellow enzyme class, in A. fumigatus led to accumulation of chanoclavine-I and chanoclavine-I-aldehyde. Complementation of the A. fumigatus easA mutant with a wild-type allele from the same fungus restored the wild-type profile of ergot alkaloids. These data demonstrate that the product of A. fumigatus easA is required for incorporation of chanoclavine-I-aldehyde into more-complex ergot alkaloids, presumably by reducing the double bond conjugated to the aldehyde group, thus facilitating ring closure. Augmentation of the A. fumigatus easA mutant with a homologue of easA from Claviceps purpurea resulted in accumulation of ergot alkaloids typical of clavicipitaceous fungi (agroclavine, setoclavine, and its diastereoisomer isosetoclavine). These data indicate that functional differences in the easA-encoded old yellow enzymes of A. fumigatus and C. purpurea result in divergence of their respective ergot alkaloid pathways. PMID:20435769

  10. Cytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation.

    PubMed

    Zanger, Ulrich M; Schwab, Matthias

    2013-04-01

    Cytochromes P450 (CYP) are a major source of variability in drug pharmacokinetics and response. Of 57 putatively functional human CYPs only about a dozen enzymes, belonging to the CYP1, 2, and 3 families, are responsible for the biotransformation of most foreign substances including 70-80% of all drugs in clinical use. The highest expressed forms in liver are CYPs 3A4, 2C9, 2C8, 2E1, and 1A2, while 2A6, 2D6, 2B6, 2C19 and 3A5 are less abundant and CYPs 2J2, 1A1, and 1B1 are mainly expressed extrahepatically. Expression of each CYP is influenced by a unique combination of mechanisms and factors including genetic polymorphisms, induction by xenobiotics, regulation by cytokines, hormones and during disease states, as well as sex, age, and others. Multiallelic genetic polymorphisms, which strongly depend on ethnicity, play a major role for the function of CYPs 2D6, 2C19, 2C9, 2B6, 3A5 and 2A6, and lead to distinct pharmacogenetic phenotypes termed as poor, intermediate, extensive, and ultrarapid metabolizers. For these CYPs, the evidence for clinical significance regarding adverse drug reactions (ADRs), drug efficacy and dose requirement is rapidly growing. Polymorphisms in CYPs 1A1, 1A2, 2C8, 2E1, 2J2, and 3A4 are generally less predictive, but new data on CYP3A4 show that predictive variants exist and that additional variants in regulatory genes or in NADPH:cytochrome P450 oxidoreductase (POR) can have an influence. Here we review the recent progress on drug metabolism activity profiles, interindividual variability and regulation of expression, and the functional and clinical impact of genetic variation in drug metabolizing P450s. PMID:23333322

  11. Alternative Gene Form Discovery and Candidate Gene Selection from Gene Indexing?Projects

    PubMed Central

    Burke, John; Wang, Hui; Hide, Winston; Davison, Daniel B.

    1998-01-01

    Several efforts are under way to partition single-read expressed sequence tag (EST), as well as full-length transcript data, into large-scale gene indices, where transcripts are in common index classes if and only if they share a common progenitor gene. Accurate gene indexing facilitates gene expression studies, as well as inexpensive and early gene sequence discovery through assembly of ESTs that are derived from genes that have not been sequenced by classical methods. We extend, correct, and enhance the information obtained from index groups by splitting index classes into subclasses based on sequence dissimilarity (diversity). Two applications of this are highlighted in this report. First it is shown that our method can ameliorate the damage that artifacts, such as chimerism, inflict on index integrity. Additionally, we demonstrate how the organization imposed by an effective subpartition can greatly increase the sensitivity of gene expression studies by accounting for the existence and tissue- or pathology-specific regulation of novel gene isoforms and polymorphisms. We apply our subpartitioning treatment to the UniGene gene indexing project to measure a marked increase in information quality and abundance (in terms of assembly length and insertion/deletion error) after treatment and demonstrate cases where new levels of information concerning differential expression of alternate gene forms, such as regulated alternative splicing, are discovered. [Tables 2 and 3 can be viewed in their entirety as Online Supplements at http://www.genome.org.] PMID:9521931

  12. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

    PubMed Central

    2011-01-01

    Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability. PMID:22013910

  13. Pseudomonas aeruginosa high-level resistance to polymyxins and other antimicrobial peptides requires cprA, a gene that is disrupted in the PAO1 strain.

    PubMed

    Gutu, Alina D; Rodgers, Nicole S; Park, Jihye; Moskowitz, Samuel M

    2015-09-01

    The arn locus, found in many Gram-negative bacterial pathogens, mediates resistance to polymyxins and other cationic antimicrobial peptides through 4-amino-l-arabinose modification of the lipid A moiety of lipopolysaccharide. In Pseudomonas aeruginosa, several two-component regulatory systems (TCSs) control the arn locus, which is necessary but not sufficient for these resistance phenotypes. A previous transposon mutagenesis screen to identify additional polymyxin resistance genes that these systems regulate implicated an open reading frame designated PA1559 in the genome of the P. aeruginosa PAO1 strain. Resequencing of this chromosomal region and bioinformatics analysis for a variety of P. aeruginosa strains revealed that in the sequenced PAO1 strain, a guanine deletion at the end of PA1559 results in a frameshift and truncation of a full-length open reading frame that also encompasses PA1560 in non-PAO1 strains, such as P. aeruginosa PAK. Deletion analysis in the PAK strain showed that this full-length open reading frame, designated cprA, is necessary for polymyxin resistance conferred by activating mutations in the PhoPQ, PmrAB, and CprRS TCSs. The cprA gene was also required for PmrAB-mediated resistance to other cationic antimicrobial peptides in the PAK strain. Repair of the mutated cprA allele in the PAO1 strain restored polymyxin resistance conferred by an activating TCS mutation. The deletion of cprA did not affect the arn-mediated lipid A modification, indicating that the CprA protein is necessary for a different aspect of polymyxin resistance. This protein has a domain structure with a strong similarity to the extended short-chain dehydrogenase/reductase family that comprises isomerases, lyases, and oxidoreductases. These results suggest a new avenue through which to pursue targeted inhibition of polymyxin resistance. PMID:26100714

  14. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  15. Improvements to cardiovascular gene ontology.

    PubMed

    Lovering, Ruth C; Dimmer, Emily C; Talmud, Philippa J

    2009-07-01

    Gene Ontology (GO) provides a controlled vocabulary to describe the attributes of genes and gene products in any organism. Although one might initially wonder what relevance a 'controlled vocabulary' might have for cardiovascular science, such a resource is proving highly useful for researchers investigating complex cardiovascular disease phenotypes as well as those interpreting results from high-throughput methodologies. GO enables the current functional knowledge of individual genes to be used to annotate genomic or proteomic datasets. In this way, the GO data provides a very effective way of linking biological knowledge with the analysis of the large datasets of post-genomics research. Consequently, users of high-throughput methodologies such as expression arrays or proteomics will be the main beneficiaries of such annotation sets. However, as GO annotations increase in quality and quantity, groups using small-scale approaches will gradually begin to benefit too. For example, genome wide association scans for coronary heart disease are identifying novel genes, with previously unknown connections to cardiovascular processes, and the comprehensive annotation of these novel genes might provide clues to their cardiovascular link. At least 4000 genes, to date, have been implicated in cardiovascular processes and an initiative is underway to focus on annotating these genes for the benefit of the cardiovascular community. In this article we review the current uses of Gene Ontology annotation to highlight why Gene Ontology should be of interest to all those involved in cardiovascular research. PMID:19046747

  16. Reverse engineering transcriptional gene networks.

    PubMed

    Belcastro, Vincenzo; di Bernardo, Diego

    2014-01-01

    The aim of this chapter is a step-by-step guide on how to infer gene networks from gene expression profiles. The definition of a gene network is given in Subheading 1, where the different types of networks are discussed. The chapter then guides the readers through a data-gathering process in order to build a compendium of gene expression profiles from a public repository. Gene expression profiles are then discretized and a statistical relationship between genes, called mutual information (MI), is computed. Gene pairs with insignificant MI scores are then discarded by applying one of the described pruning steps. The retained relationships are then used to build up a Boolean adjacency matrix used as input for a clustering algorithm to divide the network into modules (or communities). The gene network can then be used as a hypothesis generator for discovering gene function and analyzing gene signatures. Some case studies are presented, and an online web-tool called Netview is described. PMID:24233783

  17. Imprinting genes associated with endometriosis

    PubMed Central

    Kobayashi, Hiroshi

    2014-01-01

    Purpose: Much work has been carried out to investigate the genetic and epigenetic basis of endometriosis and proposed that endometriosis has been described as an epigenetic disease. The purpose of this study was to extract the imprinting genes that are associated with endometriosis development. Methods: The information on the imprinting genes can be accessed publicly from a web-based interface at http://www.geneimprint.com/site/genes-by-species. Results: In the current version, the database contains 150 human imprinted genes derived from the literature. We searched gene functions and their roles in particular biological processes or events, such as development and pathogenesis of endometriosis. From the genomic imprinting database, we picked 10 genes that were highly associated with female reproduction; prominent among them were paternally expressed genes (DIRAS3, BMP8B, CYP1B1, ZFAT, IGF2, MIMT1, or MIR296) and maternally expressed genes (DVL1, FGFRL1, or CDKN1C). These imprinted genes may be associated with reproductive biology such as endometriosis, pregnancy loss, decidualization process and preeclampsia. Discussion: This study supports the possibility that aberrant epigenetic dysregulation of specific imprinting genes may contribute to endometriosis predisposition. PMID:26417259

  18. Broker genes in human disease.

    PubMed

    Cai, James J; Borenstein, Elhanan; Petrov, Dmitri A

    2010-01-01

    Genes that underlie human disease are important subjects of systems biology research. In the present study, we demonstrate that Mendelian and complex disease genes have distinct and consistent protein-protein interaction (PPI) properties. We show that five different network properties can be reduced to two independent metrics when applied to the human PPI network. These two metrics largely coincide with the degree (number of connections) and the clustering coefficient (the number of connections among the neighbors of a particular protein). We demonstrate that disease genes have simultaneously unusually high degree and unusually low clustering coefficient. Such genes can be described as brokers in that they connect many proteins that would not be connected otherwise. We show that these results are robust to the effect of gene age and inspection bias variation. Notably, genes identified in genome-wide association study (GWAS) have network patterns that are almost indistinguishable from the network patterns of nondisease genes and significantly different from the network patterns of complex disease genes identified through non-GWAS means. This suggests either that GWAS focused on a distinct set of diseases associated with an unusual set of genes or that mapping of GWAS-identified single nucleotide polymorphisms onto the causally affected neighboring genes is error prone. PMID:20937604

  19. Broker Genes in Human Disease

    PubMed Central

    Cai, James J.; Borenstein, Elhanan; Petrov, Dmitri A.

    2010-01-01

    Genes that underlie human disease are important subjects of systems biology research. In the present study, we demonstrate that Mendelian and complex disease genes have distinct and consistent protein–protein interaction (PPI) properties. We show that five different network properties can be reduced to two independent metrics when applied to the human PPI network. These two metrics largely coincide with the degree (number of connections) and the clustering coefficient (the number of connections among the neighbors of a particular protein). We demonstrate that disease genes have simultaneously unusually high degree and unusually low clustering coefficient. Such genes can be described as brokers in that they connect many proteins that would not be connected otherwise. We show that these results are robust to the effect of gene age and inspection bias variation. Notably, genes identified in genome-wide association study (GWAS) have network patterns that are almost indistinguishable from the network patterns of nondisease genes and significantly different from the network patterns of complex disease genes identified through non-GWAS means. This suggests either that GWAS focused on a distinct set of diseases associated with an unusual set of genes or that mapping of GWAS-identified single nucleotide polymorphisms onto the causally affected neighboring genes is error prone. PMID:20937604

  20. Ancient origins of axial patterning genes: Hox genes and ParaHox genes in the Cnidaria.

    PubMed

    Finnerty, J R; Martindale, M Q

    1999-01-01

    Among the bilaterally symmetrical, triploblastic animals (the Bilateria), a conserved set of developmental regulatory genes are known to function in patterning the anterior-posterior (AP) axis. This set includes the well-studied Hox cluster genes, and the recently described genes of the ParaHox cluster, which is believed to be the evolutionary sister of the Hox cluster (Brooke et al. 1998). The conserved role of these axial patterning genes in animals as diverse as frogs and flies is believed to reflect an underlying homology (i.e., all bilaterians derive from a common ancestor which possessed an AP axis and the developmental mechanisms responsible for patterning the axis). However, the origin and early evolution of Hox genes and ParaHox genes remain obscure. Repeated attempts have been made to reconstruct the early evolution of Hox genes by analyzing data from the triphoblastic animals, the Bilateria (Schubert et al. 1993; Zhang and Nei 1996). A more precise dating of Hox origins has been elusive due to a lack of sufficient information from outgroup taxa such as the phylum Cnidaria (corals, hydras, jellyfishes, and sea anemones). In combination with outgroup taxa, another potential source of information about Hox origins is outgroup genes (e.g., the genes of the ParaHox cluster). In this article, we present cDNA sequences of two Hox-like genes (anthox2 and anthox6) from the sea anemone, Nematostella vectensis. Phylogenetic analysis indicates that anthox2 (= Cnox2) is homologous to the GSX class of ParaHox genes, and anthox6 is homologous to the anterior class of Hox genes. Therefore, the origin of Hox genes and ParaHox genes occurred prior to the evolutionary split between the Cnidaria and the Bilateria and predated the evolution of the anterior-posterior axis of bilaterian animals. Our analysis also suggests that the central Hox class was invented in the bilaterian lineage, subsequent to their split from the Cnidaria. PMID:11324016

  1. Identifying Driver Genes in Cancer by Triangulating Gene Expression, Gene Location, and Survival Data

    PubMed Central

    Rouam, Sigrid; Miller, Lance D; Karuturi, R Krishna Murthy

    2014-01-01

    Driver genes are directly responsible for oncogenesis and identifying them is essential in order to fully understand the mechanisms of cancer. However, it is difficult to delineate them from the larger pool of genes that are deregulated in cancer (ie, passenger genes). In order to address this problem, we developed an approach called TRIAngulating Gene Expression (TRIAGE through clinico-genomic intersects). Here, we present a refinement of this approach incorporating a new scoring methodology to identify putative driver genes that are deregulated in cancer. TRIAGE triangulates – or integrates – three levels of information: gene expression, gene location, and patient survival. First, TRIAGE identifies regions of deregulated expression (ie, expression footprints) by deriving a newly established measure called the Local Singular Value Decomposition (LSVD) score for each locus. Driver genes are then distinguished from passenger genes using dual survival analyses. Incorporating measurements of gene expression and weighting them according to the LSVD weight of each tumor, these analyses are performed using the genes located in significant expression footprints. Here, we first use simulated data to characterize the newly established LSVD score. We then present the results of our application of this refined version of TRIAGE to gene expression data from five cancer types. This refined version of TRIAGE not only allowed us to identify known prominent driver genes, such as MMP1, IL8, and COL1A2, but it also led us to identify several novel ones. These results illustrate that TRIAGE complements existing tools, allows for the identification of genes that drive cancer and could perhaps elucidate potential future targets of novel anticancer therapeutics. PMID:25949096

  2. Aberrant Gene Expression in Humans

    PubMed Central

    Yang, Ence; Ji, Guoli; Brinkmeyer-Langford, Candice L.; Cai, James J.

    2015-01-01

    Gene expression as an intermediate molecular phenotype has been a focus of research interest. In particular, studies of expression quantitative trait loci (eQTL) have offered promise for understanding gene regulation through the discovery of genetic variants that explain variation in gene expression levels. Existing eQTL methods are designed for assessing the effects of common variants, but not rare variants. Here, we address the problem by establishing a novel analytical framework for evaluating the effects of rare or private variants on gene expression. Our method starts from the identification of outlier individuals that show markedly different gene expression from the majority of a population, and then reveals the contributions of private SNPs to the aberrant gene expression in these outliers. Using population-scale mRNA sequencing data, we identify outlier individuals using a multivariate approach. We find that outlier individuals are more readily detected with respect to gene sets that include genes involved in cellular regulation and signal transduction, and less likely to be detected with respect to the gene sets with genes involved in metabolic pathways and other fundamental molecular functions. Analysis of polymorphic data suggests that private SNPs of outlier individuals are enriched in the enhancer and promoter regions of corresponding aberrantly-expressed genes, suggesting a specific regulatory role of private SNPs, while the commonly-occurring regulatory genetic variants (i.e., eQTL SNPs) show little evidence of involvement. Additional data suggest that non-genetic factors may also underlie aberrant gene expression. Taken together, our findings advance a novel viewpoint relevant to situations wherein common eQTLs fail to predict gene expression when heritable, rare inter-individual variation exists. The analytical framework we describe, taking into consideration the reality of differential phenotypic robustness, may be valuable for investigating complex traits and conditions. PMID:25617623

  3. Gene: a gene-centered information resource at NCBI.

    PubMed

    Brown, Garth R; Hem, Vichet; Katz, Kenneth S; Ovetsky, Michael; Wallin, Craig; Ermolaeva, Olga; Tolstoy, Igor; Tatusova, Tatiana; Pruitt, Kim D; Maglott, Donna R; Murphy, Terence D

    2015-01-01

    The National Center for Biotechnology Information's (NCBI) Gene database (www.ncbi.nlm.nih.gov/gene) integrates gene-specific information from multiple data sources. NCBI Reference Sequence (RefSeq) genomes for viruses, prokaryotes and eukaryotes are the primary foundation for Gene records in that they form the critical association between sequence and a tracked gene upon which additional functional and descriptive content is anchored. Additional content is integrated based on the genomic location and RefSeq transcript and protein sequence data. The content of a Gene record represents the integration of curation and automated processing from RefSeq, collaborating model organism databases, consortia such as Gene Ontology, and other databases within NCBI. Records in Gene are assigned unique, tracked integers as identifiers. The content (citations, nomenclature, genomic location, gene products and their attributes, phenotypes, sequences, interactions, variation details, maps, expression, homologs, protein domains and external databases) is available via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programming utilities (E-Utilities and Entrez Direct) and for bulk transfer by FTP. PMID:25355515

  4. Gene: a gene-centered information resource at NCBI

    PubMed Central

    Brown, Garth R.; Hem, Vichet; Katz, Kenneth S.; Ovetsky, Michael; Wallin, Craig; Ermolaeva, Olga; Tolstoy, Igor; Tatusova, Tatiana; Pruitt, Kim D.; Maglott, Donna R.; Murphy, Terence D.

    2015-01-01

    The National Center for Biotechnology Information's (NCBI) Gene database (www.ncbi.nlm.nih.gov/gene) integrates gene-specific information from multiple data sources. NCBI Reference Sequence (RefSeq) genomes for viruses, prokaryotes and eukaryotes are the primary foundation for Gene records in that they form the critical association between sequence and a tracked gene upon which additional functional and descriptive content is anchored. Additional content is integrated based on the genomic location and RefSeq transcript and protein sequence data. The content of a Gene record represents the integration of curation and automated processing from RefSeq, collaborating model organism databases, consortia such as Gene Ontology, and other databases within NCBI. Records in Gene are assigned unique, tracked integers as identifiers. The content (citations, nomenclature, genomic location, gene products and their attributes, phenotypes, sequences, interactions, variation details, maps, expression, homologs, protein domains and external databases) is available via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programming utilities (E-Utilities and Entrez Direct) and for bulk transfer by FTP. PMID:25355515

  5. Heterochromatic Genes in Drosophila: A Comparative Analysis of Two Genes

    PubMed Central

    Schulze, Sandra R.; McAllister, Bryant F.; Sinclair, Donald A. R.; Fitzpatrick, Kathleen A.; Marchetti, Marcella; Pimpinelli, Sergio; Honda, Barry M.

    2006-01-01

    Centromeric heterochromatin comprises ?30% of the Drosophila melanogaster genome, forming a transcriptionally repressive environment that silences euchromatic genes juxtaposed nearby. Surprisingly, there are genes naturally resident in heterochromatin, which appear to require this environment for optimal activity. Here we report an evolutionary analysis of two genes, Dbp80 and RpL15, which are adjacent in proximal 3L heterochromatin of D. melanogaster. DmDbp80 is typical of previously described heterochromatic genes: large, with repetitive sequences in its many introns. In contrast, DmRpL15 is uncharacteristically small. The orthologs of these genes were examined in D. pseudoobscura and D. virilis. In situ hybridization and whole-genome assembly analysis show that these genes are adjacent, but not centromeric in the genome of D. pseudoobscura, while they are located on different chromosomal elements in D. virilis. Dbp80 gene organization differs dramatically among these species, while RpL15 structure is conserved. A bioinformatic analysis in five additional Drosophila species demonstrates active repositioning of these genes both within and between chromosomal elements. This study shows that Dbp80 and RpL15 can function in contrasting chromatin contexts on an evolutionary timescale. The complex history of these genes also provides unique insight into the dynamic nature of genome evolution. PMID:16648646

  6. Gene Therapy for Cartilage Repair

    PubMed Central

    Madry, Henning; Orth, Patrick; Cucchiarini, Magali

    2011-01-01

    The concept of using gene transfer strategies for cartilage repair originates from the idea of transferring genes encoding therapeutic factors into the repair tissue, resulting in a temporarily and spatially defined delivery of therapeutic molecules to sites of cartilage damage. This review focuses on the potential benefits of using gene therapy approaches for the repair of articular cartilage and meniscal fibrocartilage, including articular cartilage defects resulting from acute trauma, osteochondritis dissecans, osteonecrosis, and osteoarthritis. Possible applications for meniscal repair comprise meniscal lesions, meniscal sutures, and meniscal transplantation. Recent studies in both small and large animal models have demonstrated the applicability of gene-based approaches for cartilage repair. Chondrogenic pathways were stimulated in the repair tissue and in osteoarthritic cartilage using genes for polypeptide growth factors and transcription factors. Although encouraging data have been generated, a successful translation of gene therapy for cartilage repair will require an ongoing combined effort of orthopedic surgeons and of basic scientists. PMID:26069580

  7. XLMR genes: Update 1996

    SciTech Connect

    Lubs, H.A.; Tranebjaerg, L.; Arena, J.F.

    1996-07-12

    A current list of all known forms of X-linked mental retardation (XLMR) and a slightly revised classification are presented. The number of known disorders has not increased because 6 disorders have been combined based on new molecular data or on clinical grounds and only 6 newly described XLMR disorders have been reported. Of the current 105 XLMR disorders, 34 have been mapped, and 18 disorders and 1 non-specific XLMR (FRAXE) have been cloned. The number of families with nonspecific XLMR with a LOD score of {ge}2.0 has more than doubled, with 42 (including FRAXE) now being known. A summary of the localization of presumed nonspecific mental retardation (MR) genes from well-studied X-chromosomal translocations and deletions is also included. Only 10-12 nonoverlapping loci are required to explain all localizations of non-specific MR from both approaches. These new trends mark the beginning of a significantly improved understanding of the role of genes on the X chromosome in producing MR. Continued close collaboration between clinical and molecular investigators will be required to complete the process. 105 refs., 2 figs., 6 tabs.

  8. Conotoxin Gene Superfamilies

    PubMed Central

    Robinson, Samuel D.; Norton, Raymond S.

    2014-01-01

    Conotoxins are the peptidic components of the venoms of marine cone snails (genus Conus). They are remarkably diverse in terms of structure and function. Unique potency and selectivity profiles for a range of neuronal targets have made several conotoxins valuable as research tools, drug leads and even therapeutics, and has resulted in a concerted and increasing drive to identify and characterise new conotoxins. Conotoxins are translated from mRNA as peptide precursors, and cDNA sequencing is now the primary method for identification of new conotoxin sequences. As a result, gene superfamily, a classification based on precursor signal peptide identity, has become the most convenient method of conotoxin classification. Here we review each of the described conotoxin gene superfamilies, with a focus on the structural and functional diversity present in each. This review is intended to serve as a practical guide to conotoxin superfamilies and to facilitate interpretation of the increasing number of conotoxin precursor sequences being identified by targeted-cDNA sequencing and more recently high-throughput transcriptome sequencing. PMID:25522317

  9. Genes of aging.

    PubMed

    Hamet, Pavel; Tremblay, Johanne

    2003-10-01

    According to developmental genetics theories, aging is a genetically programmed and controlled continuum of development and maturation. Being dynamic and malleable processes, development and aging are controlled not only by genes but also by environmental and epigenetic influences that predominate in the second half of life. Genetic mutations affect many phenotypes in flies, worms, rodents, and humans which share several diseases or their equivalents, including cancer, neurodegeneration, and infectious disorders as well as their susceptibility to them. Life span and stress resistance are closely linked. Oxidative stress actually constitutes a defined hypothesis of aging in that macromolecule oxidative damage accumulates with age and tends to be associated with life expectancy. DNA methylation, a force in the regulation of gene expression, is also one of the biomarkers of genetic damage. The mitotic clock of aging is marked, if not guided, by telomeres, essential genetic elements stabilizing natural chromosomic ends. The dream of humans to live longer, healthy lives is being tested by attempts to modify longevity in animal models, frequently by dietary manipulation. The quest continues to understand the mechanisms of healthy aging, one of the most compelling areas of research in the 21st century. PMID:14577056

  10. Peptide-based gene delivery.

    PubMed

    Mahat, R I; Monera, O D; Smith, L C; Rolland, A

    1999-04-01

    To achieve effective plasmid-based gene therapy, the control of cellular access and uptake, intracellular trafficking and nuclear retention of plasmids must be achieved. Inefficient endosomal release, cytoplasmic transport and nuclear entry of plasmids are amongst some of the key limiting factors in the use of plasmids for effective gene therapy. A number of non-viral gene delivery systems have been designed to overcome these limiting factors. The most common approach to protect and control plasmid distribution is to complex plasmids with cationic lipids or polymers through electrostatic interactions. Endosomal release of plasmids can be achieved, for instance, by using pH-sensitive lipids, inactivated viral particles, endosomolytic peptides and polymers. Among the least explored gene delivery systems are those that consist mainly of synthetic, short peptides. Peptides can be incorporated into multicomponent gene delivery complexes for specific purposes, such as for DNA condensation, cell-specific targeting, endosomolysis or nuclear transport. The aims of this review are to: (i) explore the conceptual and experimental aspects of peptide-DNA interactions; (ii) critically assess the possible use of peptides for efficient gene transfer; and (iii) present an overview on the use of peptides to enhance the effectiveness of other gene delivery systems. On balance, peptide-based gene delivery systems appear to have a significant potential as commercially viable gene delivery products. PMID:11715946

  11. Comparative genomics of metabolic pathways in Mycobacterium species: gene duplication, gene decay and lateral gene transfer.

    PubMed

    Marri, Pradeep Reddy; Bannantine, John P; Golding, Geoffrey B

    2006-11-01

    The genus Mycobacterium comprises significant pathogenic species that infect both humans and animals. One species within this genus, Mycobacterium tuberculosis, is the primary killer of humans resulting from bacterial infections. Five mycobacterial genomes belonging to four different species (M. tuberculosis, Mycobacterium bovis, Mycobacterium leprae and Mycobacterium avium ssp. paratuberculosis) have been sequenced to date and another 14 mycobacterial genomes are at various stages of completion. A comparative analysis of the gene products of key metabolic pathways revealed that the major differences among these species are in the gene products constituting the cell wall and the gene families encoding the acidic glycine-rich (PE/PPE/PGRS) proteins. Mycobacterium leprae has evolved by retaining a minimal gene set for most of the gene families, whereas M. avium ssp. paratuberculosis has acquired some of the virulence factors by lateral gene transfer. PMID:17064286

  12. Candidate reference genes for gene expression studies in water lily.

    PubMed

    Luo, Huolin; Chen, Sumei; Wan, Hongjian; Chen, Fadi; Gu, Chunsun; Liu, Zhaolei

    2010-09-01

    The selection of an appropriate reference gene(s) is a prerequisite for the proper interpretation of quantitative Real-Time polymerase chain reaction data. We report the evaluation of eight candidate reference genes across various tissues and treatments in the water lily by the two software packages geNorm and NormFinder. Across all samples, clathrin adaptor complexes medium subunit (AP47) and actin 11 (ACT11) emerged as the most suitable reference genes. Across different tissues, ACT11 and elongation factor 1-alpha (EF1alpha) exhibited a stable expression pattern. ACT11 and AP47 also stably expressed in roots subjected to various treatments, but in the leaves of the same plants the most stably expressed genes were ubiquitin-conjugating enzyme 16 (UBC16) and ACT11. PMID:20452325